WorldWideScience

Sample records for ammassalik island se

  1. Climate, glacier mass balance and runoff (1993-2005) for the Mittivakkat Glacier catchment, Ammassalik Island, SE Greenland, and in a long term perspective (1898-1993)

    DEFF Research Database (Denmark)

    Mernild, Sebastian H.; Kane, D.L.; Hansen, Birger;

    2008-01-01

    Climate, glacier mass balance and runoff are investigated in the Low-Arctic Mittivakkat Glacier catchment on Ammassalik Island, Southeast Greenland. High-resolution meteorological data from the catchment covering 1993-2005 and standard synoptic meteorological data from the nearby town of Tasiilaq....... The calculated glacier net mass balance indicates an average glacier loss of 550±530 mm w.eq. yr-1, and 89 out of 105 mass balance years show a negative net mass balance. For the 106-yr period average runoff was estimated to be 1957±254 mm w.eq. yr-1.......Climate, glacier mass balance and runoff are investigated in the Low-Arctic Mittivakkat Glacier catchment on Ammassalik Island, Southeast Greenland. High-resolution meteorological data from the catchment covering 1993-2005 and standard synoptic meteorological data from the nearby town of Tasiilaq...... temperatures (MAAT) occur in the coastal area, indicating an approximately 20-d shorter thawing period. The higher lying glacier area, in contrast, experiences an increasing MAAT, an approximately 40-d longer thawing period and a 60-d longer snow-free period. The Mittivakkat Glacier net mass balance has been...

  2. Climatic conditions at the Mittivakkat Glacier catchment (1994-2006), Ammassalik Island, SE Greenland, and in a 109-year perspective (1898-2006)

    DEFF Research Database (Denmark)

    Mernild, Sebastian H.; Hansen, Birger; Jakobsen, Bjarne Holm;

    2008-01-01

    the catchment, meteorological conditions are monitored at the coast (Station Coast, 25 m a.s.l.) for the period 1998-2006 and in the glacier area (Station Nunatak, 515 m a.s.l.) for 1994-2006. During this 13-year period, solar radiation shows increasing values, averaging 0.5 W m-2 y-1, at the nunatak...... and decreasing values, averaging 1.4 W m-2 y-1, at the coast. The mean annual solar radiation at Station Coast is 102 W m-2 y-1, which is about 10% lower than at Station Nunatak, and is probably caused by increasing and higher percentages of dense clouds and sea fog in the coastal area. The mean annual air....... The total annual precipitation varies from 1,851 mm w.eq. y-1 at the nunatak (solid precipitation: 80%, mixed: 6%, and liquid: 14%) to 1,428 mm w.eq. y-1 at the coast (53%, 31%, and 16%), covering an average positive orographic effect for solid precipitation during winter (113 mm w.eq. 100 m-1...

  3. Dephasing and interaction of excitons CdSe/ZnSe islands

    DEFF Research Database (Denmark)

    Wagner, H. P.; Tranitz, H.-P.; Preis, H.;

    2000-01-01

    The dephasing of excitons in self-organized CdSe/ZnSe islands grown by molecular-beam epitaxy is investigated using spectrally resolved four-wave mixing. A distribution of dephasing times is observed, indicating the existence of localized excitons with different relaxation times at comparable...

  4. Multi-decadal marine- and land-terminating glacier recession in the Ammassalik region, southeast Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2012-06-01

    Full Text Available Landsat imagery was applied to elucidate glacier fluctuations of land- and marine-terminating outlet glaciers from the Greenland Ice Sheet (GrIS and local land-terminating glaciers and ice caps (GIC peripheral to the GrIS in the Ammassalik region, Southeast Greenland, during the period 1972–2011. Data from 21 marine-terminating glaciers (including the glaciers Helheim, Midgaard, and Fenris, the GrIS land-terminating margin, and 35 GIC were examined and compared to observed atmospheric air temperatures, precipitation, and reconstructed ocean water temperatures (at 400 m depth in the Irminger Sea. Here, we document that net glacier recession has occurred since 1972 in the Ammassalik region for all glacier types and sizes, except for three GIC. The land-terminating GrIS and GIC reflect lower marginal and areal changes than the marine-terminating outlet glaciers. The mean annual land-terminating GrIS and GIC margin recessions were about three to five times lower than the GrIS marine-terminating recession. The marine-terminating outlet glaciers had an average net frontal retreat for 1999–2011 of 0.098 km yr−1, which was significantly higher than in previous sub-periods 1972–1986 and 1986–1999. For the marine-terminating GrIS, the annual areal recession rate has been decreasing since 1972, while increasing for the land-terminating GrIS since 1986. On average for all the observed GIC, a mean net frontal retreat for 1986–2011 of 0.010 ± 0.006 km yr−1 and a mean areal recession of around 1% per year occurred; overall for all observed GIC, a mean recession rate of 27 ± 24% occurred based on the 1986 GIC area. Since 1986, five GIC melted away in the Ammassalik area.

  5. Inter-island transport in CdSe/ZnSe quantum heterostructures

    CERN Document Server

    Wachter, S; Baldauf, M; Schmidt, M; Kurtz, E; Klingshirn, C F; Kalt, H; Litvinov, D A; Gerthsen, D

    2001-01-01

    We report on localization dynamics of excitons in ensembles of self- organized CdSe islands embedded in ZnSe. The experimental methods employed are temperature-dependent, spatially resolved photoluminescence ( mu -PL), spatially integrated PL (macro-PL), as well as time-resolved PL (TRPL). We observe the well known non- monotonous shift of the PL maximum with temperature caused by redistribution of the excitons amongst the islands. The measured shift is compared with the exact shift of the bandgap deduced from mu -PL measurements and found to depend strongly on island size and distribution. These transport processes are recovered in the temporal evolution of the PL. The decaytime of the spectrally integrated PL reaches its maximum at exactly the same temperature at which the redshift of the macro-PL turns into a blueshift. In TRPL the PL- spectrum consists of two contributions. We put the emission on the high energy side down to excited states in the islands. (17 refs).

  6. Stress Dynamics of Magma Activity during Orogenic Evolution: An Example from Kinmen Island, SE China

    Science.gov (United States)

    Chen, Ping-Chuan; Yeh, En-Chao; Lin, Jian-Wei; Lee, Chi-Yu; Chen, Rou-Fei; Lin, Wayne; Hsieh, Pei-Shan; Lin, Cheng-Kuo; Iizuka, Yoshiyuki

    2016-04-01

    During orogeny, a mountain belt experienced different orogenic stages with various conditions of temperature, pressure, stress and fluid pressure. The speculation, that the orogenic stresses evolve from reverse faulting via strike-slip faulting to normal faulting stress regimes corresponding to syn-orogenic, post-orogenic and an-orogenic stage respectively, has been proposed but has not been proved yet. Here we report the study of dikes from Kinmen Island can shed light on understanding the stress evolution of orogeny. The Kinmen Island, located in the southeastern continental margin of Mainland China, cropped out the middle to lower crust of NE structural grain, which was experienced deformation and metamorphism during Late Yenshanian Orogeny(LYO). Based on previous studies of geochemistry, geochronology, and P-T conditions, various types of dike have been identified. They are syn-orognic dikes of amphibolite (130-110Ma), post-orogenic dikes of pegmatite and aplite (110-100Ma), and an-orogenic dike of gabbro (94-76Ma). During syn-orogenic stage of LYO, dike intrusion appeared as low-angle dip, which reflected that reverse faulting regime and horizontal maximum stress direction in E-W orientation. In post-orogenic stage, stress would be divided into two sub-stages. The early one was strike-slip faulting regime and horizontal maximum stress was in NW-SE orientation. The late one was normal faulting regime and horizontal maximum stress direction returned to E-W orientation. Finally, an-orogenic dike intrusion striked NE-SW with vertical dip, which displayed that normal faulting regime and NE-SW horizontal maximum stress direction. Our observation is consistent with the expected stress evolution during orogeny. Deviatoric stresses from new findings were decreased at early post-orogenic stage but increased after late post-orogenic stage, indicating the change of fluid pressure ratio with time. The spatiotemporal variation of stress field might be suggested the change

  7. Late Cretaceous lithospheric extension in SE China: Constraints from volcanic rocks in Hainan Island

    Science.gov (United States)

    Zhou, Yun; Liang, Xinquan; Kröner, Alfred; Cai, Yongfeng; Shao, Tongbin; Wen, Shunv; Jiang, Ying; Fu, Jiangang; Wang, Ce; Dong, Chaoge

    2015-09-01

    Petrological, geochemical and in-situ zircon U-Pb dating and Hf-isotope analyses have been carried out on a suite of basalt-andesite-rhyolite volcanic rocks exposed in the Liuluocun area, Hainan Island, SE China. Zircon analyses show that these volcanic rocks crystallized in the Early Cretaceous (ca. 102 Ma). The basalts are characterized by low MgO contents and mg-numbers but high rare earth element, high field strength element and large ion lithophile element contents and Nb-Ta negative anomalies. They have relatively uniform Sr-Nd isotope compositions with εNd(t) values of - 4.09 to - 3.63. The andesites show enrichment of high field strength element and rare earth element with negligible Eu anomalies. They have εNd(t) values of - 2.35 to - 3.88 and εHf(t) values of - 9.73 to - 1.13. The rhyolites have high K2O and SiO2 contents. They are characterized by prominent Eu, P and Ti negative anomalies and enrichment in large ion lithophile element, and show εHf(t) values of - 7.51 to + 0.47 and εNd(t) values of - 2.49 to - 2.69. Petrogenetic analysis indicates that the Liuluocun volcanic rocks were produced by incomplete reaction of the mantle wedge peridotite with felsic melts derived from partial melting of subducted sediment. All these characteristics, combined with geological observations, suggest that their formation was related to regional lithospheric extension in the South China Craton during the Early Cretaceous, which may have been caused by subduction of the Paleo-Pacific plate beneath the continental plate of China.

  8. Remote sensing of the urban heat island and its changes in Xiamen City of SE China

    Institute of Scientific and Technical Information of China (English)

    XU Han-qiu; CHEN Ben-qing

    2004-01-01

    World-wide urbanization has significantly modified the landscape, which has important climatic implicationsacross all scales due to the simultaneous removal of natural land cover and introduction of urban materials. Thisresulted in a phenomenon known as an urban heat island(UHI). A study on the UHI in Xiamen of China was carriedout using remote sensing technology. Satellite thermal infrared images were used to determine surface radianttemperatures. Thermal remote sensing data were obtained from band 6 of two Landsat TM/ETM+ images of 1989and 2000 to observe the UHI changes over 1 1-year period. The thermal infrared bands were processed throughseveral image enhancement technologies. This generated two 3-dimension-perspective images of Xiamen's urbanheat island in 1989 and 2000, respectively, and revealed heat characteristics and spatial distribution features of theUHI. To find out the change of the UHI between 1989 and 2000, the two thermal images were first normalized andscaled to seven grades to reduce seasonal difference and then overlaid to produce a difference image by subtractingcorresponding pixels. The difference image showed an evident development of the urban heat island in the 11 years.This change was due largely to the urban expansion with a consequent alteration in the ratio of sensible heat flux tolatent heat flux. To quantitatively compare UHI, an index called Urban-Heat-Island Ratio Index(URI) was created.It can reveal the intensity of the UHI within the urban area. The calculation of the index was based on the ratio ofUHI area to urban area. The greater the index, the more intense the UHI was. The calculation of the index for theXiamen City indicated that the ratio of UHI area to urban area in 2000 was less than that in 1989. High temperaturesin several areas in 1989 were reduced or just disappeared, such as those in old downtown area and GulangyuIsland. For the potential mitigation of the UHI in Xiamen, a long-term heat island reduction strategy of

  9. Quality Aspects of a Marine Aggregate Deposit off the SE Euboea Island, Greece, for its Exploitation - Preliminary Results

    Science.gov (United States)

    Anastasatou, Marianthi; Kapsimalis, Vasilios; Stamatakis, Michael; Tsoutsia, Antonia; Poulos, Serafeim; Rousakis, Grigoris; Karditsa, Aikaterini; Petrakis, Stelios; Aspiotis, Konstantinos; Papavlasopoulou, Nafsika; Stamatakis, Giorgos

    2015-04-01

    Aggregates are inert materials, such as terrestrial or marine sand and gravel, composed mainly of limestone, igneous rocks and sandstone. There is an international trend of increasing demand for aggregates during the last 30 years. Thus, marine aggregate (MA) demand has been displayed a remarkably increased due to limited terrestrial deposits and strict environmental issues related to their exploitation, induced by mining legislation. Regarding offshore MA extraction, important physical and biological seabed impacts that may persist long after the completion of the MA dredging, should be addressed, according to European directives, that deal with aspects such as restoration of the influenced subaqueous mining area. The present contribution focuses on the qualitative determination of the marine sediments on inner continental shelf of SE Euboea (central Aegean Sea), concerning primarily its silica content and secondarily the various environmental issues, in order to evaluate whether or not this subaqueous deposit fulfils the requirements for its exploitation. This MA deposit was found during the implementation of the research project THALES-MARE (MIS 375655) and after taking into consideration the presence of highly siliceous coastal lithology of the South Euboea Island. The area belongs to the Attico-Cycladic geotectonic zone, and especially in the Blueschist Unit, Styra and Ochi nappes. It consists mainly of metamorphosed clastic siliceous sedimentary and calcareous, mafic and felsic volcanic rocks and serpentinites. Sixteen representative samples were analysed out of 48 were collected in June 2014, during the scientific cruise of the M/V Aegaio (Hellenic Centre for Marine Research). The grain size analysis shows that seabed sediments are granulometrically classified mostly as sand, with contaminants of finer fractions and with the sand content often to be >90%. X-Ray Diffraction analysis revealed that the predominant crystalline phase is quartz (often >70

  10. Mesophotic coral environment monitoring and habitat surveys at the Main Hawaiian Island Chain (SE1006, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goals of the cruise were to collect a variety of data to assess the status of mesophotic corals in waters between the islands of Maui, Kahoolawe, Lanai, and...

  11. Insights on the Quaternary Tectonic Evolution of the SE Indonesia Arc-Continent Collision from the Study of Uplifted Coral Terraces on Sumba Island.

    Science.gov (United States)

    Leclerc, F.; Rigaud, S.; Chiang, H. W.; Djamil, Y. S.; Herdiyanti, T.; Johnny, J.; Ildefonso, S.; Meilano, I.; Bijaksana, S.; Abidin, H. Z.; Tapponnier, P.; Wang, X.

    2015-12-01

    Sumba Island is uniquely positioned within the Sunda-Banda forearc, at the transition between oceanic subduction and arc-continent collision. There, the convergence between the Sunda and Australian plates is accommodated along at least three major structures: the megathrust, the Savu backthrust located south of Sumba and the Flores backthrust located north of the volcanic arc. The incipient collision in the vicinity of Sumba is responsible for coastal vertical movements. Quaternary reefal deposits form spectacular uplifted flights of terraces, which directly overlie Mid Miocene - Early Pliocene deep carbonate and volcaniclastic rocks at elevations exceeding 500m. Although aerial fossil reefs extensively rim the northern and eastern coasts of Sumba, studies have been limited to Cape Laundi where an uplift rate of 0.2-0.5 m/kyr is estimated for the last 400 kyr, partly on the basis of alpha-spectrometric U/Th dating. At the island scale, the relief morphology and the hydrographic network point to a N-S asymmetry, indicating a general tilt toward the north. A subducting seafloor asperity and south-dipping normal faults have been postulated to generate this asymmetry. However as the pattern and kinematics of the deformation remain partially determined, structures and processes capable of driving such deformation and accommodating the nascent collision may be undisclosed. New topographic data coupled with field observations and coral mass-spectrometric U/Th dating allow investigating the morphology, stratigraphy and age of the fossil reef terraces at the island scale. Tectonic structures disrupting the topography are identified and their activities are relatively dated with respect to fossil reef terraces. The deformation pattern of Sumba is characterized, especially in Cape Laundi where the uplift rate is re-evaluated. Through a multi-disciplinary study, we intend to reconstruct the tectonic evolution of Sumba island and, at a larger scale, of the collision in SE

  12. Biostratigraphic evidence of dramatic Holocene uplift of Robinson Crusoe Island, Juan Fernández Ridge, SE Pacific Ocean

    Directory of Open Access Journals (Sweden)

    P. Sepúlveda

    2014-09-01

    Full Text Available A study of the biostratigraphy and sedimentology of Holocene deposits on Robinson Crusoe Island (RCI on the Juan Fernández Ridge (JFR indicates that a~dramatic but localized uplift occurred since 8000 BP, at a rate of about 8.5 mm yr−1. In fact, supratidal flats and sand layers with marine gastropods (mostly Nerita sp. are now exposed ca. 70 m a.s.l., and covered by transitional dunes. The last volcanic activity on RCI occurred at ca. 0.8 Ma (active hotspot located 280 km further west and there is no sign of a compensating bulge that explains this uplift, isobaths of the sea floor instead suggesting general subsidence. However, modeling indicates that large-scale landslides followed by isostatic rebound are a viable explanation, partially reflected in the low-resolution bathymetry of the area.

  13. Biostratigraphic evidence of dramatic Holocene uplift of Robinson Crusoe Island, Juan Fernández Ridge, SE Pacific Ocean

    Science.gov (United States)

    Sepúlveda, P.; Le Roux, J. P.; Lara, L. E.; Orozco, G.; Astudillo, V.

    2014-09-01

    A study of the biostratigraphy and sedimentology of Holocene deposits on Robinson Crusoe Island (RCI) on the Juan Fernández Ridge (JFR) indicates that a~dramatic but localized uplift occurred since 8000 BP, at a rate of about 8.5 mm yr-1. In fact, supratidal flats and sand layers with marine gastropods (mostly Nerita sp.) are now exposed ca. 70 m a.s.l., and covered by transitional dunes. The last volcanic activity on RCI occurred at ca. 0.8 Ma (active hotspot located 280 km further west) and there is no sign of a compensating bulge that explains this uplift, isobaths of the sea floor instead suggesting general subsidence. However, modeling indicates that large-scale landslides followed by isostatic rebound are a viable explanation, partially reflected in the low-resolution bathymetry of the area.

  14. Biostratigraphic evidence for dramatic Holocene uplift of Robinson Crusoe Island, Juan Fernández Ridge, SE Pacific Ocean

    Science.gov (United States)

    Sepúlveda, P.; Le Roux, J. P.; Lara, L. E.; Orozco, G.; Astudillo, V.

    2015-03-01

    Hotspot oceanic islands typically experience subsidence due to several processes related to migration of the oceanic plate away from the mantle plume and surface flexural loading. However, many other processes can interrupt subsidence, some of which may be associated with catastrophic events. A study of the biostratigraphy and sedimentology of Holocene deposits on Robinson Crusoe Island (RCI) on the Juan Fernández Ridge (JFR) indicated that dramatic uplift has occurred since 8000 years BP, at a rate of about 8.5mm yr-1. This is evidenced by supratidal flats with tepee structures and sand layers containing marine gastropods (mostly Nerita sp.) that are now exposed ca. 70 m a.s.l. The active hotspot is located 280 km further west and the last volcanic activity on RCI occurred at ca. 800 000 years BP. Long-term subsidence is evidenced by deep submerged marine abrasion terraces at RCI. As no direct evidence was found for the existence of a compensating bulge generated by the present hotspot upon which RCI would be situated, it must be concluded that subsidence in the wake of the mantle plume beneath the migrating plate was interrupted by very rapid uplift, but on a scale that did not fully compensate for the previous subsidence. This can be attributed to large-scale landslides followed by isostatic rebound, although this is only vaguely reflected in the low-resolution bathymetry of the area. To determine if this mechanism produced the uplift, a detailed bathymetric survey of the area will be required. If such a survey confirms this hypothesis, it may have implications for the short-term dynamics of vertical variations of oceanic edifices and their related effects on ecosystems and human population.

  15. Architecture and morphology of coral reef sequences. Modeling and observations from uplifting islands of SE Sulawesi, Indonesia

    Science.gov (United States)

    Pastier, Anne-Morwenn; Husson, Laurent; Bezos, Antoine; Pedoja, Kevin; Elliot, Mary; Hafidz, Abdul; Imran, Muhammad; Lacroix, Pascal; Robert, Xavier

    2016-04-01

    During the Late Neogene, sea level oscillations have profoundly shaped the morphology of the coastlines of intertropical zones, wherein relative sea level simultaneously controlled reef expansion and erosion of earlier reef bodies. In uplifted domains like SE Sulawesi, the sequences of fossil reefs display a variety of fossil morphologies. Similarly, the morphologies of the modern reefs are highly variable, including cliff notches, narrow fringing reefs, wide flat terraces, and barriers reefs. In this region, where uplift rates vary rapidly laterally, the entire set of morphologies is displayed within short distances. We developed a numerical model that predicts the architecture of fossil reefs sequences and apply it to observations from SE Sulawesi, accounting -amongst other parameters- for reef growth, coastal erosion, and uplift rates. The observations that we use to calibrate our models are mostly the morphology of both the onshore (dGPS and high-resolution Pleiades DEM) and offshore (sonar) coast, as well as U-Th radiometrically dated coral samples. Our method allows unravelling the spatial and temporal evolution of large domains on map view. Our analysis indicates that the architecture and morphology of uplifting coastlines is almost systematically polyphased (as attested by samples of different ages within a unique terrace), which assigns a primordial role to erosion, comparable to reef growth. Our models also reproduce the variety of modern morphologies, which are chiefly dictated by the uplift rates of the pre-existing morphology of the substratum, itself responding to the joint effects of reef building and subsequent erosion. In turn, we find that fossil and modern morphologies can be returned to uplift rates rather precisely, as the parametric window of each specific morphology is often narrow.

  16. High resolution sparker evidence of sediment transport patterns and Late Quaternary structures between the islands of Sylt and Rømø, SE. Northsea

    Science.gov (United States)

    Boldreel, L. O.; Kuijpers, A.; Madsen, E. B.; Hass, C.; Rasmussen, R.; Lindhorst, S.; Bartholdy, J.

    2009-04-01

    The off-shore northern part of the barrier island Sylt in the southeastern North Sea has been investigated using high-resolution sparker seismics. Bedforms identified in the seismic data reveal the postglacial sedimentary regime and actual sediment dynamics. The area can be divided into three parts. The North Sea sector of the area is characterized by northward sediment bypass as a result of strong long-shore (tidal) currents heading towards the Lister Deep, the tidal inlet between Sylt and the Danish island of Rømø. The Lister Deep is characterized by a major dune field with up to 8 m heigh dunes with a wavelength of 270 m indicative of easterly sediment transport (flood dominated). Further to the northwest in the outer delta a dune field suggesting westerly sediment transport is found. The northern part of the Lister Deep is formed by a marked erosion channel with a depth of 30-40 msec. The two dune fields are separated by minor structures. East of Sylt the area is characterized by presence of dunes of smaller dimensions than those observed in the Lister Deep. In the eastern and western part of the channel system present here, the dunes indicate sediment transport towards south (flood dominated), whereas in the central part of the area northward transport is indicated. Based on the bedform pattern a general current regime can be described. Northward sediment transport along the westcoast of Sylt following the coastline leads into the Lister Deep, where under the influence of the coastal configuration and Coriolis effect a major dune field has been formed along the north coast of Sylt. The outgoing (ebb) current comes from the Wadden Sea area towards the east and enters the northern part of the Lister Deep, where the erosion channel is found. Here the current is responsibly for the formation of the west migrating dunefield in the Lister Deep and towards the outer delta the current turns north and large amounts of sediments are likely deposited. Thus the model

  17. Returning from the Horizon: Introducing Urban Island Studies

    OpenAIRE

    Xavier Barceló Pinya; Gordon Cooke; Naciye Doratlı; Ahmed Elewa; Ilan Kelman; Jonathan Pugh; Lea Schick; Swaminathan, R.

    2015-01-01

    Island studies tends to focus on peripheral, isolated, and marginal aspects of island communities, while urban studies has showed scant awareness of islandness: Although many people research cities on islands, there is little tradition of researching island cities or urban archipelagos per se. Island cities (densely populated small islands and population centres of larger islands and archipelagos) nevertheless play import cultural, economic, political, and environmental roles on local, region...

  18. 2015 Hawaii SE Island UAS Orthomosaic

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This imagery was captured September 20, 2015 for the Hawaiian Monk Seal Research Program. Unmanned Aircraft Systems (UAS) are being tested to assess their...

  19. « L'île du soleil » : une parenthèse de temporalité insolite The « Island of the Sun »: an Unusual Temporal Digression

    Directory of Open Access Journals (Sweden)

    Hélène Fragaki

    2010-12-01

    Full Text Available Dans le livre II de sa Bibliothèque historique, Diodore de Sicile raconte comment Iambule a découvert une île heureuse lors d’un voyage à travers l’Arabie. Ce récit fabuleux, qui peut être défini comme un roman utopique au sens large du terme, est donc délibérément intégré dans une œuvre qui se veut historique. Sa version originale, attribuée à Iambule, remonte à l’époque hellénistique et ne peut être postérieure au milieu du Ier s. av. J.-C., date à laquelle la Bibliothèque historique a été rédigée. Au début du roman, une série d’aventures extraordinaires anime le temps et l’éclaire d’une lueur mystérieuse en faisant intervenir des intervalles déterminés par des chiffres symboliques. On est ainsi introduit à une dimension temporelle utopique, celle de l’île heureuse : immuable, continu et homogène, le temps n’est que le support d’activités constructives, répétitives et rigoureusement rythmées ; il est dépourvu de tout aspect angoissant ou ravageur et n’amène que la croissance et la prospérité, d’autant plus que la vie est excessivement longue et la mort dédramatisée. Cette parenthèse temporelle paisible, dont la clôture est également marquée par des durées symboliques, apparaît comme une réaction à un temps réel violemment agité. Toutefois, elle n’est pas aussi statique qu’il ne paraît à première vue, dans la mesure où elle s’insère dans le mouvement de la temporalité historique et où elle est accessible par le temps bien plus turbulent de l’aventure et du voyage.In volume 2 of his book Bibliotheca Historica, Diodorus of Sicily tells the story of Iamboulos who discovered a blissful island while traveling through Arabia. This fabulous story, which can be defined as a utopian novel in the broader sense of the term, is therefore deliberately incorporated into a book which is supposed to be historical. Its original version, attributed to Iamboulos, dates

  20. Returning from the Horizon: Introducing Urban Island Studies

    Directory of Open Access Journals (Sweden)

    Xavier Barceló Pinya

    2015-12-01

    Full Text Available Island studies tends to focus on peripheral, isolated, and marginal aspects of island communities, while urban studies has showed scant awareness of islandness: Although many people research cities on islands, there is little tradition of researching island cities or urban archipelagos per se. Island cities (densely populated small islands and population centres of larger islands and archipelagos nevertheless play import cultural, economic, political, and environmental roles on local, regional, and global scales. Many major cities and ports have developed on small islands, and even villages can fulfil important urban functions on lightly populated islands. Island concepts are also deployed to metaphorically describe developments in urban space. The journal Urban Island Studies explores island and urban processes around the world, taking an island approach to urban research and an urban approach to island research.

  1. Se los por se lo

    OpenAIRE

    José Luis Rivarola

    1985-01-01

    El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966) en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre refle...

  2. SE PREVENINDO?

    Directory of Open Access Journals (Sweden)

    Ana Débora Assis Moura

    2010-01-01

    Full Text Available Este estudio tuvo como objetivo verificar el comportamiento de las prostitutas en relación a la prevención de enfermedades de transmisión sexual y del Síndrome de Inmunodeficiencia Adquirida-SIDA, así como investigar cómo se previenen de esas enfermedades. Se trata de una investigación exploratoria, con enfoque cualitativo, llevada a cabo en la Asociación de las Prostitutas en Ceará, Brazil, en septiembre de 2008, a través de una encuesta con 25 prostitutas. El análisis de los datos se hizo según el análisis de contenido, después de ser agrupados en cuatro categorías: conocimiento sobre las enfermedades de transmisión sexual/SIDA; convivencia con la(s enfermedad(es; prevención de la enfermedad de transmisión sexual/SIDA; y el uso de drogas. Se concluyó que las prostitutas no usan preservativos en todas las relaciones sexuales, por lo tanto, las enfermedades de transmisión sexual representan una realidad; la desinformación sobre la(s enfermedad(es es notable; el consumo de drogas lícitas e ilícitas es frecuente entre ellas, factor que las expone a situaciones más vulnerables con relación al VIH/SIDA.

  3. Se los por se lo

    Directory of Open Access Journals (Sweden)

    José Luis Rivarola

    1985-12-01

    Full Text Available El sistema de la conjugación "objetiva" plantea interesantesproblemas que fueron tratados en parte por K. Heger (1966 en suestudio comparativo del francés y del español. De la comparaciónse desprende, por ejemplo, que en español hay un cierto número deambigüedades que no permiten establecer un "paradigma tan completo y unívoco" como en el caso del francés. Dentro de estas ambigüedades se encuentran las que propicia el gramema se: "El morfema [gramema] se funciona no sólo como pronombre reflexivo, sinotambién como variante combinatoria del pronombre personal complemento indirecto de la tercera persona.

  4. Galapagos Islands

    Science.gov (United States)

    2002-01-01

    This true-color image of the Galapagos Islands was acquired on March 12, 2002, by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite. The Galapagos Islands, which are part of Ecuador, sit in the Pacific Ocean about 1000 km (620 miles) west of South America. As the three craters on the largest island (Isabela Island) suggest, the archipelago was created by volcanic eruptions, which took place millions of years ago. Unlike most remote islands in the Pacific, the Galapagos have gone relatively untouched by humans over the past few millennia. As a result, many unique species have continued to thrive on the islands. Over 95 percent of the islands' reptile species and nearly three quarters of its land bird species cannot be found anywhere else in the world. Two of the more well known are the Galapagos giant tortoise and marine iguanas. The unhindered evolutionary development of the islands' species inspired Charles Darwin to begin The Origin of Species eight years after his visit there. To preserve the unique wildlife on the islands, the Ecuadorian government made the entire archipelago a national park in 1959. Each year roughly 60,000 tourists visit these islands to experience what Darwin did over a century and a half ago. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  5. Solomon Islands

    OpenAIRE

    World Bank

    2015-01-01

    This report aims to build understanding of the existing disaster risk financing and insurance (DRFI) tools in use in the Solomon Islands and to identify gaps where engagement could further develop financial resilience. It also aims to encourage peer exchange of regional knowledge, specifically by encouraging dialogue on past experiences, lessons learned, optimal use of these financial tool...

  6. Islands for SAT

    OpenAIRE

    H Fang; Kilani, Y.; Lee, J.H.M.; Stuckey, P. J.

    2006-01-01

    In this note we introduce the notion of islands for restricting local search. We show how we can construct islands for CNF SAT problems, and how much search space can be eliminated by restricting search to the island.

  7. Beautiful hainan island

    Institute of Scientific and Technical Information of China (English)

    汪伦

    2002-01-01

    Hainan Island is the second largest island in China. It is situated on the Nanhai Sea(South China Sea) and faces Guangdong Province across Qiongzhou Strait (海峡).Hainan Province was established (建立)in 1988. It consists of Hainan Island, Xisha Islands, Zhongsha Islands, Nansha Islands and the vast sea areas around them.Its total area is 340,000 km2.

  8. A NEW SPECIES OF RANINOIDES (CRUSTACEA: DECAPODA:RANINIDAE) FROM OFF THE SOUTHEASTERN COAST OF HAINAN ISLAND AND NANSHA ISLANDS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Raninoides longifions new species, off SE coast of Hainan Island, dorsal surface of carapace with an arched granular edge across carapace between the anterolateral teeth, median frontal tooth longest, second frontal teeth subquadrate.

  9. Contenha-se, se for capaz

    Directory of Open Access Journals (Sweden)

    Mirna Feitoza Pereira

    2008-11-01

    Full Text Available Em O Instinto da Linguagem, Steven Pinker discorre sobre sua célebre tese: a linguagem não é a mais prodigiosa invenção cultural humana. Ela é uma peça da constituição biológica do cérebro. A linguagem é uma habilidade complexa e especializada, que se desenvolve espontaneamente na criança, sem qualquer esforço consciente ou instrução formal, que se manifesta sem que se perceba sua lógica subjacente, que é qualitativamente a mesma em todo indiví­duo, e que difere de capacidades mais gerais de processamento de informações ou de comportamento inteligente. Para Pinker, a concepção de linguagem como um tipo de instinto transmite a idéia de que as pessoas sabem falar mais ou menos da mesma maneira que as aranhas sabem tecer suas teias. Ele apóia suas idéias em Darwin e Chomsky. Palavras-chave linguagem, gramática universal, evolução Abstract In Language Instinct, Steven Pinker argues about his famous thesis: language is not the most prodigious human cultural invention. It is a distinct piece of the biological constitution of the brain. Language is a complex, specialized skill, which develops spontaneously in the child, without conscious effort or formal instruction. It reveals itself without awareness of its underlying logic, which is qualitatively the same in every individual, and which is distinct from more general abilities of information processing of intelligent behavior. According to Pinker, the conception of language as a kind of instinct conveys the idea that people know how to talk in more or less the same way as spiders know how to spin webs. His thesis is founded in Darwin and Chomsky-s theories. Keywords language, universal grammar, evolution

  10. Researching Pacific island livelihoods:

    DEFF Research Database (Denmark)

    Egelund Christensen, Andreas; Mertz, Ole

    2010-01-01

    on contemporary theories of nissology and conceptual analytical frameworks for island research. Through a review of selected case-study-based island literature on changing livelihoods coming out of the South Pacific, we wish to illustrate and discuss advantages of finding common grounds for small island studies......Small island literature is vast in focus and aim, and is rooted in many different disciplines. The challenge is to find common grounds for researching small islands conceptually and theoretically. The aim of this article is to comment on how to research small islands, including a discussion....... The focus is on two dimensions of island livelihood, migration and natural resource management, both of which are significant contributors in making island livelihoods and shaping Pacific seascapes. We argue that there is still a substantial lack of studies targeting small island dynamics that are empirical...

  11. SE-FIT

    Science.gov (United States)

    Chen, Yongkang; Weislogel, Mark; Schaeffer, Ben; Semerjian, Ben; Yang, Lihong; Zimmerli, Gregory

    2012-01-01

    The mathematical theory of capillary surfaces has developed steadily over the centuries, but it was not until the last few decades that new technologies have put a more urgent demand on a substantially more qualitative and quantitative understanding of phenomena relating to capillarity in general. So far, the new theory development successfully predicts the behavior of capillary surfaces for special cases. However, an efficient quantitative mathematical prediction of capillary phenomena related to the shape and stability of geometrically complex equilibrium capillary surfaces remains a significant challenge. As one of many numerical tools, the open-source Surface Evolver (SE) algorithm has played an important role over the last two decades. The current effort was undertaken to provide a front-end to enhance the accessibility of SE for the purposes of design and analysis. Like SE, the new code is open-source and will remain under development for the foreseeable future. The ultimate goal of the current Surface Evolver Fluid Interface Tool (SEFIT) development is to build a fully integrated front-end with a set of graphical user interface (GUI) elements. Such a front-end enables the access to functionalities that are developed along with the GUIs to deal with pre-processing, convergence computation operation, and post-processing. In other words, SE-FIT is not just a GUI front-end, but an integrated environment that can perform sophisticated computational tasks, e.g. importing industry standard file formats and employing parameter sweep functions, which are both lacking in SE, and require minimal interaction by the user. These functions are created using a mixture of Visual Basic and the SE script language. These form the foundation for a high-performance front-end that substantially simplifies use without sacrificing the proven capabilities of SE. The real power of SE-FIT lies in its automated pre-processing, pre-defined geometries, convergence computation operation

  12. Shemya Island prehistory

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The 752 artifacts described in this paper are from 5 sites on Shemya Island. Artifactual evidence suggests the island had a small resident population and was...

  13. Island political economy

    OpenAIRE

    Bertram, Geoffrey; Poirine, Bernard

    2007-01-01

    International audience In this chapter we build on the observation that island economies, and especially small ones (population below one million), exhibit a remarkably wide range of economic structures built on a correspondingly wide range of development strategies. Common elements of "islandness" may serve to define island economies as a general class, but there clearly exist several distinct "species" within that class, and a corresponding menu of strategic options open to islander comm...

  14. Excitons, biexcitons, and phonons in ultrathin CdSe/ZnSe quantum structures

    DEFF Research Database (Denmark)

    Gindele, F.; Woggon, Ulrike; Langbein, Wolfgang Werner;

    1999-01-01

    The optical properties of CdSe nanostructures grown by migration-enhanced epitaxy of CdSe on ZnSe are studied by time-, energy-, and temperature-dependent photoluminescence and excitation spectroscopy, as well as by polarization-dependent four-wave mixing and two-photon absorption experiments....... The nanostructures consist of a coherently strained Zn1-xCdxSe/ZnSe quantum well with embedded islands of higher Cd content with sizes of a few nanometer due to strain-induced CdSe accumulation. The local increase in CdSe concentration results in a strong localization of the excitonic wave function, in an increase...... in radiative lifetime, and a decrease of the dephasing rate. Local LO-phonon modes caused by the strong modulation of the Cd concentration profile are found in phonon-assisted relaxation processes. Confined biexcitons with large binding energies between 20 and 24 meV are observed, indicating the important role...

  15. Rhode Island unemployment

    OpenAIRE

    Leonard Lardaro

    2010-01-01

    How can a state like Rhode Island have such a high unemployment rate? This question has been asked often over the past year, especially since at one point, Rhode Island found itself with the dubious distinction of having the highest unemployment rate in the United States. Following that extreme, Rhode Island seemed to settle into a niche where its rank was third nationally.

  16. The Islands, Barbados

    NARCIS (Netherlands)

    Drieman, R.; Hinborch, M.; Monden, M.; Vendrik, E.A.J.

    2009-01-01

    Master project report. In Barbados the problem arose of lack of space for development on the existing shoreline. Therefore the project "The Islands" has been conceptualized. In front of the west coast of Barbados, a group of artificial islands will be created. On the islands there will be space for

  17. SE debt restructuring plan

    International Nuclear Information System (INIS)

    Slovenske elektrarne, a.s. (SE) plans to restructure one's own debts in 2003-2005. Debt restructuring plan is following: 2003: Collection of pre-payment on electricity - 60 million Euro (2.5 billion Slovak crowns), consumer unknown. Own promissory notes in total value of 100 million US$ (3.5 billion Slovak crowns) - in process. Sale of claims worth 2.4 billion Slovak crowns (57.21 million Euro) - negotiations in process. 2003/2004: Restructuring of loans payable IV. quarter 2003 and at the beginning of 2004 in value of 200 million Euro (8.3 billion Slovak crowns). Aim of SE is a new credit payable within 7 years, with instalments payable in the last two to three without any state subsidies. 2005: Loans worth 460 million Euro (189 billion Slovak crowns) will still remain. SE want to negotiate them with banks without state support

  18. SE-selskabet

    DEFF Research Database (Denmark)

    Schaumburg-Müller, Peer; Werlauff, Erik

    Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion.......Bogen behandler den særlige, fælleseuropæiske aktieselskabstype, der står til valgfri disposition for virksomhederne i form af europæiske aktieselskaber, såkaldte SE-selskaber, som alene kan stiftes ved en grænseoverskridende transaktion....

  19. Paradise Islands? Island States and Environmental Performance

    Directory of Open Access Journals (Sweden)

    Sverker C. Jagers

    2016-03-01

    Full Text Available Island states have been shown to outperform continental states on a number of large-scale coordination-related outcomes, such as levels of democracy and institutional quality. The argument developed and tested in this article contends that the same kind of logic may apply to islands’ environmental performance, too. However, the empirical analysis shows mixed results. Among the 105 environmental outcomes that we analyzed, being an island only has a positive impact on 20 of them. For example, island states tend to outcompete continental states with respect to several indicators related to water quality but not in aspects related to biodiversity, protected areas, or environmental regulations. In addition, the causal factors previously suggested to make islands outperform continental states in terms of coordination have weak explanatory power in predicting islands’ environmental performance. We conclude the paper by discussing how these interesting findings can be further explored.

  20. Birds observed at Shemya Island, Aleutian Islands

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report covers Shemya Island bird surveys. The reports outline migrant bird activity during August 31 to October 3, 1977. The purpose of the study was to survey...

  1. Se min kjole

    DEFF Research Database (Denmark)

    Bogen Se min kjole udkom i anledning af 50-året for de første ordinationer af kvindelige præster i den danske folkekirke i 1948. Bogen giver analyser af, hvad kvindelige præster har betydet for præsterollen og for prædikengenren; den fortæller om de første kvindelige præsters liv og syn på...

  2. Darwin and the island

    OpenAIRE

    Fox, Justin Daniel.

    1995-01-01

    This thesis examines the fictional island and assesses the impact of Darwinism on the genre. I show how islands have been a recurring feature in European literature, fictional spaces where authors create a microcosm in which they satirise, criticise or hold up a mirror to their own society. I argue that traditonal Utopian islands are static realms and that through the introduction of evolution (Darwin and Wallace made their most important discoveries regarding the mechanism of...

  3. Tanzania - Mafia Island Airport

    Data.gov (United States)

    Millenium Challenge Corporation — The evaluation design and subsequent data gathering activities will address the following key research questions: a) Has the Mafia Island Airport Upgrade Project...

  4. Phytoseiid mites of the Canary Islands (Acari, Phytoseiidae. II. Tenerife and La Gomera Islands

    Directory of Open Access Journals (Sweden)

    Ferragut, F.

    2007-12-01

    Full Text Available Phytoseiid mites (Acari, Phytoseiidae inhabiting plants in natural ecosystems from Tenerife and La Gomera islands (Canary Islands have been studied. Surveys were conducted from 1997 to 2002. Eleven species were collected, one of them being reported for the first time from the Canary Islands and six of them reported for the first time from Tenerife and La Gomera islands. Euseius machadoi n. sp. collected from woody plants in the Canarian laurisilva is proposed as a new species.

    En muestreos realizados desde 1997 hasta 2002 se ha estudiado la fauna de ácaros fitoseidos (Acari, Phytoseiidae asociada a plantas de ecosistemas naturales de las islas de Tenerife y La Gomera (Islas Canarias. Se han recolectado un total de 11 especies, siendo una de ellas citada por vez primera en las islas Canarias y seis de ellas citadas por primera vez en las islas de Tenerife y La Gomera. Euseius machadoi n. sp., recolectado en plantas leñosas de la laurisilva canaria, se propone como una nueva especie.

  5. A NEW SPECIES OF RANINOIDES (CRUSTACEA : DECAPODA : RANINIDAE) FROM OFF THE SOUTHEASTERN COAST OF HAINAN ISLAND AND NANSHA ISLANDS

    Institute of Scientific and Technical Information of China (English)

    陈惠莲; MichaelTuerkay

    2001-01-01

    Ranlnoides longifions new species, off SE coast of Hainan Island, dorsal surface of carapace with an arched granular edge across carapace between the anterolateral teeth, median frontal tooth longest, second frontal teeth subquadrate.

  6. Surface morphology of Cr:Ga2Se3 heteroepitaxy on Si(001)

    Science.gov (United States)

    Yitamben, E. N.; Lovejoy, T. C.; Paul, D. F.; Callaghan, J. B.; Ohuchi, F. S.; Olmstead, M. A.

    2009-08-01

    Addition of the transition-metal dopant Cr to Ga2Se3 during heteroepitaxial growth on Si(001), a system of interest as a prototype silicon-compatible, dilute magnetic semiconductor, has been studied with scanning-tunneling microscopy and scanning Auger microscopy as a function of Cr concentration and the presence or absence of an undoped buffer or capping layer. Chromium incorporates into laminar Ga2Se3 films up to a solubility limit of several atomic percent, after which Cr-rich islands nucleate. At low Cr concentrations, the vacancy-ordered nanoridge structure characteristic of pure Ga2Se3 remains but nanoridge aspect ratios decrease with Cr concentration; this is likely associated with Cr removing intrinsic vacancies. At higher Cr concentrations, faceted, Cr-rich islands nucleate, often surrounded by trenches, and the terrace morphology no longer resembles pure Ga2Se3 . Growth of Cr-doped Ga2Se3 directly on Si(001):As is qualitatively similar to growth on a pure Ga2Se3 buffer layer; however, the island structure changes dramatically upon coverage of a highly doped layer with undoped Ga2Se3 . Addition of Cr stabilizes cubic overlayer growth under Se-poor growth conditions beyond that of pure Ga2Se3 ; no growth of the hexagonal layered structure characteristic of bulk GaSe was observed.

  7. Marine and Island Ecology.

    Science.gov (United States)

    Stephens, Lawrence J.; And Others

    1988-01-01

    Describes an ecology course which provides students with an opportunity to observe aquatic and terrestrial life in the Bahamas. States that students learn scientific methodology by measuring physical and chemical aspects of the island habitats. Provides information on the island, course description and objectives, transportation, facilities, and…

  8. St. Vincent Island Tour

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This letter, written by Charles Marks who lived on St. Vincent Island as a child, notes the changes he saw in the island when he visited in 1981. He notes that the...

  9. The Cook Islands

    OpenAIRE

    World Bank

    2015-01-01

    This country note is produced is part of The Pacific Catastrophe Risk Assessment andFinancing Initiative (PCRAFI). The geographic spread of the Cook Islands poses logistical problems for any necessary post-disaster relief and response efforts. The events of 2005 demonstrated that the Cook Islands is extremely vulnerable to the threat of tropical cyclones (TCs): in the two months of Februar...

  10. Vorrats-SE ohne Arbeitnehmerbeteiligung

    OpenAIRE

    Blanke, Thomas

    2005-01-01

    Das neue Praxisfeld der SE wirft eine Fülle von Rechtsfragen auf. In Deutschland ist im März 2005 in Berlin die 'Go East Invest SE. Europäische Gesellschaft zur Industrieansiedlung und Markterschließung' in das Handelsregister eingetragen worden, obwohl entgegen Art. 12 Abs.2 SE-VO keine Regelung zur Arbeitnehmermitbestimmung getroffen wurde. Seit Oktober nimmt auch bereits der Handel mit Vorrats-SE Gestalt an. Vorrats-SE sind Gesellschaften, die allein zum Zweck des Handels mit dem SE-Mantel...

  11. Formation and properties of epitaxial CdSe, ZnSe quantum dots. Conventional molecular beam epitaxy and related techniques

    Energy Technology Data Exchange (ETDEWEB)

    Mahapatra, Suddhasatta

    2008-01-16

    This thesis systematically investigates three such alternative approaches, along with conventional MBE, with emphasis on the formation-mechanism of QDs, and optimization of their morphological and optical attributes. it is shown here that no distinct 3D islands are formed in MBE growth of CdSe on ZnSe. While CdSe heteroepitaxy occurs in the multilayer-mode at T{sub G}=300 C, a reentrant recovery of the layer-by-layer mode is reported in this thesis, for growth at T{sub G}<{proportional_to}240 C. In the second variant technique, formation of large and distinct islands is demonstrated by deposition of amorphous selenium (a-Se) onto a 2D CdSe epilayer at room temperature and its subsequent desorption at a higher temperature (T{sub D}=230 C). The process steps of the third variant technique, developed in course of this work, are very similar to those of the previous one-the only alteration being the substitution of selenium with tellurium as the cap-forming-material. (orig.)

  12. Electron-impact ionization of Se2+ and Se3+

    Science.gov (United States)

    Pindzola, M. S.; Loch, S. D.

    2016-06-01

    Electron-impact ionization cross sections for Se2+ and Se3+ are calculated using a semi-relativistic configuration-average distorted-wave (CADW) method. Good agreement between the CADW calculations and recent experimental measurements are found for the single ionization of Se2+ from threshold to 500 eV and for the double ionization of Se2+ from threshold to 225 eV. Good agreement between the CADW calculations and recent experimental measurements are also found for the single ionization of Se3+ from threshold to 200 eV and for the double ionization of Se3+ near the peak of the cross section at 350 eV. Disagreements at other incident electron energies may be due to the complexity of the ionization pathways for low charged Se atomic ions, the various theoretical approximations, and the difficulty in measuring relatively small double ionization events.

  13. Islands, resettlement and adaptation

    Science.gov (United States)

    Barnett, Jon; O'Neill, Saffron J.

    2012-01-01

    Resettlement of people living on islands in anticipation of climate impacts risks maladaptation, but some forms of population movement carry fewer risks and larger rewards in terms of adapting to climate change.

  14. Nunivak Island muskox studies

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report covers the Nunivak Island muskox, summarizing the carrying capacity and age and sex ratios. Recommendations are attached for muskox management.

  15. Vicia vulcanorum (Fabaceae a new species from the island of Lanzarote (Canary Islands

    Directory of Open Access Journals (Sweden)

    Morales-Mateos, J. B.

    2012-12-01

    Full Text Available Vicia vulcanorum J. Gil & M. L. Gil (Fabaceae, a new species of subg. Cracca (Dumort. Peterm., sect. Cracca Dumort. is described and illustrated from the island of Lanzarote, Canary Islands, north-west of Africa. It is related to and compared with Vicia cirrhosa C. Sm. ex Webb & Berthel. and Vicia filicaulis Webb & Berthel., two endemic species from the western and central group of the Canary Islands, and Vicia ferreirensis Goyder, an endemic species from Porto Santo Island, Madeira Archipelago.Se describe e ilustra Vicia vulcanorum J. Gil & M. L. Gil (Fabaceae, una nueva especie y endemismo de la isla de Lanzarote, Islas Canarias, perteneciente al subg. Cracca (Dumort. Peterm., sect. Cracca Dumort. Se encuentra relacionada y es comparada con Vicia cirrhosa C. Sm. ex Webb & Berthel. y Vicia filicaulis Webb & Berthel., especies endémicas de las islas centrales y occidentales del archipiélago canario, y con Vicia ferreirensis Goyder, especie endémica de la isla de Porto Santo, en el archipiélago de Madeira.

  16. Melville Island, Australia

    Science.gov (United States)

    1992-01-01

    Melville Island, just off the coast of Darwin, Northern Territory, Australia (11.5S, 131.0E) is a sparsely inhabited tropical island with heavy woodland concentrations. The widespread and prominant smoke plumes were most likely set to renew pasture under open canopy woodland. Soil erosion is almost non- existant as can be seen by the clear and clean river flow. The offshore sediments are coastal current borne deposits from King Sound to the west.

  17. Solomon Islands; Selected Issues

    OpenAIRE

    International Monetary Fund

    2011-01-01

    This paper analyzes Solomon Islands’ ongoing reforms concerning of the mineral taxation regime and the fiscal impact of mineral resources. The analysis shows that mineral revenue could be substantial, provided that mineral prices remain strong in the medium term. Enforcing the tax agreement with, a Gold Ridge company, and implementing the new resource taxation regime are critical to ensure that the forthcoming mineral wealth spills over to the rest of the economy. Solomon Islands should ado...

  18. Initial growth behavior of Cu(In,Ga)Se 2 on molybdenum substrates

    Science.gov (United States)

    Schlenker, T.; Schock, H. W.; Werner, J. H.

    2003-11-01

    We study the initial growth stage of Cu(In,Ga)Se 2 on Mo films on glass, as the typical back contact for Cu(In,Ga)Se 2 solar cells. A thermal evaporation process deposits Cu(In,Ga)Se 2 of nominal 3 nm thickness at different rates R and substrate temperatures TSub. An ultrahigh resolution scanning electron microscope serves to visualize the nucleation behavior. The deposited Cu(In,Ga)Se 2 forms three-dimensional isolated nuclei, known as Volmer-Weber growth mode. Deposition rate R and substrate temperature TSub control the areal density n of the Cu(In,Ga)Se 2 nuclei. For the growth on polycrystalline Mo substrates fabricated by sputter process, we observe a power law dependence between the island density n and the deposition rate R, and an exponential dependence of the island density n on substrate temperature TSub. The theory of homogeneous nucleation explains the Cu(In,Ga)Se 2 cluster formation on sputtered Mo substrates and the dependence of the island density on the growth conditions. On electron gun evaporated molybdenum, the cluster growth shows a similar behavior, but the nucleation mechanism deviates from the model of homogeneous nucleation and strong island density fluctuations occur.

  19. Combined crustal-geological cross-section of Ellesmere Island

    DEFF Research Database (Denmark)

    Stephenson, Randell Alexander; Schiffer, Christian; Oakey, Gordon

    resulted in a regional geological cross-section spanning Ellesmere Island from Hansen Point (NW) to the Bache Peninsula (SE). This cross-section, based on the excellent surface exposure afforded in this region, provides a model of the structure of the upper crust to a depth of about 10 km. Although......-sections have been integrated to produce a single, combined crustal-geological 2-D model of Ellesmere Island with the aim of illuminating the relationships between crustal architecture and geology as expressed at the surface of and in the topography of Ellesmere Island.......Ellesmere Island, in Canada’s Arctic, consists of a series of ~SW-NE trending tectonic provinces, the crustal structure and geological expression of which represent a combination of interplate, accretionary orogenesis in the Palaeozoic and, most recently, intraplate deformation in the Cenozoic...

  20. Epitaxial growth of ZnSe and ZnSe/CdSe nanowires on ZnSe

    Energy Technology Data Exchange (ETDEWEB)

    Bellet-Amalric, E.; Bounouar, S.; Kheng, K. [CEA-CNRS-UJF Group, Nanophysique et Semiconducteurs, CEA Grenoble, INAC, 17 rue des Martyrs, 38 054 Grenoble (France); Elouneg-Jamroz, M.; Bougerol, C.; Hertog, M. den; Genuist, Y.; Poizat, J.P.; Andre, R.; Tatarenko, S. [CEA-CNRS-UJF Group, Nanophysique et Semiconducteurs, Institut Neel, BP 166, 38 042 Grenoble (France)

    2010-06-15

    We report the molecular beam epitaxy (MBE) growth of ZnSe nanowires (NWs) on a ZnSe(100) epilayer assisted by gold catalyst. Gold dewetting assists in the formation of nanotrenches along the [0-1-1] direction in the ZnSe buffer layer. Nucleation of the gold catalyst in the trenches leads to the growth of NWs preferentially in directions orthogonal to the trenches. The wires adopt mostly the wurtzite type structure and grow along the c-axis. CdSe quantum dots were inserted in the ZnSe NWs. The CdSe insertions systematically adopt a cubic zinc-blende arrangement with a[111] growth axis, as confirmed by transmission electron microscopy. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Seal Island and Franklin Island National Wildlife Refuges Trip Report

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a summary of visits to both Seal Island National Wildlife Refuge and Franklin Island National Wildlife Refuge on August 14, 15, 16, 1982.

  2. Formation and properties of epitaxial CdSe, ZnSe quantum dots. Conventional molecular beam epitaxy and related techniques

    International Nuclear Information System (INIS)

    This thesis systematically investigates three such alternative approaches, along with conventional MBE, with emphasis on the formation-mechanism of QDs, and optimization of their morphological and optical attributes. it is shown here that no distinct 3D islands are formed in MBE growth of CdSe on ZnSe. While CdSe heteroepitaxy occurs in the multilayer-mode at TG=300 C, a reentrant recovery of the layer-by-layer mode is reported in this thesis, for growth at TGD=230 C). The process steps of the third variant technique, developed in course of this work, are very similar to those of the previous one-the only alteration being the substitution of selenium with tellurium as the cap-forming-material. (orig.)

  3. CdSe quantum dot formation: alternative paths to relaxation of a strained CdSe layer and influence of the capping conditions.

    Science.gov (United States)

    Robin, I C; Aichele, T; Bougerol, C; André, R; Tatarenko, S; Bellet-Amalric, E; Van Daele, B; Van Tendeloo, G

    2007-07-01

    CdSe/ZnSe quantum dot formation is investigated by studying different steps of the growth. To precisely control the critical thickness of CdSe grown on a ZnSe buffer layer, the CdSe self-regulated growth rate in atomic layer epitaxy growth mode is determined by reflection high-energy electron diffraction (RHEED) measurements for a temperature range between 180 and 280 °C. Then, the two-dimensional-three-dimensional (2D-3D) transition of a strained CdSe layer on (001)-ZnSe induced by the use of amorphous selenium is studied. The formation of CdSe islands is found when 3 monolayers (ML) of CdSe are deposited. When only 2.5 ML of CdSe are deposited, another relaxation mechanism is observed, leading to the appearance of strong undulations on the surface. We also studied the evolution of the surface morphology when 2.7 ML are deposited, to study the boundary between those two phenomena. The influence of capping on quantum dot morphology is investigated. It is found that cadmium is redistributed within the layer during capping. Our results show that the cadmium distribution after capping depends on the capping temperature and on the strain of the CdSe layer. Cadmium incorporation after capping is also studied. It is found that the amount of incorporated cadmium depends on the strain of the CdSe layer before capping.

  4. CdSe quantum dot formation: alternative paths to relaxation of a strained CdSe layer and influence of the capping conditions

    Energy Technology Data Exchange (ETDEWEB)

    Robin, I C [CEA-CNRS-UJF ' Nanophysics and Semiconductors' Group Laboratoire de Spectrometrie Physique/CNRS UMR5588, Universite J. Fourier, Grenoble, BP87, 38402 St Martin d' Heres (France); Aichele, T [CEA-CNRS-UJF ' Nanophysics and Semiconductors' Group Laboratoire de Spectrometrie Physique/CNRS UMR5588, Universite J. Fourier, Grenoble, BP87, 38402 St Martin d' Heres (France); Bougerol, C [CEA-CNRS-UJF ' Nanophysics and Semiconductors' Group Laboratoire de Spectrometrie Physique/CNRS UMR5588, Universite J. Fourier, Grenoble, BP87, 38402 St Martin d' Heres (France); Andre, R [CEA-CNRS-UJF ' Nanophysics and Semiconductors' Group Laboratoire de Spectrometrie Physique/CNRS UMR5588, Universite J. Fourier, Grenoble, BP87, 38402 St Martin d' Heres (France); Tatarenko, S [CEA-CNRS-UJF ' Nanophysics and Semiconductors' Group Laboratoire de Spectrometrie Physique/CNRS UMR5588, Universite J. Fourier, Grenoble, BP87, 38402 St Martin d' Heres (France); Bellet-Amalric, E [CEA-CNRS-UJF ' Nanophysics and Semiconductors' Group, Departement de Recherche Fondamentale sur la Matiere Condensee/SP2M CEA Grenoble, 17 rue des Martyrs, 38054 Grenoble cedex 9 (France); Daele, B Van [IMEC, Kapeldreef 75, 3001 Leuven (Belgium); Tendeloo, G van [EMAT University of Antwerp (RUCA), Groenenborgerlaan 171, 2020 Antwerp (Belgium)

    2007-07-04

    CdSe/ZnSe quantum dot formation is investigated by studying different steps of the growth. To precisely control the critical thickness of CdSe grown on a ZnSe buffer layer, the CdSe self-regulated growth rate in atomic layer epitaxy growth mode is determined by reflection high-energy electron diffraction (RHEED) measurements for a temperature range between 180 and 280 deg. C. Then, the two-dimensional-three-dimensional (2D-3D) transition of a strained CdSe layer on (001)-ZnSe induced by the use of amorphous selenium is studied. The formation of CdSe islands is found when 3 monolayers (ML) of CdSe are deposited. When only 2.5 ML of CdSe are deposited, another relaxation mechanism is observed, leading to the appearance of strong undulations on the surface. We also studied the evolution of the surface morphology when 2.7 ML are deposited, to study the boundary between those two phenomena. The influence of capping on quantum dot morphology is investigated. It is found that cadmium is redistributed within the layer during capping. Our results show that the cadmium distribution after capping depends on the capping temperature and on the strain of the CdSe layer. Cadmium incorporation after capping is also studied. It is found that the amount of incorporated cadmium depends on the strain of the CdSe layer before capping.

  5. Sakhalin Island terrain intelligence

    Science.gov (United States)

    ,

    1943-01-01

    This folio of maps and explanatory tables outlines the principal terrain features of Sakhalin Island. Each map and table is devoted to a specialized set of problems; together they cover the subjects of terrain appreciation, climate, rivers, water supply, construction materials, suitability for roads, suitability for airfields, fuels and other mineral resources, and geology. In most cases, the map of the island is divided into two parts: N. of latitude 50° N., Russian Sakhalin, and south of latitude 50° N., Japanese Sakhalin or Karafuto. These maps and data were compiled by the United States Geological Survey during the period from March to September, 1943.

  6. Long Island Solar Farm

    Energy Technology Data Exchange (ETDEWEB)

    Anders, R.

    2013-05-01

    The Long Island Solar Farm (LISF) is a remarkable success story, whereby very different interest groups found a way to capitalize on unusual circumstances to develop a mutually beneficial source of renewable energy. The uniqueness of the circumstances that were necessary to develop the Long Island Solar Farm make it very difficult to replicate. The project is, however, an unparalleled resource for solar energy research, which will greatly inform large-scale PV solar development in the East. Lastly, the LISF is a superb model for the process by which the project developed and the innovation and leadership shown by the different players.

  7. Archaeoastronomy of Easter Island

    Science.gov (United States)

    Edwards, Edmundo

    Astronomer priests or "skywatchers" on Easter Island lived in stone towers that were used as observatories and built stone markers in the periphery that indicated the heliacal rising of certain stars that served to indicate the arrival of marine birds, turtles, the offshore fishing season, and times for planting and harvest. Petroglyphs related to such sites depict outriggers, fishhooks, pelagic fish, and turtles and supposedly represented a star map. In this chapter, we analyze a set of such skywatchers dwellings, and stone markers located upon the North coast of Easter Island that have astronomic orientations, its related petroglyphs, and the relations between these directions with their yearly activities and their ritual calendar.

  8. Gulf Island National Wildlife Refuges

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document provides a brief history and describes physical features of the Gulf Island National Wildlife Refuges. The Gulf Island National Wildlife Refuges...

  9. 1957 Aleutian Islands, USA Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The magnitude 8.6 (Mw) earthquake occurred south of the Andreanof Islands, in the Aleutian Islands. It generated an 8-meter tsunami that did great damage on Adak...

  10. Marketing plan for Kuuskajaskari Island

    OpenAIRE

    XIE, JUANJUAN

    2009-01-01

    Marketing palan for Kuuskajaskari Island. ‡b Kuuskajaskari Island owned by the town of Rauma. Marketing plan should help the entrepreneurs of the islands to create services that target groups want and promote them by using the efficient marketing mix. The theoretical part consists of nature of tourism industry, travel consumers in general, then focus on Rauma areas and its island as targeted destination. Data was gathered from different official Finnish websites, books and from Sanni-Mari Aal...

  11. Islanded operation of distribution networks

    International Nuclear Information System (INIS)

    This report summarises the results of a study assessing the benefits and risks to distribution network of generator islanding and examining the technical, commercial and regulatory changes required to facilitate the operation of islanding. The background to the study is traced, and details are given of a literature review, the technical criteria for operating sections of the network in islanding mode, and the impact of islanding on trading. Case studies and a detailed implementation plan, data acquisition, and commercial incentives are discussed

  12. Islanded operation of distribution networks

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This report summarises the results of a study assessing the benefits and risks to distribution network of generator islanding and examining the technical, commercial and regulatory changes required to facilitate the operation of islanding. The background to the study is traced, and details are given of a literature review, the technical criteria for operating sections of the network in islanding mode, and the impact of islanding on trading. Case studies and a detailed implementation plan, data acquisition, and commercial incentives are discussed.

  13. Sample Set (SE): SE14 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE14 Effect of agricultural films for tomato fruit metabolites Investigation of Sol...anum lycopersicum fruit metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  14. Sample Set (SE): SE16 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE16 Effect of agricultural films for spinach leaf metabolites 2 Investigation of S...pinacia oleracea leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural film or no agricultural

  15. Sample Set (SE): SE18 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE18 Global identification of phospholipid molecular species in mouse liver and bra...in by Orbitrap MS and automated search engine Lipid Search A comprehensive and precise identification of pho

  16. Sample Set (SE): SE10 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE10 Effect of phosphorus nutrition for cabbage metabolites Investigation of Brassi...ca oleracea var. capitata Hatukoi leaf metabolites. 3 growth conditions (high, low and no phosphorus nutrition

  17. Sample Set (SE): SE20 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE20 Arabidopsis thaliana leaf metabolite analysis for a software test Investigatio...es that were investigated to optimize the parameters of PowerGet software for better metabolite annotation i

  18. Sample Set (SE): SE19 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE19 Grobal triacylglycerol analysis in mouse liver and white adipose tissue (WAT) ...rol (TAG) molecular species from complex lipid mixtures of mouse liver and white adipose tissue (WAT) using

  19. Sample Set (SE): SE30 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE30 Comparison of seed metabolites among soybean varieties Investigation of Glycine max. green seed metabol...ites. 3 varieties (Kamogawashichiri, Koitozairai, Tanbakuro) data are examined. Tak

  20. Sample Set (SE): SE31 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE31 Comparison of seed metabolites among eggplant fruit tissues Investigation of S...olanum melongena Senryounigou metabolites. 3 tissues (flesh, fruit, peel) data are examined. Takeshi Ara 1,

  1. Sample Set (SE): SE3 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3 Comparison of fruit metabolites among tomato varieties 1 Investigation of Solanum lycopersicum fruit met...abolites. 3 caltivars and an original species, 3 replicates data are examined. Naok

  2. Sample Set (SE): SE26 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE26 Effect of compost for cabbage metabolites Investigation of Brassica oleracea v...ar. capitata YR Seisyun leaf metabolites. 2 growth conditions (with or without 6t compost treatment) and 3 r

  3. Sample Set (SE): SE12 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE12 Effect of agricultural films for spinach leaf metabolites Investigation of Spi...nacia oleracea leaf metabolites. 2 cultivars (Nihon and Wasesaradaakari), 2 growth conditions (normal film and UV film

  4. Sample Set (SE): SE55 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE55 AtMetExpress development: a phytochemical atlas of arabidopsis development We analyzed phytochemical...idopsis produces various phytochemicals in a highly tissue-specific manner, which often accompanies the expr

  5. HEAT ISLAND REDUCTION STRATEGIES GUIDEBOOK

    Science.gov (United States)

    This heat island reduction strategies guidebook provides an overview of urban heat islands and steps communities can take to reduce them. In particular, this guidebook provides background basics and answers the questions: “What is a heat island?” “What are its impacts?" "What ar...

  6. Solomon Islands Botany

    NARCIS (Netherlands)

    Steenis, van C.G.G.J.

    1969-01-01

    A discussion of the Results of the Royal Society Expedition to the British Solomon Islands Protectorate, 1965. Organized by E.J.H. Corner. Phil. Trans. R. Soc. B 255 (1969) 185-631, 196 fig. University Printing House, Shaftesbury Road, Cambridge. Obtainable through booksellers or direct to the Royal

  7. Solomon Islands : Workforce Development

    OpenAIRE

    World Bank

    2014-01-01

    Solomon Islands has undertaken a comprehensive assessment of the strength of its workforce development (WfD) policies and institutions to support these initiatives and enhance evidence based dialogue on their implementation. This assessment has been based on the World Bank s Systems Approach for Better Education Results (SABER) systems benchmarking initiative, under which a suite of analyt...

  8. Mauritius - a Sustainable Island

    DEFF Research Database (Denmark)

    Larsen, Anders

    2010-01-01

    The Government of Mauritius has a long-term vision of transforming Mauritius into a sustainable Island. One important element towards the achievement of this vision is to increase the country's renewable energy usage and thereby reducing dependence on fossil fuels. Democratisation of energy...

  9. Christmas Island birds returning

    Science.gov (United States)

    Six months after their mass exodus, birds are beginning to return to Christmas Island. Roughly 17 million birds, almost the entire adult bird population, either perished or fled their mid-Pacific atoll home last autumn, leaving behind thousands of nestlings to starve (Eos, April 5, 1983, p. 131). It is believed that the strong El Niño altered the ecology of the surrounding waters and forced the birds to flee. Christmas Island is the world's largest coral atoll.“Ocean and atmosphere scientists are unsure of future directions for the El Niño conditions and cannot now predict what will happen to the birds in the coming months,” said Ralph W. Schreiber, curator of ornithology at the Natural History Museum of Los Angeles County in California. Heisthe ornithologist who discovered the disappearance. “The recovery of the bird populations depends on the food supply in the waters surrounding the island.” The island's birds feed exclusively on small fish and squid.

  10. Bone island and leprosy

    International Nuclear Information System (INIS)

    Objective. To determine the incidence of bone islands in leprosy patients. Design. X-rays of feet and hands of patients with Hansen's disease (leprosy) were reviewed retrospectively. A second group of related age- and sex-matched patients who did not have Hansen's disease was used for control purposes. Controls had undergone hand or foot X-rays during diagnosis of other pathologies. The patients with Hansen's disease were compared with the control group, and were also analyzed as subgroups with different types of leprosy. The results were subjected to statistical analysis. Patients. Ninety patients with Hansen's disease were randomly selected for this study. Patients who had had ulcers on hands or feet were excluded from the study. Results and conclusions. Bone islands were demonstrated in 20 patients with Hansen's disease; no bone islands were observed in the controls. This was statistically significant (P<0.01). Bone islands were only seen in patients with lepromatous leprosy and borderline types but were not demonstrated in patients with tuberculoid leprosy. There was also a statistically significant relationship for a disease duration of 15 years or more. The cause of this raised incidence of enostosis in leprosy patients is not clear, but there may be a genetic predisposition in patients with leprosy, or it may be a side effect of leprosy, especially the lepromatous form. (orig.)

  11. Island Ecology in Bermuda.

    Science.gov (United States)

    Wulff, Barry L.; And Others

    1981-01-01

    Reports on an island ecology course offered by Eastern Connecticut State College providing opportunities for students to study the ecology and natural history of organisms found in a variety of subtropical habitats in Bermuda. Explains student selection criteria, trip preparation, evaluation criteria, daily programs, and habitats studied on the…

  12. Vetenfinf se ha actualizado recientemente

    Directory of Open Access Journals (Sweden)

    Veterinaria.org

    2008-02-01

    Full Text Available ResumenSe trata de un sitio web alojado en el servidor de Veterinaria.org y mantenido por el Dr. Norberto Fondevila, del Instituto de Virologia CICVyA- INTA Cautelar de Argentina .

  13. Señas Mexicano

    Directory of Open Access Journals (Sweden)

    Juan F. García Mejía

    2007-01-01

    Full Text Available En este artículo se muestra un sistema que permite el estudio y práctica del Lenguaje de Señas Mexicano (LMS, el cual es el método de comunicación de las personas que padecen un trastorno de procesamiento auditivo. El sistema propuesto en este artículo consta de un guante de tela instrumentado con sensores de flexión, una etapa de acondicionamiento de señales y una tarjeta de adquisición de datos; que en su conjunto constituyen el Hardware. El software esta formado por un programa de adquisición de datos y una interfaz de usuario, ambos codificados en Visual Basic Net. El sistema propuesto se modela por medio del lenguaje de modelado unificado (UML, ya que Visual Basic es un lenguaje orientado a eventos.

  14. Porøse materialer

    DEFF Research Database (Denmark)

    Hansen, Ernst Jan de Place

    2000-01-01

    Dette undervisningsnotat er en samling af noter, der refererer til den indledende del af kurset Materialmekanik og Porøse materailer på Insitut for Bærende Konstruktiner og Materialer (BKM).......Dette undervisningsnotat er en samling af noter, der refererer til den indledende del af kurset Materialmekanik og Porøse materailer på Insitut for Bærende Konstruktiner og Materialer (BKM)....

  15. Island solution; Inselloesung

    Energy Technology Data Exchange (ETDEWEB)

    Bah, Isaac

    2013-06-15

    On the Azores island Graciosa the Berlin-based company Younicos has installed a new electricity system with advanced storage technology, which will make the islanders independent from fossil fuels. With an energy mix of wind power, photovoltaics and biomass the dependence on fossil fuels should be terminated. In the center of the flagship project specifically developed hybrid batteries are used (combination of sodium-sulfur- and lithium-ion batteries) with 2.7 MW of power and a storage capacity of ten megawatts hours. [German] Auf der Azoren-Insel Graciosa installiert das Berliner Unternehmen Younicos ein neues Stromsystem mit modernster Speichertechnologie, das die Bewohner unabhaengig von fossilen Energietraegern machen soll. Mit einem Energiemix aus Windkraft, Photovoltaik und Biomasse soll die Abhaengigkeit von fossilen Brennstoffen beendet werden. Im Zentrum des Vorzeigeprojekts stehen speziell fuer den Inseleinsatz entwickelte Hybridbatterien (Kombination aus Natrium-Schwefel- und Lithium-Ionen-Akkus) mit 2,7 Megawatt Leistung und eine Speicherkapazitaet von zehn Megawattestunden.

  16. The conventional island

    International Nuclear Information System (INIS)

    For the conventional island, GEC Alsthom designs, manufactures and supplies: Mechanical equipment for the conventional island, Electrical equipment for the entire PWR unit, Safety-class mechanical equipment. Its experience and its own R and D resources, as well as close collaboration with EDF and experience feedback from equipment manufacturing, plant unit construction, and operation, enabled GEC Aslthom to meet the challenge of making a success of the massive nuclear power program launched in France. The latest step in the French nuclear power program is the 'N4' generation of 1450 MWe class units, for which GEC Alsthom has developed a second generation of impulse turbines, more compact and efficient moisture separator/reheaters and seawater-tight condensers

  17. Urban heat island 1

    DEFF Research Database (Denmark)

    Bühler, Oliver; Jensen, Marina Bergen; Petersen, Karen Sejr

    2010-01-01

    Urban Heat Island beskriver det forhold, at temperaturen i byområder er højere end temperaturen i tilgrænsede landområder. Årsagen hertil ligger i den urbane arealanvendelse, hvor en mindre andel af arealerne er dækket af vegetation, og en større andel består af forseglede arealer....

  18. Sample Set (SE): SE27 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE27 Effect of agricultural films for cabbage leaf metabolites Investigation of Bra...ssica oleracea var. capitata YR Tenkuu leaf metabolites. 3 growth conditions (covered with normal or UV cut agricultural... film or no agricultural film), 3 replicates data are examined. Takeshi Ara 1, Naoki Yamamoto 1,

  19. Sample Set (SE): SE57 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available ster analysis based on the metabolite accumulation patterns clearly showed differences among the plant famil...etabolite accumulation patterns in plants We optimized the MRM conditions for specifi c compounds by perform...SE57 Widely targeted metabolomics based on large-scale MS/MS data for elucidating m

  20. Sample Set (SE): SE56 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE56 MS/MS spectral tag-based annotation of non-targeted profile of plant secondary...sis, resulting in clarification of the functions of reported genes involved in glycosylation of flavonoids. Thus, non-target

  1. Sample Set (SE): SE53 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE53 Covering chemical diversity of genetically-modified tomatoes using metabolomic...rect acquisition of an interpretable data set of estimable chemical diversity. As an example, we report an a...etected compounds that represent 86% of the estimated chemical diversity of the metabolites listed in the Ly

  2. Significados y funciones del "se"

    Directory of Open Access Journals (Sweden)

    Lidia Contreras

    2004-06-01

    Full Text Available En este artículo la autora se limita a comentar críticamente lo que la Real Academia Española de la Lengua (cit. Ac. dice en su "Gramática de la lengua española" de 1931 (Madrid, Espasa-Calpe, S. A. con respecto a los diversos tipos de "se" que ella toma en cuenta, comentario que pretende mostrar una mayor diversificación que la establecida en la mencionada obra. (In this article, its author offers a critical commentary of the position taken by The Spanish Royal Academy of Language (RAE in Gramática de la lengua española (1931 on the subject of "Uses of 'se'". The author intends to show a greater variety of uses than those proposed by RAE.

  3. [Salmonella pathogenicity islands].

    Science.gov (United States)

    Sırıken, Belgin

    2013-01-01

    Salmonella species are facultative intracellular pathogenic bacteria. They can invade macrophages, dendritic and epithelial cells. The responsible virulence genes for invasion, survival, and extraintestinal spread are located in Salmonella pathogenicity islands (SPIs). SPIs are thought to be acquired by horizontal gene transfer. Some of the SPIs are conserved throughout the Salmonella genus, and some of them are specific for certain serovars. There are differences between Salmonella serotypes in terms of adaptation to host cell, virulence factors and the resulting infection according to SPA presence and characteristics. The most important Salmonella virulence gene clusters are located in 12 pathogenicity islands. Virulence genes that are involved in the intestinal phase of infection are located in SPI-1 and SPI-2 and the remaining SPIs are required for intracellular survival, fimbrial expression, magnesium and iron uptake, multiple antibiotic resistance and the development of systemic infections. In addition SPIs, Sigma ss (RpoS) factors and adaptive acid tolerance response (ATR) are the other two important virulence factors. RpoS and ATR found in virulent Salmonella strains help the bacteria to survive under inappropriate conditions such as gastric acidity, bile salts, inadequate oxygen concentration, lack of nutrients, antimicrobial peptides, mucus and natural microbiota and also to live in phagosomes or phagolysosomes. This review article summarizes the data related to pathogenicity islands in Salmonella serotypes and some factors which play role in the regulation of virulence genes.

  4. Ud at se med Erasmus

    DEFF Research Database (Denmark)

    Frandsen, Pernille

    2009-01-01

    Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus.......Få lidt luft under vingerne, kom ud at møde udenlandske kolleger og se, hvordan man også kan lave uddannelsesbibliotek. Med begejstring fortæller tre bibliotekarer om deres oplevelser i det store udland – alt sammen finansieret af Erasmus....

  5. MARICULTURE ON CROATIAN ISLANDS

    Directory of Open Access Journals (Sweden)

    Gordana Šarušić

    2000-09-01

    Full Text Available The first attempts of intensive mariculture in Croatia commenced at the very beginning of 1980’s. The mid-eighties brought an expansion of mariculture production, which has been continuously increasing. A few different marine organisms are intensively cultured - both fish and shellfish. Among them commercially most important and highly valued species are sea bass Dicentrarchus labrax and sea bream Sparus aurata. Mussel Mytilus galloprovincialis and oyster Ostrea edulis are the most important shellfish. Fish species such as dentex Dentex dentex, red sea bream Pagrus major and sheepshead bream Puntazzo puntazzo are reared too, but in a rather small quantities. Only recently the rearing, on-growing- of bluefin tuna Thunnus thynnus started in Croatia. The juveniles (70% are reared in a Croatian hatcheries, and 30% has to be imported mainly from Italy and France, due to a higher demand for this kind of culture among the small growers. Croatian part of Adriatic sea possesses a number of geomorfologicaly suitable sites and meteorological conditions which determined the choice - type - of intensive culture. All fish species are reared in a floating cages. The choice of cages i. e. semi off-shore or floating frames, size, rearing volume and design depend on the investors personal preference. The annual turnouf of a market size bass was about 600t and 300t bream in 1996., by 10 island farms which is 70% of total production in Croatia. Including other cultured fish species last year production was up to 1000t, and it™s being estimated to be about 1300t in the following year. The shellfish production on the islands is usually individual attempt of farmers, producing minor quantities mostly in polyculture. This production has bigger potential but it’s limited owing to the EU quality control regulations which do not allow the export, and by domestic market which has drastically decreased due to the collapse of tourism during the recent war. Almost 80

  6. Gamma ray dose rates in the Weh Island, Indonesia

    International Nuclear Information System (INIS)

    The Weh Island is located at the northern most part of Great Sumatera Fault system which has NW-SE trend elongated from Bands Aceh until Semangko Bay about 1650 km within Sumatera Island. We had conducted the measurement of gamma ray dose rate in Weh Island of Sumatera in Indonesia. From about 15 observation points, we found that the average of gamma ray dose rate was 50.8 ± 4.8 nGy/h. From the present study, natural intensity of radioactivity could be checked and can be concluded into the following; 1) There are two high radioactive level zones in the investigating area. One of them is the east zone in accordance with valleys and erosion zone along the structure line (Great Sumatra fault). 2) The other zone is the central part of this area. Even if this zone looks lineament geographically, it indicates the existence of fault line. (author)

  7. Introduction to the "SE Field"

    OpenAIRE

    Defourny, Jacques

    2014-01-01

    The "SE Field" stands here for the main concepts defining the research areas of the EMES European Research Network since its creation in an informal (1996-2001) and then formal way (2002): Social Enterprise, Social Entrepreneurship, Social Economy and Solidarity Economy

  8. 32 CFR 935.62 - Island Attorney.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Island Attorney. 935.62 Section 935.62 National... WAKE ISLAND CODE Judiciary § 935.62 Island Attorney. There is an Island Attorney, appointed by the General Counsel as needed. The Island Attorney shall serve at the pleasure of the General Counsel....

  9. Investigation of the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems

    Energy Technology Data Exchange (ETDEWEB)

    Marchuk, O.V. [Department of Physical and Colloidal Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Shemet, V.Ya. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine); Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Ave 13, 43009 Lutsk (Ukraine)

    2006-06-08

    Phase diagram of the Cu{sub 2}Se-PbSe system was constructed using differential-thermal analysis, X-ray diffraction and metallography. The eutectic reaction L-bar {beta}-Cu{sub 2}Se+PbSe takes place at 886K and corresponds to 46mol% PbSe. The peritectoid reaction {beta}-Cu{sub 2}Se+PbSe-bar {alpha}-Cu{sub 2}Se takes place at 420K. The formation of the PrCuSe{sub 2} compound (LaCuS{sub 2} structure type, space group P2{sub 1}/c) and the solid solution range Pr{sub 2}Se{sub 3}-Pr{sub 2}PbSe{sub 4} (Th{sub 3}P{sub 4} structure type, space group I4-bar 3d, a=0.89916(2)nm, R{sub I}=0.0682 for Pr{sub 2}PbSe{sub 4}) was confirmed using X-ray powder diffraction. The interactions between the components in the Pr{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Pr{sub 2}Se{sub 3}-Ag{sub 2}Se-PbSe systems at 870K were determined using X-ray powder diffraction. No quaternary compounds exist in these systems.

  10. Sample Set (SE): SE58 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available calibration curves over a biologically defined concentration range for all detected compounds. By performing... metabolomics on a stepwise gradient between two biological specimens, we obtain ...rference. Analysis of artificial biological gradients is a general and inexpensive tool for calibration that...ments using artificial biological gradients We introduce a powerful approach that provides semiquantitative ...SE58 Exploring matrix effects and quantification performance in metabolomics experi

  11. Renewable energy islands in Europe

    Energy Technology Data Exchange (ETDEWEB)

    Oestergaard, Iben [ed.

    1998-12-31

    This publication includes a compiled presentation of various aspects concerning the possible transformation of some European islands into renewable energy communities and these projects were presented by a selection of pioneer islands at the first European Seminar on Renewable Energy Islands, held on the Danish island of Samsoee, 29-30 June 1998. This issue has increased in importance with the presentation of the ambitious EU-White Paper: `Energy for the future: Renewable Sources of Energy` which was adopted in 1998. One of the key elements of the strategy for an accelerated implementation of renewable energy is to transform 100 localities within Europe into communities which are to be 100% self-sufficient with renewable energy before 2010. In line with this strategy, the Danish Government appointed the island of Samsoe towards the end of 1997 to be the first `official` Danish, renewable energy island. This is to serve as a demonstration project for other local communities, both in Denmark as well as in the rest Europe. Gothland, Madeira, Canary Islands, Cape Verde, Arki, Crete, Minorca and Orkney Islands were represented. Environmental advantages of wind, solar and wave power for distant island communities were indicated. Serious savings would be achieved by limitation of fossil fuel import and utilization of local resources. (EG)

  12. Island biogeography of the Anthropocene.

    Science.gov (United States)

    Helmus, Matthew R; Mahler, D Luke; Losos, Jonathan B

    2014-09-25

    For centuries, biogeographers have examined the factors that produce patterns of biodiversity across regions. The study of islands has proved particularly fruitful and has led to the theory that geographic area and isolation influence species colonization, extinction and speciation such that larger islands have more species and isolated islands have fewer species (that is, positive species-area and negative species-isolation relationships). However, experimental tests of this theory have been limited, owing to the difficulty in experimental manipulation of islands at the scales at which speciation and long-distance colonization are relevant. Here we have used the human-aided transport of exotic anole lizards among Caribbean islands as such a test at an appropriate scale. In accord with theory, as anole colonizations have increased, islands impoverished in native species have gained the most exotic species, the past influence of speciation on island biogeography has been obscured, and the species-area relationship has strengthened while the species-isolation relationship has weakened. Moreover, anole biogeography increasingly reflects anthropogenic rather than geographic processes. Unlike the island biogeography of the past that was determined by geographic area and isolation, in the Anthropocene--an epoch proposed for the present time interval--island biogeography is dominated by the economic isolation of human populations. PMID:25254475

  13. Islanders' Perspectives on Sustainable Living

    Directory of Open Access Journals (Sweden)

    Gillian Cambers

    2006-05-01

    Full Text Available An internet forum, supported by the Small Islands Voice initiative, has since 2002 provided a place where islanders from around the world could discuss issues and problems and also learn from the experiences of others. This paper provides a reflective overview of the discussions over the past four years and attempts to identify some specific characteristics that identify islanders in their approaches to everyday living. An analysis of the forum respondents shows that approximately two thirds are male; one half come from the Pacific islands; and more than a half are employed in island-based occupations. Discussions have covered infrastructural development; resource management; environmental, social and economic issues. The overview indicates islanders are very willing to speak out and take ownership of their issues and problems and their discussions show a significant level of understanding about the need to balance limited resources and economic development. Proposals for action are practical and feasible and there is a strong vein of common sense running through the responses. Most significantly, islanders show a deep love for their island homes, an attitude of caring about the future development of their islands, and a willingness to try to solve their problems themselves.

  14. Islands and Non-islands in Native and Heritage Korean

    Science.gov (United States)

    Kim, Boyoung; Goodall, Grant

    2016-01-01

    To a large extent, island phenomena are cross-linguistically invariable, but English and Korean present some striking differences in this domain. English has wh-movement and Korean does not, and while both languages show sensitivity to wh-islands, only English has island effects for adjunct clauses. Given this complex set of differences, one might expect Korean/English bilinguals, and especially heritage Korean speakers (i.e., early bilinguals whose L2 became their dominant language during childhood) to be different from native speakers, since heritage speakers have had more limited exposure to Korean, may have had incomplete acquisition and/or attrition, and may show significant transfer effects from the L2. Here we examine islands in heritage speakers of Korean in the U.S. Through a series of four formal acceptability experiments comparing these heritage speakers with native speakers residing in Korea, we show that the two groups are remarkably similar. Both show clear evidence for wh-islands and an equally clear lack of adjunct island effects. Given the very different linguistic environment that the heritage speakers have had since early childhood, this result lends support to the idea that island phenomena are largely immune to environmental influences and stem from deeper properties of the processor and/or grammar. Similarly, it casts some doubt on recent proposals that islands are learned from the input. PMID:26913017

  15. Looking for the Island

    OpenAIRE

    goldiechiari

    2013-01-01

    Looking for the island è un progetto video dedicato al Garbage Patch, un’ isola “discarica” che si trova nell’Oceano Pacifico iniziata a costituirsi nel 1950. La sua estensione non è nota con precisione: le stime vanno da 700.000 km² fino a più di 10 milioni di km². Questa particolare isola, composta da polimeri sotto forma di bottiglie, imballaggi, reti e da altri generi di spazzatura, viene mossa costantemente dalle onde dell’oceano che logorano la materia riducendola a minuscole partic...

  16. Mediterranean Islands: A Concept

    OpenAIRE

    Lopašić, A.

    2001-01-01

    This article represents some of the results of my fieldwork and research on the islands of Sardinia, Corsica, Malta, Sicily, Crete and Susak between the years 1962–1986. My main filed-work in Sardinia was supported by the Social Science Research Council, London and the University of Reading/Berks, and the ones in Corsica, Malta and Sardinia by the Department of Ethnology, University of Cologne (Institut für Völkerkunde, Universität Köln) forming a part of a project on the Medit...

  17. Urban heat island

    Science.gov (United States)

    Kim, Hongsuk H.

    1991-01-01

    The phenomenon of urban heat island was investigated by the use of LANDSAT Thematic Mapper data sets collected over the metropolitan area of Washington DC (U.S.). By combining the retrieved spectral albedos and temperatures, urban modification on radiation budgets of five surface categories were analyzed. The surface radiation budget imagery of the area show that urban heating is attributable to a large heat flux from the rapidly heating surfaces of asphalt, bare soil and short grass. In summer, symptoms of diurnal heating begin to appear by mid morning and can be about 10 degrees warmer than nearby woodlands in summer.

  18. Weather In Some Islands

    Institute of Scientific and Technical Information of China (English)

    王良华

    2007-01-01

    There are four seasons in a year. When spring comes, the weather is mild(温和的). Summer comes after spring. Summer is the hottest season of the year. Autumn follows summer. It is the best season of the year. Winter is the coldest season of the year. Some islands(岛) have their own particular(特别的) seasons because their weather is very much affected(影响) by the oceans(海洋) around them. In Britain, winter is not very cold and summer is not very hot.

  19. Organizations as Designed Islands

    Directory of Open Access Journals (Sweden)

    Pasquale Gagliardi

    2009-05-01

    Full Text Available The literature and practice of organizational design are mostly based on simplistic conceptions which ignore recent theoretical developments in organizational studies. Conceiving of organizations as ‘designed islands’, it is argued, can contribute to a more solid theoretical foundation to organization theory, viewed as normative science. Relying on the work of Peter Sloterdijk, who describes the forms of life in space in terms of spheres, the heuristic power of the island metaphor is explored. What can be learnt from the art of isolating in order to construct lived organizational environments is then discussed, and the paradoxical relationship between connection and isolation is highlighted.

  20. Non-native vascular plants from Canary Islands (Spain): nomenclatural and taxonomical adjustments

    OpenAIRE

    VERLOOVE, F

    2013-01-01

    Se propone correcciones taxonómicas y nomenclaturales respecto a 88 taxones no nativos de la lista de plantas vasculares de las Islas Canarias (España). Non-native vascular plants from Canary Islands (Spain): nomenclatural and taxonomical adjustments. Corrections and other adjustments are proposed for 88 non-native taxa from the checklist of vascular plants from the Canary Islands (Spain).

  1. Stroke and Native Hawaiians/Pacific Islanders

    Science.gov (United States)

    ... Population Profiles > Native Hawaiian/Other Pacific Islander > Stroke Stroke and Native Hawaiians/Pacific Islanders Native Hawaiians/Pacific ... non-Hispanic white adults to die from a stroke in 2010. In general, Native Hawaiian/Pacific Islander ...

  2. ¿Se desindustrializa Brasil?

    Directory of Open Access Journals (Sweden)

    Fernando Mattos

    2014-01-01

    Full Text Available Este estudio pretende retomar algunos temas específicos del debate sobre la desindustrialización en Brasil, así como también, apunta a recordar algunos aspectos del debate teórico-histórico sobre la desindustrialización, presente en la literatura sobre desarrollo económico. En la primera parte, se destacan algunos elementos del referido debate presentes en la literatura especializada, discutiendo aspectos teóricos de la formulación kaldoriana que destacan el papel del crecimiento industrial y de la mudanza estructural en el crecimiento de las economías capitalistas. En la segunda, son organizados y analizados algunos indicadores recientes del desempeño del sector industrial brasileño. Finalmente, se ofrecen algunas breves notas conclusivas.

  3. Diffuse soil CO_2 degassing from Linosa island

    Directory of Open Access Journals (Sweden)

    Dario Cellura

    2014-06-01

    Full Text Available Normal 0 14 false false false MicrosoftInternetExplorer4 Normal 0 14 false false false IT X-NONE X-NONE MicrosoftInternetExplorer4 Herein, we present and discuss the result of 148 measurements of soil CO2 flux performed for the first time in Linosa island (Sicily Channel, Italy, a Plio-Pleistocene volcanic complex no longer active but still of interest owing to its location within a seismically active portion of the Sicily Channel rift system. The main purpose of this survey was to assess the occurrence of CO2 soil degassing, and compare flux estimations from this island with data of soil degassing from worldwide active volcanic as well as non-volcanic areas. To this aim soil CO2 fluxes were measured over a surface of about 4.2 km2 covering ~80% of the island. The soil CO2 degassing was observed to be mainly concentrated in the eastern part of the island likely due to volcano-tectonic lineaments, the presence of which is in good agreement with the known predominant regional faults system. Then, the collected data were interpreted using sequential Gaussian simulation that allowed estimating the total CO2 emissions of the island. Results show low levels of CO2 emissions from the soil of the island (~55 ton d-1 compared with CO2 emissions of currently active volcanic areas, such as Miyakejima (Japan and Vulcano (Italy. Results from this study suggest that soil degassing in Linosa is mainly fed by superficial organic activity with a moderate contribution of a deep CO2 likely driven by NW-SE trending active tectonic structures in the eastern part of the island.

  4. THE STRENGTH OF THE DISSOLVED OXYGEN MAXIMUM IN THE VERTICAL DISTRIBUTION OF N ANSHA ISLANDS WATERS

    Institute of Scientific and Technical Information of China (English)

    林洪瑛; 程赛伟; 韩舞鹰

    2002-01-01

    Observation data from a cruise in the Nansha Islands, in May to June 1990, Decem ber, 1993, September to October 1994, and July, 1999, respectively, were used to develop the method presented here to indicate the existing strength of the diss ol ved oxygen maximum in the vertical distribution of Nansha Islands waters. Its se asonal variation and regional distribution are discussed in this paper. Analysis results showed that the distribution of the strength of dissolved oxygen maximum (Domax-Dosur) was closely related to the upper layer circulation and the bioactivity of Nansha Islands seawater.

  5. An Island Called Cuba

    Directory of Open Access Journals (Sweden)

    Jean Stubbs

    2011-06-01

    Full Text Available Review of: An Island Called Home: Returning to Jewish Cuba. Ruth Behar, photographs by Humberto Mayol. New Brunswick NJ: Rutgers University Press, 2007. xiii + 297 pp. (Cloth US$ 29.95 Fidel Castro: My Life: A Spoken Autobiography. Fidel Castro & Ignacio Ramonet. New York: Scribner/Simon & Schuster, 2008. vii + 724 pp. (Paper US$ 22.00, e-book US$ 14.99 Cuba: What Everyone Needs to Know. Julia E. Sweig. New York: Oxford University Press, 2009. xiv + 279 pp. (Paper US$ 16.95 [First paragraph] These three ostensibly very different books tell a compelling story of each author’s approach, as much as the subject matter itself. Fidel Castro: My Life: A Spoken Autobiography is based on a series of long interviews granted by the then-president of Cuba, Fidel Castro, to Spanish-Franco journalist Ignacio Ramonet. Cuba: What Everyone Needs to Know, by U.S. political analyst Julia Sweig, is one of a set country series, and, like Ramonet’s, presented in question/answer format. An Island Called Home: Returning to Jewish Cuba, with a narrative by Cuban-American anthropologist Ruth Behar and photographs by Cuban photographer Humberto Mayol, is a retrospective/introspective account of the Jewish presence in Cuba. While from Ramonet and Sweig we learn much about the revolutionary project, Behar and Mayol convey the lived experience of the small Jewish community against that backdrop.

  6. Enjebi Island dose assessment

    International Nuclear Information System (INIS)

    We have updeated the radiological dose assessment for Enjebi Island at Enewetak Atoll using data derived from analysis of food crops grown on Enjebi. This is a much more precise assessment of potential doses to people resettling Enjebi Island than the 1980 assessment in which there were no data available from food crops on Enjebi. Details of the methods and data used to evaluate each exposure pathway are presented. The terrestrial food chain is the most significant potential exposure pathway and 137Cs is the radionuclide responsible for most of the estimated dose over the next 50 y. The doses are calculated assuming a resettlement date of 1990. The average wholebody maximum annual estimated dose equivalent derived using our diet model is 166 mremy;the effective dose equivalent is 169 mremy. The estimated 30-, 50-, and 70-y integral whole-body dose equivalents are 3.5 rem, 5.1 rem, and 6.2 rem, respectively. Bone-marrow dose equivalents are only slightly higher than the whole-body estimates in each case. The bone-surface cells (endosteal cells) receive the highest dose, but they are a less sensitive cell population and are less sensitive to fatal cancer induction than whole body and bone marrow. The effective dose equivalents for 30, 50, and 70 y are 3.6 rem, 5.3 rem, and 6.6 rem, respectively. 79 refs., 17 figs., 24 tabs

  7. Solomon Islands : Health Financing Options

    OpenAIRE

    Somanathan, Aparnaa

    2010-01-01

    The objective of this Policy Note is to provide an assessment of available options for financing health care in the Solomon Islands. In doing so, the analysis will factor in the country-specific economic, social and political factors, which will ultimately influence the performance of the health financing mechanisms. The Note was motivated by the Solomon Islands Government s (SIG) interest...

  8. The Museum of Piano Island

    Institute of Scientific and Technical Information of China (English)

    LURUCAI

    2004-01-01

    GULANGYU, the island of pianos in southeast Xiamen, has more than 500 pianos. In the island's Shuzhuang Garden is the Gulangyu Piano Museum.Spread out over 2,000 square meters of land, the museum has on exhibit more than 70 pianos from the UK, France, Germany and Austria.

  9. Islanded operation of distributed networks

    International Nuclear Information System (INIS)

    This report summarises the findings of a study to investigate the regulatory, commercial and technical risks and benefits associated with the operation of distributed generation to power an islanded section of distributed network. A review of published literature was carried out, and UK generators were identified who could operate as part of an island network under the existing technical, regulatory, and safety framework. Agreement on case studies for consideration with distributed network operators (DNOs) is discussed as well as the quantification of the risks, benefits and costs of islanding, and the production of a case implementation plan for each case study. Technical issues associated with operating sections of network in islanded mode are described, and impacts of islanding on trading and settlement, and technical and commercial modelling are explored

  10. Islanded operation of distributed networks

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    This report summarises the findings of a study to investigate the regulatory, commercial and technical risks and benefits associated with the operation of distributed generation to power an islanded section of distributed network. A review of published literature was carried out, and UK generators were identified who could operate as part of an island network under the existing technical, regulatory, and safety framework. Agreement on case studies for consideration with distributed network operators (DNOs) is discussed as well as the quantification of the risks, benefits and costs of islanding, and the production of a case implementation plan for each case study. Technical issues associated with operating sections of network in islanded mode are described, and impacts of islanding on trading and settlement, and technical and commercial modelling are explored.

  11. First principles studies of the oxygen reduction reaction on Se-Ru nanostructures

    Science.gov (United States)

    Zuluaga, Sebastian; Stolbov, Sergey

    2011-03-01

    Experiments show an enhanced rate of the oxygen reduction reaction (ORR) on Se-Ru nanostructures (NS) in hydrogen fuel cell cathodes. We use first principles methods to study Ru and Se-Ru NS of approximate 1.2 nm size and shine some light on how the Se affects the O and OH adsorption, which is the bottle neck of the power delivered by the fuel cell. Experiments shows that the Se-Ru NS have a Ru core but is not clear how the Se is distributed on the surface. Our calculation shows that the Se atom adsorbs on the Ru surface with a binding energies in the range 5.7 to 7.1 eV with electronic charge transfer from the Ru atoms. Due to repulsion between negatively charged Se atoms, they tend to spread uniformly over the the Ru NS rather than form islands on its surface. We have also found that, in contrast to the flat Ru surface, the Se bond to the low coordinated Ru atoms have significant covalent component. Our calculation shows how the presence of Se atoms affects the adsorption of the ORR intermediates on the NS. In particular, we show that the electrostatic repulsion between charged Se and O or OH reduces the binding energy of the latters.

  12. H-deficient blood groups ( Bombay) of Reunion Island.

    Science.gov (United States)

    Gerard, G; Vitrac, D; Le Pendu, J; Muller, A; Oriol, R

    1982-11-01

    Forty-two H-deficient individuals (lacking H antigen on erythrocytes) with anti-H in their sera were found on Reunion Island. A, B, and AB Bombay subjects had small but detectable amounts of A and/or B antigens on erythrocytes. All the H-deficient phenotypes tested were nonsecretors of ABH in their saliva, and one-third were Lewis negative. Fifty-three of the 108 (49%) unaffected members in the 14 Bombay pedigrees analyzed were se/se, showing that the families were selected for the nonsecretor trait, and suggesting that the Bombay probands used to select the families have se/se genotype. In accordance with this concept, all the children from Bombay nonsecretor x unaffected nonsecretor matings were se/se. Segregation of H and Se is compatible with the genetic model proposing that Se and H are closely linked structural genes, and the analysis of the present and previously published Bombay pedigrees strongly supports this model.

  13. Energy Self-Sufficient Island

    International Nuclear Information System (INIS)

    In order to analyze energy self-sufficient island, example of a smaller island, connected to the power system of a bigger island with an undersea cable, was taken. Mounting substation 10/0,4 is situated on the island and for the moment it provides enough electricity using the medium voltage line. It is assumed that the island is situated on the north part of the Adriatic Sea. The most important problem that occurs on the island is the population drop that occurs for a significant number of years, therefore, life standard needs to be improved, and economic development needs to be encouraged immediately. Local authorities to stimulate sustainable development on the island through different projects, to breath in a new life to the island, open new jobs and attract new people to come live there. Because of the planned development and increase of the population, energy projects, planned as a support to sustainable development, and later achievement of the energy self-sufficiency, is described in this paper. Therefore, Rewisland methodology appliance is described taking into the account three possible scenarios of energy development. Each scenario is calculated until year 2030. Also, what is taken into the account is 100% usage of renewable sources of energy in 2030. Scenario PTV, PP, EE - This scenario includes installation of solar photovoltaic modules and solar thermal collectors on the buildings roofs, as well as well as implementation of energy efficiency on the island (replacement of the street light bulbs with LED lightning, replacement of the old windows and doors on the houses, as well as the installation of the thermal insulation). Scenario PV island - This scenario, similarly to the previous one, includes installation of solar photovoltaic modules and solar thermal collectors an the residential buildings, as well as the 2 MW photovoltaic power plant and ''Green Hotel'', a building that satisfies all of its energy needs completely from renewable energy sources

  14. A transferable force field for CdS-CdSe-PbS-PbSe solid systems

    NARCIS (Netherlands)

    Fan, Zhaochuan; Koster, Rik S.; Wang, Shuaiwei; Fang, Changming; Yalcin, Anil O.; Tichelaar, Frans D.; Zandbergen, Henny W.; van Huis, Marijn A.; Vlugt, Thijs J. H.

    2014-01-01

    A transferable force field for the PbSe-CdSe solid system using the partially charged rigid ion model has been successfully developed and was used to study the cation exchange in PbSe-CdSe heteronanocrystals [A. O. Yalcin et al., "Atomic resolution monitoring of cation exchange in CdSe-PbSe heterona

  15. Main: SE1PVGRP18 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE1PVGRP18 S000288 10-Feb-2000 (last modified) seki SE1 (Stem element 1) found in the bean (P.v.) grp1...ecifically; See S000289, S000101 (SE2); SE1; grp1.8; vascular; stem; shoot; bean (Phaseolus vulgaris) ATAATGGGCCACACTGTGGGGCAT ...

  16. Main: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available SE2PVGRP1 S000101 17-May-1998 (last modified) kehi SE2 (stem element 2) of bean (P.v.) GRP1....8 gene; part of SE2 element; stem; SE2; GRP; GRP1; bean (Phaseolus vulgaris) TTNNNGTAGCTAGTGTATTTGTAT ...

  17. Global Collembola on Deception Island.

    Science.gov (United States)

    Greenslade, Penelope; Potapov, Mikhail; Russell, David; Convey, Peter

    2012-01-01

    Three new non-indigenous springtail species are recorded in recent collections made on Deception Island, South Shetland Islands, maritime Antarctic: Deuteraphorura (Deuteraphorura) cebennaria (Gisin) (Collembola: Onychiuridae), Mesaphorura macrochaeta Rusek (Tullbergiidae), and Proisotoma minuta Axelson (Isotomidae). One of these, D. (D.) cebennaria, is described. Additionally, two new indigenous species, Mesaphorura macrochaeta Rusek and Proisotoma minuta Axelson, are also recorded. The total number of Collembola species now known from the island is 14, comprised of eight native species and six non-indigenous species. This number of non-indigenous species recorded at Deception Island compares with only a single non-indigenous springtail recorded at any other maritime or continental Antarctic location. The reason underlying this high level of occurrence of non-indigenous species on Deception Island is likely to be a combination of the island's high level of human visitation and the presence of relatively benign terrestrial habitats associated with areas of geothermal activity. Two of the new records represent species recently assessed as being of the highest risk to become invaders in the less extreme environments of the subantarctic, thereby emphasising the importance and urgency of adopting and applying effective biosecurity measures to protect the unique and vulnerable ecosystems of this region. Also documented are the impacts on the soil fauna of the island from human trampling, which drastically reduced densities of both native and non-indigenous species to 1% of the abundance typical of non-trampled sites. PMID:23438196

  18. Investigation of the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K

    Energy Technology Data Exchange (ETDEWEB)

    Gulay, L.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine)]. E-mail: gulay@lab.univer.lutsk.ua; Olekseyuk, I.D. [Department of General and Inorganic Chemistry, Volyn State University, Voli Aveune 13, 43009 Lutsk (Ukraine); Wolcyrz, M. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Stepien-Damm, J. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland); Pietraszko, A. [W. Trzebiatowski Institute of Low Temperature and Structure Research, Polish Academy of Sciences, Okolna Str. 2, P.O. Box 1410, 50-950 Wroclaw (Poland)

    2006-06-08

    The interactions between the components in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe and Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe systems at 870K were determined using X-ray single crystal and powder diffraction. The existence of the compounds with compositions RCuSe{sub 2}-R{sub 2/3}Cu{sub 2}Se{sub 2}(Er{sub 2/3}Cu{sub 2}S{sub 2} structure type, space group P3-bar , a=0.40563(1)nm, c=0.64542(3)nm, R{sub I}=0.0737 for HoCuSe{sub 2} and a=0.40407(1)nm, c=0.64420(3)nm, R{sub I}=0.0660 for ErCuSe{sub 2}) and RCu{sub 5}Se{sub 4} (unknown structure) was confirmed in the R{sub 2}Se{sub 3}-Cu{sub 2}Se (R=Ho, Er) sections. The existence of the compounds Ho{sub 6}Pb{sub 2}Se{sub 11} (Y{sub 6}Pb{sub 2}Se{sub 11} structure type, space group Cmcm, a=0.40561(2)nm, b=1.34018(6)nm, c=3.7525(1)nm) and Er{sub 2}PbSe{sub 4} (CaFe{sub 2}O{sub 4} structure type, space group Pnma, a=1.2554(2)nm, b=0.40778(5)nm, c=1.4885(2)nm, R{sub I}=0.0914) was confirmed in the R{sub 2}Se{sub 3}-PbSe (R=Ho, Er) sections. The existence of the compounds Ho{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35314(8)nm, b=0.40819(2)nm, c=1.25609(7)nm, {beta}=104.577(3){sup o}) and HoCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.0516(2)nm, b=0.40470(8)nm, c=1.3410(3)nm, R{sub 1}=0.0541) in the Ho{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed. The formation of the compounds Er{sub 5}CuPb{sub 3}Se{sub 11} (Er{sub 5}CuPb{sub 3}Se{sub 11} structure type, space group Cmcm, a=0.40688(2)nm, b=1.34607(7)nm, c=3.8040(2)nm), Er{sub 3.33}CuPb{sub 1.5}Se{sub 7} (Lu{sub 3.33}CuPb{sub 1.5}Se{sub 7} structure type, space group Cm, a=1.35018(7)nm, b=0.40693(2)nm, c=1.25433(6)nm, {beta}=104.492(2){sup o}) and ErCuPbSe{sub 3} ({beta}-BaLaCuSe{sub 3} structure type, space group Pnma, a=1.04846(8)nm, b=0.40424(3)nm, c=1.34143(7)nm) in the Er{sub 2}Se{sub 3}-Cu{sub 2}Se-PbSe system was confirmed.

  19. Contrasting food web factor and body size relationships with Hg and Se concentrations in marine biota.

    Directory of Open Access Journals (Sweden)

    Roxanne Karimi

    Full Text Available Marine fish and shellfish are primary sources of human exposure to mercury, a potentially toxic metal, and selenium, an essential element that may protect against mercury bioaccumulation and toxicity. Yet we lack a thorough understanding of Hg and Se patterns in common marine taxa, particularly those that are commercially important, and how food web and body size factors differ in their influence on Hg and Se patterns. We compared Hg and Se content among marine fish and invertebrate taxa collected from Long Island, NY, and examined associations between Hg, Se, body length, trophic level (measured by δ(15N and degree of pelagic feeding (measured by δ(13C. Finfish, particularly shark, had high Hg content whereas bivalves generally had high Se content. Both taxonomic differences and variability were larger for Hg than Se, and Hg content explained most of the variation in Hg:Se molar ratios among taxa. Finally, Hg was more strongly associated with length and trophic level across taxa than Se, consistent with a greater degree of Hg bioaccumulation in the body over time, and biomagnification through the food web, respectively. Overall, our findings indicate distinct taxonomic and ecological Hg and Se patterns in commercially important marine biota, and these patterns have nutritional and toxicological implications for seafood-consuming wildlife and humans.

  20. Contrasting food web factor and body size relationships with Hg and Se concentrations in marine biota.

    Science.gov (United States)

    Karimi, Roxanne; Frisk, Michael; Fisher, Nicholas S

    2013-01-01

    Marine fish and shellfish are primary sources of human exposure to mercury, a potentially toxic metal, and selenium, an essential element that may protect against mercury bioaccumulation and toxicity. Yet we lack a thorough understanding of Hg and Se patterns in common marine taxa, particularly those that are commercially important, and how food web and body size factors differ in their influence on Hg and Se patterns. We compared Hg and Se content among marine fish and invertebrate taxa collected from Long Island, NY, and examined associations between Hg, Se, body length, trophic level (measured by δ(15)N) and degree of pelagic feeding (measured by δ(13)C). Finfish, particularly shark, had high Hg content whereas bivalves generally had high Se content. Both taxonomic differences and variability were larger for Hg than Se, and Hg content explained most of the variation in Hg:Se molar ratios among taxa. Finally, Hg was more strongly associated with length and trophic level across taxa than Se, consistent with a greater degree of Hg bioaccumulation in the body over time, and biomagnification through the food web, respectively. Overall, our findings indicate distinct taxonomic and ecological Hg and Se patterns in commercially important marine biota, and these patterns have nutritional and toxicological implications for seafood-consuming wildlife and humans. PMID:24019976

  1. Se metallomics during lactic fermentation of Se-enriched yogurt.

    Science.gov (United States)

    Palomo, María; Gutiérrez, Ana M; Pérez-Conde, M Concepción; Cámara, Carmen; Madrid, Yolanda

    2014-12-01

    Selenium biotransformation by lactic acid bacteria during the preparation of Se-enriched yogurt was evaluated. The study focused on the distribution of selenium in the aqueous soluble protein fraction and the detection of selenoamino acids. Screening of selenium in Tris-buffer-urea soluble fraction was carried out by sodium dodecyl sulphate polyacrylamide gel electrophoresis after pre-fractionating with asymmetric field flow fractionation using inductively coupled plasma-mass spectrometry as the detector. Selenium-containing fractions were identified by peptide mapping using nano LC-ESI/LTQMS. Proteins such as thioredoxin, glutaredoxin, albumin, β-lactoglobulin, and lactoperoxidase were identified in the selenium-containing fraction. All these proteins were detected in both the control and the selenium-enriched yogurt except chaperones, which were only detected in the control samples. Chaperones are heat-shock proteins expressed in response to elevated temperature or other cellular stresses. Selenium may have an effect on chaperones expression in Lactobacillus. For the amino acids analysis, selenocysteine was the primary seleno-containing species.

  2. Se equivocó el masoreta ¿se equivocaba?

    Directory of Open Access Journals (Sweden)

    Fernández Tejero, Emilia

    2009-12-01

    Full Text Available This article has a didactic purpose; it is not aimed at scholars of the Masora but rather at researchers in closely associated areas. The editions of Hebrew Biblical manuscripts and critical studies that have been published recently are particularly useful tools for those who wish to delve into other areas of research such as the history of the Hebrew Biblical text, its exegesis or the origins of grammar. Here, the author concentrates on the analysis of three issues: variant formulations of a same information; coherence between a text and its Masorah, and the possible discrepancies among sources.

    Este artículo, de carácter didáctico, no está destinado a los estudiosos de la Masora, sino a investigadores de áreas cercanas. Las ediciones de manuscritos y los estudios publicados en los últimos años son instrumentos de gran utilidad para quienes deseen adentrarse en un campo de investigación con repercusión en otras áreas tales como la historia del texto bíblico hebreo, su exégesis o los inicios de la gramática. Se analizan tres cuestiones: distinta formulación para una misma noticia, coherencia entre un texto y su masora y posibles discrepancias entre las fuentes.

  3. WATER TEMPERATURE and DEPTH - SENSOR collected from OSCAR ELTON SETTE in main Hawaiian Islands from 2008-07-11 to 2008-07-29 (NCEI Accession 0155892)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID SE 08-06). XBT casts...

  4. WATER TEMPERATURE, DISSOLVED OXYGEN, and others collected from OSCAR ELTON SETTE in main Hawaiian Islands from 2008-07-11 to 2008-07-29 (NCEI Accession 0155891)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — CTD data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID: SE 08-06). CTD casts...

  5. Three Mile Island Accident Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Three Mile Island Accident Data consists of mostly upper air and wind observations immediately following the nuclear meltdown occurring on March 28, 1979, near...

  6. Synthesizing knowledge of ocean islands

    Science.gov (United States)

    Jefferson, Anne J.; Lees, Jonathan M.; McClinton, Tim

    2011-11-01

    AGU Chapman Conference on the Galápagos as a Laboratory for the Earth Sciences; Puerto Ayora, Galápagos, Ecuador, 25-30 July 2011 An inspiration for Darwin's theory of evolution, the Galápagos Islands and surrounding waters are a natural laboratory for a wide range of Earth science topics. The Galápagos are perfectly situated for geophysical and geochemical investigations of deep-Earth processes at a hot spot, and proximity to a spreading center allows exploration of hot spot-ridge interactions. Several highly active volcanoes show rapid deformation facilitating investigation of melt transport paths and volcanic structure. The islands exhibit a range of ages, eruptive styles, and climatic zones that allow analysis of hydrogeologic and geomorphic processes. The Galápagos Islands are a World Heritage Site and are an ideal setting for developing an integrated biological and geological understanding of ocean island evolution.

  7. Papahanaumokuakea - Laysan Island Restoration 2009

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This project will support restoration activities at Laysan Island. Staff and volunteers continue efforts to eradicate alien invasive species such as Indian dropseed...

  8. Papahanaumokuakea - Laysan Island Restoration 2011

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This project supports restoration activities at Laysan Island. Staff and volunteers continue efforts to eradicate alien invasive species such as Indian dropseed...

  9. Hawaiian Islands Wilderness proposal : Synopsis

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is a synopsis of the Hawaiian Islands Wilderness proposal. It covers information such as the location of the proposed area, management the wilderness...

  10. Ship impact against protection islands

    DEFF Research Database (Denmark)

    Pedersen, Preben Terndrup

    1997-01-01

    The five most exposed piers and the anchor blocks on the East Bridge shall be protected by aritificial islands. Extensive analytical and experimental investitations were carried out to verify the efficiency of how these protection works....

  11. Popham Buys St. Vincent Island

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — An announcement has recently been made that William Lee Popham has purchased an option on Saint Vincent Island including all of the water bottoms legally belonging...

  12. Hawaiian Islands Wilderness proposal announcement

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document is a letter from the Bureau of Sport Fisheries and Wildlife stating that documents pertaining to the Hawaiian Islands Wilderness proposal have been...

  13. Papahanaumokuakea - Laysan Island Restoration 2010

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The Goal of the Laysan Island Restoration is to restore Laysan to a "Pristine" state which would require minimal monitoring and habitat for Endemic Endangered...

  14. Krakatau: genetic consequences of island colonization

    OpenAIRE

    Parrish, Tracey Louise

    2003-01-01

    This research has examined the genetic consequences of colonization in five tree species on the Krakatau islands, Indonesia after habitat had been destroyed over a century earlier by extreme volcanic events. The Krakatau islands provide a unique, well-documented example of island colonization in the tropics. The islands are continental and lay approximately midway between Java and Sumatra; the nearest points on these landmassess to the islands being approximately 41 and 31 km, respectively. C...

  15. Solomon Islands national situation analysis

    OpenAIRE

    Govan, H.; Schwarz, A.M.; Harohau, D.; Oeta, J.

    2013-01-01

    The CGIAR Research Program on Aquatic Agricultural Systems (CRP AAS) was approved by the CGIAR Fund Council in July, 2011. Solomon Islands, one of five countries targeted by the program, began its rollout with a five month planning phase between August and December of 2011. Subsequent steps of the Program rollout include scoping, diagnosis and design. This report is the first to be produced during the scoping phase in Solomon Islands; it addresses the national setting and provides basic infor...

  16. Oceanographic Survey in waters of the Northern Mariana Islands, Guam, and Micronesia (SE1003, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goals of the cruise were to collect acoustic backscatter and oceanographic data at the vicinity of CNMI, Guam, and in the northern part of Micronesia. Data...

  17. Marine geological study of the continental shelf around Heugsan island, SE Korea

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Chi Won; Jin, Jae Hwa; Shin, Won Cheol; Kim, Won Sik; Kim, Jung Ki; Kim, Sang Woo; Lee, Ho Yong; Chang, Cheong Hae; Kim, Sung Woo; Lee, Yoon Oh; Park, Young Soo; Bahng, Hyo Ky [Korea Inst. of Geology Mining and Materials, Taejon (Korea, Republic of)

    1995-12-01

    This annual report is a result of marine geological and geophysical surveys conducted in 1995 to obtain a variety of data available for mapping Korean continental shelf geology. The study area is situated off city of Mokpo, comprising a rectangle enclosed by lines connecting between 34 degree 30`N and 35 degree 00`N, and between 125 degree 00`E and 126 degree 00`E. Geophysical surveys included water-depth sounding, sea floor side scanning, 3.5 khz sub-bottom profiling, air gun seismic reflection profiling and measurement of total magnetic intensity. During geological terms, 102 grab samples were collected from a grid of 4 miles x 4 miles spaced on the sea floor, and 31 sediment cores were raised from the proper sites determined by preliminary interpretation of geophysical data. The survey vessel, R/V Tamhae, was positioned by a GPS system (Loran-GPS 10X; Trimble Navigation Co.). The sea floor is largely covered with seven distinct types of surface and near-surface sediments; (1) massive sand, (2) homogeneous clay, (3) laminated silt, (4) bioturbated muddy sand, (5) massive silt, (6) bioturbated gravelly muddy sand, and (7) shell aggregate. Based on synthetic interpretation of high-resolution (3.5 khz) seismic data and correlated sedimentary facies, the shallow substratum comprises low-stand, transgressive and high-stand systems tracts (LST, TST and HST, respectively) formed during the last glacio-eutectics regression and transgression. Air gun seismic profiles show that pre-Pleistocene sediments comprise 4 sequences designated as B, C, D, and E, respectively. (author). 63 refs.

  18. Cetacean Ecology Survey at North Western Hawaiian Islands (SE1303, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goal of the cruise was to collect data on the abundance, distribution, stock structure, and habitat of cetaceans in the Papah?naumoku?kea Marine National...

  19. Eco-geomorphic processes that maintain a small coral reef island: Ballast Island in the Ryukyu Islands, Japan

    Science.gov (United States)

    Kayanne, Hajime; Aoki, Kenji; Suzuki, Takuya; Hongo, Chuki; Yamano, Hiroya; Ide, Yoichi; Iwatsuka, Yuudai; Takahashi, Kenya; Katayama, Hiroyuki; Sekimoto, Tsunehiro; Isobe, Masahiko

    2016-10-01

    Landform changes in Ballast Island, a small coral reef island in the Ryukyu Islands, were investigated by remote sensing analysis and a field survey. The area of the island almost doubled after a mass coral bleaching event in 1998. Coral branches generated by the mass mortality and broken by waves were delivered and stocked on a reef flat and accumulated to expand the area of the island. In 2012 high waves generated by typhoons also changed the island's topography. Overall, the island moved in the downdrift direction of the higher waves. Waves impacting both sides of the island piled up a large volume of coral gravels above the high-tide level. Eco-geomorphic processes, including a supply of calcareous materials from the corals on the same reef especially during stormy wave conditions, were key factors in maintaining the dynamic topographic features of this small coral reef island.

  20. of Canary Islands

    Directory of Open Access Journals (Sweden)

    Eduardo Parra López

    2006-01-01

    Full Text Available La ultraperiferia añade a los problemas inherentes a la insularidad los derivados de la lejanía respecto a los principales centros de aprovisionamiento, la considerable escasez de recursos, la fragmentación del territorio, y por tanto, de los mercados. En las últimas décadas se ha ido tomando conciencia del impacto de la ultraperiferia sobre el desarrollo de las regiones y estados insulares. La ultraperiferia es un atributo geográfico que condiciona las opciones de desarrollo y el tipo de especialización de las economías, afecta a la competitividad y a las estrategias empresariales. El agroturismo es una de las actividades que está adquiriendo mayor relevancia en el marco de la diversificación de las explotaciones agrarias, agropecuarias y del turismo. Por ello, la necesidad de activar económicamente las zonas rurales de territorios insulares ultraperiféricos, así como la valorización de las producciones agrarias y agropecuarias vinculadas a la actividad turística, se presentan como elementos vitales para estrategias de diversificación, transformación y mejora de la competitividad y calidad de las mismas. El presente trabajo tiene como objetivo analizar los cambios y el posible impacto que supone la incorporación del agroturismo como una alternativa al turismo de sol y playa, de incremento de rentas de las familias, del desarrollo rural y de nuevas formas de turismo. Se pretende establecer un análisis estratégico del agroturismo, analizar el lado de la oferta y demanda, para sentar la base de las razones de fomentar esta actividad.

  1. Aleutian Canada goose transplant from Buldir Island to Agattu Island, Aleutian Islands, Alaska, summer 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Geese were captured on Buldir Island by searching the upper and lower edge of the lowland tall plant association where tall plants offer cover and short plants...

  2. Measurement of the static quadrupole moments of the first 2+ states in 76Se, 78Se, 80Se and 82Se

    International Nuclear Information System (INIS)

    The reorientation effect in Coulomb excitation was employed to measure the static quadrupole moments of the first 2+ excited states in 76Se, 78Se, 80Se, and 82Se. Beams of 4He and 16O were used on thin highly enriched targets and the resulting spectra of the well resolved backward elastic and inelastic scattered particles were detected by four surface-barrier detectors. For constructive interference via the second 2+ excited states the determined quadrupole moments are: -0.34 +- 0.07 e . b for 76Se; -0.26 +- 0.09 e . b for 78Se; -0.31 +- 0.07 e . b for 80Se; -0.22 +- 0.07 e . b for 82Se. (Auth.)

  3. CRED Gridded Bathymetry of Southeast Maro Reef (100-010) in the Northwestern Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — File 100-010b is a 60-m ASCII grid of depth data collected near SE Maro Reef in the Northwestern Hawaiian Islands as of May 2003. This grid has been produced as...

  4. Runoff generation in SE Spain

    Science.gov (United States)

    Dalen, E. N.; Kirkby, M. J.; Chapman, P. J.; Bracken, L. J.

    2007-12-01

    We are working to improve a hydrological model for prediction of runoff in medium-scale semi-arid catchments in SE Spain. The aim is to develop and improve understandings of runoff generation in semi-arid areas and to improve modelling of runoff. Objectives are to investigate the influence of geology, landuse and seasonality on infiltration rates and use remonte sensing (RS) and GIS to classify an area into Hydrologically Similar Surfaces (HYSS) categories. The research includes investigating the impact of different landscape elements on runoff within two 150 km2 catchments, the Rambla Nogalte and the Rambla de Torrealvilla. Most storms within these catchments are of short duration. HYSS are defined as areas with similar1-D (vertical) partitioning of net rainfall between infiltration and overland flow. HYSS are identified from field measurements of soils, micro and macro- topography and infiltration rates; then combined with analysis of multi-spectral airborne RS images. HYSS are selected to minimise internal variability in the relationship between rainfall and local runoff generation and are scaled up to cover larger areas. The overall sampling strategy for measurements has been to undertake constant intensity rainfall simulator measurements within provisional HYSS categories, and to augment this with a large number of minidisk infiltrometer measurements. This strategy captures as much of the variability in the landscape as possible. The wide variability within even small areas has led to the final adoption of only a few large classes that can be effectively distinguished. The final part of the research is to link the spatial partitioning of the two catchments into HYSS with the detailed rainfall records for the areas, and combine these two sets of data into a grid-based model for runoff generation across the area. The applied Green-Ampt modelling approach gave 63 possible combinations of surface properties (9 HYSS) and areas in the Rambla Nogalte each represented

  5. Late Quaternary climate change shapes island biodiversity

    DEFF Research Database (Denmark)

    Weigelt, Patrick; Steinbauer, Manuel; Cabral, Juliano;

    2016-01-01

    Island biogeographical models consider islands either as geologically static with biodiversity resulting from ecologically neutral immigration–extinction dynamics1, or as geologically dynamic with biodiversity resulting from immigration–speciation–extinction dynamics influenced by changes in island...... sea levels3, 4 and caused massive changes in island area, isolation and connectivity5, orders of magnitude faster than the geological processes of island formation, subsidence and erosion considered in island theory2, 6. Consequences of these oscillations for present biodiversity remain unassessed5, 7...

  6. Protection Island and San Juan Islands National Wildlife Refuges: Comprehensive Conservation Plan and San Juan Islands Wilderness Stewardship Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Protection Island and San Juan Islands NWRs for the next 15 years. This plan outlines...

  7. Aleutian Canada goose survey at Alaid and Nizki Islands, Near Island Group, Aleutian Islands, Alaska, spring 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Arctic foxes, introduced to Alaid and Nizki islands in 1911, 1920 and 1935, were removed from the two islands in 1975 and 1976 by means of shooting and trapping...

  8. Bird and mammal abundance at Nizki Island with notes on observations at Alaid Island, Aleutian Islands, Alaska, spring 1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — To document migratory bird use and response following elimination of introduced Arctic foxes from an island in the western Aleutian Islands. Fox elimination from an...

  9. Late Quaternary climate change shapes island biodiversity.

    Science.gov (United States)

    Weigelt, Patrick; Steinbauer, Manuel Jonas; Cabral, Juliano Sarmento; Kreft, Holger

    2016-04-01

    Island biogeographical models consider islands either as geologically static with biodiversity resulting from ecologically neutral immigration-extinction dynamics, or as geologically dynamic with biodiversity resulting from immigration-speciation-extinction dynamics influenced by changes in island characteristics over millions of years. Present climate and spatial arrangement of islands, however, are rather exceptional compared to most of the Late Quaternary, which is characterized by recurrent cooler and drier glacial periods. These climatic oscillations over short geological timescales strongly affected sea levels and caused massive changes in island area, isolation and connectivity, orders of magnitude faster than the geological processes of island formation, subsidence and erosion considered in island theory. Consequences of these oscillations for present biodiversity remain unassessed. Here we analyse the effects of present and Last Glacial Maximum (LGM) island area, isolation, elevation and climate on key components of angiosperm diversity on islands worldwide. We find that post-LGM changes in island characteristics, especially in area, have left a strong imprint on present diversity of endemic species. Specifically, the number and proportion of endemic species today is significantly higher on islands that were larger during the LGM. Native species richness, in turn, is mostly determined by present island characteristics. We conclude that an appreciation of Late Quaternary environmental change is essential to understand patterns of island endemism and its underlying evolutionary dynamics. PMID:27027291

  10. Thermal island destabilization and the Greenwald limit

    Energy Technology Data Exchange (ETDEWEB)

    White, R. B.; Gates, D. A.; Brennan, D. P. [Plasma Physics Laboratory, Princeton University, P.O.Box 451, Princeton, New Jersey 08543 (United States)

    2015-02-15

    Magnetic reconnection is ubiquitous in the magnetosphere, the solar corona, and in toroidal fusion research discharges. In a fusion device, a magnetic island saturates at a width which produces a minimum in the magnetic energy of the configuration. At saturation, the modified current density profile, a function of the flux in the island, is essentially flat, the growth rate proportional to the difference in the current at the O-point and the X-point. Further modification of the current density profile in the island interior causes a change in the island stability and additional growth or contraction of the saturated island. Because field lines in an island are isolated from the outside plasma, an island can heat or cool preferentially depending on the balance of Ohmic heating and radiation loss in the interior, changing the resistivity and hence the current in the island. A simple model of island destabilization due to radiation cooling of the island is constructed, and the effect of modification of the current within an island is calculated. An additional destabilization effect is described, and it is shown that a small imbalance of heating can lead to exponential growth of the island. A destabilized magnetic island near the plasma edge can lead to plasma loss, and because the radiation is proportional to plasma density and charge, this effect can cause an impurity dependent density limit.

  11. Thermal island destabilization and the Greenwald limit

    Science.gov (United States)

    White, R. B.; Gates, D. A.; Brennan, D. P.

    2015-02-01

    Magnetic reconnection is ubiquitous in the magnetosphere, the solar corona, and in toroidal fusion research discharges. In a fusion device, a magnetic island saturates at a width which produces a minimum in the magnetic energy of the configuration. At saturation, the modified current density profile, a function of the flux in the island, is essentially flat, the growth rate proportional to the difference in the current at the O-point and the X-point. Further modification of the current density profile in the island interior causes a change in the island stability and additional growth or contraction of the saturated island. Because field lines in an island are isolated from the outside plasma, an island can heat or cool preferentially depending on the balance of Ohmic heating and radiation loss in the interior, changing the resistivity and hence the current in the island. A simple model of island destabilization due to radiation cooling of the island is constructed, and the effect of modification of the current within an island is calculated. An additional destabilization effect is described, and it is shown that a small imbalance of heating can lead to exponential growth of the island. A destabilized magnetic island near the plasma edge can lead to plasma loss, and because the radiation is proportional to plasma density and charge, this effect can cause an impurity dependent density limit.

  12. Anthropic pressures on Egadi Islands

    International Nuclear Information System (INIS)

    The Egadi Islands, like most Mediterranean islets, have radically changed the traditional lifestyle and the economic development model, based for centuries on the almost self-sufficient resources and production activities, mostly related to the sea (fishing and fish processing) and to the land. During the second half of the 1900., the development of transport radically transformed this model to make smaller islands, at least those closest to the coast, more tightly interconnected and dependent on the mainland. In particular, in Favignana, which is the most populous island and very close to the coast, the traditional activities tourism have led to a strong anthropic pressure concentrated in a few months of the year (summer) on the one hand, and a reduction of the resident population during the winter months on the other, with a serious impact on the care of the land

  13. Turnover of Se in adequately fed chickens using Se-75 as a tracer.

    Science.gov (United States)

    Brandt-Kjelsen, A; Govasmark, E; Haug, A; Salbu, B

    2014-06-01

    Inorganic selenium (Se) in the form of selenite is applied to livestock to avoid Se deficiency. Selenite is, however, an artificial Se source in diets of unsupplemented chickens. It is therefore hypothesized that organic Se sources, such as Se-enriched yeast and wheat, could be a more suitable Se supply in animal nutrition, although information on the transition of Se from organic Se sources in fast-growing chickens is scarce. In this work, chickens were fed a low Se diet (0.27 ± 0.01 mg Se/kg, Se-enriched yeast) until 20 days of age, after which the Se concentration was increased to maximum concentration allowed by the poultry industry in Europe (0.5 p.p.m. Se). At the same time, a daily contribution of carrier-free (75)Se tracer from labelled wheat was administered from day 20 to 27. The chickens showed S and Se homeostasis, as the concentration of S and Se in liver, blood or kidney remained about constant, and steady state of S and Se in the other organs was reached 1 day after the diet shift. The uptake of (75)Se was readily seen in all organs. After 1 week, the depuration of the (75)Se tracer was followed, and biological half-lives and retention in individual organs were determined. The shortest biological half-lives were observed in major metabolic organs, the liver, kidney and pancreas with half-lives close to 4 days. There was a significant (p < 0.05) uptake in lung, brain and muscle that reached steady state when the administration of (75)Se was terminated. The half-life of (75)Se in heart was 9 days and 7 days in blood. The longest half-lives were observed in muscle (12 days), brain and lungs (13 days). All half-lives were shorter than in Se deplete animals.

  14. Low temperature solution-phase growth of ZnSe and ZnSe/CdSe core/shell nanowires

    Science.gov (United States)

    Petchsang, Nattasamon; Shapoval, Liubov; Vietmeyer, Felix; Yu, Yanghai; Hodak, Jose H.; Tang, I.-Ming; Kosel, Thomas H.; Kuno, Masaru

    2011-08-01

    High quality ZnSe nanowires (NWs) and complementary ZnSe/CdSe core/shell species have been synthesized using a recently developed solution-liquid-solid (SLS) growth technique. In particular, bismuth salts as opposed to pre-synthesized Bi or Au/Bi nanoparticles have been used to grow NWs at low temperatures in solution. Resulting wires are characterized using transmission electron microscopy and possess mean ensemble diameters between 15 and 28 nm with accompanying lengths ranging from 4-10 μm. Subsequent solution-based overcoating chemistry results in ZnSe wires covered with CdSe nanocrystals. By varying the shell's growth time, different thicknesses can be obtained and range from 8 to 21 nm. More interestingly, the mean constituent CdSe nanocrystal diameter can be varied and results in size-dependent shell emission spectra.High quality ZnSe nanowires (NWs) and complementary ZnSe/CdSe core/shell species have been synthesized using a recently developed solution-liquid-solid (SLS) growth technique. In particular, bismuth salts as opposed to pre-synthesized Bi or Au/Bi nanoparticles have been used to grow NWs at low temperatures in solution. Resulting wires are characterized using transmission electron microscopy and possess mean ensemble diameters between 15 and 28 nm with accompanying lengths ranging from 4-10 μm. Subsequent solution-based overcoating chemistry results in ZnSe wires covered with CdSe nanocrystals. By varying the shell's growth time, different thicknesses can be obtained and range from 8 to 21 nm. More interestingly, the mean constituent CdSe nanocrystal diameter can be varied and results in size-dependent shell emission spectra. Electronic supplementary information (ESI) available. See DOI: 10.1039/c1nr10176e

  15. The reactivity of [PhP(Se)(mu-Se)]2 and (PhP)3Se2 towards acetylenes and cyanamides: X-ray crystal structures of some P-Se-C and P-Se-C-N heterocycles.

    Science.gov (United States)

    Bhattacharyya, Pravat; Slawin, Alexandra M Z; Woollins, J Derek

    2002-06-17

    Several unusual P-Se-C and P-Se-C-N heterocycles are formed by the reaction of [PhP(Se)(mu-Se)]2 or (PhP)3Se2 with alkynes or cyanamides, generated by the fragmentation of the organophosphorus-selenium compound and addition across the C identical to C or C identical to N triple bond of the organic substrate. X-ray crystallographic analysis reveals an unexpected diversity of structural motifs within these heterocyclic systems, including P2SeCN, P2C2Se and PC2Se2 rings.

  16. Submarine physiography off Lakshadweep Islands, Arabian Sea

    Digital Repository Service at National Institute of Oceanography (India)

    Chauhan, O.S.; Chaubey, A.K.

    Analysis of echosoundings, side scan sonar and shallow seismic data, supplementEd. by 152 sediment samples, collected along 150 km around Lakshadweep Islands, Arabian Sea, revealed that the islands have a very narrow shelf, and an abrupt, shelf...

  17. Champion Island, Galapagos Stable Oxygen Calibration Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Galapagos Coral Stable Oxygen Calibration Data. Sites: Bartolome Island: 0 deg, 17 min S, 90 deg 33 min W. Champion Island: 1 deg, 15 min S, 90 deg, 05 min W....

  18. Bartolome Island, Galapagos Stable Oxygen Calibration Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Galapagos Coral Stable Oxygen Calibration Data. Sites: Bartolome Island: 0 deg, 17'S, 90 deg 33' W. Champion Island: 1 deg, 15'S, 90 deg, 05' W. Urvina Bay (Isabela...

  19. Control and Operation of Islanded Distribution System

    DEFF Research Database (Denmark)

    Mahat, Pukar

    operational challenges. But, on the other hand, it has also opened up some opportunities. One opportunity/challenge is an islanded operation of a distribution system with DG unit(s). Islanding is a situation in which a distribution system becomes electrically isolated from the remainder of the power system...... of power supply provided that various issues with islanding are properly addressed. Some of the issues with islanding are state (islanded or grid connected) detection, control of voltage and frequency, load control and protection. In this dissertation, some of the major technical issues with islanding...... are addressed. A hybrid islanding detection technique, based on the average rate of voltage change and real power shift, is developed to overcome the problems with most of the existing islanding detection techniques. It uses a passive technique (average rate of voltage change) and an active technique (real...

  20. Benthic Mapping in Long Island Sound

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — QTCView is used with an incorporated depthfinder to create a sonar map of the bottom to the west of the Charles Island, in Long Island Sound in Connecticut waters....

  1. Obesity and Native Hawaiians/Pacific Islanders

    Science.gov (United States)

    ... Population Profiles > Native Hawaiian/Other Pacific Islander > Obesity Obesity and Native Hawaiians/Pacific Islanders Native Hawaiians/Pacific ... youthonline . [Accessed 05/25/2016] HEALTH IMPACT OF OBESITY More than 80 percent of people with type ...

  2. Bair Island Restoration Project Monitoring Plan 2003

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Bair Island is located adjacent to the San Francisco Bay in Redwood City, San Mateo County, California (Figure 1). Historically, Bair Island was part of a large...

  3. Bair Island Restoration Project Monitoring Plan 2004

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Bair Island is located adjacent to the San Francisco Bay in Redwood City, San Mateo County, California (Figure 1). Historically, Bair Island was part of a large...

  4. Energy Transition Initiative: Island Energy Snapshot - U.S. Virgin Islands (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-03-01

    This profile provides a snapshot of the energy landscape of the U.S. Virgin Islands (USVI) - St. Thomas, St. John, and St. Croix. The Virgin Islands archipelago makes up the northern portion of the Lesser Antilles and the western island group of the Leeward Islands, forming the border between the Atlantic Ocean and the Caribbean Sea.

  5. 33 CFR 80.720 - St. Simons Island, GA to Amelia Island, FL.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false St. Simons Island, GA to Amelia Island, FL. 80.720 Section 80.720 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Island, GA to Amelia Island, FL. (a) A line drawn from St. Simons Light to the northernmost tank...

  6. Colloidal PbSe/CdSe Heteronanocrystals. Atomic configuration, electronic structure and optical properties

    NARCIS (Netherlands)

    Grodzinska, D.

    2012-01-01

    This thesis focuses on the structural characterization and the opto-electronic properties of PbSe/CdSe core/shell QDs and on the structural and morphological evolution of PbSe/CdSe core/shell QDs upon thermal annealing under vacuum.

  7. Southern California Channel Islands Bibliography, through 1992

    OpenAIRE

    Channel Islands National Marine Sanctuary

    1992-01-01

    The Southern California Channel Islands Bibliography, through 1992, comprises 4035 references to the scientific literature on Southern California's Channel Islands. The Bibliography was compiled by the Channel Islands National Marine Sanctuary and is presented here in a February 1993 version. The Santa Barbara Museum of Natural History presents a California Channel Islands Bibliography on its website. It has more recent references and overlaps considerably with this bibliography. How...

  8. Hydro climatic ranking of small Mediterranean islands

    OpenAIRE

    Ljubenkov, Igor

    2013-01-01

    Islands are specific environments whose natural features form the basis of social and economic development. It is particularly distinct on small islands. In hydrological terms, these are islands with surface areas between 100 and 1000 km2. There are 40 small islands in the Mediterranean Basin. Most of these have very limited water resources, due to their geological structure and precipitation regime. This paper outlines the basic geographical and climatic features of small Mediterranean islan...

  9. Ecology of Great Salt Pond, Block Island

    Science.gov (United States)

    Great Salt Pond is an island of estuarine water on Block Island, which sits in the middle of the Northwest Atlantic Continental Shelf. When the last continental glaciers retreated, they left a high spot on a terminal moraine. The rising sea from melting glaciers formed two island...

  10. Krakatau: genetic consequences of island colonization

    NARCIS (Netherlands)

    Parrish, Tracey Louise

    2003-01-01

    This research has examined the genetic consequences of colonization in five tree species on the Krakatau islands, Indonesia after habitat had been destroyed over a century earlier by extreme volcanic events. The Krakatau islands provide a unique, well-documented example of island colonization in the

  11. Stepping-stones to the Edge: Artistic Expressions of Islandness in an Ocean of Islands

    Directory of Open Access Journals (Sweden)

    Laurie Brinklow

    2013-05-01

    Full Text Available Since the earliest of times, islands have captured the artistic imagination—and, often, for the artist who finds his or her muse in being ‘islanded’, the smaller the island the better. Archipelagos offer an ideal setting for artists who take their inspiration from place: on small islands off islands they can experience an intensity of island living they might not otherwise have on a main island: boundedness and connection, isolation and community. This paper examines expressions of islandness by artists who live on islands off islands that are poles apart—‘archipelagos’ of the Canadian North Atlantic and the Great Southern Ocean. It draws upon interviews with those artists and writers to consider the nature of humans’ attachment and attraction to islands, exploring through the lens of phenomenology what Stratford et al. call the “entanglement between and among islands”.

  12. Li2Se as a Neutron Scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi-TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe

  13. The Ag{sub 2}Se-HgSe-SiSe{sub 2} system in the 0-60 mol.% SiSe{sub 2} region

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D

    2003-01-13

    Phase equilibria in the quasiternary Ag{sub 2}Se-HgSe-SiSe{sub 2} system were investigated using X-ray phase analysis. Its isothermal section at 298 K was constructed. The formation of the quaternary Ag{sub 6}HgSiSe{sub 6} phase was confirmed. The existence of the homogeneity range for this compound at 23-43 mol.% of Hg{sub 4}SiSe{sub 6} (Ag{sub 6.16-4.56}Hg{sub 0.92-1.72}SiSe{sub 6}) was determined. The formation of three new intermediate phases Ag{sub {approx}}{sub 7.04-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.48-{approx}}{sub 0.84}Si= Se{sub 6} ({beta}), Ag{sub {approx}}{sub 3.44-{approx}}{sub 2.96}Hg{sub {approx}}{sub 2.28-{approx}}{sub 2.52}Si= Se{sub 6} ({delta}) and Ag{sub 2}Hg{sub 3}SiSe{sub 6} ({epsilon}) was found. All phases are localized along the Ag{sub 8}SiSe{sub 6}-Hg{sub 4}SiSe{sub 6} section. The crystal structures of the {beta}-phase (for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} composition) and {delta}-phase (for the Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6} composition) were determined. Both phases crystallize with a cubic unit cell (space group F4-bar3m) with the lattice parameters a=1.08806(4) nm and a=1.07108(2) nm for the Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6} and Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6}, respectively. Atomic parameters for them were refined in the anisotropic approximation [R{sub I}=0.0830 (Ag{sub 6.4}Hg{sub 0.8}SiSe{sub 6}) and R{sub I}=0.0950 (Ag{sub 3.2}Hg{sub 2.4}SiSe{sub 6})]. The crystal structure of the {epsilon}-phase is under investigation. The phase diagram of the HgSe-SiSe{sub 2} system was constructed in the range 0-60 mol.% SiSe{sub 2}. It was established that the Hg{sub 4}SiSe{sub 6} compound melts congruently at 1044 K and forms eutectics at {approx}12 mol.% SiSe{sub 2} (1023 K) and {approx}52 mol.% SiSe{sub 2} (961 K)

  14. Extinction debt on oceanic islands

    DEFF Research Database (Denmark)

    Triantis, K.A.; Borges, Paulo A. V.; Ladle, R.J.;

    2010-01-01

    the magnitude of such future extinction events has been hampered by potentially inaccurate assumptions about the slope of species-area relationships, which are habitat- and taxon-specific. We overcome this challenge by applying a method that uses the historical sequence of deforestation in the Azorean Islands...

  15. Palaeotsunamis in the Pacific Islands

    Science.gov (United States)

    Goff, J.; Chague-Goff, C.; Dominey-Howes, D.; McAdoo, B.; Cronin, S.; Bonte-Grapetin, Michael; Nichol, S.; Horrocks, M.; Cisternas, M.; Lamarche, G.; Pelletier, B.; Jaffe, B.; Dudley, W.

    2011-01-01

    The recent 29 September 2009 South Pacific and 27 February 2010 Chilean events are a graphic reminder that the tsunami hazard and risk for the Pacific Ocean region should not be forgotten. Pacific Islands Countries (PICs) generally have short (Elsevier B.V.

  16. 1946 Unimak Island, USA Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — On April 1, 1946, at 12:29 [local time] a rather strong magnitude 7.4 earthquake occurred with source to the south of Unimak Island, causing one of the most...

  17. Date with the Green Island

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ Qingdao,also spelled Tsingtao,iS one of the most beautiful and clean cities in China and with a population of around 2.5 million(7 million regional)is the largest city after Jinan(the capital)in Shandong Province.The name"Qingdao"means "The Green Island".

  18. Island formation and tectonic processes

    NARCIS (Netherlands)

    Draper, G.

    2011-01-01

    Tectonic processes can form an island in one of two ways. 1. Those processes that cause a rise in water levels and flooding a pre-existing topography, known as tectonic flooding. 2. Those processes that cause uplift of the basin floor to form a topography that emerges above water level, called tecto

  19. On a Crowded Desert Island.

    Science.gov (United States)

    Rothstein, Samuel

    1989-01-01

    Suggests reference sources most appropriate for a desert island. In addition to "Robinson Crusoe" (Daniel Defoe) and a reference guide to the literature of travel, the list includes basic books on reference work, guides to reference sources, journals, an almanac, encyclopedias, a guide to English usage, and a book of quotations. (14 references)…

  20. 46 CFR 7.70 - Folly Island, SC to Hilton Head Island, SC.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Folly Island, SC to Hilton Head Island, SC. 7.70 Section... BOUNDARY LINES Atlantic Coast § 7.70 Folly Island, SC to Hilton Head Island, SC. (a) A line drawn from the southernmost extremity of Folly Island to latitude 32°35′ N. longitude 79°58.2′ W. (Stono Inlet Lighted...

  1. The Ag{sub 2}Se-HgSe-GeSe{sub 2} system and crystal structures of the compounds

    Energy Technology Data Exchange (ETDEWEB)

    Parasyuk, O.V.; Gulay, L.D.; Romanyuk, Ya.E.; Olekseyuk, I.D.; Piskach, L.V

    2003-03-10

    The phase diagram of the quasi-ternary Ag{sub 2}Se-HgSe-GeSe{sub 2} system at 298 K was investigated using X-ray phase analysis and metallography. The formation of five intermediate quaternary phases {beta} (Ag{sub {approx}}{sub 7.12-{approx}}{sub 6.32}Hg{sub {approx}}{sub 0.44-{approx}}{sub 0.82}G= eSe{sub 6}), {gamma} (Ag{sub {approx}}{sub 6.08-{approx}}{sub 4.00}Hg{sub {approx}}{sub 0.96-{approx}}{sub 2.00}G= eSe{sub 6}), {delta} (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}), {epsilon} (Ag{sub {approx}}{sub 2.24-{approx}}{sub 2.00}Hg{sub {approx}}{sub 2.88-{approx}}{sub 3.00}G= eSe{sub 6}) and {approx}Ag{sub 1.4}Hg{sub 1.3}GeSe{sub 6} was established. The crystal structure of the {beta}-phase (for the Ag{sub 6.504}Hg{sub 0.912}GeSe{sub 6} composition) was determined using X-ray single crystal diffraction. It crystallizes in a cubic structure (space group F4-bar 3m) with the lattice parameter a=1.09026(4) nm. The crystal structure of the {delta}-phase (Ag{sub 3.4}Hg{sub 2.3}GeSe{sub 6}) was determined using X-ray powder diffraction (space group F4-bar 3m, a=1.07767(8) nm). The crystal structure determination of the {gamma}-phase (space group Pmn2{sub 1}) was performed for the compositions Ag{sub 5.6}Hg{sub 1.2}GeSe{sub 6}, Ag{sub 4.8}Hg{sub 1.6}GeSe{sub 6} and Ag{sub 4}Hg{sub 2}GeSe{sub 6} using X-ray powder diffraction. The crystal structure of the LT-Hg{sub 2}GeSe{sub 4} compound (space group I4-bar , a=0.56786(2), c=1.12579(5) nm) was confirmed by powder diffraction also.

  2. The Structure and Electrical Properties of the Ag2Se + Ga2Se3 + GeSe2 Glass System

    Science.gov (United States)

    Marple, Maxwell Adam Thomas

    Silver containing homogeneous chalcogenide glasses in the ternary system Ag2Se-Ga2Se3-GeSe2 (AGGS) are synthesized and their atomic structure-property relationships are investigated. Structural studies are carried out using Raman, 77Se, 71Ga, 69Ga, and 109Ag nuclear magnetic resonance (NMR) spectroscopy. The structure of these glasses consists primarily of a network of corner sharing (Ga/Ge)Se4/2 tetrahedra with a small fraction of homopolar Se-Se bonds. Compositional modification of the atomic structure follows the charge compensated network model developed in the literature for aluminosilicate glasses. Ag2Se acts as a network modifier, forming non-bridging Se in glasses with Ag/Ga >1, while Ga 2Se3 plays the role of a network intermediate similar to Al2O3 in oxide glasses. The network favors the formation of homopolar Ge-Ge bonding in glasses with Ag/Ga <1, to accommodate the Se deficiency brought by the incorporation of Ga2Se3 with Ga being tetrahedrally coordinated to Se. This structural model is consistent with the variation in the glass transition temperatures and molar volume. Electrical Impedance Spectroscopy (EIS) reveals the ionic conductivity of the AGGS glasses to be quite high at ambient temperature, reaching up to 10 --4 S/cm for glasses with the highest Ag content. Increasing Se deficiency with respect to stoichiometry can enhance the conductivity further to ˜3x10--4 S/cm . Transference number measurements using the electromotive force (EMF) method as well as variable temperature 109Ag NMR line shape studies indicate that the conductivity is predominantly ionic in nature and results from fast hopping dynamics of Ag ions. The high ionic conductivity can be related to a heavily modified structural network that results in a potential energy landscape with many suitable hopping sites for the Ag ions. These structural characteristics and electrical properties of the glasses in the AGGS system may guide in the development of next generation fast ion

  3. Index Balearicum (II): An Annotated check-list of the vascular plants described from the balearic islands. Additions (2002-2007) and corrections

    OpenAIRE

    Roselló Picornell, Josep Antoni; Sáez, Llorenç

    2008-01-01

    Se presentan adiciones y correcciones al listado de plantas vasculares cuyo tipo nomenclatural es originario de las islas Baleares. Se propone una nueva combinación nomenclatural: Sonchus willkommii (Burnat & Barbey) comb. nov. Additions and corrections to the check-list of vascular plants described from the Balearic Islands are presented. A nomenclatural change is proposed: Sonchus willkommii (Burnat & Barbey) comb. nov.

  4. Nanoindentation response of piezoelectric nano-islands

    Science.gov (United States)

    Cheng, Guang; Sriram, Sharath; Bhaskaran, Madhu; Venkatesh, T. A.

    2014-09-01

    Through three-dimensional finite element modeling, it is demonstrated that the nanoindentation response of piezoelectric nano-islands is strongly dependent on the shape of the nano-island and the depth of indentation. For indentations that are relatively deep (i.e., greater than 5% of the height of the islands), the substrate's elastic and plastic properties have a strong influence on the indentation response of piezoelectric nano-islands with substrate plasticity resulting in a significant reduction in the mechanical and electrical indentation stiffness. The predictions of the finite element models compare well with experiments on nano-islands of strontium-doped lead zirconate titanate.

  5. Challenges, advances and perspectives in island biogeography

    Directory of Open Access Journals (Sweden)

    Paulo A.V. Borges

    2016-07-01

    Full Text Available Island biogeographical research is becoming more and more fashionable, with the continuous identification of new challenges that are critical for the advancement of science. In this contribution we identify biases and limitations associated with island biogeographical studies, and also describe recent advances and propose new perspectives. The main proposals include: 1 downscaling island biogeographical studies to local/plot scale; 2 investigating geographical patterns of intra-specific genetic variation to infer dispersal processes among and within islands; 3 using applied biogeographical research to respond to the current island biodiversity crisis; and 4 applying new computer-intensive methods such as artificial intelligence (AI approaches.

  6. Semiconductor-metal transition of Se in Ru-Se Catalyst Nanoparticles

    Science.gov (United States)

    Babu, P. K.; Lewera, Adam; Oldfield, Eric; Wieckowski, Andrzej

    2009-03-01

    Ru-Se composite nanoparticles are promising catalysts for the oxygen reduction reaction (ORR) in fuel cells. Though the role of Se in enhancing the chemical stability of Ru nanoparticles is well established, the microscopic nature of Ru-Se interaction was not clearly understood. We carried out a combined investigation of ^77Se NMR and XPS on Ru-Se nanoparticles and our results indicate that Se, a semiconductor in elemental form, becomes metallic when interacting with Ru. ^77Se spin-lattice relaxation rates are found to be proportional to T, the well-known Korringa behavior characteristic of metals. The NMR results are supported by the XPS binding energy shifts which suggest that a possible Ru->Se charge transfer could be responsible for the semiconductor->metal transition of Se which also makes Ru less susceptible to oxidation during ORR.

  7. Synthesis and characterization of ZnSe:Fe/ZnSe core/shell nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Lin; Zhu, Jianguo, E-mail: yanglin_1028@163.com; Xiao, Dingquan

    2014-04-15

    High-quality ZnSe:Fe/ZnSe core/shell nanocrystals were prepared via a hydrothermal microemulsion technique. Effective surface passivation of monodisperse ZnSe:Fe nanocrystals is achieved by overcoating them with a ZnSe shell. The samples were characterized by means of XRD, EDX, TEM, PSD, XPS, photoluminescence, and Raman spectrum. The results show that the as-synthesized nanocrystals are cubic zinc blende ZnSe structure with high purity and the average particle size of ZnSe:Fe/ZnSe core/shell nanocrystal is larger than that of ZnSe:Fe core. The growth of ZnSe shell causes a small red shift in PL spectra, and then the PL quantum yield (QY) increases from 16% before shell growth to the maximum of 37% after increasing shell thickness up to 1.2 monolayers (ML). Moreover, both transverse optic (TO) and longitudinal optic (LO) phonon modes of ZnSe are shifted toward lower frequency as compared with the reported ones. -- Highlights: • ZnSe:Fe/ZnSe core/shell QDs were prepared by a hydrothermal microemulsion method. • ZnSe shell efficiently passivates surface defects by serving as a physical barrier. • The particle size and PL properties can be turned with the growth of ZnSe shell. • The luminescence efficiency and stability of QDs could be improved in this manner.

  8. Cs3Sm7Se12

    Directory of Open Access Journals (Sweden)

    Christof Schneck

    2012-01-01

    Full Text Available The title compound, tricaesium heptasamarium(III dodecaselenide, is setting a new starting point for realization of the channel structure of the Cs3M7Se12 series, now with M = Sm, Gd–Er. This Cs3Y7Se12-type arrangement is structurally based on the Z-type sesquiselenides M2Se3 adopting the Sc2S3 structure. Thus, the structural set-up of Cs3Sm7Se12 consists of edge- and vertex-connected [SmSe6]9− octahedra [dØ(Sm3+ – Se2− = 2.931 Å], forming a rock-salt-related network [Sm7Se12]3− with channels along [001] that are apt to take up monovalent cations (here Cs+ with coordination numbers of 7 + 1 for one and of 6 for the second cation. The latter cation has a trigonal–prismatic coordination and shows half-occupancy, resulting in an impossible short distance [2.394 (4 Å] between symmetrically coupled Cs+ cations of the same kind. While one Sm atom occupies Wyckoff position 2b with site symmetry ..2/m, all other 11 crystallographically different atoms (namely 2 × Cs, 3 × Sm and 6 × Se are located at Wyckoff positions 4g with site symmetry ..m.

  9. Unrecognized hemoglobin SE disease as microcytosis

    OpenAIRE

    Smith, Avery; Cooper, Barry; Guileyardo, Joseph; Mora, Adan

    2016-01-01

    Hemoglobin SE disease was first described during the 1950s as a relatively benign microcytosis, but increasing prevalence has revealed a predisposition towards vasoocclusive sickling. Recognition of SE hemoglobinopathies’ potential complications is crucial so medical measures can be utilized to avoid multiorgan injury.

  10. 75 FR 51098 - Protection Island and San Juan Islands National Wildlife Refuges, Jefferson, Island, San Juan...

    Science.gov (United States)

    2010-08-18

    ... Register on August 14, 2007 (72 FR 45444), announcing our intent to complete a CCP/EA and inviting public... libraries in northwestern Washington: Anacortes Public Library, Bellingham Public Library, Clinton Public Library, Coupeville Public Library, Evergreen State College Library, Island Public......

  11. Cs2UPd3Se6

    Directory of Open Access Journals (Sweden)

    George N. Oh

    2011-02-01

    Full Text Available Dicaesium uranium(IV tripalladium(II hexaselenide, Cs2UPd3Se6, crystallizes in the space group Fmmm in the Ba2NaCu3O6 structure type. The asymmetric unit comprises the following atoms with site symmetries as shown: U1 (mm2, Cs1 (222, Cs2 (m2m, Pd1 (.m., Pd2 (2mm, Se1 (m.., and Se2 (1. This layered structure contains six edge-sharing square-planar [PdSe4] units that form a hexagon. These, in turn, edge-share with [USe6] trigonal–prismatic units, forming an extended layer parallel to (010. The layers are stacked along [010]. They are staggered, and are separated by the Cs atoms. The Cs atoms are either coordinated in a square antiprism of Se atoms or are ten-coordinate, with one square face and the opposite face hexagonal.

  12. Worldwide patterns of bird colouration on islands.

    Science.gov (United States)

    Doutrelant, Claire; Paquet, Matthieu; Renoult, Julien P; Grégoire, Arnaud; Crochet, Pierre-André; Covas, Rita

    2016-05-01

    Island environments share distinctive characteristics that offer unique opportunities to investigate parallel evolution. Previous research has produced evidence of an island syndrome for morphological traits, life-history strategies and ecological niches, but little is known about the response to insularity of other important traits such as animal signals. Here, we tested whether birds' plumage colouration is part of the island syndrome. We analysed with spectrophotometry the colouration of 116 species endemic to islands and their 116 closest mainland relatives. We found a pattern of reduced brightness and colour intensity for both sexes on islands. In addition, we found a decrease in the number of colour patches on islands that, in males, was associated with a decrease in the number of same-family sympatric species. These results demonstrate a worldwide pattern of parallel colour changes on islands and suggest that a relaxation of selection on species recognition may be one of the mechanisms involved.

  13. Inverter Anti-Islanding with Advanced Grid Support in Single- and Multi-Inverter Islands

    Energy Technology Data Exchange (ETDEWEB)

    Hoke, Andy

    2016-08-16

    As PV and other DER systems are connected to the grid at increased penetration levels, island detection may become more challenging for two reasons: 1. In islands containing many DERs, active inverter-based anti-islanding methods may have more difficulty detecting islands because each individual inverter's efforts to detect the island may be interfered with by the other inverters in the island. 2. The increasing numbers of DERs are leading to new requirements that DERs ride through grid disturbances and even actively try to regulate grid voltage and frequency back towards nominal operating conditions. These new grid support requirements may directly or indirectly interfere with anti-islanding controls. This report describes a series of tests designed to examine the impacts of both grid support functions and multi-inverter islands on anti-islanding effectiveness.

  14. Holocene changes in climate and vegetation in the Ammassalik area, East Greenland, recorded in lake sediments and soil profiles

    DEFF Research Database (Denmark)

    Jakobsen, Bjarne Holm; Fredskild, Bent; Pedersen, Jørn Bjarke Torp

    2008-01-01

    , appears to have experienced the warmest Holocene summer conditions, ice-free seas and limited snow covers. The climate situation seems to have been to a considerable extent based on internal regional meteorological processes and largely without strong and regular cyclonic impacts from lower latitudes...... this southerly influx of heat and moisture, will be the blocking effect of a snow and ice-covered region, resulting in decreasing precipitation and probably slightly increasing net radiation in landscapes. A framework and a climatic system are created to characterize the environmental changes of the latest 4...

  15. WATER TEMPERATURE and DEPTH collected from OSCAR ELTON SETTE in Guam, Commonwealth of the Northern Mariana Islands, and others from 2015-05-08 to 2015-06-06 (NCEI Accession 0155929)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID SE 15-02). XBT casts...

  16. WATER TEMPERATURE and DEPTH - SENSOR collected from OSCAR ELTON SETTE in main Hawaiian Islands and Hawaii EEZ from 2009-02-06 to 2009-02-25 (NCEI Accession 0155922)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID SE 09-01). XBT casts...

  17. WATER TEMPERATURE and DEPTH - SENSOR collected from NOAA Ship OSCAR ELTON SETTE in Hawaii EEZ, main Hawaiian Islands, and Papahanaumokuakea Marine National Monument from 2010-09-02 to 2010-10-26 (NCEI Accession 0155914)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — XBT data were collected during a Pacific Islands Fisheries Science Center's Cetacean Research Program's shipboard cetacean survey (Cruise ID: SE 10-08). XBT casts...

  18. Pathogenicity island mobility and gene content.

    Energy Technology Data Exchange (ETDEWEB)

    Williams, Kelly Porter

    2013-10-01

    Key goals towards national biosecurity include methods for analyzing pathogens, predicting their emergence, and developing countermeasures. These goals are served by studying bacterial genes that promote pathogenicity and the pathogenicity islands that mobilize them. Cyberinfrastructure promoting an island database advances this field and enables deeper bioinformatic analysis that may identify novel pathogenicity genes. New automated methods and rich visualizations were developed for identifying pathogenicity islands, based on the principle that islands occur sporadically among closely related strains. The chromosomally-ordered pan-genome organizes all genes from a clade of strains; gaps in this visualization indicate islands, and decorations of the gene matrix facilitate exploration of island gene functions. A %E2%80%9Clearned phyloblocks%E2%80%9D method was developed for automated island identification, that trains on the phylogenetic patterns of islands identified by other methods. Learned phyloblocks better defined termini of previously identified islands in multidrug-resistant Klebsiella pneumoniae ATCC BAA-2146, and found its only antibiotic resistance island.

  19. Tsunami damage along the Andaman Islands coasts

    Science.gov (United States)

    2005-01-01

    Among the first places to be affected by the massive tidal wave that ripped across the Indian Ocean on December 26, 2004, were the Andaman Islands. Located approximately 850 kilometers north of the epicenter of the earthquake that triggered the tsunami, the islands were not only among the first land masses to be swept under the wave, they have also been rattled by a series of aftershocks. Administrated by the Indian government, about 300,000 people live on the remote island chain, including several indigenous tribes. As of January 3, over 6,000 were confirmed dead or missing in the Andaman Islands. This Moderate Resolution Imaging Spectroradiometer (MODIS) image shows the Andaman Islands on January 3, 2005. Compared to previous images of the islands, the beaches along the west side of the islands have been stripped bare, leaving a strip of bright tan land along the coast. The change is most notable on North Sentinel Island, home of the Sentinelese aboriginals, and on Interview Island, where the formerly green coastline has been replaced with an abnormally bright ring of bare sand. The large image reveals additional damage along all the islands of the Andaman chain.

  20. Island development: Local governance under globalization

    Directory of Open Access Journals (Sweden)

    Huei-Min Tsai

    2014-12-01

    Full Text Available Issues surrounding island development have generated a growing volume of research. What does it mean to develop? How can island communities maintain control over development processes to the benefit of the local economy, rather than seeing economic flows enter and exit the island with little or a primarily negative impact? And how important is local knowledge for edifying local governance and enhancing potentials for innovation in island development? Island histories have repeatedly been forwarded as exemplars and ‘lessons’ for global learning on (unsustainability. To consider these issues, we have selected a number of papers from among the presentations given at the International Geographical Union’s Commission on Islands Conference, Island Development: Local Economy, Culture, Innovation and Sustainability, which took place in the Penghu Archipelago, Taiwan, 1–5 October 2013. These papers serve as examples of how the processes of globalization have penetrated the borders and changed the political and economic structures of islands. They also explore how island-based innovations in science, technology, culture, and formal or informal governance might contribute to sustainable island development.

  1. Cladocera of Hainan Island, China.

    Science.gov (United States)

    Sinev, Artem Y; Gu, Yangliang; Han, Bo-Ping

    2015-01-01

    The cladoceran fauna of Hainan Island (China) was investigated. Samples were collected in January 2013 and in April 2014 from over hundred water bodies, including large and small reservoirs, ponds and pools, rivers, streams, and paddy fields. There are no large natural lakes on the island. We found 53 species of Cladocera: 9 species of Sididae; 5 Daphniidae; 2 Moinidae; 2 Macrothricidae; 2 Ilyocryptidae; 3 Bosminidae; and 30 Chydoridae. Planktonic communities were dominated by Diaphanosoma dubium Manuilova, 1964, D. excisum Sars, 1885, D. sarsi Richard, 1894, Moina micrura Kurz, 1874 and Bosminopsis deitersi (Richard, 1895). Six Chydoridae species are first records for China. The fauna consists mostly of Oriental and Pantropical species, but, also includes non-tropical Palaearctic species and East Asian endemics. For these species, Hainan Island is the southernmost record. The number of species is rather small, compared to adjacent areas. This may reflect a low intensity of sampling, but more likely a lack of natural lakes. Communities in reservoirs suffer from water level fluctuations, and the absence of permanent macrophyte stands, a preferred habitat of littoral cladocera. PMID:26623784

  2. Generalized model of island biodiversity

    Science.gov (United States)

    Kessler, David A.; Shnerb, Nadav M.

    2015-04-01

    The dynamics of a local community of competing species with weak immigration from a static regional pool is studied. Implementing the generalized competitive Lotka-Volterra model with demographic noise, a rich dynamics with four qualitatively distinct phases is unfolded. When the overall interspecies competition is weak, the island species recapitulate the mainland species. For higher values of the competition parameter, the system still admits an equilibrium community, but now some of the mainland species are absent on the island. Further increase in competition leads to an intermittent "disordered" phase, where the dynamics is controlled by invadable combinations of species and the turnover rate is governed by the migration. Finally, the strong competition phase is glasslike, dominated by uninvadable states and noise-induced transitions. Our model contains, as a special case, the celebrated neutral island theories of Wilson-MacArthur and Hubbell. Moreover, we show that slight deviations from perfect neutrality may lead to each of the phases, as the Hubbell point appears to be quadracritical.

  3. Floating Cities, Islands and States

    CERN Document Server

    Bolonkin, Alexander

    2008-01-01

    Many small countries are in need of additional territory. They build landfills and expensive artificial islands. The ocean covers 71 per cent of the Earth surface. Those countries (or persons of wealth) starting the early colonization of the ocean may obtain advantages through additional territory or creating their own independent state. An old idea is building a big ship. The best solution to this problem, however, is the provision of floating cities, islands, and states. The author idea is to use for floating cities, islands, and states a cheap floating platform created from a natural ice field taken from the Arctic or Antarctic oceans. These cheap platforms protected by air-film (bottom and sides) and a conventional insulating cover (top) and having a cooling system can exist for an unlimited time. They can be increased in number or size at any time, float in warm oceans, travel to different continents and countries, serve as artificial airports, harbors and other marine improvements, as well as floating c...

  4. The system SnSe-Bi

    Energy Technology Data Exchange (ETDEWEB)

    Alidzhanov, M.A.; Alizade, M.Z.; Aslanov, G.A.; Gurshumov, A.P.; Persakhova, A.Y.

    1986-10-01

    The authors study the system SnSe-Bi on annealed samples by methods of physicochemical analysis; x-ray phase, differential-thermal analysis, microstructural analysis, and measurements of the microhardness. It was established that the eutectic contains five mole % SnSe and melts at 260 C. A bounded region of the SnSe-based solid solutions exist, and the solubility of SnSe in bismuth was not observed. Anomalies in the temperature dependences of the thermo-emf and electrical conductivity of the solid solutions were determined by the phase transformations of tin monoselenide. The nature of the changes in the thermo-emf and the electrical conductivity as a function of the temperature is associated with the changes in the density and effective mass of the charge carriers.

  5. Como Perseu se defendeu de Medusa?

    Directory of Open Access Journals (Sweden)

    Rose Lumertz de Freitas

    2012-04-01

    Full Text Available Na psicanálise francesa, principalmente com Lacan, o conceito de falta passou a ser de grande importância. Ao que, então, perguntamos: o que é a falta? E quando esta falta? O que acontece? O que acontece quando o não especularizável não está excluído, se fazendo, assim, especular? Quando Perseu vai ao encontro de Medusa, guiando-se por sua imagem refletida em um espelho de bronze polido, segurado por Atena, como pôde este herói defender-se de Medusa? Qual foi a forma encontrada por ele para se defender da presença do objeto que introduz a dimensão do real nu?

  6. Solving the shape conundrum in $^{70}$Se

    CERN Multimedia

    We propose a multi-step Coulomb-excitation study of $^{70}$Se at HIE-ISOLDE using the $^{208}$Pb( $^{70}$Se, $^{70}$Se*)$^{208}$Pb* reaction at a safe energy of 5.0 MeV/u. We aim at a precise measurement of the $\\left \\langle 2^{+}_{1} \\hspace{0.1cm} || \\hspace{0.1cm}\\hat{E}2 \\hspace{0.1cm} || \\hspace{0.1cm}2^{+}_{ 1} \\right \\rangle$ diagonal matrix element as well as gaining information on additional matrix elements. Such information will shed light onto the shape conundrum of the 2$^{+}_{1}$ state in $^{70}$Se as well as foreseeing the opportunity for a more detailed understanding of the shape-coexistence phenomenon in this region.

  7. Spectral Motion Synchronization in SE(3)

    OpenAIRE

    Arrigoni, Federica; Fusiello, Andrea; Rossi, Beatrice

    2015-01-01

    This paper addresses the problem of motion synchronization (or averaging) and describes a simple, closed-form solution based on a spectral decomposition, which does not consider rotation and translation separately but works straight in SE(3), the manifold of rigid motions. Besides its theoretical interest, being the first closed form solution in SE(3), experimental results show that it compares favourably with the state of the art both in terms of precision and speed.

  8. Double electron capture searches in $^{74}$Se

    CERN Document Server

    Lehnert, B; Degering, D; Sommer, D; Wagner, L; Zuber, K

    2016-01-01

    A search for various double electron capture modes of $^{74}$Se has been performed using an ultralow background Ge-detector in the Felsenkeller laboratory, Germany. Especially for the potentially resonant transition into the 1204.2 keV excited state of $^{74}$Ge a lower half-life limit of $0.70\\cdot 10^{19}$ yr (90% credibility) has been obtained. Serious concerns are raised about the validity of obtained $^{74}$Se limits in some recent publications.

  9. MAGNETIC ANOMALY IN SUPERCONDUCTING FeSe

    OpenAIRE

    Mendoza, D.; Benitez, J. L.; Morales, F.; Escudero, R.

    2010-01-01

    Synthesis, electrical and magnetic characterization of superconducting FeSe0.85 compound is reported. An anomaly in the magnetization against temperature around 90K is observed. Magnetic characterization of a commercial compound with nominal FeSe stoichiometry is also presented. The overall magnetic behaviors as well as the magnetic anomaly in both compounds are discussed in terms of magnetic impurities and secondary phases. Keyword: A. Superconductors

  10. Magnetic properties of FeSe superconductor

    OpenAIRE

    Grechnev, G. E.; Panfilov, A.S.; Desnenko, V. A.; Fedorchenko, A. V.; Gnatchenko, S. L.; Chareev, D. A.; Volkova, O. S.; A.N. Vasiliev

    2012-01-01

    A detailed magnetization study for the novel FeSe superconductor is carried out to investigate the behavior of the intrinsic magnetic susceptibility $\\chi$ in the normal state with temperature and under hydrostatic pressure. The temperature dependencies of $\\chi$ and its anisotropy $\\Delta \\chi=\\chi_{|}-\\chi_{\\bot}$ are measured for FeSe single crystals in the temperature range 4.2-300 K, and a substantial growth of susceptibility with temperature is revealed. The observed anisotropy $\\Delta ...

  11. Atomistic Model of Physical Ageing in Se-rich As-Se Glasses

    Energy Technology Data Exchange (ETDEWEB)

    Golovchak,R.; Shpotyuk, O.; Kozdras, A.; Bureau, B.; Vlcek, M.; Ganjoo, A.; Jain, H.

    2007-01-01

    Thermal, optical, X-ray excited and magnetic methods were used to develop a microstructural model of physical ageing in Se-rich glasses. The glass composition As10Se90, possessing a typical cross-linked chain structure, was chosen as a model object for the investigations. The effect of physical ageing in this glass was revealed by differential scanning calorimetry, whereas the corresponding changes in its atomic arrangement were studied by extended X-ray absorption fine structure, Raman and solid-state 77Se nuclear magnetic resonance spectroscopy. Straightening-shrinkage processes are shown to be responsible for the physical ageing in this Se-rich As-Se glass.

  12. Exciton-Phonon Scattering in CdSe/ZnSe Quantum Dots

    Institute of Scientific and Technical Information of China (English)

    张立功; 申德振; 范希武; 吕少哲

    2002-01-01

    A temperature-dependent photoluminescence measurement is performed in CdSe/ZnSe quantum dots with a ZnCdSe quantum well. We deduce the temperature dependence of the exciton linewidth and peak energy of the zero-dimensional exciton in the quantum dots and two-dimensional exciton in the CdSe wetting layer. The experimental data reveal a reduction of homogeneous broadening of the exciton line in the quantum dots in comparison with that in the two-dimensional wetting layer, which indicates the decrease of exciton and optical phonon coupling in the CdSe quantum dots.

  13. Partial pressure diagrams of the In-Se-O and Ga-Se-O systems

    International Nuclear Information System (INIS)

    The partial pressure diagrams of the In-Se-O and Ga-Se-O systems in the po2 and pSeO2 coordinates have been discussed. The mono- and invariant equilibria have been calculated using isothermal Want-Hoff equation. The relationships between the partial pressure diagrams and the condensed phase equilibrium diagrams have been established. It has been shown that the increase of the SeO2 partial pressure leads to the formation of the A2III Se3 compounds and the formation of oxide phases requires relatively high pressures of oxygen

  14. Amphoteric CdSe nanocrystalline quantum dots.

    Science.gov (United States)

    Islam, Mohammad A

    2008-06-25

    The nanocrystal quantum dot (NQD) charge states strongly influence their electrical transport properties in photovoltaic and electroluminescent devices, optical gains in NQD lasers, and the stability of the dots in thin films. We report a unique electrostatic nature of CdSe NQDs, studied by electrophoretic methods. When we submerged a pair of metal electrodes, in a parallel plate capacitor configuration, into a dilute solution of CdSe NQDs in hexane, and applied a DC voltage across the pair, thin films of CdSe NQDs were deposited on both the positive and the negative electrodes. Extensive characterizations including scanning electron microscopy (SEM), atomic force microscopy (AFM), Fourier transform infrared (FTIR) and Raman studies revealed that the films on both the positive and the negative electrodes were identical in every respect, clearly indicating that: (1) a fraction (<1%) of the CdSe NQDs in free form in hexane solution are charged and, more importantly, (2) there are equal numbers of positive and negative CdSe NQDs in the hexane solution. Experiments also show that the number of deposited dots is at least an order of magnitude higher than the number of initially charged dots, indicating regeneration. We used simple thermodynamics to explain such amphoteric nature and the charging/regeneration of the CdSe NQDs.

  15. Origin of pitchblende veins in the Union Island area, Great Slave Lake, Northwest Territories

    International Nuclear Information System (INIS)

    Pitchblende veins are sparsely distributed in an 8 x 1 km zone of northeast-trending, steeply dipping Aphebian sedimentary rocks deposited on Archean granitic basement and affected by complex faulting. They occur in brecciated dolomite of the Union Island Group on the east shore of Union Island, and along fractures subsidiary to a nearly vertical, northeast-trending fault between phyllites of this group and arkosic quartzite of the younger Sosan Group, which is exposed for a distance of 4 km on Opener Island to the east. The veins are close to the unconformity between the host rocks and the younger, gently dipping clastic redbeds of the Late Aphebian Et-Then Group, which most probably covered the mineralized zone at one time. A supergene origin for the veins is proposed on the basis of geological setting, mineralogy, presence of Ag, Se and V, isotopic dates on pitchblende, and lack of evidence for alternative magmatic or metamorphic hydrothermal sources

  16. Lead levels on traffic-less islands.

    Science.gov (United States)

    Elwood, P C; Blaney, R; Robb, R C; Essex-Cater, A J; Davies, B E; Toothill, C

    1985-09-01

    Surveys were conducted on three traffic-less islands: Tory and Aran, off the coast of Ireland, and Sark, one of the Channel Islands off the coast of France. Identical methods were used in surveys in three other areas, all of which have heavy gasoline driven traffic. These were Jersey, another of the Channel Islands, Ebbw Vale--a mixed industrial area, and Cardiff--the capital city of Wales. Environmental lead levels were very low in two of the traffic-less islands, but on the third, house dust lead levels were comparable with levels found throughout Wales. Blood lead levels on one of the islands were similar to those which have been reported for unaccultured remote tribes, but on the other two traffic-less islands blood lead levels were comparable with those of areas on the mainland of Wales.

  17. Backscatter 0.5m TIFF Mosaic of St. Croix (Buck Island), US Virgin Islands, 2004

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This image represents a 0.5 meter resolution backscatter mosaic of the north shore of Buck Island, St. Croix, US Virgin Islands. NOAA's NOS/NCCOS/CCMA Biogeography...

  18. Introduced arctic fox eradication at Rat Island, Aleutian Islands, Alaska, summer 1984

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Mechanical means similar to those employed on Amata Island during the summer of 1983 were used to attempt eradication of fox on Rat Island. These labor intensive...

  19. Progress report on field studies in the Aleutian Islands, Semidi Islands and Bering Sea, 1983

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report summarizes work in the Aleutian Islands, Semidi Islands, and Bering Sea in support of work unit 953.10. Distribution and abundance of birds as seas work...

  20. Energy Transition Initiative, Island Energy Snapshot - British Virgin Islands (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-03-01

    This profile provides a snapshot of the energy landscape of the British Virgin Islands (BVI), one of three sets of the Virgin Island territories in an archipelago making up the northern portion of the Lesser Antilles.

  1. Narrative report Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge: Calendar year 1971

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge summarizes refuge activities for calendar year 1971....

  2. Narrative Report Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge: Calendar year 1970

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This narrative report for Mackay Island National Wildlife Refuge and Fisherman Island National Wildlife Refuge summarizes refuge activities for calendar year 1970....

  3. CRED 20m Gridded bathymetry of Necker Islands, Northwestern Hawaiian Islands, USA (NetCDF format)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Gridded bathymetry of the shelf and slope environments of Necker Island, Northwestern Hawaiian Islands, Hawaii, USA. This netCDF includes multibeam bathymetry from...

  4. Pine Island, Matlacha Pass, Island Bay, and Caloosahatchee National Wildlife Refuges: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on Pine Island, Matlacha Pass, Island Bay, and Caloosahatchee NWRs for the next 15 years....

  5. Effect of composition on optical properties of GeSe3–Sb2Se3–ZnSe thin films

    Indian Academy of Sciences (India)

    M R Balboul; H M Hosni; M A Soliman; S A Fayek

    2014-10-01

    Optical properties of the chalcogenides GeSe3, Sb2Se3, ZnSe, (GeSe3)80(Sb2Se3)20 and (GeSe3)70 (Sb2Se3)10(ZnSe)20 thin films are investigated. Incorporation of ZnSe into both GeSe3, Sb2Se3 results in amorphous (GeSe3)70(Sb2Se3)10(ZnSe)20 composition. The estimated optical energy gap, g, is found to decrease from 3.06 eV for ZnSe to 1.81 eV for (GeSe3)70(Sb2Se3)10(ZnSe)20. While, the band tail width, e, exhibits an opposite trend. The g behaviour is believed to be associated with cohesive energy, CE, as the incorporation of ZnSe lowers its value. The calculated number of the excess of Se–Se homopolar bonds is found to affect mainly the e values. The refractive index, , is discussed in terms of Wemple–DiDomenico single oscillator dispersion model in the normal dispersion region. The oscillator energy, o, and the dispersion energy, d, are determined for films under investigation.

  6. Summary Report: Asian Pacific Islander Workers Hearing

    OpenAIRE

    Asian Pacific American Labor Alliance; AFL-CIO; UCLA Labor Center

    2002-01-01

    The first ever California State Assembly Hearing on Asian Pacific Islander Workers was convened by the Labor Employment Committee and the Asian Pacific Islander Legislative Caucus, at the request of Assembly member Judy Chu. The Hearing brought together Asian Pacific Islander workers and advocates from all over California. Their stories are a snapshot of millions of workers. The testimonies gave a glimpse of the detrimental impact that worker exploitation has on families and communities. Most...

  7. Solomon Islands: Malaita Hub scoping report

    OpenAIRE

    Schwarz, A.M.; Andrew, N.; Govan, H.; Harohau, D.; Oeta, J.

    2013-01-01

    The CGIAR Research Program (CRP) Aquatic Agricultural Systems (AAS) will target five countries, including Solomon Islands. The proposed hubs for Solomon Islands were to cover most provinces, referencing the Western, Central and Eastern regions. Scoping of the initial ‘Central’ hub was undertaken in Guadalcanal, Malaita and Central Islands provinces and this report details findings from all three. As scoping progressed however, it was agreed that, based on the AAS context and priority need...

  8. Geology and petrology of Raiatea Island (Society islands, French Polynesia)

    International Nuclear Information System (INIS)

    Raiatea Island is made up of an alkali basaltic shield volcano, the upper 1000 m of which were emplaced between 2.75 and 2.52 Ma with an average construction rate of ca. 4 mm/year. Trachytic lavas were then emplaced between 2.54 and 2.44 Ma, both as flows and plugs along N-S trending fractures. Their geochemical characteristics point to a fractionation-controlled derivation from the basaltic magmas. Our new age set is consistent with a Pacific plate motion of 11 cm/year with respect to a fixed Society plume. (authors)

  9. Molecular Evolutionary Consequences of Island Colonization

    Science.gov (United States)

    James, Jennifer E.; Lanfear, Robert; Eyre-Walker, Adam

    2016-01-01

    Island endemics are expected to have low effective population sizes (Ne), first because some may experience population bottlenecks when they are founded, and second because they have restricted ranges. Therefore, we expect island species to have reduced genetic diversity, inefficient selection, and reduced adaptive potential compared with their mainland counterparts. We used both polymorphism and substitution data to address these predictions, improving on the approach of recent studies that only used substitution data. This allowed us to directly test the assumption that island species have small values of Ne. We found that island species had significantly less genetic diversity than mainland species; however, this pattern could be attributed to a subset of island species that appeared to have undergone a recent population bottleneck. When these species were excluded from the analysis, island and mainland species had similar levels of genetic diversity, despite island species occupying considerably smaller areas than their mainland counterparts. We also found no overall difference between island and mainland species in terms of the effectiveness of selection or the mutation rate. Our evidence suggests that island colonization has no lasting impact on molecular evolution. This surprising result highlights gaps in our knowledge of the relationship between census and effective population size. PMID:27358424

  10. Dendrochronology of strain-relaxed islands.

    Science.gov (United States)

    Merdzhanova, T; Kiravittaya, S; Rastelli, A; Stoffel, M; Denker, U; Schmidt, O G

    2006-06-01

    We report on the observation and study of tree-ring structures below dislocated SiGe islands (superdomes) grown on Si(001) substrates. Analogous to the study of tree rings (dendrochronology), these footprints enable us to gain unambiguous information on the growth and evolution of superdomes and their neighboring islands. The temperature dependence of the critical volume for dislocation introduction is measured and related to the composition of the islands. We show clearly that island coalescence is the dominant pathway towards dislocation nucleation at low temperatures, while at higher temperatures anomalous coarsening is effective and leads to the formation of a depletion region around superdomes.

  11. Señalización y seguridad vial

    OpenAIRE

    García Verduch, Antonio

    1992-01-01

    Se explica el suceso de que un autobús con 55 pasajeros se salió de la autopista y sufrió un accidente, se pide que se esclarezcan los hechos y que se dote de mejor señalización a las carreteras españolas

  12. Solid waste management on small islands: the case of Green Island, Taiwan

    NARCIS (Netherlands)

    Chen, M.C.; Ruijs, A.J.W.; Wesseler, J.H.H.

    2005-01-01

    Municipalities of small islands have limited capacities for waste disposal. In the case of Green Island, Taiwan, continuing with business as usual would only allow the disposal of waste on the island for another 8 years. Three alternatives for solid waste management (SWM) are compared. The cost-effe

  13. 77 FR 71531 - Special Local Regulation; Kelley's Island Swim, Lake Erie; Kelley's Island, Lakeside, OH

    Science.gov (United States)

    2012-12-03

    ... Regulation; Kelley's Island Swim, Lake Erie; Kelley's Island, Lakeside, OH in the Federal Register (77 FR... Homeland Security FR Federal Register NPRM Notice of Proposed Rulemaking TFR Temporary Final Rule A... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Kelley's Island Swim,...

  14. Imagery and Imaginary of Islander Identity: Older People and Migration in Irish Small-Island Communities

    Science.gov (United States)

    Burholt, Vanessa; Scharf, Thomas; Walsh, Kieran

    2013-01-01

    This article examines the imagery and imaginaries of islander identity and makes an original contribution to the fields of gerontology and nissology. Drawing on data collected through in-depth interviews with 19 older residents of two small-island communities located off the island of Ireland, we address the central roles played by older people in…

  15. Some data on the avifauna of the Island of Roti, Lesser Sunda Islands, Indonesia

    NARCIS (Netherlands)

    Verheijen, J.A.J.

    1976-01-01

    INTRODUCTION For several years I had been looking for an opportunity to visit the island of Roti (Rotti, Roté, Loté). Junge (1954) mentions that only once an ornithological collection was made in the island, namely by Dr. H. F. C. ten Kate, an ethnologist who visited the island in 1891. Büttikofer (

  16. One-pot synthesis of hollow NiSe-CoSe nanoparticles with improved performance for hybrid supercapacitors

    Science.gov (United States)

    Chen, Haichao; Fan, Meiqiang; Li, Chao; Tian, Guanglei; Lv, Chunju; Chen, Da; Shu, Kangying; Jiang, Jianjun

    2016-10-01

    Hollow NiSe-CoSe samples have been synthesized for the first time via a one-pot solvothermal approach. The strategy is robust enough to synthesize NiSe-CoSe nanoparticles with different NiSe to CoSe ratios but with a similar hollow structure. Co ions in the NiSe-CoSe nanoparticles play decisive role for formation of the hollow structure; otherwise, the nanoparticles become solid for the NiSe sample. When used as the positive electroactive materials for energy storage, the NiSe-CoSe samples show excellent electrochemical activity in alkaline electrolyte. Using the synergistic effect between NiSe and CoSe, the electrochemical performance of NiSe-CoSe can be tuned by varying the NiSe to CoSe ratios. The NiSe-CoSe sample with a NiSe to CoSe ratio of 4:2 shows the best electrochemical performance in terms of superior specific capacity, improved rate capability and excellent cycling stability. In addition, the electrochemical performance of NiSe-CoSe sample with a NiSe to CoSe ratio of 4:2 is also evaluated via assembling hybrid supercapacitors with RGO, and the hybrid supercapacitor delivers both high power and energy densities (41.8 Wh kg-1 at 750 W kg-1 and 20.3 Wh kg-1 at 30 kW kg-1).

  17. Monoclinic Cu2Se3Sn.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Ostapyuk, T A; Klymovych, O S; Zmiy, O F

    2010-05-01

    A previously unknown modification of dicopper(I) triselenostannate(IV), Cu(2)Se(3)Sn, has been obtained from the Cu(2)Se-SnSe(2) quasi-binary system and investigated using X-ray single-crystal diffraction. The Se atoms are stacked in a closest-packed arrangement with the layers in the sequence ABC. The Cu atoms occupy one-third of the tetrahedral interstices, whereas the Sn atoms are located in one-sixth of the tetrahedral interstices. All the atoms occupy general positions. The structure possesses pseudo-inversion symmetry. The Cu(2)Se(3)Sn structure investigated in this paper (96 atoms per unit cell, ordered distribution of Cu and Sn over 12 cation positions) is a superstructure of the reported cubic (eight atoms per unit cell, random distribution of Cu and Sn over one cation position) and monoclinic (24 atoms per unit cell, ordered distribution of Cu and Sn over three cation positions) modifications. PMID:20442500

  18. PbSe Nanocrystal Excitonic Solar Cells

    KAUST Repository

    Choi, Joshua J.

    2009-11-11

    We report the design, fabrication, and characterization of colloidal PbSe nanocrystal (NC)-based photovoltaic test structures that exhibit an excitonic solar cell mechanism. Charge extraction from the NC active layer is driven by a photoinduced chemical potential energy gradient at the nanostructured heterojunction. By minimizing perturbation to PbSe NC energy levels and thereby gaining insight into the "intrinsic" photovoltaic properties and charge transfer mechanism of PbSe NC, we show a direct correlation between interfacial energy level offsets and photovoltaic device performance. Size dependent PbSe NC energy levels were determined by cyclic voltammetry and optical spectroscopy and correlated to photovoltaic measurements. Photovoltaic test structures were fabricated from PbSe NC films sandwiched between layers of ZnO nanoparticles and PEDOT:PSS as electron and hole transporting elements, respectively. The device current-voltage characteristics suggest a charge separation mechanism that Is distinct from previously reported Schottky devices and consistent with signatures of excitonic solar cells. Remarkably, despite the limitation of planar junction structure, and without film thickness optimization, the best performing device shows a 1-sun power conversion efficiency of 3.4%, ranking among the highest performing NC-based solar cells reported to date. © 2009 American Chemical Society.

  19. MoSe2 / Polyaniline Solar Cells

    Directory of Open Access Journals (Sweden)

    H.S. Patel

    2011-01-01

    Full Text Available Solar cells have been investigated since long for harnessing the solar energy. During this decade, a new direction has come up where in the polymers have been used in the fabrication of solar cells. Polyaniline is one of the polymers which has shown potential for its applications in heterostructure solar cells. This material is being used along with the semiconductors like InSe, TiO2, Si etc. to form the photosensitive interface. In this direction, we report our investigations on the use of Molybdenum diselenide (MoSe2 as photosensitive semiconducting material in MoSe2 / polyaniline solar cells. In this paper, the preparation of MoSe2 / polyaniline solar cells has been reported. Also, the photovoltage → photocurrent characteristics of this structure have been discussed in detail in this paper. The variation of different parameters of MoSe2 / polyaniline solar cells (like open circuit voltage, short circuit current, photoconversion efficiency and fill factor with the intensity of incident illuminations has been reported in this paper. In present case, the photocurrent density was found to be around 250 µA/cm2 with the photovoltage around 8.5 mV (which is low the photoconversion efficiency was found to be around 0.7 % along with the fill factor around 0.33. The efforts have been made to explain the low values of the photoconversion efficiency.

  20. Vegetation of eastern Unalaska Island, Aleutian Islands, Alaska

    Science.gov (United States)

    Talbot, Stephen S.; Schofield, Wilfred B.; Talbot, Sandra L.; Daniëls, Fred J. A.

    2010-01-01

    Plant communities of Unalaska Island in the eastern Aleutian Islands of western Alaska, and their relationship to environmental variables, were studied using a combined Braun-Blanquet and multivariate approach. Seventy relevés represented the range of structural and compositional variation in the matrix of vegetation and landform zonation. Eleven major community types were distinguished within six physiognomic–ecological groups: I. Dry coastal meadows: Honckenya peploides beach meadow, Leymus mollis dune meadow. II. Mesic meadows: Athyrium filix-femina – Aconitum maximum meadow, Athyrium filix-femina – Calamagrostis nutkaensis meadow, Erigeron peregrinus – Thelypteris quelpaertensis meadow. III. Wet snowbed meadow: Carex nigricans snowbed meadow. IV. Heath: Linnaea borealis – Empetrum nigrum heath, Phyllodoce aleutica heath, Vaccinium uliginosum – Thamnolia vermicularis fellfield. V. Mire: Carex pluriflora – Plantago macrocarpa mire. VI. Deciduous shrub thicket: Salix barclayi – Athyrium filix-femina thicket. These were interpreted as a complex gradient primarily influenced by soil moisture, elevation, and pH. Phytogeographical and syntaxonomical analysis of the plant communities indicated that the dry coastal meadows, most of the heaths, and the mire vegetation belonged, respectively, to the widespread classes Honckenyo–Elymetea, Loiseleurio–Vaccinietea, and Scheuchzerio–Caricetea, characterized by their circumpolar and widespread species. Amphi-Beringian species were likely diagnostic of amphi-Beringian syntaxa, many of these yet to be described.

  1. In or On? Island Words, Island Worlds: II

    Directory of Open Access Journals (Sweden)

    Ronstrom Owe

    2011-11-01

    Full Text Available The first part of the paper examines uses and meanings of the orientational metaphors ‘in’, ‘on’, ‘out’ and ‘off’. In the discussed languages in North Western Europe there are general principles of metaphoric entailment and underlying image schemas that guide the choice of positional metaphor: islands you are normally ‘on’, and mainlands ‘in’. The second part of the paper examines cases where this use is debated or contested. The author finds that these contestations seem to be fuelled by the different relations between subject and object that positional metaphors entail. Expressions with ‘in’ highlight belonging and collective identity, enlarge objects by conceptualizing them as encompassing containers, and reduce subjects to a part of the object. Expressions with ‘on’ highlight individuality and agency, reduce the object, and enlarge the subject by placing it above the object. Such differing entailments of positional metaphors may influence how islands are positioned and understood.

  2. Type-II excitons in ZnTe/ZnSe quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Andre, Regis; Najjar, Rita; Besombes, Lucien; Bougerol, Catherine; Tatarenko, Serge; Mariette, Henri [CEA-CNRS group ' ' Nanophysique et Semiconducteurs' ' , Institut Neel-CNRS, Grenoble (France)

    2009-04-15

    We present the photoluminescence and time resolved photoluminescence properties of an ensemble of ZnTe quantum dots embedded in a ZnSe matrix. Those heterostructures exhibit a type-II band alignment with holes confined within the dots and electrons kept in the close vicinity of the dots by coulomb attraction. We show that the structural and optical features of the samples, grown by molecular beam epitaxy, are highly sensitive to the growth conditions. Depending on the Se to Zn flux ratio, the ZnTe islands can disappear and lead to a thin 2D quantum well, or be preserved and localize excitons, as evidenced by photoluminescence experiments. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  3. Island Falls 'A' dam repair

    International Nuclear Information System (INIS)

    Repairs to the Island Falls 'A' Dam located on the Churchill River in northern Saskatchewan is described. The dam was built in 1928-1930. It had suffered extensive freeze thaw damage and some portions of the structure did not meet minimum safety standards. The paper emphasizes concrete repair methodology, the design and installation of high strength steel anchors for stability enhancement, increasing structural capacity, re-establishment of drainage and re-design of spillway operations. The extensive involvement with the local First Nations community, which was critical to the successful completion of the job is also discussed

  4. The Bruny Island Radio Spectrometer

    Science.gov (United States)

    Erickson, W. C.

    1997-11-01

    A radio spectrometer has been built on Bruny Island, south of Hobart, for the study of solar bursts in the rarely observed frequency range from 3 to 20 MHz. This spectrometer is an adaptive device that employs digital techniques to avoid most of the strong terrestrial interference prevalent in this frequency range. The residual interference that cannot be avoided is excised during off-line processing. As a result, successful observations are made down to the minimum frequency that can propagate through the ionosphere to the antenna. This minimum frequency depends upon the zenith distance of the Sun and it is usually between 4 and 8 MHz.

  5. Improved photoluminescence quantum yield and stability of CdSe-TOP, CdSe-ODA-TOPO, CdSe/CdS and CdSe/EP nanocomposites

    Science.gov (United States)

    Wei, Shutian; Zhu, Zhilin; Wang, Zhixiao; Wei, Gugangfen; Wang, Pingjian; Li, Hai; Hua, Zhen; Lin, Zhonghai

    2016-07-01

    Size-controllable monodisperse CdSe nanocrystals with different organic capping were prepared based on the hot-injection method. The effective separation of nucleation and growth was achieved by rapidly mixing two highly reactive precursors. As a contrast, we prepared CdSe/CdS nanocrystals (NCs) successfully based on the selective ion layer adsorption and reaction (SILAR) technique. This inorganic capping obtained higher photoluminescence quantum yield (PLQY) of 59.3% compared with organic capping of 40.8%. Furthermore, the CdSe-epoxy resin (EP) composites were prepared by adopting a flexible ex situ method, and showed excellent stability in the ambient environment for one year. So the composites with both high PLQY of nanocrystals and excellent stability are very promising to device application.

  6. Lattice thermal conductivity of LaSe

    Energy Technology Data Exchange (ETDEWEB)

    Li, Wei, E-mail: tolwwt@163.com [School of Physics and Telecommunication Engineering, South China Normal University, 510006 Guangzhou (China); Pan, Zhong-liang; Chen, Jun-fang; He, Qin-yu [School of Physics and Telecommunication Engineering, South China Normal University, 510006 Guangzhou (China); Wang, Teng [School of Computer, South China Normal University, 510631 Guangzhou (China)

    2015-07-15

    The phonon dispersions and phonon density of states of LaSe are obtained, based on density functional perturbation theory and the norm-conserving pseudo-potential method. An anomaly in calculated phonon dispersion curves is presented and interpreted as a Kohn anomaly. The heat capacity of LaSe is calculated then. For the three-phonon process scattering, the lowest non-harmonic cubic terms of the interatomic potential are considered to obtain single-phonon relaxation rate by applying the Fermi's golden rule. For the boundary scattering, the average phonon relaxation time was obtained. Considering two kinds of phonon scattering mechanisms, we obtain the lattice thermal conductivity of LaSe.

  7. Tl2Mo9Se11

    Directory of Open Access Journals (Sweden)

    Patrick Gougeon

    2010-08-01

    Full Text Available The structure of Tl2Mo9Se11, dithallium nonamolybdenum undecaselenide, is isotypic with Tl2Mo9S11 [Potel et al. (1980. Acta Cryst. B36, 1319–1322]. The structural set-up is characterized by a mixture of Mo6Sei8Sea6 and Mo12Sei14Sea6 cluster units in a 1:1 ratio. Both components are interconnected through interunit Mo—Se bonds. The cluster units are centered at Wyckoff positions 3a and 3b (point-group symmetry overline{3}.. The two TlI atoms are situated in the voids of the three-dimensional arrangement. Two of the five independent Se atoms and the Tl atoms lie on sites with 3. symmetry (Wyckoff site 6c.

  8. Cd And Se Atomic Environments During the Growth of CdSe Nanoparticles in Glass

    Energy Technology Data Exchange (ETDEWEB)

    Hayes, T.M.; Persans, P.D.; Filin, A.; Peng, C.; Huang, W.

    2006-10-27

    Thermal treatment of Cd and Se doped borosilicate glass yields CdSe nanoparticles that are interesting for applied and fundamental studies of quantum and size effects in semiconductors. Using x-ray absorption spectroscopy at both the Cd and Se K-edges, we have studied the local atomic structure for each of these reactants at several stages of particle growth. When the doped glass is quenched from 1050 C, the Cd neighbor is mostly oxygen and the Se neighbor is mostly Zn. With heat treatment at 600-750 C, the concentration of nearest neighbor Cd-Se bonds increases and becomes dominant while the optical spectrum evolves toward that of a composite containing CdSe.

  9. A NUMERICAL STUDY OF THE EFFECT OF TAIWAN ISLAND TERRAIN ON TYPHOON HAITANG (0505) TRACK

    Institute of Scientific and Technical Information of China (English)

    YU Zhen-shou; HOU Qiu-feng; WANG Hai-dong; WU Xian-du; LI Huai-chun

    2008-01-01

    The track of Typhoon Haitang (0505), which passed through the Taiwan Island and landed again,has been successfully simulated by using the non-hydrostatic mesoscale atmospheric model MM5. Itsstructure is analyzed on the landing stage, and it is found that there exist good relationships between thetyphoon abnormal moving track and its asymmetry structure. The effect of terrain of Taiwan Island on thetyphoon Haitang, which made it rotate before landing and present a "V" type abnormal moving track inTaiwan straits, has also been simulated. Further analysis shows that the terrain of Taiwan Island not onlydirectly affects the typhoon moving track, but also changes the typhoon track by affecting its asymmetricstructure. Therefore, the typhoon asymmetric structure and the effect of terrain of Taiwan Island togetherresults in the abnormal rotating track. The terrain of Taiwan Island tends to increase the SW-NEasymmetric structure of the typhoon and has different effect on SE-NW asymmetric structure during thelandfall process of typhoon Haitang before entering and moving out of the Taiwan straits.

  10. St. Vincent Island White-Tailed Deer Monitoring Program

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The white tailed deer herd on St. Vincent Island represents an important part of the island's biotic community. To maintain the integrity of the island's deer...

  11. Reindeer and seabird survey of Hagemeister Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report describes the survey effort on Hagemeister Island in the Alaska Maritime NWR. Hagemeister Island is the second largest Bering Sea Island. Reindeer, red...

  12. Energy Transition Initiative, Island Energy Snapshot - Grenada (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2015-03-01

    This profile provides a snapshot of the energy landscape of Grenada - a small island nation consisting of the island of Grenada and six smaller islands in the southeastern Caribbean Sea - three of which are inhabited: Grenada, Carriacou, and Petite Martinique.

  13. Što se dogodilo gospodinu Davisonu

    Directory of Open Access Journals (Sweden)

    Una Krizmanić Ožegović

    2014-12-01

    Full Text Available Prije svega, dozvolite mi da kažem da svi osjećamo najiskreniju sućut zbog onoga što se dogodilo gospodinu Davidsonu. Naravno, nitko od nas nije mogao ni pomisliti da će sve tako završiti. To ne treba ni napominjati. Mislim, doista ne vjerujem da je bilo tko mogao predvidjeti posljedice onoga što se dogodilo. Daleko od toga da smo sjeli i proveli detaljnu analizu rizika kad smo odlučili djelovati u tome smjeru. Naravno da ne. Riječ je o spontanoj odluci, jednostavno nas je ponio trenutak. No, unatoč nedostatku podrobnije analize, mogu sa sigurnošću reći kako ovakav ishod nitko od nas nije mogao ni zamisliti. Mislim, očito da nije. Jednostavno, mi nismo takvi ljudi, nitko od nas. Mislim da se to podrazumijeva. Mislim da sa sigurnošću mogu reći kako se to uvriježilo među nekim ljudima koje je ovo pogodilo, u odnosu na kasniji tijek događaja. Uključujući i samoga gospodina Davidsona. S obzirom na sve što smo uspjeli zaključiti. Mislim, znate, neki od ljudi kojima se okružio bili su s pravom oprezni, s obzirom na ono što bismo mogli nazvati pristupom. Tako barem ja to, i dandanas, vidim: takav pristup u sadašnjem trenutku ne bi bio dobro prihvaćen, s obzirom na trenutačne okolnosti. Govorim s obzirom i u odnosu na treće strane, u ovome kontekstu. S obzirom da smo držali kako bi se izravan pristup protumačio kao neprimjeren, u odnosu na širi kontekst i povijest i tome slično.

  14. Synthesis of near-infrared-emitting CdTe/CdSe/ZnSe/ZnS heterostructure.

    Science.gov (United States)

    Yang, Ping

    2014-04-01

    Near-infrared-emitting quantum dots (QDs) were fabricated via organic synthesis strategies through constructing CdTe/CdSe/ZnSe/ZnS multishell heterostructure. An effective shell-coating route was developed for multishell growth on CdTe cores. Core/shell growth was monitored by absorption and photoluminescence (PL) spectroscopy and transmission electron microscopy observation. Yellow emitting CdTe cores were coated with a CdSe shell to generate type II structure. This yields core/shell QDs with red photoluminescence. The passivation by the ZnSe shell having a substantially wide bandgap confines the excitons within the CdTe/CdSe interface and isolates them from the solution environment and consequently improves the stability of the heterostructure. An additional ZnS shell was deposited around the outer layer of CdTe/CdSe/ZnSe QDs to form a heterostructure through the reaction between zinc oleate and trioctylphosphine sulfur in the crude CdTe/CdSe/ZnSe solution. By varying CdTe core size and each shell thickness, the PL wavelength of the obtained heterostructure can span from 580 to 770 nm. The PL efficiency is quenched in CdTe QDs in diluted solution but increases substantially up to 24% for CdTe/CdSe core/shell QDs. The PL efficiency of CdTe/CdSe/ZnSe/ZnS QDs with average diameter of 5.4 nm and a PL peak wavelength of 770 nm is 20%. PMID:24734747

  15. El cielo se llena de santos mexicanos

    Directory of Open Access Journals (Sweden)

    Verónica Zárate Toscano

    2005-02-01

    Full Text Available Preliminares A fines del próximo mes de julio, si Dios le conserva la vida y su salud se lo permite, el Papa Juan Pablo II elevará a la categoría de Santo al indio Juan Diego en una ceremonia en la ciudad de México, culminando así un largo, discutido y tortuoso proceso de canonización. Suerte parecida corrió en su momento el criollo Felipe de Jesús; sin embargo, otros miembros de la corte celestial de origen mexicano se han elevado a los altares de manera casi vertiginosa, como es el caso de ...

  16. Brasil. Cuando la modernidad se hizo color.

    OpenAIRE

    Cortina Maruenda, Francisco Javier; Molina Siles, Pedro Javier

    2013-01-01

    La modernidad deformada ha desterrado en múltiples ocasiones el uso del color en sus realizaciones. Incluso, hasta hoy en día, esta idea se repite como irreflexivo punto de partida de múltiples proyectos. Esto, a pesar de que los grandes maestros han hecho uso de este recurso sin ocultarlo. Un claro ejemplo fue Le Corbusier que incluso generó sus propias colecciones de colores. Por otro lado, Brasil se ha significado desde siempre como un reducto donde la manera de ver el movimiento modern...

  17. A PRELIMINARY REPORT ON PERMAFROST OCCURRENCE IN SEYMOUR ISLAND (MARAMBIO ISLAND), ANTARCTIC PENINSULA REGION

    OpenAIRE

    フクダ, マサミ; Masami, FUKUDA; Arturo E., CORTE

    1989-01-01

    Seymour Island (Marambio Island, 64°S 56°W) in the Weddel Sea is located near James Ross Island. As there was no ice-sheet over the island during and after the last glaciation period, the ground has remained frozen and permafrost of considerable depth has developed in the ground. The authors conducted the field survey related to the genesis and occurrence of permafrost in the island. The Japan-Argentina joint expedition was established by the support of Grant-in-Aid for Overseas Scientific Re...

  18. The Pacific Island Health Care Project

    Directory of Open Access Journals (Sweden)

    Donald Ames Person

    2014-10-01

    Full Text Available Introduction/BackgroundUS Associated/Affiliated Pacific Islands (USAPI include 3 Freely Associated States: Marshall Islands, Federated States of Micronesia, Palau and 3 Territories: American Samoa, Guam, and Commonwealth of the Northern Mariana Islands. ObjectiveThe Pacific Island Health Care Project (PIHCP provides humanitarian medical referral/consultation/care to >500,000 indigenous people of these remote islands. Methods In the mid-1990s, we developed a simple store-and-forward program to link the USAPI with Tripler Army Medical Center (TAMC. This application allowed image attachment to email consultations. ResultsMore than 8000 Pacific Islanders have benefited from the program. 3000 Pacific Islanders prior to telemedicine (1990-1997 and since store-and-forward telemedicine (1997-present, the PIHCP has helped an additional 5000. Records post dynamically and are stored in an archival database. Conclusion The PIHCP is the longest running telemedicine program in the world delivering humanitarian medical care. It has bridged the Developing World of the remote Pacific islands with advanced medical and surgical care available at a major US military teaching hospital.(The opinions expressed here are those of the author and not that of the Army, Department of Defense, or the US Government.

  19. Governance of ecosystem services on small islands

    NARCIS (Netherlands)

    Polman, Nico; Reinhard, Stijn; Bets, van L.K.J.; Kuhlman, Tom

    2016-01-01

    Natural ecosystems provide an attractive focus for tourism on small islands. However, at the same time tourism and other human actions can be detrimental to these ecosystems especially because governance of the ecosystem may be difficult due to the limited resilience of small island ecosystems. I

  20. Debt Management Performance Assessment : Solomon Islands

    OpenAIRE

    World Bank, (WB)

    2009-01-01

    From February 19 to 28, 2009, a World Bank team undertook a debt management performance assessment (DeMPA) mission to Honiara, Solomon Islands. The objective was to undertake a comprehensive assessment of debt management functions applying the DeMPA tool. The assessment reveals that the Solomon Islands meets the minimum requirements for effective debt management performance as specified by...

  1. Marine investigations in the Lakshadweep Islands, India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    The Lakshadweep Islands lie on the sea route between West Asia and Africa on the one hand and South Asia and the Far East on the other. In maritime history, these islands have played a vital role by providing shelter, fresh water and landmarks...

  2. The water landscapes of the Canary Islands

    DEFF Research Database (Denmark)

    Lee, Gini; Braae, Ellen Marie; Diedrich, Lisa

    2013-01-01

    Island environments, particularly small archipelagos such as the Canary Islands, are more visible subject to the vagaries of change wrought by ecological and climate dynamics, shifting social conditions and economic impacts subject to global markets, than is witnessed on continental worlds....

  3. The avifauna of Flores (Lesser Sunda Islands)

    NARCIS (Netherlands)

    Mees, G.F.

    2006-01-01

    The avifauna of the island of Flores (Lesser Sunda Islands) is reviewed. Introductory sections, which include a chapter on the history of ornithological discovery, are followed by the main part, a systematic account in which each species and subspecies known from Flores is treated separately. A disc

  4. Distribution of Grimmia Hedw. on Mediterranean islands

    NARCIS (Netherlands)

    Greven, H.C.

    1995-01-01

    On the six largest Mediterranean islands: Corsica, Crete, Cyprus, Mallorca, Sardinia and Sicily, the moss genus Grimmia (Grimmiaceae, Musci) is represented by 29 species. Many of these are newly recorded. The importance of the islands for bryophyte conservation is stressed. -Author

  5. Rhode Island School Terrorist Attack Preparedness

    Science.gov (United States)

    Dube, Michael W. M.

    2012-01-01

    This study examined the state of safety and terrorist attack preparedness in Rhode Island Schools as determined by Rhode Island school leader perceptions. The study is descriptive in nature as it gathers data to describe a particular event or situation. Using a researcher generated survey based on terrorist preparedness guidelines and suggestions…

  6. Early hominin biogeography in Island Southeast Asia.

    Science.gov (United States)

    Larick, Roy; Ciochon, Russell L

    2015-01-01

    Island Southeast Asia covers Eurasia's tropical expanse of continental shelf and active subduction zones. Cutting between island landmasses, Wallace's Line separates Sunda and the Eastern Island Arc (the Arc) into distinct tectonic and faunal provinces. West of the line, on Sunda, Java Island yields many fossils of Homo erectus. East of the line, on the Arc, Flores Island provides one skeleton and isolated remains of Homo floresiensis. Luzon Island in the Philippines has another fossil hominin. Sulawesi preserves early hominin archeology. This insular divergence sets up a unique regional context for early hominin dispersal, isolation, and extinction. The evidence is reviewed across three Pleistocene climate periods. Patterns are discussed in relation to the pulse of global sea-level shifts, as well as regional geo-tectonics, catastrophes, stegodon dispersal, and paleogenomics. Several patterns imply evolutionary processes typical of oceanic islands. Early hominins apparently responded to changing island conditions for a million-and-a-half years, likely becoming extinct during the period in which Homo sapiens colonized the region. PMID:26478140

  7. Barrier island vulnerability to breaching: a case study on Dauphin Island, Alabama

    Science.gov (United States)

    Hansen, Mark; Sallenger, Asbury H.

    2007-01-01

    Breaching of barrier islands can adversely impact society by severing infrastructure, destroying private properties, and altering water quality in back bays and estuaries. This study provides a scheme that assesses the relative vulnerability of a barrier island to breach during storms. Dauphin Island, Alabama was selected for this study because it has a well documented history of island breaches and extensive geological and geomorphic data. To assess the vulnerability of the island, we defined several variables contributing to the risk of breaching: island geology, breaching history, and island topography and geomorphology. These variables were combined to form a breaching index (BI) value for cross island computational bins, each bin every 50 m in the alongshore direction. Results suggest the eastern section of Dauphin Island has the lowest risk of breaching with the remaining portion of the island having a moderate to high risk of breaching. Two reaches in the western section of the island were found to be particularly vulnerable due primarily to their minimal cross-sectional dimensions.

  8. Climate change and size evolution in an island rodent species: new perspectives on the island rule.

    Science.gov (United States)

    Millien, Virginie; Damuth, John

    2004-06-01

    As stated by the island rule, small mammals evolve toward gigantism on islands. In addition they are known to evolve faster than their mainland counterparts. Body size in island mammals may also be influenced by geographical climatic gradients or climatic change through time. We tested the relative effects of climate change and isolation on the size of the Japanese rodent Apodemus speciosus and calculated evolutionary rates of body size change since the last glacial maximum (LGM). Currently A. speciosus populations conform both to Bergmann's rule, with an increase in body size with latitude, and to the island rule, with larger body sizes on small islands. We also found that fossil representatives of A. speciosus are larger than their extant relatives. Our estimated evolutionary rates since the LGM show that body size evolution on the smaller islands has been less than half as rapid as on Honshu, the mainland-type large island of Japan. We conclude that island populations exhibit larger body sizes today not because they have evolved toward gigantism, but because their evolution toward a smaller size, due to climate warming since the LGM, has been decelerated by the island effect. These combined results suggest that evolution in Quaternary island small mammals may not have been as fast as expected by the island effect because of the counteracting effect of climate change during this period.

  9. Reference: SE2PVGRP1 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388-396 (1995) PubMed: 7581519; ... ...SE2PVGRP1 Elmayan T, Tepfer M. Evaluation in tobacco of the organ specificity and strength of the rolD promo

  10. Det faderløse samfund

    DEFF Research Database (Denmark)

    Jensen, Henrik

    Det faderløse samfund er en kulturhistorisk afdækning af fader- og autoritetstabet i det 20. århundredes Europa, med fokus på fader-søn-forholdet og fortalt gennem skikkelser som Max Weber, Freud, Jung, Kafka - og ’den uregerlige søn’ over dem alle, psykologen og anarkisten Otto Gross. Den er...

  11. Enriched $^{82}$Se for the LUCIFER experiment

    CERN Document Server

    Beeman, J W; Benetti, P; Cardani, L; Casali, N; Chiesa, D; Clemenza, M; Dafinei, I; Di Domizio, S; Ferroni, F; Gironi, L; Giuliani, A; Gotti, C; Laubenstein, M; Maino, M; Nagorny, S; Nisi, S; Nones, C; Orio, F; Pagnanini, L; Pattavina, L; Pessina, G; Piperno, G; Pirro, S; Previtali, E; Rusconi, C; Schäffner, K; Tomei, C; Vignati, M

    2015-01-01

    The LUCIFER project aims at deploying the first array of enriched scintillating bolometers for the investigation of neutrinoless double-beta decay of $^{82}$Se. The matrix which embeds the source is an array of ZnSe crystals, where enriched $^{82}$Se is used as decay isotope. The radiopurity of the initial components employed for manufacturing crystals, that can be operated as bolometers, is crucial for achieving a null background level in the region of interest for double-beta decay investigations. In this work, we evaluated the radioactive content in 2.5 kg of 96.3% enriched $^{82}$Se metal, measured with a high-purity germanium detector at the Gran Sasso deep underground laboratory. The limits on internal contaminations of primordial decay chain elements of $^{232}$Th, $^{238}$U and $^{235}$U are respectively: $<$61 $\\mu$Bq/kg, $<$110 $\\mu$Bq/kg and $<$74 $\\mu$Bq/kg at 90% C.L.. The extremely low-background conditions in which the measurement was carried out and the high radiopurity of the $^{82}$...

  12. Biaxially Oriented CdSe Nanorod

    DEFF Research Database (Denmark)

    Breiby, Dag W.; Chin, Patrick T.K.; Andreasen, Jens Wenzel;

    2009-01-01

    The shape, structure, and orientation of rubbing-aligned cadmium selenide (CdSe) nanorods on polymer coated glass substrates have been studied using transmission electron microscopy (TEM) and grazing incidence X-ray scattering combined with computer simulations. The nanorods are found to be of...

  13. Structural studies of amorphous Se under pressure

    OpenAIRE

    Tanaka, Keiji

    1990-01-01

    X-ray-diffraction patterns, macroscopic compressibility, and crystallization in amorphous Se subject to pressure have been investigated. The material exhibits pressure-induced structural modifications in the glassy state and a phase transformation to the hexagonal phase at 120±20 kbar. The observations are discussed on the basis of microscopic and thermodynamic models.

  14. Evidences of protection against blood-stage infection of Plasmodium falciparum by the novel protein vaccine SE36.

    Science.gov (United States)

    Horii, Toshihiro; Shirai, Hiroki; Jie, Li; Ishii, Ken J; Palacpac, Nirianne Q; Tougan, Takahiro; Hato, Mariko; Ohta, Nobuo; Bobogare, Albino; Arakaki, Nana; Matsumoto, Yoshitsugu; Namazue, Junko; Ishikawa, Toyokazu; Ueda, Shigeharu; Takahashi, Michiaki

    2010-09-01

    An effective malaria vaccine is a public health priority. Proteins expressed during the blood-stage of the parasite life cycle have been proposed as good vaccine candidates. No such blood-stage vaccine, however, is available against Plasmodium falciparum, the deadliest Plasmodium species. We show here that P. falciparum serine repeat antigen 5 (SERA5) is a potential vaccine immunogen. We have constructed a new recombinant molecule of SERA5, namely SE36, based on previously reported SE47' molecule by removing the serine repeats. Epidemiological study in the holo-endemic population of Solomon Islands shows highly significant correlation of sero-conversion and malaria protective immunity against this antigen. Animal experiments using non-human primates, and a human phase 1a clinical trial assessed SE36 vaccine immunogenicity. Vaccination of squirrel monkeys with SE36 protein and aluminum hydroxyl gel (SE36/AHG) conferred protection against high parasitemia and boosted serum anti-SE36 IgG after P. falciparum parasite challenge. SE36/AHG was highly immunogenic in chimpanzees, where serum anti-SE36 IgG titers last more than one year. Phase 1a clinical trial (current controlled trials, ISRCTN78679862) demonstrated the safety and immunogenicity of SE36/AHG with 30 healthy adults and 10 placebo controls. Three subcutaneous administrations of 50 and 100microg dose of SE36/AHG were well-tolerated, with no severe adverse events; and resulted in 100% sero-conversion in both dose arms. The current research results for SE36/AHG provide initial clinical validation for future trials and suggest clues/strategies for further vaccine development. PMID:20493274

  15. Towards an Ontology for Reef Islands

    Science.gov (United States)

    Duce, Stephanie

    Reef islands are complex, dynamic and vulnerable environments with a diverse range of stake holders. Communication and data sharing between these different groups of stake holders is often difficult. An ontology for the reef island domain would improve the understanding of reef island geomorphology and improve communication between stake holders as well as forming a platform from which to move towards interoperability and the application of Information Technology to forecast and monitor these environments. This paper develops a small, prototypical reef island domain ontology, based on informal, natural language relations, aligned to the DOLCE upper-level ontology, for 20 fundamental terms within the domain. A subset of these terms and their relations are discussed in detail. This approach reveals and discusses challenges which must be overcome in the creation of a reef island domain ontology and which could be relevant to other ontologies in dynamic geospatial domains.

  16. Plasmonic Au islands on polymer nanopillars

    Energy Technology Data Exchange (ETDEWEB)

    Knoben, Wout; Brongersma, Sywert H; Crego-Calama, Mercedes, E-mail: wout.knoben@imec-nl.nl [Holst Centre/IMEC, High Tech Campus 31, 5656 AE Eindhoven (Netherlands)

    2011-07-22

    The refractive index sensitivity of localized surface plasmon resonance sensors can be improved by placing the plasmonic metal particles on pillars instead of on a planar substrate. In this paper, a simple and versatile colloidal lithography method for the fabrication of plasmonic Au islands on top of polymer nanopillars is described. The pillar height is controlled by varying the thickness of the initial polymer film. An increased pillar height results in a blue shift of the absorption spectrum of the Au islands. This is explained by a decreased effective refractive index around the islands. For pillars higher than approximately 40 nm no further blue shift is observed, in agreement with the decay length of the electromagnetic field around the islands. Pillar-supported Au islands were also fabricated on a flexible foil, demonstrating the potential of the method described here for the fabrication of flexible plasmonic substrates. Benefits and limitations of the method and of using polymers as the pillar material are discussed.

  17. Speciation of Se and DOC in soil solution and their relation to Se bioavailability.

    NARCIS (Netherlands)

    Weng, L.P.; Vega, F.A.; Supriatin, S.; Bussink, W.; Riemsdijk, van W.H.

    2011-01-01

    A 0.01 M CaCl2 extraction is often used to asses the bioavailability of plant nutrients in soils. However, almost no correlation was found between selenium (Se) in the soil extraction and Se content in grass. The recently developed anion Donnan membrane technique was used to analyze chemical speciat

  18. Ultra-Fast Synthesis for Ag2Se and CuAgSe Thermoelectric Materials

    Science.gov (United States)

    DUAN, H. Z.; LI, Y. L.; ZHAO, K. P.; QIU, P. F.; SHI, X.; CHEN, L. D.

    2016-10-01

    Ag2Se and CuAgSe have been recently reported as promising thermoelectric materials at room temperature. The traditional melting-annealing-sintering processes are used to grow Ag2Se and CuAgSe materials with the disadvantages of high costs of energy and time. In this work, phase-pure polycrystalline Ag2Se and CuAgSe compounds were synthesized from raw elemental powders directly by manual mixing followed by spark plasma sintering (MM-SPS) in a few minutes. The influence of SPS heating rate on the phase composition, microstructure, and thermoelectric properties, including Seebeck coefficient, electrical conductivity, and thermal conductivity, were investigated. The zTs of 0.8 at 390 K and 0.6 at 450 K are obtained for Ag2Se and CuAgSe, respectively, which is comparable with the values in the materials prepared by the traditional method. Furthermore, this ultrafast sample synthesis can significantly save material synthesis time and thus has the obvious advantage for large-scale production.

  19. Pivško jygajo se 'guncajo se' (Petelinje) ali o nastanku slovenskega razmerja jugati : gugati:

    OpenAIRE

    Furlan, Metka

    2010-01-01

    Since the Pivka dialect does not have second palatalization of velars, the verb jyugajo se 'they are swinging' (Petelinje), with its Slovene phonetic equivalents from Slovene gúgati se, is explained with dissimilation g : g --> o : g and the appearance of the prothetic -j.

  20. Epitaxial 2D MoSe2 (HfSe2) Semiconductor/2D TaSe2 Metal van der Waals Heterostructures.

    Science.gov (United States)

    Tsoutsou, Dimitra; Aretouli, Kleopatra E; Tsipas, Polychronis; Marquez-Velasco, Jose; Xenogiannopoulou, Evangelia; Kelaidis, Nikolaos; Aminalragia Giamini, Sigiava; Dimoulas, Athanasios

    2016-01-27

    Molecular beam epitaxy of 2D metal TaSe2/2D MoSe2 (HfSe2) semiconductor heterostructures on epi-AlN(0001)/Si(111) substrates is reported. Electron diffraction reveals an in-plane orientation indicative of van der Waals epitaxy, whereas electronic band imaging supported by first-principles calculations and X-ray photoelectron spectroscopy indicate the presence of a dominant trigonal prismatic 2H-TaSe2 phase and a minor contribution from octahedrally coordinated TaSe2, which is present in TaSe2/AlN and TaSe2/HfSe2/AlN but notably absent in the TaSe2/MoSe2/AlN, indicating superior structural quality of TaSe2 grown on MoSe2. Apart from its structural and chemical compatibility with the selenide semiconductors, TaSe2 has a workfunction of 5.5 eV as measured by ultraviolet photoelectron spectroscopy, which matches very well with the semiconductor workfunctions, implying that epi-TaSe2 can be used for low-resistivity contacts to MoSe2 and HfSe2. PMID:26727305

  1. 'Cold' crystallization in nanostructurized 80GeSe2-20Ga2Se3 glass.

    Science.gov (United States)

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe2-20Ga2Se3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized glasses testify in favor of structural fragmentation of larger free-volume entities into smaller ones. Nanocrystallites of Ga2Se3 and/or GeGa4Se8 phases and prevalent GeSe2 phase extracted mainly at the surface of thermally treated samples with preceding nucleation and void agglomeration in the initial stage of annealing are characteristic features of cold crystallization. PMID:25852346

  2. 'Cold' crystallization in nanostructurized 80GeSe2-20Ga2Se3 glass.

    Science.gov (United States)

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe2-20Ga2Se3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized glasses testify in favor of structural fragmentation of larger free-volume entities into smaller ones. Nanocrystallites of Ga2Se3 and/or GeGa4Se8 phases and prevalent GeSe2 phase extracted mainly at the surface of thermally treated samples with preceding nucleation and void agglomeration in the initial stage of annealing are characteristic features of cold crystallization.

  3. Synchrotron-radiation photoemission study of CdS/CuInSe sub 2 heterojunction formation

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, A.J.; Gebhard, S. (Solar Energy Research Institute, 1617 Cole Boulevard, Golden, CO (USA)); Rockett, A. (Department of Materials Science and Engineering, University of Illinois at Urbana-Champaign, Urbana, IL (USA)); Colavita, E. (Department of Physics, University of Calabria, I-87036 Arcavacata di Rende, Cosenza (Italy)); Engelhardt, M.; Hoechst, H. (Synchrotron Radiation Center, University of Wisconsin-Madison, Stoughton, WI (USA))

    1990-10-15

    Synchrotron-radiation soft-x-ray photoemission spectroscopy was used to investigate the development of the electronic structure at the CdS/CuInSe{sub 2} heterojunction interface. CdS overlayers were deposited in steps on single-crystal {ital p}- and {ital n}-type CuInSe{sub 2} at 250 {degree}C. Results indicate that the CdS grows in registry with the substrate, initially in a two-dimensional growth mode followed by three-dimensional island growth as is corroborated by reflection high-energy electron-diffraction analysis. Photoemission measurements were acquired after each growth in order to observe changes in the valence-band electronic structure as well as changes in the In 4{ital d}, Se 3{ital d}, Cd 4{ital d}, and S 2{ital p} core lines. The results were used to correlate the interface chemistry with the electronic structure at these interfaces and to directly determine the CdS/CuInSe{sub 2} heterojunction valence-band discontinuity and the consequent heterojunction band diagram. These results show that the Katnani-Margaritondo method is unreliable in determining offsets for heterojunctions where significant Fermi-level pinning may occur and where the local structure and chemistry of the interface depends strongly on the specific heterojunction.

  4. Radar Image of Galapagos Island

    Science.gov (United States)

    1994-01-01

    This is an image showing part of Isla Isabella in the western Galapagos Islands. It was taken by the L-band radar in HH polarization from the Spaceborne Imaging Radar C/X-Band Synthetic Aperture Radar on the 40th orbit of the space shuttle Endeavour. The image is centered at about 0.5 degree south latitude and 91 degrees west longitude and covers an area of 75 by 60 kilometers (47 by 37 miles). The radar incidence angle at the center of the image is about 20 degrees.The western Galapagos Islands, which lie about 1,200 kilometers (750 miles) west of Ecuador in the eastern Pacific, have six active volcanoes similar to the volcanoes found in Hawaii. Since the time of Charles Darwin's visit to the area in 1835, there have been over 60 recorded eruptions of these volcanoes. This SIR-C/X-SAR image of Alcedo and Sierra Negra volcanoes shows the rougher lava flows as bright features, while ash deposits and smooth pahoehoe lava flows appear dark. A small portion of Isla Fernandina is visible in the extreme upper left corner of the image.The Galapagos Islands are one of the SIR-C/X-SAR supersites and data of this area will be taken several times during the flight to allow scientists to conduct topographic change studies and to search for different lava flow types, ash deposits and fault lines.Spaceborne Imaging Radar-C and X-Synthetic Aperture Radar (SIR-C/X-SAR) is part of NASA's Mission to Planet Earth. The radars illuminate Earth with microwaves allowing detailed observations at any time, regardless of weather or sunlight conditions. SIR-C/X-SAR uses three microwave wavelengths: L-band (24 cm), C-band (6 cm) and X-band (3 cm). The multi-frequency data will be used by the international scientific community to better understand the global environment and how it is changing. The SIR-C/X-SAR data, complemented by aircraft and ground studies, will give scientists clearer insights into those environmental changes which are caused by nature and those changes which are induced by

  5. Patterns of island treeline elevation – a global perspective

    DEFF Research Database (Denmark)

    Irl, Severin David Howard; Anthelme, Fabian; Harter, David E. V.;

    2016-01-01

    hypothesize that, similar to the mainland, latitude-driven temperature variation is the most important determinant of island treeline elevation on a global scale. To test this hypothesis, we compared mainland with island treeline elevations. Then we focused 1) on the global effects of latitude, 2) on the...... regional effects of island type (continental vs oceanic islands) and 3) the local effects of several specific island characteristics (age, area, maximum island elevation, isolation and plant species richness). We collected a global dataset of islands (n = 86) by applying a stratified design using Google......Earth and the Global Island Database. For each island we extracted data on latitude and local characteristics. Treeline elevation decreased from the mainland through continental to oceanic islands. Island treeline elevation followed a hump-shaped latitudinal distribution, which is fundamentally different...

  6. Anisotropy in CdSe quantum rods

    Energy Technology Data Exchange (ETDEWEB)

    Li, Liang-shi

    2003-09-01

    The size-dependent optical and electronic properties of semiconductor nanocrystals have drawn much attention in the past decade, and have been very well understood for spherical ones. The advent of the synthetic methods to make rod-like CdSe nanocrystals with wurtzite structure has offered us a new opportunity to study their properties as functions of their shape. This dissertation includes three main parts: synthesis of CdSe nanorods with tightly controlled widths and lengths, their optical and dielectric properties, and their large-scale assembly, all of which are either directly or indirectly caused by the uniaxial crystallographic structure of wurtzite CdSe. The hexagonal wurtzite structure is believed to be the primary reason for the growth of CdSe nanorods. It represents itself in the kinetic stabilization of the rod-like particles over the spherical ones in the presence of phosphonic acids. By varying the composition of the surfactant mixture used for synthesis we have achieved tight control of the widths and lengths of the nanorods. The synthesis of monodisperse CdSe nanorods enables us to systematically study their size-dependent properties. For example, room temperature single particle fluorescence spectroscopy has shown that nanorods emit linearly polarized photoluminescence. Theoretical calculations have shown that it is due to the crossing between the two highest occupied electronic levels with increasing aspect ratio. We also measured the permanent electric dipole moment of the nanorods with transient electric birefringence technique. Experimental results on nanorods with different sizes show that the dipole moment is linear to the particle volume, indicating that it originates from the non-centrosymmetric hexagonal lattice. The elongation of the nanocrystals also results in the anisotropic inter-particle interaction. One of the consequences is the formation of liquid crystalline phases when the nanorods are dispersed in solvent to a high enough

  7. Urban heat islands in China enhanced by haze pollution

    Science.gov (United States)

    Cao, Chang; Lee, Xuhui; Liu, Shoudong; Schultz, Natalie; Xiao, Wei; Zhang, Mi; Zhao, Lei

    2016-08-01

    The urban heat island (UHI), the phenomenon of higher temperatures in urban land than the surrounding rural land, is commonly attributed to changes in biophysical properties of the land surface associated with urbanization. Here we provide evidence for a long-held hypothesis that the biogeochemical effect of urban aerosol or haze pollution is also a contributor to the UHI. Our results are based on satellite observations and urban climate model calculations. We find that a significant factor controlling the nighttime surface UHI across China is the urban-rural difference in the haze pollution level. The average haze contribution to the nighttime surface UHI is 0.7+/-0.3 K (mean+/-1 s.e.) for semi-arid cities, which is stronger than that in the humid climate due to a stronger longwave radiative forcing of coarser aerosols. Mitigation of haze pollution therefore provides a co-benefit of reducing heat stress on urban residents.

  8. Crystalline islands of semiconductor films

    Science.gov (United States)

    Zmievskaya, G. I.; Bondareva, A. L.

    2011-01-01

    Silicon carbide (SiC) nucleation in the form of powder in a discharge plasma and the formation of thin film islands on a Si(100) substrate in the course of gas-phase epitaxy are simulated numerically. Models of plasma-like media and nonequilibrium processes accompanying phase transitions of the first kind (such as condensation and crystallization) in the initial fast (fluctuation) stage are described. The nonstationary evolution of nuclei size distribution functions is modeled by solving kinetic equations in partial derivatives and stochastic Ito-Stratonovich analog equations. This makes it possible to refine the formation mechanisms of microcrystalline state polytypes and calculate the nucleation rate and the initial roughness of a SiC coating.

  9. SRTM Stereo Pair: Fiji Islands

    Science.gov (United States)

    2000-01-01

    The Sovereign Democratic Republic of the Fiji Islands, commonly known as Fiji, is an independent nation consisting of some 332 islands surrounding the Koro Sea in the South Pacific Ocean. This topographic image shows Viti Levu, the largest island in the group. With an area of 10,429 square kilometers (about 4000 square miles), it comprises more than half the area of the Fiji Islands. Suva, the capital city, lies on the southeast shore. The Nakauvadra, the rugged mountain range running from north to south, has several peaks rising above 900 meters (about 3000 feet). Mount Tomanivi, in the upper center, is the highest peak at 1324 meters (4341 feet). The distinct circular feature on the north shore is the Tavua Caldera, the remnant of a large shield volcano that was active about 4 million years ago. Gold has been mined on the margin of the caldera since the 1930s. The Nadrau plateau is the low relief highland in the center of the mountain range. The coastal plains in the west, northwest and southeast account for only 15 percent of Viti Levu's area but are the main centers of agriculture and settlement.This stereoscopic view was generated using preliminary topographic data from the Shuttle Radar Topography Mission. A computer-generated artificial light source illuminates the elevation data from the top (north) to produce a pattern of light and shadows. Slopes facing the light appear bright, while those facing away are shaded. Also, colors show the elevation as measured by SRTM. Colors range from green at the lowest elevations to pink at the highest elevations. This image contains about 1300 meters (4300 feet) of total relief. The stereoscopic effect was created by first draping the shading and colors back over the topographic data and then generating two differing perspectives, one for each eye. The 3-D perception is achieved by viewing the left image with the right eye and the right image with the left eye (cross-eyed viewing), or by downloading and printing the

  10. Whale shark (Rhincodon typus seasonal presence, residence time and habitat use at darwin island, galapagos marine reserve.

    Directory of Open Access Journals (Sweden)

    David Acuña-Marrero

    Full Text Available The life history of the whale shark (Rhincodon typus, including its reproductive ecology, still remains largely unknown. Here, we present results from the first whale shark population study around Darwin Island, Galapagos Marine Reserve. Following a diversified approach we characterized seasonal occurrence, population structure and size, and described habitat use of whale sharks based on fine scale movements around the island. Whale shark presence at Darwin Island was negatively correlated with Sea Surface Temperature (SST, with highest abundance corresponding to a cool season between July and December over six years of monitoring. From 2011 to 2013 we photo-identified 82 whale sharks ranging from 4 to 13.1 m Total Length (TL. Size distribution was bimodal, with a great majority (91.5% of adult female individuals averaging 11.35 m±0.12 m (TL±SE, all but one showing signs of a potential pregnancy. Population dynamics models for apparently pregnant sharks estimated the presence of 3.76±0.90 (mean ± SE sharks in the study area per day with an individual residence time of 2.09±0.51 (mean ± SE days. Movement patterns analysis of four apparently pregnant individuals tracked with acoustic tags at Darwin Island revealed an intense use of Darwin's Arch, where no feeding or specific behavior has been recorded, together with periodic excursions around the island's vicinity. Sharks showed a preference for intermediate depths (20-30 m with occasional dives mostly to mid-water, remaining the majority of their time at water temperatures between 24-25°C. All of our results point to Darwin Island as an important stopover in a migration, possibly with reproductive purposes, rather than an aggregation site. Current studies carried out in this area to investigate regional scale movement patterns may provide essential information about possible pupping grounds for this enigmatic species.

  11. Whale shark (Rhincodon typus) seasonal presence, residence time and habitat use at darwin island, galapagos marine reserve.

    Science.gov (United States)

    Acuña-Marrero, David; Jiménez, Jesús; Smith, Franz; Doherty, Paul F; Hearn, Alex; Green, Jonathan R; Paredes-Jarrín, Jules; Salinas-de-León, Pelayo

    2014-01-01

    The life history of the whale shark (Rhincodon typus), including its reproductive ecology, still remains largely unknown. Here, we present results from the first whale shark population study around Darwin Island, Galapagos Marine Reserve. Following a diversified approach we characterized seasonal occurrence, population structure and size, and described habitat use of whale sharks based on fine scale movements around the island. Whale shark presence at Darwin Island was negatively correlated with Sea Surface Temperature (SST), with highest abundance corresponding to a cool season between July and December over six years of monitoring. From 2011 to 2013 we photo-identified 82 whale sharks ranging from 4 to 13.1 m Total Length (TL). Size distribution was bimodal, with a great majority (91.5%) of adult female individuals averaging 11.35 m±0.12 m (TL±SE), all but one showing signs of a potential pregnancy. Population dynamics models for apparently pregnant sharks estimated the presence of 3.76±0.90 (mean ± SE) sharks in the study area per day with an individual residence time of 2.09±0.51 (mean ± SE) days. Movement patterns analysis of four apparently pregnant individuals tracked with acoustic tags at Darwin Island revealed an intense use of Darwin's Arch, where no feeding or specific behavior has been recorded, together with periodic excursions around the island's vicinity. Sharks showed a preference for intermediate depths (20-30 m) with occasional dives mostly to mid-water, remaining the majority of their time at water temperatures between 24-25°C. All of our results point to Darwin Island as an important stopover in a migration, possibly with reproductive purposes, rather than an aggregation site. Current studies carried out in this area to investigate regional scale movement patterns may provide essential information about possible pupping grounds for this enigmatic species.

  12. Whale shark (Rhincodon typus) seasonal presence, residence time and habitat use at darwin island, galapagos marine reserve.

    Science.gov (United States)

    Acuña-Marrero, David; Jiménez, Jesús; Smith, Franz; Doherty, Paul F; Hearn, Alex; Green, Jonathan R; Paredes-Jarrín, Jules; Salinas-de-León, Pelayo

    2014-01-01

    The life history of the whale shark (Rhincodon typus), including its reproductive ecology, still remains largely unknown. Here, we present results from the first whale shark population study around Darwin Island, Galapagos Marine Reserve. Following a diversified approach we characterized seasonal occurrence, population structure and size, and described habitat use of whale sharks based on fine scale movements around the island. Whale shark presence at Darwin Island was negatively correlated with Sea Surface Temperature (SST), with highest abundance corresponding to a cool season between July and December over six years of monitoring. From 2011 to 2013 we photo-identified 82 whale sharks ranging from 4 to 13.1 m Total Length (TL). Size distribution was bimodal, with a great majority (91.5%) of adult female individuals averaging 11.35 m±0.12 m (TL±SE), all but one showing signs of a potential pregnancy. Population dynamics models for apparently pregnant sharks estimated the presence of 3.76±0.90 (mean ± SE) sharks in the study area per day with an individual residence time of 2.09±0.51 (mean ± SE) days. Movement patterns analysis of four apparently pregnant individuals tracked with acoustic tags at Darwin Island revealed an intense use of Darwin's Arch, where no feeding or specific behavior has been recorded, together with periodic excursions around the island's vicinity. Sharks showed a preference for intermediate depths (20-30 m) with occasional dives mostly to mid-water, remaining the majority of their time at water temperatures between 24-25°C. All of our results point to Darwin Island as an important stopover in a migration, possibly with reproductive purposes, rather than an aggregation site. Current studies carried out in this area to investigate regional scale movement patterns may provide essential information about possible pupping grounds for this enigmatic species. PMID:25551553

  13. Iwill P4SE-Gold

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    这是Iwill公司865PE产品线中的一款高档产品。主板要用红色PCB.整体布局显得比较紧凑。P4SE-Gold同时集成了Intel 82547EI千兆网卡芯片和Realtek RTL8100百兆网卡芯片,如果你家中有两台PC需要共享Internet连接.这块主板倒是可以省去额外添置网卡的麻烦。P4SE-Gold在I/O接口的设计上也比较特殊.它集成了2个以太网卡接口,

  14. Bats of the Western Indian Ocean Islands

    Directory of Open Access Journals (Sweden)

    John O’Brien

    2011-08-01

    Full Text Available The natural colonisation of many remote oceanic islands by bats, including those of the western Indian Ocean, has been facilitated by their unique capability among mammals for powered flight. In the western Indian Ocean region, only the Malagasy islands of Madagascar and the Comoros archipelago have been naturally colonised by non-volant mammals. Despite their greater potential for inter-island dispersal, and thus gene transfer, endemicity of Chiroptera in the western Indian Ocean islands is high. Given their vulnerability to stochastic and anthropogenic disturbances, greater focus needs to be placed on investigating the demographic and ecological history of bats on Western Indian Ocean islands to safeguard not only their future, but also the ecosystem functioning on these islands, for which they are undoubtedly such an integral part. Here, I summarise the taxonomic and life history information available on bats from Western Indian Ocean islands and highlight knowledge gaps and conservation issues that threaten the continued persistence of some species.

  15. Amchitka Island, Alaska, special sampling project 1997

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, Nevada Operations Office

    2000-06-28

    This 1997 special sampling project represents a special radiobiological sampling effort to augment the 1996 Long-Term Hydrological Monitoring Program (LTHMP) for Amchitka Island in Alaska. Lying in the western portion of the Aleutian Islands arc, near the International Date Line, Amchitka Island is one of the southernmost islands of the Rat Island Chain. Between 1965 and 1971, the U.S. Atomic Energy Commission conducted three underground nuclear tests on Amchitka Island. In 1996, Greenpeace collected biota samples and speculated that several long-lived, man-made radionuclides detected (i.e., americium-241, plutonium-239 and -240, beryllium-7, and cesium-137) leaked into the surface environment from underground cavities created during the testing. The nuclides of interest are detected at extremely low concentrations throughout the environment. The objectives of this special sampling project were to scientifically refute the Greenpeace conclusions that the underground cavities were leaking contaminants to the surface. This was achieved by first confirming the presence of these radionuclides in the Amchitka Island surface environment and, second, if the radionuclides were present, determining if the source is the underground cavity or worldwide fallout. This special sampling and analysis determined that the only nonfallout-related radionuclide detected was a low level of tritium from the Long Shot test, which had been previously documented. The tritium contamination is monitored and continues a decreasing trend due to radioactive decay and dilution.

  16. Water resources of the Yap Islands

    Science.gov (United States)

    Van der Brug, Otto

    1984-01-01

    The Yap Islands consist of four major islands, Yap, Gagil-Tamil, Maap, and Rumung. Of these, Yap Island has more than half the total land area, most of the population, and almost all of the economic development. The islands of Maap and Rumung together compose only 15 percent of the land area and population. Average annual rainfall over the Yap Islands amounts to 122 inches. Rainfall-runoff comparisons indicate that about half of the annual rainfall runs off to the ocean on Yap Island and Gagil-Tamil. Streams on Gagil-Tamil are perennial but streams on Yap Island are dry an average of 3 months per year due to geologic differences. Analyses of water samples from 23 sources show the good quality and the chemical similarity of surface and ground water. This report summarizes the hydrologic data collected and provides interpretations that can be used by the planning and public works officials of Yap to make decisions concerning development and management of their water resources.

  17. Fuelwood production in Prince Edward Island

    International Nuclear Information System (INIS)

    The most recent Prince Edward Island Fuelwood Survey occurred in 1990-91. Consumption of fuelwood rose again to 49% of Prince Edward Island's 43,170 households. Total residential fuelwood consumption was estimated to be 242,000 m3. The fuelwood industry makes an important contribution to the economy of Prince Edward Island. In the 1990-91 heating season, fuelwood valued at USD 9 million displaced approximately 43 million litres of domestic heating oil valued at USD 16.4 million. In addition, it is estimated that 70 cents of every dollar spent on fuelwood remains in the province and contributes spin-off benefits, whereas 90 cents of every dollar spent on heating oil is lost to the economy of Prince Edward Island. The percentage of people cutting their own fuelwood decreased from 52 in 1984-85 to only 23.4 in 1990-91. The governments of Canada and Prince Edward Island have implemented a series of Forest Resource Development Agreements (FRDAs) starting in 1983. The current 1988-1993 FRDA provides USD 24 million for research and incentives for reforestation and management of Prince Edward Island woodlots. It is expected that 3,800 Prince Edward Island woodlot owners will be participating in a woodlot management program by 1993. Silviculture treatments of hardwood stands include thinning, stand conversion (removal of lowgrade softwoods such as balsam fir in mainly hardwood stands), and shelterwood (strip) cutting, particularly in marginal stands. (9 refs.)

  18. Kan pædagogen se barnet

    DEFF Research Database (Denmark)

    Øhrgaard, Per

    2008-01-01

    relationer er noget levende og foranderligt. Begrebet Kontekst fremhæves ligeledes som et vigtigt begreb, der understreger, at moderne børn må lære at være kontekst-følsomme. Børnene må lære, at forskellige kontekster efterspørger forskellig adfærd. Pædagogerne må se institutionen som et læringsrum hvor...

  19. Experience with the SE in Germany

    Directory of Open Access Journals (Sweden)

    Jochem Reichert

    2008-03-01

    Full Text Available A rather significant proportion of the Societas Europaeas (the European Company, or SE formed to date have had German roots. German corporate law has been enriched by an interesting alternative which meanwhile seems to have gained momentum. This contribution focuses on SEs incorporated by German entrepreneurs and provides an interesting account concerning the use of SEs in Germany in practice, such as Allianz, Fresenius, BASF and Porsche. Has the SE been used to circumvent rigid company law provisions or is it a more flexible and effective tool, perhaps, for company mobility? The practical motives behind setting up this company form are also reflected upon. These include: the facilitation of cross-border mergers; transfer of the registered office; the ‘European’ image; a more flexible form of co-determination in large companies (reduction of the number of supervisory board members; avoidance and freezing of co-determination for medium-sized enterprises; the appeal of the one-tier system and its endangerment by German co-determination; and flat and uniform structures for company groups. The author also briefly discusses some of the problems arising from the formation of SEs in Germany. He ultimately concludes that practice has shown that it is possible to work with the legal regime of the SE in Germany, which adds a new company form to those available in that Member State.

  20. Thermoelectric properties of SnSe compound

    International Nuclear Information System (INIS)

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data

  1. Forming Glasses from Se and Te

    Directory of Open Access Journals (Sweden)

    Pierre Lucas

    2009-10-01

    Full Text Available Despite being close neighbors on the Periodic Table, selenium and tellurium present a totally different abilities to form glasses. Se is a very good glass former, and gives rise to numerous glass compositions which are popular for their transparency in the infrared range and their stability against crystallization. These glasses can be shaped into sophisticated optical devices such as optical fibers, planar guides or lenses. Nevertheless, their transparencies are limited at about 12 μm (depending on the thickness of the optical systems due to the relatively small mass of the Se element. On the other hand, tellurium is heavier and its use in substitution for Se permits to shift the IR cutoff beyond 20 μm. However, the semimetallic nature of Te limits its glass formation ability and this glass family is known to be unstable and consequently has found application as phase change material in the Digital Versatile Disk (DVD technology. In this paper, after a review of selenide glasses and their applications, it will be shown how, in a recent past, it has been possible to stabilize tellurium glasses by introducing new elements like Ga or I in their compositions.

  2. Patrimonio cultural: lo intangible se hace tangible

    Directory of Open Access Journals (Sweden)

    William Heredia Orjuela

    2004-11-01

    Full Text Available Se presentan tres reflexiones a manera de ensayo, elaboradas por estudiantes de vii semestre de la Facultad de Administración de Empresas Turísticas y Hoteleras. El tema central que engloba los escritos es el de la responsabilidad frente al patrimonio cultural, su valoración y su relación con el turismo. En el ensayo La protección del patrimonio cultural como reflejo del ser humano, la estudiante cecilia hinosTrosa hace un llamado de atención frente al problema del tráfico ilícito de bienes que conlleva la pérdida de testimonios de la cultura humana. El escrito de la estudiante mariel cecilia hernández destaca las bondades de recuperar las tradiciones y de cómo éstas se pueden difundir a través del turismo. Por último, el estudiante William heredia hace una reflexión sobre la tangibilidad de lo intangible, en el ensayo Patrimonio Cultural: lo tangible se hace intangible, donde destaca la declaratoria del Carnaval de Barranquilla como patrimonio oral e intangible de la humanidad.

  3. Thermoelectric properties of SnSe compound

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Xinhong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Lu, Pengfei, E-mail: photon@bupt.edu.cn [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Wu, Liyuan; Han, Lihong [State Key Laboratory of Information Photonics and Optical Communications, Ministry of Education, Beijing University of Posts and Telecommunications, P.O. Box 72, Beijing 100876 (China); Liu, Gang [School of Electronic Engineering, Beijing University of Posts and Telecommunications, Beijing 100876 (China); Song, Yuxin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Wang, Shumin [State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, Shanghai 200050 (China); Photonics Laboratory, Department of Microtechnology and Nanoscience, Chalmers University of Technology, 41296 Gothenburg (Sweden)

    2015-09-15

    Highlights: • The electronic and thermoelectric properties of SnSe bulk material are studied. • The ZT can reach as high as 1.87 along yy and 1.6 along zz direction at 800k. • SnSe is an indirect-band material, and SOC has little effect on the band structure. • The high ZT can be attributed to the intrinsically ultralow thermal conductivity. - Abstract: A first-principles study and Boltzmann transport theory have been performed to evaluate the electronic structure and thermoelectric properties of SnSe compound. The energy band structure and density of states are studied in detail. The electronic transport coefficients are then calculated as a function of chemical potential or temperature within the assumption of the constant relaxation time. The figure of merit ZT is obtained with the use of calculated thermoelectric properties and can reach as high as 1.87 along yy and 1.6 along zz direction at 800 K. Our theoretical result agrees well with previous experimental data.

  4. Breeding productivity of Smith Island black ducks

    Science.gov (United States)

    Haramis, G.M.; Jorde, D.G.; Olsen, G.H.; Stotts, D.B.; Harrison, M.K.; Perry, M.C.

    2002-01-01

    We investigated the breeding performance of American black ducks (Anas rubripes) on Smith Island, Chesapeake Bay, to improve our understanding of island black duck breeding ecology and to make management recommendations to enhance productivity. During 1995-96, we implanted 56 female black ducks with 20-g radio transmitters and tracked 35 of the individuals through the breeding season to locate nests, determine nest fate, and identify brood habitat. We also increased preseason banding efforts and compared capture characteristics over 12 years with those from the Deal Island Wildlife Management Area, a banding site on the mainland of Tangier Sound. A low rate of nesting (37%), lack of renesting, and poor hatching success (31%) indicated that island salt marsh habitats present a harsh environment for breeding black ducks. Black ducks located 11 of 13 nests (85%) in black needlerush (Juncus roemerianus) marsh where they were vulnerable to flooding from extreme tides and to egg predators. No nests were found on forested tree hammocks, a feature that distinguishes Smith Island from nearby South Marsh and Bloodsworth Islands. Nest predators included red foxes (Vulpes vulpes), herring gulls (Larus argentams), fish crows (Corvus ossifragus), and, potentially, Norway rats (Rattus norvegicus). Unlike mainland red foxes, foxes radio tracked on Smith Island were found to be capable swimmers and effective low marsh predators. We found shoreline meadows of widgeon grass (Ruppia maritima) to be important foraging sites for black ducks and suspected that the virtual absence of fresh water in this high salinity environment (1217+ ppt) to incur some cost in terms of growth and survival of ducklings. Preseason bandings revealed a high proportion of banded adults and a strong positive correlation in age ratios with the Deal Island banding site. This latter finding strongly suggests a negative universal effect of storm tides on nest success for Tangier Sound black ducks. Management to

  5. In Brief: Tsunami hits the Solomon Islands

    Science.gov (United States)

    Zielinski, Sarah

    2007-04-01

    A magnitude 8.1 earthquake shook the Solomon Islands on 1 April at approximately 7:40 A.M. local time. The earthquake generated a tsunami several meters high that struck many of the islands. The earthquake occurred along the boundary of the Pacific plate where the Australia, Woodlark, and Solomon Sea plates subduct beneath it, according to the U.S. Geological Survey's Earthquake Hazards Program. At least 34 people were killed by the tsunami and several dozen more are still missing, according to the National Disaster Council in the Solomon Islands. The NDC estimates that 900-2500 homes were destroyed by the tsunami, displacing about 5500 people.

  6. The Maltese Islands : climate, vegetation and landscape

    OpenAIRE

    Schembri, Patrick J.

    1997-01-01

    The Maltese Islands, situated in the central Mediterranean, occupy an area of only some 316 km. The climate is typically Mediterranean: the average annual rainfall is c.530mm of which some 85% falls during the period October to March; the mean monthly temperature range is 12-26°C, and the islands are very windy and sunny. Although small, the Maltese Islands have a considerable diversity of landscapes and ecosystems which are representative of the range and variety of those of the Mediterranea...

  7. Quantifying and interpreting nestedness in habitat islands

    DEFF Research Database (Denmark)

    Matthews, Thomas J.; Cottee-Jones, H. Eden W.; Whittaker, Robert James

    2015-01-01

    Aim: The concept of nestedness is important in determining the relative contribution to overall system diversity of different habitat patches within a fragmented system. Much of the previous work on nestedness has focused on islands within oceans (islands sensu stricto). The largest analysis...... with fragment area, suggesting that structured extinctions may be important in determining the composition of certain habitat island communities. We found that the degree of nestedness in an archipelago is an important consideration for systematic conservation planning. Main conclusions: Significant nestedness...

  8. Structure, composition and age of the small islands of Santa Luzia, Branco and Raso (Cape Verde Archipelago)

    Science.gov (United States)

    Ancochea, Eumenio; Huertas, María José; Hernán, Francisco; Brändle, José Luis; Alonso, Mar

    2015-09-01

    The northern alignment of Cape Verde Archipelago contains three small islands in its central sector: Santa Luzia, Branco and Raso on which there is very scarce geological, petrological or geochronological information available. The three islands along with the island of São Vicente arise on a continuous underwater relief less than 50 m deep and about 70 km long that formed from separate volcanic edifices. The southernmost island, Raso is formed by accumulation of several tens of lava flows and some remaining strombolian cones. An erosion surface covered by sediments allows the separation of two different episodes of growth: the lower one older than 2 Ma, and the upper one between 0.9 and 1.2 Ma. The smaller island of Branco is the remnant of a large stratovolcano about 6 km in radius, 1000 m of altitude and between 5 and 6 Ma in age. Santa Luzia, the northernmost and largest island of this particular group is essentially a remaining rift zone between 4 and 7 Ma old, at least 600 m high, about 10 km long and 7 km wide. The SE extreme of the island is occupied by rocks of an older partially submarine stage of growth which, also include gabbroic intrusions crossed by a dense network of dikes whose age may be estimated in 8 Ma or more. On the contrary, the NW end shows the only remains of late post-erosion activity that is of much less volumetric importance and it has been dated between 0.8 and 1.4 Ma. The three islands as a whole are formed by moderately or strongly alkaline, basic and ultrabasic rocks similar to those found in the neighboring island of São Vicente. Ultraalkaline rocks only appear in Raso and differentiate types as trachyandesites and phonolites are exclusively found in Santa Luzia. The similar age found for the main stages of growth recorded in the mentioned four islands and, even more, in the other two islands: Santo Antão and São Nicolau situated at the end of the Barlovento alignment, are not easily comprehensible with evolution models

  9. Abundance and survival rates of the Hawai'i Island associated spinner dolphin (Stenella longirostris stock.

    Directory of Open Access Journals (Sweden)

    Julian A Tyne

    Full Text Available Reliable population estimates are critical to implement effective management strategies. The Hawai'i Island spinner dolphin (Stenella longirostris is a genetically distinct stock that displays a rigid daily behavioural pattern, foraging offshore at night and resting in sheltered bays during the day. Consequently, they are exposed to frequent human interactions and disturbance. We estimated population parameters of this spinner dolphin stock using a systematic sampling design and capture-recapture models. From September 2010 to August 2011, boat-based photo-identification surveys were undertaken monthly over 132 days (>1,150 hours of effort; >100,000 dorsal fin images in the four main resting bays along the Kona Coast, Hawai'i Island. All images were graded according to photographic quality and distinctiveness. Over 32,000 images were included in the analyses, from which 607 distinctive individuals were catalogued and 214 were highly distinctive. Two independent estimates of the proportion of highly distinctive individuals in the population were not significantly different (p = 0.68. Individual heterogeneity and time variation in capture probabilities were strongly indicated for these data; therefore capture-recapture models allowing for these variations were used. The estimated annual apparent survival rate (product of true survival and permanent emigration was 0.97 SE ± 0.05. Open and closed capture-recapture models for the highly distinctive individuals photographed at least once each month produced similar abundance estimates. An estimate of 221 ± 4.3 SE highly distinctive spinner dolphins, resulted in a total abundance of 631 ± 60.1 SE, (95% CI 524-761 spinner dolphins in the Hawai'i Island stock, which is lower than previous estimates. When this abundance estimate is considered alongside the rigid daily behavioural pattern, genetic distinctiveness, and the ease of human access to spinner dolphins in their preferred resting habitats, this

  10. FBSAD Recruit Reef Fish Belt Transect Survey at Hawaii Island (Big Island), Main Hawaiian Islands, 2005 (NODC Accession 0046935)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Shore-based belt transects were conducted at 8-13 m depths at 3 longshore sites on the leeward coast (North and South Kohala districts) of the Big Island (Hawaii...

  11. FBSAB RECRUIT Reef Fish Belt Transect Survey at Hawaii Island (Big Island), Main Hawaiian Islands, 2009 (NODC Accession 0073870)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Shore-based belt transects were conducted at 1 to ~ 5 m depths at a total two (2) sites on the leeward coast (South Kohala district) of the Big Island (Hawaii...

  12. 33 CFR 117.615 - Plum Island River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Plum Island River. 117.615... DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Massachusetts § 117.615 Plum Island River. The draw of the Plum Island Turnpike Bridge, mile 3.3 between Newburyport and Plum Island, shall operate...

  13. Studying Islands: On Whose Terms? Some Epistemological and Methodological Challenges to the Pursuit of Island Studies

    Directory of Open Access Journals (Sweden)

    Godfrey Baldacchino

    2008-05-01

    Full Text Available The pursuit of nissology, or island studies, calls for a re-centering of focus from mainland to island, away from the discourse of conquest of mainlanders, giving voice and platform for the expression of island narratives. Yet, studying islands ‘on their own terms’, in spite of its predilection for “authenticity”, is fraught with epistemological and methodological difficulties. The insider/outsider distinction does not work all that well when it comes to islands, where hybridity is the norm. This paper seeks to extend this debate, grappling especially with the contributions of Grant McCall and Peter Hay to the sparse literature. Five dilemmas related to indigenous island geographies are presented and discussed, in a semi-autobiographical style.

  14. Adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene: First principle calculations

    Energy Technology Data Exchange (ETDEWEB)

    Üzengi Aktürk, O., E-mail: ouzengi@adu.edu.tr [Department of Physics, Adnan Menderes University, Aydın 09100 (Turkey); Tomak, M. [Department of Physics, Middle East Technical University, Ankara 06800 (Turkey)

    2015-08-30

    Highlights: • Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. • It is found that RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic. • RuSe{sub 2} makes it half metallic and RuSe{sub 3} makes semiconductor. - Abstract: We have investigated the adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene. The change of the adsorption energy with the number of Se atoms and magnetization values are investigated. Electronic properties of adsorption of RuSe{sub x} (x =1–5) cluster on Se-doped graphene are investigated. The highest adsorption energy belongs to RuSe adsorbate. The biggest magnetization value belongs to RuSe{sub 2} adsorbate. This adsorbate makes the substrate half metallic. This property is important in electronic device applications. It is observed that substitutional Se atom changes the electronic properties of graphene. This substitution makes graphene metallic. While RuSe, RuSe{sub 4}, RuSe{sub 5} adsorbate make substrate metallic, RuSe{sub 3} makes it semiconducting. Generally, it is found that there is a charge transfer from the substrate to clusters within the Löwdin analysis. This is in line with the charge difference results.

  15. Bryogeography of the Galapagos Islands

    NARCIS (Netherlands)

    Gradstein, S.R.; Weber, William A.

    1982-01-01

    De las Islas Galápagos se conoce más de 200 especies de briófitas (el número total de los musgos y de las hepáticas es de mas o menos igual). Más que 2/3 partes de las especies occurren en la selva y matorrales perennifolias y húmedas limitadas a las zonas altas de algunas islas. Una proporción elev

  16. ZnSe-ZnMnSe and CdTe-CdMnTe superlattices

    Science.gov (United States)

    Gunshor, R. L.; Kolodziejski, L. A.; Otsuka, N.; Datta, S.

    1986-08-01

    We report the growth and characterization of superiattices of a new wide-gap, zincblende material system, Zn 1 - xMn xSe. ZnSe exhibiting dominant free excitonic emission in photoluminescence (PL) is the well material, while wider-band-gap Zn 1 - xMn xSe (0.23 efficiency compared to films of the ZnSe well material, while transmission electron microscopy shows extremely abrupt interfaces by the presence of seventh-order satellite spots. Previously reported superiattices in the CdTe-CdMnTe material system were grown with the (111) orientation, and exhibit unique excitonic properties believed related to the (111) interfaces. Using various techniques to select (111) or (100) heteroepitaxy of CdTe on (100) GaAs, we report the first (100) superlattices of this material, and compare the optical properties to the previous (111) structures.

  17. 77Se nuclear magnetic resonance of topological insulator Bi2Se3

    Science.gov (United States)

    Georgieva, Nataliya M.; Rybicki, Damian; Guehne, Robin; Williams, Grant V. M.; Chong, Shen V.; Kadowaki, Kazuo; Garate, Ion; Haase, Jürgen

    2016-05-01

    Topological insulators constitute a new class of materials with an energy gap in the bulk and peculiar metallic states on the surface. We report on new features resulting from the bulk electronic structure, based on a comprehensive nuclear magnetic resonance (NMR) study of 77Se on Bi2Se3 and Cu0.15Bi2Se3 single crystals. First, we find two resonance lines and show that they originate from the two inequivalent Se lattice sites. Second, we observe unusual field-independent linewidths and attribute them to an unexpectedly strong internuclear coupling mediated by bulk electrons. In order to support this interpretation, we present a model calculation of the indirect internuclear coupling and show that the Bloembergen-Rowland coupling is much stronger than the Ruderman-Kittel-Kasuya-Yosida coupling. Our results call for a revision of earlier NMR studies and add information concerning the bulk electronic properties.

  18. "Sex and the Island": Lives of Single Women in Prince Edward Island

    OpenAIRE

    COLLINS, Kristen

    2011-01-01

    This article considers the significance attributed to Prince Edward Island in managing a marginalized single female identity, as presented by accounts of thirty never-married and previously-married Island women, aged twenty-seven through sixty-five. As popular media and social narratives overwhelmingly position contemporary single women against an urban backdrop, the question arises as to whether unmarried Island women feel "marooned" in ways their urban counterparts may not. In accordance wi...

  19. Quasikristalle und verwandte Phasen im System Zn-Mg-SE (SE=Y, Er, Ho, Dy)

    OpenAIRE

    Sterzel, Roland

    2003-01-01

    Ziel dieser Arbeit ist die Herstellung und Charakterisierung von Zn-Mg-SE-Legierungen (SE = Y, Ho, Er, Dy, Tb, Gd), um Informationen über Struktur, Stabilisierung und physikalische Eigenschaften der quasikristallinen Phasen dieses Systems zu erhalten. Die Quasikristalle dieses Systems unterscheiden sich von Quasikristallen anderer Legierungen, die meist Al als Hauptkomponente enthalten. Es konnten bis zu 275 mm3 große Einkristalle der flächenzentriert ikosaedrischen Phase in den Systemen Zn-M...

  20. Temperature dependence of excitonic transition in ZnSe/ZnCdSe quantum wells

    Institute of Scientific and Technical Information of China (English)

    GUO Zi-zheng; LIANG Xi-xia; BAN Shi-liang

    2005-01-01

    A theoretical calculation for the temperature dependence of the excitonic transition in ZnSe/ZnCdSe quantum wells is performed. The exciton binding energy is calculated with a variational technique by considering the temperature-dependence parameters. Our results show that the exciton binding energy reduces linearly with temperature increasing. We find that the strain due to lattice mismatch and differential thermal expansion decreases with the temperature increasing.

  1. Anomalous scaling of Cu-island dynamics on Ag(100)

    Energy Technology Data Exchange (ETDEWEB)

    Zaum, Christopher; Morgenstern, Karina [Institut fuer Festkoerperphysik, Gottfried Wilhelm Leibniz Universitaet, Appelstr. 2, D-30167 Hannover (Germany)

    2008-07-01

    We deposited Cu-islands containing 10 to 500 atoms on a clean Ag(100) surface at room temperature and investigated diffusion and decay of these islands with a fast scanning tunneling microscope. Islands at sizes above 80 atoms per island are adsorbed in hollow-sites. Islands at sizes below 80 atoms per island are adsorbed in bridge-sites. Diffusion and decay behavior of the hollow-site islands is similar to the behavior of both Ag-islands on Ag(100) and Cu-islands on Cu(100). In contrast, the diffusivity and the decay time of the bridge-site islands are significantly higher than any previously measured values. This indicates a novel mechanism of diffusion.

  2. Researching Pacific island livelihoods: mobility, natural resource management and nissology.

    Science.gov (United States)

    Christensen, Andreas E; Mertz, Ole

    2010-01-01

    Small island literature is vast in focus and aim, and is rooted in many different disciplines. The challenge is to find common grounds for researching small islands conceptually and theoretically. The aim of this article is to comment on how to research small islands, including a discussion on contemporary theories of nissology and conceptual analytical frameworks for island research. Through a review of selected case-study-based island literature on changing livelihoods coming out of the South Pacific, we wish to illustrate and discuss advantages of finding common grounds for small island studies. The focus is on two dimensions of island livelihood, migration and natural resource management, both of which are significant contributors in making island livelihoods and shaping Pacific seascapes. We argue that there is still a substantial lack of studies targeting small island dynamics that are empirical and interdisciplinary in focus and link socio-economic and ecological processes of small island societies at temporal and analytical scales.

  3. Energy dynamics in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Heimbrodt, Wolfram; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam [Department of Physics and Material Sciences Center, Phillipps-University Marburg (Germany)

    2009-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between dilute magnetic ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The DQWs have been studied by cw and time resolved spectroscopy in external magnetic fields up to 7 Tesla. The ZnSe quantum wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is the main difference to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures with heavy hole excitons being the lowest lying states. In the magnetic field we were able to change the barrier height, to split the states of the wells due to the Giant-Zeeman-effect of the ZnMnSe barriers and to manipulate the radiationless energy transfer processes between the 3d-internal transitions and the excitonic states. As a result of the sophisticated interaction of these mechanisms a unique excitation energy dynamics was found and is discussed in detail.

  4. Tunnelling process in ZnSe/ZnMnSe double-quantum-well structures

    Energy Technology Data Exchange (ETDEWEB)

    Jankowski, Stephanie; Niebling, Tobias; Heimbrodt, Wolfram [Phillipps-University Marburg (Germany). Department of Physics and Matrial Science Center

    2008-07-01

    Asymmetric ZnSe/ZnMnSe double-quantum-well (DQW) structures with different barrier width have been grown between ZnMnSe cladding layers on a (100)GaAs substrate with a ZnSe buffer. The ZnSe wells are under tensile strain in these DQW structures yielding the light-hole exciton states to be the energetically lowest lying states. This is different to earlier papers, where tunnelling of carriers and excitons have been studied in DQW structures made of diluted magnetic semiconductors with heavy hole excitons to be the lowest lying states. In an external magnetic field we were able to manipulate the barrier height due to Giant Zeeman effect of the ZnMnSe barriers. Hence we can study the tunnelling processes in these structures in dependence of the height and width of the barrier by photoluminescence, photomodulated reflectivity as well as time resolved measurements. Surprisingly, very different results to heavy hole tunnelling have been found. The obtained results and differences will be discussed in detail.

  5. Long Island Smart Energy Corridor

    Energy Technology Data Exchange (ETDEWEB)

    Mui, Ming [Long Island Power Authority, Uniondale, NY (United States)

    2015-02-04

    The Long Island Power Authority (LIPA) has teamed with Stony Brook University (Stony Brook or SBU) and Farmingdale State College (Farmingdale or FSC), two branches of the State University of New York (SUNY), to create a “Smart Energy Corridor.” The project, located along the Route 110 business corridor on Long Island, New York, demonstrated the integration of a suite of Smart Grid technologies from substations to end-use loads. The Smart Energy Corridor Project included the following key features: -TECHNOLOGY: Demonstrated a full range of smart energy technologies, including substations and distribution feeder automation, fiber and radio communications backbone, advanced metering infrastructure (AM”), meter data management (MDM) system (which LIPA implemented outside of this project), field tools automation, customer-level energy management including automated energy management systems, and integration with distributed generation and plug-in hybrid electric vehicles. -MARKETING: A rigorous market test that identified customer response to an alternative time-of-use pricing plan and varying levels of information and analytical support. -CYBER SECURITY: Tested cyber security vulnerabilities in Smart Grid hardware, network, and application layers. Developed recommendations for policies, procedures, and technical controls to prevent or foil cyber-attacks and to harden the Smart Grid infrastructure. -RELIABILITY: Leveraged new Smart Grid-enabled data to increase system efficiency and reliability. Developed enhanced load forecasting, phase balancing, and voltage control techniques designed to work hand-in-hand with the Smart Grid technologies. -OUTREACH: Implemented public outreach and educational initiatives that were linked directly to the demonstration of Smart Grid technologies, tools, techniques, and system configurations. This included creation of full-scale operating models demonstrating application of Smart Grid technologies in business and residential

  6. Accidental and ideal island cities: islanding processes and urban design in Belize City and the urban archipelagos of Europe

    Directory of Open Access Journals (Sweden)

    Elizabeth Pigou-Dennis

    2014-11-01

    Full Text Available This paper explores processes of islanding, de-islanding, and re-islanding in the context of island cities. Although today popularly associated with rural, peripheral, and isolated landscapes, concepts of the ideal city coincided in Medieval and Renaissance Europe with emergent notions of the ideal island. Major European cities such as Amsterdam, Paris, and Copenhagen were established on densely urbanized small islands. In accordance with dominant political and military philosophies, they were subsequently developed through comprehensive urban design into vast yet coherent urban archipelagos. In contrast, the contemporary development of Belize City as an island city took place through piecemeal land reclamation, absent comprehensive urban design, resulting in a very different kind of urban archipelago. Neither the coherent European island cities nor Belize City are generally regarded as islands today, yet their histories of urban development evidence the impact of spatial attributes of islandness on urban form. Comprehensive urban design efforts are currently directed at land reclamation and waterfront revitalization in Belize City, aiming to restore Belize City’s island city status. We argue that cities can be islanded, de-islanded, and re-islanded in the minds of their inhabitants and that it is necessary to recognize the connection between ideal islands and ideal cities in order to understand the islanding process in full.

  7. Marine mammal observations, Amchitka Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Three marine mammals were regularly observed at Amchitka Island: sea otters (Enhydra lutris), Steller's sea lions (Eumetopias jubata), and harbor seals (Phoca...

  8. 1- HARPs of the Pacific Islands Region

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset contains information on acoustic recordings of cetaceans collected from areas within the Pacific Islands Region since 2006. In collaboration with...

  9. Butterfly Survey on Pinckney Island NWR (2001)

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Butterfly (adult Lepidoptera) survey conducted monthly (May-Nov 2001) at nine locations within Pinckney Island NWR. These nine locations include Ibis Pond,...

  10. Breeding peregrine falcon survey, Amchitka Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A breeding peregrine falcon (Falco peregrines) survey was conducted on Amchitka Island, Alaska Maritime National Wildlife Refuge from May 2-9, 1981 in conjunction...

  11. Breton Island, Louisiana Baseline (Geographic, NAD83)

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Breton Island, Louisiana Baseline (Geographic, NAD83) consists of vector line data that were input into the Digital Shoreline Analysis System (DSAS) version 4.0,...

  12. Muskox survey, Nunivak Island, summer 1980

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A muskox survey was conducted on Nunivak Island Aug. 2122 by Lee Hotchkiss and Mike Smith. This year we digressed from the usual method of attempting to make a...

  13. Principal Hawaiian Islands Geoid Heights (GEOID96)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This 2' geoid height grid for the Principal Hawaiian Islands is distributed as a GEOID96 model. The computation used 61,000 terrestrial and marine gravity data held...

  14. EAARL Topography-Fire Island National Seaashore

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — A first return elevation map (also known as a Digital Elevation Model or DEM) of Fire Island National Seashore was produced from remotely-sensed,...

  15. Mackay Island NWR Annual Narrative Report 2001

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Mackay Island NWR outlines activities and accomplishments during the 2001 calendar year. The report begins with an introduction to...

  16. Anaho Island: Mammalian species richness report

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This study assessed the mammalian species richness on Anaho Island using live trapping between July 18th and July 23rd 2005. The last mammalian species richness...

  17. St. Vincent Island : Then and Now

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report captures the memories and observations of Charles F. Marks, Jr. who lived on St. Vincent Island as a child. He recalls what it was like growing up on...

  18. Inventory and Monitoring Plan for Howland Island, Baker Island, Jarvis Island National Wildlife Refuges; Units of the Pacific Remote Islands Marine National Monuments

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This plan documents and prioritizes inventory and monitoring surveys and research currently conducted, and proposed to be conducted, at the Howland Island, Baker...

  19. Natural History of St. Vincent Island, Florida

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A study proposal aiming to ascertain, list and describe the woody flora and vertebrate fauna of St. Vincent Island, and to describe the terrestrial and fresh water...

  20. Migrants on offshore islands of Bangladesh

    Directory of Open Access Journals (Sweden)

    Rezwan Siddiqui

    2014-02-01

    Full Text Available Riverbank erosion and the consequent formation of new islands in the Bay of Bengal cause frequent changes in the shape and size of the delta, forcing the inhabitants to migrate frequently.

  1. Pacific Islands Climate Change Virtual Library

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Virtual Library provides access to web based climate variability and climate change information and tools relevant to the Pacific Islands including case...

  2. Hillshades for the main 8 Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These hillshade datasets were derived from USGS 7.5' DEM Quads for the main 8 Hawaiian Islands. Individual DEM quads were first converted to a common datum, and...

  3. Vegetation of Long Island, Adams County, Illinois

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — During the spring and early summer of 1994 most of Long Island, part of the Mark Twain NWR, was walked, and six east/west transects established. During July each...

  4. 2007 Solomon Islands, Papua New Guinea Images

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — An earthquake measuring 8.1 struck 345 kilometers northwest of the Solomon Islands' capital Honiara at 0740 local time on 2 April. (2040 GMT 1 April). The...

  5. Cross Island Evaluation and Management Plan 1986

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The purpose of this study is to provide Hurricane Island Outward Bound School with a document that to be used for internal planning purposes. In addition, it could...

  6. CNMI Northern Island Bottomfish System (NIBS)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Commonwealth of the Northern Mariana Islands (CNMI), Division of Fish and Wildlife (DFW) conducted a market sampling program that existed for a few years back...

  7. EAARL Topography-Padre Island National Seashore

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Elevation maps (also known as Digital Elevation Models or DEMs) of Padre Island National Seashore were produced from remotely-sensed, geographically-referenced...

  8. Urban Heat Island Effect Actions - Neighborhood Data

    Data.gov (United States)

    Louisville Metro Government — The urban heat island effect — defined as the difference in temperature between the core of Louisville and its suburbs — contributes to heat-related illnesses and...

  9. Channel Islands, Kelp Forest Monitoring, Sea Temperature

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This dataset from the Channel Islands National Park's Kelp Forest Monitoring Program has subtidal temperature data taken at permanent monitoring sites. Since 1993,...

  10. Hawaii Abandoned Vessel Inventory, Hawaii Island

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for Hawaii Island. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction of coral...

  11. Hawaii Abandoned Vessel Inventory, Midway Island, NWHI

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for Midway Island, NWHI. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction of...

  12. US Virgin Islands Abandoned Vessel Inventory

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for US Virgin Islands. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction of...

  13. Hawaii Abandoned Vessel Inventory, Lisianski Island, NWHI

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NOAA Abandoned Vessel Project Data for Lisianski Island, NWHI. Abandoned vessels pose a significant threat to the NOAA Trust resources through physical destruction...

  14. Pintuco se internacionaliza en el mercado andino.

    Directory of Open Access Journals (Sweden)

    Carlos Enrique Ramírez R.

    2004-01-01

    Full Text Available La historia de la internacionalización de Pintuco está presentada en este trabajo. Es importante resaltar la valiosa información sobre el mercado mundial de pinturas lo cual despierta el interés del lector al mostrar el tamaño del mercado y la importancia económica del mismo. De igual forma, la introducción es muy expedita al señalar cuál es la tendencia de dicho mercado, pues con esto se puede hacer una idea de hacia dónde deberá ir Pintuco y cuáles serán sus principales retos a superar. Luego de dar un vistazo general de lo que son las pinturas y su impacto económico, el artículo continúa con la historia del Grupo Inversiones Mundial (GIM, ente económico que ha triunfado gracias a la tenacidad de sus directivos desde 1921. La estrategia utilizada por la empresa colombiana es explicada a través de los ejemplos de cómo empezó y se desarrolló en Venezuela y Ecuador, principalmente. Y es en esto, en lo que precisamente radica lo más importante del trabajo pues sirve como motivación y como ejemplo a seguir. Las empresas colombianas como Pintuco han entendido que una de las formas de amoldarse a las nuevas tendencias del mundo empresarial es la de competir con calidad, pero no sólo en su propio mercado, sino también en el mercado de origen de su competencia. Hoy en día las fronteras son cada vez más invisibles y eso, más que una amenaza, debería ser un atractivo.

  15. The islands of Kagoshima : culture, society, industry and nature

    OpenAIRE

    KAWAI, Kei; Terada, Ryuta; KUWAHARA, Sueo; TAKARABE, Megumi; NISHIMURA, Akira; HATTA, Akio; HAYWARD, Philip; YAMAMOTO, Sota; Takezaki, Toshiro; Niimura, Hideshi; Kuwabara, Kazuyo; NODA, Shinichi; NAKATANI, Sumie; OZAKI, Takahiro; NISHIMURA, Satoru

    2013-01-01

    edited by Kei Kawai, Ryuta Terada and Sueo Kuwahara Title page, colophon Preface Editors Contributors Contents Various Island Views in Kagoshima Prefecture (frontispiece) Map of the Islands in Kagoshima Culture and Society [Chapter 1] Culture and Society in the Islands of Kagoshima / Sueo Kuwahara [Chapter 2] Research Issues in the Culture and Society of the Amami Islands / Sueo Kuwahara [Chapter 3] Amami Island Religion : Historical Dynamics of the Islanders’...

  16. Climate, ecological release and bill dimorphism in an island songbird

    OpenAIRE

    Greenberg, Russell; Danner, Raymond M.

    2013-01-01

    Sexual size dimorphism is expected to be more pronounced in vertebrates on islands, particularly in trophic characters, as a response to decreased interspecific competition for food. We found (based on measurements of 1423 museum specimens) that bill size dimorphism was greater in island than mainland populations of song sparrows. However, dimorphism varied among islands and was positively correlated with high summer temperature and island size. Island song sparrow bills follow the overall po...

  17. Fabrication and characterization of CuInSe{sub 2} thin films from In{sub 2}Se{sub 3} and Cu{sub 2}Se precursors

    Energy Technology Data Exchange (ETDEWEB)

    Song, Jin Soo [Korea Inst. of Energy and Resources, Daeduk (Korea, Republic of); Huh, Gyung Jae; Kwon, Se Han; Ahn, Byung Tae [Korea Advanced Energy Research Inst., Daeduk-Danji (Korea, Republic of). Korea Nuclear Safety Center

    1995-12-01

    CuInSe{sub 2} this films as a light absorber layer were fabricated by vacuum evaporation using In{sub 2}Se{sub 3} and Cu{sub 2}Se precursors and their properties were analyzed. Indium selenide films of 0.5{mu}m thickness were first deposited by vacuum evaporation of In{sub 2}Se{sub 3} on a Corn ing 7059 glass substrate. The films deposited at susceptor temperature of 400 degree showed a flat surface morphology with densely packed grain structure. CuInSe{sub 2} films directly formed by evaporating Cu{sub 2}Se in the pre-deposited In{sub 2}Se{sub 2} films also showed a very flat surface when the susceptor temperature was 700 degree. Cu{sub 2}Se, a second phase in the CuInSe{sub 2} film, was removed by evaporating additional In{sub 2}Se{sub 3} on the CuInSe{sub 2} film at 700 degree. The grain size of 1.2{mu}m thick CuInSe{sub 2} film was about 2{mu}m and the film had a (112) preferred orientation. As the amount of deposited In{sub 2}Se{sub 3} increased, the electrical resistivity of CuInSe{sub 2} films increased because of the decrease of hole concentration. But the optical band gap was almost constant at the value of 1.04 eV. The CuInSe{sub 2} film grown in a Mo/glass substrate had a similar smooth microstructure compared to that on a glass substrate. A solar cell with ZnO/CdS/CuInSe{sub 2}/Mo structure may be realized based on the above CuInSe{sub 2} films. (author). 16 refs., 11 figs.

  18. Kerro se korulla : personoitavia vuolukivikoruja miehille

    OpenAIRE

    Latva, Susanna

    2011-01-01

    Opinnäytetyön yhtenä keskeisenä aiheena oli kartoittaa vuolukiven käyttömahdollisuutta koru kontekstista katsottuna ja sitä kautta liittää se osaksi korumuotoilua. Vuolukiven käyttöä osana korua lähestyttiin perehtyen alan kirjallisuuteen sekä materiaalikokeilujen kautta. Toinen keskeinen aihe opinnäytetyössä oli perehtyä koruun tyylin, persoonallisuuden ja tunteiden viestijänä, jonka pohjana käytettiin teoreettista lähdeaineistoa, lisäksi osiossa on opinnäytetyön tekijän omia pohdintoja aihe...

  19. Schilddrüse und Schwangerschaft

    Directory of Open Access Journals (Sweden)

    Zettinig G

    2009-01-01

    Full Text Available Kinderwunsch, Schwangerschaft und die Zeit nach einer Geburt sind besondere Lebensabschnitte bei Patientinnen mit Schilddrüsenerkrankungen. Bei jungen Frauen sind Autoimmunerkrankungen der Schilddrüse, die Einfluss auf die Fruchtbarkeit und die intellektuelle und körperliche Entwicklung des Fetus haben können, häufig. Schilddrüsenerkrankungen können sich in dieser Lebensphase auch erstmals manifestieren; besondere Beachtung verdient die Wechselwirkung von β-HCG mit dem TSH-Rezeptor. Diese Übersicht behandelt das aktuelle Management von Patientinnen mit Schilddrüsenerkrankungen bei Kinderwunsch, in der Schwangerschaft und Postpartalperiode.

  20. As and Se interactions with fly ashes

    OpenAIRE

    López Antón, María Antonia; Díaz Somoano, Mercedes; Martínez Tarazona, María Rosa

    2012-01-01

    [ES] El arsénico y el selenio son elementos tóxicos presentes en el carbón en concentraciones del orden de las trazas que pueden ser emitidos al medio ambiente durante los procesos de conversión del carbón. Sin embargo, los compuestos de arsénico y selenio pueden ser retenidos en las cenizas volantes originadas en el propio proceso en distint as proporciones dependiendo de las características de las cenizas y las condiciones del proceso. Este trabajo se centra en...

  1. ASSESING GEOGRAPHIC ISOLATION OF THE GALAPAGOS ISLANDS

    OpenAIRE

    Orellana, D.; Smith, F.

    2016-01-01

    The Galapagos Archipelago is one of the most important ecological spots in the planet due its unique biodiversity, active geology, and relatively well-preserved ecosystems. These characteristics are strongly based on the geographical isolation of the islands. On the one hand this isolation allowed the evolution processes that gave the islands their international fame and on the other hand it kept them from major human impacts that affected the vast majority of the Earth’s surface. Ga...

  2. Marine Pollution at Northeast of Penang Island

    OpenAIRE

    H.A. Gasim; A.M. Hashim; P.Z.M. Bakri; M.Z. Samsuri; N.L.A. Rais; N.D.M. Noor

    2013-01-01

    Oceans cover large area of earth surface and it is important for humans to protect from pollution. Malaysia has large marine areas which consist of islands, coastal and sea areas which are facing pollution problem due to the rapid urbanization and industrialization. This study investigated sources of marine pollution occurred at area near a reclamation project at the northeast of Penang Island. Three locations were chosen for water sampling which included Sg. Fetes, North Tanjung Tokong and G...

  3. Youth lead youth in Marshall Islands.

    Science.gov (United States)

    Johnson, G

    1988-01-01

    The promotion of family planning and birth control in Pacific countries is often frustrated by traditional and religious beliefs, if not deterred by tremendous funding and logistics problems. In the central Pacific republic of the Marshall Islands, however, youthful health workers are taking a unique approach to health promotion that has spurred acceptance of the once controversial subjects of family planning and birth control. A group known as Youth to Youth in Health is spearheading a family planning outreach drive in the schools and community in the Marshall Islands. Coupling health presentations with traditional island music and dance to produce lively health shows, the group's programs on family planning, birth control, nutrition, and cancer have struck a responsive chord in a culture known for its religious and traditional conservatism. The group makes creative use of puppet shows, skits, health songs, and pantomimes, interspersed with contemporary renditions of Marshall Islands music and traditional dances. These have rekindled pride in their culture among the group and sparked a sense of urgency about the need to improve health conditions in the islands. As evidence of the group's impact, family planning staff point to a nearly 4-fold rise in the number of youth clients under 19 years since the Youth to Youth started in mid-1986. Their combination of traditional custom with family planning and other health information has proved to be an innovative and needed program for the islands. PMID:12269067

  4. Active ageing as lifestyle on Croatian islands

    Directory of Open Access Journals (Sweden)

    Klempić-Bogadi Sanja

    2014-01-01

    Full Text Available The main feature of Croatian islands, in addition to their beautiful nature, is the fact that they are demographically and sociologically one of the most threatened areas affected by ageing. The ageing of the island population is the result of a long-term depopulation caused by the continuous emigration of the younger working-active population over the past hundred years, but also by the retirement return migration in the last thirty years. The most critical situation is on small islands where the majority of population is aged over 60 and this has a significant impact on all aspects of island life. The research conducted on small islands in the Šibenik archipelago in 2011 has shown that older people live alone, with no significant health problems limiting their daily activities, in their own households (homes, on modest pensions, and many of them supplement their income through agriculture. They very often financially help their children, who live mostly in nearby mainland cities. The necessity of self-reliance, due to the lack of younger generations, forces the inhabitants of Croatian island to lead an active life until their old age. Although they are no longer actively employed, they still continue to contribute significantly to the family and society through their involvement in various community activities.

  5. Reef fish structure and distribution in a south-western Atlantic Ocean tropical island.

    Science.gov (United States)

    Pinheiro, H T; Ferreira, C E L; Joyeux, J-C; Santos, R G; Horta, P A

    2011-12-01

    The community structure of the reef fish fauna of Trindade Island, a volcanic oceanic island located 1160 km off the coast of Brazil, is described based on intensive visual censuses. Seventy-six species were encountered in 252 censuses, with mean ± S.E. of 99 ± 3 individuals and 15.7 ± 0.3 species 40 m(-2) transect. The average fish biomass, calculated from length-class estimation, was 22.1 kg 40 m(-2) transect. The species contributing most to biomass were, in decreasing order, Melichthys niger, Cephalopholis fulva, Kyphosus spp., Holocentrus adscensionis, Sparisoma amplum, Sparisoma axillare, Acanthurus bahianus and Epinephelus adscensionis. Carnivorous fishes were the largest trophic group in terms of biomass, followed by omnivores and roving herbivores. The two predominant types of reef habitat, fringing reefs built by coralline algae and rocky reefs made of volcanic boulders, showed significant differences in the biomass and the abundance of the trophic guilds. Within each habitat type, significant differences in species richness, density and biomass were detected among crest, slope and interface zones. Although similar in overall species composition to coastal reefs in Brazil, the fish fauna of Trindade Island shares certain characteristics, such as a high abundance of planktivores, with other Brazilian oceanic islands. Despite comparatively high fish biomass, including the macro-carnivorous species habitually targeted by fisheries, signs of overfishing were evident. These findings highlight the urgency for a conservation initiative for this isolated, unique and vulnerable reef system. PMID:22141900

  6. Petrology of the prehistoric lavas and dyke of the Barren Island, Andaman Sea, Indian Ocean

    Indian Academy of Sciences (India)

    M A Alam; D Chandrasekharam; O Vaselli; B Capaccioni; P Manetti; P B Santo

    2004-12-01

    Although Barren Island (Andaman Sea, Indian Ocean) witnessed several volcanic eruptions during historic times, the eruptions that led to the formation of this volcanic island occurred mainly during prehistoric times. It is still active and currently in the fumarolic stage. Its volcanic evolution appears to be characterized by a constructive phase with the piling up of lava flows and scoria deposits and Strombolian activities, followed by a sudden collapse of the main cone. Deposits of a possible caldera-forming eruption were not recognized earlier. After a period of peri-calderic hydromagmatic activity, whose deposits presently mantle inner and outer caldera walls, a new phase of intracalderic Vulcanian activities took place. A prominent dyke in the SE inner side of the caldera wall was recognized. Petrographically the lava flows and dyke are similar but they differ in their chemical composition (viz., SiO2, MgO, Ni, Cr) significantly. Similarity in major, minor and trace element composition (viz., K/La, K/Nb, K/Rb, K/Ti ratios) of these rocks together with Chondrite normalized trace element (Rb, Ba, Sr, P, Zr, Ti and Nb) and REE (La, Ce, Nd and Y) patterns of the Barren Island prehistoric lava flows and dyke and low-K lavas of Sunda Arc indicates that Barren Island must have evolved from a source similar to that of Sunda Arc lavas during the Quaternary Period.

  7. Reef fish structure and distribution in a south-western Atlantic Ocean tropical island.

    Science.gov (United States)

    Pinheiro, H T; Ferreira, C E L; Joyeux, J-C; Santos, R G; Horta, P A

    2011-12-01

    The community structure of the reef fish fauna of Trindade Island, a volcanic oceanic island located 1160 km off the coast of Brazil, is described based on intensive visual censuses. Seventy-six species were encountered in 252 censuses, with mean ± S.E. of 99 ± 3 individuals and 15.7 ± 0.3 species 40 m(-2) transect. The average fish biomass, calculated from length-class estimation, was 22.1 kg 40 m(-2) transect. The species contributing most to biomass were, in decreasing order, Melichthys niger, Cephalopholis fulva, Kyphosus spp., Holocentrus adscensionis, Sparisoma amplum, Sparisoma axillare, Acanthurus bahianus and Epinephelus adscensionis. Carnivorous fishes were the largest trophic group in terms of biomass, followed by omnivores and roving herbivores. The two predominant types of reef habitat, fringing reefs built by coralline algae and rocky reefs made of volcanic boulders, showed significant differences in the biomass and the abundance of the trophic guilds. Within each habitat type, significant differences in species richness, density and biomass were detected among crest, slope and interface zones. Although similar in overall species composition to coastal reefs in Brazil, the fish fauna of Trindade Island shares certain characteristics, such as a high abundance of planktivores, with other Brazilian oceanic islands. Despite comparatively high fish biomass, including the macro-carnivorous species habitually targeted by fisheries, signs of overfishing were evident. These findings highlight the urgency for a conservation initiative for this isolated, unique and vulnerable reef system.

  8. ZnSe-based white LEDs

    Science.gov (United States)

    Katayama, K.; Matsubara, H.; Nakanishi, F.; Nakamura, T.; Doi, H.; Saegusa, A.; Mitsui, T.; Matsuoka, T.; Irikura, M.; Takebe, T.; Nishine, S.; Shirakawa, T.

    2000-06-01

    The first phosphor-free white LED based on II-IV compound materials is demonstrated. Our device utilizes a phenomenon unique to ZnSe homoepitaxy, where a portion of the main greenish-blue emission from the active layer of a pn junction diode is absorbed by the conductive substrate which in turn gives off an intense broad-band yellow emission centered around 585 nm by photoluminescence. These two emission bands combine to give a spectrum which appears white to the naked eye. A typical ZnSe-based white LED lamp exhibits a color temperature of approximately 3400 K with a CRI (color rendering index) of 68. The optical output power and operating voltage of such a device at a forward current of 20 mA is 2.0 mW and 2.7 V, respectively. The luminous efficiency estimated from these results is 10.4l m/W, which is comparable to the incandescent lamp as well as the commercial InGaN-based white LED. Device lifetimes (half-life) have exceeded 800 h at 20°C.

  9. Se il filosofo ha un compito

    Directory of Open Access Journals (Sweden)

    Carmine Di Martino

    2011-01-01

    Full Text Available Il testo muove da una ricognizione dello “stile” complessivo dell’interrogazione filosofica contemporanea: stile decostruttivo, che si risolve in un’illustrazione del limite istitutivo e costitutivo di ogni dire filosofico (e non solo filosofico. In un secondo tempo del suo intervento, l’autore si chiede se una tale comprensione, puramente “negativa”, di quel limite e della validità della parola che ne discende, non sia essa stessa ideologica, e se non sia possibile frequentare una definizione positiva di tale limite, e una possibilità non soltanto autodecostruttiva della parola filosofica “dopo” Nietzsche, Heidegger, Derrida.

  10. Structure of Se-rich As-Se glasses by high-resolution x-ray photoelectron spectroscopy

    International Nuclear Information System (INIS)

    To establish the validity of various proposed structural models, we have investigated the structure of the binary AsxSe100-x chalcogenide glass family (x≤40) by high-resolution x-ray photoelectron spectroscopy. From the composition dependence of the valence band, the contributions to the density of states from the 4p lone pair electrons of Se and the 4p bonding states and 4s electrons of Se and As are identified in the top part of the band. The analysis of Se 3d and As 3d core-level spectra supports the so-called chain crossing model for the atomic structure of Se-rich AsxSe100-x bulk glasses. The results also indicate small deviations (∼3-8%) from this model, especially for glass compositions with short Se chains (2540Se60 and of Se-Se-Se fragments in a glass with composition x=30 is established

  11. Bio-fortification and isotopic labelling of Se metabolites in onions and carrots following foliar application of Se and 77Se

    DEFF Research Database (Denmark)

    Kápolna, Emese; Laursen, Kristian H.; Husted, Søren;

    2012-01-01

    that foliar application of Se(IV) gave rise to bio-synthesis of a higher fraction of the desired organic Se species and was better tolerated by the plants than Se(VI). Based on these findings onions and carrots were bio-fortified by foliar application of a solution of 77Se(IV) that was enriched to 99.7% as 77...

  12. Escuela para señoritas, Inglaterra

    Directory of Open Access Journals (Sweden)

    Stillman y Eastwlck-Field, Arquitectos

    1963-02-01

    Full Text Available The object was to design part of a new building which had been seriously damaged during the war, so that the old and new parts would blend into a pleasant whole, with a capacity for 600 girls. The new designs avoid the glass box style of school buildings, and glass walls have been adopted only on the ground floor, thus giving an impression of light and airiness to what used to be a partial basement. Classrooms have been designed in a simple manner, and give the impression of conventional rooms. Simple lines and materials have been chosen throughout. Strong contrasts in the external finish have been avoided, and colours provide a relaxing background to the intensive activities of the students. A constructional feature is the use of prefabricated concrete joists and supports. Outer walls consist of brick panels filling in the space between the visible concrete framework. Ceilings are of insulating boards, and the floors are covered with linoleum. Special attention has been devoted to the hall. In this case the roof is of white gypsum, and the only features are the grills covering the fluorescent lighting. The walls of this hall are of glass, and are covered with heavy velvet curtains. A balcony with hardwood posts adds a simple and friendly feature to the building. The furniture and drapery have been carefully chosen. Camden school has a rigid tradition of individualism and fine education, and the new building has succeeded in maintaining the exclusive quality of the older parts, as well as offering an overall impression of up to date construction.El problema consistía en proyectar un nuevo núcleo para un edificio que había sido seriamente bombardeado durante la guerra, de tal modo que las partes antiguas y nuevas formasen un conjunto agradable y con capacidad para más de 600 chicas. En la nueva construcción se ha evitado el carácter de «cajas de cristal» de las nuevas escuelas ordinarias y se han empleado muros de cristal solamente en la

  13. Preparation and characterization of Bi2Se3(0001) and of epitaxial FeSe nanocrystals on Bi2Se3(0001)

    Science.gov (United States)

    Cavallin, Alberto; Sevriuk, Vasilii; Fischer, Kenia Novakoski; Manna, Sujit; Ouazi, Safia; Ellguth, Martin; Tusche, Christian; Meyerheim, Holger L.; Sander, Dirk; Kirschner, Jürgen

    2016-04-01

    Procedures to prepare clean Bi2Se3(0001) surfaces from bulk samples and epitaxial FeSe nanocrystals on Bi2Se3(0001) are reported. Bi2Se3(0001) substrates are prepared by in vacuo cleavage of bulk samples, followed by ion bombardment and annealing cycles. FeSe is prepared by Fe deposition onto Bi2Se3 at 303 K, followed by annealing at T ≈ 623 K. We use low-energy electron diffraction, surface X-ray diffraction, photoemission spectroscopy, scanning tunneling microscopy and spectroscopy, and stress measurements to elucidate the correlation between structural and electronic properties of the pristine Bi2Se3(0001) and FeSe covered surfaces. Our analysis reveals the formation of epitaxial FeSe nanocrystals with a thickness of three unit cells (1.5 nm). Electron diffraction experiments indicate an anisotropic epitaxial strain in FeSe. A negligible strain close to 0.0% and a tensile strain of + 2.1% are observed along the in-plane [ 01 1 bar 0 ] and [ 2 11 bar 0 ] Bi2Se3 directions, respectively. The out-of-plane strain is + 4.2%. The role of this strain state for the reported high-TC superconductivity in bulk FeSe is discussed.

  14. Sandy Point, Green Cay and Buck Island National Wildlife Refuges: United States Virgin Islands, Caribbean Islands National Wildlife Refuge Complex: Comprehensive Conservation Plan

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This Comprehensive Conservation Plan (CCP) was written to guide management on United States Virgin Islands, Caribbean Islands NWR Complex for the next 15 years....

  15. Opportunities and challenges for a sustainable energy policy in SE Europe: SE European Energy Community Treaty

    International Nuclear Information System (INIS)

    Energy demand continues to increase in turn raising concerns about energy supply. In this paper, the author has tried to systematize the role of the energy sector in South Eastern (SE) Europe in the context of the European energy policy process. This should make the energy sector in SE Europe more visible and open to substantial activities and appropriate funding. This is important to assure its full alignment with the European energy policy process, and in so doing, make it less fragile. According to the SE European Energy Community Treaty, parties to the Treaty are obliged to implement reforms in the energy and environmental sector in accordance with the European Union's respective policy. This paper raises awareness of the environmental requirements that have been set, of renewable energy and its implementation, at the same time pointing out that the response in SE Europe has been at a low level. It is believed that this paper could draw attention to the existing problems and could contribute to the establishment of a common integrated energy market in SE Europe and the EU. (author)

  16. Synthesis, characterization and properties of Se nanowires intercalated polyaniline/Se nanocomposites

    Directory of Open Access Journals (Sweden)

    M. Husain

    2013-09-01

    Full Text Available Present work reports novel synthesis of Polyaniline (PANI/Se nanocomposites. Se nanowires are prepared from SeO2 under assistance of vitamin C and polyaniline is synthesized through chemical oxidation. The effect of composition of Se nanowires on the properties of polyaniline was investigated and five orders increase in conductivity after doping has been observed. The electrical properties of nanocomposites show that conduction is through hopping process due to the wide range of localized states present near fermi level. FTIR (Fourier Transform Infrared spectroscopy and ultraviolet (UV-visible studies confirm the occurrence of polyaniline in conducting emeraldine salt form in the composites and suggest incorporation of Se in polymer. The optical studies indicate that absorption mechanism is due to indirect allowed transition and the optical band gap tends to decrease after doping. The thermal stability of composites has been ascertained on the basis of DSC (Differential Scanning Calorimetery measurements. TEM (Transmission Electron Microscopy and SEM (Scanning Electron Microscopy analysis have also been carried out for morphological studies.

  17. The sediments of lake on the Ardley Island, Antarctica:Identification of penguin-dropping soil Sun Liguang

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    During CHINARE-15(Dec. 1998 - Mar. 1999), a lake core 67. 5 cm in length, was sampled in Y2 lake, which is located on the Ardley Island, Antarctica.The concentrations of some chemical elements in Y2 lake sediments were analyzed.According to comparative research on elementary characters of sediments in Antarctic West Lake, fresh penguin dropping as well as guano soil on the Ardley Island and Pacific Island in South China Sea, it presents that the Y2 lake sediments were ameliorated by penguin dropping. The result of element cluster analysis shows that the type elements in the sediment impacted by penguin dropping include Sr, F, S,P,Ca,Se,Cu, Zn and Ba. This can provide a base for further interpreting the climatic and environmental event recorded in the sediment.

  18. Adaptive radiation of island plants: Evidence from Aeonium (Crassulaceae) of the Canary Islands

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Olesen, J.M.

    2001-01-01

    discussion of the mechanisms governing radiations on islands. Most examples are from the Hawaiian and Canarian floras, and in particular from studies on the morphological, ecological and molecular diversification of the genus Aeonium, the largest plant radiation of the Canarian Islands....

  19. Oloketa Tingting Fo Apem Education Long Solomon Islands: Issues in Solomon Islands Education

    Science.gov (United States)

    Alcorn, Noeline

    2010-01-01

    This book makes available to a wider audience for the first time material based on fieldwork carried out by the Solomon Island researchers in their own country. The findings will have vital relevance to policy makers, teachers and students. Over the past four years the School of Education, Solomon Islands College of Higher Education and the…

  20. Escape from the island. Grammaticality and (reduced) acceptability of wh-island violations in Danish

    DEFF Research Database (Denmark)

    Christensen, Ken Ramshøj; Kizach, Johannes; Nyvad, Anne Mette

    2013-01-01

    argument wh-movement, and this difference is attributable to matrix verb compatibility and factivity, not D-linking. (3) Long movement reduces acceptability, but is more acceptable than island violations. (4) Training effects reveal that island violations, though degraded, are grammatical in Danish. Since...

  1. CRED Gridded Bathymetry of Necker Island (100-021) in the Northwestern Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — File 100-021b is a 60-m ASCII grid of depth data collected near Necker Island in the Northwestern Hawaiian Islands as of May 2003. This grid has been produced as...

  2. Vegetation and checklist of Inaccessible Island, central South Atlantic Ocean, with notes on Nightingale Island

    Directory of Open Access Journals (Sweden)

    J. P. Roux

    1992-12-01

    Full Text Available The physiography and climate of Inaccessible and Nightingale Islands are briefly discussed. The vegetation and the major plant associations are described. Notes are given on the ecology and distribution of each taxon. Taxa newly recorded for Inaccessible Island include Agrostis goughensis, A.holgateana, A. wacei, Calamagrostis deschampsiiformis, Carex thouarsii var.  recurvata, Conyza albida, Elaphoglossum campylolepium and  Uncinia meridensis. One species, C.  albida, is alien to the Tristan group. Two native ferns Asplenium platybasis var.  subnudum and Blechnum australe were found on Nightingale Island for the first time, and the presence of introduced Malus domestica orchards was recorded. Two unidentified taxa were found that may represent new species:  Elaphoglossum sp. at Inaccessible Island and Apium sp. at both Inaccessible and Nightingale Islands. The total number of vascular plant species recorded at Inaccessible and Nightingale Islands now stands at 98 and 43, respectively, of which 26 (28% and seven (16% are introduced species. Only Airiplex plebeja and two species of Cotula occur at Nightingale Island but are absent from Inaccessible Island.

  3. 76 FR 30884 - Special Local Regulation; Kelley's Island Swim, Lake Erie; Kelley's Island, Lakeside, OH

    Science.gov (United States)

    2011-05-27

    ... Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public meeting. But you may... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Kelley's Island Swim, Lake... Kelley's Island Swim, which takes place in the second half of July. This special local regulated area...

  4. 78 FR 35135 - Special Local Regulation; Kelley's Island Swim, Lake Erie; Kelley's Island, Lakeside, OH

    Science.gov (United States)

    2013-06-12

    ... of the Federal Register (77 FR 71531). These special local regulations will be enforced from 7 a.m... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Kelley's Island Swim, Lake... Kelley's Island Swim from. This special local regulated area is necessary to protect swimmers from...

  5. 77 FR 33130 - Special Local Regulation; Kelley's Island Swim, Lake Erie; Kelley's Island, Lakeside, OH

    Science.gov (United States)

    2012-06-05

    ... Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public meeting. But you may... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Kelley's Island Swim, Lake... annual Kelley's Island Swim. This special local regulated area is necessary to protect swimmers...

  6. Islands erased by snow and ice: approaching the spatial philosophy of cold water island imaginaries

    Directory of Open Access Journals (Sweden)

    Johannes Riquet

    2016-05-01

    Full Text Available Representations of islands in Western fiction typically revolve around tropical islands. Critical discourse tends to reproduce this tendency and rarely addresses the specific spatial poetics of cold-water island fictions. This paper discusses three texts that poetically deploy the geographical inventory of northern snow- and icescapes to challenge essentialist assumptions about islands: D. H. Lawrence’s short story “The man who loved islands”, Georgina Harding’s novel The solitude of Thomas Cave, and Michel Serres’s treatise Le passage du Nord-Ouest. It is argued that these texts reflect on the importance of the horizontal and vertical components of material and textual topographies for the conception and experience of islands. In all three, the physical transformation of the islandscapes by snow and ice serves to put the island concept itself into question. Serres’s philosophical text geopoetically portrays the Arctic archipelago of the Northwest Passage to explore the reciprocal relations between language and the material world. In Lawrence and Harding, the snow-covered islands cease to function as economically productive spaces and turn into complex spatial figures offering a philosophical meditation on islandness as a contradictory and multifaceted condition.

  7. Conserving the Seychelles Warbler Acrocephalus sechellensis by translocation : a transfer from Cousin Island to Aride Island

    NARCIS (Netherlands)

    Komdeur, Jan; Bullock, Ian D.; Rands, Michael R.W.

    1991-01-01

    The Seychelles Warbler was once a highly threatened single-island endemic species with a population of 26 individuals confined to Cousin Island in the inner Seychelles. Following long-term management of Cousin, the population steadily recovered to around 300-360 birds. Given the vulnerability of one

  8. 46 CFR 7.85 - St. Simons Island, GA to Little Talbot Island, FL.

    Science.gov (United States)

    2010-10-01

    ...°42.7′ N. longitude 81°19.0′ W. (St. Mary's Entrance Lighted Whistle Buoy “1”); thence to Amelia Island Light. (b) A line drawn from the southernmost extremity of Amelia Island to latitude 30°29.4′...

  9. CRED Gridded Bathymetry near Laysan Island (100-006), Northwestern Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — File 100-006b is a 60-m ASCII grid of depth data collected near Laysan Island in the Northwestern Hawaiian Islands as of May 2003. This grid has been produced as...

  10. CRED Gridded Bathymetry of Nihoa Island (100-025) in the Northwestern Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — File 100-025b is a 60-m ASCII grid of depth data collected near Nihoa Island in the Northwestern Hawaiian Islands as of May 2003. This grid has been produced as...

  11. Stygofauna of the Canary Islands, 9. The amphipod genus Pseudoniphargus (Crustacea) in the Canary Islands

    NARCIS (Netherlands)

    Stock, Jan H.

    1988-01-01

    Pseudoniphargus was known from inland stygohabitats in the Iberian peninsula, the Azores, Madeira, N.W. Africa, and Bermuda, but not from the Canary Islands. Systematic sampling in six of the seven larger islands of the latter archipelago has revealed the presence of the genus in Tenerife (4 species

  12. DARWIN Y LA PARADOJA DE LAS ISLAS VACÍAS Darwin and the Empty Island Paradox

    Directory of Open Access Journals (Sweden)

    JUAN FELIPE BLANCO

    Full Text Available Aunque se conoce el interés y fascinación de Darwin por la naturaleza marina a través de sus tratados sobre arrecifes coralinos, islas oceánicas y balanos, poco se comenta sobre los múltiples ejemplos dulceacuícolas que él utilizó para plantear la -teoría de la migración- dentro de -El origen-. Ésta plantea que la fauna y la flora se -dispersan- desde los continentes hacia las islas oceánicas. Sin embargo, en la islas muy alejadas de los centros de origen la probabilidad de colonización es muy baja y por lo tanto solo se encuentra una fracción de la biota continental, pudiendo considerarse en algunos casos -vacías-. Aunque las corrientes de agua de dichas islas también se consideran -vacías-, Darwin propuso un mecanismo para explicar la presencia de peces -dulceacuícolas- en las mismas, y por lo tanto no podrían considerarse -vacías-, lo cual plantea una paradoja. El mecanismo planteado por él coincide con el ciclo de vida conocido actualmente como diádromo en el cual los individuos de muchas especies de peces, camarones y gasterópodos requieren de aguas marinas y dulces para completar su desarrollo. La diadromía es una convergencia evolutiva que apareció en diferentes linajes a partir de ancestros tanto marinos como dulceacuícolas. En este ensayo se discute la evolución de la fauna dulceacuícola insular, sus implicaciones ecológicas y evolutivas, y algunos modelos experimentales. Finalmente, se discute sobre los impactos de las represas en islas tropicales y subtropicales sobre las especies diádromas.Although Darwin's fascination and interest on marine nature are well known due to his treatises about coral reefs, oceanic islands, and barnacles, little is commented about the many -freshwater- examples that he provided for supporting -The Migration Theory- in his book -The Origin of the Species-. According to this theory, faunas and floras disperse from continents to oceanic islands. However, those islands located at

  13. Photo and electroluminescence of ZnSe: Sn and ZnSe:(Sn, Pr) phosphors

    Science.gov (United States)

    Mishra, A. K.; Mishra, S. K.; Pandey, S. P.; Lakshmi Mishra, Kshama

    2016-09-01

    We have prepared ZnSe (luminescent grade) phosphor doped with Sn and (Sn,Pr) with varying concentration in an inert atmosphere in a silica tubular furnace at temperature of (780 ± 20) °C for 1 hr to obtain ZnSe:Sn and ZnSe: (Sn,Pr) phosphors. The photo luminescence (PL) and electroluminescence (EL) spectra of these phosphors have been studied at room temperature and results were discussed in the light of existing models. Dependence of EL emission on the voltage frequency has also been carried out. It is found that the plot between the integrated light intensity versus 1/√Vrms is a straight line suggesting the existence of Mott-Schottky type barrier on the metal semiconductor interface.

  14. Absorption Spectra of CuGaSe 2 and CuInSe 2 Semiconducting Nanoclusters

    KAUST Repository

    Mokkath, Junais Habeeb

    2015-10-01

    The structural and optical properties of the chalcopyrite CunGanSe2n and CunInnSe2n nanoclusters (n = 2, 4, 6, and 8) are investigated as a function of the size using a combination of basin-hopping global optimization and time-dependent density functional theory. Although the lowest energy structures are found to show almost random geometries, the band gaps and absorption spectra still are subject to systematic blue shifts for decreasing cluster size in the case of CunGanSe2n, indicating strong electron confinement. The applicability of the nanoclusters in photovoltaics is discussed. © 2015 American Chemical Society.

  15. Two-Dimensional Island Shape Determined by Detachment

    Science.gov (United States)

    Saito, Yukio; Kawasaki, Ryo

    2007-07-01

    Effect of an anisotropic detachment on a heteroepitaxial island shape is studied by means of a kinetic Monte Carlo simulation of a square lattice gas model. Only with molecular deposition followed by surface diffusion, islands grow in a ramified dendritic shape, similar to diffusion-limited aggregate (DLA). Introduction of molecular detachment from edges makes islands compact. To understand an anisotropic island shape observed in the experiment of pentacene growth on a hydrogen-terminated Si(111) vicinal surface, asymmetry in detachment around the substrate step is assumed. Edge molecules detach more to the higher terrace than to the lower terrace. The island edge from which molecules are easy to detach is smooth and the one hard to detach is dendritic. If islands are close to each other, islands tend to align in a line, since detached molecules from the smooth edge of the right island are fed to the dendritic and fast growing edge of the left island.

  16. Cathodoluminescence of ZnSe(Bi) : Al

    International Nuclear Information System (INIS)

    Studies on cathodoluminescence (CL) in the ZnSe crystals, annealed at the temperature of 1200 K in the Bi melt, containing aluminium admixture, are carried out. The spectra are taken at different levels of excitation and delay times by the t0 registration. With the t0 increase the orange band intensity with λmax = 630 nm (1.968 eV) in the CL spectrum decreases as compared to the intensity of the dominating yellow-green band with λmax = 550 nm (2.254 eV). It is shown that such a behaviour of the yellow-green band is conditioned by competition of two processes: recombination of donor-acceptor pairs and free electrons with holes localized on the acceptors. The first mechanism dominates at low temperatures and the second one - at high temperatures. The contribution of both mechanisms in the area of T ∼ 120 mK becomes equal

  17. Tee-se-itse-asenne tyyliblogeissa

    OpenAIRE

    Vartama, Saana

    2011-01-01

    Tämä opinnäytetyö käsittelee suomalaisten tyyliblogien tee-se-itse- eli DIY-asennetta esimerkkiblogien kautta. Aluksi määritellään, mitä eroa on muodilla ja tyylillä ja mitä DIY-kulttuuri on. Tyyliblogeissa on erilaisia DIY-sisältöjä; itse tehtyjä vaatteita ja asusteita, tuunattuja vaatteita ja asusteita sekä kierrätettyjä vaatteita ja asusteita. On tyyliblogeja, joissa käsitellään ainoastaan DIY-sisältöä ja jaetaan DIY-ohjeita, ja sellaisia DIY-tyyliblogeja, joissa käsitellään muutakin ty...

  18. Optical properties of thermally annealed CdZnSe/ZnSe quantum dots

    International Nuclear Information System (INIS)

    To analyse the diffusion characteristics, photoluminescence (PL) spectroscopy has been carried out in extensive detail on single, as well as, ensembles of thermally annealed (TA) CdSe/ZnSe QDs. For a series of QD-ensembles, each annealed for tA = 30 s at temperatures from TA = 300-550 C, the change in the QD-composition has been calculated from the blue-shift of the exciton ground-state PL-emission, using a concentration function based on Fick's laws of diffusion. The diffusion length (LD) and the activation energy (EA) have been determined thereof. For the studied QDs, EA has been evaluated to be 2.2 eV. Additionally, TA results also in an enhancement of the PL-intensity and reduction of the full-width-at-half maximum (FWHM) of the spectra. This point towards an increased homogeneity of the QD-size and composition, and decrease in the concentration of defects around the QDs. For single CdSe/ZnSe QDs, TA has been varied from 100-240 C, in steps for 20 C, with tA kept fixed at 30 s. Finally, the evolution of the magneto-optic response with post-growth thermal annealing has been studied for both individual QDs and QD-ensembles. An external magnetic field, applied perpendicular to the plane of the QDs (Faraday configuration), results in Zeeman spin splitting of the ground exciton state. The emissions from the Zeeman-split states are left and right circularly polarized and from the degree of circular polarization (DCP), as well as, the spectral separation of the PL-peaks, the g-factor can be estimated. For CdSe/ZnSe QD-ensembles, the g-factor has been observed to change sign with TA. (orig.).

  19. PbSe/PbSe xS1-x core-alloyed shell nanocrystals

    International Nuclear Information System (INIS)

    This work describes a novel synthetic method for the formation of PbSe core-shell nanocrystals. The PbSe show a special interest due to their strong quantum size effect and activity in the near IR spectral regime. Common colloidal procedure of semiconductor core-shell structures includes an initial preparation of the core, isolation of the NCs from the mother solution, dissolving in a new solution with a post injection of the shell constituents. This paper discusses an alternative procedure, utilizing a single-injection of the core and shell constituents, simultaneously. The faster reactivity of selenium to a lead precursor, directs a nucleation of a PbSe core, while the sulfur reagent participate at a later stage as a PbSe xS1-x shell. PbSe core-shell NCs, prepared by the discussed single-injection process, were compared with those prepared via a two-step injection, containing equimolar reagents and NCs size. Both cases showed a strong fluorescence (with quantum efficiency 30-60%), but with a pronounced red-shift of the band edge (30-120 meV), with respect to the core, upon an increase of the shell thickness. This red-shift was substantially larger for core-shell NCs prepared via a one-step injection. The red-shift corresponds to the formation of type II transition between E c,PbSe and E v,PbS. While the extra red-shift, upon preparation by a single injection, corresponds to the formation of shells with a tunable alloy composition

  20. Recent hydrogeologic study of the Vis island

    Directory of Open Access Journals (Sweden)

    Janislav Kapelj

    2002-12-01

    Full Text Available The Vis Island belongs to the group of the Middle Dalmatian islands. It comprises an area of about 90.2 km2. Morphologically, three belts of highlands and two depressions with karst poljes are significant. The highest point on the island is Hum with 587 m a.s.l. theisland’s water supply is organized from the water-supply station “Korita”, situated in the central part of island, in tectonically formed depression. There are two additional capturedobjects: the well K-1 above the Komiža town and the spring “Pizdica”. The most important hydrogeological role on the island have two hydrogeological barriers, one in the KomižaBay, completely made of impermeable igneous and clastic rocks, and another one, the recently recognized relative barrier in the area of Dra~evo, Plisko and Velo polje. Since the island karst aquifer is in permanent dynamic relation with seawater, classical geologic,structural and hydrogeologic investigations have been performed with application of hydrogeochemical methods taking into account the natural chemical tracer content of groundwater and its variations in different hydrologic and vegetation conditions. Precipitationregime is very unfavorable with regard to the recharging of island’s aquifer, because dry periods are usually very long. During the summer tourist season, when the number of inhabitants and fresh water consumption considerably increase, amounts of island’sgroundwater suitable for water supply and irrigation rapidly decrease. Sometimes, insufficient quantity of fresh water on the Vis Island causes restrictions. Concerning the development of tourist potential and the present agricultural activities, summer lack ofwater is a serious restrictive factor. Some results of the performed hydrogeological study, important as a basis for island’s fresh water potential assessment, will be presented.

  1. Runaway electrons and magnetic island confinement

    Science.gov (United States)

    Boozer, Allen H.

    2016-08-01

    The breakup of magnetic surfaces is a central feature of ITER planning for the avoidance of damage due to runaway electrons. Rapid thermal quenches, which lead to large accelerating voltages, are thought to be due to magnetic surface breakup. Impurity injection to avoid and to mitigate both halo and runaway electron currents utilizes massive gas injection or shattered pellets. The actual deposition is away from the plasma center, and the breakup of magnetic surfaces is thought to spread the effects of the impurities across the plasma cross section. The breakup of magnetic surfaces would prevent runaway electrons from reaching relativistic energies were it not for the persistence of non-intercepting flux tubes. These are tubes of magnetic field lines that do not intercept the walls. In simulations and in magnetic field models, non-intercepting flux tubes are found to persist near the magnetic axis and in the cores of magnetic islands even when a large scale magnetic surface breakup occurs. As long as a few magnetic surfaces reform before all of the non-intercepting flux tubes dissipate, energetic electrons confined and accelerated in these flux tubes can serve as the seed electrons for a transfer of the overall plasma current from thermal to relativistic carriers. The acceleration of electrons is particularly strong because of the sudden changes in the poloidal flux that naturally occur in a rapid magnetic relaxation. The physics of magnetic islands as non-intercepting flux tubes is studied. Expressions are derived for (1) the size of islands required to confine energetic runaway electrons, (2) the accelerating electric field in an island, (3) the increase or reduction in the size of an island by the runaway electron current, (4) the approximate magnitude of the runaway current in an island, and (5) the time scale for the evolution of an island.

  2. Marine Resource Survey in waters surrounding Guam and the Commonwealth of the Northern Mariana Islands (SE1002, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goals of the cruise were to collect a variety of data to assess the status of marine resources in waters surrounding Guam and CNMI. Marine resource habitats...

  3. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1208, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  4. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1306_AfterCalib, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  5. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1107, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  6. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1306_BeforeCalib, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  7. Mesophotic coral environment monitoring and habitat surveys at the Main Hawaiian Island Chain (SE0807, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The goals of the cruise were to collect a variety of data to assess the status of mesophotic corals in the Auau Channel, off the west coast of Maui. Camera surveys...

  8. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1102L1, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  9. Comparison of fishery-independent methods for sampling Main Hawaiian Islands Bottomfish assemblages (SE1302, EK60)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Optical, active acoustics, and research fishing data on bottomfish abundance and biomass were collected over predetermined grids to compare results of...

  10. Virtually Impossible: Deleuze and Derrida on the Political Problem of Islands (and Island Studies

    Directory of Open Access Journals (Sweden)

    Stewart Williams

    2012-11-01

    Full Text Available It is commonplace to think of an island as a discreetly bounded unit. Selected writings on islands by the poststructuralist philosophers Gilles Deleuze and Jacques Derrida reveal the island variously to be both real and imaginary, mythological and scientific, but as most problematic when constituted in political terms as an indivisible, sovereign entity. These two thinkers’ more broadly developed concepts of the virtual and the impossible, respectively, are seen to disrupt any assumptions about the fixity and closure of the island polity. Instead they emphasize its actualization through processual relations that can be difficult yet dynamic and decisive in effecting the move from being to becoming-other. As the possibilities for instituting more ethical as well as different political relations open up, the question of island studies remaining in its currently coherent, familiar form is raised for consideration.

  11. Tools for sustainability assessment in island socio-ecological systems: an application to the Canary Islands

    Directory of Open Access Journals (Sweden)

    Isabel Banos-González

    2016-05-01

    Full Text Available An integral dynamic model, in combination with other methods (indicators, policy and scenario analysis, is presented as a tool for sustainability assessment in island socio-ecological systems (SES. The Fuerteventura sustainability model (FSM, tested for the 1996-2011, allows a better understanding of the dynamic interactions between sustainability indicators and other factors of this island. The FSM was first applied to analyse the vulnerability of this island to climate change for the 2012-2025 period; results point to the need for urgent measures to mitigate its effects on some of the analysed indicators. A set of policy measures was then assessed from the behaviour of nine indicators and their sustainability thresholds. Finally, the FSM facilitated the development of a dynamic model of the island of El Hierro, extrapolating the features common to both SES. We propose this to be a useful tool for the quantitative sustainability assessment and the management of real island socio-ecological systems

  12. Temperature dependent band offsets in PbSe/PbEuSe quantum well heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Simma, M.; Bauer, G.; Springholz, G. [Institut fuer Halbleiter und Festkoerperphysik, Johannes Kepler Universitaet, A-4040 Linz (Austria)

    2012-10-22

    The band offsets of PbSe/Pb{sub 1-x}Eu{sub x}Se multi-quantum wells grown by molecular beam epitaxy are determined as a function of temperature and europium content using temperature-modulated differential transmission spectroscopy. The confined quantum well states in the valence and conduction bands are analyzed using a k{center_dot}p model with envelope function approximation. From the fit of the experimental data, the normalized conduction band offset is determined as 0.45{+-}0.15 of the band gap difference, independently of Eu content up to 14% and temperature from 20 to 300 K.

  13. At læse er at se – med den andens øjne

    DEFF Research Database (Denmark)

    Christensen, Bodil

    2015-01-01

    i en almindelig skoleklasse? Hvordan kan (ungdoms)litteraturen hjælpe os til at se med den andens øjne? Det forsøger denne artikel at gøre rede for. Artiklen er opbygget ud fra en praksisstrategi, hvorfor der indledes med den samlede konklusion. Herefter følger argumentationen (også) i en...... danskundervisningen. Når først interessen er vakt, så kan teorien underbygge målet med læsningen: Gennem litteraturen kan vi lære at se verden, som den ser ud for andre end os selv....

  14. 'Cold' crystallization in nanostructurized 80GeSe 2 -20Ga 2 Se 3 glass

    OpenAIRE

    Klym, Halyna; Ingram, Adam; Shpotyuk, Oleh; Calvez, Laurent; Petracovschi, Elena; Kulyk, Bohdan; Serkiz, Roman; Szatanik, Roman

    2015-01-01

    'Cold' crystallization in 80GeSe 2-20Ga 2 Se 3 chalcogenide glass nanostructurized due to thermal annealing at 380°C for 10, 25, 50, 80, and 100 h are probed with X-ray diffraction, atomic force, and scanning electron microscopy, as well as positron annihilation spectroscopy performed in positron annihilation lifetime and Doppler broadening of annihilation line modes. It is shown that changes in defect-related component in the fit of experimental positron lifetime spectra for nanocrystallized...

  15. Energy transfer processes in ZnSe/(Zn,Mn)Se double quantum wells

    Science.gov (United States)

    Jankowski, Stephanie; Horst, Swantje; Chernikov, Alexej; Chatterjee, Sangam; Heimbrodt, Wolfram

    2009-10-01

    The complex interplay of energy transfer and tunneling processes in a series of asymmetric ZnSe/(Zn,Mn)Se double quantum-well (DQW) structures is investigated. Steady-state and time-resolved photoluminescence at low temperatures and external magnetic fields up to 7 T in this system show remarkable differences to earlier studies on CdTe/(Cd,Mn)Te DQWs. The pure quantum-mechanical tunneling process is only a minor contribution to the magnetic field dependence of the emission even in case of small barriers and strong QW coupling. The experimental results are supported by quantum-well calculations.

  16. ¿De qué se habla cuando se habla de calidad de los servicios?

    OpenAIRE

    Rey, Carina

    2012-01-01

    En los últimos años, la calidad de los servicios y por ende de las bibliotecas se ha convertido en un tema estrella. En los medios de comunicación y en los foros profesionales se comentan las puntuaciones obtenidas en EFQM, los procesos de evaluación para optar a una certificación, o sobre las bondades de un modelo u otro; y surge la duda: ¿de qué estamos hablando?, ¿qué entendemos por calidad de servicio?, ¿cuáles son los aspectos a tener en cuenta en las valoraciones?, ¿qué elementos tenemo...

  17. A new marine interstitial psammogammarus (Crustacea, Amphipoda, Melitidae) from Gura Ici Island, off western Halmahera (North Moluccas, Indonesia), and an overview of the genus

    NARCIS (Netherlands)

    R. Vonk; B.W. Hoeksema; D. Jaume

    2011-01-01

    Psammogammarus wallacei sp. n. is described from the shallow marine interstitial of a sand and coral rubble beach on the Gura Ici islands (North Moluccas; Indonesia). This is the first record of this circum-tropical genus from SE Asia, with the geographically closest relative inhabiting the Ryukyu a

  18. Photocatalytic Hydrogen Generation by CdSe/CdS Nanoparticles.

    Science.gov (United States)

    Qiu, Fen; Han, Zhiji; Peterson, Jeffrey J; Odoi, Michael Y; Sowers, Kelly L; Krauss, Todd D

    2016-09-14

    The photocatalytic hydrogen (H2) production activity of various CdSe semiconductor nanoparticles was compared including CdSe and CdSe/CdS quantum dots (QDs), CdSe quantum rods (QRs), and CdSe/CdS dot-in-rods (DIRs). With equivalent photons absorbed, the H2 generation activity orders as CdSe QDs ≫ CdSe QRs > CdSe/CdS QDs > CdSe/CdS DIRs, which is surprisingly the opposite of the electron-hole separation efficiency. Calculations of photoexcited surface charge densities are positively correlated with the H2 production rate and suggest the size of the nanoparticle plays a critical role in determining the relative efficiency of H2 production. PMID:27478995

  19. Distribution of Se and its species in Myriophyllum spicatum and Ceratophyllum demersum growing in water containing Se (VI).

    Science.gov (United States)

    Mechora, Spela; Cuderman, Petra; Stibilj, Vekoslava; Germ, Mateja

    2011-09-01

    The uptake of Se (VI) by two aquatic plants, Myriophyllum spicatum L. and Ceratophyllum demersum L., and its effects on their physiological characteristics have been studied. Plants were cultivated outdoors under semi-controlled conditions and in two concentrations of Na selenate solution (20 μg Se L(-1) and 10 mg Se L(-1)). The higher dose of Se reduced the photochemical efficiency of PSII in both species, while the lower dose had no effect on PSII. Addition of Se had no effect on the amounts of chlorophyll a and b. The concentration of Se in plants grown in 10 mg Se L(-1), averaged 212 ± 12 μg Seg(-1) DM in M. spicatum (grown from 8-13 d), and 492 ± 85 μg Se g(-1) DM in C. demersum (grown for 31 d). Both species could take up a large amount of Se. The amount of soluble Se compounds in enzyme extracts ranged from 16% to 26% in control, and in high Se solution from 48% to 36% in M. spicatum and C. demersum, respectively. Se-species were determined using HPLC-ICP-MS. The main soluble species in both plants was selenate (∼37%), while SeMet and SeMeSeCys were detected at trace levels. PMID:21703659

  20. Purification and identification of Se-containing antioxidative peptides from enzymatic hydrolysates of Se-enriched brown rice protein.

    Science.gov (United States)

    Liu, Kunlun; Zhao, Yan; Chen, Fusheng; Fang, Yong

    2015-11-15

    As a further study of Se-containing proteins (Se-Pro) derived from Se-enriched brown rice (Se-BR), this paper aimed to purify and identify Se-containing antioxidative peptides (Se-antioxi-Peps) from Se-Pro hydrolysates. The total Se content in Se-BR was 6.26μg/g DW, and selenocystine, Se-methylselenocysteine, and selenomethionine were identified as the main organic Se species by high-performance liquid chromatography-inductively coupled plasma mass spectrometry. Se-Pro was extracted and hydrolyzed by four types of proteases, and Alcalase was chosen as the optimum enzyme according to the degree of hydrolysis (DH). The hydrolysate with 17.08% DH possessing the highest DPPH radical scavenging activity was separated into five fractions (F1 to F5). Fractions F3 to F5, which had high antioxidative activities, were further separated. Sub-fractions F3-3, F4-2, and F5-1 were chosen to evaluate antioxidative activities and analyze Se species. The Se-antioxi-Pep with the sequence SeMet-Pro-Ser was identified by electrospray ionization Fourier transform ion cyclotron resonance mass spectrometry. PMID:25977046

  1. Seabird modulations of isotopic nitrogen on islands.

    Directory of Open Access Journals (Sweden)

    Stéphane Caut

    Full Text Available The transport of nutrients by migratory animals across ecosystem boundaries can significantly enrich recipient food webs, thereby shaping the ecosystems' structure and function. To illustrate the potential role of islands in enabling the transfer of matter across ecosystem boundaries to be gauged, we investigated the influence of seabirds on nitrogen input on islands. Basing our study on four widely differing islands in terms of their biogeography and ecological characteristics, sampled at different spatial and temporal intervals, we analyzed the nitrogen isotopic values of the main terrestrial ecosystem compartments (vascular plants, arthropods, lizards and rodents and their relationship to seabird values. For each island, the isotopic values of the ecosystem were driven by those of seabirds, which ultimately corresponded to changes in their marine prey. First, terrestrial compartments sampled within seabird colonies were the most enriched in δ(15N compared with those collected at various distances outside colonies. Second, isotopic values of the whole terrestrial ecosystems changed over time, reflecting the values of seabirds and their prey, showing a fast turnover throughout the ecosystems. Our results demonstrate that seabird-derived nutrients not only spread across the terrestrial ecosystems and trophic webs, but also modulate their isotopic values locally and temporally on these islands. The wealth of experimental possibilities in insular ecosystems justifies greater use of these model systems to further our understanding of the modalities of trans-boundary nutrient transfers.

  2. Island Movements: Thinking with the Archipelago

    Directory of Open Access Journals (Sweden)

    Jonathan Pugh

    2013-05-01

    Full Text Available Whether in Homer or Plato, Shakespeare or Huxley, throughout history, thinking about islands has shaped how we think about human nature and our place in the world. However, to date archipelagos have received far less attention. This is problematic because we live, increasingly, in a world of island-island movements and not static forms. Not only in the more obvious cases of the Caribbean, Hawaii or the Philippines but, as Stratford et al (2011 say, many ‘continental forms’ like Canada and Australia are in fact archipelagos composed of thousands of island movements. To this list we can add more manufactured archipelagos: wind turbine arrays, industrial oil and military constellations. The key question therefore arises: what does it mean to think with the archipelago? This paper argues firstly that archipelagic thinking denaturalizes the conceptual basis of space and place, and therefore engages ‘the spatial turn’ presently sweeping the social sciences and humanities. Secondly, such thinking highlights the trope of what I call ‘metamorphosis’, of the adaptation and transformation of material, cultural and political practices through island movements. In both cases, I argue that thinking with the archipelago requires an important shift in how we frame analysis and engagement.

  3. Hexagonal CoSe formation in mechanical alloyed Co 75Se 25 mixture

    Science.gov (United States)

    Campos, C. E. M.; de Lima, J. C.; Grandi, T. A.; Machado, K. D.; Drago, V.; Pizani, P. S.

    2004-07-01

    A hexagonal CoSe alloy with NiAs-type structure was obtained by mechanical alloying starting from a mixture of pure crystalline powders with nominal composition Co 75Se 25. X-ray diffraction (XRD), differential scanning calorimetry (DSC), Mössbauer spectroscopy (MS) and Raman scattering (RS) techniques were used to follow the structural, thermal, magnetic and optical properties of the binary mixture as a function of milling time. XRD results show the formation of a nanometric hexagonal CoSe phase between 3 and 70 h of milling coexisting with non-reacted Co phases, also in nanometric scale. DSC and RS results showed some changes in the thermal and optical properties of the crystalline phases when the milling time increases. The Raman active modes of the CoSe and Co oxide phases were observed. MS results showed practically no iron in the samples milled up to 15 h, while for extended milling times (70 h), they showed the presence of some α-Fe and the formation of other iron alloys due to the contamination by the milling media.

  4. Late Cretaceous-Early Palaeogene tectonic development of SE Asia

    Science.gov (United States)

    Morley, C. K.

    2012-10-01

    The Late Cretaceous-Early Palaeogene history of the continental core of SE Asia (Sundaland) marks the time prior to collision of India with Asia when SE Asia, from the Tethys in the west to the Palaeo-Pacific in the east, lay in the upper plate of subduction zones. In Myanmar and Sumatra, subduction was interrupted in the Aptian-Albian by a phase of arc accretion (Woyla and Mawgyi arcs) and in Java, eastern Borneo and Western Sulawesi by collision of continental fragments rifted from northern Australia. Subsequent resumption of subduction in the Myanmar-Thailand sector explains: 1) early creation of oceanic crust in the Andaman Sea in a supra-subduction zone setting ~ 95 Ma, 2) the belt of granite plutons of Late Cretaceous-Early Palaeogene age (starting ~ 88 Ma) in western Thailand and central Myanmar, and 3) amphibolite grade metamorphism between 70 and 80 Ma seen in gneissic outcrops in western and central Thailand, and 4) accretionary prism development in the Western Belt of Myanmar, until glancing collision with the NE corner of Greater India promoted ophiolite obduction, deformation and exhumation of marine sediments in the early Palaeogene. The Ranong strike-slip fault and other less well documented faults, were episodically active during the Late Cretaceous-Palaeogene time. N to NW directed subduction of the Palaeo-Pacific ocean below Southern China, Vietnam and Borneo created a major magmatic arc, associated with rift basins, metamorphic core complexes and strike-slip deformation which continued into the Late Cretaceous. The origin and timing of termination of subduction has recently been explained by collision of a large Luconia continental fragment either during the Late Cretaceous or Palaeogene. Evidence for such a collision is absent from the South China Sea well and seismic reflection record and here collision is discounted. Instead relocation of the subducting margin further west, possibly in response of back-arc extension (which created the Proto

  5. Aquí se vende todo

    Directory of Open Access Journals (Sweden)

    Amalia Ran

    2010-11-01

    Full Text Available Aunque « memoria » sea la palabra más usada en el contexto histórico reciente de Argentina, es el olvido aquello de lo que más se habla, y lo que domina al final el discurso público de las últimas décadas. ¿ Cuáles son las distintas formas de « recordar » el pasado doloroso en un entorno que intenta silenciarlo al transformar la memoria en un objeto-fetiche ? ¿ De qué modo conserva el espacio urbano —la ciudad y sus múltiples lugares abiertos y cerrados— una memoria de la desgracia y del horror ?, y ¿ cómo se refleja ese espacio urbano dentro del texto narrativo ? El presente trabajo estudia la problemática de la ciudad globalizada del post-trauma y la desmemoria mediante el análisis de la novela de Horacio Vázquez-Rial, La capital del olvido (2004. Asimismo, propone analizar los efectos de los procesos de privatización y globalización que barrieron a Buenos Aires durante los noventa para explorar las diversas expresiones públicas y privadas de una cultura de culpa y vergüenza que niega recordar su pasado.Though memory may be most often used term within the historic context of Argentina, it is oblivion which dominates finally the public discourse of recent years. What are the different forms of “ remembering ” the painful past in an environment that attempts to silence memory by transforming it into a fetish-object ? In which way the urban space —the city with its multiple open and closed places— conserves a memory of the tragedy and horror ? And, how this space is represented within the narrative text ? This work analyzes the problematic of the globalized city, its post-trauma and oblivion by studying Horacio Vázquez-Rial’s novel, La capital del olvido (“ City of Oblivion ”, 2004. Additionally, it offers to analyze the effects of globalization and privatization processes that swept Buenos Aires during the decade of the nineties, in order to explore the diversity of public and private

  6. Disordered La3Cu4.88Se7.

    Science.gov (United States)

    Gulay, L D; Daszkiewicz, M; Strok, O M; Pietraszko, A

    2011-03-01

    The crystal structure of copper(I) lanthanum selenide, La(3)Cu(4.88)Se(7), obtained from the La(2)Se(3)-Cu(2)Se quasi-binary system, has been investigated using X-ray single-crystal diffraction. The positions of the La and Se atoms are ordered and lie on mirror planes, whereas all positions for the Cu atoms are partially occupied. The crystal is built from edge-sharing [LaSe(6)] and [LaSe(7)] polyhedra. The five positions for the Cu atoms determine an ionic diffusion pathway in the structure. PMID:21368401

  7. Cervical cancer screening in the Faroe Islands

    DEFF Research Database (Denmark)

    Hammer, Turið; Lynge, Elsebeth; Djurhuus, Gisela W;

    2015-01-01

    aim was to provide the first description of cervical cancer screening, and to determine the screening history of women diagnosed with cervical cancer in the Faroe Islands. MATERIAL AND METHODS: Screening data from 1996 to 2012 were obtained from the Diagnostic Centre at the National Hospital......BACKGROUND: The Faroe Islands have had nationally organised cervical cancer screening since 1995. Women aged 25-60 years are invited every third year. Participation is free of charge. Although several European overviews on cervical screening are available, none have included the Faroe Islands. Our...... 1999. At present, 7.0% of samples have abnormal cytology. Of all ASCUS samples, 76-95% were tested for HPV. A total of 58% of women diagnosed with cervical cancer did not participate in screening prior to their diagnosis, and 32% had normal cytology in the previous four years. CONCLUSION: Despite...

  8. The Floating (Pathogenicity) Island: A Genomic Dessert.

    Science.gov (United States)

    Novick, Richard P; Ram, Geeta

    2016-02-01

    Among the prokaryotic genomic islands (GIs) involved in horizontal gene transfer (HGT) are the classical pathogenicity islands, including the integrative and conjugative elements (ICEs), the gene-transfer agents (GTAs), and the staphylococcal pathogenicity islands (SaPIs), the primary focus of this review. While the ICEs and GTAs mediate HGT autonomously, the SaPIs are dependent on specific phages. The ICEs transfer primarily their own DNA, the GTAs exclusively transfer unlinked host DNA, and the SaPIs combine the capabilities of both. Thus the SaPIs derive their importance from the genes they carry (their genetic cargo) and the genes they move. They act not only as versatile high-frequency mobilizers but also as mediators of phage interference and consequently are major benefactors of their host bacteria. PMID:26744223

  9. The electric dipole response of $^{76}$Se

    CERN Document Server

    Goddard, P M; Werner, V; Rusev, G; Stevenson, P D; Rios, A; Bernards, C; Chakraborty, A; Crider, B P; Kelley, J H; Kwan, E; Glorius, J; Peters, E E; Pietralla, N; Raut, R; Romig, C; Savran, D; Schnorrenberger, L; Smith, M K; Sonnabend, K; Tonchev, A P; Tornow, W; Yates, S W

    2013-01-01

    The dipole response of $^{76}_{34}$Se in the energy range 4 to 9 MeV has been analyzed using a $(\\vec\\gamma,{\\gamma}')$ polarized photon scattering technique, performed at the High Intensity $\\gamma$-Ray Source facility, to complement previous work performed using unpolarized photons. The results of this work offer both an enhanced sensitivity scan of the dipole response and an unambiguous determination of the parities of the observed J=1 states. The dipole response is found to be dominated by $E1$ excitations, and can reasonably be attributed to a pygmy dipole resonance. Evidence is presented to suggest that a significant amount of directly unobserved excitation strength is present in the region, due to unobserved branching transitions in the decays of resonantly excited states. The dipole response of the region is severely underestimated when considering only ground state decay branches. We investigate the electric dipole response theoretically, performing calculations in a 3D cartesian-basis time-dependent...

  10. Medikamentöse Therapie der Epilepsie

    Directory of Open Access Journals (Sweden)

    Gallmetzer P

    2009-01-01

    Full Text Available Durch neu zugelassene Antiepileptika wurde die medikamentöse Epilepsietherapie in den vergangenen Jahren entscheidend bereichert. Bei ca. 65 % der Epilepsiepatienten kann durch eine antiepileptische Therapie anhaltende Anfallsfreiheit erreicht werden, bei den übrigen 35 % entwickelt sich eine schwer behandelbare Epilepsie. Die wichtigsten Behandlungsziele sind neben der Anfallskontrolle die gute Verträglichkeit der medikamentösen Therapie, die Vermeidung chronischer Nebenwirkungen, die einfache Handhabung der Medikation für Arzt und Patient, die günstige Beeinflussung assoziierter Begleiterkrankungen sowie die Berücksichtigung der Bedürfnisse spezieller Patientengruppen. Generell sollte somit eine möglichst individualisierte Therapie erfolgen, die auf die Bedürfnisse des jeweiligen Patienten abgestimmt ist. Bei fehlender Anfallskontrolle sollte eine prächirurgische Epilepsiediagnostik erfolgen, um zu klären, ob der Patient ein Kandidat für einen epilepsiechirurgischen Eingriff ist. Mit Rufinamid, Stiripentol und Lacosamid sowie demnächst auch mit Eslicarbazepin stehen zur Behandlung schwer behandelbarer Epilepsiesyndrome neue Therapieoptionen zur Verfügung.

  11. Innovation in island ecotourism in different contexts: Yakushima (Japan and Tahiti and its Islands

    Directory of Open Access Journals (Sweden)

    Anne-Marie d’Hauteserre

    2016-05-01

    Full Text Available This article examines whether the future of tourism in island destinations lies in more and continued innovation on the part of all stakeholders so tourists will consider the extra expense of travelling a worthwhile investment. Islands have long been icons as tourism destinations. However, established destination images can cause a lack in adaptability to changing markets. Though located in different parts of the world and seeking different markets most island destinations would benefit from innovative strategies and products to enhance their attractiveness to high yield visitors. The article uses two examples to analyse the innovative forms that have been adopted in island destinations in the hope they could become models or encourage imitation by other destinations. Two aspects of innovation are discussed. New imaginary can creatively and innovatively (re-imagine representations; sustainability could be an important innovative pursuit, which requires new narratives for continued tourism growth. These concepts are applied next to the island of Yakushima in Japan and Tahiti and its Islands to determine the main innovative elements used or required to jumpstart the attractiveness of island destinations, though it is recognized that implementation is complex.

  12. Assesing Geographic Isolation of the Galapagos Islands

    Science.gov (United States)

    Orellana, D.; Smith, F.

    2016-06-01

    The Galapagos Archipelago is one of the most important ecological spots in the planet due its unique biodiversity, active geology, and relatively well-preserved ecosystems. These characteristics are strongly based on the geographical isolation of the islands. On the one hand this isolation allowed the evolution processes that gave the islands their international fame and on the other hand it kept them from major human impacts that affected the vast majority of the Earth's surface. Galapagos' geographical isolation is therefore of mayor value, but it is rapidly diminishing due to the increase of marine and air transportation among islands and with the rest of the world. This increased accessibility implies enhanced risks for the ecological dynamics on the archipelago (e.g. increased risk of biological invasions, uncontrolled tourism growth, more water and energy consumption). Here, we introduce a general accessibility model to assess geographical isolation of the Galapagos Islands. The model aims to characterize accessibility in terms of human mobility by evaluating travel time to each point of the archipelago using all available transportation modalities. Using a multi criteria cost surface for marine and land areas, we estimated travel time for each surface unit using the fastest route and mode of transportation available while considering several friction factors such as surface type, slope, infrastructure, transfer points, legal restrictions, and physical barriers. We created maps to evaluate the isolation of different islands and places, highlighting the potential risks for several habitats and ecosystems. The model can be used for research and decision-making regarding island conservation, such as estimating spreading paths for invasive species, informing decisions on tourism management, and monitoring isolation changes of sensitive ecosystems.

  13. Stone anchors from Minicoy Island, Lakshadweep, India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.

    for coastal protection in Sedivalu village on Minicoy. This head is 50 cm high by 35 cm wide, and has a socket on its back for attachment to the torso. The facial features have disappeared due to flaking (Sila Tripati and Gudigar, 2001). The islands... and Ali Rajas of Kerala. It appears that the mainland had contact with these islands during the early centuries of the Christian era, if not earlier (Sila Tripati, 1999). Though Islam came to Lakshadweep after the 11th and 12th centuries AD...

  14. Finnish travelers' travel motivation : case: Canary Islands

    OpenAIRE

    Jokilehto, Katri

    2012-01-01

    The aim of the thesis was to study the travel motives which lead Finnish people to travel to the Canary Islands and other factors which impact on the holiday decision process and destination choice. The target group for the research was Finnish people and the aim was to study the travel motives of Finns to the Canary Islands and which factors are important for Finnish people to gain a successful holiday. The research was conducted by using internet survey and the collected data was analyzed b...

  15. How a bird is an island

    Directory of Open Access Journals (Sweden)

    Lapoint Richard

    2012-06-01

    Full Text Available Abstract Replicate adaptive radiations occur when lineages repeatedly radiate and fill new but similar niches and converge phenotypically. While this is commonly seen in traditional island systems, it may also be present in host-parasite relationships, where hosts serve as islands. In a recent article in BMC Biology, Johnson and colleagues have produced the most extensive phylogeny of the avian lice (Ischnocera to date, and find evidence for this pattern. This study opens the door to exploring adaptive radiations from a novel host-parasite perspective. See research article: http://www.biomedcentral.com/1741-7007/10/52

  16. Ancient shell industry at Bet Dwarka island

    Digital Repository Service at National Institute of Oceanography (India)

    Gaur, A.S.; Sundaresh; Patankar, V.

    stream_size 23813 stream_content_type text/plain stream_name Curr_Sci_89_941.pdf.txt stream_source_info Curr_Sci_89_941.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 GENERAL ARTICLES... out in the season 2001 ? 02, to trace the cultural sequence of Figure 1. Turbinella pyrum discovered from Bet Dwarka Island. GENERAL ARTICLES CURRENT SCIENCE, VOL. 89, NO. 6, 25 SEPTEMBER 2005 the Island and also t o understand...

  17. Islands in the Midst of the World

    Science.gov (United States)

    2002-01-01

    The Greek islands of the Aegean Sea, scattered across 800 kilometers from north to south and between Greece and western Turkey, are uniquely situated at the intersection of Europe, Asia and Africa. This image from the Multi-angle Imaging SpectroRadiometer includes many of the islands of the East Aegean, Sporades, Cyclades, Dodecanese and Crete, as well as part of mainland Turkey. Many sites important to ancient and modern history can be found here. The largest modern city in the Aegean coast is Izmir, situated about one quarter of the image length from the top, southeast of the large three-pronged island of Lesvos. Izmir can be located as a bright coastal area near the greenish waters of the Izmir Bay, about one quarter of the image length from the top, southeast of Lesvos. The coastal areas around this cosmopolitan Turkish city were a center of Ionian culture from the 11th century BC, and at the top of the image (north of Lesvos), once stood the ancient city of Troy.The image was acquired before the onset of the winter rains, on September 30, 2001, but dense vegetation is never very abundant in the arid Mediterranean climate. The sharpness and clarity of the view also indicate dry, clear air. Some vegetative changes can be detected between the western or southern islands such as Crete (the large island along the bottom of the image) and those closer to the Turkish coast which appear comparatively green. Volcanic activities are evident by the form of the islands of Santorini. This small group of islands shaped like a broken ring are situated to the right and below image center. Santorini's Thera volcano erupted around 1640 BC, and the rim of the caldera collapsed, forming the shape of the islands as they exist today.The Multi-angle Imaging SpectroRadiometer observes the daylit Earth continuously from pole to pole, and views almost the entire globe every 9 days. This natural-color image was acquired by MISR's nadir (vertical-viewing) camera, and is a portion of the

  18. Study of crystal structure of ternary compounds CuIn3Se5 and CuIn5Se8

    International Nuclear Information System (INIS)

    The structures of monocrystals of CuIn3Se5 and CuIn5Se8 ternary compounds have been studied by X-ray diffraction for the first time. The lattice parameters of CuIn3Se5 and CuIn5Se8 crystals are determined. It is established that CuIn3Se5 has a thiogallate lattice with c = 2a, which leads to the domain structure formation. CuIn5Se8 has a hexagonal lattice and exhibits cleavage along the (001) plane. The interrelation between the atomic composition and crystal structure of these new ternary semiconductor compounds is discussed

  19. Vulnerability assessment of small islands to tourism: The case of the Marine Tourism Park of the Gili Matra Islands, Indonesia

    Directory of Open Access Journals (Sweden)

    Fery Kurniawan

    2016-04-01

    Full Text Available The Indonesian government is currently directing its focus of development on the optimum uses of marine and coastal ecosystem services including the marine and coastal tourism. One of the main locus of coastal and marine tourism is the small islands tourism such as Gili Matra Islands among others. Small islands tourism is one of the favourite touristic activities because the destination provides beauty, exotism, aesthetic and a diversity of natural habitats including the warm, clear and attractive water. Tourism is being considered as a development instrument in order to boost a country’s economy and has become part of the global industry. However, tourism is also one of the actors that is responsible for environmental depletion, due to the constructions of buildings and tourism activities. This paper aims to study the level of vulnerability in small islands to tourism as a basis of integrated small islands management in Indonesian conservation area. The group of islands in this study consists of three islands namely Gili Ayer Island, Gili Meno Island and Gili Trawangan Island (known as Gili Matra Islands that were observed using Small Islands Vulnerability Index (SIVI. The results indicate that Gili Matra Islands have a vulnerability status from low into moderate, ranging from 2.25 to 2.75. Gili Ayer Island has the highest vulnerability with SIVI of 2.75 (Moderate, followed by Gili Meno Island with SIVI of 2.50 (Low and Gili Trawangan Island with SIVI of 2.25 (Low. The driving factor of vulnerability is the intensive utilization of marine tourism activities. Tourism is the sole stress to Gili Matra Island’s ecosystem due to its direct damaging impact and reducing its environmental quality. The vulnerability index which was built from the coastline, coral reef, live coral reef, and development area was applicable to assess the small island’s vulnerability in Indonesia, especially for coral island.

  20. Estuarine Shoreline and Barrier-Island Sandline Change Assessment Dataset

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — The Barrier Island and Estuarine Wetland Physical Change Assessment Dataset was created to calibrate and test probability models of barrier island sandline and...

  1. Shipwreck archaeology of the Lakshadweep Islands, west coast of India

    Digital Repository Service at National Institute of Oceanography (India)

    Tripati, S.; Gudigar, P.

    Archaeological investigations in the Lakshadweep Islands have brought to light the presence of a large number of shipwrecks and the archival records have the details of some of these wrecks. Northern islands and reefs of Minicoy were the locations...

  2. Bald eagle nest survey, 1981, Amchitka Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — A nesting survey for bald eagles Haliaeetus leucocephalus was conducted from May 29, 1981, on a portion of Amchitka Island, Aleutian Islands Unit, Alaska Maritime...

  3. Fox management plan, Aleutian Islands Unit, AMNWR: Draft

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The presence or absence of arctic fox on islands in the Aleutian Islands Units is described as a decision tool for fox eradication. An effective chemical...

  4. Narrative report: Gulf Island National Wildlife Refuges: 1966

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Gulf Island National Wildlife Refuges (Petit Bois National Wildlife Refuge, Horn Island National Wildlife Refuge, and Breton...

  5. Piram island: Pirates Fort in the Gulf of Khambat

    Digital Repository Service at National Institute of Oceanography (India)

    Gaur, A; Bhatt, B.K.

    Traditionally, Piram Island has been considered as landmark point for the navigators in the Gulf of Cambay. The mention has also been made that Island has served as heaven for pirates. A coastal archaeological exploration was undertaken in order...

  6. Breast Cancer and the Environment on Long Island

    Science.gov (United States)

    The cornerstone of the LIBCSP is the Breast Cancer and the Environment on Long Island Study, which was undertaken to determine whether certain environmental contaminants increase risk of breast cancer among women on Long Island.

  7. Vascular plant diversity of the Paracel Islands, China

    Directory of Open Access Journals (Sweden)

    Yi Tong

    2013-05-01

    Full Text Available The Paracel Islands (Xisha Islands comprise a group of tropical islands that are located south of mainland China and have a particular natural flora. Based on a literature search and our own investigations, we present here a checklist of plants for 24 of the Paracel Islands. We also report an analysis of plant diversity, its distribution and relationship with that of neighboring regions. A total of 396 vascular plants were recorded which belonged to 262 genera and 85 families. Of these, 220 were wild species and 176 were cultivated. As a whole, the islands do not possess a rich flora; however, there are major differences in plant diversity among islands. The flora consists in large part of tropical elements, typical of tropical coral islands of China. The flora is most closely connected to that of Hainan Island, and closely related to those of Taiwan of China, Indochina, Malaysia, Indonesia and the Philippines.

  8. Northern fur seal pup weights, Pribilof Islands, Alaska, 1957-present

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This database contains northern fur seal pup mass and length data by date, island, rookery and sex on the Pribilof Islands, Alaska, collected between 1957-2012....

  9. Narrative report: Gulf Island National Wildlife Refuges: 1964

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Gulf Island National Wildlife Refuges (Petit Bois National Wildlife Refuge, Horn Island National Wildlife Refuge, and Breton...

  10. Narrative report: Gulf Island National Wildlife Refuges: 1965

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Gulf Island National Wildlife Refuges (Petit Bois National Wildlife Refuge, Horn Island National Wildlife Refuge, and Breton...

  11. Narrative report: Gulf Island National Wildlife Refuges: 1967

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Gulf Island National Wildlife Refuges (Petit Bois National Wildlife Refuge, Horn Island National Wildlife Refuge, and Breton...

  12. Narrative report: Gulf Island National Wildlife Refuges: 1968

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This annual narrative report for Gulf Island National Wildlife Refuges (Petit Bois National Wildlife Refuge, Horn Island National Wildlife Refuge, and Breton...

  13. Northern Mariana Islands Marine Monitoring Team Reef Flat Surveys

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Commonwealth of the Northern Mariana Islands' (CNMI) interagency marine monitoring team conducts surveys on reef flat areas on the islands of Saipan, Tinian and...

  14. Northwest Hawaiian Islands Coral Reef Ecosystem Division Reef Fish Biomass

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset represents island-scale mean and Standard Error of biomass for 4 trophic groups using all data from North West Hawaiian Islands gathered using NOAA's...

  15. Correspondence Regarding the Purchase of St. Vincent Island

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This document contains a series of letters discussing the sale of St. Vincent Island. Robert Bishop wishes to purchase the island and writes back and forth with the...

  16. Kodiak brown bear population on Kodiak Island, Alaska

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Methods and estimates of the Brown bear population on Kodiak Island. The total number of Kodiak Brown Bears on Kodiak Island has been estimated to be 1669. Three...

  17. Rural development issues in Prince Edward Island, Canada

    Directory of Open Access Journals (Sweden)

    Stephen A. Royle

    2002-01-01

    Full Text Available Historical background and contemporary rural area differencies in PrinceEdwar Island is represented. The effects of some development projects areanalysed zaking into account the changes of activity orientation of differentparts of the island.

  18. FastStats: Health of Asian or Pacific Islander Population

    Science.gov (United States)

    ... NCHS Home Health of Asian or Pacific Islander Population Recommend on Facebook Tweet Share Compartir Data are ... U.S. Live births for Asian or Pacific Islander population Number of births: 282,723 Births per 1, ...

  19. Blackbeard Island Wilderness: Report on wilderness character monitoring

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report provides a detailed summary of the baseline wilderness character assessment completed for the Blackbeard Island Wilderness on the Blackbeard Island...

  20. Li2Se:Te as a neutron scintillator

    International Nuclear Information System (INIS)

    We show that Li2Se:Te is a potential neutron scintillator material based on density functional calculations. Li2Se exhibits a number of properties favorable for efficient neutron detection, such as a high Li concentration for neutron absorption, a small effective atomic mass and a low density for reduced sensitivity to background gamma rays, and a small band gap for a high light yield. Our calculations show that Te doping should lead to the formation of deep acceptor complex VLi–TeSe, which can facilitate efficient light emission, similar to the emission activation in Te doped ZnSe. - Highlights: • Te doped Li2Se is proposed as a promising neutron scintillator based on density functional calculations. • Li2Se has a high Li concentration, a low density, and a small band gap, favorable for neutron detection. • Li2Se can be activated by VLi–TeSe

  1. Amsterdam Expeditions to the West Indian Islands, Report 13. Marine sponges from an island cave on San Salvador Island, Bahamas

    NARCIS (Netherlands)

    Soest, van R.W.M.; Sass, B. Daniel

    1981-01-01

    Dixon Hill Lighthouse Cave, about 800 m (0.5 miles) inshore on San Salvador Island, Bahamas, was found to hold populations of three sponge species new to science, viz. Pellina penicilliformis n. sp., Prosuberites geracei n. sp., and Cinachyra subterranea n. sp. The new species are described and figu

  2. Freshwater flux to Sermilik Fjord, SE Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2010-10-01

    Full Text Available Terrestrial inputs of freshwater flux to Sermilik Fjord, SE Greenland, were estimated, indicating ice discharge to be the dominant source of freshwater. A freshwater flux of 40.4 ± 4.9×109 m3 y−1 was found (1999–2008, with an 85% contribution originated from ice discharge (65% alone from Helheim Glacier, 11% from terrestrial surface runoff (from melt water and rain, 3% from precipitation at the fjord surface area, and 1% from subglacial geothermal and frictional melting due to basal ice motion. The results demonstrate the dominance of ice discharge as a primary mechanism for delivering freshwater to Sermilik Fjord. Time series of ice discharge for Helheim Glacier, Midgård Glacier, and Fenris Glacier were calculated from satellite-derived average surface velocity, glacier width, and estimated ice thickness, and fluctuations in terrestrial surface freshwater runoff were simulated based on observed meteorological data. These simulations were compared and bias corrected against independent glacier catchment runoff observations. Modeled runoff to Sermilik Fjord was variable, ranging from 2.9 ± 0.4×109 m3 y−1 in 1999 to 5.9 ± 0.9×109 m3 y−1 in 2005. The sub-catchment runoff of the Helheim Glacier region accounted for 25% of the total runoff to Sermilik Fjord. The runoff distribution from the different sub-catchments suggested a strong influence from the spatial variation in glacier coverage, indicating high runoff volumes, where glacier cover was present at low elevations.

  3. Freshwater flux to Sermilik Fjord, SE Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2010-07-01

    Full Text Available Fluctuations in terrestrial surface freshwater flux to Sermilik Fjord, SE Greenland, were simulated and analyzed. SnowModel, a state-of-the-art snow-evolution, snow and ice melt, and runoff modeling system, was used to simulate the temporal and spatial terrestrial runoff distribution to the fjord based on observed meteorological data (1999–2008 from stations located on and around the Greenland Ice Sheet (GrIS. Simulated runoff was compared and verified against independent glacier catchment runoff observations (1999–2005. Modeled runoff to Sermilik Fjord was highly variable, ranging from 2.9×109 m3 y−1 in 1999 to 5.9×109 m3 y−1 in 2005. The uneven spatial runoff distribution produced an areally-averaged annual maximum runoff at the Helheim glacier terminus of more than 3.8 m w.eq. The sub-catchment runoff of the Helheim glacier region accounted for 25% of the total runoff to Sermilik Fjord. The runoff distribution from the different sub-catchments suggested a strong influence from the spatial variation in glacier coverage. To assess the Sermilik Fjord freshwater flux, simulated terrestrial runoff and net precipitation (precipitation minus evaporation and sublimation for the fjord area were combined with satellite-derived ice discharge and subglacial geothermal and frictional melting due to basal ice motion. A terrestrial freshwater flux of ~40.4×109 m3 y−1 was found for Sermilik Fjord, with an 11% contribution originated from surface runoff. For the Helheim glacier sub-catchment only 4% of the flux originated from terrestrial surface runoff.

  4. La desaceleración económica colombiana: se cosecha lo que se siembra

    Directory of Open Access Journals (Sweden)

    Carlos Humberto Ortiz

    2009-12-01

    Full Text Available La desaceleración económica que experimenta Colombia desde 1980 se explica por el estancamiento estructural de la economía y por la escalada de violencia relacionada con la expansión del narcotráfico. Los datos disponibles no rechazan esta hipótesis. El artículo plantea que la desindustrialización y el narcotráfico se forjaron en el mismo crisol: un modelo de desarrollo que ha integrado progresivamente la economía nacional a los mercados mundiales al tiempo que ha renunciado, también progresivamente, a la opción industrialista. Además, argumenta que la explosión del narcotráfico obedece a la profundización de la guerra contra las drogas en un contexto de demanda mundial creciente e inelástica.

  5. Terrestrial reptiles from San Lorenzo Island, Lima, Peru

    Directory of Open Access Journals (Sweden)

    José Pérez Z.

    2015-04-01

    Full Text Available We report four species of terrestrial reptiles, a geckonid (Phyllodactlus cf. microphyllus, two lizards (Microlophus peruvianus and M. tigris and one snake (Pseudalsophis elegans from San Lorenzo island, Departament of Lima, Peru. Herein, we report the first record of “Loma’s lizard” M. tigris and the snake P. elegans in Peruvian islands. The presence of Lomas herbaceous and the considerable extent of San Lorenzo island can explain the relatively high species richness of terrestrial reptiles on the island.

  6. Citrus Genetic Resources Grown on the Ryukyu Islands, Japan

    OpenAIRE

    Yamamoto, Masashi; ヤマモト, マサシ; 山本, 雅史

    2014-01-01

    The Ryukyu Islands are located southwest part of Japan. Various local citrus are grown in this subtropical region. Since there are large geographical and climatic differences between the Ryukyu Islands and the main islands (Honshu, Kyushu, and Shikoku) of Japan, there are unique local citrus genetic resources on the Ryukyu Islands. Shiikuwasha (Citrus depressa) is an indigenous mandarin species in this region. This species is clearly distinguished from the mandarin grown in China and India ba...

  7. Chumash Ritual and Sacred Geography on Santa Cruz Island, California

    OpenAIRE

    Perry, Jennifer E.

    2007-01-01

    In contrast to the archaeological visibility of Chumash rock art on the mainland, its virtual absence on the northern Channel Islands is reflective of what little is understood about ritual behavior in island prehistory. By relying on relevant ethnohistoric and ethnographic references from the mainland, it is possible to evaluate how related activities may be manifested archaeologically on the islands. On Santa Cruz Island, portable ritual items and rock features have been identified on El Mo...

  8. Quantum superposition of charge states on capacitively coupled superconducting islands

    OpenAIRE

    Heij, C. P.; Dixon, D C; van der Wal, C H; Hadley, P.; Mooij, J.E.

    2003-01-01

    We investigate the ground state properties of a system containing two superconducting islands coupled capacitively by a wire. The ground state is a macroscopic superposition of charge states, even though the islands cannot exchange charge carriers. The ground state of the system is probed by measuring the switching current of a Bloch transistor containing one of the islands. Calculations based on superpositions of charge states on both islands show good agreement with the experiments. The abi...

  9. 21 CFR 118.4 - Salmonella Enteritidis (SE) prevention measures.

    Science.gov (United States)

    2010-04-01

    ... National Poultry Improvement Plan's standards for “U.S. S. Enteritidis Clean” status (9 CFR 145.23(d)) or... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Salmonella Enteritidis (SE) prevention measures....4 Salmonella Enteritidis (SE) prevention measures. You must follow the SE prevention measures...

  10. Calculation of half-life for 79Se decay

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The half-life for 79Se decay is calculated by using the Logf1ut systematics method. Based on the data analysis and comparison with experimental data the 79Se half-life is recommended. The scheme for 79Se decay is also shown and the radiation data are calculated in the text.

  11. Por uma cidade que se move e se comunica: corpo, rua e improviso

    Directory of Open Access Journals (Sweden)

    Julia Saldanha Vieira de Aguiar

    2009-06-01

    Full Text Available Este trabalho trata da relação de um lugar com suas pessoas. A reflexão acontece a partir de um estudo de caso: o Camelódromo da Praça XV. O Camelódromo foi uma grande feira, que durante 40 anos ocupou um espaço importante no centro de Porto Alegre/RS. (Auto organizado e vivido principalmente pelo povo, o fenômeno se configurava em um lugar onde improviso e estética constituiam o modo de ser e agir no cotidiano da rua. Ironicamente, no início de 2009, o Camelódromo foi transferido para dentro de um prédio. Hoje, onde se desenrolava o espetáculo do imprevisível, encontra-se um estacionamento para carros. Este trabalho foi produzido nos últimos meses do Camelódromo; em um espírito de elogio à estética do improviso e à auto-organização. Buscamos articular idéias da teoria da complexidade, do urbanismo, das artes e da comunicação, para tentar compreender um pouco essa manifestação espontânea, tão característica da urbe no século XXI.

  12. Interaction of bootstrap-current-driven magnetic islands

    International Nuclear Information System (INIS)

    The formation and interaction of fluctuating neoclassical pressure gradient driven magnetic islands is examined. The interaction of magnetic islands produces a stochastic region around the separatrices of the islands. This interaction causes the island pressure profile to be broadened, reducing the island bootstrap current and drive for the magnetic island. A model is presented that describes the magnetic topology as a bath of interacting magnetic islands with low to medium poloidal mode number (m congruent 3-30). The islands grow by the bootstrap current effect and damp due to the flattening of the pressure profile near the island separatrix caused by the interaction of the magnetic islands. The effect of this sporadic growth and decay of the islands (''magnetic bubbling'') is not normally addressed in theories of plasma transport due to magnetic fluctuations. The nature of the transport differs from statistical approaches to magnetic turbulence since the radial step size of the plasma transport is now given by the characteristic island width. This model suggests that tokamak experiments have relatively short-lived, coherent, long wavelength magnetic oscillations present in the steep pressure-gradient regions of the plasma. 42 refs

  13. Biometric variation in Spadella cephaloptera on the Canary Islands (Chaetognatha)

    NARCIS (Netherlands)

    Broerse, Alexandra T.C.

    1993-01-01

    Specimens of Spadella cephaloptera from Tenerife, Gran Canaria and Gomera (Canary Islands) were compared biometrically in regards to morphometric and meristic characters. Variation exists among the populations on the islands as well as between the islands. The populations on Gomera seem more distinc

  14. Reconnection of islanded portion of the CIGRE low voltage network

    DEFF Research Database (Denmark)

    Mustafa, Ghullam; Bak, Claus Leth; Bak-Jensen, Birgitte;

    2016-01-01

    Islanding is a condition where a portion of the power network is electrically isolated from the main the transmission grid. Islanded operation is encouraged in order to improve the reliability of the power network. However, the reliability of the small networks operating is island is less as comp...

  15. Sustainable Mobility for Tourists at the Dutch Coastal Islands (Waddeneilanden)

    NARCIS (Netherlands)

    Sminia, O.; Vogtländer, J.G.; Brezet, J.C.

    2010-01-01

    The European Coastal Islands around the North sea, are joined together in a project that stimulates sustainable development. Within this 'Cradle-to-Cradle Islands' project, some islands were selected as breading grounds for potentially sustainable projects. One of these projects was the development

  16. Is the island universe model consistent with observations?

    OpenAIRE

    Piao, Yun-Song

    2005-01-01

    We study the island universe model, in which initially the universe is in a cosmological constant sea, then the local quantum fluctuations violating the null energy condition create the islands of matter, some of which might corresponds to our observable universe. We examine the possibility that the island universe model is regarded as an alternative scenario of the origin of observable universe.

  17. 33 CFR 80.1122 - Channel Islands Harbor, CA.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Channel Islands Harbor, CA. 80.1122 Section 80.1122 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY INTERNATIONAL NAVIGATION RULES COLREGS DEMARCATION LINES Pacific Coast § 80.1122 Channel Islands Harbor, CA. (a) A line drawn from Channel Islands...

  18. Photo-geomorphologic study of representative islands of Lakshadweep

    Digital Repository Service at National Institute of Oceanography (India)

    Wagle, B.G.; Kunte, P.D.

    The Lakshadweep group of islands is scattered in the Arabian Sea about 200 to 400 km off the west coast of Kerala, India. The general topography of islands is hummocky to flat with steeper shore on the east. The coralline islands are fringed...

  19. Tracing the Evolution of Florida's St. Vincent Island

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This is a history of St. Vincent Island, up to the year that it was bought by the U.S. Fish and Wildlife Service. St. Vincent Island is a natural barrier island...

  20. Terroir, storytelling and cultural heritage as opportunity for island entrepreneurship

    DEFF Research Database (Denmark)

    Korsgaard, Steffen T.

    This paper explores how entrepreneurs can create opportunities for business in rural island settings. Three cases of food entrepreneurship are examined and it is suggested that opportunities can be created by leveraging the unique localized resources available in rural island settings in persuasive...... and authentic stories told through and about the products. Similarities and differences between conventional and rural island entrepreneurship are explored....