WorldWideScience

Sample records for ammassalik island se

  1. Climate, glacier mass balance and runoff (1993-2005) for the Mittivakkat Glacier catchment, Ammassalik Island, SE Greenland, and in a long term perspective (1898-1993)

    DEFF Research Database (Denmark)

    Mernild, Sebastian H.; Kane, D.L.; Hansen, Birger;

    2008-01-01

    Climate, glacier mass balance and runoff are investigated in the Low-Arctic Mittivakkat Glacier catchment on Ammassalik Island, Southeast Greenland. High-resolution meteorological data from the catchment covering 1993-2005 and standard synoptic meteorological data from the nearby town of Tasiilaq...... (Ammassalik) from 1898-2005 are used. Within the catchment, gradients and variations are observed in meteorological conditions between the coastal and the glacier areas. During the period 1993-2005 about 15% lower annual solar radiation was observed in the coastal area. Further, decreasing mean annual air...... temperatures (MAAT) occur in the coastal area, indicating an approximately 20-d shorter thawing period. The higher lying glacier area, in contrast, experiences an increasing MAAT, an approximately 40-d longer thawing period and a 60-d longer snow-free period. The Mittivakkat Glacier net mass balance has been...

  2. Climatic conditions at the Mittivakkat Glacier catchment (1994-2006), Ammassalik Island, SE Greenland, and in a 109-year perspective (1898-2006)

    DEFF Research Database (Denmark)

    Mernild, Sebastian H.; Hansen, Birger; Jakobsen, Bjarne Holm;

    2008-01-01

    the catchment, meteorological conditions are monitored at the coast (Station Coast, 25 m a.s.l.) for the period 1998-2006 and in the glacier area (Station Nunatak, 515 m a.s.l.) for 1994-2006. During this 13-year period, solar radiation shows increasing values, averaging 0.5 W m-2 y-1, at the nunatak...... and decreasing values, averaging 1.4 W m-2 y-1, at the coast. The mean annual solar radiation at Station Coast is 102 W m-2 y-1, which is about 10% lower than at Station Nunatak, and is probably caused by increasing and higher percentages of dense clouds and sea fog in the coastal area. The mean...... annual air temperature is increasing by 0.10ºC y-1 at the nunatak and by 0.05ºC y-1 at the coast, extending the thawing periods by about 50 days and 5 days, respectively. A snow-free period of 64 days is observed at the nunatak. The coastal area is highly dominated by air temperature inversion and sea...

  3. Dephasing and interaction of excitons CdSe/ZnSe islands

    DEFF Research Database (Denmark)

    Wagner, H. P.; Tranitz, H.-P.; Preis, H.;

    2000-01-01

    The dephasing of excitons in self-organized CdSe/ZnSe islands grown by molecular-beam epitaxy is investigated using spectrally resolved four-wave mixing. A distribution of dephasing times is observed, indicating the existence of localized excitons with different relaxation times at comparable...

  4. Multi-decadal marine- and land-terminating glacier recession in the Ammassalik region, southeast Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2012-06-01

    Full Text Available Landsat imagery was applied to elucidate glacier fluctuations of land- and marine-terminating outlet glaciers from the Greenland Ice Sheet (GrIS and local land-terminating glaciers and ice caps (GIC peripheral to the GrIS in the Ammassalik region, Southeast Greenland, during the period 1972–2011. Data from 21 marine-terminating glaciers (including the glaciers Helheim, Midgaard, and Fenris, the GrIS land-terminating margin, and 35 GIC were examined and compared to observed atmospheric air temperatures, precipitation, and reconstructed ocean water temperatures (at 400 m depth in the Irminger Sea. Here, we document that net glacier recession has occurred since 1972 in the Ammassalik region for all glacier types and sizes, except for three GIC. The land-terminating GrIS and GIC reflect lower marginal and areal changes than the marine-terminating outlet glaciers. The mean annual land-terminating GrIS and GIC margin recessions were about three to five times lower than the GrIS marine-terminating recession. The marine-terminating outlet glaciers had an average net frontal retreat for 1999–2011 of 0.098 km yr−1, which was significantly higher than in previous sub-periods 1972–1986 and 1986–1999. For the marine-terminating GrIS, the annual areal recession rate has been decreasing since 1972, while increasing for the land-terminating GrIS since 1986. On average for all the observed GIC, a mean net frontal retreat for 1986–2011 of 0.010 ± 0.006 km yr−1 and a mean areal recession of around 1% per year occurred; overall for all observed GIC, a mean recession rate of 27 ± 24% occurred based on the 1986 GIC area. Since 1986, five GIC melted away in the Ammassalik area.

  5. Inter-island transport in CdSe/ZnSe quantum heterostructures

    CERN Document Server

    Wachter, S; Baldauf, M; Schmidt, M; Kurtz, E; Klingshirn, C F; Kalt, H; Litvinov, D A; Gerthsen, D

    2001-01-01

    We report on localization dynamics of excitons in ensembles of self- organized CdSe islands embedded in ZnSe. The experimental methods employed are temperature-dependent, spatially resolved photoluminescence ( mu -PL), spatially integrated PL (macro-PL), as well as time-resolved PL (TRPL). We observe the well known non- monotonous shift of the PL maximum with temperature caused by redistribution of the excitons amongst the islands. The measured shift is compared with the exact shift of the bandgap deduced from mu -PL measurements and found to depend strongly on island size and distribution. These transport processes are recovered in the temporal evolution of the PL. The decaytime of the spectrally integrated PL reaches its maximum at exactly the same temperature at which the redshift of the macro-PL turns into a blueshift. In TRPL the PL- spectrum consists of two contributions. We put the emission on the high energy side down to excited states in the islands. (17 refs).

  6. The absolute age of SE-RF-6 (Ngamanie) and its relation to SE-RF-2 (Nenumbo) : two decorated lapita sites in the southeast Solomon Islands

    International Nuclear Information System (INIS)

    The relative age of SE-RF-6, SE-RF-2 and SE-SZ-8, three decorative phase Lapita sites in the Reef/Santa Cruz region of the Outer Easter Islands of Solomon Islands, has been the subject of dispute. A review of the evidence recovered from SE-RF-6 (Ngamanie), in conjunction with a Bayesian calibration model, supports the notion that it postdates the nearby site of SE-RF-2 (Nenumbo). We conclude that the SE-RF-6 represents an occupation of 50 to 100 years duration (compared with 50 or less for SE-RF-2), beginning some time in the interval 2470-2910 BP. (author). 22 refs., 4 figs., 3 tabs

  7. Stress Dynamics of Magma Activity during Orogenic Evolution: An Example from Kinmen Island, SE China

    Science.gov (United States)

    Chen, Ping-Chuan; Yeh, En-Chao; Lin, Jian-Wei; Lee, Chi-Yu; Chen, Rou-Fei; Lin, Wayne; Hsieh, Pei-Shan; Lin, Cheng-Kuo; Iizuka, Yoshiyuki

    2016-04-01

    During orogeny, a mountain belt experienced different orogenic stages with various conditions of temperature, pressure, stress and fluid pressure. The speculation, that the orogenic stresses evolve from reverse faulting via strike-slip faulting to normal faulting stress regimes corresponding to syn-orogenic, post-orogenic and an-orogenic stage respectively, has been proposed but has not been proved yet. Here we report the study of dikes from Kinmen Island can shed light on understanding the stress evolution of orogeny. The Kinmen Island, located in the southeastern continental margin of Mainland China, cropped out the middle to lower crust of NE structural grain, which was experienced deformation and metamorphism during Late Yenshanian Orogeny(LYO). Based on previous studies of geochemistry, geochronology, and P-T conditions, various types of dike have been identified. They are syn-orognic dikes of amphibolite (130-110Ma), post-orogenic dikes of pegmatite and aplite (110-100Ma), and an-orogenic dike of gabbro (94-76Ma). During syn-orogenic stage of LYO, dike intrusion appeared as low-angle dip, which reflected that reverse faulting regime and horizontal maximum stress direction in E-W orientation. In post-orogenic stage, stress would be divided into two sub-stages. The early one was strike-slip faulting regime and horizontal maximum stress was in NW-SE orientation. The late one was normal faulting regime and horizontal maximum stress direction returned to E-W orientation. Finally, an-orogenic dike intrusion striked NE-SW with vertical dip, which displayed that normal faulting regime and NE-SW horizontal maximum stress direction. Our observation is consistent with the expected stress evolution during orogeny. Deviatoric stresses from new findings were decreased at early post-orogenic stage but increased after late post-orogenic stage, indicating the change of fluid pressure ratio with time. The spatiotemporal variation of stress field might be suggested the change

  8. Late Cretaceous lithospheric extension in SE China: Constraints from volcanic rocks in Hainan Island

    Science.gov (United States)

    Zhou, Yun; Liang, Xinquan; Kröner, Alfred; Cai, Yongfeng; Shao, Tongbin; Wen, Shunv; Jiang, Ying; Fu, Jiangang; Wang, Ce; Dong, Chaoge

    2015-09-01

    Petrological, geochemical and in-situ zircon U-Pb dating and Hf-isotope analyses have been carried out on a suite of basalt-andesite-rhyolite volcanic rocks exposed in the Liuluocun area, Hainan Island, SE China. Zircon analyses show that these volcanic rocks crystallized in the Early Cretaceous (ca. 102 Ma). The basalts are characterized by low MgO contents and mg-numbers but high rare earth element, high field strength element and large ion lithophile element contents and Nb-Ta negative anomalies. They have relatively uniform Sr-Nd isotope compositions with εNd(t) values of - 4.09 to - 3.63. The andesites show enrichment of high field strength element and rare earth element with negligible Eu anomalies. They have εNd(t) values of - 2.35 to - 3.88 and εHf(t) values of - 9.73 to - 1.13. The rhyolites have high K2O and SiO2 contents. They are characterized by prominent Eu, P and Ti negative anomalies and enrichment in large ion lithophile element, and show εHf(t) values of - 7.51 to + 0.47 and εNd(t) values of - 2.49 to - 2.69. Petrogenetic analysis indicates that the Liuluocun volcanic rocks were produced by incomplete reaction of the mantle wedge peridotite with felsic melts derived from partial melting of subducted sediment. All these characteristics, combined with geological observations, suggest that their formation was related to regional lithospheric extension in the South China Craton during the Early Cretaceous, which may have been caused by subduction of the Paleo-Pacific plate beneath the continental plate of China.

  9. Remote sensing of the urban heat island and its changes in Xiamen City of SE China

    Institute of Scientific and Technical Information of China (English)

    XU Han-qiu; CHEN Ben-qing

    2004-01-01

    World-wide urbanization has significantly modified the landscape, which has important climatic implicationsacross all scales due to the simultaneous removal of natural land cover and introduction of urban materials. Thisresulted in a phenomenon known as an urban heat island(UHI). A study on the UHI in Xiamen of China was carriedout using remote sensing technology. Satellite thermal infrared images were used to determine surface radianttemperatures. Thermal remote sensing data were obtained from band 6 of two Landsat TM/ETM+ images of 1989and 2000 to observe the UHI changes over 1 1-year period. The thermal infrared bands were processed throughseveral image enhancement technologies. This generated two 3-dimension-perspective images of Xiamen's urbanheat island in 1989 and 2000, respectively, and revealed heat characteristics and spatial distribution features of theUHI. To find out the change of the UHI between 1989 and 2000, the two thermal images were first normalized andscaled to seven grades to reduce seasonal difference and then overlaid to produce a difference image by subtractingcorresponding pixels. The difference image showed an evident development of the urban heat island in the 11 years.This change was due largely to the urban expansion with a consequent alteration in the ratio of sensible heat flux tolatent heat flux. To quantitatively compare UHI, an index called Urban-Heat-Island Ratio Index(URI) was created.It can reveal the intensity of the UHI within the urban area. The calculation of the index was based on the ratio ofUHI area to urban area. The greater the index, the more intense the UHI was. The calculation of the index for theXiamen City indicated that the ratio of UHI area to urban area in 2000 was less than that in 1989. High temperaturesin several areas in 1989 were reduced or just disappeared, such as those in old downtown area and GulangyuIsland. For the potential mitigation of the UHI in Xiamen, a long-term heat island reduction strategy of

  10. Quality Aspects of a Marine Aggregate Deposit off the SE Euboea Island, Greece, for its Exploitation - Preliminary Results

    Science.gov (United States)

    Anastasatou, Marianthi; Kapsimalis, Vasilios; Stamatakis, Michael; Tsoutsia, Antonia; Poulos, Serafeim; Rousakis, Grigoris; Karditsa, Aikaterini; Petrakis, Stelios; Aspiotis, Konstantinos; Papavlasopoulou, Nafsika; Stamatakis, Giorgos

    2015-04-01

    Aggregates are inert materials, such as terrestrial or marine sand and gravel, composed mainly of limestone, igneous rocks and sandstone. There is an international trend of increasing demand for aggregates during the last 30 years. Thus, marine aggregate (MA) demand has been displayed a remarkably increased due to limited terrestrial deposits and strict environmental issues related to their exploitation, induced by mining legislation. Regarding offshore MA extraction, important physical and biological seabed impacts that may persist long after the completion of the MA dredging, should be addressed, according to European directives, that deal with aspects such as restoration of the influenced subaqueous mining area. The present contribution focuses on the qualitative determination of the marine sediments on inner continental shelf of SE Euboea (central Aegean Sea), concerning primarily its silica content and secondarily the various environmental issues, in order to evaluate whether or not this subaqueous deposit fulfils the requirements for its exploitation. This MA deposit was found during the implementation of the research project THALES-MARE (MIS 375655) and after taking into consideration the presence of highly siliceous coastal lithology of the South Euboea Island. The area belongs to the Attico-Cycladic geotectonic zone, and especially in the Blueschist Unit, Styra and Ochi nappes. It consists mainly of metamorphosed clastic siliceous sedimentary and calcareous, mafic and felsic volcanic rocks and serpentinites. Sixteen representative samples were analysed out of 48 were collected in June 2014, during the scientific cruise of the M/V Aegaio (Hellenic Centre for Marine Research). The grain size analysis shows that seabed sediments are granulometrically classified mostly as sand, with contaminants of finer fractions and with the sand content often to be >90%. X-Ray Diffraction analysis revealed that the predominant crystalline phase is quartz (often >70

  11. An Alternative Georoute: Approaching the Geological Heritage of the SE Part of Milos Island, Greece, via Hiking, Kayaking and Snorkeling

    Science.gov (United States)

    Mavrogonatos, Constantinos; Galanopoulos, Evangelos; Anastasatou, Marianthi; Chadjimpaloglou, Petros; Xydous, Stamatios

    2015-04-01

    Milos Island is located at the southwest edge of the Cyclades island complex, in the central part of the Aegean archipelago. It is part of the modern South Aegean Volcanic Arc (SAVA), which belongs to the Hellenic subduction zone. This on-going process has resulted in the coexistence of complex geological formations and geodynamic phenomena with sceneries of incomparable natural beauty, in many areas along the arc. Among them, Milos Island is widely known to be a place of astonishing geological and natural wealth, combined with a cultural heritage that dates back to the 8th millennium BC. As geotourism has been rapidly evolving worldwide over the last years, Milos Island was among the first places in Greece that developed a network of geotrails and featured many sites of special interest in terms of geology, volcanology and geoarchaeology. This study proposes an original georoute through land and sea, which aims t? emerge both overland and underwater areas of special interest. It is a novel way to approach the geological and cultural wealth of Milos and focuses on the Aghia Kiriaki area, at the South part of the island. This alternative georoute includes hiking, kayaking and snorkeling, and anyone who follows it, can be guided to a significant number of important geological, volcanic, morphological and geoarcheological sites, in a relatively narrow area, combining athletic activities as well. The proposed georoute has a total length of 3,2 km and an estimated time of completion of about 4 hours. It starts from Aghia Kiriaki area, where visitors can see remnants of one of the island's collapsed calderic domes in a panoramic view towards the East. In the same site, volcanic emanations create impressive scenery, which introduces the participants to aspects of the island's geologic and volcanic history. After about 800 meters of hiking, throughout an area that is dominated by products of phreatic eruptions, Aghia Kiriaki beach is the next stop. Impressive findings of

  12. Architecture and morphology of coral reef sequences. Modeling and observations from uplifting islands of SE Sulawesi, Indonesia

    Science.gov (United States)

    Pastier, Anne-Morwenn; Husson, Laurent; Bezos, Antoine; Pedoja, Kevin; Elliot, Mary; Hafidz, Abdul; Imran, Muhammad; Lacroix, Pascal; Robert, Xavier

    2016-04-01

    During the Late Neogene, sea level oscillations have profoundly shaped the morphology of the coastlines of intertropical zones, wherein relative sea level simultaneously controlled reef expansion and erosion of earlier reef bodies. In uplifted domains like SE Sulawesi, the sequences of fossil reefs display a variety of fossil morphologies. Similarly, the morphologies of the modern reefs are highly variable, including cliff notches, narrow fringing reefs, wide flat terraces, and barriers reefs. In this region, where uplift rates vary rapidly laterally, the entire set of morphologies is displayed within short distances. We developed a numerical model that predicts the architecture of fossil reefs sequences and apply it to observations from SE Sulawesi, accounting -amongst other parameters- for reef growth, coastal erosion, and uplift rates. The observations that we use to calibrate our models are mostly the morphology of both the onshore (dGPS and high-resolution Pleiades DEM) and offshore (sonar) coast, as well as U-Th radiometrically dated coral samples. Our method allows unravelling the spatial and temporal evolution of large domains on map view. Our analysis indicates that the architecture and morphology of uplifting coastlines is almost systematically polyphased (as attested by samples of different ages within a unique terrace), which assigns a primordial role to erosion, comparable to reef growth. Our models also reproduce the variety of modern morphologies, which are chiefly dictated by the uplift rates of the pre-existing morphology of the substratum, itself responding to the joint effects of reef building and subsequent erosion. In turn, we find that fossil and modern morphologies can be returned to uplift rates rather precisely, as the parametric window of each specific morphology is often narrow.

  13. Growth and characterization of ZnSe/CdSe/ZnSe quantum dots fabricated by using an alternate molecular beam supplying method

    International Nuclear Information System (INIS)

    ZnSe/CdSe/ZnSe structures inserted CdSe thin layer are fabricated using an alternate molecular beam supply (ALS). Examining the PL peak energy dependence on beam irradiation time in ALS cycle, we studied the initial stage of CdSe growth. When CdSe below the critical thickness is supplied on ZnSe grown on GaAs (1 0 0), two kinds of 2D islands (platelets) appear. We confirmed the alloying of 2D-CdSe islands and 3D-CdSe islands (dots) is prominent under Cd beam irradiation in ALS growth

  14. Returning from the Horizon: Introducing Urban Island Studies

    Directory of Open Access Journals (Sweden)

    Xavier Barceló Pinya

    2015-12-01

    Full Text Available Island studies tends to focus on peripheral, isolated, and marginal aspects of island communities, while urban studies has showed scant awareness of islandness: Although many people research cities on islands, there is little tradition of researching island cities or urban archipelagos per se. Island cities (densely populated small islands and population centres of larger islands and archipelagos nevertheless play import cultural, economic, political, and environmental roles on local, regional, and global scales. Many major cities and ports have developed on small islands, and even villages can fulfil important urban functions on lightly populated islands. Island concepts are also deployed to metaphorically describe developments in urban space. The journal Urban Island Studies explores island and urban processes around the world, taking an island approach to urban research and an urban approach to island research.

  15. Excitons, biexcitons, and phonons in ultrathin CdSe/ZnSe quantum structures

    DEFF Research Database (Denmark)

    Gindele, F.; Woggon, Ulrike; Langbein, Wolfgang Werner; Hvam, Jørn Märcher; Leonhardi, K.; Hommel, D.; Selke, H.

    1999-01-01

    nanostructures consist of a coherently strained Zn1-xCdxSe/ZnSe quantum well with embedded islands of higher Cd content with sizes of a few nanometer due to strain-induced CdSe accumulation. The local increase in CdSe concentration results in a strong localization of the excitonic wave function, in an increase...

  16. « L'île du soleil » : une parenthèse de temporalité insolite The « Island of the Sun »: an Unusual Temporal Digression

    Directory of Open Access Journals (Sweden)

    Hélène Fragaki

    2010-12-01

    Full Text Available Dans le livre II de sa Bibliothèque historique, Diodore de Sicile raconte comment Iambule a découvert une île heureuse lors d’un voyage à travers l’Arabie. Ce récit fabuleux, qui peut être défini comme un roman utopique au sens large du terme, est donc délibérément intégré dans une œuvre qui se veut historique. Sa version originale, attribuée à Iambule, remonte à l’époque hellénistique et ne peut être postérieure au milieu du Ier s. av. J.-C., date à laquelle la Bibliothèque historique a été rédigée. Au début du roman, une série d’aventures extraordinaires anime le temps et l’éclaire d’une lueur mystérieuse en faisant intervenir des intervalles déterminés par des chiffres symboliques. On est ainsi introduit à une dimension temporelle utopique, celle de l’île heureuse : immuable, continu et homogène, le temps n’est que le support d’activités constructives, répétitives et rigoureusement rythmées ; il est dépourvu de tout aspect angoissant ou ravageur et n’amène que la croissance et la prospérité, d’autant plus que la vie est excessivement longue et la mort dédramatisée. Cette parenthèse temporelle paisible, dont la clôture est également marquée par des durées symboliques, apparaît comme une réaction à un temps réel violemment agité. Toutefois, elle n’est pas aussi statique qu’il ne paraît à première vue, dans la mesure où elle s’insère dans le mouvement de la temporalité historique et où elle est accessible par le temps bien plus turbulent de l’aventure et du voyage.In volume 2 of his book Bibliotheca Historica, Diodorus of Sicily tells the story of Iamboulos who discovered a blissful island while traveling through Arabia. This fabulous story, which can be defined as a utopian novel in the broader sense of the term, is therefore deliberately incorporated into a book which is supposed to be historical. Its original version, attributed to Iamboulos, dates

  17. Faroe Islands

    DEFF Research Database (Denmark)

    Christoffersen, Lisbet

    2015-01-01

    An update introduction including recent legislative changes on the Folkchurch of the Faroe Islands......An update introduction including recent legislative changes on the Folkchurch of the Faroe Islands...

  18. Se los por se lo

    OpenAIRE

    José Luis Rivarola

    1985-01-01

    El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966) en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre refle...

  19. Galapagos Islands

    Science.gov (United States)

    2002-01-01

    This true-color image of the Galapagos Islands was acquired on March 12, 2002, by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite. The Galapagos Islands, which are part of Ecuador, sit in the Pacific Ocean about 1000 km (620 miles) west of South America. As the three craters on the largest island (Isabela Island) suggest, the archipelago was created by volcanic eruptions, which took place millions of years ago. Unlike most remote islands in the Pacific, the Galapagos have gone relatively untouched by humans over the past few millennia. As a result, many unique species have continued to thrive on the islands. Over 95 percent of the islands' reptile species and nearly three quarters of its land bird species cannot be found anywhere else in the world. Two of the more well known are the Galapagos giant tortoise and marine iguanas. The unhindered evolutionary development of the islands' species inspired Charles Darwin to begin The Origin of Species eight years after his visit there. To preserve the unique wildlife on the islands, the Ecuadorian government made the entire archipelago a national park in 1959. Each year roughly 60,000 tourists visit these islands to experience what Darwin did over a century and a half ago. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  20. SE PREVENINDO?

    Directory of Open Access Journals (Sweden)

    Ana Débora Assis Moura

    2010-01-01

    Full Text Available Este estudio tuvo como objetivo verificar el comportamiento de las prostitutas en relación a la prevención de enfermedades de transmisión sexual y del Síndrome de Inmunodeficiencia Adquirida-SIDA, así como investigar cómo se previenen de esas enfermedades. Se trata de una investigación exploratoria, con enfoque cualitativo, llevada a cabo en la Asociación de las Prostitutas en Ceará, Brazil, en septiembre de 2008, a través de una encuesta con 25 prostitutas. El análisis de los datos se hizo según el análisis de contenido, después de ser agrupados en cuatro categorías: conocimiento sobre las enfermedades de transmisión sexual/SIDA; convivencia con la(s enfermedad(es; prevención de la enfermedad de transmisión sexual/SIDA; y el uso de drogas. Se concluyó que las prostitutas no usan preservativos en todas las relaciones sexuales, por lo tanto, las enfermedades de transmisión sexual representan una realidad; la desinformación sobre la(s enfermedad(es es notable; el consumo de drogas lícitas e ilícitas es frecuente entre ellas, factor que las expone a situaciones más vulnerables con relación al VIH/SIDA.

  1. Se los por se lo

    Directory of Open Access Journals (Sweden)

    José Luis Rivarola

    1985-12-01

    Full Text Available El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966 en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre reflexivo, sinotambién como variante combinatoria del pronombre personal complemento indirecto de la tercera persona.

  2. Happy Island

    CERN Document Server

    McLerran, Larry

    2011-01-01

    I discuss the phase diagram for QCD in the baryon chemical potential and temperature plane. I argue that there is a new phase of matter different from the deconfined Quark Gluon Plasma: Quarkyonic Matter. Quarkyonic Matter is confined and exists at densities parametrically large compared to the QCD scale, when the number of quark colors, $N_c$ is large. I motivate the possibility that Quarkyonic Matter is in an inhomogeneous phase, and is surrounded by lines of phase transitions, making a Happy Island in the $\\mu_B$-T plane. I conjecture about the geography of Happy Island.

  3. Solomon Islands

    OpenAIRE

    World Bank

    2015-01-01

    This report aims to build understanding of the existing disaster risk financing and insurance (DRFI) tools in use in the Solomon Islands and to identify gaps where engagement could further develop financial resilience. It also aims to encourage peer exchange of regional knowledge, specifically by encouraging dialogue on past experiences, lessons learned, optimal use of these financial tool...

  4. Islands for SAT

    OpenAIRE

    H Fang; Kilani, Y.; Lee, J.H.M.; Stuckey, P. J.

    2006-01-01

    In this note we introduce the notion of islands for restricting local search. We show how we can construct islands for CNF SAT problems, and how much search space can be eliminated by restricting search to the island.

  5. Beautiful hainan island

    Institute of Scientific and Technical Information of China (English)

    汪伦

    2002-01-01

    Hainan Island is the second largest island in China. It is situated on the Nanhai Sea(South China Sea) and faces Guangdong Province across Qiongzhou Strait (海峡).Hainan Province was established (建立)in 1988. It consists of Hainan Island, Xisha Islands, Zhongsha Islands, Nansha Islands and the vast sea areas around them.Its total area is 340,000 km2.

  6. Island Formation: Constructing a Coral Island

    Science.gov (United States)

    Austin, Heather; Edd, Amelia

    2009-01-01

    The process of coral island formation is often difficult for middle school students to comprehend. Coral island formation is a dynamic process, and students should have the opportunity to experience this process in a synergistic context. The authors provide instructional guidelines for constructing a coral island. Students play an interactive role…

  7. A NEW SPECIES OF RANINOIDES (CRUSTACEA: DECAPODA:RANINIDAE) FROM OFF THE SOUTHEASTERN COAST OF HAINAN ISLAND AND NANSHA ISLANDS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Raninoides longifions new species, off SE coast of Hainan Island, dorsal surface of carapace with an arched granular edge across carapace between the anterolateral teeth, median frontal tooth longest, second frontal teeth subquadrate.

  8. Researching Pacific island livelihoods:

    DEFF Research Database (Denmark)

    Egelund Christensen, Andreas; Mertz, Ole

    2010-01-01

    Small island literature is vast in focus and aim, and is rooted in many different disciplines. The challenge is to find common grounds for researching small islands conceptually and theoretically. The aim of this article is to comment on how to research small islands, including a discussion on...... contemporary theories of nissology and conceptual analytical frameworks for island research. Through a review of selected case-study-based island literature on changing livelihoods coming out of the South Pacific, we wish to illustrate and discuss advantages of finding common grounds for small island studies...

  9. The Nourishing Sea: Partnered Guardianship of Fishery and Seabed Mineral Resources for the Economic Viability of Small Pacific Island Nations

    OpenAIRE

    Paul D'Arcy

    2013-01-01

    While island biogeography and modern economics portray Pacific island nations as isolated, ecologically fragile, resource poor and barely viable economies forever dependent on foreign aid, Pacific island history and culture conceives of their islands as intimately inter-linked to the surrounding ocean and of that ocean as an avenue to expanded resource bases, both terrestrial and aquatic. Pacific Islanders live in the most aquatic human zone on Earth, with the highest territorial ratios of se...

  10. Shemya Island prehistory

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The 752 artifacts described in this paper are from 5 sites on Shemya Island. Artifactual evidence suggests the island had a small resident population and was...

  11. Island political economy

    OpenAIRE

    Bertram, Geoffrey; Poirine, Bernard

    2007-01-01

    International audience In this chapter we build on the observation that island economies, and especially small ones (population below one million), exhibit a remarkably wide range of economic structures built on a correspondingly wide range of development strategies. Common elements of "islandness" may serve to define island economies as a general class, but there clearly exist several distinct "species" within that class, and a corresponding menu of strategic options open to islander comm...

  12. Birds observed at Shemya Island, Aleutian Islands

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report covers Shemya Island bird surveys. The reports outline migrant bird activity during August 31 to October 3, 1977. The purpose of the study was to survey...

  13. Paradise Islands? Island States and Environmental Performance

    Directory of Open Access Journals (Sweden)

    Sverker C. Jagers

    2016-03-01

    Full Text Available Island states have been shown to outperform continental states on a number of large-scale coordination-related outcomes, such as levels of democracy and institutional quality. The argument developed and tested in this article contends that the same kind of logic may apply to islands’ environmental performance, too. However, the empirical analysis shows mixed results. Among the 105 environmental outcomes that we analyzed, being an island only has a positive impact on 20 of them. For example, island states tend to outcompete continental states with respect to several indicators related to water quality but not in aspects related to biodiversity, protected areas, or environmental regulations. In addition, the causal factors previously suggested to make islands outperform continental states in terms of coordination have weak explanatory power in predicting islands’ environmental performance. We conclude the paper by discussing how these interesting findings can be further explored.

  14. Darwin and the island

    OpenAIRE

    Fox, Justin Daniel.

    1995-01-01

    This thesis examines the fictional island and assesses the impact of Darwinism on the genre. I show how islands have been a recurring feature in European literature, fictional spaces where authors create a microcosm in which they satirise, criticise or hold up a mirror to their own society. I argue that traditonal Utopian islands are static realms and that through the introduction of evolution (Darwin and Wallace made their most important discoveries regarding the mechanism of...

  15. Tanzania - Mafia Island Airport

    Data.gov (United States)

    Millenium Challenge Corporation — The evaluation design and subsequent data gathering activities will address the following key research questions: a) Has the Mafia Island Airport Upgrade Project...

  16. Future strategy of SE

    International Nuclear Information System (INIS)

    In this presentation author (General Director of Slovenske elektrarne, a. s.) presents structure and investment plans of SE. The feasibility study of construction of the blocks 3 and 4 of the Mochovce NPP is presented

  17. The Cook Islands

    OpenAIRE

    World Bank

    2015-01-01

    This country note is produced is part of The Pacific Catastrophe Risk Assessment andFinancing Initiative (PCRAFI). The geographic spread of the Cook Islands poses logistical problems for any necessary post-disaster relief and response efforts. The events of 2005 demonstrated that the Cook Islands is extremely vulnerable to the threat of tropical cyclones (TCs): in the two months of Februar...

  18. Marine and Island Ecology.

    Science.gov (United States)

    Stephens, Lawrence J.; And Others

    1988-01-01

    Describes an ecology course which provides students with an opportunity to observe aquatic and terrestrial life in the Bahamas. States that students learn scientific methodology by measuring physical and chemical aspects of the island habitats. Provides information on the island, course description and objectives, transportation, facilities, and…

  19. St. Vincent Island Tour

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This letter, written by Charles Marks who lived on St. Vincent Island as a child, notes the changes he saw in the island when he visited in 1981. He notes that the...

  20. Back to Treasure Island

    Science.gov (United States)

    Shriki, Atara

    2011-01-01

    In this article, the author presents the Treasure Island problem and some inquiry activities derived from the problem. Trying to find where pirates buried a treasure leads to a surprising answer, multiple solutions, and a discussion of problem solving. The Treasure Island problem is an example of an inquiry activity that can be implemented in…

  1. SE debt restructuring plan

    International Nuclear Information System (INIS)

    Slovenske elektrarne, a.s. (SE) plans to restructure one's own debts in 2003-2005. Debt restructuring plan is following: 2003: Collection of pre-payment on electricity - 60 million Euro (2.5 billion Slovak crowns), consumer unknown. Own promissory notes in total value of 100 million US$ (3.5 billion Slovak crowns) - in process. Sale of claims worth 2.4 billion Slovak crowns (57.21 million Euro) - negotiations in process. 2003/2004: Restructuring of loans payable IV. quarter 2003 and at the beginning of 2004 in value of 200 million Euro (8.3 billion Slovak crowns). Aim of SE is a new credit payable within 7 years, with instalments payable in the last two to three without any state subsidies. 2005: Loans worth 460 million Euro (189 billion Slovak crowns) will still remain. SE want to negotiate them with banks without state support

  2. SE-selskabet

    DEFF Research Database (Denmark)

    Schaumburg-Müller, Peer; Werlauff, Erik

    Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion.......Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion....

  3. A NEW SPECIES OF RANINOIDES (CRUSTACEA : DECAPODA : RANINIDAE) FROM OFF THE SOUTHEASTERN COAST OF HAINAN ISLAND AND NANSHA ISLANDS

    Institute of Scientific and Technical Information of China (English)

    陈惠莲; MichaelTuerkay

    2001-01-01

    Ranlnoides longifions new species, off SE coast of Hainan Island, dorsal surface of carapace with an arched granular edge across carapace between the anterolateral teeth, median frontal tooth longest, second frontal teeth subquadrate.

  4. Census Snapshot: Rhode Island

    OpenAIRE

    Romero, Adam P; Baumle, Amanda; Badgett, M. V. Lee; Gates, Gary J.

    2007-01-01

    Using data from the U.S. Census Bureau, this report provides demographic and economic information about same-sex couples and same-sex couples raising children in Rhode Island. We compare same-sex “unmarried partners,” which the Census Bureau defines as an unmarried couple who “shares living quarters and has a close personal relationship,” to different-sex married couples in Rhode Island. In many ways, the over 2,400 same-sex couples living in Rhode Island are similar to married coupl...

  5. Se min kjole

    DEFF Research Database (Denmark)

    Bogen Se min kjole udkom i anledning af 50-året for de første ordinationer af kvindelige præster i den danske folkekirke i 1948. Bogen giver analyser af, hvad kvindelige præster har betydet for præsterollen og for prædikengenren; den fortæller om de første kvindelige præsters liv og syn på...

  6. Autosalon se servisem

    OpenAIRE

    Wilkonský, Roman

    2015-01-01

    Diplomová práce se zabývá zpracováním projektové dokumentace pro provádění stavby. Stavba je navržená jako autosalon se servisem. Stavební parcela se nachází v katastrálním území Ostrava - Vítkovice. Projektová dokumentace je zpracována v souladu s platnými zákony, vyhláškami a normami. Stavba je funkčně rozdělena na dva objekty a to výstavní sál s administrativním a sociálním zázemím a servisní část s myčkou a sociálním zázemím. Tyto dva objekty jsou provozně a stavebně propojeny. Nejdelší p...

  7. Nunivak Island muskox studies

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report covers the Nunivak Island muskox, summarizing the carrying capacity and age and sex ratios. Recommendations are attached for muskox management.

  8. Solomon Islands; Selected Issues

    OpenAIRE

    International Monetary Fund

    2011-01-01

    This paper analyzes Solomon Islands’ ongoing reforms concerning of the mineral taxation regime and the fiscal impact of mineral resources. The analysis shows that mineral revenue could be substantial, provided that mineral prices remain strong in the medium term. Enforcing the tax agreement with, a Gold Ridge company, and implementing the new resource taxation regime are critical to ensure that the forthcoming mineral wealth spills over to the rest of the economy. Solomon Islands should ado...

  9. Islands and Islandness in Rock Music Lyrics

    Directory of Open Access Journals (Sweden)

    Daniele Mezzana

    2012-05-01

    Full Text Available This paper presents a first exploration, qualitative in character, based on a review of 412 songs produced in the period 1960-2009, about islands in rock music as both social products and social tools potentially contributing to shaping ideas, emotions, will, and desires. An initial taxonomy of 24 themes clustered under five meta-themes of space, lifestyle, emotions, symbolism, and social-political relations is provided, together with some proposals for further research.

  10. Vicia vulcanorum (Fabaceae a new species from the island of Lanzarote (Canary Islands

    Directory of Open Access Journals (Sweden)

    Morales-Mateos, J. B.

    2012-12-01

    Full Text Available Vicia vulcanorum J. Gil & M. L. Gil (Fabaceae, a new species of subg. Cracca (Dumort. Peterm., sect. Cracca Dumort. is described and illustrated from the island of Lanzarote, Canary Islands, north-west of Africa. It is related to and compared with Vicia cirrhosa C. Sm. ex Webb & Berthel. and Vicia filicaulis Webb & Berthel., two endemic species from the western and central group of the Canary Islands, and Vicia ferreirensis Goyder, an endemic species from Porto Santo Island, Madeira Archipelago.Se describe e ilustra Vicia vulcanorum J. Gil & M. L. Gil (Fabaceae, una nueva especie y endemismo de la isla de Lanzarote, Islas Canarias, perteneciente al subg. Cracca (Dumort. Peterm., sect. Cracca Dumort. Se encuentra relacionada y es comparada con Vicia cirrhosa C. Sm. ex Webb & Berthel. y Vicia filicaulis Webb & Berthel., especies endémicas de las islas centrales y occidentales del archipiélago canario, y con Vicia ferreirensis Goyder, especie endémica de la isla de Porto Santo, en el archipiélago de Madeira.

  11. Surface morphology of Cr:Ga2Se3 heteroepitaxy on Si(001)

    Science.gov (United States)

    Yitamben, E. N.; Lovejoy, T. C.; Paul, D. F.; Callaghan, J. B.; Ohuchi, F. S.; Olmstead, M. A.

    2009-08-01

    Addition of the transition-metal dopant Cr to Ga2Se3 during heteroepitaxial growth on Si(001), a system of interest as a prototype silicon-compatible, dilute magnetic semiconductor, has been studied with scanning-tunneling microscopy and scanning Auger microscopy as a function of Cr concentration and the presence or absence of an undoped buffer or capping layer. Chromium incorporates into laminar Ga2Se3 films up to a solubility limit of several atomic percent, after which Cr-rich islands nucleate. At low Cr concentrations, the vacancy-ordered nanoridge structure characteristic of pure Ga2Se3 remains but nanoridge aspect ratios decrease with Cr concentration; this is likely associated with Cr removing intrinsic vacancies. At higher Cr concentrations, faceted, Cr-rich islands nucleate, often surrounded by trenches, and the terrace morphology no longer resembles pure Ga2Se3 . Growth of Cr-doped Ga2Se3 directly on Si(001):As is qualitatively similar to growth on a pure Ga2Se3 buffer layer; however, the island structure changes dramatically upon coverage of a highly doped layer with undoped Ga2Se3 . Addition of Cr stabilizes cubic overlayer growth under Se-poor growth conditions beyond that of pure Ga2Se3 ; no growth of the hexagonal layered structure characteristic of bulk GaSe was observed.

  12. Seal Island and Franklin Island National Wildlife Refuges Trip Report

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a summary of visits to both Seal Island National Wildlife Refuge and Franklin Island National Wildlife Refuge on August 14, 15, 16, 1982.

  13. Islands of Astronomy

    Directory of Open Access Journals (Sweden)

    Godfrey Baldacchino

    2009-05-01

    Full Text Available A global review of islands and their connections with astronomy throughout history up to the contemporary times suggests eight compelling, distinct yet interlocking reasons why islands have been and remain so important to astronomy and astronomers. Islands constitute favourable locations for various types of astronomy-related activities: from tracking satellites and monitoring significant celestial events, to providing exceptional locations to jurisdictions with mandated dark and unpolluted skies. They appeal for their favourable longitude and (especially southern latitude, as well as for their disposition towards the conditions that the scientific community may expect in an ideal world: relatively clear viewing conditions from a secure, self-contained platform that is, however, endowed with connectivity. This article is written as a contribution to the International Year of Astronomy (2009.

  14. Formation and properties of epitaxial CdSe, ZnSe quantum dots. Conventional molecular beam epitaxy and related techniques

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, Suddhasatta

    2008-01-16

    This thesis systematically investigates three such alternative approaches, along with conventional MBE, with emphasis on the formation-mechanism of QDs, and optimization of their morphological and optical attributes. it is shown here that no distinct 3D islands are formed in MBE growth of CdSe on ZnSe. While CdSe heteroepitaxy occurs in the multilayer-mode at T{sub G}=300 C, a reentrant recovery of the layer-by-layer mode is reported in this thesis, for growth at T{sub G}<{proportional_to}240 C. In the second variant technique, formation of large and distinct islands is demonstrated by deposition of amorphous selenium (a-Se) onto a 2D CdSe epilayer at room temperature and its subsequent desorption at a higher temperature (T{sub D}=230 C). The process steps of the third variant technique, developed in course of this work, are very similar to those of the previous one-the only alteration being the substitution of selenium with tellurium as the cap-forming-material. (orig.)

  15. 78 FR 48668 - PSEG Long Island LLC, Long Island Electric Utility Servco LLC, Long Island Power Authority, Long...

    Science.gov (United States)

    2013-08-09

    ... Energy Regulatory Commission PSEG Long Island LLC, Long Island Electric Utility Servco LLC, Long Island Power Authority, Long Island Lighting Company; Notice of Petition for Declaratory Order Take notice that...) Rules of Practice and Procedure, 18 CFR 385.207, PSEG Long Island LLC (PSEG LI), Long Island...

  16. Long Island Solar Farm

    Energy Technology Data Exchange (ETDEWEB)

    Anders, R.

    2013-05-01

    The Long Island Solar Farm (LISF) is a remarkable success story, whereby very different interest groups found a way to capitalize on unusual circumstances to develop a mutually beneficial source of renewable energy. The uniqueness of the circumstances that were necessary to develop the Long Island Solar Farm make it very difficult to replicate. The project is, however, an unparalleled resource for solar energy research, which will greatly inform large-scale PV solar development in the East. Lastly, the LISF is a superb model for the process by which the project developed and the innovation and leadership shown by the different players.

  17. Sakhalin Island terrain intelligence

    Science.gov (United States)

    U.S. Geological Survey Military Geology Branch

    1943-01-01

    This folio of maps and explanatory tables outlines the principal terrain features of Sakhalin Island. Each map and table is devoted to a specialized set of problems; together they cover the subjects of terrain appreciation, climate, rivers, water supply, construction materials, suitability for roads, suitability for airfields, fuels and other mineral resources, and geology. In most cases, the map of the island is divided into two parts: N. of latitude 50° N., Russian Sakhalin, and south of latitude 50° N., Japanese Sakhalin or Karafuto. These maps and data were compiled by the United States Geological Survey during the period from March to September, 1943.

  18. Vorrats-SE ohne Arbeitnehmerbeteiligung

    OpenAIRE

    Blanke, Thomas

    2005-01-01

    Das neue Praxisfeld der SE wirft eine Fülle von Rechtsfragen auf. In Deutschland ist im März 2005 in Berlin die 'Go East Invest SE. Europäische Gesellschaft zur Industrieansiedlung und Markterschließung' in das Handelsregister eingetragen worden, obwohl entgegen Art. 12 Abs.2 SE-VO keine Regelung zur Arbeitnehmermitbestimmung getroffen wurde. Seit Oktober nimmt auch bereits der Handel mit Vorrats-SE Gestalt an. Vorrats-SE sind Gesellschaften, die allein zum Zweck des Handels mit dem SE-Mantel...

  19. 1957 Aleutian Islands, USA Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The magnitude 8.6 (Mw) earthquake occurred south of the Andreanof Islands, in the Aleutian Islands. It generated an 8-meter tsunami that did great damage on Adak...

  20. Gulf Island National Wildlife Refuges

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document provides a brief history and describes physical features of the Gulf Island National Wildlife Refuges. The Gulf Island National Wildlife Refuges...

  1. Islanded operation of distribution networks

    International Nuclear Information System (INIS)

    This report summarises the results of a study assessing the benefits and risks to distribution network of generator islanding and examining the technical, commercial and regulatory changes required to facilitate the operation of islanding. The background to the study is traced, and details are given of a literature review, the technical criteria for operating sections of the network in islanding mode, and the impact of islanding on trading. Case studies and a detailed implementation plan, data acquisition, and commercial incentives are discussed

  2. Islanded operation of distribution networks

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This report summarises the results of a study assessing the benefits and risks to distribution network of generator islanding and examining the technical, commercial and regulatory changes required to facilitate the operation of islanding. The background to the study is traced, and details are given of a literature review, the technical criteria for operating sections of the network in islanding mode, and the impact of islanding on trading. Case studies and a detailed implementation plan, data acquisition, and commercial incentives are discussed.

  3. Marketing plan for Kuuskajaskari Island

    OpenAIRE

    XIE, JUANJUAN

    2009-01-01

    Marketing palan for Kuuskajaskari Island. ‡b Kuuskajaskari Island owned by the town of Rauma. Marketing plan should help the entrepreneurs of the islands to create services that target groups want and promote them by using the efficient marketing mix. The theoretical part consists of nature of tourism industry, travel consumers in general, then focus on Rauma areas and its island as targeted destination. Data was gathered from different official Finnish websites, books and from Sanni-Mari Aal...

  4. Initial growth behavior of Cu(In,Ga)Se 2 on molybdenum substrates

    Science.gov (United States)

    Schlenker, T.; Schock, H. W.; Werner, J. H.

    2003-11-01

    We study the initial growth stage of Cu(In,Ga)Se 2 on Mo films on glass, as the typical back contact for Cu(In,Ga)Se 2 solar cells. A thermal evaporation process deposits Cu(In,Ga)Se 2 of nominal 3 nm thickness at different rates R and substrate temperatures TSub. An ultrahigh resolution scanning electron microscope serves to visualize the nucleation behavior. The deposited Cu(In,Ga)Se 2 forms three-dimensional isolated nuclei, known as Volmer-Weber growth mode. Deposition rate R and substrate temperature TSub control the areal density n of the Cu(In,Ga)Se 2 nuclei. For the growth on polycrystalline Mo substrates fabricated by sputter process, we observe a power law dependence between the island density n and the deposition rate R, and an exponential dependence of the island density n on substrate temperature TSub. The theory of homogeneous nucleation explains the Cu(In,Ga)Se 2 cluster formation on sputtered Mo substrates and the dependence of the island density on the growth conditions. On electron gun evaporated molybdenum, the cluster growth shows a similar behavior, but the nucleation mechanism deviates from the model of homogeneous nucleation and strong island density fluctuations occur.

  5. HEAT ISLAND REDUCTION STRATEGIES GUIDEBOOK

    Science.gov (United States)

    This heat island reduction strategies guidebook provides an overview of urban heat islands and steps communities can take to reduce them. In particular, this guidebook provides background basics and answers the questions: “What is a heat island?” “What are its impacts?" "What ar...

  6. Electron-impact ionization of Se2+ and Se3+

    Science.gov (United States)

    Pindzola, M. S.; Loch, S. D.

    2016-06-01

    Electron-impact ionization cross sections for Se2+ and Se3+ are calculated using a semi-relativistic configuration-average distorted-wave (CADW) method. Good agreement between the CADW calculations and recent experimental measurements are found for the single ionization of Se2+ from threshold to 500 eV and for the double ionization of Se2+ from threshold to 225 eV. Good agreement between the CADW calculations and recent experimental measurements are also found for the single ionization of Se3+ from threshold to 200 eV and for the double ionization of Se3+ near the peak of the cross section at 350 eV. Disagreements at other incident electron energies may be due to the complexity of the ionization pathways for low charged Se atomic ions, the various theoretical approximations, and the difficulty in measuring relatively small double ionization events.

  7. Kiritimati, Kiribati (Christmas Island)

    Science.gov (United States)

    2002-01-01

    Pronounced 'Ki-ris-mas,' Kiritimati Island has a large infilled lagoon that gives it the largest land area (125 square miles, 321 square km) of any atoll in the world. Captain Cook named the atoll Christmas Island when he arrived on Christmas Eve in 1777. Used for nuclear testing in the 1950s and 1960s, the island is now valued for its marine and wildlife resources. It is particularly important as a seabird nesting site-with an estimated 6 million birds using or breeding on the island, including several million Sooty Terns. Rainfall on Kiritimati is linked to El Nino patterns, with long droughts experienced between the wetter El Nino years. This image is based on a mosaic of four digital photographs taken on 16 January 2002 from the Space Station Alpha as part of the Crew Earth Observations Project. The underlying data have 10 meter spatial resolution. Coral reefs are one of the areas selected as a scientific theme for this project (see also the recent Earth Observatory article, Mapping the Decline of Coral Reefs. The mosaic, based on images ISS004-ESC-6249 to 6252, was provided by the Earth Sciences and Image Analysis Laboratory at Johnson Space Center. Additional images taken by astronauts and cosmonauts can be viewed at the NASA-JSC Gateway to Astronaut Photography of Earth.

  8. Solomon Islands Botany

    NARCIS (Netherlands)

    Steenis, van C.G.G.J.

    1969-01-01

    A discussion of the Results of the Royal Society Expedition to the British Solomon Islands Protectorate, 1965. Organized by E.J.H. Corner. Phil. Trans. R. Soc. B 255 (1969) 185-631, 196 fig. University Printing House, Shaftesbury Road, Cambridge. Obtainable through booksellers or direct to the Royal

  9. Solomon Islands : Workforce Development

    OpenAIRE

    World Bank

    2014-01-01

    Solomon Islands has undertaken a comprehensive assessment of the strength of its workforce development (WfD) policies and institutions to support these initiatives and enhance evidence based dialogue on their implementation. This assessment has been based on the World Bank s Systems Approach for Better Education Results (SABER) systems benchmarking initiative, under which a suite of analyt...

  10. Bone island and leprosy

    International Nuclear Information System (INIS)

    Objective. To determine the incidence of bone islands in leprosy patients. Design. X-rays of feet and hands of patients with Hansen's disease (leprosy) were reviewed retrospectively. A second group of related age- and sex-matched patients who did not have Hansen's disease was used for control purposes. Controls had undergone hand or foot X-rays during diagnosis of other pathologies. The patients with Hansen's disease were compared with the control group, and were also analyzed as subgroups with different types of leprosy. The results were subjected to statistical analysis. Patients. Ninety patients with Hansen's disease were randomly selected for this study. Patients who had had ulcers on hands or feet were excluded from the study. Results and conclusions. Bone islands were demonstrated in 20 patients with Hansen's disease; no bone islands were observed in the controls. This was statistically significant (P<0.01). Bone islands were only seen in patients with lepromatous leprosy and borderline types but were not demonstrated in patients with tuberculoid leprosy. There was also a statistically significant relationship for a disease duration of 15 years or more. The cause of this raised incidence of enostosis in leprosy patients is not clear, but there may be a genetic predisposition in patients with leprosy, or it may be a side effect of leprosy, especially the lepromatous form. (orig.)

  11. Christmas Island birds returning

    Science.gov (United States)

    Six months after their mass exodus, birds are beginning to return to Christmas Island. Roughly 17 million birds, almost the entire adult bird population, either perished or fled their mid-Pacific atoll home last autumn, leaving behind thousands of nestlings to starve (Eos, April 5, 1983, p. 131). It is believed that the strong El Niño altered the ecology of the surrounding waters and forced the birds to flee. Christmas Island is the world's largest coral atoll.“Ocean and atmosphere scientists are unsure of future directions for the El Niño conditions and cannot now predict what will happen to the birds in the coming months,” said Ralph W. Schreiber, curator of ornithology at the Natural History Museum of Los Angeles County in California. Heisthe ornithologist who discovered the disappearance. “The recovery of the bird populations depends on the food supply in the waters surrounding the island.” The island's birds feed exclusively on small fish and squid.

  12. Mauritius - a Sustainable Island

    DEFF Research Database (Denmark)

    Larsen, Anders

    2010-01-01

    The Government of Mauritius has a long-term vision of transforming Mauritius into a sustainable Island. One important element towards the achievement of this vision is to increase the country's renewable energy usage and thereby reducing dependence on fossil fuels. Democratisation of energy...

  13. Island Ecology in Bermuda.

    Science.gov (United States)

    Wulff, Barry L.; And Others

    1981-01-01

    Reports on an island ecology course offered by Eastern Connecticut State College providing opportunities for students to study the ecology and natural history of organisms found in a variety of subtropical habitats in Bermuda. Explains student selection criteria, trip preparation, evaluation criteria, daily programs, and habitats studied on the…

  14. 78 FR 58880 - Safety Zone; Catawba Island Club Wedding Event, Catawba Island Club, Catawba Island, OH

    Science.gov (United States)

    2013-09-25

    ... DHS Department of Homeland Security FR Federal Register NPRM Notice of Proposed Rulemaking TFR... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Catawba Island Club Wedding Event, Catawba Island Club, Catawba Island, OH ACTION: Temporary final rule. SUMMARY: The Coast Guard is...

  15. Single-island home range use by four female Peary caribou, Bathurst Island, Canadian High Arctic, 1993-94

    Directory of Open Access Journals (Sweden)

    Frank L. Miller

    2003-04-01

    Full Text Available Spatial and temporal use of seasonal, and collectively, annual ranges by four female Peary caribou (Rangifer taran-dus pearyi was investigated using satellite telemetry. Knowledge of how caribou use space allows a better understanding of their demands on those ranges and enhances evaluation of associated environmental stressors. The study took place during an environmentally favorable caribou-year with high reproduction and calf survival and low (none detected 1+ yr-old mortality, 1 August 1993 to 31 July 1994, Bathurst Island, south-central Queen Elizabeth Islands, Canadian High Arctic. All four females exhibited a pattern of single-island seasonal, and collectively, annual range use. Estimates of the maximum area encompassed by each individual during the course of the annual-cycle varied from 1735 to 2844 km2 (mean±SE = 2284±250 km2. Although, there was 46% spatial overlap among individual ranges, temporal isolation resulted in the four individuals maintaining seasonal ranges distinctly separate from each other. This collective area encompassed 4970 km2 and equaled about 31% and 18% of Bathurst Island and the Bathurst Island complex, respectively. Individual wintering areas formed a relatively small portion of each individual's annual range (mean±SE=71±17 km2: 24 km2, 158 days of occupation, <1% of the annual area; 70 km2, 187 days, 4%; 95 km2, 200 days, 4%; and 94 km2, 172 days, 6%. Seasonal movements were greatest during pre-rut and pre-calving.

  16. Structural and optical properties of CuSe2 nanocrystals formed in thin solid Cu-Se film

    Science.gov (United States)

    Gilić, M.; Petrović, M.; Kostić, R.; Stojanović, D.; Barudžija, T.; Mitrić, M.; Romčević, N.; Ralević, U.; Trajić, J.; Romčević, M.; Yahia, I. S.

    2016-05-01

    This paper describes the structural and optical properties of Cu-Se thin films. The surface morphology of thin films was investigated by atomic force microscopy (AFM) and scanning electron microscopy (SEM). Formation of Cu-Se thin films is concluded to proceed unevenly, in the form of islands which later grew into agglomerates. The structural characterization of Cu-Se thin film was investigated using X-ray diffraction pattern (XRD). The presence of two-phase system is observed. One is the solid solution of Cu in Se and the other is low-pressure modification of CuSe2. The Raman spectroscopy was used to identify and quantify the individual phases present in the Cu-Se films. Red shift and asymmetry of Raman mode characteristic for CuSe2 enable us to estimate nanocrystal dimension. In the analysis of the far-infrared reflection spectra, numerical model for calculating the reflectivity coefficient of layered system, which includes film with nanocrystalite inclusions (modeled by Maxwell-Garnett approximation) and substrate, has been applied.

  17. Island solution; Inselloesung

    Energy Technology Data Exchange (ETDEWEB)

    Bah, Isaac

    2013-06-15

    On the Azores island Graciosa the Berlin-based company Younicos has installed a new electricity system with advanced storage technology, which will make the islanders independent from fossil fuels. With an energy mix of wind power, photovoltaics and biomass the dependence on fossil fuels should be terminated. In the center of the flagship project specifically developed hybrid batteries are used (combination of sodium-sulfur- and lithium-ion batteries) with 2.7 MW of power and a storage capacity of ten megawatts hours. [German] Auf der Azoren-Insel Graciosa installiert das Berliner Unternehmen Younicos ein neues Stromsystem mit modernster Speichertechnologie, das die Bewohner unabhaengig von fossilen Energietraegern machen soll. Mit einem Energiemix aus Windkraft, Photovoltaik und Biomasse soll die Abhaengigkeit von fossilen Brennstoffen beendet werden. Im Zentrum des Vorzeigeprojekts stehen speziell fuer den Inseleinsatz entwickelte Hybridbatterien (Kombination aus Natrium-Schwefel- und Lithium-Ionen-Akkus) mit 2,7 Megawatt Leistung und eine Speicherkapazitaet von zehn Megawattestunden.

  18. The conventional island

    International Nuclear Information System (INIS)

    For the conventional island, GEC Alsthom designs, manufactures and supplies: Mechanical equipment for the conventional island, Electrical equipment for the entire PWR unit, Safety-class mechanical equipment. Its experience and its own R and D resources, as well as close collaboration with EDF and experience feedback from equipment manufacturing, plant unit construction, and operation, enabled GEC Aslthom to meet the challenge of making a success of the massive nuclear power program launched in France. The latest step in the French nuclear power program is the 'N4' generation of 1450 MWe class units, for which GEC Alsthom has developed a second generation of impulse turbines, more compact and efficient moisture separator/reheaters and seawater-tight condensers

  19. Magnetic islands' dynamics

    International Nuclear Information System (INIS)

    The nonlinear evolution of the tearing mode is studied within the framework of single fluid magnetohydrodynamics (MHD) for different cases. First, the most simple instance of magnetic islands is studied, that is, the reduced MHD model within the cylindrical approximation for a given or constant resistivity profile. The nonlinear saturation of the tearing instability is then treated using two different methods: the first one, called the flux coordinate method, takes into account the fact that the current density is a flux function, whereas the second, simply called the perturbative method, does not. The generalized Rutherford equation is then provided by the asymptotic matching condition. It is shown not to depend on the choice of normalizations, as it should, and, in addition to new terms calculated for the first time, gives back all the results derived in previous work on the subject. It is also shown that the magnetic island gives rise to an order w3 modification of the poloidal magnetic flux, where w is the saturated island width, which is due to the flattening of the current density profile inside the separatrix. The perturbative method is then used to tackle two other issues, the first one being that of island rotation and the presence of an outer perturbation to the system. The corrections to the Rutherford equation due to these new effects are derived, and the importance of regularizing the vorticity profile in a new viscous-resistive boundary layer centered on the separatrix is emphasized, although not done explicitly. The second issue deals with the saturation of the tearing mode in full MHD, assuming single helicity and zero pressure. The equations are rewritten in a way that resembles the reduced MHD equations, so that the saturation equation can be derived using the perturbative method. Finally, the interest of such a study concerning the Reversed Field Pinch is discussed, and, in particular, the possibility that the tearing mode saturation may provide

  20. Urban heat island 1

    DEFF Research Database (Denmark)

    Bühler, Oliver; Jensen, Marina Bergen; Petersen, Karen Sejr

    2010-01-01

    Urban Heat Island beskriver det forhold, at temperaturen i byområder er højere end temperaturen i tilgrænsede landområder. Årsagen hertil ligger i den urbane arealanvendelse, hvor en mindre andel af arealerne er dækket af vegetation, og en større andel består af forseglede arealer....

  1. Formation and properties of epitaxial CdSe, ZnSe quantum dots. Conventional molecular beam epitaxy and related techniques

    International Nuclear Information System (INIS)

    This thesis systematically investigates three such alternative approaches, along with conventional MBE, with emphasis on the formation-mechanism of QDs, and optimization of their morphological and optical attributes. it is shown here that no distinct 3D islands are formed in MBE growth of CdSe on ZnSe. While CdSe heteroepitaxy occurs in the multilayer-mode at TG=300 C, a reentrant recovery of the layer-by-layer mode is reported in this thesis, for growth at TGD=230 C). The process steps of the third variant technique, developed in course of this work, are very similar to those of the previous one-the only alteration being the substitution of selenium with tellurium as the cap-forming-material. (orig.)

  2. MARICULTURE ON CROATIAN ISLANDS

    Directory of Open Access Journals (Sweden)

    Gordana Šarušić

    2000-09-01

    Full Text Available The first attempts of intensive mariculture in Croatia commenced at the very beginning of 1980’s. The mid-eighties brought an expansion of mariculture production, which has been continuously increasing. A few different marine organisms are intensively cultured - both fish and shellfish. Among them commercially most important and highly valued species are sea bass Dicentrarchus labrax and sea bream Sparus aurata. Mussel Mytilus galloprovincialis and oyster Ostrea edulis are the most important shellfish. Fish species such as dentex Dentex dentex, red sea bream Pagrus major and sheepshead bream Puntazzo puntazzo are reared too, but in a rather small quantities. Only recently the rearing, on-growing- of bluefin tuna Thunnus thynnus started in Croatia. The juveniles (70% are reared in a Croatian hatcheries, and 30% has to be imported mainly from Italy and France, due to a higher demand for this kind of culture among the small growers. Croatian part of Adriatic sea possesses a number of geomorfologicaly suitable sites and meteorological conditions which determined the choice - type - of intensive culture. All fish species are reared in a floating cages. The choice of cages i. e. semi off-shore or floating frames, size, rearing volume and design depend on the investors personal preference. The annual turnouf of a market size bass was about 600t and 300t bream in 1996., by 10 island farms which is 70% of total production in Croatia. Including other cultured fish species last year production was up to 1000t, and it™s being estimated to be about 1300t in the following year. The shellfish production on the islands is usually individual attempt of farmers, producing minor quantities mostly in polyculture. This production has bigger potential but it’s limited owing to the EU quality control regulations which do not allow the export, and by domestic market which has drastically decreased due to the collapse of tourism during the recent war. Almost 80

  3. Solomon Islands : Operational Procurement Review

    OpenAIRE

    World Bank

    2012-01-01

    Solomon Islands is a remote, scattered archipelago about 1,900 km northeast of Australia in the South Pacific, with terrain ranging from about 1,000 mountainous islands to low-lying coral atolls stretching in a 1,450 km chain east of Papua New Guinea across the Coral Sea to Vanuatu. The archipelago covers a total area of 725,197 sq km (approx 280,000 sq miles) with the main islands being C...

  4. Gamma ray dose rates in the Weh Island, Indonesia

    International Nuclear Information System (INIS)

    The Weh Island is located at the northern most part of Great Sumatera Fault system which has NW-SE trend elongated from Bands Aceh until Semangko Bay about 1650 km within Sumatera Island. We had conducted the measurement of gamma ray dose rate in Weh Island of Sumatera in Indonesia. From about 15 observation points, we found that the average of gamma ray dose rate was 50.8 ± 4.8 nGy/h. From the present study, natural intensity of radioactivity could be checked and can be concluded into the following; 1) There are two high radioactive level zones in the investigating area. One of them is the east zone in accordance with valleys and erosion zone along the structure line (Great Sumatra fault). 2) The other zone is the central part of this area. Even if this zone looks lineament geographically, it indicates the existence of fault line. (author)

  5. Adaptation and diversification on islands.

    Science.gov (United States)

    Losos, Jonathan B; Ricklefs, Robert E

    2009-02-12

    Charles Darwin's travels on HMS Beagle taught him that islands are an important source of evidence for evolution. Because many islands are young and have relatively few species, evolutionary adaptation and species proliferation are obvious and easy to study. In addition, the geographical isolation of many islands has allowed evolution to take its own course, free of influence from other areas, resulting in unusual faunas and floras, often unlike those found anywhere else. For these reasons, island research provides valuable insights into speciation and adaptive radiation, and into the relative importance of contingency and determinism in evolutionary diversification. PMID:19212401

  6. Island biogeography of the Anthropocene.

    Science.gov (United States)

    Helmus, Matthew R; Mahler, D Luke; Losos, Jonathan B

    2014-09-25

    For centuries, biogeographers have examined the factors that produce patterns of biodiversity across regions. The study of islands has proved particularly fruitful and has led to the theory that geographic area and isolation influence species colonization, extinction and speciation such that larger islands have more species and isolated islands have fewer species (that is, positive species-area and negative species-isolation relationships). However, experimental tests of this theory have been limited, owing to the difficulty in experimental manipulation of islands at the scales at which speciation and long-distance colonization are relevant. Here we have used the human-aided transport of exotic anole lizards among Caribbean islands as such a test at an appropriate scale. In accord with theory, as anole colonizations have increased, islands impoverished in native species have gained the most exotic species, the past influence of speciation on island biogeography has been obscured, and the species-area relationship has strengthened while the species-isolation relationship has weakened. Moreover, anole biogeography increasingly reflects anthropogenic rather than geographic processes. Unlike the island biogeography of the past that was determined by geographic area and isolation, in the Anthropocene--an epoch proposed for the present time interval--island biogeography is dominated by the economic isolation of human populations. PMID:25254475

  7. Islanders' Perspectives on Sustainable Living

    Directory of Open Access Journals (Sweden)

    Gillian Cambers

    2006-05-01

    Full Text Available An internet forum, supported by the Small Islands Voice initiative, has since 2002 provided a place where islanders from around the world could discuss issues and problems and also learn from the experiences of others. This paper provides a reflective overview of the discussions over the past four years and attempts to identify some specific characteristics that identify islanders in their approaches to everyday living. An analysis of the forum respondents shows that approximately two thirds are male; one half come from the Pacific islands; and more than a half are employed in island-based occupations. Discussions have covered infrastructural development; resource management; environmental, social and economic issues. The overview indicates islanders are very willing to speak out and take ownership of their issues and problems and their discussions show a significant level of understanding about the need to balance limited resources and economic development. Proposals for action are practical and feasible and there is a strong vein of common sense running through the responses. Most significantly, islanders show a deep love for their island homes, an attitude of caring about the future development of their islands, and a willingness to try to solve their problems themselves.

  8. Renewable energy islands in Europe

    Energy Technology Data Exchange (ETDEWEB)

    Oestergaard, Iben [ed.

    1998-12-31

    This publication includes a compiled presentation of various aspects concerning the possible transformation of some European islands into renewable energy communities and these projects were presented by a selection of pioneer islands at the first European Seminar on Renewable Energy Islands, held on the Danish island of Samsoee, 29-30 June 1998. This issue has increased in importance with the presentation of the ambitious EU-White Paper: `Energy for the future: Renewable Sources of Energy` which was adopted in 1998. One of the key elements of the strategy for an accelerated implementation of renewable energy is to transform 100 localities within Europe into communities which are to be 100% self-sufficient with renewable energy before 2010. In line with this strategy, the Danish Government appointed the island of Samsoe towards the end of 1997 to be the first `official` Danish, renewable energy island. This is to serve as a demonstration project for other local communities, both in Denmark as well as in the rest Europe. Gothland, Madeira, Canary Islands, Cape Verde, Arki, Crete, Minorca and Orkney Islands were represented. Environmental advantages of wind, solar and wave power for distant island communities were indicated. Serious savings would be achieved by limitation of fossil fuel import and utilization of local resources. (EG)

  9. Reunion Island Volcano Erupts

    Science.gov (United States)

    2002-01-01

    On January 16, 2002, lava that had begun flowing on January 5 from the Piton de la Fournaise volcano on the French island of Reunion abruptly decreased, marking the end of the volcano's most recent eruption. These false color MODIS images of Reunion, located off the southeastern coast of Madagascar in the Indian Ocean, were captured on the last day of the eruption (top) and two days later (bottom). The volcano itself is located on the southeast side of the island and is dark brown compared to the surrounding green vegetation. Beneath clouds (light blue) and smoke, MODIS detected the hot lava pouring down the volcano's flanks into the Indian Ocean. The heat, detected by MODIS at 2.1 um, has been colored red in the January 16 image, and is absent from the lower image, taken two days later on January 18, suggesting the lava had cooled considerably even in that short time. Earthquake activity on the northeast flank continued even after the eruption had stopped, but by January 21 had dropped to a sufficiently low enough level that the 24-hour surveillance by the local observatory was suspended. Reunion is essentially all volcano, with the northwest portion of the island built on the remains of an extinct volcano, and the southeast half built on the basaltic shield of 8,630-foot Piton de la Fournaise. A basaltic shield volcano is one with a broad, gentle slope built by the eruption of fluid basalt lava. Basalt lava flows easily across the ground remaining hot and fluid for long distances, and so they often result in enormous, low-angle cones. The Piton de la Fournaise is one of Earth's most active volcanoes, erupting over 150 times in the last few hundred years, and it has been the subject of NASA research because of its likeness to the volcanoes of Mars. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  10. Weather In Some Islands

    Institute of Scientific and Technical Information of China (English)

    王良华

    2007-01-01

    There are four seasons in a year. When spring comes, the weather is mild(温和的). Summer comes after spring. Summer is the hottest season of the year. Autumn follows summer. It is the best season of the year. Winter is the coldest season of the year. Some islands(岛) have their own particular(特别的) seasons because their weather is very much affected(影响) by the oceans(海洋) around them. In Britain, winter is not very cold and summer is not very hot.

  11. Urban heat island

    Science.gov (United States)

    Kim, Hongsuk H.

    1991-01-01

    The phenomenon of urban heat island was investigated by the use of LANDSAT Thematic Mapper data sets collected over the metropolitan area of Washington DC (U.S.). By combining the retrieved spectral albedos and temperatures, urban modification on radiation budgets of five surface categories were analyzed. The surface radiation budget imagery of the area show that urban heating is attributable to a large heat flux from the rapidly heating surfaces of asphalt, bare soil and short grass. In summer, symptoms of diurnal heating begin to appear by mid morning and can be about 10 degrees warmer than nearby woodlands in summer.

  12. Organizations as Designed Islands

    Directory of Open Access Journals (Sweden)

    Pasquale Gagliardi

    2009-05-01

    Full Text Available The literature and practice of organizational design are mostly based on simplistic conceptions which ignore recent theoretical developments in organizational studies. Conceiving of organizations as ‘designed islands’, it is argued, can contribute to a more solid theoretical foundation to organization theory, viewed as normative science. Relying on the work of Peter Sloterdijk, who describes the forms of life in space in terms of spheres, the heuristic power of the island metaphor is explored. What can be learnt from the art of isolating in order to construct lived organizational environments is then discussed, and the paradoxical relationship between connection and isolation is highlighted.

  13. Mediterranean Islands: A Concept

    OpenAIRE

    Lopašić, A.

    2001-01-01

    This article represents some of the results of my fieldwork and research on the islands of Sardinia, Corsica, Malta, Sicily, Crete and Susak between the years 1962–1986. My main filed-work in Sardinia was supported by the Social Science Research Council, London and the University of Reading/Berks, and the ones in Corsica, Malta and Sardinia by the Department of Ethnology, University of Cologne (Institut für Völkerkunde, Universität Köln) forming a part of a project on the Medit...

  14. Sample Set (SE): SE20 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE20 Arabidopsis thaliana leaf metabolite analysis for a software test Investigatio...es that were investigated to optimize the parameters of PowerGet software for better metabolite annotation i

  15. Sample Set (SE): SE12 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE12 Effect of agricultural films for spinach leaf metabolites Investigation of Spi...nacia oleracea leaf metabolites. 2 cultivars (Nihon and Wasesaradaakari), 2 growth conditions (normal film and UV film

  16. Sample Set (SE): SE14 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE14 Effect of agricultural films for tomato fruit metabolites Investigation of Sol...anum lycopersicum fruit metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  17. Sample Set (SE): SE16 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE16 Effect of agricultural films for spinach leaf metabolites 2 Investigation of S...pinacia oleracea leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  18. Sample Set (SE): SE10 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE10 Effect of phosphorus nutrition for cabbage metabolites Investigation of Brassi...ca oleracea var. capitata Hatukoi leaf metabolites. 3 growth conditions (high, low and no phosphorus nutrition

  19. Sample Set (SE): SE37 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE37 Medicago truncatula shoot metabolite analysis using stable isotopes Metabolite...formed to estimate the elemental composition with high reliability using the number of stable isotopes incor

  20. Stroke and Native Hawaiians/Pacific Islanders

    Science.gov (United States)

    ... Population Profiles > Native Hawaiian/Other Pacific Islander > Stroke Stroke and Native Hawaiians/Pacific Islanders Native Hawaiians/Pacific ... non-Hispanic white adults to die from a stroke in 2010. In general, Native Hawaiian/Pacific Islander ...

  1. Asthma and Native Hawaiians/Pacific Islanders

    Science.gov (United States)

    ... Population Profiles > Native Hawaiian/Other Pacific Islander > Asthma Asthma and Native Hawaiians/Pacific Islanders Native Hawaiians/Pacific Islanders are 70 percent more likely to have asthma as non-Hispanic whites. National data for this ...

  2. Diffuse soil CO_2 degassing from Linosa island

    Directory of Open Access Journals (Sweden)

    Dario Cellura

    2014-06-01

    Full Text Available Normal 0 14 false false false MicrosoftInternetExplorer4 Normal 0 14 false false false IT X-NONE X-NONE MicrosoftInternetExplorer4 Herein, we present and discuss the result of 148 measurements of soil CO2 flux performed for the first time in Linosa island (Sicily Channel, Italy, a Plio-Pleistocene volcanic complex no longer active but still of interest owing to its location within a seismically active portion of the Sicily Channel rift system. The main purpose of this survey was to assess the occurrence of CO2 soil degassing, and compare flux estimations from this island with data of soil degassing from worldwide active volcanic as well as non-volcanic areas. To this aim soil CO2 fluxes were measured over a surface of about 4.2 km2 covering ~80% of the island. The soil CO2 degassing was observed to be mainly concentrated in the eastern part of the island likely due to volcano-tectonic lineaments, the presence of which is in good agreement with the known predominant regional faults system. Then, the collected data were interpreted using sequential Gaussian simulation that allowed estimating the total CO2 emissions of the island. Results show low levels of CO2 emissions from the soil of the island (~55 ton d-1 compared with CO2 emissions of currently active volcanic areas, such as Miyakejima (Japan and Vulcano (Italy. Results from this study suggest that soil degassing in Linosa is mainly fed by superficial organic activity with a moderate contribution of a deep CO2 likely driven by NW-SE trending active tectonic structures in the eastern part of the island.

  3. Enjebi Island dose assessment

    International Nuclear Information System (INIS)

    We have updeated the radiological dose assessment for Enjebi Island at Enewetak Atoll using data derived from analysis of food crops grown on Enjebi. This is a much more precise assessment of potential doses to people resettling Enjebi Island than the 1980 assessment in which there were no data available from food crops on Enjebi. Details of the methods and data used to evaluate each exposure pathway are presented. The terrestrial food chain is the most significant potential exposure pathway and 137Cs is the radionuclide responsible for most of the estimated dose over the next 50 y. The doses are calculated assuming a resettlement date of 1990. The average wholebody maximum annual estimated dose equivalent derived using our diet model is 166 mremy;the effective dose equivalent is 169 mremy. The estimated 30-, 50-, and 70-y integral whole-body dose equivalents are 3.5 rem, 5.1 rem, and 6.2 rem, respectively. Bone-marrow dose equivalents are only slightly higher than the whole-body estimates in each case. The bone-surface cells (endosteal cells) receive the highest dose, but they are a less sensitive cell population and are less sensitive to fatal cancer induction than whole body and bone marrow. The effective dose equivalents for 30, 50, and 70 y are 3.6 rem, 5.3 rem, and 6.6 rem, respectively. 79 refs., 17 figs., 24 tabs

  4. An Island Called Cuba

    Directory of Open Access Journals (Sweden)

    Jean Stubbs

    2011-06-01

    Full Text Available Review of: An Island Called Home: Returning to Jewish Cuba. Ruth Behar, photographs by Humberto Mayol. New Brunswick NJ: Rutgers University Press, 2007. xiii + 297 pp. (Cloth US$ 29.95 Fidel Castro: My Life: A Spoken Autobiography. Fidel Castro & Ignacio Ramonet. New York: Scribner/Simon & Schuster, 2008. vii + 724 pp. (Paper US$ 22.00, e-book US$ 14.99 Cuba: What Everyone Needs to Know. Julia E. Sweig. New York: Oxford University Press, 2009. xiv + 279 pp. (Paper US$ 16.95 [First paragraph] These three ostensibly very different books tell a compelling story of each author’s approach, as much as the subject matter itself. Fidel Castro: My Life: A Spoken Autobiography is based on a series of long interviews granted by the then-president of Cuba, Fidel Castro, to Spanish-Franco journalist Ignacio Ramonet. Cuba: What Everyone Needs to Know, by U.S. political analyst Julia Sweig, is one of a set country series, and, like Ramonet’s, presented in question/answer format. An Island Called Home: Returning to Jewish Cuba, with a narrative by Cuban-American anthropologist Ruth Behar and photographs by Cuban photographer Humberto Mayol, is a retrospective/introspective account of the Jewish presence in Cuba. While from Ramonet and Sweig we learn much about the revolutionary project, Behar and Mayol convey the lived experience of the small Jewish community against that backdrop.

  5. Opportunity at 'Cook Islands'

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,825th Martian day, or sol, of Opportunity's surface mission (March 12, 2009). North is at the top. The rover had driven half a meter (1.5 feet) earlier on Sol 1825 to fine-tune its location for placing its robotic arm onto an exposed patch of outcrop including a target area informally called 'Cook Islands.' On the preceding sol, Opportunity turned around to drive frontwards and then drove 4.5 meters (15 feet) toward this outcrop. The tracks from the SOl 1824 drive are visible near the center of this view at about the 11 o'clock position. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Opportunity had previously been driving backward as a strategy to redistribute lubrication in a wheel drawing more electrical current than usual. The outcrop exposure that includes 'Cook Islands' is visible just below the center of the image. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock. This view is presented as a cylindrical projection with geometric seam correction.

  6. Non-native vascular plants from Canary Islands (Spain): nomenclatural and taxonomical adjustments

    OpenAIRE

    VERLOOVE, F

    2013-01-01

    Se propone correcciones taxonómicas y nomenclaturales respecto a 88 taxones no nativos de la lista de plantas vasculares de las Islas Canarias (España). Non-native vascular plants from Canary Islands (Spain): nomenclatural and taxonomical adjustments. Corrections and other adjustments are proposed for 88 non-native taxa from the checklist of vascular plants from the Canary Islands (Spain).

  7. The Museum of Piano Island

    Institute of Scientific and Technical Information of China (English)

    LURUCAI

    2004-01-01

    GULANGYU, the island of pianos in southeast Xiamen, has more than 500 pianos. In the island's Shuzhuang Garden is the Gulangyu Piano Museum.Spread out over 2,000 square meters of land, the museum has on exhibit more than 70 pianos from the UK, France, Germany and Austria.

  8. Islands for nuclear power stations

    International Nuclear Information System (INIS)

    The safety principles, design criteria and types of artificial island for an offshore nuclear power station are discussed with particular reference to siting adjacent to an industrial island. The paper concludes that the engineering problems are soluble and that offshore nuclear power stations will eventually be built but that much fundamental work is still required. (author)

  9. Solomon Islands : Health Financing Options

    OpenAIRE

    Somanathan, Aparnaa

    2010-01-01

    The objective of this Policy Note is to provide an assessment of available options for financing health care in the Solomon Islands. In doing so, the analysis will factor in the country-specific economic, social and political factors, which will ultimately influence the performance of the health financing mechanisms. The Note was motivated by the Solomon Islands Government s (SIG) interest...

  10. Señas Mexicano

    Directory of Open Access Journals (Sweden)

    Juan F. García Mejía

    2007-01-01

    Full Text Available En este artículo se muestra un sistema que permite el estudio y práctica del Lenguaje de Señas Mexicano (LMS, el cual es el método de comunicación de las personas que padecen un trastorno de procesamiento auditivo. El sistema propuesto en este artículo consta de un guante de tela instrumentado con sensores de flexión, una etapa de acondicionamiento de señales y una tarjeta de adquisición de datos; que en su conjunto constituyen el Hardware. El software esta formado por un programa de adquisición de datos y una interfaz de usuario, ambos codificados en Visual Basic Net. El sistema propuesto se modela por medio del lenguaje de modelado unificado (UML, ya que Visual Basic es un lenguaje orientado a eventos.

  11. Islanded operation of distributed networks

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This report summarises the findings of a study to investigate the regulatory, commercial and technical risks and benefits associated with the operation of distributed generation to power an islanded section of distributed network. A review of published literature was carried out, and UK generators were identified who could operate as part of an island network under the existing technical, regulatory, and safety framework. Agreement on case studies for consideration with distributed network operators (DNOs) is discussed as well as the quantification of the risks, benefits and costs of islanding, and the production of a case implementation plan for each case study. Technical issues associated with operating sections of network in islanded mode are described, and impacts of islanding on trading and settlement, and technical and commercial modelling are explored.

  12. Islanded operation of distributed networks

    International Nuclear Information System (INIS)

    This report summarises the findings of a study to investigate the regulatory, commercial and technical risks and benefits associated with the operation of distributed generation to power an islanded section of distributed network. A review of published literature was carried out, and UK generators were identified who could operate as part of an island network under the existing technical, regulatory, and safety framework. Agreement on case studies for consideration with distributed network operators (DNOs) is discussed as well as the quantification of the risks, benefits and costs of islanding, and the production of a case implementation plan for each case study. Technical issues associated with operating sections of network in islanded mode are described, and impacts of islanding on trading and settlement, and technical and commercial modelling are explored

  13. THE STRENGTH OF THE DISSOLVED OXYGEN MAXIMUM IN THE VERTICAL DISTRIBUTION OF N ANSHA ISLANDS WATERS

    Institute of Scientific and Technical Information of China (English)

    林洪瑛; 程赛伟; 韩舞鹰

    2002-01-01

    Observation data from a cruise in the Nansha Islands, in May to June 1990, Decem ber, 1993, September to October 1994, and July, 1999, respectively, were used to develop the method presented here to indicate the existing strength of the diss ol ved oxygen maximum in the vertical distribution of Nansha Islands waters. Its se asonal variation and regional distribution are discussed in this paper. Analysis results showed that the distribution of the strength of dissolved oxygen maximum (Domax-Dosur) was closely related to the upper layer circulation and the bioactivity of Nansha Islands seawater.

  14. 75 FR 51098 - Protection Island and San Juan Islands National Wildlife Refuges, Jefferson, Island, San Juan...

    Science.gov (United States)

    2010-08-18

    ... Register on August 14, 2007 (72 FR 45444), announcing our intent to complete a CCP/EA and inviting public... natural processes to occur with minimal human intervention; monitoring wildlife species; and working with... Fish and Wildlife Service Protection Island and San Juan Islands National Wildlife Refuges,...

  15. Energy Self-Sufficient Island

    International Nuclear Information System (INIS)

    In order to analyze energy self-sufficient island, example of a smaller island, connected to the power system of a bigger island with an undersea cable, was taken. Mounting substation 10/0,4 is situated on the island and for the moment it provides enough electricity using the medium voltage line. It is assumed that the island is situated on the north part of the Adriatic Sea. The most important problem that occurs on the island is the population drop that occurs for a significant number of years, therefore, life standard needs to be improved, and economic development needs to be encouraged immediately. Local authorities to stimulate sustainable development on the island through different projects, to breath in a new life to the island, open new jobs and attract new people to come live there. Because of the planned development and increase of the population, energy projects, planned as a support to sustainable development, and later achievement of the energy self-sufficiency, is described in this paper. Therefore, Rewisland methodology appliance is described taking into the account three possible scenarios of energy development. Each scenario is calculated until year 2030. Also, what is taken into the account is 100% usage of renewable sources of energy in 2030. Scenario PTV, PP, EE - This scenario includes installation of solar photovoltaic modules and solar thermal collectors on the buildings roofs, as well as well as implementation of energy efficiency on the island (replacement of the street light bulbs with LED lightning, replacement of the old windows and doors on the houses, as well as the installation of the thermal insulation). Scenario PV island - This scenario, similarly to the previous one, includes installation of solar photovoltaic modules and solar thermal collectors an the residential buildings, as well as the 2 MW photovoltaic power plant and ''Green Hotel'', a building that satisfies all of its energy needs completely from renewable energy sources

  16. Marte Valles Crater 'Island'

    Science.gov (United States)

    2004-01-01

    10 April 2004 Marte Valles is an outflow channel system that straddles 180oW longitude between the region south of Cerberus and far northwestern Amazonis. The floor of the Marte valleys have enigmatic platy flow features that some argue are formed by lava, others suggest they are remnants of mud flows. This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows an island created in the middle of the main Marte Valles channel as fluid---whether lava or mud---flowed past two older meteor impact craters. The craters are located near 21.5oN, 175.3oW. The image covers an area about 3 km (1.9 mi) across. Sunlight illuminates the scene from the lower left.

  17. PWR: nuclear islands

    International Nuclear Information System (INIS)

    Framatome and its partners have produced this glossary of technical terms that can be used in writing English language documents relating to power plants (nuclear islands, individual components, nuclear services, etc.) with the hope of improving the quality of the documents intended for their clients, suppliers and partners and for others. This glossary will be particularly useful to the translators and authors of technical proposals, design documents, manufacturing documents, construction and operating documents concerning Pressurized Water Reactors written in English or French. It can also be useful as a reference document for students, researchers, journalists, etc., having to write on this subject. We would like to thank all those individuals working at the Ministere de la Recherche et de la Technologie, Electricite de France, Jeumont Schneider and Framatome who have contributed to this glossary. We would also appreciate any comments or sugestions intended to improve subsequent editions of this glossary

  18. Man made floating island

    Energy Technology Data Exchange (ETDEWEB)

    Martinak, B.

    1987-08-04

    An artificial island is described for use in energy production from ocean waves, comprising: a platform disposed atop the ocean surface; vertically disposed rigid posts extending beneath the platform short of the ocean floor; a stationary wave amplifier affixed to the posts, the wave amplifier of a conical shape with inclined sides for directing water upwardly from substantially any lateral direction when submerged to amplify wave action; a movable inverted conical float slidably mounted for translation movement along the posts and disposed between the platform and the wave amplifier for movement with the waves; an apex of the conical float directed substantially toward an apex of the conical wave amplifier; and an energy-drive device disposed on the platform. A means is provided for converting the motion of the float to transmittable energy for operating the energy-driven device.

  19. Islands in the ice

    DEFF Research Database (Denmark)

    Jørgensen, Tina; Kjær, Kurt H.; Haile, James Seymour;

    2012-01-01

    Nunataks are isolated bedrocks protruding through ice sheets. They vary in age, but represent island environments in 'oceans' of ice through which organism dispersals and replacements can be studied over time. The J.A.D. Jensen's Nunataks at the southern Greenland ice sheet are the most isolated...... nunataks on the northern hemisphere - some 30 km from the nearest biological source. They constitute around 2 km(2) of ice-free land that was established in the early Holocene. We have investigated the changes in plant composition at these nunataks using both the results of surveys of the flora over the...... where the botanical survey was exhaustive. As no animals and humans are found on the nunataks, this change in diversity over a period of just 42 years must relate to environmental changes probably being climate-driven. This suggests that even the flora of fairly small and isolated ice-free areas reacts...

  20. PIPS: pathogenicity island prediction software.

    Directory of Open Access Journals (Sweden)

    Siomar C Soares

    Full Text Available The adaptability of pathogenic bacteria to hosts is influenced by the genomic plasticity of the bacteria, which can be increased by such mechanisms as horizontal gene transfer. Pathogenicity islands play a major role in this type of gene transfer because they are large, horizontally acquired regions that harbor clusters of virulence genes that mediate the adhesion, colonization, invasion, immune system evasion, and toxigenic properties of the acceptor organism. Currently, pathogenicity islands are mainly identified in silico based on various characteristic features: (1 deviations in codon usage, G+C content or dinucleotide frequency and (2 insertion sequences and/or tRNA genetic flanking regions together with transposase coding genes. Several computational techniques for identifying pathogenicity islands exist. However, most of these techniques are only directed at the detection of horizontally transferred genes and/or the absence of certain genomic regions of the pathogenic bacterium in closely related non-pathogenic species. Here, we present a novel software suite designed for the prediction of pathogenicity islands (pathogenicity island prediction software, or PIPS. In contrast to other existing tools, our approach is capable of utilizing multiple features for pathogenicity island detection in an integrative manner. We show that PIPS provides better accuracy than other available software packages. As an example, we used PIPS to study the veterinary pathogen Corynebacterium pseudotuberculosis, in which we identified seven putative pathogenicity islands.

  1. Sample Set (SE): SE27 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE27 Effect of agricultural films for cabbage leaf metabolites Investigation of Bra...ssica oleracea var. capitata YR Tenkuu leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural... film or no agricultural film), 3 replicates data are examined. Takeshi Ara 1, Naoki Yamamoto 1,

  2. Sample Set (SE): SE58 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE58 Exploring matrix effects and quantification performance in metabolomics experiments using artificial...ificial biological gradients is a general and inexpensive tool for calibration that... the peaks but also highlights cases with strong background-dependent signal interference. Analysis of art

  3. Sample Set (SE): SE56 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE56 MS/MS spectral tag-based annotation of non-targeted profile of plant secondary...sis, resulting in clarification of the functions of reported genes involved in glycosylation of flavonoids. Thus, non-target

  4. Significados y funciones del "se"

    Directory of Open Access Journals (Sweden)

    Lidia Contreras

    2004-06-01

    Full Text Available En este artículo la autora se limita a comentar críticamente lo que la Real Academia Española de la Lengua (cit. Ac. dice en su "Gramática de la lengua española" de 1931 (Madrid, Espasa-Calpe, S. A. con respecto a los diversos tipos de "se" que ella toma en cuenta, comentario que pretende mostrar una mayor diversificación que la establecida en la mencionada obra. (In this article, its author offers a critical commentary of the position taken by The Spanish Royal Academy of Language (RAE in Gramática de la lengua española (1931 on the subject of "Uses of 'se'". The author intends to show a greater variety of uses than those proposed by RAE.

  5. Island Bay Wilderness study area : Island Bay National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is a brief report on a wilderness study area located in the Island Bay National Wildlife Refuge. It discusses the history of the study area, its...

  6. IslandViewer update: improved genomic island discovery and visualization

    OpenAIRE

    Dhillon, Bhavjinder K.; Chiu, Terry A.; Laird, Matthew R.; Langille, Morgan G I; Brinkman, Fiona S. L.

    2013-01-01

    IslandViewer (http://pathogenomics.sfu.ca/islandviewer) is a web-accessible application for the computational prediction and analysis of genomic islands (GIs) in bacterial and archaeal genomes. GIs are clusters of genes of probable horizontal origin and are of high interest because they disproportionately encode virulence factors and other adaptations of medical, environmental and industrial interest. Many computational tools exist for the prediction of GIs, but three of the most accurate met...

  7. Ud at se med Erasmus

    DEFF Research Database (Denmark)

    Frandsen, Pernille

    2009-01-01

    Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus.......Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus....

  8. 27 CFR 9.170 - Long Island.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Long Island. 9.170 Section... Island. (a) Name. The name of the viticultural area described in this section is “Long Island.” (b) Approved maps. The appropriate maps for determining the boundary of the Long Island viticultural area...

  9. 21 CFR 808.89 - Rhode Island.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Rhode Island. 808.89 Section 808.89 Food and Drugs... and Local Exemptions § 808.89 Rhode Island. The following Rhode Island medical device requirements are... from preemption under section 521(b) of the act: Rhode Island General Laws, Section 5-49-2.1,...

  10. 46 CFR 7.80 - Tybee Island, GA to St. Simons Island, GA.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Tybee Island, GA to St. Simons Island, GA. 7.80 Section... BOUNDARY LINES Atlantic Coast § 7.80 Tybee Island, GA to St. Simons Island, GA. (a) A line drawn from the southernmost extremity of Savannah Beach on Tybee Island 255° true across Tybee Inlet to the shore of...

  11. Guest editorial introduction: Understanding island cities

    Directory of Open Access Journals (Sweden)

    Adam Grydehoj

    2014-11-01

    Full Text Available Island studies research has traditionally focused on relatively rural, peripheral, and isolated communities, yet island cities (strongly urbanized small islands or archipelagos or major population centres of large islands or archipelagos also represent an important research area. Island spatiality has a host of historical and continuing effects on urban development, influencing urban densification and agglomeration, zonal differentiation, and neighbourhood formation in cities both big and small. This special section of Island Studies Journal includes papers on the island cities and urban archipelagos of Peel (Isle of Man, British Isles, Nuuk (Greenland, Palma de Majorca (Spain, Belize City (Belize, and Mumbai (India. The Island Cities and Urban Archipelagos research network seeks to help enrich wider island studies scholarship and contribute to introducing the island dimension to urban studies.

  12. Introduction to the "SE Field"

    OpenAIRE

    Defourny, Jacques

    2014-01-01

    The "SE Field" stands here for the main concepts defining the research areas of the EMES European Research Network since its creation in an informal (1996-2001) and then formal way (2002): Social Enterprise, Social Entrepreneurship, Social Economy and Solidarity Economy

  13. Hawaiian Islands Wilderness proposal announcement

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is a letter from the Bureau of Sport Fisheries and Wildlife stating that documents pertaining to the Hawaiian Islands Wilderness proposal have been...

  14. ROE Long Island Hypoxia Data

    Data.gov (United States)

    U.S. Environmental Protection Agency — This raster map uses five color-coded categories to show concentrations of dissolved oxygen in bottom waters of Long Island Sound during the summer of 2014. Data...

  15. Ship impact against protection islands

    DEFF Research Database (Denmark)

    Pedersen, Preben Terndrup

    1997-01-01

    The five most exposed piers and the anchor blocks on the East Bridge shall be protected by aritificial islands. Extensive analytical and experimental investitations were carried out to verify the efficiency of how these protection works....

  16. Papahanaumokuakea - Laysan Island Restoration 2009

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This project will support restoration activities at Laysan Island. Staff and volunteers continue efforts to eradicate alien invasive species such as Indian dropseed...

  17. Papahanaumokuakea - Laysan Island Restoration 2011

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This project supports restoration activities at Laysan Island. Staff and volunteers continue efforts to eradicate alien invasive species such as Indian dropseed...

  18. Popham Buys St. Vincent Island

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — An announcement has recently been made that William Lee Popham has purchased an option on Saint Vincent Island including all of the water bottoms legally belonging...

  19. Hawaiian Islands Wilderness proposal : Synopsis

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is a synopsis of the Hawaiian Islands Wilderness proposal. It covers information such as the location of the proposed area, management the wilderness...

  20. Three Mile Island Accident Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Three Mile Island Accident Data consists of mostly upper air and wind observations immediately following the nuclear meltdown occurring on March 28, 1979, near...

  1. Papahanaumokuakea - Laysan Island Restoration 2010

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Goal of the Laysan Island Restoration is to restore Laysan to a "Pristine" state which would require minimal monitoring and habitat for Endemic Endangered...

  2. Investigation of the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems

    Energy Technology Data Exchange (ETDEWEB)

    Marchuk, O.V. [Department of Physical and Colloidal Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Shemet, V.Ya. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)

    2006-06-08

    Phase diagram of the Cu{sub 2}Se-PbSe system was constructed using differential-thermal analysis, X-ray diffraction and metallography. The eutectic reaction L-bar {beta}-Cu{sub 2}Se+PbSe takes place at 886K and corresponds to 46mol% PbSe. The peritectoid reaction {beta}-Cu{sub 2}Se+PbSe-bar {alpha}-Cu{sub 2}Se takes place at 420K. The formation of the PrCuSe{sub 2} compound (LaCuS{sub 2} structure type, space group P2{sub 1}/c) and the solid solution range Pr{sub 2}Se{sub 3}-Pr{sub 2}PbSe{sub 4} (Th{sub 3}P{sub 4} structure type, space group I4-bar 3d, a=0.89916(2)nm, R{sub I}=0.0682 for Pr{sub 2}PbSe{sub 4}) was confirmed using X-ray powder diffraction. The interactions between the components in the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems at 870K were determined using X-ray powder diffraction. No quaternary compounds exist in these systems.

  3. Solomon Islands national situation analysis

    OpenAIRE

    Govan, H.; Schwarz, A.M.; Harohau, D.; Oeta, J.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (CRP AAS) was approved by the CGIAR Fund Council in July, 2011. Solomon Islands, one of five countries targeted by the program, began its rollout with a five month planning phase between August and December of 2011. Subsequent steps of the Program rollout include scoping, diagnosis and design. This report is the first to be produced during the scoping phase in Solomon Islands; it addresses the national setting and provides basic infor...

  4. Invasive rodent eradication on islands.

    Science.gov (United States)

    Howald, Gregg; Donlan, C Josh; Galván, Juan Pablo; Russell, James C; Parkes, John; Samaniego, Araceli; Wang, Yiwei; Veitch, Dick; Genovesi, Piero; Pascal, Michel; Saunders, Alan; Tershy, Bernie

    2007-10-01

    Invasive mammals are the greatest threat to island biodiversity and invasive rodents are likely responsible for the greatest number of extinctions and ecosystem changes. Techniques for eradicating rodents from islands were developed over 2 decades ago. Since that time there has been a significant development and application of this conservation tool. We reviewed the literature on invasive rodent eradications to assess its current state and identify actions to make it more effective. Worldwide, 332 successful rodent eradications have been undertaken; we identified 35 failed eradications and 20 campaigns of unknown result. Invasive rodents have been eradicated from 284 islands (47,628 ha). With the exception of two small islands, rodenticides were used in all eradication campaigns. Brodifacoum was used in 71% of campaigns and 91% of the total area treated. The most frequent rodenticide distribution methods (from most to least) are bait stations, hand broadcasting, and aerial broadcasting. Nevertheless, campaigns using aerial broadcast made up 76% of the total area treated. Mortality of native vertebrates due to nontarget poisoning has been documented, but affected species quickly recover to pre-eradication population levels or higher. A variety of methods have been developed to mitigate nontarget impacts, and applied research can further aid in minimizing impacts. Land managers should routinely remove invasive rodents from islands <100 ha that lack vertebrates susceptible to nontarget poisoning. For larger islands and those that require nontarget mitigation, expert consultation and greater planning effort are needed. With the exception of house mice (Mus musculus), island size may no longer be the limiting factor for rodent eradications; rather, social acceptance and funding may be the main challenges. To be successful, large-scale rodent campaigns should be integrated with programs to improve the livelihoods of residents, island biosecurity, and reinvasion response

  5. Three Mile Island

    International Nuclear Information System (INIS)

    The Three Mile Island accident taught a lesson to the industry. Packaged units, ancillary units, off-plots and so on need as much detailed attention as the main stream, especially when their failure can cause a shut-down of the main stream. To try to clear the choke, the operators used instrument air. Its pressure was lower than that of the water so water got back into the instrument air lines. There was a non-return valve in the line but it was faulty. How often have the authors connected process equipment to service lines at a lower pressure and ended up with flammable gas in the nitrogen lines or oil in the compressed air lines? The actual pressures in services lines are often lower than the nominal pressures. Instrument air should never be used for line blowing. The water in the instrument air lines caused several instrument failures and the turbine tripped. This stopped heat removal from the radioactive core. The production of heat by fission stopped automatically within a few minutes. (Silver rods drop down into the core. They absorb neutrons and stop radioactive fission.) However the heat produced by radioactive decay (about 6 percent of the normal load) had to be removed. This caused the primary water to boil. The pilot-operated relief valve (PORV) on the primary circuit lifted and pumps started up automatically to replace the water evaporated from the primary circuit. (Unfortunately the PORV stuck open)

  6. Radiometric evidence for involvement of floating islands in the formation of Florida Everglades tree islands

    Science.gov (United States)

    Gleason, Patrick J.; Piepgras, Donald; Stone, Peter A.; Stipp, Jerry

    1980-04-01

    Inversions of radiocarbon dates were determined on samples from the peat profiles of two small extant tree islands in the northeastern Everglades, Florida. These reversals were predicted from the theory that such tree islands developed on laterally displaced floating islands.

  7. WATER TEMPERATURE and DEPTH - SENSOR collected from OSCAR ELTON SETTE in main Hawaiian Islands from 2008-07-11 to 2008-07-29 (NCEI Accession 0155892)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID SE 08-06). XBT casts...

  8. WATER TEMPERATURE, DISSOLVED OXYGEN, and others collected from OSCAR ELTON SETTE in main Hawaiian Islands from 2008-07-11 to 2008-07-29 (NCEI Accession 0155891)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — CTD data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID: SE 08-06). CTD casts...

  9. Aleutian Canada goose transplant from Buldir Island to Agattu Island, Aleutian Islands, Alaska, summer 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Geese were captured on Buldir Island by searching the upper and lower edge of the lowland tall plant association where tall plants offer cover and short plants...

  10. ¿Se desindustrializa Brasil?

    Directory of Open Access Journals (Sweden)

    Fernando Mattos

    2014-01-01

    Full Text Available Este estudio pretende retomar algunos temas específicos del debate sobre la desindustrialización en Brasil, así como también, apunta a recordar algunos aspectos del debate teórico-histórico sobre la desindustrialización, presente en la literatura sobre desarrollo económico. En la primera parte, se destacan algunos elementos del referido debate presentes en la literatura especializada, discutiendo aspectos teóricos de la formulación kaldoriana que destacan el papel del crecimiento industrial y de la mudanza estructural en el crecimiento de las economías capitalistas. En la segunda, son organizados y analizados algunos indicadores recientes del desempeño del sector industrial brasileño. Finalmente, se ofrecen algunas breves notas conclusivas.

  11. Bryophytes from Simeonof Island in the Shumagin Islands, southwestern Alaska

    Science.gov (United States)

    Schofield, W.B.; Talbot, S. S.; Talbot, S.L.

    2004-01-01

    Simeonof Island is located south of the Alaska Peninsula in the hyperoceanic sector of the middle boreal subzone. We examined the bryoflora of Simeonof Island to determine species composition in an area where no previous collections had been reported. This field study was conducted in sites selected to represent the spectrum of environmental variation within Simeonof Island. Data were analyzed using published reports to compare bryophyte distribution patterns at three levels, the Northern Hemisphere, North America, and Alaska. A total of 271 bryophytes were identified: 202 mosses and 69 liverworts. The annotated list of species for Simeonof Island expands the known range for many species and fills distribution gaps within Hulte??n's Western Pacific Coast district. Maps and notes on the distribution of 14 significant distribution records are presented. Compared with bryophyte distribution in the Northern Hemisphere, the bryoflora of Simeonof Island primarily includes taxa of boreal (55%), temperate (20%), arctic (10%), and cosmopolitan (8%) distribution; 6% of the moss flora are western North America endemics. A description of the bryophytes present in the vegetation and habitat types is provided as is a quantitative analysis of the most frequently occurring bryophytes in crowberry heath.

  12. PALEOBATHYMETRIC INTERPRETATION OF THE FISH OTOLITHS FROM THE LOWER - MIDDLE QUATERNARY DEPOSITS OF KEPHALLONIA AND ZAKYNTHOS ISLANDS (IONIAN SEA, WESTERN GREECE)

    OpenAIRE

    KONSTANTINA AGIADI; MARIA TRIANTAPHYLLOU; ANGELA GIRONE; VASSILIS KARAKITSIOS; MICHAEL DERMITZAKIS

    2010-01-01

    Fish otoliths are herein used to estimate the depositional depth of the Early - Middle Pleistocene deposits at SE Zakynthos and SW Kephallonia Islands (Ionian Sea, Western Greece), through comparison with the modern bathymetric distributions of the identified fish taxa. These estimates provide a more detailed picture of the depth variations for the Gelasian - Ionian stage interval in the study areas. The Lower Pleistocene marine deposits of the Gerakas Formation (SE Zakynthos Island, Ionian S...

  13. Terrestrial bird population trends on Aguiguan (Goat Island), Mariana Islands

    Science.gov (United States)

    Amidon, Fred; Camp, Richard J.; Marshall, Ann P.; Pratt, Thane K.; Williams, Laura; Radley, Paul; Cruz, Justine B.

    2014-01-01

    The island of Aguiguan is part of the Mariana archipelago and currently supports populations of four endemic species, including one endemic genus, Cleptornis. Bird population trends since 1982 were recently assessed on the neighbouring islands of Saipan, Tinian, and Rota indicating declines in some native species. Point-transect surveys were conducted in 2008 by the U.S. Fish and Wildlife Service to assess population densities and trends on Aguiguan. Densities for six of the nine native birds—White-throated Ground-dove Gallicolumba xanthonura, Collared Kingfisher Todiramphus chloris, Rufous Fantail Rhipidura rufifrons, Golden White-eye Cleptornis marchei, Bridled White-eye Zosterops conspicillatus and Micronesian Starling Aplonis opaca—and the non-native bird—Island Collared-dove Streptopelia bitorquata—were significantly greater in 2008 than in 1982. No differences in densities were detected among the surveys for Mariana Fruit-dove Ptilinopus roseicapilla, and Micronesian MyzomelaMyzomela rubratra. Three federally and locally listed endangered birds—Nightingale Reed-warbler Acrocephalus luscinius, Mariana Swiftlet Collocalia bartschi, and Micronesian Megapode Megapodius laperous)—were either not detected during the point-transect counts, the surveys were not appropriate for the species, or the numbers of birds detected were too small to estimate densities. The factors behind the increasing trends for some species are unknown but may be related to increased forest cover on the island since 1982. With declining trends for some native species on neighbouring islands, the increasing and stable trends on Aguiguan is good news for forest bird populations in the region, as Aguiguan populations can help support conservation efforts on other islands in the archipelago.

  14. 16ch high-resolution seismic reflection surveys on the active fault of upper fore-arc slope off Okinawa Island, central Ryukyu Island Arc, Southwest Japan

    Science.gov (United States)

    Arai, K.; Inoue, T.; Sato, T.; Tuzino, T.

    2010-12-01

    The Ryukyu Island Arc extends from Kyushu to Taiwan, a distance of 1,200 km, along the Ryukyu Trench where the Philippine Sea Plate is subducting beneath the Eurasian Plate. The Okinawa Trough, a back arc basin has formed behind the Ryukyu Island Arc in late Pliocene to early Pleistocene. The research cruises of GH08 (from 28th July to 29th August 2008) and GH09 (from 16th July to 17th August 2009) were carried out around Okinawa Island, which is located on the central Ryukyu Island Arc. More than 4,500 miles multi channel high-resolution seismic profiles were acquired during these two cruises by the GI-gun (355cu. inch) or the Cluster-gun (30+30 cu. inch) systems with 16ch digital streamer cable. Survey area in the southeast off Okinawa Island is located on the upper fore-arc slope. Seismic reflections of the upper fore-arc slope show a distinct reflector which may represent erosional unconformable surface. The distinct reflector had tilted southeastward and was overlain by the stratified sediments. No obvious deformation such as the fold and faults parallel to the Ryukyu Trench axis was found under the upper slope. In contrast, some active faults which were perpendicular to the Ryukyu Trench axis (NW-SE direction) were observed. The most conspicuous normal fault was found on north off Okinawa Island. The fault with 70-80°dipping toward northeast has been active since the early Pleistocene inferred from seismic stratigraphy and calcareous nannofossil biochronology. The maximum displacement reaches to 0.7 s two way travel time in depth. An average of maximum vertical displace component of the normal fault may reach up to ten cm/1000 years. Seismic profiles indicate that the tilting of Ryukyu Island Arc forward to the Ryukyu Trench plays the important role of formation of the fault in a NW-SE direction.

  15. Bird and mammal abundance at Nizki Island with notes on observations at Alaid Island, Aleutian Islands, Alaska, spring 1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — To document migratory bird use and response following elimination of introduced Arctic foxes from an island in the western Aleutian Islands. Fox elimination from an...

  16. Aleutian Canada goose survey at Alaid and Nizki Islands, Near Island Group, Aleutian Islands, Alaska, spring 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Arctic foxes, introduced to Alaid and Nizki islands in 1911, 1920 and 1935, were removed from the two islands in 1975 and 1976 by means of shooting and trapping...

  17. Protection Island and San Juan Islands National Wildlife Refuges: Comprehensive Conservation Plan and San Juan Islands Wilderness Stewardship Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Protection Island and San Juan Islands NWRs for the next 15 years. This plan outlines...

  18. Como se formam as dunas?

    OpenAIRE

    Gonçalves, Adorinda; Velho, António; Pires, Delmina; Rodrigues, Maria José; Mafra, Paulo

    2006-01-01

    O ensino experimental das ciências, em particular no 1º Ciclo do Ensino Básico, tem sido objecto de estudo de vários investigadores nas últimas décadas. Encontram-se vários indicadores que apontam que este tipo de ensino promove o desenvolvimento de competências muito importantes para o desenvolvimento integral da criança no sentido de uma maior autonomia e capacidade reflexiva, aspecto potenciado pelo espírito criativo e de descoberta que encontramos nestas idades. O 1º Ciclo do Ensino Básic...

  19. Late Quaternary climate change shapes island biodiversity.

    Science.gov (United States)

    Weigelt, Patrick; Steinbauer, Manuel Jonas; Cabral, Juliano Sarmento; Kreft, Holger

    2016-04-01

    Island biogeographical models consider islands either as geologically static with biodiversity resulting from ecologically neutral immigration-extinction dynamics, or as geologically dynamic with biodiversity resulting from immigration-speciation-extinction dynamics influenced by changes in island characteristics over millions of years. Present climate and spatial arrangement of islands, however, are rather exceptional compared to most of the Late Quaternary, which is characterized by recurrent cooler and drier glacial periods. These climatic oscillations over short geological timescales strongly affected sea levels and caused massive changes in island area, isolation and connectivity, orders of magnitude faster than the geological processes of island formation, subsidence and erosion considered in island theory. Consequences of these oscillations for present biodiversity remain unassessed. Here we analyse the effects of present and Last Glacial Maximum (LGM) island area, isolation, elevation and climate on key components of angiosperm diversity on islands worldwide. We find that post-LGM changes in island characteristics, especially in area, have left a strong imprint on present diversity of endemic species. Specifically, the number and proportion of endemic species today is significantly higher on islands that were larger during the LGM. Native species richness, in turn, is mostly determined by present island characteristics. We conclude that an appreciation of Late Quaternary environmental change is essential to understand patterns of island endemism and its underlying evolutionary dynamics. PMID:27027291

  20. Thermal island destabilization and the Greenwald limit

    Energy Technology Data Exchange (ETDEWEB)

    White, R. B.; Gates, D. A.; Brennan, D. P. [Plasma Physics Laboratory, Princeton University, P.O.Box 451, Princeton, New Jersey 08543 (United States)

    2015-02-15

    Magnetic reconnection is ubiquitous in the magnetosphere, the solar corona, and in toroidal fusion research discharges. In a fusion device, a magnetic island saturates at a width which produces a minimum in the magnetic energy of the configuration. At saturation, the modified current density profile, a function of the flux in the island, is essentially flat, the growth rate proportional to the difference in the current at the O-point and the X-point. Further modification of the current density profile in the island interior causes a change in the island stability and additional growth or contraction of the saturated island. Because field lines in an island are isolated from the outside plasma, an island can heat or cool preferentially depending on the balance of Ohmic heating and radiation loss in the interior, changing the resistivity and hence the current in the island. A simple model of island destabilization due to radiation cooling of the island is constructed, and the effect of modification of the current within an island is calculated. An additional destabilization effect is described, and it is shown that a small imbalance of heating can lead to exponential growth of the island. A destabilized magnetic island near the plasma edge can lead to plasma loss, and because the radiation is proportional to plasma density and charge, this effect can cause an impurity dependent density limit.

  1. Thermal island destabilization and the Greenwald limit

    Science.gov (United States)

    White, R. B.; Gates, D. A.; Brennan, D. P.

    2015-02-01

    Magnetic reconnection is ubiquitous in the magnetosphere, the solar corona, and in toroidal fusion research discharges. In a fusion device, a magnetic island saturates at a width which produces a minimum in the magnetic energy of the configuration. At saturation, the modified current density profile, a function of the flux in the island, is essentially flat, the growth rate proportional to the difference in the current at the O-point and the X-point. Further modification of the current density profile in the island interior causes a change in the island stability and additional growth or contraction of the saturated island. Because field lines in an island are isolated from the outside plasma, an island can heat or cool preferentially depending on the balance of Ohmic heating and radiation loss in the interior, changing the resistivity and hence the current in the island. A simple model of island destabilization due to radiation cooling of the island is constructed, and the effect of modification of the current within an island is calculated. An additional destabilization effect is described, and it is shown that a small imbalance of heating can lead to exponential growth of the island. A destabilized magnetic island near the plasma edge can lead to plasma loss, and because the radiation is proportional to plasma density and charge, this effect can cause an impurity dependent density limit.

  2. Thermal island destabilization and the Greenwald limit

    International Nuclear Information System (INIS)

    Magnetic reconnection is ubiquitous in the magnetosphere, the solar corona, and in toroidal fusion research discharges. In a fusion device, a magnetic island saturates at a width which produces a minimum in the magnetic energy of the configuration. At saturation, the modified current density profile, a function of the flux in the island, is essentially flat, the growth rate proportional to the difference in the current at the O-point and the X-point. Further modification of the current density profile in the island interior causes a change in the island stability and additional growth or contraction of the saturated island. Because field lines in an island are isolated from the outside plasma, an island can heat or cool preferentially depending on the balance of Ohmic heating and radiation loss in the interior, changing the resistivity and hence the current in the island. A simple model of island destabilization due to radiation cooling of the island is constructed, and the effect of modification of the current within an island is calculated. An additional destabilization effect is described, and it is shown that a small imbalance of heating can lead to exponential growth of the island. A destabilized magnetic island near the plasma edge can lead to plasma loss, and because the radiation is proportional to plasma density and charge, this effect can cause an impurity dependent density limit

  3. Contrasting food web factor and body size relationships with Hg and Se concentrations in marine biota.

    Science.gov (United States)

    Karimi, Roxanne; Frisk, Michael; Fisher, Nicholas S

    2013-01-01

    Marine fish and shellfish are primary sources of human exposure to mercury, a potentially toxic metal, and selenium, an essential element that may protect against mercury bioaccumulation and toxicity. Yet we lack a thorough understanding of Hg and Se patterns in common marine taxa, particularly those that are commercially important, and how food web and body size factors differ in their influence on Hg and Se patterns. We compared Hg and Se content among marine fish and invertebrate taxa collected from Long Island, NY, and examined associations between Hg, Se, body length, trophic level (measured by δ(15)N) and degree of pelagic feeding (measured by δ(13)C). Finfish, particularly shark, had high Hg content whereas bivalves generally had high Se content. Both taxonomic differences and variability were larger for Hg than Se, and Hg content explained most of the variation in Hg:Se molar ratios among taxa. Finally, Hg was more strongly associated with length and trophic level across taxa than Se, consistent with a greater degree of Hg bioaccumulation in the body over time, and biomagnification through the food web, respectively. Overall, our findings indicate distinct taxonomic and ecological Hg and Se patterns in commercially important marine biota, and these patterns have nutritional and toxicological implications for seafood-consuming wildlife and humans. PMID:24019976

  4. Contrasting food web factor and body size relationships with Hg and Se concentrations in marine biota.

    Directory of Open Access Journals (Sweden)

    Roxanne Karimi

    Full Text Available Marine fish and shellfish are primary sources of human exposure to mercury, a potentially toxic metal, and selenium, an essential element that may protect against mercury bioaccumulation and toxicity. Yet we lack a thorough understanding of Hg and Se patterns in common marine taxa, particularly those that are commercially important, and how food web and body size factors differ in their influence on Hg and Se patterns. We compared Hg and Se content among marine fish and invertebrate taxa collected from Long Island, NY, and examined associations between Hg, Se, body length, trophic level (measured by δ(15N and degree of pelagic feeding (measured by δ(13C. Finfish, particularly shark, had high Hg content whereas bivalves generally had high Se content. Both taxonomic differences and variability were larger for Hg than Se, and Hg content explained most of the variation in Hg:Se molar ratios among taxa. Finally, Hg was more strongly associated with length and trophic level across taxa than Se, consistent with a greater degree of Hg bioaccumulation in the body over time, and biomagnification through the food web, respectively. Overall, our findings indicate distinct taxonomic and ecological Hg and Se patterns in commercially important marine biota, and these patterns have nutritional and toxicological implications for seafood-consuming wildlife and humans.

  5. Anthropic pressures on Egadi Islands

    International Nuclear Information System (INIS)

    The Egadi Islands, like most Mediterranean islets, have radically changed the traditional lifestyle and the economic development model, based for centuries on the almost self-sufficient resources and production activities, mostly related to the sea (fishing and fish processing) and to the land. During the second half of the 1900., the development of transport radically transformed this model to make smaller islands, at least those closest to the coast, more tightly interconnected and dependent on the mainland. In particular, in Favignana, which is the most populous island and very close to the coast, the traditional activities tourism have led to a strong anthropic pressure concentrated in a few months of the year (summer) on the one hand, and a reduction of the resident population during the winter months on the other, with a serious impact on the care of the land

  6. Lo que no se puede decir: se muestra

    OpenAIRE

    Cerruti, Nicolás

    2015-01-01

    Lacan escribe mal, siempre me ha dado esa sensación. Lacan escribe tan mal que es ilegible. ¿Cómo, un sujeto que se esmeró tanto por el decir y sus límites, que enseñó tanto de lo simbólico y de los discursos, que nombró tanto al Otro, cómo puede ser que un sujeto así no haya encontrado la forma de escribir bien (para trasmitir aún mejor)? ¿Por qué no encontró mejores formas de decir? Si Freud era un maestro, con tanta belleza que hasta mereció un premio, ¿cómo es que Lacan no lo siguió en es...

  7. Oceanographic Survey in waters of the Northern Mariana Islands, Guam, and Micronesia (SE1003, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goals of the cruise were to collect acoustic backscatter and oceanographic data at the vicinity of CNMI, Guam, and in the northern part of Micronesia. Data...

  8. Cetacean Ecology Survey at North Western Hawaiian Islands (SE1303, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goal of the cruise was to collect data on the abundance, distribution, stock structure, and habitat of cetaceans in the Papah?naumoku?kea Marine National...

  9. Marine geological study of the continental shelf around Heugsan island, SE Korea

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Chi Won; Jin, Jae Hwa; Shin, Won Cheol; Kim, Won Sik; Kim, Jung Ki; Kim, Sang Woo; Lee, Ho Yong; Chang, Cheong Hae; Kim, Sung Woo; Lee, Yoon Oh; Park, Young Soo; Bahng, Hyo Ky [Korea Inst. of Geology Mining and Materials, Taejon (Korea, Republic of)

    1995-12-01

    This annual report is a result of marine geological and geophysical surveys conducted in 1995 to obtain a variety of data available for mapping Korean continental shelf geology. The study area is situated off city of Mokpo, comprising a rectangle enclosed by lines connecting between 34 degree 30`N and 35 degree 00`N, and between 125 degree 00`E and 126 degree 00`E. Geophysical surveys included water-depth sounding, sea floor side scanning, 3.5 khz sub-bottom profiling, air gun seismic reflection profiling and measurement of total magnetic intensity. During geological terms, 102 grab samples were collected from a grid of 4 miles x 4 miles spaced on the sea floor, and 31 sediment cores were raised from the proper sites determined by preliminary interpretation of geophysical data. The survey vessel, R/V Tamhae, was positioned by a GPS system (Loran-GPS 10X; Trimble Navigation Co.). The sea floor is largely covered with seven distinct types of surface and near-surface sediments; (1) massive sand, (2) homogeneous clay, (3) laminated silt, (4) bioturbated muddy sand, (5) massive silt, (6) bioturbated gravelly muddy sand, and (7) shell aggregate. Based on synthetic interpretation of high-resolution (3.5 khz) seismic data and correlated sedimentary facies, the shallow substratum comprises low-stand, transgressive and high-stand systems tracts (LST, TST and HST, respectively) formed during the last glacio-eutectics regression and transgression. Air gun seismic profiles show that pre-Pleistocene sediments comprise 4 sequences designated as B, C, D, and E, respectively. (author). 63 refs.

  10. Main: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE1PVGRP18 S000288 10-Feb-2000 (last modified) seki SE1 (Stem element 1) found in the bean (P.v.) grp1...ecifically; See S000289, S000101 (SE2); SE1; grp1.8; vascular; stem; shoot; bean (Phaseolus vulgaris) ATAATGGGCCACACTGTGGGGCAT ...

  11. Main: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE2PVGRP1 S000101 17-May-1998 (last modified) kehi SE2 (stem element 2) of bean (P.v.) GRP1....8 gene; part of SE2 element; stem; SE2; GRP; GRP1; bean (Phaseolus vulgaris) TTNNNGTAGCTAGTGTATTTGTAT ...

  12. The Kattegat Island of Anholt

    DEFF Research Database (Denmark)

    Schrøder, Niels

    2015-01-01

    relatively simple models can describe the processes that take place. New data are presented which provide a detailed description of the last 16,000 years of climate and sea level change influence on the forces that have formed the island. This geological history can be used to provide information on the...... history of groundwater recharge and drainage, and the development of the salt-fresh groundwater interface under a sand island. The fact that the center of Anholt was covered by the sea 6,000 years ago, and consequently the freshwater lens, over 100 m below sea level, did not exist means that the present...

  13. Investigation of the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K

    Energy Technology Data Exchange (ETDEWEB)

    Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine); Wolcyrz, M. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Stepien-Damm, J. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Pietraszko, A. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland)

    2006-06-08

    The interactions between the components in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K were determined using X-ray single crystal and powder diffraction. The existence of the compounds with compositions RCuSe{sub 2}-R{sub 2/3}Cu{sub 2}Se{sub 2}(Er{sub 2/3}Cu{sub 2}S{sub 2} structure type, space group P3-bar , a=0.40563(1)nm, c=0.64542(3)nm, R{sub I}=0.0737 for HoCuSe{sub 2} and a=0.40407(1)nm, c=0.64420(3)nm, R{sub I}=0.0660 for ErCuSe{sub 2}) and RCu{sub 5}Se{sub 4} (unknown structure) was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=Ho, Er) sections. The existence of the compounds Ho{sub 6}Pb{sub 2}Se{sub 11} (Y{sub 6}Pb{sub 2}Se{sub 11} structure type, space group Cmcm, a=0.40561(2)nm, b=1.34018(6)nm, c=3.7525(1)nm) and Er{sub 2}PbSe{sub 4} (CaFe{sub 2}O{sub 4} structure type, space group Pnma, a=1.2554(2)nm, b=0.40778(5)nm, c=1.4885(2)nm, R{sub I}=0.0914) was confirmed in the R{sub 2}Se{sub 3}-PbSe (R=Ho, Er) sections. The existence of the compounds Ho{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35314(8)nm, b=0.40819(2)nm, c=1.25609(7)nm, {beta}=104.577(3){sup o}) and HoCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.0516(2)nm, b=0.40470(8)nm, c=1.3410(3)nm, R{sub 1}=0.0541) in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed. The formation of the compounds Er{sub 5}CuPb{sub 3}Se{sub 11} (Er{sub 5}CuPb{sub 3}Se{sub 11} structure type, space group Cmcm, a=0.40688(2)nm, b=1.34607(7)nm, c=3.8040(2)nm), Er{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35018(7)nm, b=0.40693(2)nm, c=1.25433(6)nm, {beta}=104.492(2){sup o}) and ErCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.04846(8)nm, b=0.40424(3)nm, c=1.34143(7)nm) in the Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed.

  14. Benthic Mapping in Long Island Sound

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — QTCView is used with an incorporated depthfinder to create a sonar map of the bottom to the west of the Charles Island, in Long Island Sound in Connecticut waters....

  15. Bartolome Island, Galapagos Stable Oxygen Calibration Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Galapagos Coral Stable Oxygen Calibration Data. Sites: Bartolome Island: 0 deg, 17'S, 90 deg 33' W. Champion Island: 1 deg, 15'S, 90 deg, 05' W. Urvina Bay (Isabela...

  16. Champion Island, Galapagos Stable Oxygen Calibration Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Galapagos Coral Stable Oxygen Calibration Data. Sites: Bartolome Island: 0 deg, 17 min S, 90 deg 33 min W. Champion Island: 1 deg, 15 min S, 90 deg, 05 min W....

  17. Bair Island Restoration Project Monitoring Plan 2004

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Bair Island is located adjacent to the San Francisco Bay in Redwood City, San Mateo County, California (Figure 1). Historically, Bair Island was part of a large...

  18. Submarine physiography off Lakshadweep Islands, Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S; Chaubey, A

    Analysis of echosoundings, side scan sonar and shallow seismic data, supplementEd. by 152 sediment samples, collected along 150 km around Lakshadweep Islands, Arabian Sea, revealed that the islands have a very narrow shelf, and an abrupt, shelf...

  19. STM imaging of electrically floating islands

    Science.gov (United States)

    Realpe, H.; Shamir, N.; Mintz, M. H.; Manassen, Y.

    2006-07-01

    Appearances and disappearances of Gd islands grown on top of a W(1 1 0) substrate were observed in time scales of hours after exposing the surface to a few Langmuirs of hydrogen. The phenomenon is presented and explained in terms of (temporary) creation of electrically floating islands, due to electrical decoupling of the island and substrate by the hydrogen that diffuses into the island/substrate interface. The disappearance of such an island is explained by forming a double barrier junction consisting of two tunneling barriers in series, causing, by charging, the potential of the island to become equal to that of the tip. The island then becomes "invisible" and the tip follows the corrugation of the surface under the substrate. The reappearance follows hydrogen mobility that retains the electrical conductivity of the island-substrate interface.

  20. Obesity and Native Hawaiians/Pacific Islanders

    Science.gov (United States)

    ... Population Profiles > Native Hawaiian/Other Pacific Islander > Obesity Obesity and Native Hawaiians/Pacific Islanders Native Hawaiians/Pacific ... youthonline . [Accessed 05/25/2016] HEALTH IMPACT OF OBESITY More than 80 percent of people with type ...

  1. Late Quaternary climate change shapes island biodiversity

    DEFF Research Database (Denmark)

    Weigelt, Patrick; Steinbauer, Manuel; Cabral, Juliano;

    2016-01-01

    sea levels3, 4 and caused massive changes in island area, isolation and connectivity5, orders of magnitude faster than the geological processes of island formation, subsidence and erosion considered in island theory2, 6. Consequences of these oscillations for present biodiversity remain unassessed5, 7......Island biogeographical models consider islands either as geologically static with biodiversity resulting from ecologically neutral immigration–extinction dynamics1, or as geologically dynamic with biodiversity resulting from immigration–speciation–extinction dynamics influenced by changes in island...... diversity of endemic species. Specifically, the number and proportion of endemic species today is significantly higher on islands that were larger during the LGM. Native species richness, in turn, is mostly determined by present island characteristics. We conclude that an appreciation of Late Quaternary...

  2. Energy Transition Initiative: Island Energy Snapshot - U.S. Virgin Islands (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-03-01

    This profile provides a snapshot of the energy landscape of the U.S. Virgin Islands (USVI) - St. Thomas, St. John, and St. Croix. The Virgin Islands archipelago makes up the northern portion of the Lesser Antilles and the western island group of the Leeward Islands, forming the border between the Atlantic Ocean and the Caribbean Sea.

  3. 33 CFR 80.720 - St. Simons Island, GA to Amelia Island, FL.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false St. Simons Island, GA to Amelia Island, FL. 80.720 Section 80.720 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Island, GA to Amelia Island, FL. (a) A line drawn from St. Simons Light to the northernmost tank...

  4. Electrical and optical properties of indium-modified Se2Sb2Te6 films

    International Nuclear Information System (INIS)

    The electrical and optical characteristics of indium-doped Se2Sb2Te6 phase-change alloy are studied in this paper. It is found that adding indium to Se2Sb2Te6 alloy increases its amorphous-crystalline transition temperature, TC, and reduces the electrical conduction activation energy. The capacitance-temperature measurements showed a drastic change in the capacitance of the modified film as the temperature approaches TC and eventually the capacitance becomes negative and nonlinear. The negativity and nonlinearity in the capacitance-voltage dependence can be attributed to the growth of conductive crystalline islands with increasing temperature.

  5. Southern California Channel Islands Bibliography, through 1992

    OpenAIRE

    Channel Islands National Marine Sanctuary

    1992-01-01

    The Southern California Channel Islands Bibliography, through 1992, comprises 4035 references to the scientific literature on Southern California's Channel Islands. The Bibliography was compiled by the Channel Islands National Marine Sanctuary and is presented here in a February 1993 version. The Santa Barbara Museum of Natural History presents a California Channel Islands Bibliography on its website. It has more recent references and overlaps considerably with this bibliography. How...

  6. Hydro climatic ranking of small Mediterranean islands

    OpenAIRE

    Ljubenkov, Igor

    2013-01-01

    Islands are specific environments whose natural features form the basis of social and economic development. It is particularly distinct on small islands. In hydrological terms, these are islands with surface areas between 100 and 1000 km2. There are 40 small islands in the Mediterranean Basin. Most of these have very limited water resources, due to their geological structure and precipitation regime. This paper outlines the basic geographical and climatic features of small Mediterranean islan...

  7. Food and nutrition security in Solomon Islands

    OpenAIRE

    Andersen, A B; Thilsted, S. H.; Schwarz, A.M.

    2013-01-01

    This report is a literature review on Food and Nutrition Security in Solomon Islands, based on data from surveys conducted by Solomon Islands National Statistical Office, as well as from national and international organizations working in Solomon Islands. The purpose of the report is to present information outlining the current food and nutrition situation in Solomon Islands before implementation of the CGIAR Research Program on Aquatic Agricultural Systems (AAS), led by WorldFish. The aim of...

  8. The geology of the Falkland Islands

    OpenAIRE

    Aldiss, D. T.; Edwards, E.J.

    1999-01-01

    This report is complementary to the 1:250 000 scale geological map of the Falkland Islands compiled in 1998. The report and map are products of the Falkland Islands Geological Mapping Project (1996-1998). Geological observation and research in the Islands date from 1764. The Islands were visited during two pioneering scientific cruises in the 19th century. Subsequently, many scientists visited en route to the Antarctic or Patagonia. Geological affinities to other parts of the sout...

  9. 32 CFR 935.61 - Wake Island Court.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Wake Island Court. 935.61 Section 935.61... REGULATIONS WAKE ISLAND CODE Judiciary § 935.61 Wake Island Court. (a) The trial judicial authority for Wake Island is vested in the Wake Island Court. (b) The Wake Island Court consists of one or more...

  10. Rotation and Locking of Magnetic Islands

    International Nuclear Information System (INIS)

    The polarization drifts arising from the acceleration of plasma flowing alongside a magnetic island are shown to be destabilizing. A critical island width is found above which the polarization drifts (inertial forces) defeat the stabilizing effect of the viscous forces and prevent islands from being unlocked by increasing the plasma rotation. copyright 1997 The American Physical Society

  11. Ecology of Great Salt Pond, Block Island

    Science.gov (United States)

    Great Salt Pond is an island of estuarine water on Block Island, which sits in the middle of the Northwest Atlantic Continental Shelf. When the last continental glaciers retreated, they left a high spot on a terminal moraine. The rising sea from melting glaciers formed two island...

  12. 27 CFR 9.68 - Merritt Island.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Merritt Island. 9.68... Merritt Island. (a) Name. The name of the viticultural area described in this section is “Merritt Island.” (b) Approved maps. The appropriate maps for determining the boundaries of the Merritt...

  13. 50 CFR 32.59 - Rhode Island.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Rhode Island. 32.59 Section 32.59 Wildlife... § 32.59 Rhode Island. The following refuge units have been opened for hunting and/or fishing and are listed in alphabetical order with applicable refuge-specific regulations. Block Island National...

  14. Ecology and Evolution: Islands of Change.

    Science.gov (United States)

    Benz, Richard

    This book was designed for middle and junior high school science classes and focuses on island biogeography, ecology, and evolution. Sections include: (1) "Galapagos: Frame of Reference"; (2) "Ecology and Islands"; and (3) "Evolution." Nineteen standards-based activities use the Galapagos Islands as a running theme but are designed to help…

  15. Stepping-stones to the Edge: Artistic Expressions of Islandness in an Ocean of Islands

    Directory of Open Access Journals (Sweden)

    Laurie Brinklow

    2013-05-01

    Full Text Available Since the earliest of times, islands have captured the artistic imagination—and, often, for the artist who finds his or her muse in being ‘islanded’, the smaller the island the better. Archipelagos offer an ideal setting for artists who take their inspiration from place: on small islands off islands they can experience an intensity of island living they might not otherwise have on a main island: boundedness and connection, isolation and community. This paper examines expressions of islandness by artists who live on islands off islands that are poles apart—‘archipelagos’ of the Canadian North Atlantic and the Great Southern Ocean. It draws upon interviews with those artists and writers to consider the nature of humans’ attachment and attraction to islands, exploring through the lens of phenomenology what Stratford et al. call the “entanglement between and among islands”.

  16. Gondwana break-up related magmatism in the Falkland Islands

    OpenAIRE

    Hole, M. J.; Ellam, R. M.; MacDonald, D. I. M.; Kelley, S. P.

    2015-01-01

    Jurassic dykes (c. 182 Ma) are widespread across the Falkland Islands and exhibit considerable geochemical variability. Orthopyroxene-bearing NW–SE-oriented quartz-tholeiite dykes underwent fractional crystallization at >1 GPa, and major element constraints suggest that they were derived by melting of a pyroxenite-rich source. They have εNd182 in the range –6 to –11 and 87Sr/86Sr182 >0.710 and therefore require an old lithospheric component in their source. A suite of basaltic andesites and a...

  17. Island formation and tectonic processes

    OpenAIRE

    Draper, G

    2011-01-01

    Tectonic processes can form an island in one of two ways. 1. Those processes that cause a rise in water levels and flooding a pre-existing topography, known as tectonic flooding. 2. Those processes that cause uplift of the basin floor to form a topography that emerges above water level, called tectonic emergence.

  18. 1946 Unimak Island, USA Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — On April 1, 1946, at 12:29 [local time] a rather strong magnitude 7.4 earthquake occurred with source to the south of Unimak Island, causing one of the most...

  19. Date with the Green Island

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ Qingdao,also spelled Tsingtao,iS one of the most beautiful and clean cities in China and with a population of around 2.5 million(7 million regional)is the largest city after Jinan(the capital)in Shandong Province.The name"Qingdao"means "The Green Island".

  20. Extinction debt on oceanic islands

    DEFF Research Database (Denmark)

    Triantis, K.A.; Borges, Paulo A. V.; Ladle, R.J.;

    2010-01-01

    magnitude of such future extinction events has been hampered by potentially inaccurate assumptions about the slope of species-area relationships, which are habitat- and taxon-specific. We overcome this challenge by applying a method that uses the historical sequence of deforestation in the Azorean Islands...

  1. 46 CFR 7.70 - Folly Island, SC to Hilton Head Island, SC.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Folly Island, SC to Hilton Head Island, SC. 7.70 Section... BOUNDARY LINES Atlantic Coast § 7.70 Folly Island, SC to Hilton Head Island, SC. (a) A line drawn from the southernmost extremity of Folly Island to latitude 32°35′ N. longitude 79°58.2′ W. (Stono Inlet Lighted...

  2. Modeling the distribution of Norway rats (Rattus norvegicus on offshore islands in the Falkland Islands

    Directory of Open Access Journals (Sweden)

    Michael A. Tabak

    2015-01-01

    Full Text Available Non-native rats (Rattus spp. threaten native island species worldwide. Efforts to eradicate them from islands have increased in frequency and become more ambitious in recent years. However, the long-term success of some eradication efforts has been compromised by the ability of rats, particularly Norway rats (Rattus norvegicus which are good swimmers, to recolonize islands following eradications. In the Falkland Islands, an archipelago in the South Atlantic Ocean, the distance of 250 m between islands (once suggested as the minimum separation distance for an effective barrier to recolonization has shown to be insufficient. Norway rats are present on about half of the 503 islands in the Falklands. Bird diversity is lower on islands with rats and two vulnerable passerine species, Troglodytes cobbi (the only endemic Falkland Islands passerine and Cinclodes antarcticus, have greatly reduced abundances and/or are absent on islands with rats. We used logistic regression models to investigate the potential factors that may determine the presence of Norway rats on 158 islands in the Falkland Islands. Our models included island area, distance to the nearest rat-infested island, island location, and the history of island use by humans as driving variables. Models best supported by data included only distance to the nearest potential source of rats and island area, but the relative magnitude of the effect of distance and area on the presence of rats varied depending on whether islands were in the eastern or western sector of the archipelago. The human use of an island was not a significant parameter in any models. A very large fraction (72% of islands within 500 m of the nearest potential rat source had rats, but 97% of islands farther than 1,000 m away from potential rat sources were free of rats.

  3. Electrical and Optical Properties of Indium-Modified SeSbTe Thin Films for Low Power Memory Devices

    International Nuclear Information System (INIS)

    The electrical and optical characteristics of indium doped Se2Sb2Te6 phase-change alloy are studied. It is found that adding indium to Se2Sb2Te6 alloy (In0.3Se2Sb2Te6) increased the crystallization temperature and reduced the electrical conduction activation energy. The capacitance-temperature measurements showed a drastic change in the capacitance of the modified film when the temperature approaches the crystallization temperature, and eventually the capacitance becomes negative and nonlinear. The negativity and nonlinearity in the capacitance voltage dependence can be attributed to the growth of conductive crystalline islands by increasing the temperature. (author)

  4. Measurement of the static quadrupole moments of the first 2+ states in 76Se, 78Se, 80Se and 82Se

    International Nuclear Information System (INIS)

    The reorientation effect in Coulomb excitation was employed to measure the static quadrupole moments of the first 2+ excited states in 76Se, 78Se, 80Se, and 82Se. Beams of 4He and 16O were used on thin highly enriched targets and the resulting spectra of the well resolved backward elastic and inelastic scattered particles were detected by four surface-barrier detectors. For constructive interference via the second 2+ excited states the determined quadrupole moments are: -0.34 +- 0.07 e . b for 76Se; -0.26 +- 0.09 e . b for 78Se; -0.31 +- 0.07 e . b for 80Se; -0.22 +- 0.07 e . b for 82Se. (Auth.)

  5. Inverter Anti-Islanding with Advanced Grid Support in Single- and Multi-Inverter Islands

    Energy Technology Data Exchange (ETDEWEB)

    Hoke, Andy

    2016-08-16

    As PV and other DER systems are connected to the grid at increased penetration levels, island detection may become more challenging for two reasons: 1. In islands containing many DERs, active inverter-based anti-islanding methods may have more difficulty detecting islands because each individual inverter's efforts to detect the island may be interfered with by the other inverters in the island. 2. The increasing numbers of DERs are leading to new requirements that DERs ride through grid disturbances and even actively try to regulate grid voltage and frequency back towards nominal operating conditions. These new grid support requirements may directly or indirectly interfere with anti-islanding controls. This report describes a series of tests designed to examine the impacts of both grid support functions and multi-inverter islands on anti-islanding effectiveness.

  6. Time course of selenium labelling of selenoproteins in Se adequate and Se deficient rats

    International Nuclear Information System (INIS)

    Column chromatography has identified a number of new selenoproteins. To discriminate between selenoproteins and Se-binding proteins, the authors used SDS-PAGE to remove loosely-bound 75Se and thus quantitate 75Se-labelled selenoproteins. +Se (Wayne Lab Blox) and -Se rats (75Se]selenite (0.5 ug Se) and sacrificed 1, 3, 24 or 72 hr later. 75Se-proteins in various tissues were separated according to subunit molecular weight by SDS-PAGE, and gel slices were counted to determine 75Se labelling. In +Se plasma, a 55kDa protein was the major 75Se-protein at 1 and 3 hr; gluathione peroxidase (GSH-Px, 20kDa subunit) was labelled at 24 and 72 hr. In -Se plasma the 55kDa 75Se-protein was 4-fold higher and GSH-Px 75Se was reduced. In +Se liver cytosol GSH-Px was the major 75Se- species at all times; GSH-Px 75Se was greater in +Se than -Se liver. In +Se and -Se testes, a 17kDa protein was labelled increasingly over 72 hr. Notably, a number of additional 75Se-proteins were observed, but cycloheximide pretreatment completely blocked 75Se-labelling of all selenoproteins in both +Se and -Se rats. This study shows that SDS-PAGE can be used to resolve and quantify a number of selenoproteins in addition to GSH-Px. The cycloheximide inhibition of labelling further suggests that these species are true selenoproteins that are labelled only during or immediately after protein synthesis

  7. Index Balearicum (II): An Annotated check-list of the vascular plants described from the balearic islands. Additions (2002-2007) and corrections

    OpenAIRE

    Roselló Picornell, Josep Antoni; Sáez, Llorenç

    2008-01-01

    Se presentan adiciones y correcciones al listado de plantas vasculares cuyo tipo nomenclatural es originario de las islas Baleares. Se propone una nueva combinación nomenclatural: Sonchus willkommii (Burnat & Barbey) comb. nov. Additions and corrections to the check-list of vascular plants described from the Balearic Islands are presented. A nomenclatural change is proposed: Sonchus willkommii (Burnat & Barbey) comb. nov.

  8. Morphotectonics of the Mascarene Islands

    Directory of Open Access Journals (Sweden)

    A. E. Scheidegger

    1998-06-01

    Full Text Available A study is made of the orientations (strikes/trends of joints, valleys, ridges and lineaments, i.e. of the (potentially morphotectonic features, of the Mascarene Islands (Reunion, Mauritius and Rodrigues in the Indian Ocean. It turns out that a connection exists between these features on all islands. For the joints alone, the results for Mauritius as a whole agree closely with those for Rodrigues as a whole, and also partially with those of Reunion. Inasmuch as the trends of the valleys, ridges and lineaments are related to the trends (strikes of the joints, a common morphotectonic predesign seems to be present for all features studied. The morphotectonic orientations on the island also agree closely with the trends of fracture zones, ridges and trenches in the nearby ocean bottom; which has had a bearing on the theories of the origin of the Mascarene Islands. Generally, a hot-spot origin is preferred for Reunion, and may be for Mauritius as well, although differing opinions have also been voiced. The dynamics of a hot-spot is hard to reconcile with the close fit of the joint strikes in Réunion with the trends of the Madagascar and Rodrigues fracture zones. The closely agreeing joint maxima in Mauritius and Rodrigues í across the deep Mauritius trench í also agree with the trend of that trench and with the trend of the Rodrigues fracture zone. Thus, it would appear as most likely that the trends of joints and of fracture zones are all part of the same pattern and are due to the same cause: viz. to action of the neotectonic stress field.

  9. The Falkland Islands Morbidity Survey

    OpenAIRE

    King, H. O. M.; Bleaney, A. A.

    1982-01-01

    A 12-month retrospective morbidity survey of the Falkland Islands in 1979 is described. A larger proportion of the population appear to have sought medical attention in this time than would be expected on the basis of comparable British figures. In general, cause-specific morbidity was similar in the two countries, although there were several discrepancies identified which may have been of environmental origin. The low prevalence of essential hypertension in males was particularly notable.

  10. "Lo que se dice y se hace. Lo que se calla y se niega" : Apropiaciones de la literatura en el aula

    OpenAIRE

    Mattioli, María Luz

    2012-01-01

    El presente trabajo surge a partir de una indagación personal que se va consolidando a medida que transito distintas aulas y experiencias. En todas estas situaciones se me presentan los mismos interrogantes: ¿cuáles son los distintos modos de leer literatura que se presentan en las aulas? ¿Cómo se presentan y en la voz de qué actores/alumnos? Y ¿cuáles son las distintas formas del conocimiento que se da en cada situación en particular?

  11. Island development: Local governance under globalization

    Directory of Open Access Journals (Sweden)

    Huei-Min Tsai

    2014-12-01

    Full Text Available Issues surrounding island development have generated a growing volume of research. What does it mean to develop? How can island communities maintain control over development processes to the benefit of the local economy, rather than seeing economic flows enter and exit the island with little or a primarily negative impact? And how important is local knowledge for edifying local governance and enhancing potentials for innovation in island development? Island histories have repeatedly been forwarded as exemplars and ‘lessons’ for global learning on (unsustainability. To consider these issues, we have selected a number of papers from among the presentations given at the International Geographical Union’s Commission on Islands Conference, Island Development: Local Economy, Culture, Innovation and Sustainability, which took place in the Penghu Archipelago, Taiwan, 1–5 October 2013. These papers serve as examples of how the processes of globalization have penetrated the borders and changed the political and economic structures of islands. They also explore how island-based innovations in science, technology, culture, and formal or informal governance might contribute to sustainable island development.

  12. Tsunami damage along the Andaman Islands coasts

    Science.gov (United States)

    2005-01-01

    Among the first places to be affected by the massive tidal wave that ripped across the Indian Ocean on December 26, 2004, were the Andaman Islands. Located approximately 850 kilometers north of the epicenter of the earthquake that triggered the tsunami, the islands were not only among the first land masses to be swept under the wave, they have also been rattled by a series of aftershocks. Administrated by the Indian government, about 300,000 people live on the remote island chain, including several indigenous tribes. As of January 3, over 6,000 were confirmed dead or missing in the Andaman Islands. This Moderate Resolution Imaging Spectroradiometer (MODIS) image shows the Andaman Islands on January 3, 2005. Compared to previous images of the islands, the beaches along the west side of the islands have been stripped bare, leaving a strip of bright tan land along the coast. The change is most notable on North Sentinel Island, home of the Sentinelese aboriginals, and on Interview Island, where the formerly green coastline has been replaced with an abnormally bright ring of bare sand. The large image reveals additional damage along all the islands of the Andaman chain.

  13. Pathogenicity island mobility and gene content.

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Kelly Porter

    2013-10-01

    Key goals towards national biosecurity include methods for analyzing pathogens, predicting their emergence, and developing countermeasures. These goals are served by studying bacterial genes that promote pathogenicity and the pathogenicity islands that mobilize them. Cyberinfrastructure promoting an island database advances this field and enables deeper bioinformatic analysis that may identify novel pathogenicity genes. New automated methods and rich visualizations were developed for identifying pathogenicity islands, based on the principle that islands occur sporadically among closely related strains. The chromosomally-ordered pan-genome organizes all genes from a clade of strains; gaps in this visualization indicate islands, and decorations of the gene matrix facilitate exploration of island gene functions. A %E2%80%9Clearned phyloblocks%E2%80%9D method was developed for automated island identification, that trains on the phylogenetic patterns of islands identified by other methods. Learned phyloblocks better defined termini of previously identified islands in multidrug-resistant Klebsiella pneumoniae ATCC BAA-2146, and found its only antibiotic resistance island.

  14. Introduced mammals on Western Indian Ocean islands

    Directory of Open Access Journals (Sweden)

    James C. Russell

    2016-04-01

    Full Text Available The diversity of introduced mammals and their introduction history varies greatly across the Western Indian Ocean (WIO islands, from ancient introductions in the past millennia on islands off the East coast of Africa where extant terrestrial native mammal communities exist, to very recent invasions in the past decades on islands in the Mascarene archipelago. We compile the distribution of 16 introduced mammal taxa on 28 island groups comprising almost 2000 islands. Through an exhaustive literature review and expert consultation process we recorded all mammal eradications, and species recoveries which could be attributed to introduced mammal eradication or control. All island groups have been invaded by mammals, and invasive cats and rats in particular are ubiquitous, but cultural contingency has also led to regional invasions by other mammals such as lemurs, civets and tenrecs. Mammal eradications have been attempted on 45 islands in the WIO, the majority in the Seychelles and Mauritius, and where successful have resulted in spectacular recovery of species and ecosystems. Invasive mammalian predator eradication or control in association with habitat management has led to improved conservation prospects for at least 24 species, and IUCN red-list down-listing of eight species, in the Mascarene Islands. Future island conservation prioritisation in the region will need to take account of global climate change and predicted sea-level rises and coastal inundation. Greater investment and prioritisation in island conservation in the region is warranted, given its high biodiversity values and the extent of invasions.

  15. Generalized model of island biodiversity

    Science.gov (United States)

    Kessler, David A.; Shnerb, Nadav M.

    2015-04-01

    The dynamics of a local community of competing species with weak immigration from a static regional pool is studied. Implementing the generalized competitive Lotka-Volterra model with demographic noise, a rich dynamics with four qualitatively distinct phases is unfolded. When the overall interspecies competition is weak, the island species recapitulate the mainland species. For higher values of the competition parameter, the system still admits an equilibrium community, but now some of the mainland species are absent on the island. Further increase in competition leads to an intermittent "disordered" phase, where the dynamics is controlled by invadable combinations of species and the turnover rate is governed by the migration. Finally, the strong competition phase is glasslike, dominated by uninvadable states and noise-induced transitions. Our model contains, as a special case, the celebrated neutral island theories of Wilson-MacArthur and Hubbell. Moreover, we show that slight deviations from perfect neutrality may lead to each of the phases, as the Hubbell point appears to be quadracritical.

  16. Floating Cities, Islands and States

    CERN Document Server

    Bolonkin, Alexander

    2008-01-01

    Many small countries are in need of additional territory. They build landfills and expensive artificial islands. The ocean covers 71 per cent of the Earth surface. Those countries (or persons of wealth) starting the early colonization of the ocean may obtain advantages through additional territory or creating their own independent state. An old idea is building a big ship. The best solution to this problem, however, is the provision of floating cities, islands, and states. The author idea is to use for floating cities, islands, and states a cheap floating platform created from a natural ice field taken from the Arctic or Antarctic oceans. These cheap platforms protected by air-film (bottom and sides) and a conventional insulating cover (top) and having a cooling system can exist for an unlimited time. They can be increased in number or size at any time, float in warm oceans, travel to different continents and countries, serve as artificial airports, harbors and other marine improvements, as well as floating c...

  17. A global analysis of island pyrogeography

    Science.gov (United States)

    Trauernicht, C.; Murphy, B. P.

    2014-12-01

    Islands have provided insight into the ecological role of fire worldwide through research on the positive feedbacks between fire and nonnative grasses, particularly in the Hawaiian Islands. However, the global extent and frequency of fire on islands as an ecological disturbance has received little attention, possibly because 'natural fires' on islands are typically limited to infrequent dry lightning strikes and isolated volcanic events. But because most contemporary fires on islands are anthropogenic, islands provide ideal systems with which to understand the linkages between socio-economic development, shifting fire regimes, and ecological change. Here we use the density of satellite-derived (MODIS) active fire detections for the years 2000-2014 and global data sets of vegetation, climate, population density, and road development to examine the drivers of fire activity on islands at the global scale, and compare these results to existing pyrogeographic models derived from continental data sets. We also use the Hawaiian Islands as a case study to understand the extent to which novel fire regimes can pervade island ecosystems. The global analysis indicates that fire is a frequent disturbance across islands worldwide, strongly affected by human activities, indicating people can more readily override climatic drivers than on continental land masses. The extent of fire activity derived from local records in the Hawaiian Islands reveals that our global analysis likely underestimates the prevalence of fire among island systems and that the combined effects of human activity and invasion by nonnative grasses can create conditions for frequent and relatively large-scale fires. Understanding the extent of these novel fire regimes, and mitigating their impacts, is critical to reducing the current and rapid degradation of native island ecosystems worldwide.

  18. Runoff generation in SE Spain

    Science.gov (United States)

    Dalen, E. N.; Kirkby, M. J.; Chapman, P. J.; Bracken, L. J.

    2007-12-01

    We are working to improve a hydrological model for prediction of runoff in medium-scale semi-arid catchments in SE Spain. The aim is to develop and improve understandings of runoff generation in semi-arid areas and to improve modelling of runoff. Objectives are to investigate the influence of geology, landuse and seasonality on infiltration rates and use remonte sensing (RS) and GIS to classify an area into Hydrologically Similar Surfaces (HYSS) categories. The research includes investigating the impact of different landscape elements on runoff within two 150 km2 catchments, the Rambla Nogalte and the Rambla de Torrealvilla. Most storms within these catchments are of short duration. HYSS are defined as areas with similar1-D (vertical) partitioning of net rainfall between infiltration and overland flow. HYSS are identified from field measurements of soils, micro and macro- topography and infiltration rates; then combined with analysis of multi-spectral airborne RS images. HYSS are selected to minimise internal variability in the relationship between rainfall and local runoff generation and are scaled up to cover larger areas. The overall sampling strategy for measurements has been to undertake constant intensity rainfall simulator measurements within provisional HYSS categories, and to augment this with a large number of minidisk infiltrometer measurements. This strategy captures as much of the variability in the landscape as possible. The wide variability within even small areas has led to the final adoption of only a few large classes that can be effectively distinguished. The final part of the research is to link the spatial partitioning of the two catchments into HYSS with the detailed rainfall records for the areas, and combine these two sets of data into a grid-based model for runoff generation across the area. The applied Green-Ampt modelling approach gave 63 possible combinations of surface properties (9 HYSS) and areas in the Rambla Nogalte each represented

  19. WATER TEMPERATURE and DEPTH collected from OSCAR ELTON SETTE in Guam, Commonwealth of the Northern Mariana Islands, and others from 2015-05-08 to 2015-06-06 (NCEI Accession 0155929)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID SE 15-02). XBT casts...

  20. WATER TEMPERATURE and DEPTH - SENSOR collected from OSCAR ELTON SETTE in main Hawaiian Islands and Hawaii EEZ from 2009-02-06 to 2009-02-25 (NCEI Accession 0155922)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID SE 09-01). XBT casts...

  1. Holocene changes in climate and vegetation in the Ammassalik area, East Greenland, recorded in lake sediments and soil profiles

    DEFF Research Database (Denmark)

    Jakobsen, Bjarne Holm; Fredskild, Bent; Pedersen, Jørn Bjarke Torp

    2008-01-01

    , appears to have experienced the warmest Holocene summer conditions, ice-free seas and limited snow covers. The climate situation seems to have been to a considerable extent based on internal regional meteorological processes and largely without strong and regular cyclonic impacts from lower latitudes...

  2. Control and Operation of Islanded Distribution System

    DEFF Research Database (Denmark)

    Mahat, Pukar

    operational challenges. But, on the other hand, it has also opened up some opportunities. One opportunity/challenge is an islanded operation of a distribution system with DG unit(s). Islanding is a situation in which a distribution system becomes electrically isolated from the remainder of the power system...... grid and if they are operated with isochronous control and voltage control when the distribution system is islanded. It is proposed that the DG units are controlled differently when the distribution system changes state from grid connected condition to islanded condition. However, isochronous...... is based on frequency deviation and real power shift. When a distribution system, with all its generators operating at maximum power, is islanded, the frequency will go down if the total load is more than the total generation. An under-frequency load shedding procedure for islanded distribution...

  3. Backscatter 0.5m TIFF Mosaic of St. Croix (Buck Island), US Virgin Islands, 2004

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.5 meter resolution backscatter mosaic of the north shore of Buck Island, St. Croix, US Virgin Islands. NOAA's NOS/NCCOS/CCMA Biogeography...

  4. Pine Island, Matlacha Pass, Island Bay, and Caloosahatchee National Wildlife Refuges: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Pine Island, Matlacha Pass, Island Bay, and Caloosahatchee NWRs for the next 15 years....

  5. Introduced arctic fox eradication at Rat Island, Aleutian Islands, Alaska, summer 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Mechanical means similar to those employed on Amata Island during the summer of 1983 were used to attempt eradication of fox on Rat Island. These labor intensive...

  6. Narrative report Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge: Calendar year 1971

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge summarizes refuge activities for calendar year 1971....

  7. Narrative Report Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge: Calendar year 1970

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge summarizes refuge activities for calendar year 1970....

  8. Progress report on field studies in the Aleutian Islands, Semidi Islands and Bering Sea, 1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes work in the Aleutian Islands, Semidi Islands, and Bering Sea in support of work unit 953.10. Distribution and abundance of birds as seas work...

  9. CRED 20m Gridded bathymetry of Necker Islands, Northwestern Hawaiian Islands, USA (NetCDF format)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Gridded bathymetry of the shelf and slope environments of Necker Island, Northwestern Hawaiian Islands, Hawaii, USA. This netCDF includes multibeam bathymetry from...

  10. Energy Transition Initiative, Island Energy Snapshot - British Virgin Islands (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-03-01

    This profile provides a snapshot of the energy landscape of the British Virgin Islands (BVI), one of three sets of the Virgin Island territories in an archipelago making up the northern portion of the Lesser Antilles.

  11. Solomon Islands: Malaita Hub scoping report

    OpenAIRE

    Schwarz, A.M.; Andrew, N.; Govan, H.; Harohau, D.; Oeta, J.

    2013-01-01

    The CGIAR Research Program (CRP) Aquatic Agricultural Systems (AAS) will target five countries, including Solomon Islands. The proposed hubs for Solomon Islands were to cover most provinces, referencing the Western, Central and Eastern regions. Scoping of the initial ‘Central’ hub was undertaken in Guadalcanal, Malaita and Central Islands provinces and this report details findings from all three. As scoping progressed however, it was agreed that, based on the AAS context and priority need...

  12. The evolution of birdsong on islands

    OpenAIRE

    Morinay, Jennifer; Cardoso, Gonçalo C.; Doutrelant, Claire; Covas, Rita

    2013-01-01

    Islands are simplified, isolated ecosystems, providing an ideal set-up to study evolution. Among several traits that are expected to change on islands, an interesting but poorly understood example concerns signals used in animal communication. Islands are typified by reduced species diversity, increased population density, and reduced mate competition, all of which could affect communication signals. We used birdsong to investigate whether there are systematic changes in communication signals...

  13. Adakites from Solander Island, New Zealand

    International Nuclear Information System (INIS)

    The subduction related, island arc Pleistocene volcano of Solander Island in Foveaux Strait is composed of adakite, a new rock type first described from Adak Island in the Aleutian arc. Adakites are formed by the partial fusion of young oceanic crust under eclogitic facies conditions. Comparison with other adakite localities suggests that the oceanic crust presently subducting at the nearby trench may be <25 Ma old. (author). 23 refs., 5 figs., 2 tabs

  14. Water resources of the Palau Islands

    Science.gov (United States)

    Van der Brug, Otto

    1984-01-01

    The Palau Islands are a group of 350 islands, ranging in size from a few hundred square feet to the 153-square-mile island of Babelthuap. Babelthuap is the second largest island in the Western Pacific and comprises more than 80 percent of the total land area of the Palau Islands. Most of the islands are uninhabited limestone ridges covered with dense vegetation. These islands have no freshwater resources and are not included in this report. The island of Koror with an area of 3.6 square miles is the administrative, commercial, and population center of Palau and has an annual average rainfall of 148 inches. Short-term rainfall records at other locations in the islands indicate little variation in annual rainfall throughout the Palau Islands. Runoff-to-rainfall ratios for streams on Babelthuap show that about 70 percent of the rain falling on the island runs off to the ocean. The uniformity of rainfall and basin characteristics is shown by the excellent correlation between mean annual rainfall on Koror and streamflow on Babelthuap and by the close correlations between discharge at gaging stations and partial-record sites. Surface water quality is generally very good as shown by 55 chemical analyses of water from 18 sources. The dissolved solids concentration of water samples did not exceed 66 milligrams per liter. This report summarizes in one volume hydrologic data collection in a 14-year period of study and provides interpretations of the data than can be used by planners and public works officials as a basis for making decisions on the development and management of the islands ' water resources.

  15. Seabird modulations of isotopic nitrogen on islands

    OpenAIRE

    Caut, Stéphane; Angulo, Elena; Pisanu, Beinot; Ruffino, Lise; Faulquier, Lucie; Lorvelec, Olivier; Chapuis, Jean-Louis; Pascal, Michel; Vidal, Éric; Courchamp, Franck

    2012-01-01

    The transport of nutrients by migratory animals across ecosystem boundaries can significantly enrich recipient food webs, thereby shaping the ecosystems' structure and function. To illustrate the potential role of islands in enabling the transfer of matter across ecosystem boundaries to be gauged, we investigated the influence of seabirds on nitrogen input on islands. Basing our study on four widely differing islands in terms of their biogeography and ecological characteristics, sampled at di...

  16. Solomon Islands; Tax Summary and Statistical Appendix

    OpenAIRE

    International Monetary Fund

    2008-01-01

    This Tax Summary and Statistical Appendix for the Solomon Islands outlines the summary of various taxes. Residents are taxed on their worldwide income. Nonresidents are taxed on income sourced from the Solomon Islands. Both resident and nonresident investors undertaking commercial, economic, industrial or professional activity in the Solomon Islands may apply to the Commissioner of Inland Revenue for an exemption from income tax. An excise duty is levied on plugs, twist, fig, stick, cake, and...

  17. Summary Report: Asian Pacific Islander Workers Hearing

    OpenAIRE

    Asian Pacific American Labor Alliance; AFL-CIO; UCLA Labor Center

    2002-01-01

    The first ever California State Assembly Hearing on Asian Pacific Islander Workers was convened by the Labor Employment Committee and the Asian Pacific Islander Legislative Caucus, at the request of Assembly member Judy Chu. The Hearing brought together Asian Pacific Islander workers and advocates from all over California. Their stories are a snapshot of millions of workers. The testimonies gave a glimpse of the detrimental impact that worker exploitation has on families and communities. Most...

  18. Geology and petrology of Raiatea Island (Society islands, French Polynesia)

    International Nuclear Information System (INIS)

    Raiatea Island is made up of an alkali basaltic shield volcano, the upper 1000 m of which were emplaced between 2.75 and 2.52 Ma with an average construction rate of ca. 4 mm/year. Trachytic lavas were then emplaced between 2.54 and 2.44 Ma, both as flows and plugs along N-S trending fractures. Their geochemical characteristics point to a fractionation-controlled derivation from the basaltic magmas. Our new age set is consistent with a Pacific plate motion of 11 cm/year with respect to a fixed Society plume. (authors)

  19. Origin of pitchblende veins in the Union Island area, Great Slave Lake, Northwest Territories

    International Nuclear Information System (INIS)

    Pitchblende veins are sparsely distributed in an 8 x 1 km zone of northeast-trending, steeply dipping Aphebian sedimentary rocks deposited on Archean granitic basement and affected by complex faulting. They occur in brecciated dolomite of the Union Island Group on the east shore of Union Island, and along fractures subsidiary to a nearly vertical, northeast-trending fault between phyllites of this group and arkosic quartzite of the younger Sosan Group, which is exposed for a distance of 4 km on Opener Island to the east. The veins are close to the unconformity between the host rocks and the younger, gently dipping clastic redbeds of the Late Aphebian Et-Then Group, which most probably covered the mineralized zone at one time. A supergene origin for the veins is proposed on the basis of geological setting, mineralogy, presence of Ag, Se and V, isotopic dates on pitchblende, and lack of evidence for alternative magmatic or metamorphic hydrothermal sources

  20. Modeling the distribution of Norway rats (Rattus norvegicus) on offshore islands in the Falkland Islands

    OpenAIRE

    Tabak,Michael; Poncet, Sally; Passfield,Ken; Martinez del Rio, Carlos

    2015-01-01

    Non-native rats (Rattus spp.) threaten native island species worldwide. Efforts to eradicate them from islands have increased in frequency and become more ambitious in recent years. However, the long-term success of some eradication efforts has been compromised by the ability of rats, particularly Norway rats (Rattus norvegicus) which are good swimmers, to recolonize islands following eradications. In the Falkland Islands, an archipelago in the South Atlantic Ocean, the distance of 250 m betw...

  1. Molecular Evolutionary Consequences of Island Colonization

    Science.gov (United States)

    James, Jennifer E.; Lanfear, Robert; Eyre-Walker, Adam

    2016-01-01

    Island endemics are expected to have low effective population sizes (Ne), first because some may experience population bottlenecks when they are founded, and second because they have restricted ranges. Therefore, we expect island species to have reduced genetic diversity, inefficient selection, and reduced adaptive potential compared with their mainland counterparts. We used both polymorphism and substitution data to address these predictions, improving on the approach of recent studies that only used substitution data. This allowed us to directly test the assumption that island species have small values of Ne. We found that island species had significantly less genetic diversity than mainland species; however, this pattern could be attributed to a subset of island species that appeared to have undergone a recent population bottleneck. When these species were excluded from the analysis, island and mainland species had similar levels of genetic diversity, despite island species occupying considerably smaller areas than their mainland counterparts. We also found no overall difference between island and mainland species in terms of the effectiveness of selection or the mutation rate. Our evidence suggests that island colonization has no lasting impact on molecular evolution. This surprising result highlights gaps in our knowledge of the relationship between census and effective population size. PMID:27358424

  2. Escape from the island. Grammaticality and (reduced) acceptability of wh-island violations in Danish

    DEFF Research Database (Denmark)

    Christensen, Ken Ramshøj; Kizach, Johannes; Nyvad, Anne Mette

    2013-01-01

    -islands. We report results from two acceptability judgment experiments on long and short wh-movement and wh-extraction from wh-islands in Danish. The results revealed four main findings: (1) No adjunct/argument asymmetry in extraction from wh-islands. (2) Long adjunct wh-movement is less acceptable than long...

  3. Solid waste management on small islands: the case of Green Island, Taiwan

    NARCIS (Netherlands)

    Chen, M.C.; Ruijs, A.J.W.; Wesseler, J.H.H.

    2005-01-01

    Municipalities of small islands have limited capacities for waste disposal. In the case of Green Island, Taiwan, continuing with business as usual would only allow the disposal of waste on the island for another 8 years. Three alternatives for solid waste management (SWM) are compared. The cost-effe

  4. 33 CFR 110.6 - Portland Harbor, Portland, Maine (between Little Diamond Island and Great Diamond Island).

    Science.gov (United States)

    2010-07-01

    ... (between Little Diamond Island and Great Diamond Island). 110.6 Section 110.6 Navigation and Navigable... Areas § 110.6 Portland Harbor, Portland, Maine (between Little Diamond Island and Great Diamond Island). Beginning at the southeasterly corner of the wharf, at the most southerly point of Great Diamond Island...

  5. A genetic comparison of West Greenland and Baffin Island (Canada walruses: Management implications

    Directory of Open Access Journals (Sweden)

    Liselotte Wesley Andersen

    2013-08-01

    Full Text Available Until recently Atlantic walruses (Odobenus rosmarus rosmarus have been subject to relatively intense exploitation in West Greenland. Animals in this stock have also been hunted in Nunavut/Canada. However, the demographic identity of these animals and their connection with walruses in neighbouring areas is poorly resolved, hampering the determination of sustainable harvest levels. It has been suggested that walruses in West Greenland are genetically linked with walruses at SE Baffin Island (Canada where they are also hunted for subsistence purposes. To determine the relationship(s between walruses in these areas we conducted a genetic analysis including recent samples from West Greenland, Southeast Baffin Island in western Davis Strait, Hudson Strait in Canada and Northwest Greenland in northern Baffin Bay. Seventeen microsatellite markers were applied to all samples. Walruses in West Greenland and at Southeast Baffin Island did not differ from each other and therefore may be regarded as belonging to the same stock. However, walruses in these two areas differed genetically from both Northwest Greenland and Hudson Strait walruses. These findings support (1 that there are subunits within the range of walruses in the Hudson Strait-Davis Strait-Baffin Bay region and (2 that walruses along E Baffin Island and W Greenland constitute a common population that receive some influx from Hudson Strait. Thus, sustainable catch levels in Southeast Baffin Island (Nunavut and in West Greenland must be set in light of the finding that they belong to the same stock, which is exploited in these two areas. This requires Canadian-Greenlandic co-management of the W Greenland-SE Baffin Island walrus stock.

  6. In or On? Island Words, Island Worlds: II

    Directory of Open Access Journals (Sweden)

    Ronstrom Owe

    2011-11-01

    Full Text Available The first part of the paper examines uses and meanings of the orientational metaphors ‘in’, ‘on’, ‘out’ and ‘off’. In the discussed languages in North Western Europe there are general principles of metaphoric entailment and underlying image schemas that guide the choice of positional metaphor: islands you are normally ‘on’, and mainlands ‘in’. The second part of the paper examines cases where this use is debated or contested. The author finds that these contestations seem to be fuelled by the different relations between subject and object that positional metaphors entail. Expressions with ‘in’ highlight belonging and collective identity, enlarge objects by conceptualizing them as encompassing containers, and reduce subjects to a part of the object. Expressions with ‘on’ highlight individuality and agency, reduce the object, and enlarge the subject by placing it above the object. Such differing entailments of positional metaphors may influence how islands are positioned and understood.

  7. Li2Se as a Neutron Scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi-TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe

  8. The Ag{sub 2}Se-HgSe-SiSe{sub 2} system in the 0-60 mol.% SiSe{sub 2} region

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D

    2003-01-13

    Phase equilibria in the quasiternary Ag{sub 2}Se-HgSe-SiSe{sub 2} system were investigated using X-ray phase analysis. Its isothermal section at 298 K was constructed. The formation of the quaternary Ag{sub 6}HgSiSe{sub 6} phase was confirmed. The existence of the homogeneity range for this compound at 23-43 mol.% of Hg{sub 4}SiSe{sub 6} (Ag{sub 6.16-4.56}Hg{sub 0.92-1.72}SiSe{sub 6}) was determined. The formation of three new intermediate phases Ag{sub {approx}}{sub 7.04-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.48-{approx}}{sub 0.84}Si= Se{sub 6} ({beta}), Ag{sub {approx}}{sub 3.44-{approx}}{sub 2.96}Hg{sub {approx}}{sub 2.28-{approx}}{sub 2.52}Si= Se{sub 6} ({delta}) and Ag{sub 2}Hg{sub 3}SiSe{sub 6} ({epsilon}) was found. All phases are localized along the Ag{sub 8}SiSe{sub 6}-Hg{sub 4}SiSe{sub 6} section. The crystal structures of the {beta}-phase (for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} composition) and {delta}-phase (for the Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6} composition) were determined. Both phases crystallize with a cubic unit cell (space group F4-bar3m) with the lattice parameters a=1.08806(4) nm and a=1.07108(2) nm for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} and Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6}, respectively. Atomic parameters for them were refined in the anisotropic approximation [R{sub I}=0.0830 (Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6}) and R{sub I}=0.0950 (Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6})]. The crystal structure of the {epsilon}-phase is under investigation. The phase diagram of the HgSe-SiSe{sub 2} system was constructed in the range 0-60 mol.% SiSe{sub 2}. It was established that the Hg{sub 4}SiSe{sub 6} compound melts congruently at 1044 K and forms eutectics at {approx}12 mol.% SiSe{sub 2} (1023 K) and {approx}52 mol.% SiSe{sub 2} (961 K)

  9. Radioactivity of Rye Island waters

    International Nuclear Information System (INIS)

    The sources are discussed of radioactive contamination of water and processes are indicated affecting the occurrence of radionuclides in ground water, mainly sorption and desorption of radionuclides in the soil and soil properties in radionuclide migration. An analysis is made of the current radioactivity of surface and ground waters of the Rye Island, a fertile agricultural area in southern Slovakia. The gross alpha and beta activities and the concentrations of 90Sr, 137Cs, Ra and U were determined in water samples. The values found are lower than the maximum permissible concentrations. The gross beta activity of samples has increased in the past ten years. (H.S.)

  10. Island Falls 'A' dam repair

    International Nuclear Information System (INIS)

    Repairs to the Island Falls 'A' Dam located on the Churchill River in northern Saskatchewan is described. The dam was built in 1928-1930. It had suffered extensive freeze thaw damage and some portions of the structure did not meet minimum safety standards. The paper emphasizes concrete repair methodology, the design and installation of high strength steel anchors for stability enhancement, increasing structural capacity, re-establishment of drainage and re-design of spillway operations. The extensive involvement with the local First Nations community, which was critical to the successful completion of the job is also discussed

  11. The Bruny Island Radio Spectrometer

    Science.gov (United States)

    Erickson, W. C.

    1997-11-01

    A radio spectrometer has been built on Bruny Island, south of Hobart, for the study of solar bursts in the rarely observed frequency range from 3 to 20 MHz. This spectrometer is an adaptive device that employs digital techniques to avoid most of the strong terrestrial interference prevalent in this frequency range. The residual interference that cannot be avoided is excised during off-line processing. As a result, successful observations are made down to the minimum frequency that can propagate through the ionosphere to the antenna. This minimum frequency depends upon the zenith distance of the Sun and it is usually between 4 and 8 MHz.

  12. The Ag{sub 2}Se-HgSe-GeSe{sub 2} system and crystal structures of the compounds

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D.; Piskach, L.V

    2003-03-10

    The phase diagram of the quasi-ternary Ag{sub 2}Se-HgSe-GeSe{sub 2} system at 298 K was investigated using X-ray phase analysis and metallography. The formation of five intermediate quaternary phases {beta} (Ag{sub {approx}}{sub 7.12-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.44-{approx}}{sub 0.82}G= eSe{sub 6}), {gamma} (Ag{sub {approx}}{sub 6.08-{approx}}{sub 4.00}Hg{sub {approx}}{sub 0.96-{approx}}{sub 2.00}G= eSe{sub 6}), {delta} (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}), {epsilon} (Ag{sub {approx}}{sub 2.24-{approx}}{sub 2.00}Hg{sub {approx}}{sub 2.88-{approx}}{sub 3.00}G= eSe{sub 6}) and {approx}Ag{sub 1.4}Hg{sub 1.3}GeSe{sub 6} was established. The crystal structure of the {beta}-phase (for the Ag{sub 6.504}Hg{sub 0.912}GeSe{sub 6} composition) was determined using X-ray single crystal diffraction. It crystallizes in a cubic structure (space group F4-bar 3m) with the lattice parameter a=1.09026(4) nm. The crystal structure of the {delta}-phase (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}) was determined using X-ray powder diffraction (space group F4-bar 3m, a=1.07767(8) nm). The crystal structure determination of the {gamma}-phase (space group Pmn2{sub 1}) was performed for the compositions Ag{sub 5.6}Hg{sub 1.2}GeSe{sub 6}, Ag{sub 4.8}Hg{sub 1.6}GeSe{sub 6} and Ag{sub 4}Hg{sub 2}GeSe{sub 6} using X-ray powder diffraction. The crystal structure of the LT-Hg{sub 2}GeSe{sub 4} compound (space group I4-bar , a=0.56786(2), c=1.12579(5) nm) was confirmed by powder diffraction also.

  13. The Structure and Electrical Properties of the Ag2Se + Ga2Se3 + GeSe2 Glass System

    Science.gov (United States)

    Marple, Maxwell Adam Thomas

    Silver containing homogeneous chalcogenide glasses in the ternary system Ag2Se-Ga2Se3-GeSe2 (AGGS) are synthesized and their atomic structure-property relationships are investigated. Structural studies are carried out using Raman, 77Se, 71Ga, 69Ga, and 109Ag nuclear magnetic resonance (NMR) spectroscopy. The structure of these glasses consists primarily of a network of corner sharing (Ga/Ge)Se4/2 tetrahedra with a small fraction of homopolar Se-Se bonds. Compositional modification of the atomic structure follows the charge compensated network model developed in the literature for aluminosilicate glasses. Ag2Se acts as a network modifier, forming non-bridging Se in glasses with Ag/Ga >1, while Ga 2Se3 plays the role of a network intermediate similar to Al2O3 in oxide glasses. The network favors the formation of homopolar Ge-Ge bonding in glasses with Ag/Ga <1, to accommodate the Se deficiency brought by the incorporation of Ga2Se3 with Ga being tetrahedrally coordinated to Se. This structural model is consistent with the variation in the glass transition temperatures and molar volume. Electrical Impedance Spectroscopy (EIS) reveals the ionic conductivity of the AGGS glasses to be quite high at ambient temperature, reaching up to 10 --4 S/cm for glasses with the highest Ag content. Increasing Se deficiency with respect to stoichiometry can enhance the conductivity further to ˜3x10--4 S/cm . Transference number measurements using the electromotive force (EMF) method as well as variable temperature 109Ag NMR line shape studies indicate that the conductivity is predominantly ionic in nature and results from fast hopping dynamics of Ag ions. The high ionic conductivity can be related to a heavily modified structural network that results in a potential energy landscape with many suitable hopping sites for the Ag ions. These structural characteristics and electrical properties of the glasses in the AGGS system may guide in the development of next generation fast ion

  14. Energy Transition Initiative, Island Energy Snapshot - Grenada (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-03-01

    This profile provides a snapshot of the energy landscape of Grenada - a small island nation consisting of the island of Grenada and six smaller islands in the southeastern Caribbean Sea - three of which are inhabited: Grenada, Carriacou, and Petite Martinique.

  15. Monitoring Supports Establishment of Pacific Remote Islands Marine National Monument

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The U.S. Pacific Remote Islands consist of Howland, Baker, and Jarvis Islands, Johnston, Wake, and Palmyra Atolls, and Kingman Reef. Except for Wake, these islands...

  16. Reindeer and seabird survey of Hagemeister Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report describes the survey effort on Hagemeister Island in the Alaska Maritime NWR. Hagemeister Island is the second largest Bering Sea Island. Reindeer, red...

  17. St. Vincent Island White-Tailed Deer Monitoring Program

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The white tailed deer herd on St. Vincent Island represents an important part of the island's biotic community. To maintain the integrity of the island's deer...

  18. A PRELIMINARY REPORT ON PERMAFROST OCCURRENCE IN SEYMOUR ISLAND (MARAMBIO ISLAND), ANTARCTIC PENINSULA REGION

    OpenAIRE

    フクダ, マサミ; Masami, FUKUDA; Arturo E., CORTE

    1989-01-01

    Seymour Island (Marambio Island, 64°S 56°W) in the Weddel Sea is located near James Ross Island. As there was no ice-sheet over the island during and after the last glaciation period, the ground has remained frozen and permafrost of considerable depth has developed in the ground. The authors conducted the field survey related to the genesis and occurrence of permafrost in the island. The Japan-Argentina joint expedition was established by the support of Grant-in-Aid for Overseas Scientific Re...

  19. A NUMERICAL STUDY OF THE EFFECT OF TAIWAN ISLAND TERRAIN ON TYPHOON HAITANG (0505) TRACK

    Institute of Scientific and Technical Information of China (English)

    YU Zhen-shou; HOU Qiu-feng; WANG Hai-dong; WU Xian-du; LI Huai-chun

    2008-01-01

    The track of Typhoon Haitang (0505), which passed through the Taiwan Island and landed again,has been successfully simulated by using the non-hydrostatic mesoscale atmospheric model MM5. Itsstructure is analyzed on the landing stage, and it is found that there exist good relationships between thetyphoon abnormal moving track and its asymmetry structure. The effect of terrain of Taiwan Island on thetyphoon Haitang, which made it rotate before landing and present a "V" type abnormal moving track inTaiwan straits, has also been simulated. Further analysis shows that the terrain of Taiwan Island not onlydirectly affects the typhoon moving track, but also changes the typhoon track by affecting its asymmetricstructure. Therefore, the typhoon asymmetric structure and the effect of terrain of Taiwan Island togetherresults in the abnormal rotating track. The terrain of Taiwan Island tends to increase the SW-NEasymmetric structure of the typhoon and has different effect on SE-NW asymmetric structure during thelandfall process of typhoon Haitang before entering and moving out of the Taiwan straits.

  20. Phase equilibrium in the AgInSe2-CdSe system

    International Nuclear Information System (INIS)

    Results of phase equilibrium in the AgInSe2-CdSe system by differential thermal, X-ray, microstructural analyses and measurements of microhardness are given. The system is quasibinary with limited solubility of the components in the solid state. The region of solid solution on the base of AgInSe2 is 4 mol.% CdSe (820 K). The ranges of solid solutions on the base of CdSe are much larger (up to 40 mol.% AgInSe2 at 820 K). Coordinates of eutectic point are 10 mol.% CdSe, 1023 K. The alloy AgCd2InSe4 is located in the solid solution ranges based on CdSe. (author)

  1. Semiconductor-metal transition of Se in Ru-Se Catalyst Nanoparticles

    Science.gov (United States)

    Babu, P. K.; Lewera, Adam; Oldfield, Eric; Wieckowski, Andrzej

    2009-03-01

    Ru-Se composite nanoparticles are promising catalysts for the oxygen reduction reaction (ORR) in fuel cells. Though the role of Se in enhancing the chemical stability of Ru nanoparticles is well established, the microscopic nature of Ru-Se interaction was not clearly understood. We carried out a combined investigation of ^77Se NMR and XPS on Ru-Se nanoparticles and our results indicate that Se, a semiconductor in elemental form, becomes metallic when interacting with Ru. ^77Se spin-lattice relaxation rates are found to be proportional to T, the well-known Korringa behavior characteristic of metals. The NMR results are supported by the XPS binding energy shifts which suggest that a possible Ru->Se charge transfer could be responsible for the semiconductor->metal transition of Se which also makes Ru less susceptible to oxidation during ORR.

  2. Synthesis and characterization of ZnSe:Fe/ZnSe core/shell nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Lin; Zhu, Jianguo, E-mail: yanglin_1028@163.com; Xiao, Dingquan

    2014-04-15

    High-quality ZnSe:Fe/ZnSe core/shell nanocrystals were prepared via a hydrothermal microemulsion technique. Effective surface passivation of monodisperse ZnSe:Fe nanocrystals is achieved by overcoating them with a ZnSe shell. The samples were characterized by means of XRD, EDX, TEM, PSD, XPS, photoluminescence, and Raman spectrum. The results show that the as-synthesized nanocrystals are cubic zinc blende ZnSe structure with high purity and the average particle size of ZnSe:Fe/ZnSe core/shell nanocrystal is larger than that of ZnSe:Fe core. The growth of ZnSe shell causes a small red shift in PL spectra, and then the PL quantum yield (QY) increases from 16% before shell growth to the maximum of 37% after increasing shell thickness up to 1.2 monolayers (ML). Moreover, both transverse optic (TO) and longitudinal optic (LO) phonon modes of ZnSe are shifted toward lower frequency as compared with the reported ones. -- Highlights: • ZnSe:Fe/ZnSe core/shell QDs were prepared by a hydrothermal microemulsion method. • ZnSe shell efficiently passivates surface defects by serving as a physical barrier. • The particle size and PL properties can be turned with the growth of ZnSe shell. • The luminescence efficiency and stability of QDs could be improved in this manner.

  3. Opportunity at 'Cook Islands' (Vertical)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,825th Martian day, or sol, of Opportunity's surface mission (March 12, 2009). North is at the top. This view is presented as a vertical projection with geometric seam correction. The rover had driven half a meter (1.5 feet) earlier on Sol 1825 to fine-tune its location for placing its robotic arm onto an exposed patch of outcrop including a target area informally called 'Cook Islands.' On the preceding sol, Opportunity turned around to drive frontwards and then drove 4.5 meters (15 feet) toward this outcrop. The tracks from the SOl 1824 drive are visible near the center of this view at about the 11 o'clock position. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Opportunity had previously been driving backward as a strategy to redistribute lubrication in a wheel drawing more electrical current than usual. The outcrop exposure that includes 'Cook Islands' is visible just below the center of the image. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

  4. Opportunity at 'Cook Islands' (Polar)

    Science.gov (United States)

    2009-01-01

    NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,825th Martian day, or sol, of Opportunity's surface mission (March 12, 2009). North is at the top. This view is presented as a polar projection with geometric seam correction. The rover had driven half a meter (1.5 feet) earlier on Sol 1825 to fine-tune its location for placing its robotic arm onto an exposed patch of outcrop including a target area informally called 'Cook Islands.' On the preceding sol, Opportunity turned around to drive frontwards and then drove 4.5 meters (15 feet) toward this outcrop. The tracks from the SOl 1824 drive are visible near the center of this view at about the 11 o'clock position. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Opportunity had previously been driving backward as a strategy to redistribute lubrication in a wheel drawing more electrical current than usual. The outcrop exposure that includes 'Cook Islands' is visible just below the center of the image. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock.

  5. Unrecognized hemoglobin SE disease as microcytosis

    OpenAIRE

    Smith, Avery; Cooper, Barry; Guileyardo, Joseph; Mora, Adan

    2016-01-01

    Hemoglobin SE disease was first described during the 1950s as a relatively benign microcytosis, but increasing prevalence has revealed a predisposition towards vasoocclusive sickling. Recognition of SE hemoglobinopathies’ potential complications is crucial so medical measures can be utilized to avoid multiorgan injury.

  6. Analysis of One-Bond Se-Se Nuclear Couplings in Diselenides and 1,2-Diselenoles on the Basis of Molecular Orbital Theory: Torsional Angular Dependence, Electron Density Influence, and Origin in J1(Se, Se)

    OpenAIRE

    Waro Nakanishi; Satoko Hayashi; Akito Tanioku

    2009-01-01

    Nuclear couplings for the Se-Se bonds, 1 J(Se, Se), are analyzed on the basis of the molecular orbital (MO) theory. The values are calculated by employing the triple ζ basis sets of the Slater type at the DFT level. 1 J(Se, Se) are calculated modeled by MeSeSeMe (1a), which shows the typical torsional angular dependence on ϕ(CMeSeSeCMe). The dependence explains well the observed 1 J obsd (Se, Se) of small values (≤ 64 Hz) for RSeSeR′ (1) (simple derivatives of 1a) and large values (330–380 Hz...

  7. Debt Management Performance Assessment : Solomon Islands

    OpenAIRE

    World Bank, (WB)

    2009-01-01

    From February 19 to 28, 2009, a World Bank team undertook a debt management performance assessment (DeMPA) mission to Honiara, Solomon Islands. The objective was to undertake a comprehensive assessment of debt management functions applying the DeMPA tool. The assessment reveals that the Solomon Islands meets the minimum requirements for effective debt management performance as specified by...

  8. The water landscapes of the Canary Islands

    DEFF Research Database (Denmark)

    Lee, Gini; Braae, Ellen Marie; Diedrich, Lisa

    2013-01-01

    Island environments, particularly small archipelagos such as the Canary Islands, are more visible subject to the vagaries of change wrought by ecological and climate dynamics, shifting social conditions and economic impacts subject to global markets, than is witnessed on continental worlds....

  9. Protection of Marine Structures by Artificial Islands

    DEFF Research Database (Denmark)

    Simonsen, Bo Cerup; Ottesen Hansen, N.E.

    1998-01-01

    The theoretical background for the ship protection islands for the Great Belt suspension bridge in Denmark is presented. The islands protect two anchor blocks and five approach bridge piers of the Great Belt Suspension Bridge in Denmark. The design is a complex multi-discipline task. Besides prot...

  10. Early hominin biogeography in Island Southeast Asia.

    Science.gov (United States)

    Larick, Roy; Ciochon, Russell L

    2015-01-01

    Island Southeast Asia covers Eurasia's tropical expanse of continental shelf and active subduction zones. Cutting between island landmasses, Wallace's Line separates Sunda and the Eastern Island Arc (the Arc) into distinct tectonic and faunal provinces. West of the line, on Sunda, Java Island yields many fossils of Homo erectus. East of the line, on the Arc, Flores Island provides one skeleton and isolated remains of Homo floresiensis. Luzon Island in the Philippines has another fossil hominin. Sulawesi preserves early hominin archeology. This insular divergence sets up a unique regional context for early hominin dispersal, isolation, and extinction. The evidence is reviewed across three Pleistocene climate periods. Patterns are discussed in relation to the pulse of global sea-level shifts, as well as regional geo-tectonics, catastrophes, stegodon dispersal, and paleogenomics. Several patterns imply evolutionary processes typical of oceanic islands. Early hominins apparently responded to changing island conditions for a million-and-a-half years, likely becoming extinct during the period in which Homo sapiens colonized the region. PMID:26478140

  11. Teaching island studies: on whose terms?

    Directory of Open Access Journals (Sweden)

    Kathleen Stuart

    2010-11-01

    Full Text Available Island studies can be deceptively difficult for inexperienced undergraduates due to the field’s trans-disciplinary and international scope, advanced academic content and engagement with a wide range of cognitive processes and methodologies. At the same time, island studies can potentially transform and motivate students on a personal level by tapping into their experiential knowledge when they adopt an island-centred standpoint. Such a stance is challenging to measure and not automatically or readily achieved. A teacher of island studies must therefore be sensitive to presenting and studying islands ‘on their own terms’, but realistic as to what progress can be made at an introductory level by general students. This paper draws upon the author’s experience in teaching the core introductory survey course in island studies to undergraduates at the University of Prince Edward Island from 2007 to 2009. That experience is examined in light of the dilemmas which relate to indigenous island geographies.

  12. Long Island Sound Curricular Resource Guide

    Science.gov (United States)

    Payne, Diana, Ed.

    2009-01-01

    Long Island Sound is an estuary of national significance and provides important economic, recreational, and aesthetic value to the citizens of Connecticut and New York. Investigations have been conducted regarding living marine resources and nutrient loading. However, Long Island Sound is often overlooked as an educational resource. This guide is…

  13. Rhode Island School Terrorist Attack Preparedness

    Science.gov (United States)

    Dube, Michael W. M.

    2012-01-01

    This study examined the state of safety and terrorist attack preparedness in Rhode Island Schools as determined by Rhode Island school leader perceptions. The study is descriptive in nature as it gathers data to describe a particular event or situation. Using a researcher generated survey based on terrorist preparedness guidelines and suggestions…

  14. 40 CFR 81.340 - Rhode Island.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 17 2010-07-01 2010-07-01 false Rhode Island. 81.340 Section 81.340... AREAS FOR AIR QUALITY PLANNING PURPOSES Section 107 Attainment Status Designations § 81.340 Rhode Island. Rhode Island—TSP Designated area Does not meet primary standards Does not meet secondary...

  15. Distribution of Grimmia Hedw. on Mediterranean islands

    NARCIS (Netherlands)

    Greven, H.C.

    1995-01-01

    On the six largest Mediterranean islands: Corsica, Crete, Cyprus, Mallorca, Sardinia and Sicily, the moss genus Grimmia (Grimmiaceae, Musci) is represented by 29 species. Many of these are newly recorded. The importance of the islands for bryophyte conservation is stressed. -Author

  16. The avifauna of Flores (Lesser Sunda Islands)

    NARCIS (Netherlands)

    Mees, G.F.

    2006-01-01

    The avifauna of the island of Flores (Lesser Sunda Islands) is reviewed. Introductory sections, which include a chapter on the history of ornithological discovery, are followed by the main part, a systematic account in which each species and subspecies known from Flores is treated separately. A disc

  17. Barrier island vulnerability to breaching: a case study on Dauphin Island, Alabama

    Science.gov (United States)

    Hansen, Mark; Sallenger, Asbury H.

    2007-01-01

    Breaching of barrier islands can adversely impact society by severing infrastructure, destroying private properties, and altering water quality in back bays and estuaries. This study provides a scheme that assesses the relative vulnerability of a barrier island to breach during storms. Dauphin Island, Alabama was selected for this study because it has a well documented history of island breaches and extensive geological and geomorphic data. To assess the vulnerability of the island, we defined several variables contributing to the risk of breaching: island geology, breaching history, and island topography and geomorphology. These variables were combined to form a breaching index (BI) value for cross island computational bins, each bin every 50 m in the alongshore direction. Results suggest the eastern section of Dauphin Island has the lowest risk of breaching with the remaining portion of the island having a moderate to high risk of breaching. Two reaches in the western section of the island were found to be particularly vulnerable due primarily to their minimal cross-sectional dimensions.

  18. Association between sedentary behaviour and socioeconomic factors, diet and lifestyle among the Balearic Islands adolescents

    OpenAIRE

    Bibiloni Maria del Mar; Pich Jordi; Córdova Alfredo; Pons Antoni; Tur Josep A

    2012-01-01

    Abstract Background Many different factors influenced food habits and physical activity patterns of adolescents in a complex interactive way. The aim of this study was to assess association between sedentary behaviour and socioeconomic factors, diet and lifestyle among the Balearic Islands adolescents. Methods A cross-sectional survey (n = 1961; 12–17 years old) was carried out. Physical activity was assessed using the International Physical Activity Questionnaire for adolescents (IPAQ-A). Se...

  19. Cs2UPd3Se6

    Directory of Open Access Journals (Sweden)

    George N. Oh

    2011-02-01

    Full Text Available Dicaesium uranium(IV tripalladium(II hexaselenide, Cs2UPd3Se6, crystallizes in the space group Fmmm in the Ba2NaCu3O6 structure type. The asymmetric unit comprises the following atoms with site symmetries as shown: U1 (mm2, Cs1 (222, Cs2 (m2m, Pd1 (.m., Pd2 (2mm, Se1 (m.., and Se2 (1. This layered structure contains six edge-sharing square-planar [PdSe4] units that form a hexagon. These, in turn, edge-share with [USe6] trigonal–prismatic units, forming an extended layer parallel to (010. The layers are stacked along [010]. They are staggered, and are separated by the Cs atoms. The Cs atoms are either coordinated in a square antiprism of Se atoms or are ten-coordinate, with one square face and the opposite face hexagonal.

  20. Effects of magnetic islands on drift wave instability

    International Nuclear Information System (INIS)

    Magnetic islands have been implemented in the gyrokinetic toroidal code to study the effects of the islands on microturbulence. The pressure profile flattening is verified in the simulation with the islands. Simulations of ion temperature gradient instability find that different toroidal modes are linearly coupled together and that toroidal spectra become broader when the island width increases. The real frequencies and growth rates of different toroidal modes approach each other with the averaged value independent of the island width. The linear mode structures are enhanced at the island separatrices and weakened at the island centers, consistent with the flattening of the pressure profile inside the islands

  1. Genomic island excisions in Bordetella petrii

    Directory of Open Access Journals (Sweden)

    Levillain Erwan

    2009-07-01

    Full Text Available Abstract Background Among the members of the genus Bordetella B. petrii is unique, since it is the only species isolated from the environment, while the pathogenic Bordetellae are obligately associated with host organisms. Another feature distinguishing B. petrii from the other sequenced Bordetellae is the presence of a large number of mobile genetic elements including several large genomic regions with typical characteristics of genomic islands collectively known as integrative and conjugative elements (ICEs. These elements mainly encode accessory metabolic factors enabling this bacterium to grow on a large repertoire of aromatic compounds. Results During in vitro culture of Bordetella petrii colony variants appear frequently. We show that this variability can be attributed to the presence of a large number of metastable mobile genetic elements on its chromosome. In fact, the genome sequence of B. petrii revealed the presence of at least seven large genomic islands mostly encoding accessory metabolic functions involved in the degradation of aromatic compounds and detoxification of heavy metals. Four of these islands (termed GI1 to GI3 and GI6 are highly related to ICEclc of Pseudomonas knackmussii sp. strain B13. Here we present first data about the molecular characterization of these islands. We defined the exact borders of each island and we show that during standard culture of the bacteria these islands get excised from the chromosome. For all but one of these islands (GI5 we could detect circular intermediates. For the clc-like elements GI1 to GI3 of B. petrii we provide evidence that tandem insertion of these islands which all encode highly related integrases and attachment sites may also lead to incorporation of genomic DNA which originally was not part of the island and to the formation of huge composite islands. By integration of a tetracycline resistance cassette into GI3 we found this island to be rather unstable and to be lost from

  2. Quantifying and interpreting nestedness in habitat islands

    DEFF Research Database (Denmark)

    Matthews, Thomas J.; Cottee-Jones, H. Eden W.; Whittaker, Robert James

    2015-01-01

    Aim: The concept of nestedness is important in determining the relative contribution to overall system diversity of different habitat patches within a fragmented system. Much of the previous work on nestedness has focused on islands within oceans (islands sensu stricto). The largest analysis...... of habitat island systems to date found significant nestedness to be a near universal feature, but the methods used have since been criticized as inappropriate. Thus, there is a need for an updated, critical examination of the prevalence, underlying drivers and implications of nestedness in multiple habitat...... island systems. Location: Global. Methods: Here, we collate 97 datasets from published habitat island studies, comprising multiple taxa. We use the NODF metric (nestedness metric based on overlap and decreasing fill) to estimate nestedness and determine significance using the four-step proportional...

  3. On Some Physical Properties of GeSe3-Sb2Se3-ZnSe Thin Films and Their Radiation Response

    International Nuclear Information System (INIS)

    Thin films of the chalcogenides GeSe3, Sb2Se3, ZnSe, (GeSe3)80(Sb2Se3)20 and (GeSe3)70(Sb2Se3)10(ZnSe)20, are prepared by thermal evaporation onto glass substrates. The effect of ZnSe incorporation with both GeSe3, Sb2Se3 results in amorphous (GeSe3)70(Sb2Se3)10(ZnSe)20 composition as obtained from the X-ray analysis. Electrical measurements reveal a decrease in dc activation energy, ΔEdc, and an increase in ac activation energy, ΔEac, for (GeSe3)70(Sb2Se3)10(ZnSe)20 as compared with (GeSe3)80(Sb2Se3)20. Optical energy gap, Eg, and band tail width, Ee, are estimated in UV/VIS spectral region for fresh and γ-irradiated films, revealing a decrease in Eg and an increase in Ee for ZnSe and (GeSe3)70(Sb2Se3)10(ZnSe)20 compositions, with irradiation dose.

  4. Rising sea levels and small island states

    International Nuclear Information System (INIS)

    A review is given of the problems small island nations face with respect to sea level rise caused by global warming. Many small island nations are very vulnerable to sea level rise. Particularly at risk are coral reef atolls, which are generally quite small, lie within three metres of current sea levels, and have no land at higher elevations to relocate populations and economic activity. Volcanic islands in the Pacific have high ground, but it is largely rugged, high relief and soil-poor. The most vulnerable islands are those that consist entirely of atolls and reef islands, such as Kirabai, Maldives, Tokelau and Tuvalu. Small island states, which by themselves have little power or influence in world affairs, have banded together to form the Strategic Alliance of Small Island States (AOSIS). This alliance had grown to include 42 states by the time of the 1992 U.N. Earth Summit. Although the greenhouse effect is mainly caused by industrial nations, developing countries will suffer the most from it. Choices of response strategy will depend on environmental, economic and social factors. Most small island nations do not have the resources to fight sea level rise in the way that the Dutch have. Retreat can occur as a gradual process or as catastrophic abandonment. Prohibiting construction close to the water's edge is a good approach. Sea level histories for each island state should be compiled and updated, island geomorphology and settlement patterns should be surveyed to determine risk areas, storm regimes should be determined, and information on coastal impacts of sea level rise should be disseminated to the public

  5. Glass formation and the third harmonic generation of Cu2Se-GeSe2-As2Se3 glasses

    Science.gov (United States)

    Reshak, A. H.; Klymovych, O. S.; Myronchuk, G. L.; Zamuruyeva, O. V.; Zmiy, O. F.; Alahmed, Z. A.; Chyský, J.; Bila, Jiri; Kamarudin, H.

    2014-10-01

    We have performed the investigation of the nonlinear optical properties namely the third harmonic generation (THG) of the glass-formation region in the Cu2Se-GeSe2-As2Se3 system. The samples were synthesized by direct single-temperature method from high-purity elementary substances. We have found that the value of disorder parameter Δ depends on the composition of the glassy alloys. The measurements show that increasing the Cu2Se concentration leads to increased slope of the absorption edge, which may be explained by the decrease of the height of random potential relief for the electrons in the tails of the state density which border the band edges. A very sharp increase in the THG at low temperature was observed. Significant enhancement in THG was obtained with decreasing the energy gap, which agreed well with the nonlinear optical susceptibilities obtained from other glasses.

  6. Radar Image of Galapagos Island

    Science.gov (United States)

    1994-01-01

    This is an image showing part of Isla Isabella in the western Galapagos Islands. It was taken by the L-band radar in HH polarization from the Spaceborne Imaging Radar C/X-Band Synthetic Aperture Radar on the 40th orbit of the space shuttle Endeavour. The image is centered at about 0.5 degree south latitude and 91 degrees west longitude and covers an area of 75 by 60 kilometers (47 by 37 miles). The radar incidence angle at the center of the image is about 20 degrees.The western Galapagos Islands, which lie about 1,200 kilometers (750 miles) west of Ecuador in the eastern Pacific, have six active volcanoes similar to the volcanoes found in Hawaii. Since the time of Charles Darwin's visit to the area in 1835, there have been over 60 recorded eruptions of these volcanoes. This SIR-C/X-SAR image of Alcedo and Sierra Negra volcanoes shows the rougher lava flows as bright features, while ash deposits and smooth pahoehoe lava flows appear dark. A small portion of Isla Fernandina is visible in the extreme upper left corner of the image.The Galapagos Islands are one of the SIR-C/X-SAR supersites and data of this area will be taken several times during the flight to allow scientists to conduct topographic change studies and to search for different lava flow types, ash deposits and fault lines.Spaceborne Imaging Radar-C and X-Synthetic Aperture Radar (SIR-C/X-SAR) is part of NASA's Mission to Planet Earth. The radars illuminate Earth with microwaves allowing detailed observations at any time, regardless of weather or sunlight conditions. SIR-C/X-SAR uses three microwave wavelengths: L-band (24 cm), C-band (6 cm) and X-band (3 cm). The multi-frequency data will be used by the international scientific community to better understand the global environment and how it is changing. The SIR-C/X-SAR data, complemented by aircraft and ground studies, will give scientists clearer insights into those environmental changes which are caused by nature and those changes which are induced by

  7. Patterns of island treeline elevation – a global perspective

    DEFF Research Database (Denmark)

    Irl, Severin David Howard; Anthelme, Fabian; Harter, David E. V.;

    2016-01-01

    hypothesize that, similar to the mainland, latitude-driven temperature variation is the most important determinant of island treeline elevation on a global scale. To test this hypothesis, we compared mainland with island treeline elevations. Then we focused 1) on the global effects of latitude, 2) on the...... regional effects of island type (continental vs oceanic islands) and 3) the local effects of several specific island characteristics (age, area, maximum island elevation, isolation and plant species richness). We collected a global dataset of islands (n = 86) by applying a stratified design using Google......Earth and the Global Island Database. For each island we extracted data on latitude and local characteristics. Treeline elevation decreased from the mainland through continental to oceanic islands. Island treeline elevation followed a hump-shaped latitudinal distribution, which is fundamentally different...

  8. Adsorption behavior and current-voltage characteristics of CdSe nanocrystals on hydrogen-passivated silicon

    DEFF Research Database (Denmark)

    Walzer, Karsten; Quaade, Ulrich; Ginger, D.S.;

    2002-01-01

    Using scanning tunneling microscopy and spectroscopy we have studied both the geometric distribution and the conduction properties of organic shell capped CdSe nanocrystals adsorbed on hydrogen-passivated Si(100). At submonolayer concentrations, the nanocrystal distribution on the surface was found...... to be highly nonhomogeneous, with an aggregation of most of the nanocrystals into islands of monolayer thickness. I-V spectra collected on nanocrystals adsorbed on n- and p-type substrates showed a strong difference in the conduction behavior, caused by the substrate: CdSe nanocrystals on n...

  9. SRTM Stereo Pair: Fiji Islands

    Science.gov (United States)

    2000-01-01

    The Sovereign Democratic Republic of the Fiji Islands, commonly known as Fiji, is an independent nation consisting of some 332 islands surrounding the Koro Sea in the South Pacific Ocean. This topographic image shows Viti Levu, the largest island in the group. With an area of 10,429 square kilometers (about 4000 square miles), it comprises more than half the area of the Fiji Islands. Suva, the capital city, lies on the southeast shore. The Nakauvadra, the rugged mountain range running from north to south, has several peaks rising above 900 meters (about 3000 feet). Mount Tomanivi, in the upper center, is the highest peak at 1324 meters (4341 feet). The distinct circular feature on the north shore is the Tavua Caldera, the remnant of a large shield volcano that was active about 4 million years ago. Gold has been mined on the margin of the caldera since the 1930s. The Nadrau plateau is the low relief highland in the center of the mountain range. The coastal plains in the west, northwest and southeast account for only 15 percent of Viti Levu's area but are the main centers of agriculture and settlement.This stereoscopic view was generated using preliminary topographic data from the Shuttle Radar Topography Mission. A computer-generated artificial light source illuminates the elevation data from the top (north) to produce a pattern of light and shadows. Slopes facing the light appear bright, while those facing away are shaded. Also, colors show the elevation as measured by SRTM. Colors range from green at the lowest elevations to pink at the highest elevations. This image contains about 1300 meters (4300 feet) of total relief. The stereoscopic effect was created by first draping the shading and colors back over the topographic data and then generating two differing perspectives, one for each eye. The 3-D perception is achieved by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the

  10. Crystalline islands of semiconductor films

    Science.gov (United States)

    Zmievskaya, G. I.; Bondareva, A. L.

    2011-01-01

    Silicon carbide (SiC) nucleation in the form of powder in a discharge plasma and the formation of thin film islands on a Si(100) substrate in the course of gas-phase epitaxy are simulated numerically. Models of plasma-like media and nonequilibrium processes accompanying phase transitions of the first kind (such as condensation and crystallization) in the initial fast (fluctuation) stage are described. The nonstationary evolution of nuclei size distribution functions is modeled by solving kinetic equations in partial derivatives and stochastic Ito-Stratonovich analog equations. This makes it possible to refine the formation mechanisms of microcrystalline state polytypes and calculate the nucleation rate and the initial roughness of a SiC coating.

  11. Opportunity at 'Cook Islands' (Stereo)

    Science.gov (United States)

    2009-01-01

    [figure removed for brevity, see original site] Left-eye view of a color stereo pair for PIA11854 [figure removed for brevity, see original site] Right-eye view of a color stereo pair for PIA11854 NASA's Mars Exploration Rover Opportunity used its navigation camera to take the images combined into this full-circle view of the rover's surroundings during the 1,825th Martian day, or sol, of Opportunity's surface mission (March 12, 2009). North is at the top. This view combines images from the left-eye and right-eye sides of the navigation camera. It appears three-dimensional when viewed through red-blue glasses with the red lens on the left. The rover had driven half a meter (1.5 feet) earlier on Sol 1825 to fine-tune its location for placing its robotic arm onto an exposed patch of outcrop including a target area informally called 'Cook Islands.' On the preceding sol, Opportunity turned around to drive frontwards and then drove 4.5 meters (15 feet) toward this outcrop. The tracks from the SOl 1824 drive are visible near the center of this view at about the 11 o'clock position. For scale, the distance between the parallel wheel tracks is about 1 meter (about 40 inches). Opportunity had previously been driving backward as a strategy to redistribute lubrication in a wheel drawing more electrical current than usual. The outcrop exposure that includes 'Cook Islands' is visible just below the center of the image. The terrain in this portion of Mars' Meridiani Planum region includes dark-toned sand ripples and lighter-toned bedrock. This view is presented as a cylindrical-perspective projection with geometric seam correction.

  12. Amchitka Island, Alaska, special sampling project 1997

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, Nevada Operations Office

    2000-06-28

    This 1997 special sampling project represents a special radiobiological sampling effort to augment the 1996 Long-Term Hydrological Monitoring Program (LTHMP) for Amchitka Island in Alaska. Lying in the western portion of the Aleutian Islands arc, near the International Date Line, Amchitka Island is one of the southernmost islands of the Rat Island Chain. Between 1965 and 1971, the U.S. Atomic Energy Commission conducted three underground nuclear tests on Amchitka Island. In 1996, Greenpeace collected biota samples and speculated that several long-lived, man-made radionuclides detected (i.e., americium-241, plutonium-239 and -240, beryllium-7, and cesium-137) leaked into the surface environment from underground cavities created during the testing. The nuclides of interest are detected at extremely low concentrations throughout the environment. The objectives of this special sampling project were to scientifically refute the Greenpeace conclusions that the underground cavities were leaking contaminants to the surface. This was achieved by first confirming the presence of these radionuclides in the Amchitka Island surface environment and, second, if the radionuclides were present, determining if the source is the underground cavity or worldwide fallout. This special sampling and analysis determined that the only nonfallout-related radionuclide detected was a low level of tritium from the Long Shot test, which had been previously documented. The tritium contamination is monitored and continues a decreasing trend due to radioactive decay and dilution.

  13. Fuelwood production in Prince Edward Island

    International Nuclear Information System (INIS)

    The most recent Prince Edward Island Fuelwood Survey occurred in 1990-91. Consumption of fuelwood rose again to 49% of Prince Edward Island's 43,170 households. Total residential fuelwood consumption was estimated to be 242,000 m3. The fuelwood industry makes an important contribution to the economy of Prince Edward Island. In the 1990-91 heating season, fuelwood valued at USD 9 million displaced approximately 43 million litres of domestic heating oil valued at USD 16.4 million. In addition, it is estimated that 70 cents of every dollar spent on fuelwood remains in the province and contributes spin-off benefits, whereas 90 cents of every dollar spent on heating oil is lost to the economy of Prince Edward Island. The percentage of people cutting their own fuelwood decreased from 52 in 1984-85 to only 23.4 in 1990-91. The governments of Canada and Prince Edward Island have implemented a series of Forest Resource Development Agreements (FRDAs) starting in 1983. The current 1988-1993 FRDA provides USD 24 million for research and incentives for reforestation and management of Prince Edward Island woodlots. It is expected that 3,800 Prince Edward Island woodlot owners will be participating in a woodlot management program by 1993. Silviculture treatments of hardwood stands include thinning, stand conversion (removal of lowgrade softwoods such as balsam fir in mainly hardwood stands), and shelterwood (strip) cutting, particularly in marginal stands. (9 refs.)

  14. Solving the shape conundrum in $^{70}$Se

    CERN Multimedia

    We propose a multi-step Coulomb-excitation study of $^{70}$Se at HIE-ISOLDE using the $^{208}$Pb( $^{70}$Se, $^{70}$Se*)$^{208}$Pb* reaction at a safe energy of 5.0 MeV/u. We aim at a precise measurement of the $\\left \\langle 2^{+}_{1} \\hspace{0.1cm} || \\hspace{0.1cm}\\hat{E}2 \\hspace{0.1cm} || \\hspace{0.1cm}2^{+}_{ 1} \\right \\rangle$ diagonal matrix element as well as gaining information on additional matrix elements. Such information will shed light onto the shape conundrum of the 2$^{+}_{1}$ state in $^{70}$Se as well as foreseeing the opportunity for a more detailed understanding of the shape-coexistence phenomenon in this region.

  15. Breeding productivity of Smith Island black ducks

    Science.gov (United States)

    Haramis, G.M.; Jorde, D.G.; Olsen, G.H.; Stotts, D.B.; Harrison, M.K.

    2002-01-01

    We investigated the breeding performance of American black ducks (Anas rubripes) on Smith Island, Chesapeake Bay, to improve our understanding of island black duck breeding ecology and to make management recommendations to enhance productivity. During 1995-96, we implanted 56 female black ducks with 20-g radio transmitters and tracked 35 of the individuals through the breeding season to locate nests, determine nest fate, and identify brood habitat. We also increased preseason banding efforts and compared capture characteristics over 12 years with those from the Deal Island Wildlife Management Area, a banding site on the mainland of Tangier Sound. A low rate of nesting (37%), lack of renesting, and poor hatching success (31%) indicated that island salt marsh habitats present a harsh environment for breeding black ducks. Black ducks located 11 of 13 nests (85%) in black needlerush (Juncus roemerianus) marsh where they were vulnerable to flooding from extreme tides and to egg predators. No nests were found on forested tree hammocks, a feature that distinguishes Smith Island from nearby South Marsh and Bloodsworth Islands. Nest predators included red foxes (Vulpes vulpes), herring gulls (Larus argentams), fish crows (Corvus ossifragus), and, potentially, Norway rats (Rattus norvegicus). Unlike mainland red foxes, foxes radio tracked on Smith Island were found to be capable swimmers and effective low marsh predators. We found shoreline meadows of widgeon grass (Ruppia maritima) to be important foraging sites for black ducks and suspected that the virtual absence of fresh water in this high salinity environment (1217+ ppt) to incur some cost in terms of growth and survival of ducklings. Preseason bandings revealed a high proportion of banded adults and a strong positive correlation in age ratios with the Deal Island banding site. This latter finding strongly suggests a negative universal effect of storm tides on nest success for Tangier Sound black ducks. Management to

  16. Spectral Motion Synchronization in SE(3)

    OpenAIRE

    Arrigoni, Federica; Fusiello, Andrea; Rossi, Beatrice

    2015-01-01

    This paper addresses the problem of motion synchronization (or averaging) and describes a simple, closed-form solution based on a spectral decomposition, which does not consider rotation and translation separately but works straight in SE(3), the manifold of rigid motions. Besides its theoretical interest, being the first closed form solution in SE(3), experimental results show that it compares favourably with the state of the art both in terms of precision and speed.

  17. Magnetic properties of FeSe superconductor

    OpenAIRE

    Grechnev, G. E.; Panfilov, A.S.; Desnenko, V. A.; Fedorchenko, A. V.; Gnatchenko, S. L.; Chareev, D. A.; Volkova, O. S.; A.N. Vasiliev

    2012-01-01

    A detailed magnetization study for the novel FeSe superconductor is carried out to investigate the behavior of the intrinsic magnetic susceptibility $\\chi$ in the normal state with temperature and under hydrostatic pressure. The temperature dependencies of $\\chi$ and its anisotropy $\\Delta \\chi=\\chi_{|}-\\chi_{\\bot}$ are measured for FeSe single crystals in the temperature range 4.2-300 K, and a substantial growth of susceptibility with temperature is revealed. The observed anisotropy $\\Delta ...

  18. The system SnTe-InSe

    International Nuclear Information System (INIS)

    This paper discusses the nature of the interaction and physicochemical properties of the alloys of the system SnTe-InSe. The DTA was performed on an NTR-74 pyrometer, XPA on a Dron-2.0 diffractometer and MSA on an MIM-7 metallographic microscope. The microhardness of the samples was determined on a PMT-3 microhardness tester. The congruently melting compound SnInTeSe and solid solutions based on the starting components are formed in the system

  19. MAGNETIC ANOMALY IN SUPERCONDUCTING FeSe

    OpenAIRE

    Mendoza, D.; Benitez, J. L.; Morales, F.; Escudero, R.

    2010-01-01

    Synthesis, electrical and magnetic characterization of superconducting FeSe0.85 compound is reported. An anomaly in the magnetization against temperature around 90K is observed. Magnetic characterization of a commercial compound with nominal FeSe stoichiometry is also presented. The overall magnetic behaviors as well as the magnetic anomaly in both compounds are discussed in terms of magnetic impurities and secondary phases. Keyword: A. Superconductors

  20. Double electron capture searches in $^{74}$Se

    CERN Document Server

    Lehnert, B; Degering, D; Sommer, D; Wagner, L; Zuber, K

    2016-01-01

    A search for various double electron capture modes of $^{74}$Se has been performed using an ultralow background Ge-detector in the Felsenkeller laboratory, Germany. Especially for the potentially resonant transition into the 1204.2 keV excited state of $^{74}$Ge a lower half-life limit of $0.70\\cdot 10^{19}$ yr (90% credibility) has been obtained. Serious concerns are raised about the validity of obtained $^{74}$Se limits in some recent publications.

  1. Exciton-Phonon Scattering in CdSe/ZnSe Quantum Dots

    Institute of Scientific and Technical Information of China (English)

    张立功; 申德振; 范希武; 吕少哲

    2002-01-01

    A temperature-dependent photoluminescence measurement is performed in CdSe/ZnSe quantum dots with a ZnCdSe quantum well. We deduce the temperature dependence of the exciton linewidth and peak energy of the zero-dimensional exciton in the quantum dots and two-dimensional exciton in the CdSe wetting layer. The experimental data reveal a reduction of homogeneous broadening of the exciton line in the quantum dots in comparison with that in the two-dimensional wetting layer, which indicates the decrease of exciton and optical phonon coupling in the CdSe quantum dots.

  2. Atomistic Model of Physical Ageing in Se-rich As-Se Glasses

    Energy Technology Data Exchange (ETDEWEB)

    Golovchak,R.; Shpotyuk, O.; Kozdras, A.; Bureau, B.; Vlcek, M.; Ganjoo, A.; Jain, H.

    2007-01-01

    Thermal, optical, X-ray excited and magnetic methods were used to develop a microstructural model of physical ageing in Se-rich glasses. The glass composition As10Se90, possessing a typical cross-linked chain structure, was chosen as a model object for the investigations. The effect of physical ageing in this glass was revealed by differential scanning calorimetry, whereas the corresponding changes in its atomic arrangement were studied by extended X-ray absorption fine structure, Raman and solid-state 77Se nuclear magnetic resonance spectroscopy. Straightening-shrinkage processes are shown to be responsible for the physical ageing in this Se-rich As-Se glass.

  3. Partial pressure diagrams of the In-Se-O and Ga-Se-O systems

    International Nuclear Information System (INIS)

    The partial pressure diagrams of the In-Se-O and Ga-Se-O systems in the po2 and pSeO2 coordinates have been discussed. The mono- and invariant equilibria have been calculated using isothermal Want-Hoff equation. The relationships between the partial pressure diagrams and the condensed phase equilibrium diagrams have been established. It has been shown that the increase of the SeO2 partial pressure leads to the formation of the A2III Se3 compounds and the formation of oxide phases requires relatively high pressures of oxygen

  4. Whale shark (Rhincodon typus seasonal presence, residence time and habitat use at darwin island, galapagos marine reserve.

    Directory of Open Access Journals (Sweden)

    David Acuña-Marrero

    Full Text Available The life history of the whale shark (Rhincodon typus, including its reproductive ecology, still remains largely unknown. Here, we present results from the first whale shark population study around Darwin Island, Galapagos Marine Reserve. Following a diversified approach we characterized seasonal occurrence, population structure and size, and described habitat use of whale sharks based on fine scale movements around the island. Whale shark presence at Darwin Island was negatively correlated with Sea Surface Temperature (SST, with highest abundance corresponding to a cool season between July and December over six years of monitoring. From 2011 to 2013 we photo-identified 82 whale sharks ranging from 4 to 13.1 m Total Length (TL. Size distribution was bimodal, with a great majority (91.5% of adult female individuals averaging 11.35 m±0.12 m (TL±SE, all but one showing signs of a potential pregnancy. Population dynamics models for apparently pregnant sharks estimated the presence of 3.76±0.90 (mean ± SE sharks in the study area per day with an individual residence time of 2.09±0.51 (mean ± SE days. Movement patterns analysis of four apparently pregnant individuals tracked with acoustic tags at Darwin Island revealed an intense use of Darwin's Arch, where no feeding or specific behavior has been recorded, together with periodic excursions around the island's vicinity. Sharks showed a preference for intermediate depths (20-30 m with occasional dives mostly to mid-water, remaining the majority of their time at water temperatures between 24-25°C. All of our results point to Darwin Island as an important stopover in a migration, possibly with reproductive purposes, rather than an aggregation site. Current studies carried out in this area to investigate regional scale movement patterns may provide essential information about possible pupping grounds for this enigmatic species.

  5. Whale shark (Rhincodon typus) seasonal presence, residence time and habitat use at darwin island, galapagos marine reserve.

    Science.gov (United States)

    Acuña-Marrero, David; Jiménez, Jesús; Smith, Franz; Doherty, Paul F; Hearn, Alex; Green, Jonathan R; Paredes-Jarrín, Jules; Salinas-de-León, Pelayo

    2014-01-01

    The life history of the whale shark (Rhincodon typus), including its reproductive ecology, still remains largely unknown. Here, we present results from the first whale shark population study around Darwin Island, Galapagos Marine Reserve. Following a diversified approach we characterized seasonal occurrence, population structure and size, and described habitat use of whale sharks based on fine scale movements around the island. Whale shark presence at Darwin Island was negatively correlated with Sea Surface Temperature (SST), with highest abundance corresponding to a cool season between July and December over six years of monitoring. From 2011 to 2013 we photo-identified 82 whale sharks ranging from 4 to 13.1 m Total Length (TL). Size distribution was bimodal, with a great majority (91.5%) of adult female individuals averaging 11.35 m±0.12 m (TL±SE), all but one showing signs of a potential pregnancy. Population dynamics models for apparently pregnant sharks estimated the presence of 3.76±0.90 (mean ± SE) sharks in the study area per day with an individual residence time of 2.09±0.51 (mean ± SE) days. Movement patterns analysis of four apparently pregnant individuals tracked with acoustic tags at Darwin Island revealed an intense use of Darwin's Arch, where no feeding or specific behavior has been recorded, together with periodic excursions around the island's vicinity. Sharks showed a preference for intermediate depths (20-30 m) with occasional dives mostly to mid-water, remaining the majority of their time at water temperatures between 24-25°C. All of our results point to Darwin Island as an important stopover in a migration, possibly with reproductive purposes, rather than an aggregation site. Current studies carried out in this area to investigate regional scale movement patterns may provide essential information about possible pupping grounds for this enigmatic species. PMID:25551553

  6. Whale Shark (Rhincodon typus) Seasonal Presence, Residence Time and Habitat Use at Darwin Island, Galapagos Marine Reserve

    Science.gov (United States)

    Acuña-Marrero, David; Jiménez, Jesús; Smith, Franz; Doherty, Paul F.; Hearn, Alex; Green, Jonathan R.; Paredes-Jarrín, Jules; Salinas-de-León, Pelayo

    2014-01-01

    The life history of the whale shark (Rhincodon typus), including its reproductive ecology, still remains largely unknown. Here, we present results from the first whale shark population study around Darwin Island, Galapagos Marine Reserve. Following a diversified approach we characterized seasonal occurrence, population structure and size, and described habitat use of whale sharks based on fine scale movements around the island. Whale shark presence at Darwin Island was negatively correlated with Sea Surface Temperature (SST), with highest abundance corresponding to a cool season between July and December over six years of monitoring. From 2011 to 2013 we photo-identified 82 whale sharks ranging from 4 to 13.1 m Total Length (TL). Size distribution was bimodal, with a great majority (91.5%) of adult female individuals averaging 11.35 m±0.12 m (TL±SE), all but one showing signs of a potential pregnancy. Population dynamics models for apparently pregnant sharks estimated the presence of 3.76±0.90 (mean ± SE) sharks in the study area per day with an individual residence time of 2.09±0.51 (mean ± SE) days. Movement patterns analysis of four apparently pregnant individuals tracked with acoustic tags at Darwin Island revealed an intense use of Darwin's Arch, where no feeding or specific behavior has been recorded, together with periodic excursions around the island's vicinity. Sharks showed a preference for intermediate depths (20–30 m) with occasional dives mostly to mid-water, remaining the majority of their time at water temperatures between 24–25°C. All of our results point to Darwin Island as an important stopover in a migration, possibly with reproductive purposes, rather than an aggregation site. Current studies carried out in this area to investigate regional scale movement patterns may provide essential information about possible pupping grounds for this enigmatic species. PMID:25551553

  7. In Brief: Tsunami hits the Solomon Islands

    Science.gov (United States)

    Zielinski, Sarah

    2007-04-01

    A magnitude 8.1 earthquake shook the Solomon Islands on 1 April at approximately 7:40 A.M. local time. The earthquake generated a tsunami several meters high that struck many of the islands. The earthquake occurred along the boundary of the Pacific plate where the Australia, Woodlark, and Solomon Sea plates subduct beneath it, according to the U.S. Geological Survey's Earthquake Hazards Program. At least 34 people were killed by the tsunami and several dozen more are still missing, according to the National Disaster Council in the Solomon Islands. The NDC estimates that 900-2500 homes were destroyed by the tsunami, displacing about 5500 people.

  8. Isotopic investigation of an Australian island environment

    International Nuclear Information System (INIS)

    Collagen has been extracted from fossil bones of mega-fauna herbivores from Kangaroo Island, South Australia (Australia). Carbon and nitrogen stable isotope analyses of collagen have provided an insight into the palaeo-ecology of these late Pleistocene herbivores. In comparison with continental fossil localities in South Australia, the island herbivores have elevated nitrogen isotopic abundances. Carbon isotopic abundances suggest that browsing species had a mixed diet of grasses and leaves on the island, in contrast to the specimens from mainland Australia. Possible causes regarding elevated nitrogen isotope abundances and dietary shifts in this palaeo-ecology are discussed. (authors). 24 refs., 2 figs., 1 tab

  9. [Biodemographical study in the Island of Pascua].

    Science.gov (United States)

    Lazo, B; Campusano, C; Figueroa, H

    1993-06-01

    The aim of this study was to know the degree of miscegenation in the Easter Island population. One hundred two weddings carried out between 1987 and 1991 were recorded and the proportion of marriages between islanders and immigrants was analyzed. Also, ABO and Rh blood groups of all deliveries occurred between 1988 and 1991 were compiled. There was a particular tendency of islanders to marry with immigrants and the proportion of miscegenation was 75.5%. Additionally a decline in the frequency of A blood group is observed, comparing results from studies performed since 1932 up to date. PMID:8278694

  10. Case study: Bioremediation in the Aleutian Islands

    International Nuclear Information System (INIS)

    This case study describes the design, construction, and operation of a bioremediation pile on Adak Island, which is located in the Aleutian Island chain. Approximately 1,900 m3 of petroleum-contaminated soil were placed in the bioremediation pile. The natural bioremediation process was enhanced by an oxygen and nutrient addition system to stimulate microbial activity. Despite the harsh weather on the island, after the first 6 months of operation, laboratory analyses of soil samples indicated a significant (80%) reduction in diesel concentrations

  11. The Maltese Islands : climate, vegetation and landscape

    OpenAIRE

    Schembri, Patrick J.

    1997-01-01

    The Maltese Islands, situated in the central Mediterranean, occupy an area of only some 316 km. The climate is typically Mediterranean: the average annual rainfall is c.530mm of which some 85% falls during the period October to March; the mean monthly temperature range is 12-26°C, and the islands are very windy and sunny. Although small, the Maltese Islands have a considerable diversity of landscapes and ecosystems which are representative of the range and variety of those of the Mediterranea...

  12. FBSAB RECRUIT Reef Fish Belt Transect Survey at Hawaii Island (Big Island), Main Hawaiian Islands, 2009 (NODC Accession 0073870)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Shore-based belt transects were conducted at 1 to ~ 5 m depths at a total two (2) sites on the leeward coast (South Kohala district) of the Big Island (Hawaii...

  13. FBSAD Recruit Reef Fish Belt Transect Survey at Hawaii Island (Big Island), Main Hawaiian Islands, 2005 (NODC Accession 0046935)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Shore-based belt transects were conducted at 8-13 m depths at 3 longshore sites on the leeward coast (North and South Kohala districts) of the Big Island (Hawaii...

  14. Studying Islands: On Whose Terms? Some Epistemological and Methodological Challenges to the Pursuit of Island Studies

    Directory of Open Access Journals (Sweden)

    Godfrey Baldacchino

    2008-05-01

    Full Text Available The pursuit of nissology, or island studies, calls for a re-centering of focus from mainland to island, away from the discourse of conquest of mainlanders, giving voice and platform for the expression of island narratives. Yet, studying islands ‘on their own terms’, in spite of its predilection for “authenticity”, is fraught with epistemological and methodological difficulties. The insider/outsider distinction does not work all that well when it comes to islands, where hybridity is the norm. This paper seeks to extend this debate, grappling especially with the contributions of Grant McCall and Peter Hay to the sparse literature. Five dilemmas related to indigenous island geographies are presented and discussed, in a semi-autobiographical style.

  15. Habitat islands and the equilibrium theory of island biogeography: testing some predictions

    Science.gov (United States)

    Brown, M.; Dinsmore, J.J.

    1988-01-01

    Species-area data from a study of marsh birds are used to test five predictions generated by the equilibrium theory of island biogeography. Three predictions are supported: we found a significant species-area relationship, a non-zero level of turnover, and a variance-mean ratio of 0.5. One prediction is rejected: the extinction rates were not greater on small islands. The results of one test are equivocal: the number of species on each island was not always the same. As Gilbert (1980) suggests, a strong species-area relationship alone does not validate the theory. The avian communities we studied were on habitat islands, not true islands, and underwent complete extinction annually. Thus caution must be used before applying the theory to these and other habitat islands.

  16. 50 CFR 216.85 - Walrus and Otter Islands.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Walrus and Otter Islands. 216.85 Section... MAMMALS Pribilof Islands Administration § 216.85 Walrus and Otter Islands. By Executive Order 1044, dated February 27, 1909, Walrus and Otter Islands were set aside as bird reservations. All persons are...

  17. Effect of composition on optical properties of GeSe3–Sb2Se3–ZnSe thin films

    Indian Academy of Sciences (India)

    M R Balboul; H M Hosni; M A Soliman; S A Fayek

    2014-10-01

    Optical properties of the chalcogenides GeSe3, Sb2Se3, ZnSe, (GeSe3)80(Sb2Se3)20 and (GeSe3)70 (Sb2Se3)10(ZnSe)20 thin films are investigated. Incorporation of ZnSe into both GeSe3, Sb2Se3 results in amorphous (GeSe3)70(Sb2Se3)10(ZnSe)20 composition. The estimated optical energy gap, g, is found to decrease from 3.06 eV for ZnSe to 1.81 eV for (GeSe3)70(Sb2Se3)10(ZnSe)20. While, the band tail width, e, exhibits an opposite trend. The g behaviour is believed to be associated with cohesive energy, CE, as the incorporation of ZnSe lowers its value. The calculated number of the excess of Se–Se homopolar bonds is found to affect mainly the e values. The refractive index, , is discussed in terms of Wemple–DiDomenico single oscillator dispersion model in the normal dispersion region. The oscillator energy, o, and the dispersion energy, d, are determined for films under investigation.

  18. Structure, composition and age of the small islands of Santa Luzia, Branco and Raso (Cape Verde Archipelago)

    Science.gov (United States)

    Ancochea, Eumenio; Huertas, María José; Hernán, Francisco; Brändle, José Luis; Alonso, Mar

    2015-09-01

    The northern alignment of Cape Verde Archipelago contains three small islands in its central sector: Santa Luzia, Branco and Raso on which there is very scarce geological, petrological or geochronological information available. The three islands along with the island of São Vicente arise on a continuous underwater relief less than 50 m deep and about 70 km long that formed from separate volcanic edifices. The southernmost island, Raso is formed by accumulation of several tens of lava flows and some remaining strombolian cones. An erosion surface covered by sediments allows the separation of two different episodes of growth: the lower one older than 2 Ma, and the upper one between 0.9 and 1.2 Ma. The smaller island of Branco is the remnant of a large stratovolcano about 6 km in radius, 1000 m of altitude and between 5 and 6 Ma in age. Santa Luzia, the northernmost and largest island of this particular group is essentially a remaining rift zone between 4 and 7 Ma old, at least 600 m high, about 10 km long and 7 km wide. The SE extreme of the island is occupied by rocks of an older partially submarine stage of growth which, also include gabbroic intrusions crossed by a dense network of dikes whose age may be estimated in 8 Ma or more. On the contrary, the NW end shows the only remains of late post-erosion activity that is of much less volumetric importance and it has been dated between 0.8 and 1.4 Ma. The three islands as a whole are formed by moderately or strongly alkaline, basic and ultrabasic rocks similar to those found in the neighboring island of São Vicente. Ultraalkaline rocks only appear in Raso and differentiate types as trachyandesites and phonolites are exclusively found in Santa Luzia. The similar age found for the main stages of growth recorded in the mentioned four islands and, even more, in the other two islands: Santo Antão and São Nicolau situated at the end of the Barlovento alignment, are not easily comprehensible with evolution models

  19. Local stakeholders perception on development possibilities of Croatian islands - example of the island of Cres

    OpenAIRE

    Ivan Đogić; MARIJA Cerjak

    2015-01-01

    Croatian islands are characterized by a specific relief, climate, tradition, customs and history, which influenced their economic development. Agriculture, along with fisheries and maritime affairs, has always been the main economic activity in the islands. However, the economic situation changed in recent decades and today the islands’ economy relies heavily on tourism. Still, preserved nature and social relations present the biggest competitive advantage of the islands. High-quality agricul...

  20. IslandViewer 3: more flexible, interactive genomic island discovery, visualization and analysis

    OpenAIRE

    Dhillon, Bhavjinder K.; Laird, Matthew R.; Shay, Julie A.; Winsor, Geoffrey L; Lo, Raymond; Nizam, Fazmin; Pereira, Sheldon K.; Waglechner, Nicholas; McArthur, Andrew G.; Langille, Morgan G I; Brinkman, Fiona S. L.

    2015-01-01

    IslandViewer (http://pathogenomics.sfu.ca/islandviewer) is a widely used web-based resource for the prediction and analysis of genomic islands (GIs) in bacterial and archaeal genomes. GIs are clusters of genes of probable horizontal origin, and are of high interest since they disproportionately encode genes involved in medically and environmentally important adaptations, including antimicrobial resistance and virulence. We now report a major new release of IslandViewer, since the last release...

  1. "Sex and the Island": Lives of Single Women in Prince Edward Island

    OpenAIRE

    COLLINS, Kristen

    2011-01-01

    This article considers the significance attributed to Prince Edward Island in managing a marginalized single female identity, as presented by accounts of thirty never-married and previously-married Island women, aged twenty-seven through sixty-five. As popular media and social narratives overwhelmingly position contemporary single women against an urban backdrop, the question arises as to whether unmarried Island women feel "marooned" in ways their urban counterparts may not. In accordance wi...

  2. Abundance and survival rates of the Hawai'i Island associated spinner dolphin (Stenella longirostris stock.

    Directory of Open Access Journals (Sweden)

    Julian A Tyne

    Full Text Available Reliable population estimates are critical to implement effective management strategies. The Hawai'i Island spinner dolphin (Stenella longirostris is a genetically distinct stock that displays a rigid daily behavioural pattern, foraging offshore at night and resting in sheltered bays during the day. Consequently, they are exposed to frequent human interactions and disturbance. We estimated population parameters of this spinner dolphin stock using a systematic sampling design and capture-recapture models. From September 2010 to August 2011, boat-based photo-identification surveys were undertaken monthly over 132 days (>1,150 hours of effort; >100,000 dorsal fin images in the four main resting bays along the Kona Coast, Hawai'i Island. All images were graded according to photographic quality and distinctiveness. Over 32,000 images were included in the analyses, from which 607 distinctive individuals were catalogued and 214 were highly distinctive. Two independent estimates of the proportion of highly distinctive individuals in the population were not significantly different (p = 0.68. Individual heterogeneity and time variation in capture probabilities were strongly indicated for these data; therefore capture-recapture models allowing for these variations were used. The estimated annual apparent survival rate (product of true survival and permanent emigration was 0.97 SE ± 0.05. Open and closed capture-recapture models for the highly distinctive individuals photographed at least once each month produced similar abundance estimates. An estimate of 221 ± 4.3 SE highly distinctive spinner dolphins, resulted in a total abundance of 631 ± 60.1 SE, (95% CI 524-761 spinner dolphins in the Hawai'i Island stock, which is lower than previous estimates. When this abundance estimate is considered alongside the rigid daily behavioural pattern, genetic distinctiveness, and the ease of human access to spinner dolphins in their preferred resting habitats, this

  3. Anomalous scaling of Cu-island dynamics on Ag(100)

    Energy Technology Data Exchange (ETDEWEB)

    Zaum, Christopher; Morgenstern, Karina [Institut fuer Festkoerperphysik, Gottfried Wilhelm Leibniz Universitaet, Appelstr. 2, D-30167 Hannover (Germany)

    2008-07-01

    We deposited Cu-islands containing 10 to 500 atoms on a clean Ag(100) surface at room temperature and investigated diffusion and decay of these islands with a fast scanning tunneling microscope. Islands at sizes above 80 atoms per island are adsorbed in hollow-sites. Islands at sizes below 80 atoms per island are adsorbed in bridge-sites. Diffusion and decay behavior of the hollow-site islands is similar to the behavior of both Ag-islands on Ag(100) and Cu-islands on Cu(100). In contrast, the diffusivity and the decay time of the bridge-site islands are significantly higher than any previously measured values. This indicates a novel mechanism of diffusion.

  4. Señalización y seguridad vial

    OpenAIRE

    García Verduch, Antonio

    1992-01-01

    Se explica el suceso de que un autobús con 55 pasajeros se salió de la autopista y sufrió un accidente, se pide que se esclarezcan los hechos y que se dote de mejor señalización a las carreteras españolas

  5. Long Island Smart Energy Corridor

    Energy Technology Data Exchange (ETDEWEB)

    Mui, Ming [Long Island Power Authority, Uniondale, NY (United States)

    2015-02-04

    The Long Island Power Authority (LIPA) has teamed with Stony Brook University (Stony Brook or SBU) and Farmingdale State College (Farmingdale or FSC), two branches of the State University of New York (SUNY), to create a “Smart Energy Corridor.” The project, located along the Route 110 business corridor on Long Island, New York, demonstrated the integration of a suite of Smart Grid technologies from substations to end-use loads. The Smart Energy Corridor Project included the following key features: -TECHNOLOGY: Demonstrated a full range of smart energy technologies, including substations and distribution feeder automation, fiber and radio communications backbone, advanced metering infrastructure (AM”), meter data management (MDM) system (which LIPA implemented outside of this project), field tools automation, customer-level energy management including automated energy management systems, and integration with distributed generation and plug-in hybrid electric vehicles. -MARKETING: A rigorous market test that identified customer response to an alternative time-of-use pricing plan and varying levels of information and analytical support. -CYBER SECURITY: Tested cyber security vulnerabilities in Smart Grid hardware, network, and application layers. Developed recommendations for policies, procedures, and technical controls to prevent or foil cyber-attacks and to harden the Smart Grid infrastructure. -RELIABILITY: Leveraged new Smart Grid-enabled data to increase system efficiency and reliability. Developed enhanced load forecasting, phase balancing, and voltage control techniques designed to work hand-in-hand with the Smart Grid technologies. -OUTREACH: Implemented public outreach and educational initiatives that were linked directly to the demonstration of Smart Grid technologies, tools, techniques, and system configurations. This included creation of full-scale operating models demonstrating application of Smart Grid technologies in business and residential

  6. Local stakeholders perception on development possibilities of Croatian islands - example of the island of Cres

    Directory of Open Access Journals (Sweden)

    Ivan Đogić

    2015-03-01

    Full Text Available Croatian islands are characterized by a specific relief, climate, tradition, customs and history, which influenced their economic development. Agriculture, along with fisheries and maritime affairs, has always been the main economic activity in the islands. However, the economic situation changed in recent decades and today the islands’ economy relies heavily on tourism. Still, preserved nature and social relations present the biggest competitive advantage of the islands. High-quality agricultural products together with agricultural tradition and lifestyle of the islanders can be used for tourism purposes. High quality and uniqueness of agricultural products, specific traditions and technologies of cultivation and production together with the existing tourism demand are basic preconditions for strengthening the ties of agriculture and tourism. Development of agriculture and tourism in the islands should be based on local initiative and involvement of islanders in defining strategic development guidelines, as tourism development of the islands seeks coexistence with local, traditional culture. The aim of this paper is to show the possibilities for the development of agriculture and tourism on the island of Cres, based on the opinions and attitudes of local stakeholders. For this purpose we performed 3-round Delphi study with 17 local experts who agreed on the major issues of agriculture and tourism on the island and identified steps that should be taken in the future for further development of these activities.

  7. Adaptive radiation of island plants: Evidence from Aeonium (Crassulaceae) of the Canary Islands

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Olesen, J.M.

    2001-01-01

    discussion of the mechanisms governing radiations on islands. Most examples are from the Hawaiian and Canarian floras, and in particular from studies on the morphological, ecological and molecular diversification of the genus Aeonium, the largest plant radiation of the Canarian Islands.......The presence of diverse and species-rich plant lineages on oceanic islands is most often associated with adaptive radiation. Here we discuss the possible adaptive significance of some of the most prominent traits in island plants, including woodiness, monocarpy and sexual dimorphisms. Indirect...

  8. Channel Islands, Kelp Forest Monitoring, Sea Temperature

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset from the Channel Islands National Park's Kelp Forest Monitoring Program has subtidal temperature data taken at permanent monitoring sites. Since 1993,...

  9. US Virgin Islands Abandoned Vessel Inventory

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for US Virgin Islands. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction of...

  10. Pacific Islands Climate Change Virtual Library

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Virtual Library provides access to web based climate variability and climate change information and tools relevant to the Pacific Islands including case...

  11. Natural History of St. Vincent Island, Florida

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A study proposal aiming to ascertain, list and describe the woody flora and vertebrate fauna of St. Vincent Island, and to describe the terrestrial and fresh water...

  12. Inventory and Monitoring Plan for Howland Island, Baker Island, Jarvis Island National Wildlife Refuges; Units of the Pacific Remote Islands Marine National Monuments

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This plan documents and prioritizes inventory and monitoring surveys and research currently conducted, and proposed to be conducted, at the Howland Island, Baker...

  13. Anaho Island: Mammalian species richness report

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This study assessed the mammalian species richness on Anaho Island using live trapping between July 18th and July 23rd 2005. The last mammalian species richness...

  14. 1981 rock ptarmigan census, Adak Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Most of the Aleutian Islands support populations of rock ptarmigan Lagopus mutus, where their abundance is believed to be greatly influenced by the abundance of...

  15. Mackay Island NWR Annual Narrative Report 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Mackay Island NWR outlines activities and accomplishments during the 2001 calendar year. The report begins with an introduction to...

  16. Marine mammal observations, Amchitka Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Three marine mammals were regularly observed at Amchitka Island: sea otters (Enhydra lutris), Steller's sea lions (Eumetopias jubata), and harbor seals (Phoca...

  17. CRED REA Algal Assessments, Howland Island 2006

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Twelve quadrats were sampled along 2 consecutively-placed, 25m transect lines as part of Rapid Ecological Assessments conducted at 4 sites at Howland Island in the...

  18. 1- HARPs of the Pacific Islands Region

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset contains information on acoustic recordings of cetaceans collected from areas within the Pacific Islands Region since 2006. In collaboration with...

  19. Butterfly Survey on Pinckney Island NWR (2001)

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Butterfly (adult Lepidoptera) survey conducted monthly (May-Nov 2001) at nine locations within Pinckney Island NWR. These nine locations include Ibis Pond,...

  20. EAARL Topography-Padre Island National Seashore

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Elevation maps (also known as Digital Elevation Models or DEMs) of Padre Island National Seashore were produced from remotely-sensed, geographically-referenced...

  1. St. Vincent Island : Then and Now

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report captures the memories and observations of Charles F. Marks, Jr. who lived on St. Vincent Island as a child. He recalls what it was like growing up on...

  2. Poplar Island Environmental Restoration Project Nekton Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Poplar Island Environmental Restoration Project (PIERP) is a large scale 1,800 acres restoration project located in mid Chesapeake Bay. Fishery collections are...

  3. Principal Hawaiian Islands Geoid Heights (GEOID96)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This 2' geoid height grid for the Principal Hawaiian Islands is distributed as a GEOID96 model. The computation used 61,000 terrestrial and marine gravity data held...

  4. Urban Heat Island Effect Actions - Neighborhood Data

    Data.gov (United States)

    Louisville Metro Government — The urban heat island effect — defined as the difference in temperature between the core of Louisville and its suburbs — contributes to heat-related illnesses and...

  5. Hawaii Abandoned Vessel Inventory, Hawaii Island

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for Hawaii Island. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction of coral...

  6. Hawaii Abandoned Vessel Inventory, Midway Island, NWHI

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for Midway Island, NWHI. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction of...

  7. Hillshades for the main 8 Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These hillshade datasets were derived from USGS 7.5' DEM Quads for the main 8 Hawaiian Islands. Individual DEM quads were first converted to a common datum, and...

  8. 2007 Solomon Islands, Papua New Guinea Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — An earthquake measuring 8.1 struck 345 kilometers northwest of the Solomon Islands' capital Honiara at 0740 local time on 2 April. (2040 GMT 1 April). The...

  9. Breeding peregrine falcon survey, Amchitka Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A breeding peregrine falcon (Falco peregrines) survey was conducted on Amchitka Island, Alaska Maritime National Wildlife Refuge from May 2-9, 1981 in conjunction...

  10. Marine investigations in the Lakshadweep Islands, India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    to navigators through the ages. Recent discoveries made during marine archaeological exploration and excavations in the Lakshadweep have revealed evidences of early settlement and shipwrecks. The findings suggest that the islands had been inhabited much before...

  11. Cross Island Evaluation and Management Plan 1986

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this study is to provide Hurricane Island Outward Bound School with a document that to be used for internal planning purposes. In addition, it could...

  12. Vegetation of Long Island, Adams County, Illinois

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — During the spring and early summer of 1994 most of Long Island, part of the Mark Twain NWR, was walked, and six east/west transects established. During July each...

  13. CNMI Northern Island Bottomfish System (NIBS)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Commonwealth of the Northern Mariana Islands (CNMI), Division of Fish and Wildlife (DFW) conducted a market sampling program that existed for a few years back...

  14. Breton Island, Louisiana Baseline (Geographic, NAD83)

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Breton Island, Louisiana Baseline (Geographic, NAD83) consists of vector line data that were input into the Digital Shoreline Analysis System (DSAS) version 4.0,...

  15. CRED REA Algal Assessments, Baker Island 2006

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Twelve quadrats were sampled along 2 consecutively-placed, 25m transect lines as part of Rapid Ecological Assessments conducted at 8 sites at Baker Island in the US...

  16. Sea otter survey, Kodiak Island, 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The even pages of this report are missing, making this document of low quality. This report summarizes the results of a sea otter survey conducted on Kodiak Island...

  17. Gridded bathymetry of Niihau Island, Hawaii, USA

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Gridded bathymetry shelf, bank and slope environments of Ni'ihau Island. This 5 m grid contains data between 0 and 100 meters. The netCDF and Arc ASCII grids...

  18. Muskox survey, Nunivak Island, summer 1980

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A muskox survey was conducted on Nunivak Island Aug. 2122 by Lee Hotchkiss and Mike Smith. This year we digressed from the usual method of attempting to make a...

  19. EAARL Topography-Fire Island National Seaashore

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — A first return elevation map (also known as a Digital Elevation Model or DEM) of Fire Island National Seashore was produced from remotely-sensed,...

  20. Hawaii Abandoned Vessel Inventory, Lisianski Island, NWHI

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for Lisianski Island, NWHI. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction...

  1. Accidental and ideal island cities: islanding processes and urban design in Belize City and the urban archipelagos of Europe

    Directory of Open Access Journals (Sweden)

    Elizabeth Pigou-Dennis

    2014-11-01

    Full Text Available This paper explores processes of islanding, de-islanding, and re-islanding in the context of island cities. Although today popularly associated with rural, peripheral, and isolated landscapes, concepts of the ideal city coincided in Medieval and Renaissance Europe with emergent notions of the ideal island. Major European cities such as Amsterdam, Paris, and Copenhagen were established on densely urbanized small islands. In accordance with dominant political and military philosophies, they were subsequently developed through comprehensive urban design into vast yet coherent urban archipelagos. In contrast, the contemporary development of Belize City as an island city took place through piecemeal land reclamation, absent comprehensive urban design, resulting in a very different kind of urban archipelago. Neither the coherent European island cities nor Belize City are generally regarded as islands today, yet their histories of urban development evidence the impact of spatial attributes of islandness on urban form. Comprehensive urban design efforts are currently directed at land reclamation and waterfront revitalization in Belize City, aiming to restore Belize City’s island city status. We argue that cities can be islanded, de-islanded, and re-islanded in the minds of their inhabitants and that it is necessary to recognize the connection between ideal islands and ideal cities in order to understand the islanding process in full.

  2. A transferable force field for CdS-CdSe-PbS-PbSe solid systems

    International Nuclear Information System (INIS)

    A transferable force field for the PbSe-CdSe solid system using the partially charged rigid ion model has been successfully developed and was used to study the cation exchange in PbSe-CdSe heteronanocrystals [A. O. Yalcin et al., “Atomic resolution monitoring of cation exchange in CdSe-PbSe heteronanocrystals during epitaxial solid-solid-vapor growth,” Nano Lett. 14, 3661–3667 (2014)]. In this work, we extend this force field by including another two important binary semiconductors, PbS and CdS, and provide detailed information on the validation of this force field. The parameterization combines Bader charge analysis, empirical fitting, and ab initio energy surface fitting. When compared with experimental data and density functional theory calculations, it is shown that a wide range of physical properties of bulk PbS, PbSe, CdS, CdSe, and their mixed phases can be accurately reproduced using this force field. The choice of functional forms and parameterization strategy is demonstrated to be rational and effective. This transferable force field can be used in various studies on II-VI and IV-VI semiconductor materials consisting of CdS, CdSe, PbS, and PbSe. Here, we demonstrate the applicability of the force field model by molecular dynamics simulations whereby transformations are initiated by cation exchange

  3. Climate, ecological release and bill dimorphism in an island songbird

    OpenAIRE

    Greenberg, Russell; Danner, Raymond M.

    2013-01-01

    Sexual size dimorphism is expected to be more pronounced in vertebrates on islands, particularly in trophic characters, as a response to decreased interspecific competition for food. We found (based on measurements of 1423 museum specimens) that bill size dimorphism was greater in island than mainland populations of song sparrows. However, dimorphism varied among islands and was positively correlated with high summer temperature and island size. Island song sparrow bills follow the overall po...

  4. The islands of Kagoshima : culture, society, industry and nature

    OpenAIRE

    KAWAI, Kei; Terada, Ryuta; KUWAHARA, Sueo; TAKARABE, Megumi; NISHIMURA, Akira; HATTA, Akio; HAYWARD, Philip; YAMAMOTO, Sota; Takezaki, Toshiro; Niimura, Hideshi; Kuwabara, Kazuyo; NODA, Shinichi; NAKATANI, Sumie; OZAKI, Takahiro; NISHIMURA, Satoru

    2013-01-01

    edited by Kei Kawai, Ryuta Terada and Sueo Kuwahara Title page, colophon Preface Editors Contributors Contents Various Island Views in Kagoshima Prefecture (frontispiece) Map of the Islands in Kagoshima Culture and Society [Chapter 1] Culture and Society in the Islands of Kagoshima / Sueo Kuwahara [Chapter 2] Research Issues in the Culture and Society of the Amami Islands / Sueo Kuwahara [Chapter 3] Amami Island Religion : Historical Dynamics of the Islanders’...

  5. ASSESING GEOGRAPHIC ISOLATION OF THE GALAPAGOS ISLANDS

    OpenAIRE

    Orellana, D.; Smith, F.

    2016-01-01

    The Galapagos Archipelago is one of the most important ecological spots in the planet due its unique biodiversity, active geology, and relatively well-preserved ecosystems. These characteristics are strongly based on the geographical isolation of the islands. On the one hand this isolation allowed the evolution processes that gave the islands their international fame and on the other hand it kept them from major human impacts that affected the vast majority of the Earth’s surface. Ga...

  6. Legends, Megaliths And Astronomy In Corsica Island

    OpenAIRE

    Santucci, Jean-François; Thury-Bouvet, Ghjasippina; Hadi Khoumeri, El; Ottavi, Antoine

    2004-01-01

    This paper presents a study performed in the framework of an interdisciplinary project developed at the University of Corsica involving information technology researchers and engineers, anthropologists and people from the field of astronomy. The goal of the project is to reveal the Mythology of the Corsica Island, which has been buried under thousand years of invasions. More than 6000 years ago, Corsica, an island of the west Mediterranean basin saw the emergence of megaliths all over the isl...

  7. Floating island for extracting or processing gas

    Energy Technology Data Exchange (ETDEWEB)

    Poeppel, F.O.

    1979-09-25

    The described floating island for the extraction of gas from the sea a plurality of buoyancy units positioned on a base plate with columns extending upward therefrom at a height approximately the wave height expected. A platform containing gas liquefaction apparatus is positioned on the top of the columns. The buoyancy units are selected so that when the island is free floating, the columns project more than half way from the water.

  8. Marine Pollution at Northeast of Penang Island

    OpenAIRE

    H.A. Gasim; A.M. Hashim; P.Z.M. Bakri; M.Z. Samsuri; N.L.A. Rais; N.D.M. Noor

    2013-01-01

    Oceans cover large area of earth surface and it is important for humans to protect from pollution. Malaysia has large marine areas which consist of islands, coastal and sea areas which are facing pollution problem due to the rapid urbanization and industrialization. This study investigated sources of marine pollution occurred at area near a reclamation project at the northeast of Penang Island. Three locations were chosen for water sampling which included Sg. Fetes, North Tanjung Tokong and G...

  9. Cancer incidence in the Falkland Islands

    OpenAIRE

    Swerdlow, A J; Elsby, B; Qiao, Z.

    2001-01-01

    Cancer incidence in the Falkland Islands, 1989–2000, was compared with rates in England and Wales, from which most Islanders originate. Colon and rectum cancer incidence was significantly raised 1989–93 but greatly reduced after 1994, when colonoscopic screening in high-risk families and sigmoidoscopic screening in the general population were introduced. http://www.bjcancer.com © 2001 Cancer Research Campaign

  10. MoSe2 / Polyaniline Solar Cells

    Directory of Open Access Journals (Sweden)

    H.S. Patel

    2011-01-01

    Full Text Available Solar cells have been investigated since long for harnessing the solar energy. During this decade, a new direction has come up where in the polymers have been used in the fabrication of solar cells. Polyaniline is one of the polymers which has shown potential for its applications in heterostructure solar cells. This material is being used along with the semiconductors like InSe, TiO2, Si etc. to form the photosensitive interface. In this direction, we report our investigations on the use of Molybdenum diselenide (MoSe2 as photosensitive semiconducting material in MoSe2 / polyaniline solar cells. In this paper, the preparation of MoSe2 / polyaniline solar cells has been reported. Also, the photovoltage → photocurrent characteristics of this structure have been discussed in detail in this paper. The variation of different parameters of MoSe2 / polyaniline solar cells (like open circuit voltage, short circuit current, photoconversion efficiency and fill factor with the intensity of incident illuminations has been reported in this paper. In present case, the photocurrent density was found to be around 250 µA/cm2 with the photovoltage around 8.5 mV (which is low the photoconversion efficiency was found to be around 0.7 % along with the fill factor around 0.33. The efforts have been made to explain the low values of the photoconversion efficiency.

  11. PbSe Nanocrystal Excitonic Solar Cells

    KAUST Repository

    Choi, Joshua J.

    2009-11-11

    We report the design, fabrication, and characterization of colloidal PbSe nanocrystal (NC)-based photovoltaic test structures that exhibit an excitonic solar cell mechanism. Charge extraction from the NC active layer is driven by a photoinduced chemical potential energy gradient at the nanostructured heterojunction. By minimizing perturbation to PbSe NC energy levels and thereby gaining insight into the "intrinsic" photovoltaic properties and charge transfer mechanism of PbSe NC, we show a direct correlation between interfacial energy level offsets and photovoltaic device performance. Size dependent PbSe NC energy levels were determined by cyclic voltammetry and optical spectroscopy and correlated to photovoltaic measurements. Photovoltaic test structures were fabricated from PbSe NC films sandwiched between layers of ZnO nanoparticles and PEDOT:PSS as electron and hole transporting elements, respectively. The device current-voltage characteristics suggest a charge separation mechanism that Is distinct from previously reported Schottky devices and consistent with signatures of excitonic solar cells. Remarkably, despite the limitation of planar junction structure, and without film thickness optimization, the best performing device shows a 1-sun power conversion efficiency of 3.4%, ranking among the highest performing NC-based solar cells reported to date. © 2009 American Chemical Society.

  12. Monoclinic Cu2Se3Sn.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Ostapyuk, T A; Klymovych, O S; Zmiy, O F

    2010-05-01

    A previously unknown modification of dicopper(I) triselenostannate(IV), Cu(2)Se(3)Sn, has been obtained from the Cu(2)Se-SnSe(2) quasi-binary system and investigated using X-ray single-crystal diffraction. The Se atoms are stacked in a closest-packed arrangement with the layers in the sequence ABC. The Cu atoms occupy one-third of the tetrahedral interstices, whereas the Sn atoms are located in one-sixth of the tetrahedral interstices. All the atoms occupy general positions. The structure possesses pseudo-inversion symmetry. The Cu(2)Se(3)Sn structure investigated in this paper (96 atoms per unit cell, ordered distribution of Cu and Sn over 12 cation positions) is a superstructure of the reported cubic (eight atoms per unit cell, random distribution of Cu and Sn over one cation position) and monoclinic (24 atoms per unit cell, ordered distribution of Cu and Sn over three cation positions) modifications. PMID:20442500

  13. Additions to the flora of Tenerife (Canary Islands, Spain

    Directory of Open Access Journals (Sweden)

    Verloove, F.

    2011-12-01

    Full Text Available Additions to the flora of Tenerife (Canary Islands, Spain.- Recent fieldwork in Tenerife, especially in September 2010, yielded several interesting new records of non-native vascular plants. Bothriochloa ischaemum var. songarica, “Asian” Cardamine flexuosa, Cestrum parqui, Digitaria violascens, Ficus lyrata, Ficus rubiginosa, Hoffmannseggia glauca, Hyparrhenia rufa subsp. altissima, Jacaranda mimosifolia, Merremia tuberosa, Passiflora morifolia, Phytolacca dioica, Schefflera actinophylla and Solanum abutiloides are reported for the first time from the Canary Islands, while Eragrostis barrelieri var. pygmaea, Ficus microcarpa, Ipomoea purpurea, Leucaena leucocephala subsp. glabrata, Sechium edule, Tradescantia zebrina and Turnera ulmifolia are new to the flora of the island of Tenerife. New records of Acacia cyclops, Atriplex suberecta, Heliotropium curassavicum, Paspalum dilatatum, P. notatum, Pluchea ovalis, Pulicaria paludosa, Sclerophylax spinescens and Solanum villosum subsp. miniatum confirm their recent expansion on the island of Tenerife. New records are provided for the recently described Sporobolus copei . Finally, Paspalum vaginatum (hitherto possibly confused with P. distichum and Potentilla indica are confirmed from the island of Tenerife.

    Adiciones para la flora de Tenerife (Islas Canarias, España.- Algunos recientes trabajos de campo en Tenerife, especialmente en Septiembre de 2010, trajeron consigo varias nuevas e interesantes adiciones de plantas vasculares no autóctonas. Bothriochloa ischaemum var. songarica, Cardamine flexuosa “Asiática”, Cestrum parqui, Digitaria violascens, Ficus lyrata, Ficus rubiginosa, Hoffmannseggia glauca, Hyparrhenia rufa subsp. altissima, Jacaranda mimosifolia, Merremia tuberosa, Passiflora morifolia, Phytolacca dioica, Schefflera actinophylla y

  14. Youth lead youth in Marshall Islands.

    Science.gov (United States)

    Johnson, G

    1988-01-01

    The promotion of family planning and birth control in Pacific countries is often frustrated by traditional and religious beliefs, if not deterred by tremendous funding and logistics problems. In the central Pacific republic of the Marshall Islands, however, youthful health workers are taking a unique approach to health promotion that has spurred acceptance of the once controversial subjects of family planning and birth control. A group known as Youth to Youth in Health is spearheading a family planning outreach drive in the schools and community in the Marshall Islands. Coupling health presentations with traditional island music and dance to produce lively health shows, the group's programs on family planning, birth control, nutrition, and cancer have struck a responsive chord in a culture known for its religious and traditional conservatism. The group makes creative use of puppet shows, skits, health songs, and pantomimes, interspersed with contemporary renditions of Marshall Islands music and traditional dances. These have rekindled pride in their culture among the group and sparked a sense of urgency about the need to improve health conditions in the islands. As evidence of the group's impact, family planning staff point to a nearly 4-fold rise in the number of youth clients under 19 years since the Youth to Youth started in mid-1986. Their combination of traditional custom with family planning and other health information has proved to be an innovative and needed program for the islands. PMID:12269067

  15. Phonon softening in the CDW systems NbSe2 and TiSe2

    International Nuclear Information System (INIS)

    We present new results on the soft-mode behaviour of phonons in the Charge Density Wave (CDW) systems NbSe2 and TiSe2. Our theoretical predictions from Density Functional Theory (DFT) based on ab-initio phonon calculations coincide with the CDW instability behaviour that we observed experimentally by means of high resolution Inelastic X-ray Scattering (IXS). While TiSe2 shows a rather sharp phonon anomaly at T=190 K, the anomaly in NbSe2 at T=33 K is much broader than expected for a Fermi surface nesting driven CDW instability. For NbSe2, we exclude Fermi surface nesting as main origin of the phonon softening. For TiSe2, the phonon softening seems to be well described within the framework of DFT.

  16. Cd And Se Atomic Environments During the Growth of CdSe Nanoparticles in Glass

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, T.M.; Persans, P.D.; Filin, A.; Peng, C.; Huang, W.

    2006-10-27

    Thermal treatment of Cd and Se doped borosilicate glass yields CdSe nanoparticles that are interesting for applied and fundamental studies of quantum and size effects in semiconductors. Using x-ray absorption spectroscopy at both the Cd and Se K-edges, we have studied the local atomic structure for each of these reactants at several stages of particle growth. When the doped glass is quenched from 1050 C, the Cd neighbor is mostly oxygen and the Se neighbor is mostly Zn. With heat treatment at 600-750 C, the concentration of nearest neighbor Cd-Se bonds increases and becomes dominant while the optical spectrum evolves toward that of a composite containing CdSe.

  17. Bio-fortification and isotopic labelling of Se metabolites in onions and carrots following foliar application of Se and 77Se

    OpenAIRE

    Kapolna, Emese; Laursen, Kristian Holst; Husted, Søren; Larsen, Erik H

    2011-01-01

    The aims were to bio-fortify onions by foliar application of selenium (Se) and to intrinsically label bioactive Se-metabolites in onion and carrot by enriched, stable77Se for use in human physiological studies. Onion bulbs and leaves were enriched in Se by repeated foliar spraying of 10 or 100 μg Se mL-1 solutions of sodium selenite (Se(IV)) or sodium selenate (Se(VI)). ICP-MS analysis of onion leaves and bulbs showed that the Se concentration was enhanced by up to a factor of approximately 5...

  18. Half-life determination of 65Se

    International Nuclear Information System (INIS)

    65Se, a nuclide with Tz = -3/2, A = 4n + 1 produced in 40Ca(28Si, 3n) reaction was identified via its β-delayed proton emission. A single proton group at 3.70 +- 0.08 MeV was observed and its half-life was experimentally determined to be 9.6-4.1+5.3 ms which was corresponding to superallowed β transition from ground state of 65Se to the isospin analog state, the lowest T = 3/2 state, in 65As and the subsequent proton emission to the ground state of 64Ge. Based on these results combining with coulomb displacement energy calculation, the mass excess of 65Se was obtained as -33.26 +- 0.25 MeV. (2 tabs., 5 figs.)

  19. Klaidos patyrimas audiovizualinėse medijose

    OpenAIRE

    Tamaševičius, Saulius

    2011-01-01

    Šiame bakalauro darbe siekiama ištirti klaidos raiškos ir patyrimo galimybes skaitmeninėse audiovizualinėse medijose. Klaida analizuojama kaip teorinė ir filosofinė sąvoka. Klaidos ir skaitmeninių medijų patyrimo santykyje iškyla sinestezijos reikšmė, kvestionuojanti skaitmeninių medijų juslinio patyrimo sąlygas. Klaidos apraiškos skaitmeninėse medijose tiriamos ne tik teoriškai, žvelgiama ir į trikties (angl. glitch ) reiškinį kaip į tiesioginę skaitmeninės klaidos apraišką tiek garsinėje, t...

  20. The hydrology of Hatteras Island, North Carolina

    Science.gov (United States)

    Anderson, William Paul, Jr.

    This is a study of the groundwater hydrology and groundwater-surface-water interactions of barrier islands. Shallow groundwater is typically the sole source of freshwater on barrier islands. It is threatened by increasing coastal populations (both permanent and seasonal residents). Higher demand for groundwater may induce saltwater intrusion through overpumping. Water quality also is often threatened by inadequate waste-management practices and overwash. These factors combine to make understanding of barrier-island hydrology essential for continued development and ecological health of island communities. The hydraulic response of barrier islands is closely tied to island morphology and stratigraphy. The heterogeneity of barrier islands suggests that the underlying geologic framework is critical to barrier-island morphology. Other processes, such as spit growth, are usually imposed on an inherited geologic framework. Barrier islands typically support a freshwater aquifer that "floats" on an underlying saltwater aquifer. The height to which the water table rises depends on the hydraulic parameters of the aquifer and the island geometry. In addition, tidal fluctuations, interdunal wetland drainage, and variable recharge rates affect island hydrology. The relative importance of each of these factors was tested with a series of numerical simulations, sensitivity analyses, and field measurements. Field data were collected from Hatteras Island in order to provide calibration data, constrain the shallow stratigraphy, and estimate aquifer parameters. Geophysical studies include borehole geophysics and ground-penetrating radar (GPR). The Buxton Woods surficial aquifer is approximately 24.5 meters in thickness and contains upper and lower permeable zones separated by a semi-confining layer. Geophysical methods were used to constrain the shallow stratigraphy and the vertical geometry of the system. Borehole geophysics indicate the large-scale variations in stratigraphy. GPR

  1. Synthesis of near-infrared-emitting CdTe/CdSe/ZnSe/ZnS heterostructure.

    Science.gov (United States)

    Yang, Ping

    2014-04-01

    Near-infrared-emitting quantum dots (QDs) were fabricated via organic synthesis strategies through constructing CdTe/CdSe/ZnSe/ZnS multishell heterostructure. An effective shell-coating route was developed for multishell growth on CdTe cores. Core/shell growth was monitored by absorption and photoluminescence (PL) spectroscopy and transmission electron microscopy observation. Yellow emitting CdTe cores were coated with a CdSe shell to generate type II structure. This yields core/shell QDs with red photoluminescence. The passivation by the ZnSe shell having a substantially wide bandgap confines the excitons within the CdTe/CdSe interface and isolates them from the solution environment and consequently improves the stability of the heterostructure. An additional ZnS shell was deposited around the outer layer of CdTe/CdSe/ZnSe QDs to form a heterostructure through the reaction between zinc oleate and trioctylphosphine sulfur in the crude CdTe/CdSe/ZnSe solution. By varying CdTe core size and each shell thickness, the PL wavelength of the obtained heterostructure can span from 580 to 770 nm. The PL efficiency is quenched in CdTe QDs in diluted solution but increases substantially up to 24% for CdTe/CdSe core/shell QDs. The PL efficiency of CdTe/CdSe/ZnSe/ZnS QDs with average diameter of 5.4 nm and a PL peak wavelength of 770 nm is 20%. PMID:24734747

  2. Se num passado remoto uma mulher...

    Directory of Open Access Journals (Sweden)

    Simone Guimarães Matheus

    2011-11-01

    Full Text Available A mulher que escreveu a Bíblia, de Moacyr Scliar,é um romance de estrutura complexa e constitui-­se de duas narrativas diferenciadas, inclusive, na apresentação gráfica. A primeira narrativa, em itálico, é conduzida por um narrador-­personagem anônimo, um fracassado professor de História que se torna, de forma pouco confiável, em um “terapeuta” de vidas passadas.

  3. Brasil. Cuando la modernidad se hizo color.

    OpenAIRE

    Cortina Maruenda, Francisco Javier; Molina Siles, Pedro Javier

    2013-01-01

    La modernidad deformada ha desterrado en múltiples ocasiones el uso del color en sus realizaciones. Incluso, hasta hoy en día, esta idea se repite como irreflexivo punto de partida de múltiples proyectos. Esto, a pesar de que los grandes maestros han hecho uso de este recurso sin ocultarlo. Un claro ejemplo fue Le Corbusier que incluso generó sus propias colecciones de colores. Por otro lado, Brasil se ha significado desde siempre como un reducto donde la manera de ver el movimiento modern...

  4. Synthesis and properties of new CdSe-AgI-As2Se3 chalcogenide glasses

    International Nuclear Information System (INIS)

    Research highlights: → Determination of the glass-forming region in the pseudo-ternary CdSe-AgI-As2Se3 system. → Characterization of macroscopic properties of the new CdSe-AgI-As2Se3 glasses. → Far infrared transmission of chalcogenide glasses. → Characterization of the total conductivity of CdSe-AgI-As2Se3 glasses. -- Abstract: The glass-forming region in the pseudo-ternary CdSe-AgI-As2Se3 system was determined. Measurements including differential scanning calorimetry (DSC), density, and X-ray diffraction were performed. The effect resulting from the addition of CdSe or AgI has been highlighted by examining three series of different base glasses. The characteristic temperatures of the glass samples, including glass transition (Tg), crystallisation (Tx), and melting (Tm) temperatures are reported and used to calculate their ΔT = Tx - Tg and their Hruby, Hr = (Tx - Tg)/(Tm - Tx), criteria. Evolution of the total electrical conductivity σ and the room temperature conductivity σ298 was also studied. The terahertz transparency domain in the 50-600 cm-1 region was pointed for different chalcogenide glasses (ChGs) and the potential of the THz spectroscopy was suggested to obtain structural information on ChGs.

  5. Se status in normal and pathological human individuals before and after Se supplementation

    Science.gov (United States)

    Bellisola, G.; Cinque, G.; Galassini, S.; Guidi, G. C.; Liu, N. Q.; Moschini, G.

    1996-04-01

    The determination of selenium in plasma and in urine samples has been suggested for the assessment of Se status in human individuals. The kidney is of fundamental importance in Se homeostasis: with low Se intake its excretion will be decreased and with high Se intake it will be increased. In 21 patients with kidney disease (8 with normal kidney function and 13 with moderate renal failure) Se was measured in 1 ml of urine by PIXE after preconcentration of the sample. The total urine volume was measured to calculate total daily Se excretion. The same procedure was applied to 14 normal individuals for comparison. All individuals were then supplemented orally with selenite for 8 weeks (Se = 600 μg/day) and the procedure was repeated. The behaviour of the major selenoproteins was also investigated by measuring glutathione peroxidase activities in plasma, in platelets and in erythrocyte samples. For renal function, serum and urine creatinine concentrations were utilised and creatinine clearances were calculated. Results obtained were compared before and after Se treatment and between groups. Some correlation studies were carried out between Se and kidney functions and/or selenoperoxidase activities.

  6. Reef fish structure and distribution in a south-western Atlantic Ocean tropical island.

    Science.gov (United States)

    Pinheiro, H T; Ferreira, C E L; Joyeux, J-C; Santos, R G; Horta, P A

    2011-12-01

    The community structure of the reef fish fauna of Trindade Island, a volcanic oceanic island located 1160 km off the coast of Brazil, is described based on intensive visual censuses. Seventy-six species were encountered in 252 censuses, with mean ± S.E. of 99 ± 3 individuals and 15.7 ± 0.3 species 40 m(-2) transect. The average fish biomass, calculated from length-class estimation, was 22.1 kg 40 m(-2) transect. The species contributing most to biomass were, in decreasing order, Melichthys niger, Cephalopholis fulva, Kyphosus spp., Holocentrus adscensionis, Sparisoma amplum, Sparisoma axillare, Acanthurus bahianus and Epinephelus adscensionis. Carnivorous fishes were the largest trophic group in terms of biomass, followed by omnivores and roving herbivores. The two predominant types of reef habitat, fringing reefs built by coralline algae and rocky reefs made of volcanic boulders, showed significant differences in the biomass and the abundance of the trophic guilds. Within each habitat type, significant differences in species richness, density and biomass were detected among crest, slope and interface zones. Although similar in overall species composition to coastal reefs in Brazil, the fish fauna of Trindade Island shares certain characteristics, such as a high abundance of planktivores, with other Brazilian oceanic islands. Despite comparatively high fish biomass, including the macro-carnivorous species habitually targeted by fisheries, signs of overfishing were evident. These findings highlight the urgency for a conservation initiative for this isolated, unique and vulnerable reef system. PMID:22141900

  7. Petrology of the prehistoric lavas and dyke of the Barren Island, Andaman Sea, Indian Ocean

    Indian Academy of Sciences (India)

    M A Alam; D Chandrasekharam; O Vaselli; B Capaccioni; P Manetti; P B Santo

    2004-12-01

    Although Barren Island (Andaman Sea, Indian Ocean) witnessed several volcanic eruptions during historic times, the eruptions that led to the formation of this volcanic island occurred mainly during prehistoric times. It is still active and currently in the fumarolic stage. Its volcanic evolution appears to be characterized by a constructive phase with the piling up of lava flows and scoria deposits and Strombolian activities, followed by a sudden collapse of the main cone. Deposits of a possible caldera-forming eruption were not recognized earlier. After a period of peri-calderic hydromagmatic activity, whose deposits presently mantle inner and outer caldera walls, a new phase of intracalderic Vulcanian activities took place. A prominent dyke in the SE inner side of the caldera wall was recognized. Petrographically the lava flows and dyke are similar but they differ in their chemical composition (viz., SiO2, MgO, Ni, Cr) significantly. Similarity in major, minor and trace element composition (viz., K/La, K/Nb, K/Rb, K/Ti ratios) of these rocks together with Chondrite normalized trace element (Rb, Ba, Sr, P, Zr, Ti and Nb) and REE (La, Ce, Nd and Y) patterns of the Barren Island prehistoric lava flows and dyke and low-K lavas of Sunda Arc indicates that Barren Island must have evolved from a source similar to that of Sunda Arc lavas during the Quaternary Period.

  8. Sandy Point, Green Cay and Buck Island National Wildlife Refuges: United States Virgin Islands, Caribbean Islands National Wildlife Refuge Complex: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan CCP was written to guide management on United States Virgin Islands, Caribbean Islands NWR Complex for the next 15 years. This...

  9. Terrestrial radiation measurements in Marshall Islands

    International Nuclear Information System (INIS)

    With the prospect of habitation in the near future, radiological surveys were undertaken of Enewetak and Bikini Atolls to provide a basis for determining whether or not the atolls can be safely reinhabited. The surveys included all of the forty islands within Enewetak Atoll, but only the two principal islands, Bikini and Eneu Islands, of Bikini Atoll. These atolls were former U.S. nuclear weapons test sites in the Pacific. Integral parts of the surveys were the measurements of the distributions of radioactivity in the soil and the resulting gamma ray exposure rates for external dose estimation. Numerous soil samples were collected from both atolls for analysis by Ge (Li) gamma spectrometry and by wet chemistry techniques. At Enewetak Atoll the gamma exposure rates were measured by TLDs and a helicopter-borne array of Nal detectors, while at Bikini Atoll portable Nal detectors, pressurized ion-chambers, and TLDs were utilized. The predominant species measured in the soil samples collected from both atolls were 90Sr, 239,240Pu, 137Cs and 60Co with the latter two nuclides being the primary contributors to the gamma-ray exposure rates. The geographical distribution of the exposure rates measured on both atolls, was highly variable ranging from less than 1 μR/h on islands that had not been impacted radiologically by the testing program, to over 100 μR/h near weapon detonation sites. Thus, within Enewetak Atoll, the highest soil activities and gamma-ray exposure rates were measured on the northern islands, where the weapons testing had been most intense. Bikini Island exhibited contamination levels that were considerably higher than those on Eneu Island. Generally, the highest activity levels were observed within the island interiors or in proximity to ground zero sites, and could usually be related to the surrounding vegetation density. The island of Yvonne, within Enewetak Atoll, is the most severely contaminated land area. Particles containing as much as several

  10. Bryogeography of the Galapagos Islands

    OpenAIRE

    Gradstein, S.R.; Weber, William A.

    1982-01-01

    De las Islas Galápagos se conoce más de 200 especies de briófitas (el número total de los musgos y de las hepáticas es de mas o menos igual). Más que 2/3 partes de las especies occurren en la selva y matorrales perennifolias y húmedas limitadas a las zonas altas de algunas islas. Una proporción elevada (65-70%) de la brioflora trata de especies de una distribución amplia y neotropical o ampliamente tropical, que probablemente han llegado cón los vientos predominantes orientales del continente...

  11. Electrodeposition of CdSe coatings on ZnO nanowire arrays for extremely thin absorber solar cells

    International Nuclear Information System (INIS)

    We report on electrodeposition of CdSe coatings onto ZnO nanowire arrays and determine the effect of processing conditions on material properties such as morphology and microstructure. CdSe-coated ZnO nanowire arrays have potential use in extremely thin absorber (ETA) solar cells, where CdSe absorbs visible light and injects photoexcited electrons into the ZnO nanowires. We show that room-temperature electrodeposition enables growth of CdSe coatings that are highly crystalline, uniform, and conformal with precise control over thickness and microstructure. X-ray diffraction and transmission electron microscopy show nanocrystalline CdSe in both hexagonal and cubic phases with grain size ∼5 nm. Coating morphology depends on electrodeposition current density. Uniform and conformal coatings were achieved using moderate current densities of ∼2 mA cm-2 for nanowires with roughness factor of ∼10, while lower current densities resulted in sparse nucleation and growth of larger, isolated islands. Electrodeposition charge density controls the thickness of the CdSe coating, which was exploited to investigate the evolution of the morphology at early stages of nucleation and growth. UV-vis transmission spectroscopy and photoelectrochemical solar cell measurements demonstrate that CdSe effectively sensitizes ZnO nanowires to visible light.

  12. Oloketa Tingting Fo Apem Education Long Solomon Islands: Issues in Solomon Islands Education

    Science.gov (United States)

    Alcorn, Noeline

    2010-01-01

    This book makes available to a wider audience for the first time material based on fieldwork carried out by the Solomon Island researchers in their own country. The findings will have vital relevance to policy makers, teachers and students. Over the past four years the School of Education, Solomon Islands College of Higher Education and the…

  13. Origins and antiquity of the island fox ( Urocyon littoralis) on California's Channel Islands

    Science.gov (United States)

    Rick, Torben C.; Erlandson, Jon M.; Vellanoweth, René L.; Braje, Todd J.; Collins, Paul W.; Guthrie, Daniel A.; Stafford, Thomas W., Jr.

    2009-03-01

    The island fox ( Urocyon littoralis) is one of few reportedly endemic terrestrial mammals on California's Channel Islands. Questions remain about how and when foxes first colonized the islands, with researchers speculating on a natural, human-assisted, or combined dispersal during the late Pleistocene and/or Holocene. A natural dispersal of foxes to the northern Channel Islands has been supported by reports of a few fox bones from late Pleistocene paleontological localities. Direct AMS 14C dating of these "fossil" fox bones produced dates ranging from ˜ 6400 to 200 cal yr BP, however, postdating human colonization of the islands by several millennia. Although one of these specimens is the earliest securely dated fox from the islands, these new data support the hypothesis that Native Americans introduced foxes to all the Channel Islands in the early to middle Holocene. However, a natural dispersal for the original island colonization cannot be ruled out until further paleontological, archaeological, and genetic studies (especially aDNA [ancient DNA]) are conducted.

  14. Vegetation and checklist of Inaccessible Island, central South Atlantic Ocean, with notes on Nightingale Island

    Directory of Open Access Journals (Sweden)

    J. P. Roux

    1992-12-01

    Full Text Available The physiography and climate of Inaccessible and Nightingale Islands are briefly discussed. The vegetation and the major plant associations are described. Notes are given on the ecology and distribution of each taxon. Taxa newly recorded for Inaccessible Island include Agrostis goughensis, A.holgateana, A. wacei, Calamagrostis deschampsiiformis, Carex thouarsii var.  recurvata, Conyza albida, Elaphoglossum campylolepium and  Uncinia meridensis. One species, C.  albida, is alien to the Tristan group. Two native ferns Asplenium platybasis var.  subnudum and Blechnum australe were found on Nightingale Island for the first time, and the presence of introduced Malus domestica orchards was recorded. Two unidentified taxa were found that may represent new species:  Elaphoglossum sp. at Inaccessible Island and Apium sp. at both Inaccessible and Nightingale Islands. The total number of vascular plant species recorded at Inaccessible and Nightingale Islands now stands at 98 and 43, respectively, of which 26 (28% and seven (16% are introduced species. Only Airiplex plebeja and two species of Cotula occur at Nightingale Island but are absent from Inaccessible Island.

  15. Tuppiap Qeqertaa (Tobias Island): a newly discovered island off northeast Greenland

    DEFF Research Database (Denmark)

    Bennike, O.; Mikkelsen, N.; Forsberg, René; Hedenas, L.

    2006-01-01

    sea level, as determined by airborne laser scanning. High-quality geodetic GPS measurements determine the position of a small cairn erected on the island to 79 degrees 20'34.48" N, 15 degrees 46'31.23" W. Minor parts of the island are ice free, with small hills of gravel. Late Holocene shells of...

  16. 77 FR 51473 - Safety Zone; Bostock 50th Anniversary Fireworks, Long Island Sound; Manursing Island, NY

    Science.gov (United States)

    2012-08-24

    ... Acronyms DHS Department of Homeland Security FR Federal Register NPRM Notice of Proposed Rulemaking COTP..., NY in the Federal Register (77 FR 34894). We received no comments on the proposed rule. No public... Island Sound; Manursing Island, NY AGENCY: Coast Guard, DHS. ACTION: Final rule. SUMMARY: The Coast...

  17. 33 CFR 80.717 - Tybee Island, GA to St. Simons Island, GA.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Tybee Island, GA to St. Simons Island, GA. 80.717 Section 80.717 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Seventh District § 80.717 Tybee...

  18. 75 FR 28643 - Pine Island, Matlacha Pass, Island Bay, and Caloosahatchee National Wildlife Refuges, Lee and...

    Science.gov (United States)

    2010-05-21

    ... Register on June 27, 2007 (72 FR 35254), and extended the comment period in a notice in the Federal Register on April 2, 2008 (73 FR 17991). For more about the refuges, their purposes, and our CCP process... Fish and Wildlife Service Pine Island, Matlacha Pass, Island Bay, and Caloosahatchee National...

  19. 33 CFR 80.712 - Morris Island, SC to Hilton Head Island, SC.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Morris Island, SC to Hilton Head Island, SC. 80.712 Section 80.712 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Seventh District § 80.712 Morris...

  20. 77 FR 34894 - Safety Zone; Bostock 50th Anniversary Fireworks, Long Island Sound; Manursing Island, NY

    Science.gov (United States)

    2012-06-12

    ... Acronyms DHS Department of Homeland Security FR Federal Register NPRM Notice of Proposed Rulemaking A... Federal Register (73 FR 3316). 4. Public Meeting We do not now plan to hold a public meeting. But you may... Island Sound; Manursing Island, NY AGENCY: Coast Guard, DHS. ACTION: Notice of proposed...

  1. Escape from the Island: Grammaticality and (Reduced) Acceptability of "Wh"-Island Violations in Danish

    Science.gov (United States)

    Christensen, Ken Ramshoj; Kizach, Johannes; Nyvad, Anne Mette

    2013-01-01

    In the syntax literature, it is commonly assumed that a constraint on linguistic competence blocks extraction of "wh-"expressions (e.g. "what" or "which book") from embedded questions, referred to as "wh-"islands. Furthermore, it is assumed that there is an argument/adjunct asymmetry in extraction from "wh-"islands. We report results from two…

  2. 46 CFR 7.85 - St. Simons Island, GA to Little Talbot Island, FL.

    Science.gov (United States)

    2010-10-01

    ...°42.7′ N. longitude 81°19.0′ W. (St. Mary's Entrance Lighted Whistle Buoy “1”); thence to Amelia Island Light. (b) A line drawn from the southernmost extremity of Amelia Island to latitude 30°29.4′...

  3. CRED Gridded Bathymetry of Necker Island (100-021) in the Northwestern Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — File 100-021b is a 60-m ASCII grid of depth data collected near Necker Island in the Northwestern Hawaiian Islands as of May 2003. This grid has been produced as...

  4. Experiment of magnetic island formation in large helical device

    International Nuclear Information System (INIS)

    Magnetic island formation is experimentally investigated in the Large Helical Device (LHD). The (m, n) = (1, 1) vacuum magnetic island is generated by using the local island diverter (LID) field, where m and n are the poloidal and toroidal mode numbers, respectively. The island width depends on plasma parameters (the electron temperature and the β) and the magnetic axis position. In the case of Rax=3.53 m, the magnetic island in the plasma is larger than that in the vacuum field. Here, Rax is the major radius of the magnetic axis. In the case of Rax=3.6 m, the magnetic island is not generated when the error field is less than the threshold, which is increased as the β is increased. Evidence of island current is obtained when the magnetic island is formed due to a small error field. However, the mechanism that generates the island is not known yet. (author)

  5. Two-Dimensional Island Shape Determined by Detachment

    Science.gov (United States)

    Saito, Yukio; Kawasaki, Ryo

    2007-07-01

    Effect of an anisotropic detachment on a heteroepitaxial island shape is studied by means of a kinetic Monte Carlo simulation of a square lattice gas model. Only with molecular deposition followed by surface diffusion, islands grow in a ramified dendritic shape, similar to diffusion-limited aggregate (DLA). Introduction of molecular detachment from edges makes islands compact. To understand an anisotropic island shape observed in the experiment of pentacene growth on a hydrogen-terminated Si(111) vicinal surface, asymmetry in detachment around the substrate step is assumed. Edge molecules detach more to the higher terrace than to the lower terrace. The island edge from which molecules are easy to detach is smooth and the one hard to detach is dendritic. If islands are close to each other, islands tend to align in a line, since detached molecules from the smooth edge of the right island are fed to the dendritic and fast growing edge of the left island.

  6. Neutron diffraction study of MnSe

    International Nuclear Information System (INIS)

    We report our neutron diffraction studies at low temperature on MnSe. The low temperature data shows co-existence of cubic and hexagonal phases with both of them ordered antiferromagnetically. The ordering temperature for cubic phase is ∼ 130 K while that for the hexagonal phase is ∼ 250 K. (author)

  7. Main: 1SE9 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available 1SE9 シロイヌナズナ Arabidopsis Arabidopsis thaliana (L.) Heynh. T4p13.27 Protein Name=T4p13.27; ... abidopsis Thaliana To Be Published Ubiquitin-Like, Cell -Free, Wheat Germ, Structural Genomics, Protein Str ...

  8. Reference: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519; ... ...SE2PVGRP1 Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promo

  9. Biaxially Oriented CdSe Nanorod

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Chin, Patrick T.K.; Andreasen, Jens Wenzel;

    2009-01-01

    The shape, structure, and orientation of rubbing-aligned cadmium selenide (CdSe) nanorods on polymer coated glass substrates have been studied using transmission electron microscopy (TEM) and grazing incidence X-ray scattering combined with computer simulations. The nanorods are found to be of...

  10. Structural studies of amorphous Se under pressure

    OpenAIRE

    Tanaka, Keiji

    1990-01-01

    X-ray-diffraction patterns, macroscopic compressibility, and crystallization in amorphous Se subject to pressure have been investigated. The material exhibits pressure-induced structural modifications in the glassy state and a phase transformation to the hexagonal phase at 120±20 kbar. The observations are discussed on the basis of microscopic and thermodynamic models.

  11. Reference: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available lled by three specific regulatory elements and one unspecific activating sequence Plant Mol Biol 26: 747-756 (1994) PubMed: 7948928 ... ...SE1PVGRP18 Keller B, Heierli D Vascular expression of the grp1.8 promoter is contro

  12. Enriched $^{82}$Se for the LUCIFER experiment

    CERN Document Server

    Beeman, J W; Benetti, P; Cardani, L; Casali, N; Chiesa, D; Clemenza, M; Dafinei, I; Di Domizio, S; Ferroni, F; Gironi, L; Giuliani, A; Gotti, C; Laubenstein, M; Maino, M; Nagorny, S; Nisi, S; Nones, C; Orio, F; Pagnanini, L; Pattavina, L; Pessina, G; Piperno, G; Pirro, S; Previtali, E; Rusconi, C; Schäffner, K; Tomei, C; Vignati, M

    2015-01-01

    The LUCIFER project aims at deploying the first array of enriched scintillating bolometers for the investigation of neutrinoless double-beta decay of $^{82}$Se. The matrix which embeds the source is an array of ZnSe crystals, where enriched $^{82}$Se is used as decay isotope. The radiopurity of the initial components employed for manufacturing crystals, that can be operated as bolometers, is crucial for achieving a null background level in the region of interest for double-beta decay investigations. In this work, we evaluated the radioactive content in 2.5 kg of 96.3% enriched $^{82}$Se metal, measured with a high-purity germanium detector at the Gran Sasso deep underground laboratory. The limits on internal contaminations of primordial decay chain elements of $^{232}$Th, $^{238}$U and $^{235}$U are respectively: $<$61 $\\mu$Bq/kg, $<$110 $\\mu$Bq/kg and $<$74 $\\mu$Bq/kg at 90% C.L.. The extremely low-background conditions in which the measurement was carried out and the high radiopurity of the $^{82}$...

  13. Recent hydrogeologic study of the Vis island

    Directory of Open Access Journals (Sweden)

    Janislav Kapelj

    2002-12-01

    Full Text Available The Vis Island belongs to the group of the Middle Dalmatian islands. It comprises an area of about 90.2 km2. Morphologically, three belts of highlands and two depressions with karst poljes are significant. The highest point on the island is Hum with 587 m a.s.l. theisland’s water supply is organized from the water-supply station “Korita”, situated in the central part of island, in tectonically formed depression. There are two additional capturedobjects: the well K-1 above the Komiža town and the spring “Pizdica”. The most important hydrogeological role on the island have two hydrogeological barriers, one in the KomižaBay, completely made of impermeable igneous and clastic rocks, and another one, the recently recognized relative barrier in the area of Dra~evo, Plisko and Velo polje. Since the island karst aquifer is in permanent dynamic relation with seawater, classical geologic,structural and hydrogeologic investigations have been performed with application of hydrogeochemical methods taking into account the natural chemical tracer content of groundwater and its variations in different hydrologic and vegetation conditions. Precipitationregime is very unfavorable with regard to the recharging of island’s aquifer, because dry periods are usually very long. During the summer tourist season, when the number of inhabitants and fresh water consumption considerably increase, amounts of island’sgroundwater suitable for water supply and irrigation rapidly decrease. Sometimes, insufficient quantity of fresh water on the Vis Island causes restrictions. Concerning the development of tourist potential and the present agricultural activities, summer lack ofwater is a serious restrictive factor. Some results of the performed hydrogeological study, important as a basis for island’s fresh water potential assessment, will be presented.

  14. The sediments of lake on the Ardley Island, Antarctica:Identification of penguin-dropping soil Sun Liguang

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    During CHINARE-15(Dec. 1998 - Mar. 1999), a lake core 67. 5 cm in length, was sampled in Y2 lake, which is located on the Ardley Island, Antarctica.The concentrations of some chemical elements in Y2 lake sediments were analyzed.According to comparative research on elementary characters of sediments in Antarctic West Lake, fresh penguin dropping as well as guano soil on the Ardley Island and Pacific Island in South China Sea, it presents that the Y2 lake sediments were ameliorated by penguin dropping. The result of element cluster analysis shows that the type elements in the sediment impacted by penguin dropping include Sr, F, S,P,Ca,Se,Cu, Zn and Ba. This can provide a base for further interpreting the climatic and environmental event recorded in the sediment.

  15. Tools for sustainability assessment in island socio-ecological systems: an application to the Canary Islands

    Directory of Open Access Journals (Sweden)

    Isabel Banos-González

    2016-05-01

    Full Text Available An integral dynamic model, in combination with other methods (indicators, policy and scenario analysis, is presented as a tool for sustainability assessment in island socio-ecological systems (SES. The Fuerteventura sustainability model (FSM, tested for the 1996-2011, allows a better understanding of the dynamic interactions between sustainability indicators and other factors of this island. The FSM was first applied to analyse the vulnerability of this island to climate change for the 2012-2025 period; results point to the need for urgent measures to mitigate its effects on some of the analysed indicators. A set of policy measures was then assessed from the behaviour of nine indicators and their sustainability thresholds. Finally, the FSM facilitated the development of a dynamic model of the island of El Hierro, extrapolating the features common to both SES. We propose this to be a useful tool for the quantitative sustainability assessment and the management of real island socio-ecological systems

  16. Assessing vulnerability to climate change and socioeconomic stressors in the Reef Islands group, Solomon Islands

    DEFF Research Database (Denmark)

    Birk, Thomas

    2014-01-01

    This article assesses the vulnerability to climatic and socioeconomic stresses in the Reef Islands, Solomon Islands, an atoll island group in the Southwest Pacific. Climate change and the associated sea-level rise are often seen as the most pressing challenges to atoll communities, yet this study...... infrastructure, economic marginalization and weak governance of Solomon Islands. Findings suggest that some of these non-climatic stresses are currently – and in the short term – more important determinants of local vulnerability than climate change and sea-level rise. Certainly, these stresses are likely...... to be exacerbated by different elements of climate change in the short, medium and long term, but generally speaking climate change does not appear to be a major driver of the current changes in the islands. On the basis of these observations, the possible adaptation options, relevant to different time scales...

  17. Environmental assessment for the resettlement of Eneu Island on Bikini Atoll, Republic of the Marshall Islands

    International Nuclear Information System (INIS)

    This environmental assessment evaluates various alternatives to return the Bikini people to their homeland on Bikini Atoll. Eneu Island was spared the heavy nuclear contamination that rendered Bikini Island, the largest and main inhabitable island on the atoll, presently unsuitable for resettlement. The economic, social, technical and environmental consequences of all alternatives were compared, and alternative sites, purposes and scales for resettlement were included in the analysis. This environmental assessment explores these alternatives in detail and concludes that the resettlement of Eneu Island by some of the Bikini people at this time will not result in significant adverse effects to the environment nor will it foreclose any other full scale resettlement option involving the cleanup of Bikini Atoll. In addition, it concludes that the resettlement of Eneu can be accomplished independently from the planned cleanup and resettlement of Bikini Island. Plans and combination of plans involving the early resettlement of Eneu are fully feasible and implementable at this time. (author)

  18. Interaction induced dephasing of excitons in wide ZnSe/ZnMgSe single quantum wells

    DEFF Research Database (Denmark)

    Wagner, Hans Peter; Schätz, A.; Maier, R.;

    1998-01-01

    The dephasing of excitons in wide ZnSe/Zn0.94Mg0.06Se single quantum wells (SQW) is investigated by spectrally resolved, time integrated four-wave mixing (FWM). Simultaneous excitation of Is center-of-mass quantized heavy-hole and light-hole excition states leads to pronounced quantum beats...

  19. Pivško jygajo se 'guncajo se' (Petelinje) ali o nastanku slovenskega razmerja jugati : gugati:

    OpenAIRE

    Furlan, Metka

    2010-01-01

    Since the Pivka dialect does not have second palatalization of velars, the verb jyugajo se 'they are swinging' (Petelinje), with its Slovene phonetic equivalents from Slovene gúgati se, is explained with dissimilation g : g --> o : g and the appearance of the prothetic -j.

  20. Bio-fortification and isotopic labelling of Se metabolites in onions and carrots following foliar application of Se and 77Se

    DEFF Research Database (Denmark)

    Kápolna, Emese; Laursen, Kristian H.; Husted, Søren;

    2012-01-01

    The aims were to bio-fortify onions by foliar application of selenium (Se) and to intrinsically label bioactive Se-metabolites in onion and carrot by enriched, stable 77Se for use in human physiological studies. Onion bulbs and leaves were enriched in Se by repeated foliar spraying of 10 or 100μg......Seml−1 solutions of sodium selenite (Se(IV)) or sodium selenate (Se(VI)). ICP-MS analysis of onion leaves and bulbs showed that the Se concentration was enhanced by up to a factor of approximately 50 and 200 in bulbs and leaves, respectively. HPLC–ICP-MS analysis of proteolytic plant extracts showed......Se. The 77Se- labelled metabolites in onions were predominantly γ-glutamyl-77Se-selenomethyl-selenocysteine (γ-glu-Me77SeCys), 77Se-methylselenocysteine (Me77SeCys) and 77Se-selenomethionine (77SeMet). Furthermore, we report here for the first time the finding in carrots of the bioactive Me77Se...

  1. Epitaxial 2D MoSe2 (HfSe2) Semiconductor/2D TaSe2 Metal van der Waals Heterostructures.

    Science.gov (United States)

    Tsoutsou, Dimitra; Aretouli, Kleopatra E; Tsipas, Polychronis; Marquez-Velasco, Jose; Xenogiannopoulou, Evangelia; Kelaidis, Nikolaos; Aminalragia Giamini, Sigiava; Dimoulas, Athanasios

    2016-01-27

    Molecular beam epitaxy of 2D metal TaSe2/2D MoSe2 (HfSe2) semiconductor heterostructures on epi-AlN(0001)/Si(111) substrates is reported. Electron diffraction reveals an in-plane orientation indicative of van der Waals epitaxy, whereas electronic band imaging supported by first-principles calculations and X-ray photoelectron spectroscopy indicate the presence of a dominant trigonal prismatic 2H-TaSe2 phase and a minor contribution from octahedrally coordinated TaSe2, which is present in TaSe2/AlN and TaSe2/HfSe2/AlN but notably absent in the TaSe2/MoSe2/AlN, indicating superior structural quality of TaSe2 grown on MoSe2. Apart from its structural and chemical compatibility with the selenide semiconductors, TaSe2 has a workfunction of 5.5 eV as measured by ultraviolet photoelectron spectroscopy, which matches very well with the semiconductor workfunctions, implying that epi-TaSe2 can be used for low-resistivity contacts to MoSe2 and HfSe2. PMID:26727305

  2. 'Cold' crystallization in nanostructurized 80GeSe2-20Ga2Se3 glass.

    Science.gov (United States)

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe2-20Ga2Se3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized glasses testify in favor of structural fragmentation of larger free-volume entities into smaller ones. Nanocrystallites of Ga2Se3 and/or GeGa4Se8 phases and prevalent GeSe2 phase extracted mainly at the surface of thermally treated samples with preceding nucleation and void agglomeration in the initial stage of annealing are characteristic features of cold crystallization. PMID:25852346

  3. The adsorption properties of the ZnSe-CdSe system components

    International Nuclear Information System (INIS)

    Adsorption properties of solid solutions ZnxCd1-xSe and their binary components (ZnSe and CdSe) in reference to ammonia and carbon dioxide were studied by the method of thermodesorption spectroscopy with manometric and mass-spectrometric analysis of desorption products, IR and ESR spectroscopy. The adsorbents mentioned were powders with specific surface 0.91-1.40 m2/g and monocrystals. It was ascertained that ammonia, which is a probe for acid centers on the surface, is adsorbed better by 1-2 orders than carbon dioxide. It permitted making conclusion on the nature of active centers in the selenides studied and on adsorption mechanism. Regularities in the change of adsorption activity of components in the system ZnSe-CdSe were established

  4. DARWIN Y LA PARADOJA DE LAS ISLAS VACÍAS Darwin and the Empty Island Paradox

    Directory of Open Access Journals (Sweden)

    JUAN FELIPE BLANCO

    Full Text Available Aunque se conoce el interés y fascinación de Darwin por la naturaleza marina a través de sus tratados sobre arrecifes coralinos, islas oceánicas y balanos, poco se comenta sobre los múltiples ejemplos dulceacuícolas que él utilizó para plantear la -teoría de la migración- dentro de -El origen-. Ésta plantea que la fauna y la flora se -dispersan- desde los continentes hacia las islas oceánicas. Sin embargo, en la islas muy alejadas de los centros de origen la probabilidad de colonización es muy baja y por lo tanto solo se encuentra una fracción de la biota continental, pudiendo considerarse en algunos casos -vacías-. Aunque las corrientes de agua de dichas islas también se consideran -vacías-, Darwin propuso un mecanismo para explicar la presencia de peces -dulceacuícolas- en las mismas, y por lo tanto no podrían considerarse -vacías-, lo cual plantea una paradoja. El mecanismo planteado por él coincide con el ciclo de vida conocido actualmente como diádromo en el cual los individuos de muchas especies de peces, camarones y gasterópodos requieren de aguas marinas y dulces para completar su desarrollo. La diadromía es una convergencia evolutiva que apareció en diferentes linajes a partir de ancestros tanto marinos como dulceacuícolas. En este ensayo se discute la evolución de la fauna dulceacuícola insular, sus implicaciones ecológicas y evolutivas, y algunos modelos experimentales. Finalmente, se discute sobre los impactos de las represas en islas tropicales y subtropicales sobre las especies diádromas.Although Darwin's fascination and interest on marine nature are well known due to his treatises about coral reefs, oceanic islands, and barnacles, little is commented about the many -freshwater- examples that he provided for supporting -The Migration Theory- in his book -The Origin of the Species-. According to this theory, faunas and floras disperse from continents to oceanic islands. However, those islands located at

  5. Seabird modulations of isotopic nitrogen on islands.

    Directory of Open Access Journals (Sweden)

    Stéphane Caut

    Full Text Available The transport of nutrients by migratory animals across ecosystem boundaries can significantly enrich recipient food webs, thereby shaping the ecosystems' structure and function. To illustrate the potential role of islands in enabling the transfer of matter across ecosystem boundaries to be gauged, we investigated the influence of seabirds on nitrogen input on islands. Basing our study on four widely differing islands in terms of their biogeography and ecological characteristics, sampled at different spatial and temporal intervals, we analyzed the nitrogen isotopic values of the main terrestrial ecosystem compartments (vascular plants, arthropods, lizards and rodents and their relationship to seabird values. For each island, the isotopic values of the ecosystem were driven by those of seabirds, which ultimately corresponded to changes in their marine prey. First, terrestrial compartments sampled within seabird colonies were the most enriched in δ(15N compared with those collected at various distances outside colonies. Second, isotopic values of the whole terrestrial ecosystems changed over time, reflecting the values of seabirds and their prey, showing a fast turnover throughout the ecosystems. Our results demonstrate that seabird-derived nutrients not only spread across the terrestrial ecosystems and trophic webs, but also modulate their isotopic values locally and temporally on these islands. The wealth of experimental possibilities in insular ecosystems justifies greater use of these model systems to further our understanding of the modalities of trans-boundary nutrient transfers.

  6. Island Movements: Thinking with the Archipelago

    Directory of Open Access Journals (Sweden)

    Jonathan Pugh

    2013-05-01

    Full Text Available Whether in Homer or Plato, Shakespeare or Huxley, throughout history, thinking about islands has shaped how we think about human nature and our place in the world. However, to date archipelagos have received far less attention. This is problematic because we live, increasingly, in a world of island-island movements and not static forms. Not only in the more obvious cases of the Caribbean, Hawaii or the Philippines but, as Stratford et al (2011 say, many ‘continental forms’ like Canada and Australia are in fact archipelagos composed of thousands of island movements. To this list we can add more manufactured archipelagos: wind turbine arrays, industrial oil and military constellations. The key question therefore arises: what does it mean to think with the archipelago? This paper argues firstly that archipelagic thinking denaturalizes the conceptual basis of space and place, and therefore engages ‘the spatial turn’ presently sweeping the social sciences and humanities. Secondly, such thinking highlights the trope of what I call ‘metamorphosis’, of the adaptation and transformation of material, cultural and political practices through island movements. In both cases, I argue that thinking with the archipelago requires an important shift in how we frame analysis and engagement.

  7. Genomic Flatlining in the Endangered Island Fox.

    Science.gov (United States)

    Robinson, Jacqueline A; Ortega-Del Vecchyo, Diego; Fan, Zhenxin; Kim, Bernard Y; vonHoldt, Bridgett M; Marsden, Clare D; Lohmueller, Kirk E; Wayne, Robert K

    2016-05-01

    Genetic studies of rare and endangered species often focus on defining and preserving genetically distinct populations, especially those having unique adaptations [1, 2]. Much less attention is directed at understanding the landscape of deleterious variation, an insidious consequence of geographic isolation and the inefficiency of natural selection to eliminate harmful variants in small populations [3-5]. With population sizes of many vertebrates decreasing and isolation increasing through habitat fragmentation and loss, understanding the extent and nature of deleterious variation in small populations is essential for predicting and enhancing population persistence. The Channel Island fox (Urocyon littoralis) is a dwarfed species that inhabits six of California's Channel Islands and is derived from the mainland gray fox (U. cinereoargenteus). These isolated island populations have persisted for thousands of years at extremely small population sizes [6, 7] and, consequently, are a model for testing ideas about the accumulation of deleterious variation in small populations under natural conditions. Analysis of complete genome sequence data from island foxes shows a dramatic decrease in genome-wide variation and a sharp increase in the homozygosity of deleterious variants. The San Nicolas Island population has a near absence of variation, demonstrating a unique genetic flatlining that is punctuated by heterozygosity hotspots, enriched for olfactory receptor genes and other genes with high levels of ancestral variation. These findings question the generality of the small-population paradigm that maintains substantial genetic variation is necessary for short- and long-term persistence. PMID:27112291

  8. Elemental composition of Usnea sp lichen from Potter Peninsula, 25 de Mayo (King George) Island, Antarctica.

    Science.gov (United States)

    Bubach, Débora; Catán, Soledad Perez; Di Fonzo, Carla; Dopchiz, Laura; Arribére, Maria; Ansaldo, Martin

    2016-03-01

    Several pollutants, which include metals, are present in the Antarctic atmosphere, snow, marine and terrestrial organisms. This work reports the elements incorporated by Usnea sp thalli in Potter Peninsula, 25 de Mayo (King George) Island, South Shetlands, Antarctica. Geological origin was analyzed as possible sources of elements. For this purpose, correlations were done using a geochemical tracer, principal component analysis and enrichment factors were computed. Lithophile elements from particulate matter were present in most of the sampling sites. Bromine, Se and Hg showed the highest enrichment factors suggesting other sources than the particulate matter. Mercury values found in Usnea sp were in the same range as those reported for Deception Island (South Shetlands) and remote areas from the Patagonia Andes. PMID:26741560

  9. Anisotropy in CdSe quantum rods

    Energy Technology Data Exchange (ETDEWEB)

    Li, Liang-shi

    2003-09-01

    The size-dependent optical and electronic properties of semiconductor nanocrystals have drawn much attention in the past decade, and have been very well understood for spherical ones. The advent of the synthetic methods to make rod-like CdSe nanocrystals with wurtzite structure has offered us a new opportunity to study their properties as functions of their shape. This dissertation includes three main parts: synthesis of CdSe nanorods with tightly controlled widths and lengths, their optical and dielectric properties, and their large-scale assembly, all of which are either directly or indirectly caused by the uniaxial crystallographic structure of wurtzite CdSe. The hexagonal wurtzite structure is believed to be the primary reason for the growth of CdSe nanorods. It represents itself in the kinetic stabilization of the rod-like particles over the spherical ones in the presence of phosphonic acids. By varying the composition of the surfactant mixture used for synthesis we have achieved tight control of the widths and lengths of the nanorods. The synthesis of monodisperse CdSe nanorods enables us to systematically study their size-dependent properties. For example, room temperature single particle fluorescence spectroscopy has shown that nanorods emit linearly polarized photoluminescence. Theoretical calculations have shown that it is due to the crossing between the two highest occupied electronic levels with increasing aspect ratio. We also measured the permanent electric dipole moment of the nanorods with transient electric birefringence technique. Experimental results on nanorods with different sizes show that the dipole moment is linear to the particle volume, indicating that it originates from the non-centrosymmetric hexagonal lattice. The elongation of the nanocrystals also results in the anisotropic inter-particle interaction. One of the consequences is the formation of liquid crystalline phases when the nanorods are dispersed in solvent to a high enough

  10. Estimates of Minimum Population Size for Walrus near Southeast Baffin Island, Nunavut

    Directory of Open Access Journals (Sweden)

    Robert EA Stewart

    2013-09-01

    Full Text Available To support management objectives in Canada and Greenland, joint research between the Department of Fisheries and Oceans and Greenland Institute of Natural Resources was begun in 2005. Direct counts were used to determine the Minimum Counted Population (MCP in summer around SE Baffin Island. Aerial surveys examined the coast from roughly the Saddleback Island in northern Hudson Strait to Isabella Bay on eastern Baffin Island but concentrated on the area between Loks Land and Cape Dyer. The maximum count was obtained on 3–4 September 2007 during boat surveys. The MCP ranged from 716 (in 2006 to 1,056 (2007. Using the largest MCP adjusted with published maximum estimates of the proportion of walrus hauled out concurrently, we estimated 1,420 (95% CI: 1,219–1,622 walrus were present. In addition, four walrus had been fitted with satellite relayed data logger tags prior to the maximum counts in 2007. Using the simple proportion of ‘tags dry’ on 3 September to adjust counts on 3 and 4 September 2007 provided an estimate of 2,102 (CI = MCP-4,482. Using the proportion of time dry immediately preceding the survey to adjust the maximum count produced an estimate of 2,502 (CI = 1,660–3,345 walrus were present in Hoare Bay. We conclude approximately 2,100–2,500 walrus were present in Hoare Bay in late summer 2007. This number is a negatively biased estimator of the population of walrus around SE Baffin Island and in the Hudson Bay–Davis Strait stock as a whole. Broader survey coverage in a short period and more detailed information on the movement of walrus between Greenland and Canada and the summer dispersal of these animals within Canada are required to improve population estimates. 

  11. Changes in SE has rounded the minister

    International Nuclear Information System (INIS)

    After transformation of filial companies of Slovenske elektrarne (SE) a.s, Bratislava to separate enterprises, a change of its managers also arose to 1 August. The changes were announced by executive chairman and general manager of SE Miroslav Rapsik. Minister of economy Robert Nemcsics has not participated in companies manager selection. Robert Gunis was named as Bohunice NPP manager, Jaroslav Holubec was named as Mochovce NPP, Eduard Seboek was named as Novaky thermal power plant. Martin Slezak is chief of imposition company, Milan Fedorco is manager of Vojany thermal power plant. Vladimir Majercak has remained manager of Trencin water power plant and Jozef Guba has remained manager of uncompleted Mochovce 3-4 NPP

  12. Iwill P4SE-Gold

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    这是Iwill公司865PE产品线中的一款高档产品。主板要用红色PCB.整体布局显得比较紧凑。P4SE-Gold同时集成了Intel 82547EI千兆网卡芯片和Realtek RTL8100百兆网卡芯片,如果你家中有两台PC需要共享Internet连接.这块主板倒是可以省去额外添置网卡的麻烦。P4SE-Gold在I/O接口的设计上也比较特殊.它集成了2个以太网卡接口,

  13. Low Temperature Photoluminescence of PVT Grown ZnSe and ZnSeTe

    Science.gov (United States)

    Wang, Ling Jun; Su, Ching-Hua; Lehoczky, S. L.

    1999-01-01

    ZnSe and ZnSeTe single crystals were grown by physical vapor transport (PVT) technique horizontally and vertically. The grown ZnSe and ZnSeTe single crystals were characterized by low temperature photoluminescence at 5 to 10 K using the 3.4 eV emission of an argon laser. The intensity of the sharp near band edge defect lines at 2.799, 2.783 eV and the intrinsic free exciton line at 2.802 eV were mapped on various crystal surfaces with different orientations to the gravitational field. The results show the effects of gravity vector orientation on the defect segregation. Comparison of the photoluminescence spectra of the ZeSe crystal before and after annealing in the Zn vapor shows that the 2.783 eV line of ZnSe crystal is related to the zinc vacancy. The photoluminescence spectra of the ternary ZnSeTe crystal were characterized by a single broad band from 2.2 to 2.4 eV, with a Full Width at Half Maximum (FWHM) of about 100 meV. The temperature dependence of the peak position and intensity were determined from 7 to 150 K.

  14. Det faderløse samfund

    DEFF Research Database (Denmark)

    Jensen, Henrik

    Det faderløse samfund er en kulturhistorisk afdækning af fader- og autoritetstabet i det 20. århundredes Europa, med fokus på fader-søn-forholdet og fortalt gennem skikkelser som Max Weber, Freud, Jung, Kafka - og ’den uregerlige søn’ over dem alle, psykologen og anarkisten Otto Gross. Den er sam...

  15. Kan pædagogen se barnet

    DEFF Research Database (Denmark)

    Øhrgaard, Per

    2008-01-01

    relationer er noget levende og foranderligt. Begrebet Kontekst fremhæves ligeledes som et vigtigt begreb, der understreger, at moderne børn må lære at være kontekst-følsomme. Børnene må lære, at forskellige kontekster efterspørger forskellig adfærd. Pædagogerne må se institutionen som et læringsrum hvor...

  16. Cervical cancer screening in the Faroe Islands

    DEFF Research Database (Denmark)

    Hammer, Turið; Lynge, Elsebeth; Djurhuus, Gisela W;

    2015-01-01

    BACKGROUND: The Faroe Islands have had nationally organised cervical cancer screening since 1995. Women aged 25-60 years are invited every third year. Participation is free of charge. Although several European overviews on cervical screening are available, none have included the Faroe Islands. Our...... aim was to provide the first description of cervical cancer screening, and to determine the screening history of women diagnosed with cervical cancer in the Faroe Islands. MATERIAL AND METHODS: Screening data from 1996 to 2012 were obtained from the Diagnostic Centre at the National Hospital...... 1999. At present, 7.0% of samples have abnormal cytology. Of all ASCUS samples, 76-95% were tested for HPV. A total of 58% of women diagnosed with cervical cancer did not participate in screening prior to their diagnosis, and 32% had normal cytology in the previous four years. CONCLUSION: Despite...

  17. Storm impacts on small barrier islands

    DEFF Research Database (Denmark)

    Kroon, Aart; Fruergaard, Mikkel

    changes in this evolution due to changes in the climate and associated sea levels. We analyzed the morphologic evolution of a series of barrier islands over the last decades using maps, aerial photographs and satellite images. This decadal morphologic evolution was coupled to the frequency and intensity...... of the local extreme events. The characterization of the extreme events was based on the joint probability of the extreme water levels and storm waves for the specific sites. The predicted climate change for the Danish waters will lead to higher water levels and an increase of the overwashes on the......The shorelines of the Baltic Sea and the inner coastal waters in Denmark consist of many barrier islands. These sandy barrier islands were mainly formed in the Holocene and are still very dynamic. The present day changes in the morphology are dominantly governed by storm waves and associated high...

  18. The Floating (Pathogenicity) Island: A Genomic Dessert.

    Science.gov (United States)

    Novick, Richard P; Ram, Geeta

    2016-02-01

    Among the prokaryotic genomic islands (GIs) involved in horizontal gene transfer (HGT) are the classical pathogenicity islands, including the integrative and conjugative elements (ICEs), the gene-transfer agents (GTAs), and the staphylococcal pathogenicity islands (SaPIs), the primary focus of this review. While the ICEs and GTAs mediate HGT autonomously, the SaPIs are dependent on specific phages. The ICEs transfer primarily their own DNA, the GTAs exclusively transfer unlinked host DNA, and the SaPIs combine the capabilities of both. Thus the SaPIs derive their importance from the genes they carry (their genetic cargo) and the genes they move. They act not only as versatile high-frequency mobilizers but also as mediators of phage interference and consequently are major benefactors of their host bacteria. PMID:26744223

  19. Aeromagnetic data provide new insights on the volcanism and tectonics of Vulcano Island and offshore areas (southern Tyrrhenian Sea, Italy)

    Science.gov (United States)

    De Ritis, Riccardo; Blanco-Montenegro, Isabel; Ventura, Guido; Chiappini, Massimo

    2005-08-01

    The active Vulcano Island (Southern Tyrrhenian Sea) represents the southernmost portion of a NW-SE elongated volcanic ridge that includes also Lipari and Salina islands. The ridge is affected by a regional, NW-SE to N-S striking fault system. The elaboration and analysis of data from three high-resolution aeromagnetic surveys carried out between 1999 and 2004 on Vulcano and offshore allow us to recognize high intensity magnetic anomalies related to volcanic centers/conduits or shallow intrusions. Previously unreported offshore submarine vents have been also recognized. Some of them may correspond with source areas of outcropping exotic pyroclastics on Vulcano. The spatial analysis of the recognized magnetic anomalies and volcanic structures shows that they are preferably aligned along the strikes of the main regional faults that affect the volcanic ridge. Submarine volcanic conduits revealed by the aeromagnetic survey might represent potential sources for future submarine, effusive or explosive activity.

  20. Neutron Diffraction Researches of Spiractin Layered Semiconductor in Se

    International Nuclear Information System (INIS)

    The analysis of magnetic properties and neutron diffractometry of layered semiconductor In Se doped by Mn was carried out. Neutron diffraction structural researches shown that semiconductor In Se consists of several phases namely In1-x Mn x Se,α-Mn Se, In4Se3. It is a result of low solubility of Mn in In Se. Nonmonotonic temperature dependence of magnetic susceptibility for In Se within temperature range 2.4 . 270 K is due to antiferromagnetic properties of α-Mn Se cubic phase. Quantitative coincidence is achieved at its content about 0.15% weight in In Se. For the first time the lowering of magnetic sublattice parameter for α-Mn Se was discovered. It leads to an appearance of weak ferromagnetism. The assumption of existence self organization superlattices ferromagnetic In-xMnxSe / antiferromagnetic Mn Se is stated

  1. Structures of superconducting palladium selenides, Pd7Se2 and Pd34Se11

    International Nuclear Information System (INIS)

    (I) Pd7Se2, Mr=902.72, monoclinic, P21/a, a=9.441 (7), b=5.370 (5), c=5.495 (4) A, β=93.61 (7)0, V=278.0 (4) A3, Z=2, Dx=10.78 Mg m-3, λ(AgKα)=0.5608 A, μ(AgKα)=17.5 mm-1, F(000)=780, 298 K, R=0.042.16, monoclinic, P21/n, a=21.413 (5), b=5.504 (1), c=12.030 (2) A, β=99.44 (2)0, V=1398.6 (5) A3, Z=2, Dx=10.65 Mg m-3, λ(MoKα)=0.71073 A, μ(MoKα)=35.2 mm-1, F(000)=3876, 298 K, R=0.032 for 2591 reflections. In Pd7Se2, the Se atom is surrounded by seven Pd atoms, and the Pd atom has eight or nine Pd neighbors. In Pd34Se11, the Se atom is surrounded by five to seven Pd atoms, and the Pd atom has five to ten Pd neighbors. In both crystals, each Pd atom is coordinated by two Se atoms with a few exceptions in Pd34Se11. The Pd-Se bonds are essentially covalent with the bond lengths ranging from 2.4 to 2.6 A; the Pd-Pd bonds with interatomic distances 2.7-3.2 A are considered to be metallic. Irregular three-dimensional networks of Pd-Se chains are formed. (orig.)

  2. Innovation in island ecotourism in different contexts: Yakushima (Japan and Tahiti and its Islands

    Directory of Open Access Journals (Sweden)

    Anne-Marie d’Hauteserre

    2016-05-01

    Full Text Available This article examines whether the future of tourism in island destinations lies in more and continued innovation on the part of all stakeholders so tourists will consider the extra expense of travelling a worthwhile investment. Islands have long been icons as tourism destinations. However, established destination images can cause a lack in adaptability to changing markets. Though located in different parts of the world and seeking different markets most island destinations would benefit from innovative strategies and products to enhance their attractiveness to high yield visitors. The article uses two examples to analyse the innovative forms that have been adopted in island destinations in the hope they could become models or encourage imitation by other destinations. Two aspects of innovation are discussed. New imaginary can creatively and innovatively (re-imagine representations; sustainability could be an important innovative pursuit, which requires new narratives for continued tourism growth. These concepts are applied next to the island of Yakushima in Japan and Tahiti and its Islands to determine the main innovative elements used or required to jumpstart the attractiveness of island destinations, though it is recognized that implementation is complex.

  3. Thermoelectric properties of SnSe compound

    International Nuclear Information System (INIS)

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data

  4. Forming Glasses from Se and Te

    Directory of Open Access Journals (Sweden)

    Pierre Lucas

    2009-10-01

    Full Text Available Despite being close neighbors on the Periodic Table, selenium and tellurium present a totally different abilities to form glasses. Se is a very good glass former, and gives rise to numerous glass compositions which are popular for their transparency in the infrared range and their stability against crystallization. These glasses can be shaped into sophisticated optical devices such as optical fibers, planar guides or lenses. Nevertheless, their transparencies are limited at about 12 μm (depending on the thickness of the optical systems due to the relatively small mass of the Se element. On the other hand, tellurium is heavier and its use in substitution for Se permits to shift the IR cutoff beyond 20 μm. However, the semimetallic nature of Te limits its glass formation ability and this glass family is known to be unstable and consequently has found application as phase change material in the Digital Versatile Disk (DVD technology. In this paper, after a review of selenide glasses and their applications, it will be shown how, in a recent past, it has been possible to stabilize tellurium glasses by introducing new elements like Ga or I in their compositions.

  5. Thermoelectric properties of SnSe compound

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Xinhong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Lu, Pengfei, E-mail: photon@bupt.edu.cn [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Wu, Liyuan; Han, Lihong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Liu, Gang [School of Electronic Engineering, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Song, Yuxin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Wang, Shumin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Photonics Laboratory, Department of Microtechnology and Nanoscience, Chalmers University of Technology, 41296 Gothenburg (Sweden)

    2015-09-15

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data.

  6. Patrimonio cultural: lo intangible se hace tangible

    Directory of Open Access Journals (Sweden)

    William Heredia Orjuela

    2004-11-01

    Full Text Available Se presentan tres reflexiones a manera de ensayo, elaboradas por estudiantes de vii semestre de la Facultad de Administración de Empresas Turísticas y Hoteleras. El tema central que engloba los escritos es el de la responsabilidad frente al patrimonio cultural, su valoración y su relación con el turismo. En el ensayo La protección del patrimonio cultural como reflejo del ser humano, la estudiante cecilia hinosTrosa hace un llamado de atención frente al problema del tráfico ilícito de bienes que conlleva la pérdida de testimonios de la cultura humana. El escrito de la estudiante mariel cecilia hernández destaca las bondades de recuperar las tradiciones y de cómo éstas se pueden difundir a través del turismo. Por último, el estudiante William heredia hace una reflexión sobre la tangibilidad de lo intangible, en el ensayo Patrimonio Cultural: lo tangible se hace intangible, donde destaca la declaratoria del Carnaval de Barranquilla como patrimonio oral e intangible de la humanidad.

  7. Experience with the SE in Germany

    Directory of Open Access Journals (Sweden)

    Jochem Reichert

    2008-03-01

    Full Text Available A rather significant proportion of the Societas Europaeas (the European Company, or SE formed to date have had German roots. German corporate law has been enriched by an interesting alternative which meanwhile seems to have gained momentum. This contribution focuses on SEs incorporated by German entrepreneurs and provides an interesting account concerning the use of SEs in Germany in practice, such as Allianz, Fresenius, BASF and Porsche. Has the SE been used to circumvent rigid company law provisions or is it a more flexible and effective tool, perhaps, for company mobility? The practical motives behind setting up this company form are also reflected upon. These include: the facilitation of cross-border mergers; transfer of the registered office; the ‘European’ image; a more flexible form of co-determination in large companies (reduction of the number of supervisory board members; avoidance and freezing of co-determination for medium-sized enterprises; the appeal of the one-tier system and its endangerment by German co-determination; and flat and uniform structures for company groups. The author also briefly discusses some of the problems arising from the formation of SEs in Germany. He ultimately concludes that practice has shown that it is possible to work with the legal regime of the SE in Germany, which adds a new company form to those available in that Member State.

  8. Assesing Geographic Isolation of the Galapagos Islands

    Science.gov (United States)

    Orellana, D.; Smith, F.

    2016-06-01

    The Galapagos Archipelago is one of the most important ecological spots in the planet due its unique biodiversity, active geology, and relatively well-preserved ecosystems. These characteristics are strongly based on the geographical isolation of the islands. On the one hand this isolation allowed the evolution processes that gave the islands their international fame and on the other hand it kept them from major human impacts that affected the vast majority of the Earth's surface. Galapagos' geographical isolation is therefore of mayor value, but it is rapidly diminishing due to the increase of marine and air transportation among islands and with the rest of the world. This increased accessibility implies enhanced risks for the ecological dynamics on the archipelago (e.g. increased risk of biological invasions, uncontrolled tourism growth, more water and energy consumption). Here, we introduce a general accessibility model to assess geographical isolation of the Galapagos Islands. The model aims to characterize accessibility in terms of human mobility by evaluating travel time to each point of the archipelago using all available transportation modalities. Using a multi criteria cost surface for marine and land areas, we estimated travel time for each surface unit using the fastest route and mode of transportation available while considering several friction factors such as surface type, slope, infrastructure, transfer points, legal restrictions, and physical barriers. We created maps to evaluate the isolation of different islands and places, highlighting the potential risks for several habitats and ecosystems. The model can be used for research and decision-making regarding island conservation, such as estimating spreading paths for invasive species, informing decisions on tourism management, and monitoring isolation changes of sensitive ecosystems.

  9. Finnish travelers' travel motivation : case: Canary Islands

    OpenAIRE

    Jokilehto, Katri

    2012-01-01

    The aim of the thesis was to study the travel motives which lead Finnish people to travel to the Canary Islands and other factors which impact on the holiday decision process and destination choice. The target group for the research was Finnish people and the aim was to study the travel motives of Finns to the Canary Islands and which factors are important for Finnish people to gain a successful holiday. The research was conducted by using internet survey and the collected data was analyzed b...

  10. Islands in the Midst of the World

    Science.gov (United States)

    2002-01-01

    The Greek islands of the Aegean Sea, scattered across 800 kilometers from north to south and between Greece and western Turkey, are uniquely situated at the intersection of Europe, Asia and Africa. This image from the Multi-angle Imaging SpectroRadiometer includes many of the islands of the East Aegean, Sporades, Cyclades, Dodecanese and Crete, as well as part of mainland Turkey. Many sites important to ancient and modern history can be found here. The largest modern city in the Aegean coast is Izmir, situated about one quarter of the image length from the top, southeast of the large three-pronged island of Lesvos. Izmir can be located as a bright coastal area near the greenish waters of the Izmir Bay, about one quarter of the image length from the top, southeast of Lesvos. The coastal areas around this cosmopolitan Turkish city were a center of Ionian culture from the 11th century BC, and at the top of the image (north of Lesvos), once stood the ancient city of Troy.The image was acquired before the onset of the winter rains, on September 30, 2001, but dense vegetation is never very abundant in the arid Mediterranean climate. The sharpness and clarity of the view also indicate dry, clear air. Some vegetative changes can be detected between the western or southern islands such as Crete (the large island along the bottom of the image) and those closer to the Turkish coast which appear comparatively green. Volcanic activities are evident by the form of the islands of Santorini. This small group of islands shaped like a broken ring are situated to the right and below image center. Santorini's Thera volcano erupted around 1640 BC, and the rim of the caldera collapsed, forming the shape of the islands as they exist today.The Multi-angle Imaging SpectroRadiometer observes the daylit Earth continuously from pole to pole, and views almost the entire globe every 9 days. This natural-color image was acquired by MISR's nadir (vertical-viewing) camera, and is a portion of the

  11. How a bird is an island

    Directory of Open Access Journals (Sweden)

    Lapoint Richard

    2012-06-01

    Full Text Available Abstract Replicate adaptive radiations occur when lineages repeatedly radiate and fill new but similar niches and converge phenotypically. While this is commonly seen in traditional island systems, it may also be present in host-parasite relationships, where hosts serve as islands. In a recent article in BMC Biology, Johnson and colleagues have produced the most extensive phylogeny of the avian lice (Ischnocera to date, and find evidence for this pattern. This study opens the door to exploring adaptive radiations from a novel host-parasite perspective. See research article: http://www.biomedcentral.com/1741-7007/10/52

  12. Topological description of Easter Islander palmar dermatoglyphics.

    Science.gov (United States)

    Goodson, C S; Meier, R J

    1986-10-01

    A sample of 594 Easter Islander palms was analyzed according to the topological method. Some suggestions for clarification of the topological approach were made, including clearer definition of the palmar triradii and substitution of the term "profile" for "formula." The frequency of Easter Islander profiles was compared against British and Australian Aborigine samples (Loesch, 1974; 1983a,b) and found to be significantly different for two of the ten most common combinations. The individual pattern elements, pattern intensities, a-b count, A-line exit, and atd angle were described, with population comparisons made when they were available. PMID:3799825

  13. Rapid synthesis of CuInSe{sub 2} from sputter-deposited bilayer In{sub 2}Se{sub 3}/Cu{sub 2}Se precursors

    Energy Technology Data Exchange (ETDEWEB)

    Koo, Jaseok [School of Chemical Engineering, Yeungnam University, Gyeongsan, Gyeongbuk 712-749 (Korea, Republic of); Kim, Chae-Woong; Jeong, Chaehwan [Applied Optics and Energy Research Group, Korean Institute of Industrial Technology, 500-480 (Korea, Republic of); Kim, Woo Kyoung, E-mail: wkim@ynu.ac.kr [School of Chemical Engineering, Yeungnam University, Gyeongsan, Gyeongbuk 712-749 (Korea, Republic of)

    2015-05-01

    Binary bilayer glass/Mo/In{sub 2}Se{sub 3}/Cu{sub 2}Se precursors have been used to rapidly form CuInSe{sub 2}. Considering their possible application to large-area deposition processes, bilayer precursors were deposited by sequential radiofrequency sputtering of In{sub 2}Se{sub 3} and direct current sputtering of Cu{sub 2}Se onto unheated, Mo-coated glass substrates. High-temperature X-ray diffraction analysis of the glass/Mo/Cu{sub 2}Se sample confirmed that the as-deposited polycrystalline Cu{sub 2−x}Se phase is likely transformed to CuSe at approximately 210 °C, and then to CuSe{sub 2} at 260 °C. Further increase in temperature resulted in the peritectic decomposition of CuSe{sub 2} to CuSe (+ liquid) at approximately 330 °C, and then to Cu{sub 2−x}Se (+ liquid) at around 380 °C with the release of Se. Pre-annealing of In{sub 2}Se{sub 3}/Cu{sub 2}Se precursors in Se environment resulted in the formation of a liquid phase, which is in equilibrium with CuSe. Rapid, thermal annealing of pre-annealed samples between 500 and 550 °C apparently enhanced grain growth and reduced the reaction time to about 3 min; this can be explained by a liquid phase-assisted grain growth mechanism. - Highlights: • CuInSe{sub 2} can be synthesized from In{sub 2}Se{sub 3}/Cu{sub 2}Se precursor within 3 min at 550 °C. • In{sub 2}Se{sub 3} and Cu{sub 2}Se precursors were deposited by sputtering binary targets. • Heat treatment of Cu{sub 2}Se with Se vapor at 300 °C for 10 min can lead to CuSe.

  14. Caring for the Environment and the Mitigation of Natural Extreme Events in Gau Island, Fiji Islands

    Directory of Open Access Journals (Sweden)

    Joeli Veitayaki

    2006-11-01

    Full Text Available Since 2001, the villagers in Vanuaso Tikina, Gau Island, Fiji, have collaborated with the University of the South Pacific to manage their environmental resources to prepare them for difficult and challenging times ahead. This review essay seeks to publicize this island community-based experience by illustrating a range of resource management initiatives, and some of the challenges of their implementation. The experience is instructive to the rest of Fiji and other island and coastal societies where similar initiatives can be tried or further promoted.

  15. Vulnerability assessment of small islands to tourism: The case of the Marine Tourism Park of the Gili Matra Islands, Indonesia

    Directory of Open Access Journals (Sweden)

    Fery Kurniawan

    2016-04-01

    Full Text Available The Indonesian government is currently directing its focus of development on the optimum uses of marine and coastal ecosystem services including the marine and coastal tourism. One of the main locus of coastal and marine tourism is the small islands tourism such as Gili Matra Islands among others. Small islands tourism is one of the favourite touristic activities because the destination provides beauty, exotism, aesthetic and a diversity of natural habitats including the warm, clear and attractive water. Tourism is being considered as a development instrument in order to boost a country’s economy and has become part of the global industry. However, tourism is also one of the actors that is responsible for environmental depletion, due to the constructions of buildings and tourism activities. This paper aims to study the level of vulnerability in small islands to tourism as a basis of integrated small islands management in Indonesian conservation area. The group of islands in this study consists of three islands namely Gili Ayer Island, Gili Meno Island and Gili Trawangan Island (known as Gili Matra Islands that were observed using Small Islands Vulnerability Index (SIVI. The results indicate that Gili Matra Islands have a vulnerability status from low into moderate, ranging from 2.25 to 2.75. Gili Ayer Island has the highest vulnerability with SIVI of 2.75 (Moderate, followed by Gili Meno Island with SIVI of 2.50 (Low and Gili Trawangan Island with SIVI of 2.25 (Low. The driving factor of vulnerability is the intensive utilization of marine tourism activities. Tourism is the sole stress to Gili Matra Island’s ecosystem due to its direct damaging impact and reducing its environmental quality. The vulnerability index which was built from the coastline, coral reef, live coral reef, and development area was applicable to assess the small island’s vulnerability in Indonesia, especially for coral island.

  16. Correspondence Regarding the Purchase of St. Vincent Island

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document contains a series of letters discussing the sale of St. Vincent Island. Robert Bishop wishes to purchase the island and writes back and forth with the...

  17. Bald eagle nest survey, 1981, Amchitka Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A nesting survey for bald eagles Haliaeetus leucocephalus was conducted from May 29, 1981, on a portion of Amchitka Island, Aleutian Islands Unit, Alaska Maritime...

  18. Breast Cancer and the Environment on Long Island

    Science.gov (United States)

    The cornerstone of the LIBCSP is the Breast Cancer and the Environment on Long Island Study, which was undertaken to determine whether certain environmental contaminants increase risk of breast cancer among women on Long Island.

  19. Estuarine Shoreline and Barrier-Island Sandline Change Assessment Dataset

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Barrier Island and Estuarine Wetland Physical Change Assessment Dataset was created to calibrate and test probability models of barrier island sandline and...

  20. Vascular plant diversity of the Paracel Islands, China

    Directory of Open Access Journals (Sweden)

    Yi Tong

    2013-05-01

    Full Text Available The Paracel Islands (Xisha Islands comprise a group of tropical islands that are located south of mainland China and have a particular natural flora. Based on a literature search and our own investigations, we present here a checklist of plants for 24 of the Paracel Islands. We also report an analysis of plant diversity, its distribution and relationship with that of neighboring regions. A total of 396 vascular plants were recorded which belonged to 262 genera and 85 families. Of these, 220 were wild species and 176 were cultivated. As a whole, the islands do not possess a rich flora; however, there are major differences in plant diversity among islands. The flora consists in large part of tropical elements, typical of tropical coral islands of China. The flora is most closely connected to that of Hainan Island, and closely related to those of Taiwan of China, Indochina, Malaysia, Indonesia and the Philippines.

  1. Kodiak brown bear population on Kodiak Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Methods and estimates of the Brown bear population on Kodiak Island. The total number of Kodiak Brown Bears on Kodiak Island has been estimated to be 1669. Three...

  2. Northern Mariana Islands Marine Monitoring Team Reef Flat Surveys

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Commonwealth of the Northern Mariana Islands' (CNMI) interagency marine monitoring team conducts surveys on reef flat areas on the islands of Saipan, Tinian and...

  3. Rural development issues in Prince Edward Island, Canada

    Directory of Open Access Journals (Sweden)

    Stephen A. Royle

    2002-01-01

    Full Text Available Historical background and contemporary rural area differencies in PrinceEdwar Island is represented. The effects of some development projects areanalysed zaking into account the changes of activity orientation of differentparts of the island.

  4. Shipwreck archaeology of the Lakshadweep Islands, west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.; Gudigar, P.

    Archaeological investigations in the Lakshadweep Islands have brought to light the presence of a large number of shipwrecks and the archival records have the details of some of these wrecks. Northern islands and reefs of Minicoy were the locations...

  5. Stability of externally driven magnetic islands in a helical plasma

    International Nuclear Information System (INIS)

    Influence of external resonant magnetic perturbation (RMP) on a helical plasma is numerically investigated, using a set of reduced magnetohydrodynamic equations. Coexistence of the resistive interchange mode and RMP is simulated. In nonlinear simulations, saturated magnetic islands by the RMP typically show two states: oscillating small islands and locked large islands. In the former state, rotation of magnetic islands by neoclassical transport-driven poloidal flows disturbs growth of islands. On the other hand, in the latter state, locking of poloidal flows due to the RMP and growth of islands occur simultaneously. It is found that the curvature driven current enhances magnetic reconnection, and width of the large islands overcomes that of vacuum islands. (author)

  6. Inventory Plan for Merritt Island National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a wildlife inventory plan for Merritt Island, Pelican Island and St. Johns National Wildlife Refuge system. Species selected were based on the Refuge...

  7. Island biogeography: Shaped by sea-level shifts

    Science.gov (United States)

    Fernández-Palacios, José María

    2016-04-01

    An analysis of changes in island topography and climate that have occurred since the last glacial maximum 21,000 years ago shows how sea-level change has influenced the current biodiversity of oceanic islands. See Letter p.99

  8. FastStats: Health of Asian or Pacific Islander Population

    Science.gov (United States)

    ... NCHS Home Health of Asian or Pacific Islander Population Recommend on Facebook Tweet Share Compartir Data are ... U.S. Live births for Asian or Pacific Islander population Number of births: 282,723 Births per 1, ...

  9. Blackbeard Island Wilderness: Report on wilderness character monitoring

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report provides a detailed summary of the baseline wilderness character assessment completed for the Blackbeard Island Wilderness on the Blackbeard Island...

  10. The low prevalence of hypertension in Falkland Islands men

    OpenAIRE

    King, H. O. M.; Bleaney, A. A.

    1984-01-01

    A morbidity survey in the Falkland Islands, conducted in 1979, showed that Falkland Islands men had a lower prevalence of hypertension than their counterparts in the United Kingdon. Such a difference was not found in women.

  11. Northern fur seal pup weights, Pribilof Islands, Alaska, 1957-present

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This database contains northern fur seal pup mass and length data by date, island, rookery and sex on the Pribilof Islands, Alaska, collected between 1957-2012....

  12. AES, LEED and PYS investigation of Au deposits on InSe/Si(1 1 1) substrate

    Energy Technology Data Exchange (ETDEWEB)

    Abidri, B. [Faculte des Sciences, Departement de Physique, Universite Djillali Liabes, Sidi Bel-Abbes 22000 (Algeria); Ghaffour, M., E-mail: mohghaffour@yahoo.fr [ENSET d' Oran, BP 1523 Oran Mnaouar, Oran (Algeria); Abdellaoui, A.; Bouslama, M. [ENSET d' Oran, BP 1523 Oran Mnaouar, Oran (Algeria); Hiadsi, S. [Laboratoire de microscopie electronique USTO, departement de physique, BP1505 El m' naouar, Oran (Algeria); Monteil, Y. [Laboratoire de physique de la matiere condensee et nanostructures, laboratoire des multimateriaux et interfaces, Universite Claude Bernard Lyon I, 43 Bd du 11 novembre 1918, Villeurbanne 69622 (France)

    2010-03-01

    Auger Electron Spectroscopy (AES), Low Energy Electron Diffraction (LEED) and Photoelectron Yield Spectroscopy (PYS) measurements have been used to monitor the interaction of gold (Au) deposits on InSe/Si(1 1 1) substrate. Au has been sequentially deposed under ultra-high vacuum onto 40 A-thick film of layered semiconductor InSe which is epitaxially grown by molecular beam epitaxy (MBE) on a Si(1 1 1)1 x 1-H substrate and kept at room temperature. Au coverage varies from 0.5 monolayer to 20 monolayers (ML) (in terms of InSe atomic surface plane: 1 ML = 7.2 1014 at/cm{sup 2}) which is corresponding to 1.30 A of Au-metal. The Au/InSe/Si(1 1 1) system was characterized as function of Au deposit, we noticed an interaction at room temperature starts as an apparent intercalation process until 5 ML. Beyond this dose Au islands begin to form on the sample surface without interaction with InSe substrate, thus the interface is far from to be a simple junction Au-InSe.

  13. Adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene: First principle calculations

    Energy Technology Data Exchange (ETDEWEB)

    Üzengi Aktürk, O., E-mail: ouzengi@adu.edu.tr [Department of Physics, Adnan Menderes University, Aydın 09100 (Turkey); Tomak, M. [Department of Physics, Middle East Technical University, Ankara 06800 (Turkey)

    2015-08-30

    Highlights: • Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. • It is found that RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic. • RuSe{sub 2} makes it half metallic and RuSe{sub 3} makes semiconductor. - Abstract: We have investigated the adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene. The change of the adsorption energy with the number of Se atoms and magnetization values are investigated. Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. The highest adsorption energy belongs to RuSe adsorbate. The biggest magnetization value belongs to RuSe{sub 2} adsorbate. This adsorbate makes the substrate half metallic. This property is important in electronic device applications. It is observed that substitutional Se atom changes the electronic properties of graphene. This substitution makes graphene metallic. While RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic, RuSe{sub 3} makes it semiconducting. Generally, it is found that there is a charge transfer from the substrate to clusters within the Löwdin analysis. This is in line with the charge difference results.

  14. 77Se nuclear magnetic resonance of topological insulator Bi2Se3

    Science.gov (United States)

    Georgieva, Nataliya M.; Rybicki, Damian; Guehne, Robin; Williams, Grant V. M.; Chong, Shen V.; Kadowaki, Kazuo; Garate, Ion; Haase, Jürgen

    2016-05-01

    Topological insulators constitute a new class of materials with an energy gap in the bulk and peculiar metallic states on the surface. We report on new features resulting from the bulk electronic structure, based on a comprehensive nuclear magnetic resonance (NMR) study of 77Se on Bi2Se3 and Cu0.15Bi2Se3 single crystals. First, we find two resonance lines and show that they originate from the two inequivalent Se lattice sites. Second, we observe unusual field-independent linewidths and attribute them to an unexpectedly strong internuclear coupling mediated by bulk electrons. In order to support this interpretation, we present a model calculation of the indirect internuclear coupling and show that the Bloembergen-Rowland coupling is much stronger than the Ruderman-Kittel-Kasuya-Yosida coupling. Our results call for a revision of earlier NMR studies and add information concerning the bulk electronic properties.

  15. ZnSe-ZnMnSe and CdTe-CdMnTe superlattices

    Science.gov (United States)

    Gunshor, R. L.; Kolodziejski, L. A.; Otsuka, N.; Datta, S.

    1986-08-01

    We report the growth and characterization of superiattices of a new wide-gap, zincblende material system, Zn 1 - xMn xSe. ZnSe exhibiting dominant free excitonic emission in photoluminescence (PL) is the well material, while wider-band-gap Zn 1 - xMn xSe (0.23 efficiency compared to films of the ZnSe well material, while transmission electron microscopy shows extremely abrupt interfaces by the presence of seventh-order satellite spots. Previously reported superiattices in the CdTe-CdMnTe material system were grown with the (111) orientation, and exhibit unique excitonic properties believed related to the (111) interfaces. Using various techniques to select (111) or (100) heteroepitaxy of CdTe on (100) GaAs, we report the first (100) superlattices of this material, and compare the optical properties to the previous (111) structures.

  16. Citrus Genetic Resources Grown on the Ryukyu Islands, Japan

    OpenAIRE

    Yamamoto, Masashi; ヤマモト, マサシ; 山本, 雅史

    2014-01-01

    The Ryukyu Islands are located southwest part of Japan. Various local citrus are grown in this subtropical region. Since there are large geographical and climatic differences between the Ryukyu Islands and the main islands (Honshu, Kyushu, and Shikoku) of Japan, there are unique local citrus genetic resources on the Ryukyu Islands. Shiikuwasha (Citrus depressa) is an indigenous mandarin species in this region. This species is clearly distinguished from the mandarin grown in China and India ba...

  17. Chumash Ritual and Sacred Geography on Santa Cruz Island, California

    OpenAIRE

    Perry, Jennifer E.

    2007-01-01

    In contrast to the archaeological visibility of Chumash rock art on the mainland, its virtual absence on the northern Channel Islands is reflective of what little is understood about ritual behavior in island prehistory. By relying on relevant ethnohistoric and ethnographic references from the mainland, it is possible to evaluate how related activities may be manifested archaeologically on the islands. On Santa Cruz Island, portable ritual items and rock features have been identified on El Mo...

  18. Greek Islands, Western Asia Minor as seen from STS-58

    Science.gov (United States)

    1993-01-01

    This north-looking view shows the western margin of Turkey (right) and the Dodecanese Islands of Greece between the Aegean Sea (left) and the Sea of Crete (foreground). The largest island is Crete (foreground) with the semicircular island of Thira beyond. Thira is dominated by the volcanoe Santorini. Two airplane contrails appear between the Turkish mainland and the large island of Rhodes immediately offshore. The narrow straits of the Dardanelles, joining the Black Sea to the Mediterranean, can be detected top left.

  19. Terrestrial reptiles from San Lorenzo Island, Lima, Peru

    Directory of Open Access Journals (Sweden)

    José Pérez Z.

    2015-04-01

    Full Text Available We report four species of terrestrial reptiles, a geckonid (Phyllodactlus cf. microphyllus, two lizards (Microlophus peruvianus and M. tigris and one snake (Pseudalsophis elegans from San Lorenzo island, Departament of Lima, Peru. Herein, we report the first record of “Loma’s lizard” M. tigris and the snake P. elegans in Peruvian islands. The presence of Lomas herbaceous and the considerable extent of San Lorenzo island can explain the relatively high species richness of terrestrial reptiles on the island.

  20. Reconnection of islanded portion of the CIGRE low voltage network

    OpenAIRE

    Mustafa, Ghullam; Bak, Claus Leth; Bak-Jensen, Birgitte; Burirro, Ehsan Ali

    2016-01-01

    Islanding is a condition where a portion of the power network is electrically isolated from the main the transmission grid. Islanded operation is encouraged in order to improve the reliability of the power network. However, the reliability of the small networks operating is island is less as compared to that of the grid connected system. The islanded portion of the distribution network can be reconnected to the transmission grid if the voltage magnitudes, voltage phase angles and the frequenc...

  1. Quantum superposition of charge states on capacitively coupled superconducting islands

    OpenAIRE

    Heij, C. P.; Dixon, D C; van der Wal, C H; Hadley, P.; Mooij, J.E.

    2003-01-01

    We investigate the ground state properties of a system containing two superconducting islands coupled capacitively by a wire. The ground state is a macroscopic superposition of charge states, even though the islands cannot exchange charge carriers. The ground state of the system is probed by measuring the switching current of a Bloch transistor containing one of the islands. Calculations based on superpositions of charge states on both islands show good agreement with the experiments. The abi...

  2. Comparative crystal-structure study of Ag-free lilliantite and galenobismutite from vulcano, Aeolian Islands, Italy

    DEFF Research Database (Denmark)

    Pinto, Daniela; Balic Zunic, Tonci; Garavelli, Anna; Makovicky, Emil; Vurro, Filippo

    2006-01-01

    The crystal structures of natural Ag-free lillianite of fumarolic origin from Vulcano, Aeolian Islands, Italy, Pb2.88Bi2.12(S5.67 Se0.33)S6.00, with a 13.567(1), b 20.655(2), c 4.1216(4) Å, V 1155.0(2) Å3, space group Bbmm, Z = 4, and galenobismutite also from Vulcano, Pb1.00Bi2.03(S3.87Se0.11)¿3...

  3. Temperature dependence of excitonic transition in ZnSe/ZnCdSe quantum wells

    Institute of Scientific and Technical Information of China (English)

    GUO Zi-zheng; LIANG Xi-xia; BAN Shi-liang

    2005-01-01

    A theoretical calculation for the temperature dependence of the excitonic transition in ZnSe/ZnCdSe quantum wells is performed. The exciton binding energy is calculated with a variational technique by considering the temperature-dependence parameters. Our results show that the exciton binding energy reduces linearly with temperature increasing. We find that the strain due to lattice mismatch and differential thermal expansion decreases with the temperature increasing.

  4. Quasikristalle und verwandte Phasen im System Zn-Mg-SE (SE=Y, Er, Ho, Dy)

    OpenAIRE

    Sterzel, Roland

    2003-01-01

    Ziel dieser Arbeit ist die Herstellung und Charakterisierung von Zn-Mg-SE-Legierungen (SE = Y, Ho, Er, Dy, Tb, Gd), um Informationen über Struktur, Stabilisierung und physikalische Eigenschaften der quasikristallinen Phasen dieses Systems zu erhalten. Die Quasikristalle dieses Systems unterscheiden sich von Quasikristallen anderer Legierungen, die meist Al als Hauptkomponente enthalten. Es konnten bis zu 275 mm3 große Einkristalle der flächenzentriert ikosaedrischen Phase in den Systemen Zn-M...

  5. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1208, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  6. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1302, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  7. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1306_AfterCalib, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  8. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1107, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  9. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1102L1, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  10. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1306_BeforeCalib, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  11. Marine Resource Survey in waters surrounding Guam and the Commonwealth of the Northern Mariana Islands (SE1002, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goals of the cruise were to collect a variety of data to assess the status of marine resources in waters surrounding Guam and CNMI. Marine resource habitats...

  12. Energy dynamics in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Heimbrodt, Wolfram; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam [Department of Physics and Material Sciences Center, Phillipps-University Marburg (Germany)

    2009-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between dilute magnetic ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The DQWs have been studied by cw and time resolved spectroscopy in external magnetic fields up to 7 Tesla. The ZnSe quantum wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is the main difference to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures with heavy hole excitons being the lowest lying states. In the magnetic field we were able to change the barrier height, to split the states of the wells due to the Giant-Zeeman-effect of the ZnMnSe barriers and to manipulate the radiationless energy transfer processes between the 3d-internal transitions and the excitonic states. As a result of the sophisticated interaction of these mechanisms a unique excitation energy dynamics was found and is discussed in detail.

  13. Tunnelling process in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Niebling, Tobias; Heimbrodt, Wolfram [Phillipps-University Marburg (Germany). Department of Physics and Matrial Science Center

    2008-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The ZnSe wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is different to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures made of diluted magnetic semiconductors with heavy hole excitons to be the lowest lying states. In an external magnetic field we were able to manipulate the barrier height due to Giant Zeeman effect of the ZnMnSe barriers. Hence we can study the tunnelling processes in these structures in dependence of the height and width of the barrier by photoluminescence, photomodulated reflectivity as well as time resolved measurements. Surprisingly, very different results to heavy hole tunnelling have been found. The obtained results and differences will be discussed in detail.

  14. Optical properties of type-I PbSe/CdSe core/shell quantum dot

    International Nuclear Information System (INIS)

    Electronic properties and optical properties of exciton in a PbSe/CdSe core/shell quantum dot are investigated taking into account the spatial confinement effect. The present model is based on the PbSe/CdSe quantum dot for type-I confinement regime. The dielectric mismatch effect and the self polarization potential are taken into consideration in the PbSe/CdSe quantum dot nanostructure. Polarization charges are incorporated at the interface of the core/shell materials. Numerical calculations on the electronic and optical properties are found with the ratio of radius of inner and outer shell materials for various shell radii. The exciton binding energy and the interband optical transition energies are computed using variational formulism within the single band effective mass approximation. The oscillator strength and the recombination life time are determined with the ratio of radius of core to shell materials taking into account the dielectric mismatch between the materials. The nonlinear absorption coefficients and the changes of refractive index are computed for the ground and first excited state using compact density matrix method. The obtained results are found to be in good agreement with those reported by other investigators

  15. Self healing of magnetic islands in a Heliac

    International Nuclear Information System (INIS)

    Studies of sequences of finite pressure equilibria in the H-1NF Heliac using the HINT code have revealed true self-healing of a magnetic island chain. Other phenomena described include a strong dependence of the growth of islands on the plasma pressure profile as well as the possibility of a bifurcation to a double island chain at the minimum width. (author)

  16. Terroir, storytelling and cultural heritage as opportunity for island entrepreneurship

    DEFF Research Database (Denmark)

    Korsgaard, Steffen T.

    This paper explores how entrepreneurs can create opportunities for business in rural island settings. Three cases of food entrepreneurship are examined and it is suggested that opportunities can be created by leveraging the unique localized resources available in rural island settings in persuasive...... and authentic stories told through and about the products. Similarities and differences between conventional and rural island entrepreneurship are explored....

  17. Interaction of bootstrap-current-driven magnetic islands

    International Nuclear Information System (INIS)

    The formation and interaction of fluctuating neoclassical pressure gradient driven magnetic islands is examined. The interaction of magnetic islands produces a stochastic region around the separatrices of the islands. This interaction causes the island pressure profile to be broadened, reducing the island bootstrap current and drive for the magnetic island. A model is presented that describes the magnetic topology as a bath of interacting magnetic islands with low to medium poloidal mode number (m congruent 3-30). The islands grow by the bootstrap current effect and damp due to the flattening of the pressure profile near the island separatrix caused by the interaction of the magnetic islands. The effect of this sporadic growth and decay of the islands (''magnetic bubbling'') is not normally addressed in theories of plasma transport due to magnetic fluctuations. The nature of the transport differs from statistical approaches to magnetic turbulence since the radial step size of the plasma transport is now given by the characteristic island width. This model suggests that tokamak experiments have relatively short-lived, coherent, long wavelength magnetic oscillations present in the steep pressure-gradient regions of the plasma. 42 refs

  18. The distribution of bats on the Adriatic islands

    NARCIS (Netherlands)

    Dulić, Beatrica; Tvrtković, Nikola

    1970-01-01

    The bat fauna of the Adriatic islands is very poorly known in comparison with that of the coastal continental regions (Kolombatović, 1882, 1884; Dulić, 1959). Although ten species of bats are recorded, the data for most of the islands except the island of Lastovo (Dulić, 1968) are scarce, and of an

  19. The Galapagos Islands: Darwin and Modern Conservation Stories

    Science.gov (United States)

    Burr, Susan

    2010-01-01

    The author visited the Galapagos Islands in 2009 and here looks at their biodiversity through pictures taken then. The diverse habitats of the Islands are reflected in the great diversity of flora and fauna found on them, with many species endemic to the Islands. The stories of the land iguanas, control of introduced species and the giant…

  20. Torres Strait Islanders and Australian Nationhood: Some Educational Perspectives.

    Science.gov (United States)

    Williamson, Alan

    1992-01-01

    Analyzes the role of education in incorporating Australia's Melanesian minority, the Torres Strait Islanders, into the Australian nation. Reviews education on the Strait Islands from 1892 to 1985, focusing on issues related to educational standards, the inclusion of islanders within legislative provisions for Aborigines, immigration, and…