WorldWideScience

Sample records for amf species beans

  1. Two distinct nanovirus species infecting faba bean in Morocco.

    Science.gov (United States)

    Abraham, Adane D; Bencharki, Bouchaib; Torok, Valeria; Katul, Lina; Varrelmann, Mark; Josef Vetten, H

    2010-01-01

    Using monoclonal antibodies raised against a Faba bean necrotic yellows virus (FBNYV) isolate from Egypt and a Faba bean necrotic stunt virus (FBNSV) isolate from Ethiopia, a striking serological variability among nanovirus isolates from faba bean in Morocco was revealed. To obtain a better understanding of this nanovirus variability in Morocco, the entire genomes of two serologically contrasting isolates referred to as Mor5 and Mor23 were sequenced. The eight circular ssDNA components, each identified from Mor5- and Mor23-infected tissues and thought to form the complete nanovirus genome, ranged in size from 952 to 1,005 nt for Mor5 and from 980 to 1,004 nt for Mor23 and were structurally similar to previously described nanovirus DNAs. However, Mor5 and Mor23 differed from each other in overall nucleotide and amino acid sequences by 25 and 26%, respectively. Mor23 was most closely related to typical FBNYV isolates described earlier from Egypt and Syria, with which it shared a mean amino acid sequence identity of about 94%. On the other hand, Mor5 most closely resembled a FBNSV isolate from Ethiopia, with which it shared a mean amino acid sequence identity of approximately 89%. The serological and genetic differences observed for Mor5 and Mor23 were comparable to those observed earlier for FBNYV, FBNSV, and Milk vetch dwarf virus. Following the guidelines on nanovirus species demarcation, this suggests that Mor23 and Mor5 represent isolates of FBNYV and FBNSV, respectively. This is the first report not only on the presence of FBNSV in a country other than Ethiopia but also on the occurrence and complete genome sequences of members of two nanovirus species in the same country, thus providing evidence for faba bean crops being infected by members of two distinct nanovirus species in a restricted geographic area. PMID:20069400

  2. Two distinct nanovirus species infecting faba bean in Morocco

    OpenAIRE

    Abraham, Adane; Bencharki, Bouchaib; Torok, Valeria; Katul, Lina; Varrelmann, Mark; Josef Vetten, H.

    2009-01-01

    Using monoclonal antibodies raised against a Faba bean necrotic yellows virus (FBNYV) isolate from Egypt and a Faba bean necrotic stunt virus (FBNSV) isolate from Ethiopia, a striking serological variability among nanovirus isolates from faba bean in Morocco was revealed. To obtain a better understanding of this nanovirus variability in Morocco, the entire genomes of two serologically contrasting isolates referred to as Mor5 and Mor23 were sequenced. The eight circular ssDNA components, each ...

  3. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos; Frisvad, Jens Christian; Samson, Robert A.

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles) and...

  4. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos;

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...

  5. Petroleum hydrocarbon contamination, plant identity and arbuscular mycorrhizal fungal (AMF) community determine assemblages of the AMF spore-associated microbes.

    Science.gov (United States)

    Iffis, Bachir; St-Arnaud, Marc; Hijri, Mohamed

    2016-09-01

    The root-associated microbiome is a key determinant of pollutant degradation, soil nutrient availability and plant biomass productivity, but could not be examined in depth prior to recent advances in high-throughput sequencing. Arbuscular mycorrhizal fungi (AMF) form symbioses with the majority of vascular plants. They are known to enhance mineral uptake and promote plant growth and are postulated to influence the processes involved in phytoremediation. Amplicon sequencing approaches have previously shown that petroleum hydrocarbon pollutant (PHP) concentration strongly influences AMF community structure in in situ phytoremediation experiments. We examined how AMF communities and their spore-associated microbiomes were structured within the rhizosphere of three plant species growing spontaneously in three distinct waste decantation basins of a former petrochemical plant. Our results show that the AMF community was only affected by PHP concentrations, while the AMF-associated fungal and bacterial communities were significantly affected by both PHP concentrations and plant species identity. We also found that some AMF taxa were either positively or negatively correlated with some fungal and bacterial groups. Our results suggest that in addition to PHP concentrations and plant species identity, AMF community composition may also shape the community structure of bacteria and fungi associated with AMF spores. PMID:27376781

  6. AMF 1 Site Science

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Mark Alan [Rutgers Univ., New Brunswick, NJ (United States)

    2016-08-18

    This report documents progress on DOE Grant# DE-FG02-08ER64531 funded by the Department of Energy’s Atmospheric Systems Research (ASR) program covering the period between its inception in 2008 and its conclusion in 2014. The Atmospheric Radiation Measurement (ARM) Program’s Mobile Facility #1 (AMF#1) is a collection of state-of-the art atmospheric sensing systems including remote and in situ instrumentation designed to characterize the atmospheric column above and in the immediate vicinity of the deployment location. The grant discussed in this report funded the activities of the AMF#1 Site Scientist Team. Broad responsibilities of this team included examining new deployment sites and recommending instrument deployment configurations; data quality control during the early stages of deployments and for certain instruments through the course of the deployment; scientific outreach in the host country or location (particularly international deployments); scientific research oriented toward basic questions about cloud physics and radiation transfer in the deployment region; and training of Ph.D. students to conduct future research relevant to the Atmospheric Systems Research (ASR) program.

  7. Use of Wild Relatives and Closely Related Species to Adapt Common Bean to Climate Change

    Directory of Open Access Journals (Sweden)

    James D. Kelly

    2013-05-01

    Full Text Available Common bean (Phaseolus vulgaris L. is an important legume crop worldwide. However, abiotic and biotic stress limits bean yields to <600 kg ha−1 in low-income countries. Current low yields result in food insecurity, while demands for increased yields to match the rate of population growth combined with the threat of climate change are significant. Novel and significant advances in genetic improvement using untapped genetic diversity available in crop wild relatives and closely related species must be further explored. A meeting was organized by the Global Crop Diversity Trust to consider strategies for common bean improvement. This review resulted from that meeting and considers our current understanding of the genetic resources available for common bean improvement and the progress that has been achieved thus far through introgression of genetic diversity from wild relatives of common bean, and from closely related species, including: P. acutifolius, P. coccineus, P. costaricensis and P. dumosus. Newly developed genomic tools and their potential applications are presented. A broad outline of research for use of these genetic resources for common bean improvement in a ten-year multi-disciplinary effort is presented.

  8. Conservation of Plasmid-Encoded Traits among Bean-Nodulating Rhizobium Species

    OpenAIRE

    Brom, Susana; Girard, Lourdes; García-de los Santos, Alejandro; Sanjuan-Pinilla, Julio M.; Olivares, José; Sanjuan, Juan

    2002-01-01

    Rhizobium etli type strain CFN42 contains six plasmids. We analyzed the distribution of genetic markers from some of these plasmids in bean-nodulating strains belonging to different species (Rhizobium etli, Rhizobium gallicum, Rhizobium giardinii, Rhizobium leguminosarum, and Sinorhizobium fredii). Our results indicate that independent of geographic origin, R. etli strains usually share not only the pSym plasmid but also other plasmids containing symbiosis-related genes, with a similar organi...

  9. Alleviation of adverse impact of salinity on faba bean (vicia faba l.) by arbuscular mycorrhizal fungialleviation of adverse impact of salinity on faba bean (vicia faba l.) by arbuscular mycorrhizal fungi

    International Nuclear Information System (INIS)

    The present study was conducted to assess the effect of different concentrations of sodium chloride (NaCl) in presence and absence of AMF on growth, physio-biochemical and enzymatic activity in faba bean (Vicia faba). Different concentrations of NaCl showed reduction in growth and yield parameters, which indicates the deleterious effects of salinity on the plant. The total spore count and colonization by arbuscular mycorrhizal fungi (AMF) is also decreasing at higher concentrations of NaCl. Application of AMF mitigates the effect of NaCl stress and improved the growth and yield in the present study. NaCl also decreased the nodulation as well as nodule activity and pigments content, however the supplementation of by AMF to plants treated with sodium chloride showed enhancement in nodule activity and pigment content. Polyamines (Putresciene, Spermidine, Spermine), acid and alkaline phosphates increased with increasing concentration of sodium chloride and application of by AMF showed further increase in the above phytoconstituents, proving the protective role of these phytoconstituents against salt stress. Salinity stress is responsible for the generation of reactive oxygen species, which lead to the membrane damage through lipid peroxidation in the present study. Maximum lipid peroxidation was observed at higher concentration of sodium chloride and AMF treatment minimized the effect of salinity on lipid peroxidation. To combat with the reactive oxygen species, plants upregulate the enzymatic antioxidants like superoxide dismutase, catalase, peroxidase and ascorbate peroxidase. As the concentration of sodium chloride increases the enzyme activity also increases and further increase was observed with supplementation of AMF to salt treated plants. Arbuscular mycorrhizal fungi also restores the potassium and calcium contents and maintain their ratio that was hampered with increasing concentration of sodium chloride in the present study. In conclusion, application of AMF

  10. Development of PCR-based assays for detecting and differentiating three species of botrytis infecting broad bean

    Science.gov (United States)

    Botrytis cinerea, B. fabae and B. fabiopsis are known to cause chocolate spot on broad bean. This study was conducted to develop PCR-based assays to detect and differentiate this three species. Two sets of primers, Bc-f/Bc-r for B. cinerea and Bfab-f/Bfab-r for B. fabiopsis, were designed based on t...

  11. Isolation, identification and toxigenic potential of ochratoxin A-producing Aspergillus species from coffee beans grown in two regions of Thailand

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanakul, W.; Nielsen, Kristian Fog;

    2008-01-01

    In 2006 and 2007, 32 Thai dried coffee bean samples (Coffea arabica) from two growing sites of Chiang Mai Province, and 32 Thai dried coffee bean samples (Coffea canephora var. robusta) from two growing sites of Chumphon Province, Thailand, were collected and assessed for the distribution of fungi...... with the potential to produce ochratoxin A (OTA). The overall percentage of fungal contamination in coffee was 98% and reduced to 60% after surface disinfection. There were remarkable ecological differences in the composition of ochratoxigenic species present in these two regions. Arabica coffee bean samples from...... the North had an average of 78% incidence of colonization with Aspergillus of section Circumdati with Aspergillus westerdijkiae and A. melleus as the predominant species. Aspergillus spp. of section Nigri were found in 75% of the samples whereas A. ochraceus was not detected. Robusta coffee beans from...

  12. Nitric oxide increases tolerance responses to moderate water deficit in leaves of Phaseolus vulgaris and Vigna unguiculata bean species.

    Science.gov (United States)

    Zimmer-Prados, Lucas Martins; Moreira, Ana Sílvia Franco Pinheiro; Magalhaes, Jose Ronaldo; França, Marcel Giovanni Costa

    2014-07-01

    Drought stress is one of the most intensively studied and widespread constraints, and nitric oxide (NO) is a key signaling molecule involved in the mediation of abiotic stresses in plants. We demonstrated that a sprayed solution of NO from donor sodium nitroprusside increased drought stress tolerance responses in both sensitive (Phaseolus vulgaris) and tolerant (Vigna unguiculata) beans. In intact plants subjected to halting irrigation, NO increased the leaf relative water content and stomatal conductance in both species. After cutting leaf discs and washing them, NO induced increased electrolyte leakage, which was more evident in the tolerant species. These leaf discs were then subjected to different water deficits, simulating moderate and severe drought stress conditions through polyethylene glycol solutions. NO supplied at moderate drought stress revealed a reduced membrane injury index in sensitive species. In hydrated discs and at this level of water deficit, NO increased the electron transport rate in both species, and a reduction of these rates was observed at severe stress levels. Taken together, it can be shown that NO has an effective role in ameliorating drought stress effects, activating tolerance responses at moderate water deficit levels and in both bean species which present differential drought tolerance. PMID:25049456

  13. Prospects for arbuscular mycorrhizal fungi (AMF) to assist in phytoremediation of soil hydrocarbon contaminants.

    Science.gov (United States)

    Rajtor, Monika; Piotrowska-Seget, Zofia

    2016-11-01

    Arbuscular mycorrhizal fungi (AMF) form mutualistic associations with the roots of 80-90% of vascular plant species and may constitute up to 50% of the total soil microbial biomass. AMF have been considered to be a tool to enhance phytoremediation, as their mycelium create a widespread underground network that acts as a bridge between plant roots, soil and rhizosphere microorganisms. Abundant extramatrical hyphae extend the rhizosphere thus creating the hyphosphere, which significantly increases the area of a plant's access to nutrients and contaminants. The paper presents and evaluates the role and significance of AMF in phytoremediation of hydrocarbon contaminated sites. We focused on (1) an impact of hydrocarbons on arbuscular mycorrhizal symbiosis, (2) a potential of AMF to enhance phytoremediation, (3) determinants that influence effectiveness of hydrocarbon removal from contaminated soils. This knowledge may be useful for selection of proper plant and fungal symbionts and crucial to optimize environmental conditions for effective AMF-mediated phytoremediation. It has been concluded that three-component phytoremediation systems based on synergistic interactions between plant roots, AMF and hydrocarbon-degrading microorganisms demonstrated high effectiveness in dissipation of organic pollutants in soil. PMID:27487095

  14. Ecological distribution and niche segregation of sibling species: the case of bean beetles, Acanthoscelides obtectus Say and A. obvelatus Bridwell

    OpenAIRE

    Alvarez, Nadir; Mercier, Lény; Hossaert-McKey, Martine; Contreras-Garduño, Jorge; Kunstler Georges; Aebi, Alexandre; Benrey, Betty

    2007-01-01

    1. Molecular techniques have greatly added to the number of known sympatric cryptic species in insects. Ecological differences between these newly distinguished species are little explored, but niches often appear to overlap strongly. These cases are good models for exploring new ideas about species coexistence and community structure. 2. Acanthoscelides obtectus and A. obvelatus are two sister species of bean bruchids, which have been confused until the last decade. One important ecological...

  15. Plant mortality varies with arbuscular mycorrhizal fungal species identities in a self-thinning population

    OpenAIRE

    Zhang, Qian; Tang, Jianjun; Chen, Xin

    2010-01-01

    Because arbuscular mycorrhizal fungal (AMF) species differ in stimulating the growth of particular host plant species, AMF species may vary in their effects on plant intra-specific competition and the self-thinning process. We tested this hypothesis using a microcosm experiment with Medicago sativa L. as a model plant population and four AMF species. Our results showed that the AMF species Glomus diaphanum stimulated host plant growth more than the other three AMF species did when the plants ...

  16. Competition of Amaranthus species with dry bean plants Competição de espécies de Amaranthus com plantas de feijoeiro

    OpenAIRE

    Saul Jorge Pinto de Carvalho; Pedro Jacob Christoffoleti

    2008-01-01

    Weeds compete with field crops mainly for water, light and nutrients, and this competition is among other factors, a function of the occurrence of weed density, and the intrinsic competitive ability of each vegetal species. The objective of this research was to evaluate the competitive ability of five weed species of the Amaranthus L. genus (A. deflexus, A. hybridus, A. retroflexus, A. spinosus and A. viridis) with dry bean plants (Phaseolus vulgaris L. - 'Carioca Precoce' cultivar), using th...

  17. The influence of soil use on the occurrence and diversity of AMFs in a oxisol from Southern Brazil

    Directory of Open Access Journals (Sweden)

    Rodrigo Ferreira da Silva

    2015-07-01

    Full Text Available The soil use and edaphic factors can to change arbuscular mycorrhizal fungi occurrence and distribution. The objective of this study was to determine the influence of different soil uses in the arbuscular mycorrhizal fungi (AMF community. The areas of native Forest, fallow area, intensive grassland, extensive grazing, no-tillage, conventional tillage, orange orchard, vines and Eucalyptus dunnii were analyzed. From de collection of soil samples was established trap cultivation with Brachiaria brizantha for recovering AMF species that was conducted in camera BOD in casualized lineation, with four repetitions. After three months of trap cultivation, spores were extracted by the method of wet sieving and centrifugation on sucrose and identified by their morphological characteristics. We determined the abundance of spores by species and evaluated area, Margalef richness index, Pielou equitability, Simpson dominance and Shannon diversity. The results revealed the occurrence of Glomus mosseae, Glomus aggregatum, Glomus clarum, Acaulospora sp. and Scutellospora reticulata. The genus Glomus was the most abundant in the areas analyzed. The abundance of spores of AMF is greatest in no-tillage. The soil pH affects the occurrence of AMF species. The native forest showed lower dominance and diversity of AMF species than areas subjected to different soil use.

  18. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  19. Morphometric variation of the Herichthys bartoni (Bean, 1892 species group (Teleostei: Cichlidae: How many species comprise H. labridens (Pellegrin, 1903?

    Directory of Open Access Journals (Sweden)

    Omar Mejía

    2015-03-01

    Full Text Available Cichlids of the tribe Heroini have long been a source of taxonomical conflict. In particular, the species included in the Herichthys bartoni group have failed to be recovered as monophyletic in different molecular studies. In this paper we use traditional and geometric morphometrics to evaluate morphological variation in the species included in the H. bartoni complex in order to evaluate the number of species it contains. An update of a previously published DNA barcoding study suggests the existence of three genetic clusters that included the six recognized species analyzed in this study, none of them recovered as monophyletic. On the other hand, geometric morphometrics arise as a useful tool to discriminate species due that traditional morphometrics showed a high overlap in the characters analyzed that prevents the proposal of diagnostic characters.

  20. Are Lotus species good models for studying iron accumulation in common beans?

    DEFF Research Database (Denmark)

    Orlowska, Elzbieta; Laszcyca, Katarzyna Malgorzata; Urbanski, Dorian Fabian;

    responsible for the regulation of seed iron loading and plant iron metabolism, and use this knowledge to find the corresponding genes in Phaseolus species. For our studies we use the model legume L. japonicus for which large number of EST and genomic sequences are available, and the closely related Lotus...

  1. Irrigation of Castor Bean (Ricinus communis L. and Sunflower (Helianthus annus L. Plant Species with Municipal Wastewater Effluent: Impacts on Soil Properties and Seed Yield

    Directory of Open Access Journals (Sweden)

    Vasileios A. Tzanakakis

    2011-11-01

    Full Text Available The effects of plant species (castor bean (Ricinus communis L. versus sunflower (Helianthus annus L. and irrigation regime (freshwater versus secondary treated municipal wastewater on soil properties and on seed and biodiesel yield were studied in a three year pot trial. Plant species were irrigated at rates according to their water requirements with either freshwater or wastewater effluent. Pots irrigated with freshwater received commercial fertilizer, containing N, P, and K, applied at the beginning of each irrigation period. The results obtained in this study showed that irrigation with effluent did not result in significant changes in soil pH, soil organic matter (SOM, total kjeldahl nitrogen (TKN, and dehydrogenase activity, whereas soil available P was found to increase in the upper soil layer. Soil salinity varied slightly throughout the experiment in effluent irrigated pots but no change was detected at the end of the experiment compared to the initial value, suggesting sufficient salt leaching. Pots irrigated with effluent had higher soil salinity, P, and dehydrogenase activity but lower SOM and TKN than freshwater irrigated pots. Sunflower showed greater SOM and TKN values than castor bean suggesting differences between plant species in the microorganisms carrying out C and N mineralization in the soil. Plant species irrigated with freshwater achieved higher seed yield compared to those irrigated with effluent probably reflecting the lower level of soil salinity in freshwater irrigated pots. Castor bean achieved greater seed yield than sunflower. Biodiesel production followed the pattern of seed yield. The findings of this study suggest that wastewater effluent can constitute an important source of irrigation water and nutrients for bioenergy crop cultivations with minor adverse impacts on soil properties and seed yield. Plant species play an important role with regard to the changes in soil properties and to the related factors of

  2. Competition of Amaranthus species with dry bean plants Competição de espécies de Amaranthus com plantas de feijoeiro

    Directory of Open Access Journals (Sweden)

    Saul Jorge Pinto de Carvalho

    2008-01-01

    Full Text Available Weeds compete with field crops mainly for water, light and nutrients, and this competition is among other factors, a function of the occurrence of weed density, and the intrinsic competitive ability of each vegetal species. The objective of this research was to evaluate the competitive ability of five weed species of the Amaranthus L. genus (A. deflexus, A. hybridus, A. retroflexus, A. spinosus and A. viridis with dry bean plants (Phaseolus vulgaris L. - 'Carioca Precoce' cultivar, using the replacement series design. A fixed total density equivalent to 80 plants m-2 was used in pots of 2.8 L capacity varying the proportions between the species in coexistence. To install the experiment, Amaranthus seedlings were transplanted to the pots at the phenological stage of completely expanded cotyledon leaves, while the crop was seeded. A factorial scheme (5 x 5 was used to carry out the experiment, consisting of five species of Amaranthus (pigweeds and five species proportions (beans:pigweeds: 4:0, 3:1, 2:2, 1:3 and 0:4. Randomized blocks with four replicates were installed and the experiment was repeated twice. Dry bean plants were more competitive than each one of the five Amaranthus species when the species proportion was equivalent. A. deflexus and A. viridis were the weed species which phenology were less affected by the competition with dry bean; the intraspecific competition was more damaging for dry bean plants, suggesting that the damages caused by the weeds are more related to high density of infestation than to the intrinsic competitive ability of the species.As plantas daninhas competem com as culturas por água, luz e nutrientes, sendo que esta competição é função da densidade de ocorrência das plantas daninhas, bem como da habilidade competitiva intrínseca de cada espécie. O objetivo desta pesquisa foi avaliar a competitividade de cinco espécies de Amaranthus L. (A. deflexus, A. hybridus, A. retroflexus, A. spinosus e A. viridis

  3. Paraburkholderia nodosa is the main N2-fixing species trapped by promiscuous common bean (Phaseolus vulgaris L.) in the Brazilian 'Cerradão'.

    Science.gov (United States)

    Dall'Agnol, Rebeca F; Plotegher, Fábio; Souza, Renata C; Mendes, Iêda C; Dos Reis Junior, Fábio B; Béna, Gilles; Moulin, Lionel; Hungria, Mariangela

    2016-08-01

    The bacterial genus Burkholderia comprises species occupying several habitats, including a group of symbionts of leguminous plants-also called beta-rhizobia-that has been recently ascribed to the new genus Paraburkholderia We used common bean (Phaseolus vulgaris L.) plants to trap rhizobia from an undisturbed soil of the Brazilian Cerrado under the vegetation type 'Cerradão'. Genetic characterization started with the analyses of 181 isolates by BOX-PCR, where the majority revealed unique profiles, indicating high inter- and intra-species diversity. Restriction fragment length polymorphism-PCR of the 16S rRNA of representative strains of the BOX-PCR groups indicated two main clusters, and gene-sequencing analysis identified the minority (27%) as Rhizobium and the majority (73%) as Paraburkholderia Phylogenetic analyses of the 16S rRNA and housekeeping (recA and gyrB) genes positioned all strains of the second cluster in the species P. nodosa, and the phylogeny of a symbiotic gene-nodC-was in agreement with the conserved genes. All isolates were stable vis-à-vis nodulating common bean, but, in general, with a low capacity for fixing N2, although some effective strains were identified. The predominance of P. nodosa might be associated with the edaphic properties of the Cerrado biome, and might represent an important role in terms of maintenance of the ecosystem, which is characterized by acid soils with high saturation of aluminum and low N2 content. PMID:27199345

  4. AMF-1/Gps2 Binds p300 and Enhances Its Interaction with Papillomavirus E2 Proteins

    OpenAIRE

    Peng, Yu-Cai; Breiding, David E.; Sverdrup, Francis; Richard, James; Androphy, Elliot J.

    2000-01-01

    The cellular protein AMF-1 (Gps2) positively modulates gene expression by the papillomavirus E2 protein (D. E. Breiding et al., Mol. Cell. Biol. 17:7208–7219, 1997). We show here that AMF-1 also binds the transcriptional coactivator p300 in vitro and in vivo. E2 interacted weakly with p300. These observations led to a model in which AMF-1 recruits p300 into a complex with E2. Cotransfection of AMF-1 or p300 stimulated levels of E2-dependent transcription, while cotransfection of both AMF-1 an...

  5. Spectral classification of Gaia16amf as Type Ia SN

    Science.gov (United States)

    Piascik, A. S.; Steele, I. A.

    2016-05-01

    We conducted a spectroscopic observation of transient Gaia16amf at 2016-05-06T04:52:48 UT. This transient was observed by the Gaia Photometric Science survey on 2016-05-01T16:23:13 UT at position RA = 22:23:48.10, DEC = 41:33:45.30 A spectrum was obtained in the visible, 400-800nm, with resolution R~350, using the SPRAT spectrograph on the Liverpool Telescope located at Roque de los Muchachos.

  6. Functionalized nanoparticles for AMF-induced gene and drug delivery

    Science.gov (United States)

    Biswas, Souvik

    The properties and broad applications of nano-magnetic colloids have generated much interest in recent years. Specially, Fe3O4 nanoparticles have attracted a great deal of attention since their magnetic properties can be used for hyperthermia treatment or drug targeting. For example, enhanced levels of intracellular gene delivery can be achieved using Fe3O4 nano-vectors in the presence of an external magnetic field, a process known as 'magnetofection'. The low cytotoxicity, tunable particle size, ease of surface functionalization, and ability to generate thermal energy using an external alternating magnetic field (AMF) are properties have propelled Fe3O4 research to the forefront of nanoparticle research. The strategy of nanoparticle-mediated, AMF-induced heat generation has been used to effect intracellular hyperthermia. One application of this 'magnetic hyperthermia' is heat activated local delivery of a therapeutic effector (e.g.; drug or polynucleotide). This thesis describes the development of a magnetic nano-vector for AMF-induced, heat-activated pDNA and small molecule delivery. The use of heat-inducible vectors, such as heat shock protein ( hsp) genes, is a promising mode of gene therapy that would restrict gene expression to a local region by focusing a heat stimulus only at a target region. We thus aimed to design an Fe3O4 nanoparticle-mediated gene transfer vehicle for AMF-induced localized gene expression. We opted to use 'click' oximation techniques to assemble the magnetic gene transfer vector. Chapter 2 describes the synthesis, characterization, and transfection studies of the oxime ether lipid-based nano-magnetic vectors MLP and dMLP. The synthesis and characterization of a novel series of quaternary ammonium aminooxy reagents (2.1--2.4) is described. These cationic aminooxy compounds were loaded onto nanoparticles for ligation with carbonyl groups and also to impart a net positive charge on the nanoparticle surface. Our studies indicated that the

  7. Elemental characterization of Brazilian beans using neutron activation analysis

    International Nuclear Information System (INIS)

    Beans are important for many developing countries as a source of protein and mineral nutrients. Here, ten commercial types of Brazilian beans, from the species Phaseolus vulgaris (common beans) and Vigna unguiculata (cowpeas), were analyzed by neutron activation analysis for the determination of Br, Ca, Co, Cs, Fe, K, Mo, Na, Rb, Sc and Zn. There were statistical differences (p/0.05) amongst the commercial types, except for Br, Rb and Sc. In general, non-essential elements showed high variability, indicating that the origin of beans had a strong influence on the mass fraction of such elements. (author)

  8. AMF phasing—A precise control of the ignition timing of AKM for reduction of the injection error

    Science.gov (United States)

    Homma, Masanori; Utajima, Masayoshi; Okamoto, Toshio; Hiraishi, Kenji; Takezawa, Susumu

    This paper deals with a new concept, named "AMF Phasing", which intends to minimize the effect of injection error that would result during apogee motor firing (AMF) of the spinning spacecraft. The characteristic of velocity increment error is derived analytically, based on the disturbed spinning motion during AMF. In order to precisely estimate the amount of fuel required for post-AMF orbital correction maneuvers, a probability model is proposed which estimates the total injection error probability combining the dominant error factors, i.e. pre-AMF attitude determination error and velocity increment error during AMF. It is shown that a substantial saving in fuel normally consumed for post-AMF can be expected, when the resultant velocity increment error contribution, which otherwise would be randomly directed in inertial space, is controlled so that it appears in the direction of local right ascension by igniting AKM at the proper instant (AMF Phasing). The procedure for AMF phasing, using a Sun pulse as a reference signal for the ignition timing is described in this paper. It was actually applied for GMS-2, Japan's second Geostationary Meteorological Satellite (HIMAWARI-II). The HIMAWARI-II post-AMF orbit determination shows that AMF Phasing worked successfully and it is concluded that a substantial fuel saving was achieved.

  9. Evaluation of Genetic Diversity of Castor Bean for Biodiesel Utilization

    Science.gov (United States)

    Castor bean (Ricinus communis L., 2n=20) is a cross-pollinated diploid species belonging to the family Euphorbiaceae instead of the Leguminosae. It is a native of Africa but may have originated in India. Castor bean plants grow as annual or perennial, depending on geographical locations, climate a...

  10. Soil organisms shape the competition between grassland plant species.

    Science.gov (United States)

    Sabais, Alexander C W; Eisenhauer, Nico; König, Stephan; Renker, Carsten; Buscot, François; Scheu, Stefan

    2012-12-01

    Decomposers and arbuscular mycorrhizal fungi (AMF) both determine plant nutrition; however, little is known about their interactive effects on plant communities. We set up a greenhouse experiment to study effects of plant competition (one- and two-species treatments), Collembola (Heteromurus nitidus and Protaphorura armata), and AMF (Glomus intraradices) on the performance (above- and belowground productivity and nutrient uptake) of three grassland plant species (Lolium perenne, Trifolium pratense, and Plantago lanceolata) belonging to three dominant plant functional groups (grasses, legumes, and herbs). Generally, L. perenne benefited from being released from intraspecific competition in the presence of T. pratense and P. lanceolata. However, the presence of AMF increased the competitive strength of P. lanceolata and T. pratense against L. perenne and also modified the effects of Collembola on plant productivity. The colonization of roots by AMF was reduced in treatments with two plant species suggesting that plant infection by AMF was modified by interspecific plant interactions. Collembola did not affect total colonization of roots by AMF, but increased the number of mycorrhizal vesicles in P. lanceolata. AMF and Collembola both enhanced the amount of N and P in plant shoot tissue, but impacts of Collembola were less pronounced in the presence of AMF. Overall, the results suggest that, by differentially affecting the nutrient acquisition and performance of plant species, AMF and Collembola interactively modify plant competition and shape the composition of grassland plant communities. The results suggest that mechanisms shaping plant community composition can only be understood when complex belowground interactions are considered. PMID:22678109

  11. EFFECT OF ARBUSCULAR MYCORRHIZAL FUNGI (AMF) ON GROWTH AND YIELD OF SUNFLOWER (Helianthus annuus L.)

    OpenAIRE

    Kavitha T; Nelson R

    2014-01-01

    The arbuscular mycorrhizal fungi (AMF) are a group of plant growth promoting organisms related to improve the overall growth of various crops. Hence the present study was aimed to investigate the agronomical characteristics induced by AMF in sunflower (Helianthus annuus L.). Three different indigenous AM fungi such as Glomus mosseae, Glomus fasiculatum, Acalospora scrobiculata isolated from the sunflower rhizosphere soil were used either alone or in various combinations for th...

  12. Effects of AMF on soil enzyme activity and carbon sequestration capacity in reclaimed mine soil

    Institute of Scientific and Technical Information of China (English)

    Qian Kuimei; Wang Liping; Yin Ningning

    2012-01-01

    A series of pot experiments and field trials were carried out to evaluate the effects of arbuscular mycorrhizal fungi (AMF) on activities of soil enzymes and carbon sequestration capacity in reclaimed mine soil.A complex substrate of coal gangue,fly ash and sludge was used as reclaimed mine soil,and ryegrass was planted with AMF inoculation to construct a plant-complex substrate-microbe ecological restoration system.The changes to the soil organic carbon (SOC),activities of soil enzymes and glomalin-related soil protein (GRSP) were measured and the effects of AMF on activities of soil enzymes and carbon sequestration capacity in reclaimed mine soil were analyzed.The results show that the contents of GRSP (total glomalin (TG) and easily extractable glomalin (EEG)),SOC and activities of enzymes increased,and the increments were higher in the AMF inoculation treated plant-complex substrate-microbe ecological restoration systems than those with no AMF inoculated treatments after 12 months of ryegrass growth.TG,EEG and soil enzyme activity have a significant positive correlation,and the correlative coefficient was 0.427-0.573; SOC and TG,EEG have a significant positive correlation (p < 0.01 ),indicating that AMF plays an important role in carbon sequestration of reclaimed mine soils.

  13. The ecology of arbuscular-mycorrhizal fungi (AMF) under different cropping regimes

    International Nuclear Information System (INIS)

    The ecology of Arbuscular Mycorrhizal Fungi (AMF) in mono-cropping and low-input ideal agroforestry cropping systems of Avena sativa has been studied. Soil chemical heterogeneity, seasonality and nature of cropping system showed significant attributes on AMF. AMF percentage in roots and spore populations in soil were elevated in dry season compared to wet season. With respect to cropping regimes, mono-cropping systems exhibited highest root infection whereas the agroforestry systems possessed highest AM fungal spore populations. Generally, farming systems tested here possessed significant colonization of AMF, however, overall extent of colonization and spore densities were low. While assessing the correlation between soil chemical composition and AMF, electrical conductivity, organic carbon content, available potassium and saturation percentage showed a negative correlation. However, pH showed a positive correlation and available phosphorus content showed no correlation with AMF. Present study was aimed to view the importance of agroforestry in modern agriculture and normal agricultural system and the benefits associated with AM fungi. (author)

  14. Possible evidence for contribution of arbuscular mycorrhizal fungi (AMF) in phytoremediation of iron-cyanide (Fe-CN) complexes.

    Science.gov (United States)

    Sut, Magdalena; Boldt-Burisch, Katja; Raab, Thomas

    2016-08-01

    Arbuscular mycorrhizal fungi (AMF) are integral functioning parts of plant root systems and are widely recognized for enhancing contaminants uptake and metabolism on severely disturbed sites. However, the patterns of their influence on the phytoremediation of iron-cyanide (Fe-CN) complexes are unknown. Fe-CN complexes are of great common interest, as iron is one of the most abundant element in soil and water. Effect of ryegrass (Lolium perenne L.) roots inoculation, using mycorrhizal fungi (Rhizophagus irregularis and a mixture of R. irregularis, Funneliformis mosseae, Rhizophagus aggregatus, and Claroideoglomus etunicatum), on iron-cyanide sorption was studied. Results indicated significantly higher colonization of R. irregularis than the mixture of AMF species on ryegrass roots. Series of batch experiments using potassium hexacyanoferrate (II) solutions, in varying concentrations revealed significantly higher reduction of total CN and free CN content in the mycorrhizal roots, indicating greater cyanide decrease in the treatment inoculated with R. irregularis. Our study is a first indication of the possible positive contribution of AM fungi on the phytoremediation of iron-cyanide complexes. PMID:27256319

  15. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    Directory of Open Access Journals (Sweden)

    Ambrosano Edmilson José

    2003-01-01

    Full Text Available Nitrogen (15N released from sunnhemp (Crotalaria juncea, velvet bean (Mucuna aterrima and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha-1 of Phaseolus bean residues and the same amount of above ground parts of the leguminous species, associated to 2.7 and 2.2 Mg ha-1 of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf and three plant materials: two green-manures (sunnhemp or velvet bean, and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with 15N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experiment al period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox.

  16. Nitrogen mineralization in soils amended with sunnhemp, velvet bean and common bean residues

    International Nuclear Information System (INIS)

    Nitrogen (15N) released from sunnhemp (Crotalaria juncea), velvet bean (Mucuna aterrima) and from Phaseolus bean residues was evaluated after incubation of the plant material in an Eutrudox and a Paleudalf, in a greenhouse experiment with pots containing 6 kg of air dried soil. Dry matter equivalent to 13 Mg ha-1 of Phaseolus bean residues and the same amount of above ground arts of the leguminous species, associated to 2.7 and 2.2 Mg ha-1 of roots of sunnhemp and velvet bean respectively, were incorporated into the soil. A completely randomized experimental design was adopted, with treatments arranged in a 2 x 3 + 1 factorial, replicated three times. The treatments were the following: two soils (Eutrudox and Paleudalf) and three plant materials: two green-manures (sunnhemp or velvet bean), and Phaseolus bean residues, besides one control without plant incorporation into the soil. For the green-manure treatments there were two sub-treatments for each legume species, with 15N labeling of either shoots or roots. Soil moisture was maintained relatively constant during the experimental period and the treatments were sampled weekly during 49 days. Total mineral nitrogen in the soil, as well as that derived from the legume plants were determined by isotope dilution. Nitrogen from the velvet bean accounted for a greater proportion of the soil inorganic N; shoots were responsible for most of N accumulated. Dry bean residues caused immobilization of inorganic N. The leguminous species added were intensively and promptly mineralized preserving the soil native nitrogen. Mineralization of the legume plant N was greater in the Paleudalf soil than in the Eutrudox. (author)

  17. Biology of the coconut bug, Pseudotheraptus wayi, on French beans.

    Science.gov (United States)

    Egonyu, James Peter; Ekesi, Sunday; Kabaru, Jacques; Irungu, Lucy

    2014-01-01

    The coconut bug, Pseudotheraptus wayi Brown (Heteroptera: Coreidae), is a major pest of a wide range of economically important crops in Eastern and Southern Africa. The suitability of French beans, Phaseolus vulgaris L. (Fabales: Fabaceae) as an alternative food for mass rearing of P. wayi was determined by elucidating its development, survival, and reproduction on French bean pods in the laboratory. Development and survival of immatures on French beans was comparable to what is reported with two hosts previously used for rearing this species, namely coconut and cashew. Adults survived thrice longer and laid almost twice more eggs on the French beans than was reported for the two hosts above. These findings suggest that French beans are more suitable for mass rearing of this species than coconut and cashew, which have been used previously but can be scarce and too costly. PMID:25373191

  18. Biology of the Coconut Bug, Pseudotheraptus wayi, on French Beans

    Science.gov (United States)

    Egonyu, James Peter; Ekesi, Sunday; Kabaru, Jacques; Irungu, Lucy

    2014-01-01

    The coconut bug, Pseudotheraptus wayi Brown (Heteroptera: Coreidae), is a major pest of a wide range of economically important crops in Eastern and Southern Africa. The suitability of French beans, Phaseolus vulgaris L. (Fabales: Fabaceae) as an alternative food for mass rearing of P. wayi was determined by elucidating its development, survival, and reproduction on French bean pods in the laboratory. Development and survival of immatures on French beans was comparable to what is reported with two hosts previously used for rearing this species, namely coconut and cashew. Adults survived thrice longer and laid almost twice more eggs on the French beans than was reported for the two hosts above. These findings suggest that French beans are more suitable for mass rearing of this species than coconut and cashew, which have been used previously but can be scarce and too costly. PMID:25373191

  19. The effect of lactic acid bacteria on cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2015-07-16

    Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of cocoa pulp by microorganisms is crucial for developing chocolate flavor precursors. Yeasts conduct an alcoholic fermentation within the bean pulp that is essential for the production of good quality beans, giving typical chocolate characters. However, the roles of bacteria such as lactic acid bacteria and acetic acid bacteria in contributing to the quality of cocoa bean and chocolate are not fully understood. Using controlled laboratory fermentations, this study investigated the contribution of lactic acid bacteria to cocoa bean fermentation. Cocoa beans were fermented under conditions where the growth of lactic acid bacteria was restricted by the use of nisin and lysozyme. The resultant microbial ecology, chemistry and chocolate quality of beans from these fermentations were compared with those of indigenous (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae, the lactic acid bacteria Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in control fermentations. In fermentations with the presence of nisin and lysozyme, the same species of yeasts and acetic acid bacteria grew but the growth of lactic acid bacteria was prevented or restricted. These beans underwent characteristic alcoholic fermentation where the utilization of sugars and the production of ethanol, organic acids and volatile compounds in the bean pulp and nibs were similar for beans fermented in the presence of lactic acid bacteria. Lactic acid was produced during both fermentations but more so when lactic acid bacteria grew. Beans fermented in the presence or absence of lactic acid bacteria were fully fermented, had similar shell weights and gave acceptable chocolates with no differences

  20. Diversity of AMF associated with Ammophila arenaria ssp. arundinacea in Portuguese sand dunes.

    Science.gov (United States)

    Rodríguez-Echeverría, Susana; Freitas, Helena

    2006-11-01

    Dune vegetation is essential for the formation and preservation of sand dunes and the protection of the coast line. Coastal sand dunes are harsh environments where arbuscular mycorrhizal fungi (AMF) play an important role in promoting plant establishment and growth. We present a study of the diversity of AMF associated with A. arenaria ssp. arundinacea in two locations of the Portuguese coast under a Mediterranean climate. These two locations were selected to compare a well-preserved dune system from a protected area with a degraded dune system from a public beach. AMF diversity was assessed mainly by cloning and sequencing of a fragment of the ribosomal SSU using the primer NS31 and AM1. Most of the 89 AMF clones obtained from the rhizosphere and roots of A. arenaria belonged to the genus Glomus, the largest clade within the Glomeromycota. Higher AMF diversity was found in the least disturbed site, in which spores of Scutellospora persica, Glomus constrictum and Glomus globiferum were found in the rhizosphere of A. arenaria. PMID:17043895

  1. Phytoprotective effect of arbuscular mycorrhizal fungi species against arsenic toxicity in tropical leguminous species.

    Science.gov (United States)

    de Melo, Rangel Wesley; Schneider, Jerusa; de Souza, Costa Enio Tarso; Sousa, Soares Cláudio Roberto Fonsêca; Guimarães, Guilherme Luiz Roberto; de Souza, Moreira Fatima Maria

    2014-01-01

    Arbuscular mycorrhizal fungi (AMF) improve the tolerance of hosting plants to arsenic (As) in contaminated soils. This work assessed the phytoprotective effect of Glomus etunicatum, Acaulospora morrowiae, Gigaspora gigantea, and Acaulospora sp. on four leguminous species (Acacia mangium, Crotalaria juncea, Enterolobium contortisiliquum, and Stizolobium aterrimum) in an As-contaminated soil from a gold mining area. AMF root colonization, biomass production, As and P accumulation, as well as arsenic translocation index (TI) from roots to shoots were measured. The AMF phytoprotective effect was assessed by the P/As ratio and the activity of plant antioxidant enzymes. The AMF colonization ranged from 24 to 28%. In general, all leguminous species had low As TI when inoculated with AMF species. Inoculation of C. juncea with Acaulospora sp. improved significantly As accumulation in roots, and decreased the activity of ascorbate peroxidase (APX) and superoxide dismutase (SOD), highlighting its phytoprotective effect and the potential use of this symbiosis for phytoremediation of As-contaminated soils. However, S. aterrimum has also shown a potential for phytoremediation irrespectively of AMF inoculation. APX was a good indicator of the phytoprotective effect against As contamination in C. juncea and A. mangium. In general P/As ratio in shoots was the best indicator of the phytoprotective effect of all AMF species in all plant species. PMID:24933888

  2. AGRICULTURAL PRACTICES, MORPHOLOGIC, PROTEINIC AND CULINARY DESCRIPTION OF THE GRAIN OF BEAN CULTIVARS SOWED IN THE REGION OF TLATZALA, GUERRERO

    Directory of Open Access Journals (Sweden)

    Fausto Solano Cervantes

    2009-08-01

    Full Text Available The research had for object describe the productive process of the of bean culture in the community of Tlatzala, Guerrero and the species diversity by means of the morphologic characteristics of the grain, protein content and the culinary quality. 30 questionnaires were applied to bean producers and 20 varieties of bean were collected from which the morphologic characters of the grain, protein content and the culinary characters were obtained. The production cycle of bean initiates in May and finishes in October. The technology used is traditional, characterized by the use of the yoke in the labors of the culture that demands workforce to realize the activities of manual form. The biological cycle of the varieties begins in June, the variation at time is determinated for the cultivated genotype. The determinate or indeterminate bush beans are predominant (65 %. The sowing systems are intercalated (50 % and associated with maize (30 % and monoculture (20 %. The varieties Rojito and Blanco have special uses, the first one has the attribute of being consumed as green-bean all the year around and the second one is used to prepare the dish called Chile-ajo. The Black beans were the most frequent (45 % followed by the Red beans (35 % and the least frequent were the Striped one (5 % and Muddy-like (5 %. The kidney shape of grain was the most abundant (85 % and the oval one was the least frequent (5 %. The grain weight changed from 14.4 up to 38.5 g. The sizes of grains founded were medium (50 % and small (50 %. The protein content registered was: White beans 24.68 %, Red bean 24.64 %, Black beans 23.5 % and Striped beans of guide 22.27 %. The Rojito Enano had the major protein content (27.6 %. The cooking times were: Red beans 73 minutes, Striped of guide bean 65.5, Blacks bean 64.6 and Whites bean 59. The Black bean Enano-1 used less time (54 minutes. The Striped of guide bean registered the major amount of solid (0.32 %, followed by the Black beans

  3. Friend or Foe—Light Availability Determines the Relationship between Mycorrhizal Fungi, Rhizobia and Lima Bean (Phaseolus lunatus L.)

    Science.gov (United States)

    Ballhorn, Daniel J.; Schädler, Martin; Elias, Jacob D.; Millar, Jess A.; Kautz, Stefanie

    2016-01-01

    Plant associations with root microbes represent some of the most important symbioses on earth. While often critically promoting plant fitness, nitrogen-fixing rhizobia and arbuscular mycorrhizal fungi (AMF) also demand significant carbohydrate allocation in exchange for key nutrients. Though plants may often compensate for carbon loss, constraints may arise under light limitation when plants cannot extensively increase photosynthesis. Under such conditions, costs for maintaining symbioses may outweigh benefits, turning mutualist microbes into parasites, resulting in reduced plant growth and reproduction. In natural systems plants commonly grow with different symbionts simultaneously which again may interact with each other. This might add complexity to the responses of such multipartite relationships. We experimented with lima bean (Phaseolus lunatus), which efficiently forms associations with both types of root symbionts. We applied full light and low-light to each of four treatments of microbial inoculation. After an incubation period of 14 weeks, we quantified vegetative aboveground and belowground biomass and number and viability of seeds to determine effects of combined inoculant and light treatment on plant fitness. Under light-limited conditions, vegetative and reproductive traits were inhibited in AMF and rhizobia inoculated lima bean plants relative to controls (un-colonized plants). Strikingly, reductions in seed production were most critical in combined treatments with rhizobia x AMF. Our findings suggest microbial root symbionts create additive costs resulting in decreased plant fitness under light-limited conditions. PMID:27136455

  4. Friend or Foe-Light Availability Determines the Relationship between Mycorrhizal Fungi, Rhizobia and Lima Bean (Phaseolus lunatus L.).

    Science.gov (United States)

    Ballhorn, Daniel J; Schädler, Martin; Elias, Jacob D; Millar, Jess A; Kautz, Stefanie

    2016-01-01

    Plant associations with root microbes represent some of the most important symbioses on earth. While often critically promoting plant fitness, nitrogen-fixing rhizobia and arbuscular mycorrhizal fungi (AMF) also demand significant carbohydrate allocation in exchange for key nutrients. Though plants may often compensate for carbon loss, constraints may arise under light limitation when plants cannot extensively increase photosynthesis. Under such conditions, costs for maintaining symbioses may outweigh benefits, turning mutualist microbes into parasites, resulting in reduced plant growth and reproduction. In natural systems plants commonly grow with different symbionts simultaneously which again may interact with each other. This might add complexity to the responses of such multipartite relationships. We experimented with lima bean (Phaseolus lunatus), which efficiently forms associations with both types of root symbionts. We applied full light and low-light to each of four treatments of microbial inoculation. After an incubation period of 14 weeks, we quantified vegetative aboveground and belowground biomass and number and viability of seeds to determine effects of combined inoculant and light treatment on plant fitness. Under light-limited conditions, vegetative and reproductive traits were inhibited in AMF and rhizobia inoculated lima bean plants relative to controls (un-colonized plants). Strikingly, reductions in seed production were most critical in combined treatments with rhizobia x AMF. Our findings suggest microbial root symbionts create additive costs resulting in decreased plant fitness under light-limited conditions. PMID:27136455

  5. Arbuscular mycorrhizal fungi (AMF) as bio protector agents against wilt induced by Verticillium spp. in pepper

    Energy Technology Data Exchange (ETDEWEB)

    Goicoechea, N.; Garmendia, I.; Sanchez-Diaz, M.; Aguirreolea, J.

    2010-07-01

    Verticillium dahliae Kleb. is a vascular pathogen that alters water status and growth of pepper plants and causes drastic reductions in yield. Its control is difficult because it can survive in field soil for several years. The application of arbuscular mycorrhizal fungi (AMF) as bio protector agents against V. dahliae is an alternative to the use of chemicals which, in addition, is more respectful with the environment. The establishment of the mutualistic association of plant roots and AMF involves a continuous cellular and molecular dialogue between both symbionts that includes the pre activation of plant defense responses that may enhance the resistance or tolerance of mycorrhizal plants to soil-borne pathogens. Some AMF can improve the resistance of Capsicum annuum L. against V. dahliae. This is especially relevant for pepper cultivars (i.e. cv. Piquillo) that exhibit high susceptibility to this pathogen. Compared with non-mycorrhizal plants, mycorrhizal pepper can exhibit more balanced antioxidant metabolism in leaves along the first month after pathogen inoculation, which may contribute to delay both the development of disease symptoms and the decrease of photosynthesis in Verticillium-inoculated plants with the subsequent benefit for yield. In stems, mycorrhizal pepper show earlier and higher deposition of lignin in xylem vessels than non mycorrhizal plants, even in absence of the pathogen. Moreover, AMF can induce new isoforms of acidic chitinases and superoxide dismutase in roots. Mycorrhizal-specific induction of these enzymatic activities together with enhanced peroxidase and phenylalanine ammonia-lyase in roots may also be involved in the bio protection of Verticillium-induced wilt in pepper by AMF. (Author) 81 refs.

  6. Reforestation sites show similar and nested AMF communities to an adjacent pristine forest in a tropical mountain area of South Ecuador.

    Directory of Open Access Journals (Sweden)

    Ingeborg Haug

    Full Text Available Arbuscular mycorrhizae are important for growth and survival of tropical trees. We studied the community of arbuscular mycorrhizal fungi in a tropical mountain rain forest and in neighbouring reforestation plots in the area of Reserva Biológica San Francisco (South Ecuador. The arbuscular mycorrhizal fungi were analysed with molecular methods sequencing part of the 18 S rDNA. The sequences were classified as Operational Taxonomic Units (OTUs. We found high fungal species richness with OTUs belonging to Glomerales, Diversisporales and Archaeosporales. Despite intensive sampling, the rarefaction curves are still unsaturated for the pristine forest and the reforestation plots. The communities consisted of few frequent and many rare species. No specific interactions are recognizable. The plant individuals are associated with one to ten arbuscular mycorrhizal fungi and mostly with one to four. The fungal compositions associated with single plant individuals show a great variability and variety within one plant species. Planted and naturally occurring plants show high similarities in their fungal communities. Pristine forest and reforestation plots showed similar richness, similar diversity and a significantly nested structure of plant-AMF community. The results indicate that small-scale fragmentation presently found in this area has not destroyed the natural AMF community, at least yet. Thus, the regeneration potential of natural forest vegetation at the tested sites is not inhibited by a lack of appropriate mycobionts.

  7. Reforestation sites show similar and nested AMF communities to an adjacent pristine forest in a tropical mountain area of South Ecuador.

    Science.gov (United States)

    Haug, Ingeborg; Setaro, Sabrina; Suárez, Juan Pablo

    2013-01-01

    Arbuscular mycorrhizae are important for growth and survival of tropical trees. We studied the community of arbuscular mycorrhizal fungi in a tropical mountain rain forest and in neighbouring reforestation plots in the area of Reserva Biológica San Francisco (South Ecuador). The arbuscular mycorrhizal fungi were analysed with molecular methods sequencing part of the 18 S rDNA. The sequences were classified as Operational Taxonomic Units (OTUs). We found high fungal species richness with OTUs belonging to Glomerales, Diversisporales and Archaeosporales. Despite intensive sampling, the rarefaction curves are still unsaturated for the pristine forest and the reforestation plots. The communities consisted of few frequent and many rare species. No specific interactions are recognizable. The plant individuals are associated with one to ten arbuscular mycorrhizal fungi and mostly with one to four. The fungal compositions associated with single plant individuals show a great variability and variety within one plant species. Planted and naturally occurring plants show high similarities in their fungal communities. Pristine forest and reforestation plots showed similar richness, similar diversity and a significantly nested structure of plant-AMF community. The results indicate that small-scale fragmentation presently found in this area has not destroyed the natural AMF community, at least yet. Thus, the regeneration potential of natural forest vegetation at the tested sites is not inhibited by a lack of appropriate mycobionts. PMID:23671682

  8. Diversification and population structure in common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Matthew W Blair

    Full Text Available Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13 for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican, Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru. The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of

  9. The onset of faba bean farming in the Southern Levant

    Science.gov (United States)

    Caracuta, Valentina; Barzilai, Omry; Khalaily, Hamudi; Milevski, Ianir; Paz, Yitzhak; Vardi, Jacob; Regev, Lior; Boaretto, Elisabetta

    2015-10-01

    Even though the faba bean (Vicia faba L.) is among the most ubiquitously cultivated crops, very little is known about its origins. Here, we report discoveries of charred faba beans from three adjacent Neolithic sites in the lower Galilee region, in the southern Levant, that offer new insights into the early history of this species. Biometric measurements, radiocarbon dating and stable carbon isotope analyses of the archaeological remains, supported by experiments on modern material, date the earliest farming of this crop to ~10,200 cal BP. The large quantity of faba beans found in these adjacent sites indicates intensive production of faba beans in the region that can only have been achieved by planting non-dormant seeds. Selection of mutant-non-dormant stock suggests that the domestication of the crop occurred as early as the 11th millennium cal BP. Plant domestication| Vicia faba L.| Pre-Pottery Neolithic B| radiocarbon dating| Δ13C analysis.

  10. Use of ARM Mobile Facility (AMF) Data to Study Aerosol Indirect Effects in China

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zhanqing [Univ. of Maryland, College Park, MD (United States)

    2012-12-19

    General goals: 1) Facilitating the deployment of the ARM Mobile Facility (AMF) and Ancillary Facility (AAF) in China in 2008, 2) Processing, retrieving, improving and analyzing observation data from ground-based, air-borne and space-borne instruments; 3) Conducting a series of studies to gain insights into the direct and indirect effects of these aerosols on radiation, clouds, and precipitation using both

  11. Beans (Phaseolus spp.) - model food legumes

    International Nuclear Information System (INIS)

    Globally, 800 million people are malnourished. Heavily subsidised farmers in rich countries produce sufficient surplus food to feed the hungry, but not at a price the poor can afford. Even donating the rich world's surplus to the poor would not solve the problem. Most poor people earn their living from agriculture, so a deluge of free food would destroy their livelihoods. Thus, the only answer to world hunger is to safeguard and improve the productivity of farmers in poor countries. Diets of subsistence level farmers in Africa and Latin America often contain sufficient carbohydrates (through cassava, corn/maize, rice, wheat, etc.), but are poor in proteins. Dietary proteins can take the form of scarce animal products (eggs, milk, meat, etc.), but are usually derived from legumes (plants of the bean and pea family). Legumes are vital in agriculture as they form associations with bacteria that 'fix-nitrogen' from the air. Effectively this amounts to internal fertilisation and is the main reason that legumes are richer in proteins than all other plants. Thousands of legume species exist but more common beans (Phaseolus vulgaris L.) are eaten than any other. In some countries such as Mexico and Brazil, beans are the primary source of protein in human diets. As half the grain legumes consumed worldwide are common beans, they represent the species of choice for the study of grain legume nutrition. Unfortunately, the yields of common beans are low even by the standards of legumes, and the quality of their seed proteins is sub-optimal. Most probably this results from millennia of selection for stable rather than high yield, and as such, is a problem that can be redressed by modem genetic techniques. We have formed an international consortium called 'Phaseomics' to establish the necessary framework of knowledge and materials that will result in disease-resistant, stress-tolerant, high-quality protein and high-yielding beans. Phaseomics will be instrumental in improving

  12. Electronic measurements in an alternating magnetic field (AMF) for studying magnetic nanoparticle hyperthermia

    Science.gov (United States)

    Boekelheide, Z.; Hussein, Z. A.; Hartzell, S.

    Magnetic nanoparticle hyperthermia is a promising cancer treatment in which magnetic nanoparticles are injected into a tumor and then exposed to an alternating magnetic field (AMF). This process releases heat and damages tumor cells, but the exact mechanisms behind the effectiveness of this therapy are still unclear. Accurate sensors are required to monitor the temperature and, potentially, other parameters such as magnetic field or mechanical stress during clinical therapy or lab research. Often, optical rather than electronic temperature sensors are used to avoid eddy current self-heating in conducting parts in the AMF. However, eddy current heating is strongly dependent on the size and geometry of the conducting part, thus micro- and nano-scale electronics are a promising possibility for further exploration into magnetic nanoparticle hyperthermia. This presentation quantitatively discusses the eddy current self-heating of thin wires (thermocouples) and will also present a proof of concept thin film resistive thermometer and magnetic field sensor along with measurements of their eddy current self-heating. The results show that electronic measurements are feasible in an AMF with both thin wires and patterned thin film sensors under certain conditions.

  13. Adaptive matrix formation (AMF) method of space-time multigroup reactor kinetics equations in multidimensional model

    International Nuclear Information System (INIS)

    Adaptive matrix formation (AMF) method has been developed for the numerical solution of the transient multigroup neutron diffusion and delayed precursor equations in two- and three-dimensional geometry. The method is applied to a general class of two- and three- dimensional problems. The results of numerical experiments, as well as comparison with space-time experimental results indicate that the method is accurate and that the two- and three-dimensional calculations can be performed at 'reasonable' computer costs. Moreover, the AMF method offers the flexibility of using smaller time steps between flux shape calculations to achieve a specified accuracy and capability, without encountering numerical problems that occur in the other conventional methods. There is a large considerable saving in computer time and costs due to the partitioning of the matrix adopted in the presented AMF method. The two- and three-dimensional problems were analyzed with the present calculations model to illustrate the accuracy and stability of the method. Furthermore, the stability of the investigated method has been tested for sinusoidal, ramp, and step-change reactivity insertions. The results are in a good agreement with those of the other less approximate methods, including the problems in which the reflector zone is perturbed

  14. Influence of Arbuscular Mycorrhizal Fungus (AMF) on degradation of iron-cyanide complexes

    Science.gov (United States)

    Sut, Magdalena; Boldt-Burisch, Katja; Raab, Thomas

    2015-04-01

    Soil contamination in the vicinities of former Manufactured Gas Plant (MGP) sites is a worldwide known environmental issue. The pollutants, in form of iron-cyanide complexes, originating from the gas purification process, create a risk for human health due to potential release of toxic free cyanide, CN(aq) and HCN(g), (aq).The management and remediation of cyanide contaminated soil can be very challenging due to the complex chemistry and toxicity of CN compounds. The employment of phytoremediation to remove or stabilize contaminants at a former MGP site is an inexpensive process, but can be limited through shallow rotting, decreased biomass, poor growing and the risk of secondary accumulation. However, this adaptation may be enhanced via arbuscular mycorrhizal fungi (AMF) activity, which may cooperate on the degradation, transformation or uptake of the contaminants. We would like to present our preliminary results from the ongoing project concerning toxic substrate-AMF-plant relation, based on studying the site of a former MGP site. In situ experiments contributed to identifying those fungi that are likely to persist in extremely acidic and toxic conditions. Subsequently, commercially available Rhizophagus irregularis was grown in sterilized, un-spiked soil with the roots of the host plant Calamagrostis epigejos. Extracted roots and AMF hyphae were used in the batch experiment, were the potential of this association on degradation of iron-cyanide complexes, in form of potassium ferrocyanide solution, was assessed.

  15. Can leek interfere with bean plant–bean fly interaction?

    OpenAIRE

    Bandara, PB; V Kumar; Ninkovic, Velemir; Ahmed, Elham; Pettersson, Jan; Glinwood, Robert

    2009-01-01

    Effects of volatile odors from leek, Allium porum L., on the behavior of bean ßy, Ophiomyia phaseoli (Tryon) (Diptera: Agromyzidae), were tested in laboratory olfactometer bioassays. Aqueous and solvent extracts (dichloromethane and methanol) of leek were repellent to adult ßies. Whole leek plants were repellent and prevented attraction to the host plant, beans. Beans that had been exposed to volatiles from living leek plants for 7 d became repellent to the ßy. Leek and several...

  16. Water deficit improved the capacity of arbuscular mycorrhizal fungi (AMF) for inducing the accumulation of antioxidant compounds in lettuce leaves.

    OpenAIRE

    M. Baslam; Goicoechea, N.

    2012-01-01

    Lettuce, a major food crop within the European Union and the most used for the so-called 'Fourth Range' of vegetables, can associate with arbuscular mycorrhizal fungi (AMF). Mycorrhizal symbiosis can stimulate the synthesis of secondary metabolites, which may increase plant tolerance to stresses and enhance the accumulation of antioxidant compounds potentially beneficial to human health. Our objectives were to assess (1) if the application of a commercial formulation of AMF benefited growth o...

  17. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Johansen, Ida Elisabeth

    2011-01-01

    Reporter tagged virus clones can provide detailed information on virus–host interactions. In Phaseolus vulgaris (bean), four recessive and one dominant gene are known to control infection by strains of the potyvirus species Bean common mosaic virus (BCMV). To study the interactions between BCMV and...

  18. Genetic Diversity of North American Wild kidney bean (Phaseolus polystachios) in the Eastern US

    Science.gov (United States)

    North American wild kidney bean or thicket bean (Phaseolus polystachios (L.) Britton, Sterns, & Poggenb) is a perennial vine found in the eastern United States from Texas to Connecticut. It is the only Phaseolus species native to temperate North America. Its closest cultivated relative is P. lunatus...

  19. Transcriptome Sequencing of Lima Bean (Phaseolus lunatus to Identify Putative Positive Selection in Phaseolus and Legumes

    Directory of Open Access Journals (Sweden)

    Fengqi Li

    2015-07-01

    Full Text Available The identification of genes under positive selection is a central goal of evolutionary biology. Many legume species, including Phaseolus vulgaris (common bean and Phaseolus lunatus (lima bean, have important ecological and economic value. In this study, we sequenced and assembled the transcriptome of one Phaseolus species, lima bean. A comparison with the genomes of six other legume species, including the common bean, Medicago, lotus, soybean, chickpea, and pigeonpea, revealed 15 and 4 orthologous groups with signatures of positive selection among the two Phaseolus species and among the seven legume species, respectively. Characterization of these positively selected genes using Non redundant (nr annotation, gene ontology (GO classification, GO term enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analyses revealed that these genes are mostly involved in thylakoids, photosynthesis and metabolism. This study identified genes that may be related to the divergence of the Phaseolus and legume species. These detected genes are particularly good candidates for subsequent functional studies.

  20. Arbuscular Mycorrhizal Fungus Species Dependency Governs Better Plant Physiological Characteristics and Leaf Quality of Mulberry (Morus alba L.) Seedlings.

    Science.gov (United States)

    Shi, Song-Mei; Chen, Ke; Gao, Yuan; Liu, Bei; Yang, Xiao-Hong; Huang, Xian-Zhi; Liu, Gui-Xi; Zhu, Li-Quan; He, Xin-Hua

    2016-01-01

    Understanding the synergic interactions between arbuscular mycorrhizal fungi (AMF) and its host mulberry (Morus alba L.), an important perennial multipurpose plant, has theoretical and practical significance in mulberry plantation, silkworm cultivation, and relevant textile industry. In a greenhouse study, we compared functional distinctions of three genetically different AMF species (Acaulospora scrobiculata, Funneliformis mosseae, and Rhizophagus intraradices) on physiological and growth characteristics as well as leaf quality of 6-month-old mulberry seedlings. Results showed that mulberry was AMF-species dependent, and AMF colonization significantly increased shoot height and taproot length, stem base and taproot diameter, leaf and fibrous root numbers, and shoot and root biomass production. Meanwhile, leaf chlorophyll a or b and carotenoid concentrations, net photosynthetic rate, transpiration rate and stomatal conductance were generally significantly greater, while intercellular CO2 concentration was significantly lower in AMF-inoculated seedlings than in non-AMF-inoculated counterparts. These trends were also generally true for leaf moisture, total nitrogen, all essential amino acids, histidine, proline, soluble protein, sugar, and fatty acid as they were significantly increased under mycorrhization. Among these three tested AMFs, significantly greater effects of AMF on above-mentioned mulberry physiological and growth characteristics ranked as F. mosseae > A. scrobiculata > R. intraradices, whilst on mulberry leaf quality (e.g., nutraceutical values) for better silkworm growth as F. mosseae ≈A. scrobiculata > R. intraradices. In conclusion, our results showed that greater mulberry biomass production, and nutritional quality varied with AMF species or was AMF-species dependent. Such improvements were mainly attributed to AMF-induced positive alterations of mulberry leaf photosynthetic pigments, net photosynthetic rate, transpiration rate, and N

  1. Gene-based SNP discovery in tepary bean (Phaseolus acutifolius) and common bean (P. vulgaris) for diversity analysis and comparative mapping

    OpenAIRE

    Gujaria-Verma, Neha; Ramsay, Larissa; Sharpe, Andrew G; Sanderson, Lacey-Anne; Daniel G. Debouck; Tar’an, Bunyamin; Bett, Kirstin E.

    2016-01-01

    Background Common bean (Phaseolus vulgaris) is an important grain legume and there has been a recent resurgence in interest in its relative, tepary bean (P. acutifolius), owing to this species’ ability to better withstand abiotic stresses. Genomic resources are scarce for this minor crop species and a better knowledge of the genome-level relationship between these two species would facilitate improvement in both. High-throughput genotyping has facilitated large-scale single nucleotide polymor...

  2. Insects diversity in lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    WIWIN SETIAWATI

    2005-10-01

    Full Text Available Lima bean (Phaseolus lunatus is a vegetable which usually made as a home yard plant for Indonesian people to fulfill their daily needs. This plant has not been produced in the large number by the farmer. So it is hard to find in the market. Lima bean is light by many kind of insect. Inventory, identification and the study of insect taxon to this plant is being done to collect some information about the insect who life in the plant. The research was done in Balitsa experiment garden in the district of Lembang in Bandung regency on November 2003-February 2004, the experiment start at 4 weeks age, at the height of 1260 m over the sea level. The observation was made systematically by absolute method (D-vac macine and relative method (sweeping net. The research so that there were 26 species of phytofagous insect, 9 species of predator insect, 6 species of parasitoid insect, 4 species of pollinator and 14 species of scavenger insect. According to the research the highest species number was got in the 8th week (3rd sampling, which had 27 variety of species, so the highest diversity was also got in this with 2,113 point. Aphididae and Cicadellidae was the most insect found in roay plant. The research also had high number of species insect so the diversity of insect and evenness become high. A community will have the high stability if it is a long with the high diversity. High evenness in community that has low species dominance and high species number of insect so the high of species richness.

  3. Registration of 'Croissant' pinto bean

    Science.gov (United States)

    ‘Croissant’ (Reg. No. CV-299, PI 656597), a new medium-maturity (94–98 d) pinto bean (Phaseolus vulgaris L.) cultivar was released by the Colorado Agricultural Experiment Station to provide dry bean producers in the USA with a high-yielding cultivar that combines resistance to rust [caused by Uromyc...

  4. Functional diversity in arbuscular mycorrhizas: Exploitation of soil patches with different phosphate enrichment differs among fungal species

    DEFF Research Database (Denmark)

    Cavagnaro, T.R.; Smith, F.A.; Smith, S.E.;

    2005-01-01

    Most terrestrial plant species form associations with arbuscular mycorrhizal fungi (AMF) that transfer soil P to the plant via their external hyphae. The distribution of nutrients in soils is typically patchy (heterogeneous) but little is known about the ability of AMF to exploit P patches in soi...

  5. AMF Inoculation Enhances Growth and Improves the Nutrient Uptake Rates of Transplanted, Salt-Stressed Tomato Seedlings

    Directory of Open Access Journals (Sweden)

    Astrit Balliu

    2015-12-01

    Full Text Available The study aimed to investigate the effects of commercially available AMF inoculate (Glomus sp. mixture on the growth and the nutrient acquisition in tomato (Solanumlycopersicum L. plants directly after transplanting and under different levels of salinity. Inoculated (AMF+ and non-inoculated (AMF− tomato plants were subjected to three levels of NaCl salinity (0, 50, and 100 mM·NaCl. Seven days after transplanting, plants were analyzed for dry matter and RGR of whole plants and root systems. Leaf tissue was analyzed for mineral concentration before and after transplanting; leaf nutrient content and relative uptake rates (RUR were calculated. AMF inoculation did not affect plant dry matter or RGR under fresh water-irrigation. The growth rate of AMF−plants did significantly decline under both moderate (77% and severe (61% salt stress compared to the fresh water-irrigated controls, while the decline was much less (88% and 75%,respectivelyand statistically non-significant in salt-stressed AMF+ plants. Interestingly, root system dry matter of AMF+ plants (0.098 g plant–1 remained significantly greater under severe soil salinity compared to non-inoculated seedlings (0.082 g plant–1. The relative uptake rates of N, P, Mg, Ca, Mn, and Fe were enhanced in inoculated tomato seedlings and remained higher under (moderate salt stress compared to AMF− plants This study suggests that inoculation with commercial AMF during nursery establishment contributes to alleviation of salt stress by maintaining a favorable nutrient profile. Therefore, nursery inoculation seems to be a viable solution to attenuate the effects of increasing soil salinity levels, especially in greenhouses with low natural abundance of AMF spores.

  6. Tethered Balloon Operations at ARM AMF3 Site at Oliktok Point, AK

    Science.gov (United States)

    Dexheimer, D.; Lucero, D. A.; Helsel, F.; Hardesty, J.; Ivey, M.

    2015-12-01

    Oliktok Point has been the home of the Atmospheric Radiation Measurement Program's (ARM) third ARM Mobile Facility, or AMF3, since October 2013. The AMF3 is operated through Sandia National Laboratories and hosts instrumentation collecting continuous measurements of clouds, aerosols, precipitation, energy, and other meteorological variables. The Arctic region is warming more quickly than any other region due to climate change and Arctic sea ice is declining to record lows. Sparsity of atmospheric data from the Arctic leads to uncertainty in process comprehension, and atmospheric general circulation models (AGCM) are understood to underestimate low cloud presence in the Arctic. Increased vertical resolution of meteorological properties and cloud measurements will improve process understanding and help AGCMs better characterize Arctic clouds. SNL is developing a tethered balloon system capable of regular operation at AMF3 in order to provide increased vertical resolution atmospheric data. The tethered balloon can be operated within clouds at altitudes up to 7,000' AGL within DOE's R-2204 restricted area. Pressure, relative humidity, temperature, wind speed, and wind direction are recorded at multiple altitudes along the tether. These data were validated against stationary met tower data in Albuquerque, NM. The altitudes of the sensors were determined by GPS and calculated using a line counter and clinometer and compared. Wireless wetness sensors and supercooled liquid water content sensors have also been deployed and their data has been compared with other sensors. This presentation will provide an overview of the balloons, sensors, and test flights flown, and will provide a preliminary look at data from sensor validation campaigns and test flights.

  7. The cocoa bean fermentation process: from ecosystem analysis to starter culture development.

    Science.gov (United States)

    De Vuyst, L; Weckx, S

    2016-07-01

    Cocoa bean fermentation is still a spontaneous curing process to facilitate drying of nongerminating cocoa beans by pulp removal as well as to stimulate colour and flavour development of fermented dry cocoa beans. As it is carried out on farm, cocoa bean fermentation is subjected to various agricultural and operational practices and hence fermented dry cocoa beans of variable quality are obtained. Spontaneous cocoa bean fermentations carried out with care for approximate four days are characterized by a succession of particular microbial activities of three groups of micro-organisms, namely yeasts, lactic acid bacteria (LAB) and acetic acid bacteria (AAB), which results in well-fermented fully brown cocoa beans. This has been shown through a plethora of studies, often using a multiphasic experimental approach. Selected strains of several of the prevailing microbial species have been tested in appropriate cocoa pulp simulation media to unravel their functional roles and interactions as well as in small plastic vessels containing fresh cocoa pulp-bean mass to evaluate their capacity to dominate the cocoa bean fermentation process. Various starter cultures have been proposed for successful fermentation, encompassing both cocoa-derived and cocoa nonspecific strains of (hybrid) yeasts, LAB and AAB, some of which have been implemented on farms successfully. PMID:26743883

  8. Irradiated cocoa beans

    International Nuclear Information System (INIS)

    Groups of 40 male and 40 female CD rats were fed powdered rodent diet containing 25% (w/w) of either non-irradiated, irradiated or fumigated cocoa beans. The diets were supplemented with certain essential dietary constituents designed to satisfy normal nutritional requirements. An additional 40 male and 40 female rats received basal rodent diet alone (ground) and acted as an untreated control. After 70 days of treatment, 15 male and 15 female rats from each group were used to assess reproductive function of the F0 animals and growth and development of the F1 offspring up to weaning; the remaining animals were killed after 91 days of treatment. (orig.)

  9. THE OCCURRENCE OF INSECTS, FUNGI AND ORGANOLEPTIC CHARACTERISTICS IN STORED COFFEE BEANS IN LAMPUNG

    Directory of Open Access Journals (Sweden)

    OKKY s. DHARMAPUTRA

    1999-01-01

    Full Text Available A survey on postharvest handling and technology processing of coffee beans at farmer, trader and exporter levels was conducted in West Lampung a nd Tanggamus regencies of Lampung province during harvest time (July 1998. Interviews and sampling of coffee beans were carried out during the survey. The number of respondents at farmer, trader and exporter levels was 22, 20 and 4, respectively, while the number of samples collected from each level was 20. All samples were analyzed for moisture content, physical quality, insect and fungal infestation, reducing sugar content, and coffee cupping. The results of the interviews indicated that posth arvest handling and technol ogy processing became better from farmers to exporters. Moisture contents of coffee beans collected from farmers and traders were higher than the tolerable limit recommended by SNI (13%. Physical quality of coffee beans collected from exporters was higher than that collected from farmers and traders. Insects were found on coffee beans collected from farmers, traders and exporters, but the number of species and the percentage of samples infested by insects from each level were relatively low. The predominant species was Liposcelis entomophila. The number of fungal species on coffee beans collected from farmers was higher than that collected from traders and exporters. The predominant species at the three levels was Aspergillus niger, but the lowest percentage of beans infected by this fungus was found on coffee beans collected from expo rters. The lowest percentage of samples infected by all fungi was also found on coffee beans collected from exporters. Reducing sugar content of coffee beans collected from exporters was lower than that from farmers and traders. Aroma and flavor values tended to increase from farmers through traders to exporters, while the body decreased. Some off-flavors (i.e. earthy, mouldy, fermented and woody were encountered in a few coffee samples from farmers as

  10. Arbuscular mycorrhizal fungi alter the response of growth and nutrient uptake of snap bean (Phaseolus vulgaris L.) to O3

    Institute of Scientific and Technical Information of China (English)

    Shuguang Wang; Zhaozhong Feng; Xiaoke Wang; Wenliang Gong

    2011-01-01

    The effects of arbuscular mycorrhizal fungi (AMF) Glomus mosseae on the responses to elevated O3 in growth and nutrition of snap bean (Phaseolus vulgaris L. cv Guangzhouyuan) were investigated. Exposure was conducted in growth chambers by using three O3 concentrations (20 (CF), 80 (CFO1) and 120 nL/L (CFO2); 8 hr/day for 75 days). Results showed that elevated O3 slightly impacted overall mycorrhizal colonization, but significantly decreased the proportional frequency of hypha and increased the proportional frequency of spores and vesicles, suggesting that O3 had significant effects on mycorrhizal structure. Elevated O3 significantly decreased yield, dry mass and nutrient contents (N, P, K, Ca and Mg) in both non-mycorrhizal and mycorrhizal plants. However, significant interactive effects were found in most variables due to that the reduction by O3 in the mycorrhizal plants was less than that in the non-mycorrhizal plants. Additionally, AMF increased the concentrations of N, P, Ca, and Mg in shoot and root. It can be concluded that AMF alleviated detrimental effects of increasing O3 on host plant through improving plant nutrition and growth.

  11. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L.) Based on Transcriptome Data

    OpenAIRE

    Honglin Chen; Xin Chen; Jing Tian; Yong Yang; Zhenxing Liu; Xiyu Hao; Lixia Wang; Suhua Wang; Jie Liang; Liya Zhang; Fengxiang Yin; Xuzhen Cheng

    2016-01-01

    Rice bean (Vigna umbellata (Thunb.) Ohwi & Ohashi) is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR) markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length o...

  12. Seed borne mycoflora of castor bean (ricinus communis l.) from pakistan

    International Nuclear Information System (INIS)

    Castor bean seeds were analyzed by using ISTA (International seed testing association) for the detection of seed borne mycoflora. Thirty one fungal species belonging to 15 genera were isolated from 12 samples of castor bean seeds collected from different areas of Pakistan. Fusarium solani, Alternaria alternata, Cephaliophora tropica were most predominant fungal species isolated while the saprophytic fungi like A. niger, A. flavus were common in all samples of castor bean seed tested. Blotter method was considered to be better technique which gave maximum number of fungi followed by agar plate and deep freezing methods. (author)

  13. Homostachydrine (pipecolic acid betaine) as authentication marker of roasted blends of Coffea arabica and Coffea canephora (Robusta) beans.

    Science.gov (United States)

    Servillo, Luigi; Giovane, Alfonso; Casale, Rosario; Cautela, Domenico; D'Onofrio, Nunzia; Balestrieri, Maria Luisa; Castaldo, Domenico

    2016-08-15

    The occurrence of pipecolic acid betaine (homostachydrine) and its biosynthetic precursor N-methylpipecolic acid was detected for the first time in green coffee beans of Robusta and Arabica species. The analyses were conducted by HPLC-ESI tandem mass spectrometry and the metabolites identified by product ion spectra and comparison with authentic standards. N-methylpipecolic acid was found at similar levels in green coffee beans of Robusta and Arabica, whereas a noticeable difference of homostachydrine content was observed between the two green coffee bean species. Interestingly, homostachydrine content was found to be unaffected by coffee bean roasting treatment because of a noticeable heat stability, a feature that makes this compound a candidate marker to determine the content of Robusta and Arabica species in roasted coffee blends. To this end, a number of certified pure Arabica and Robusta green beans were analyzed for their homostachydrine content. Results showed that homostachydrine content was 1.5±0.5mg/kg in Arabica beans and 31.0±10.0mg/kg in Robusta beans. Finally, to further support the suitability of homostachydrine as quality marker of roasted blends of Arabica and Robusta coffee beans, commercial samples of roasted ground coffee blends were analyzed and the correspondence between the derived percentages of Arabica and Robusta beans with those declared on packages by manufacturers was verified. PMID:27006213

  14. Variability of Colletotrichum spp in common bean.

    Science.gov (United States)

    Mota, S F; Barcelos, Q L; Dias, M A; Souza, E A

    2016-01-01

    The Colletotrichum genus presents large genetic variability, as demonstrated by the occurrence of several pathogenic races and phenotypic traits. The objective of this study was to characterize 22 strains of C. lindemuthianum and Colletotrichum spp recovered from anthracnose lesions and bean scab, and to verify the relationship between species of the Colletotrichum genus, which inhabit anthracnose and scab lesions. Colony morphology, conidium size, the presence of septa, germination, sporulation, and mycelium growth rates, were analyzed in addition to the presence of mating-type genes, IRAP markers, and pathogenicity. Strains of Colletotrichum spp presented wide variation for all evaluated traits, indicating the presence of different species. Pathogenicity tests verified that the severity of the disease caused by strains of Colletotrichum spp must be evaluated 17 days after inoculation. Molecular analysis showed that only the C. lindemuthianum strains were grouped by the IRAP markers. For the physiological traits, we observed that C. lindemuthianum mycelium growth is slower than that of Colletotrichum spp strains. The information generated in this study confirms variability in the evaluated species of Colletotrichum and may direct future basic and applied studies aiming to control these diseases in common bean. PMID:27173211

  15. Phosphorus Use Efficiency by Brazilian Common Bean Genotypes Assessed by the 32P Dilution Technique

    International Nuclear Information System (INIS)

    The objectives of this work were to identify the most efficient common bean (Phaseolus vulgaris L.) genotypes on phosphorus (P) utilization, and verify if P from the seed affects the classification of common bean genotypes on P uptake efficiency when the 32P isotopic dilution technique is used. The experiment was conducted in a greenhouse, and plants were grown in pots with surface samples of a dystrophic Typic Haplustox. The treatments consisted of 50 common bean genotypes and two standard plant species, efficient or inefficient in P uptake. The results were assessed through correlation and cluster analysis (multivariate). Sangue de Boi, Rosinha, Thayu, Grafite, Horizonte, Pioneiro and Jalo Precoce common bean genotypes were the most efficient on P uptake, and Carioca 80, CNF 10, Perola, IAPAR 31, Roxao EEP, Apore, Pioneiro, Pontal, Timbo and Ruda were the most efficient in P utilization. The P derived from seed influences the identification of common bean genotypes for P uptake efficiency. (author)

  16. Locomotion of Mexican jumping beans

    International Nuclear Information System (INIS)

    The Mexican jumping bean, Laspeyresia saltitans, consists of a hollow seed housing a moth larva. Heating by the sun induces movements by the larva which appear as rolls, jumps and flips by the bean. In this combined experimental, numerical and robotic study, we investigate this unique means of rolling locomotion. Time-lapse videography is used to record bean trajectories across a series of terrain types, including one-dimensional channels and planar surfaces of varying inclination. We find that the shell encumbers the larva's locomotion, decreasing its speed on flat surfaces by threefold. We also observe that the two-dimensional search algorithm of the bean resembles the run-and-tumble search of bacteria. We test this search algorithm using both an agent-based simulation and a wheeled Scribbler robot. The algorithm succeeds in propelling the robot away from regions of high temperature and may have application in biomimetic micro-scale navigation systems. (paper)

  17. purple_bean_crithab_streams

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This linear coverage represents critical habitat deliniation for the Purple Bean in the Tennessee and Cumberland River Basins. Linear segments were digitized over a...

  18. Faba bean in cropping systems

    DEFF Research Database (Denmark)

    Steen Jensen, Erik; Peoples, Mark B.; Hauggaard-Nielsen, Henrik

    2010-01-01

    the plant–soil system associated with faba bean cropping via nitrate leaching or emissions of N2O to the atmosphere as a consequence of the rapid mineralization of N from its N-rich residues. It is important to develop improved preventive measures, such as catch crops, intercropping, or no-till technologies......The grain legume (pulse) faba bean (Vicia faba L.) is grown world-wide as a protein source for food and feed. At the same time faba bean offers ecosystem services such as renewable inputs of nitrogen (N) into crops and soil via biological N2 fixation, and a diversification of cropping systems. Even...... legumes to provide N to maintain soil N fertility, with industrialized, largely cereal-based systems that are heavily reliant upon fossil fuels (=N fertilizers, heavy mechanization) are some of the explanations for this decline in importance. Past studies of faba bean in cropping systems have tended...

  19. Effect of fungal infection on phenolic compounds during the storage of coffee beans

    Directory of Open Access Journals (Sweden)

    Amal, A. A.

    2013-12-01

    Full Text Available Aims: This work was undertaken to study the effect of Aspergillus infection on phenolic compounds in beans from four cultivars of the coffee plant (Coffea arabica L.. The effects of storage conditions of the coffee beans were also examined. Methodology and results: Beans from four varieties of coffee were artificially infected with three species of Aspergillus: A. niger, A. melleus and A. alliacus, and stored at 0, 8 and 25 ± 2 °C. After 3, 6 and 9 months, the contents of phenolic compounds in the beans were determined using high performance liquid chromatography (HPLC. Conclusion, significance and impact study: The results of this study showed that phenolic compounds were qualitatively and quantitatively higher in the inoculated beans as compared with the uninfected control beans, reflecting a possible induced defense mechanism in the infected beans. Increased storage periods resulted in higher levels of phenols, but the average total, bound and free phenols did not differ between the cultivars tested. Effective control of Apergillus infection in coffee beans can prevent such changes in phenolics that may affect their commercial value.

  20. Experimental investigation and numerical simulation of triggered vacuum arc behavior under TMF/RMF-AMF contact

    Science.gov (United States)

    Wang, Lijun; Deng, Jie; Qin, Kang; Zhang, Xiao; Jia, Shenli

    2016-06-01

    A series of triggering experiments was carried out to investigate the characteristics of vacuum arc controlled by TMF/RMF-AMF contacts. During all the experiments, the current ranged from 5–20 kA (rms) and both the arc appearance and behavior of cathode spots were captured by high-speed camera with corresponding arc current and arc voltage. A 3D steady magnetohydrodynamics (MHD) model was built to simulate and analyze the vacuum arc behavior under TMF/RMF-AMF contacts, and arc plasma parameters were calculated based on the above model. The experimental results showed that arc deflection was visible under both low and high current. Under high current, arc core formed, which meant the arc contracted significantly. In addition, the anode became much more active under high current. The behavior of the cathode spots showed that they split themselves into other new cathode spots. Under high current, the bulk of the spots rotated along a clockwise direction on a transverse magnetic field (TMF) plate, which caused much noise and oscillation in the arc voltage. The simulation results show that ions are likely to gather on the branches of the TMF plate on the anode plane, as a result of the effects between the electromagnetic force and pressure gradient of the arc plasma. The current contracts in the center of the TMF plate on the cathode which was due to the thin connecting rod there. The anode contraction of the current is caused by the Hall effect. Ions move along a clockwise direction on the TMF plate, which is driven by Ampere force. The current contraction resulted in significant melting in the center of the cathode surface while the other region suffered from uniform melting. The melting caused by the anode contraction is more significant than that of the cathode.

  1. 76 FR 16700 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-03-25

    ... ). The PRA, titled ``Importation of French Bean, Phaseolus vulgaris L., and Runner Bean, Phaseolus... as follows: Sec. 319.56-51 French beans and runner beans from Kenya. French beans (Phaseolus vulgaris L.) and runner beans (Phaseolus coccineus L.) may be imported into the United States from Kenya...

  2. Co-inoculation with rhizobia and AMF inhibited soybean red crown rot: from field study to plant defense-related gene expression analysis.

    Directory of Open Access Journals (Sweden)

    Xiang Gao

    Full Text Available BACKGROUND: Soybean red crown rot is a major soil-borne disease all over the world, which severely affects soybean production. Efficient and sustainable methods are strongly desired to control the soil-borne diseases. PRINCIPAL FINDINGS: We firstly investigated the disease incidence and index of soybean red crown rot under different phosphorus (P additions in field and found that the natural inoculation of rhizobia and arbuscular mycorrhizal fungi (AMF could affect soybean red crown rot, particularly without P addition. Further studies in sand culture experiments showed that inoculation with rhizobia or AMF significantly decreased severity and incidence of soybean red crown rot, especially for co-inoculation with rhizobia and AMF at low P. The root colony forming unit (CFU decreased over 50% when inoculated by rhizobia and/or AMF at low P. However, P addition only enhanced CFU when inoculated with AMF. Furthermore, root exudates of soybean inoculated with rhizobia and/or AMF significantly inhibited pathogen growth and reproduction. Quantitative RT-PCR results indicated that the transcripts of the most tested pathogen defense-related (PR genes in roots were significantly increased by rhizobium and/or AMF inoculation. Among them, PR2, PR3, PR4 and PR10 reached the highest level with co-inoculation of rhizobium and AMF. CONCLUSIONS: Our results indicated that inoculation with rhizobia and AMF could directly inhibit pathogen growth and reproduction, and activate the plant overall defense system through increasing PR gene expressions. Combined with optimal P fertilization, inoculation with rhizobia and AMF could be considered as an efficient method to control soybean red crown rot in acid soils.

  3. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... peas, and lentils are all types of legumes. Vegetables such as beans and other legumes are an important source of protein. They are a key food in healthy diets and have many benefits. Beans, lentils, and ...

  4. Rhizosphere acidification of faba bean, soybean and maize

    International Nuclear Information System (INIS)

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L-1 P as KH2PO4. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h-1 plant-1) and specific proton efflux (0.47 nmol h-1 cm-1) was greater than that those of soybean (21.80 nmol h-1 plant-1 and 0.05 nmol h-1 cm-1, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  5. Rhizosphere acidification of faba bean, soybean and maize

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, L.L. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Peking Union Medical College, Beijing, 100094 (China); Cao, J. [School of Life Science, Key Laboratory of Arid and Grassland Ecology, Lanzhou University, Lanzhou 730000 (China); Zhang, F.S. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Li, L., E-mail: lilong@cau.edu.cn [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China)

    2009-07-01

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L{sup -1} P as KH{sub 2}PO{sub 4}. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h{sup -1} plant{sup -1}) and specific proton efflux (0.47 nmol h{sup -1} cm{sup -1}) was greater than that those of soybean (21.80 nmol h{sup -1} plant{sup -1} and 0.05 nmol h{sup -1} cm{sup -1}, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  6. NetBeans IDE 8 cookbook

    CERN Document Server

    Salter, David

    2014-01-01

    If you're a Java developer of any level using NetBeans and want to learn how to get the most out of NetBeans, then this book is for you. Learning how to utilize NetBeans will provide a firm foundation for your Java application development.

  7. Chlorotic mottle of bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Jayasinghe, W.U.

    1982-01-01

    For the past years there have been outbreaks of a disease of bean ( Phaseolus vulgaris L.) in Colombia called bean chlorotic mottle. The etiology of bean chlorotic mottle was not known, but the disease was generally believed to be incited by the same whitefly-transmitted virus that causes variegatio

  8. Tannins in faba beans (Vicia faba L.) : antinutritional properties in monogastric animals

    OpenAIRE

    A.J.M. Jansman

    1993-01-01

    Condensed tannins are found in coloured-flowering varieties of faba beans ( Viciafaba L.). They are considered as antinutritional factors for nonruminant species. High-tannin hulls of faba beans and isolated tannins were shown to induce a rapid hypertrophy of the parotid glands in rats and increase the secretion of salivary proline-rich proteins with a high affinity for tannins. In this way rats are able to defend themselves against more harmful effects of tannins. The growth performance of c...

  9. Performance of faba bean genotypes with Orobanche foetida Poir. and Orobanche crenata Forsk. infestation in Tunisia

    OpenAIRE

    Imen Trabelsi; Zouhaier Abbes; Moez Amri; Mohamed Kharrat

    2015-01-01

    Orobanche foetida Poir. and O. crenata Forsk. are major constraints to faba bean (Vicia faba L.) cultivation in Tunisia. To evalúate the different levels of resistance of seven small-seeded faba bean genotypes to these parasitic weed species, three trials were conducted in fields infested and non-infested with O. foetida in the Oued Beja Agricultural Experimental Unit and O. crenata in an experimental field at Ariana of the National Institute of Agricultural Research during three cropping sea...

  10. Arbuscular mycorrhizal fungi: new species and records in Northeast of Brazil

    Directory of Open Access Journals (Sweden)

    Danielle Karla Alves da Silva

    2014-10-01

    Full Text Available Arbuscular mycorrhizal fungi (AMF comprise the largest association of plants and fungi in nature yet have only recently been considered within the context of conservation biology. The aim of this work was to document the occurrence of AMF species and highlight recent advances in our knowledge of their diversity in Northeast Brazil. This new information has been generated by the Sisbiota-Brazil Program (National System of Biodiversity Research and provides the basis for a discussion on the AMF species found in the region. The work included a bibliographic review of the records from natural and agricultural area plus data generated by collections made in natural areas in six of the nine northeastern states during the period 2010-2013. Overall we recorded 28 genera and 125 species of AMF. Of these, 11 were new species, 13 represented new records for Brazil and six were unique to the Northeast. This represents a 25% increase in our knowledge of the diversity of AMF in the region. We can now estimate that the Northeast represents about 50% of the AMF species described worldwide. This finding reinforces the need for more studies in areas that are poorly studied in order to extend our understanding of this biodiversity and to help to define future strategies for management and conservation.

  11. Advances in Faba Bean Genetics and Genomics.

    Science.gov (United States)

    O'Sullivan, Donal M; Angra, Deepti

    2016-01-01

    Vicia faba L, is a globally important grain legume whose main centers of diversity are the Fertile Crescent and Mediterranean basin. Because of its small number (six) of exceptionally large and easily observed chromosomes it became a model species for plant cytogenetics the 70s and 80s. It is somewhat ironic therefore, that the emergence of more genomically tractable model plant species such as Arabidopsis and Medicago coincided with a marked decline in genome research on the formerly favored plant cytogenetic model. Thus, as ever higher density molecular marker coverage and dense genetic and even complete genome sequence maps of key crop and model species emerged through the 1990s and early 2000s, genetic and genome knowledge of Vicia faba lagged far behind other grain legumes such as soybean, common bean and pea. However, cheap sequencing technologies have stimulated the production of deep transcriptome coverage from several tissue types and numerous distinct cultivars in recent years. This has permitted the reconstruction of the faba bean meta-transcriptome and has fueled development of extensive sets of Simple Sequence Repeat and Single Nucleotide Polymorphism (SNP) markers. Genetics of faba bean stretches back to the 1930s, but it was not until 1993 that DNA markers were used to construct genetic maps. A series of Random Amplified Polymorphic DNA-based genetic studies mainly targeted at quantitative loci underlying resistance to a series of biotic and abiotic stresses were conducted during the 1990's and early 2000s. More recently, SNP-based genetic maps have permitted chromosome intervals of interest to be aligned to collinear segments of sequenced legume genomes such as the model legume Medicago truncatula, which in turn opens up the possibility for hypotheses on gene content, order and function to be translated from model to crop. Some examples of where knowledge of gene content and function have already been productively exploited are discussed. The

  12. Allelopathic potential of a noxious weed on mung bean

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2013-10-01

    Full Text Available Eupatorium odoratum have invaded the waste lands of South West Bengal, India. A field study indicated a gradual and also significant increase in Eupatorium odoratum accompanied with significant decrease in other coexisting species. Considering the above in mind, a study was undertaken to evaluate the existence of inhibitory effect of leaf extracts and leaf leachates noxious weed Eupatorium odoratum using fully viable seeds of mung bean (Vigna radiata as the bioassay material. The study showed the reduced the percentage germination and TTC stainability along with extended T50 values of mung bean seeds. The levels of protein, DNA and RNA, activities of dehydrogenase and catalase enzymes were significantly retarded in pretreated seed samples. Amino acid and sugar levels were increased in the leachates of seeds pretreated with leaf extracts and leaf leachates. Thus, from the overall results it can be concluded that various inhibitors present in E. odoratum can impart strong inhibitory effect on mung bean. The study suggests that the leaves of E. odoratum possess phytotoxic or allelopathic chemicals which potentially rendered the inhibitory action on mung bean seeds.

  13. Interaction between beans and objects

    International Nuclear Information System (INIS)

    The interaction between the X-ray beans and objects are studied, with the modification in the intensity. The kilovolt, the bundle filtration, the structure and composition of the patient and the quantity of scattered radiation are also described, as the main parameters for the contrast and for the dose of the patient. (C.G.C.)

  14. The influence of soil use on the occurrence and diversity of AMFs in a oxisol from Southern Brazil

    OpenAIRE

    Rodrigo Ferreira da Silva; Rudinei De Marco; Gilvan Moisés Bertollo; Márcia Matsuoka; Diego Ricardo Menegol

    2015-01-01

    The soil use and edaphic factors can to change arbuscular mycorrhizal fungi occurrence and distribution. The objective of this study was to determine the influence of different soil uses in the arbuscular mycorrhizal fungi (AMF) community. The areas of native Forest, fallow area, intensive grassland, extensive grazing, no-tillage, conventional tillage, orange orchard, vines and Eucalyptus dunnii were analyzed. From de collection of soil samples was established trap cultivation with Brachiaria...

  15. Fumonisin B2 production by Aspergillus niger in Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanaku, W.; Nielsen, Kristian Fog;

    2009-01-01

    During 2006 and 2007, a total of 64 Thai dried coffee bean samples (Coffea arabica) from two growing sites in Chiangmai Province and 32 Thai dried coffee bean samples (Coffea canephora) from two growing sites in Chumporn Province, Thailand, were collected and assessed for fumonisin contamination...... by black Aspergilli. No Fusarium species known to produce fumonisin were detected, but black Aspergilli had high incidences on both Arabica and Robusta Thai coffee beans. Liquid chromatography (LC) with high-resolution mass spectrometric (HRMS) detection showed that 67% of Aspergillus niger isolates from...... coffee beans were capable of producing fumonisins B2 (FB2) and B4 when grown on Czapek Yeast Agar with 5% NaCl. Small amounts (1-9.7 ng g-1) of FB2 were detected in seven of 12 selected coffee samples after ion-exchange purification and LC-MS/MS detection. Two samples also contained FB4...

  16. Protein Quality of Irradiated Brazilian Beans

    International Nuclear Information System (INIS)

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (∼10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein

  17. Protein Quality of Irradiated Brazilian Beans

    Energy Technology Data Exchange (ETDEWEB)

    Delincee, Henry; Villavicencio, Anna-Lucia C.H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein ({approx}10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein.

  18. Protein Quality of Irradiated Brazilian Beans

    Science.gov (United States)

    Delincée, Henry; Villavicencio, Anna-Lucia C. H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macaçar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (˜10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfection process, without impairing the biological quality of the valuable bean protein.

  19. The Effects of Arbuscular Mycorrhizal Fungus (AMF) and Humic Acid on the Growth of Pepper (Capsicum annuum L.) Plant and Root Rot Disease Caused by Phytophthora capsici Leonian

    OpenAIRE

    ASLANPAY, Burcu; Semra DEMİR

    2015-01-01

    In this study, the effects of singular and double combinations of Arbuscular Mycorrhizal Fungi (AMF) and humic acid (HA) were investigated on the growth of pepper (Capsicum annuum L.) and rot root disease caused by Phytophthora capsici Leonian which has been known as an important problem of pepper cultivation and leading yield losses. Under controlled conditions, four F1 pepper cultivars (Ergenekon, Bafra, Sirena and Yıldız) were inoculated with three different AMF strains (Glomus intraradice...

  20. Reflective Polyethylene Mulch Reduces Mexican Bean Beetle (Coleoptera: Coccinellidae) Densities and Damage in Snap Beans.

    Science.gov (United States)

    Nottingham, L B; Kuhar, T P

    2016-08-01

    Mexican bean beetle, Epilachna varivestis Mulsant, is a serious pest of snap beans, Phaseolus vulgaris L., in the eastern United States. These beetles are intolerant to direct sunlight, explaining why individuals are typically found on the undersides of leaves and in the lower portion of the plant canopy. We hypothesized that snap beans grown on reflective, agricultural polyethylene (plastic mulch) would have fewer Mexican bean beetles and less injury than those grown on black plastic or bare soil. In 2014 and 2015, beans were seeded into beds of metallized, white, and black plastic, and bare soil, in field plots near Blacksburg, VA. Mexican bean beetle density, feeding injury, predatory arthropods, and snap bean yield were sampled. Reflected light intensity, temperature, and humidity were monitored using data loggers. Pyranometer readings showed that reflected light intensity was highest over metallized plastic and second highest over white plastic; black plastic and bare soil were similarly low. Temperature and humidity were unaffected by treatments. Significant reductions in Mexican bean beetle densities and feeding injury were observed in both metallized and white plastic plots compared to black plastic and bare soil, with metallized plastic having the fewest Mexican bean beetle life stages and injury. Predatory arthropod densities were not reduced by reflective plastic. Metallized plots produced the highest yields, followed by white. The results of this study suggest that growing snap beans on reflective plastic mulch can suppress the incidence and damage of Mexican bean beetle, and increase yield in snap beans. PMID:27341891

  1. Kinetics model development of cocoa bean fermentation

    Science.gov (United States)

    Kresnowati, M. T. A. P.; Gunawan, Agus Yodi; Muliyadini, Winny

    2015-12-01

    Although Indonesia is one of the biggest cocoa beans producers in the world, Indonesian cocoa beans are oftenly of low quality and thereby frequently priced low in the world market. In order to improve the quality, adequate post-harvest cocoa processing techniques are required. Fermentation is the vital stage in series of cocoa beans post harvest processing which could improve the quality of cocoa beans, in particular taste, aroma, and colours. During the fermentation process, combination of microbes grow producing metabolites that serve as the precursors for cocoa beans flavour. Microbial composition and thereby their activities will affect the fermentation performance and influence the properties of cocoa beans. The correlation could be reviewed using a kinetic model that includes unstructured microbial growth, substrate utilization and metabolic product formation. The developed kinetic model could be further used to design cocoa bean fermentation process to meet the expected quality. Further the development of kinetic model of cocoa bean fermentation also serve as a good case study of mixed culture solid state fermentation, that has rarely been studied. This paper presents the development of a kinetic model for solid-state cocoa beans fermentation using an empirical approach. Series of lab scale cocoa bean fermentations, either natural fermentations without starter addition or fermentations with mixed yeast and lactic acid bacteria starter addition, were used for model parameters estimation. The results showed that cocoa beans fermentation can be modelled mathematically and the best model included substrate utilization, microbial growth, metabolites production and its transport. Although the developed model still can not explain the dynamics in microbial population, this model can sufficiently explained the observed changes in sugar concentration as well as metabolic products in the cocoa bean pulp.

  2. Phenotyping common beans for adaptation to drought

    OpenAIRE

    Beebe, Stephen E.; Rao, Idupulapati M.; Blair, Matthew W.; Acosta-Gallegos, Jorge A.

    2013-01-01

    Common beans (Phaseolus vulgaris L.) originated in the New World and are the grain legume of greatest production for direct human consumption. Common bean production is subject to frequent droughts in highland Mexico, in the Pacific coast of Central America, in northeast Brazil, and in eastern and southern Africa from Ethiopia to South Africa. This article reviews efforts to improve common bean for drought tolerance, referring to genetic diversity for drought response, the physiology of droug...

  3. Propoxur residues in cocoa beans

    International Nuclear Information System (INIS)

    Pod-bearing Amazon and Amelonado cocoa plants were sprayed with Unden 20% (propoxur, arprocarb, baygon) at the recommended rate of 210 g a.i./ha and twice the recommended rate at monthly intervals from July to October, 1976, and cured beans from the ripe pods analysed for propoxur residues by gas chromatography. In a radiotracer study with 14C-labelled propoxur, the effect of processing methods on residues and systemic uptake of propoxur from insecticide deposits on pod surfaces were also investigated. Residues did not exceed 0.03 ppm. There was no relationship between residues and harvesting time, cocoa type or rate of application. Contamination of beans with insecticide deposits on the pod surface during processing, and systemic uptake of insecticide from pod surfaces were negligible. (author)

  4. Detoxification Of Ochratoxin AIN Green Coffee Beans By Physical Methods With Studying Genotoxicity Of Treated Samples

    International Nuclear Information System (INIS)

    Ochratoxin A (OTA) is potently nephrotoxic, teratogenic and carcinogenic, and the potency was varied markedly between species and sexes. Unfortunately, OTA are present due to mold contamination in different food stuffs such as coffee bean, therefore, the present study was carried out on collected imported coffee samples from super markets in Egypt. The isolation and identification proved presence of Penicilli sp. and Aspergillus sp. whereas the last one was dominant in two samples as A. niger and A. ochoruses. Determination of OTA by using HPLC analysis showed presence of high levels than the allowance levels in green coffee beans (more than 5 μg/kg; ppb). In addition, another group of collected samples as roasted coffee beans indicated the presence of high toxic concentrations of OTA. The study was then conducted on samples contain the highest OTA content by using some physical methods as gamma irradiation (5 and 10 kGy), charcoal (powder, granules), roasting (at 2000C for 7-10 min and 20 min). The results showed that proposed physical methods, mainly gamma irradiation and charcoal, could be efficient to decrease OTA in green beans coffee without produce toxic substance as well as non-significant changes in its properties. In addition, safety of resulted coffee beans after treatments were checked by ESR and genotoxicity test, which raise the preferability of gamma irradiation (10 kGy) treatment before using medium roasting to get coffee beans free from OTA

  5. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus.

    Science.gov (United States)

    Pinheiro, Patrícia V; Quintela, Eliane D; Junqueira, Ana Maria R; Aragão, Francisco J L; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) by expressing a mutated REP protein, which is essential for virus replication. Biosafety studies were performed for a period of three years under field conditions. The abundance of some species was significantly higher in specific treatments in a particular year, but not consistently different in other years. A regular pattern was not observed in the distribution of insects between genetically modified and conventional treatments. Data analyses showed that minor differences observed can be attributed to random variation and were not consistent enough to conclude that the treatments were different. Therefore the present study indicates that the relative abundance of species are similar in transgenic and non-transgenic fields. PMID:24922280

  6. Long-term effect of irrigation with water from sewage treatment plant on AMF biodiversity and microbial activities.

    Science.gov (United States)

    Alguacil, M. M.; Torrecillas, E.; Lozano, Z.; Torres, M. P.; Garcia-Orenes, F.; Roldan, A.

    2012-04-01

    Shortage of water is one of the most important environmental problem in the Mediterranean areas that implicates the search for strategies for saving good quality water. The use of treated waste water for the irrigation of agricultural land can be a good solution for this problem because it reduces the utilization of fresh water and potentially could improve soil key parameters, but can modify physical-chemical and biological properties of the same. The aim of this work was to study the effect of long-term irrigation with treated waste water on microbial diversity, mainly arbuscular mycorrhizal fungi (AMF) of the soil and other properties related with the microbial community. The experiment was developed in an agricultural area with Citrus orchard, located in Alicante in the southeast Spain. Here, we tested whether the communities of AMF as well as soil microbial properties were affected by irrigation with water coming from sewage treatment plant during 40 years in a soil. To carry out this study the soil properties (dehydrogenase, urease, protease-BAA, acid phosphatase, β-glucosidase, glomalin related soil protein, microbial biomass C and aggregate stability) and AMF diversity (the AM fungal small sub-unit (SSU) rRNA genes were subjected to PCR, cloning, sequencing and phylogenetic analyses) were analysed in the soil from two different plots with the same soil but with different type of irrigation (irrigated with fresh water and irrigated with treated water). The first results did not show significant differences in some soil properties between soil irrigated with water treated or not.

  7. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    -assisted selection in rice bean and other Vigna species.

  8. Analysis of simple sequence repeats in rice bean (Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; SukHa Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    rice bean and other Vigna species.

  9. Weed management strategies for castor bean crops

    Directory of Open Access Journals (Sweden)

    Augusto Guerreiro Fontoura Costa

    2014-04-01

    Full Text Available Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide selectivity, for castor bean crops. Weed science research for castor bean crops is scarce. One of the main weed management challenges for castor bean crops is the absence of herbicides registered with the Ministry of Agriculture, Livestock and Food Supply (MALFS. Research for viable herbicides for weed control in castor bean crops should be directed by research and/or rural extension institutions, associations and farmers cooperatives, as well as by manufactures, for the registration of these selective herbicides, which would be primarily used to control eudicotyledons in castor bean crops. New studies involving the integration of weed control methods in castor bean also may increase the efficiency of weed management, for both small farmers using traditional crop methods in the Brazilian Northeast region, as well as for areas with the potential for large scale production, using conservation tillage systems, such as the no-tillage crop production system.

  10. Performance of the Bean-protein Fiber

    Institute of Scientific and Technical Information of China (English)

    韩光亭; 杜宁; 孙亚宁

    2003-01-01

    The methods in testing the bean-protein fiber and the standards used were simply introduced. The fiber's mechanical and chemical performances were further analyzed. And the correlative performance of the bean-protein fibers and other natural fibers have been compared, then full knowledge of the fiber's performance was concluded.

  11. Common beans, diseases: ecology and control

    Science.gov (United States)

    Common bean, Phaseolus vulgaris, is one of the most important edible legume crops worldwide, nutritionally and economically. Diseases caused by pathogens that affect beans can have catastrophic effects, destroying entire crops in some instances. There are more than 200 pathogens (bacterial, fungal,...

  12. Nutritional and health benefits of dried beans.

    Science.gov (United States)

    Messina, Virginia

    2014-07-01

    Dried beans (often referred to as grain legumes) may contribute to some of the health benefits associated with plant-based diets. Beans are rich in a number of important micronutrients, including potassium, magnesium, folate, iron, and zinc, and are important sources of protein in vegetarian diets. In particular, they are among the only plant foods that provide significant amounts of the indispensable amino acid lysine. Commonly consumed dried beans are also rich in total and soluble fiber as well as in resistant starch, all of which contribute to the low glycemic index of these foods. They also provide ample amounts of polyphenols, many of which are potent antioxidants. Intervention and prospective research suggests that diets that include beans reduce low-density lipoprotein cholesterol, favorably affect risk factors for metabolic syndrome, and reduce risk of ischemic heart disease and diabetes. The relatively low bean intakes of North Americans and northern Europeans can be attributed to a negative culinary image as well as to intestinal discomfort attributable to the oligosaccharide content of beans. Cooking practices such as sprouting beans, soaking and discarding soaking water before cooking, and cooking in water with a more alkaline pH can reduce oligosaccharide content. Promotional efforts are needed to increase bean intake. PMID:24871476

  13. Associations of dominant plant species with arbuscular mycorrhizal fungi during vegetation development on coal mine spoil banks

    Energy Technology Data Exchange (ETDEWEB)

    Rydlova, J.; Vosatka, M. [Academy of Science. Pruhonice (Czech Republic). Inst. of Botany

    2001-07-01

    Among plants colonizing mine spoil banks in Northern Bohemia the first colonizers, mainly ruderal annuals from Chenopodiaceae and Brassicaceae were found not to be associated with arbuscular mycorrhizal fungi (AMF). These species cultivated in pots with soil from four sites in different succession stages of the spoil bank did not respond to the presence of native or non-native AMF. All grass species studied (Elytrigia repens, Calamagrostis epigejos and Arrhenatherum elatius) were found moderately colonized in the field. Carduus acanthoides was found to be highly colonized in the field; however, it did not show growth response to AMF in the pot experiment. The AMF native in four sites on the spoil banks showed high infectivity but low effectiveness in association with colonizing plants compared to the non-native isolate G. fistulosum BEG23. In general, dependence on AMF in the cultivation experiment was rather low, regardless of the fact that plants were found to be associated with AMF either in the field or in pots. Occurrence and effectiveness of mycorrhizal associations might relate primarily to the mycotrophic status of each plant species rather than to the age of the spoil bank sites studied.

  14. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  15. Enterprise JavaBeans 31

    CERN Document Server

    Rubinger, Andrew

    2010-01-01

    Learn how to code, package, deploy, and test functional Enterprise JavaBeans with the latest edition of this bestselling guide. Written by the developers of JBoss EJB 3.1, this book not only brings you up to speed on each component type and container service in this implementation, it also provides a workbook with several hands-on examples to help you gain immediate experience with these components. With version 3.1, EJB's server-side component model for building distributed business applications is simpler than ever. But it's still a complex technology that requires study and lots of practi

  16. Necessity of mycorrhizal re-inoculation in the transplantation of banana in areas with precedent of inoculated canavalia with AMF

    Directory of Open Access Journals (Sweden)

    Jaime Enrique Simó González

    2016-07-01

    Full Text Available From being the banana, a mycotrophic crop and previous results on the potential of green manure inoculated as a way to mycorrhizal economic crops, this work was developed in order to assess whether a precedent Canavalia ensiformis cultivation, inoculated with efficient strains of arbuscular mycorrhizal fungi (AMF inoculation, it is necessary the banana inoculation, ‘FHIA-18’ (AAAB cultivar in the transplant field. Four treatments were evaluated: a control without application of fertilizers and other organic-mineral fertilizers (100% FOM, both without canavalia and two other treatments that are used above canavalia inoculated AMF and half also received organic-mineral fertilizer applications: (50% FOM, one of which, the banana was reinoculated in the transplant field and the other one not. The experimental design used, was randomized blocks, with four replications. The experiment ended after three productive cycles (mother plant, stems 1 and 2. Canavalia inoculated treatments and 50 % of FOM, guaranteed high yields and satisfactory nutritional content similar to that received 100 % of FOM and significantly higher than those obtained with the control treatment. This together with the values of colonization percentages and pores at both high and inoculated treatments were no significant differences between them, indicated not only the effectiveness of mycorrhizal inoculation but rather green manure inoculation was successful to inoculate bananas and re-inoculation of the same was not needed on the transplant.

  17. Selection experiments for the optimum combination of AMF-plant-substrate for the restoration of coal mines

    Energy Technology Data Exchange (ETDEWEB)

    Li-ping Wang; Wei-wei Zhang; Guang-xia Guo; Kui-mei Qian; Xiao-pei Huang [China University of Mining & Technology, Xuzhou (China). School of Environment and Spatial Informatics

    2009-07-15

    A complex substrate consisting of fly ash, coal gangue and excess sludge was used as an experimental soil in pot culture experiments. Different soil compositions were tested by observing the growth of arbuscular mycorrhizal (AM) fungi inoculated white clover, rye grass or corn. The biomass of the host plants, the mycorrhizal colonization (MC) rate and the mycorrhizal dependency (MD) were measured. The research addresses the preferable AMF-plant-substrate combination appropriate for restoration of coal mines. We used two inoculation methods: single-inoculation with Glomus versiforme or Glomus mosseae and a dual inoculation with both G.v and G.m. The results show that G.m is the preferable fungi and that dual inoculation does not show advantages for the restoration of coal mines. White clover inoculated with AM fungi is the most suitable condition for restoration of coal mines. The best weight ratio of fly ash, coal gangue and excess sludge was found to be 20:60:20. The optimum treatment conditions of AMF-plant-activated-substrate are described. 10 refs., 2 figs., 4 tabs.

  18. Comparison of growth, nitrogen metabolism and organ weights in piglets and rats fed on diets containing Phaseolus vulgaris beans.

    Science.gov (United States)

    Huisman, J; van der Poel, A F; van Leeuwen, P; Verstegen, M W

    1990-11-01

    The effects of lectins in the diet have been mainly studied in rats. An important question is whether results obtained in rats can be extrapolated to larger animals like the pig. Phaseolus vulgaris beans are rich in toxic lectins. Therefore a study was carried out to compare the effects of diets containing 200 g Phaseolus vulgaris beans (raw or toasted)/kg in rats and piglets. Live-weight gain, nitrogen digestibility and N balance were much lower in piglets than in rats fed on diets containing raw beans. Live-weight gain and N balance were slightly negative in the piglets. When toasted beans were given, live-weight gain and N balance values were reduced in piglets but hardly at all in rats. Giving raw beans caused hypertrophy of the pancreas in the rats but in piglets the weight of the pancreas was reduced. Spleen weight was depressed in the piglets but not in the rats. Weight of liver was not affected in either animal species. When toasted beans were given no effects on the weights of pancreas, spleen or liver were found in piglets or rats. It was concluded that the piglet is much more sensitive to antinutritional factors in the Phaseolus vulgaris bean than the rat. PMID:2265182

  19. Breeding for culinary and nutritional quality of common bean (Phaseolus vulgaris L. in intercropping systems with maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Rodino A.P.

    1999-01-01

    Full Text Available Common bean (Phaseolus vulgaris L. is widely intercropped with maize (Zea mays L. in the North of Spain. Breeding beans for multiple cropping systems is important for the development of a productive and sustainable agriculture, and is mainly oriented to minimize intercrop competition and to stabilize complementarity with maize. Most agricultural research on intercropping to date has focused on the agronomic and overall yield effects of the different species, but characters related with socio-economic and food quality aspects are also important. The effect of intercropping beans with maize on food seed quality traits was studied for thirty-five bush bean varieties under different environments in Galicia (Northwestern Spain. Parameters determining Asturian (Northern Spain white bean commercial and culinary quality have also been evaluated in fifteen accessions. There are significant differences between varieties in the selected cropping systems (sole crop, intercrop with field maize and intercrop with sweet maize for dry and soaked seed weight, coat proportion, crude protein, crude fat and moisture. Different white bean accessions have been chosen according to their culinary quality. Under these environmental conditions it appears that intercropping systems with sweet maize give higher returns than sole cropping system. It is also suggested that the culinary and nutritional quality potential of some white bean accessions could be the base material in a breeding programme the objectives of which are to develop varieties giving seeds with high food quality.

  20. Western bean cutworm survival and the development of economic injury levels and economic thresholds in field corn.

    Science.gov (United States)

    Paula-Moraes, S; Hunt, T E; Wright, R J; Hein, G L; Blankenship, E E

    2013-06-01

    Western bean cutworm, Striacosta albicosta (Smith) (Lepidoptera: Noctuidae), is a native pest of dry beans (Phaseolus vulgaris L.) and corn (Zea mays L.). Historically, the western bean cutworm was distributed in the western United States, but since 1999 eastward expansion has been observed. In corn, economic impact is caused by larval ear feeding. Information on western bean cutworm biology, ecology, and economic impact is relatively limited, and the development of economic injury levels (EILs) and economic thresholds (ETs) is required for more effective management. Studies during 2008-2011, across three ecoregions of Nebraska, sought to characterize western bean cutworm survival and development of EILs and ETs. Calculations of EILs and ETs incorporated the dynamics of corn price, management cost, and pest survival. The results from the current study demonstrated low larval survival of this species (1.51-12.82%). The mean yield loss from one western bean cutworm larva per plant was 945.52 kg/ha (15.08 bu/acre), based on 74,100 plants per ha. Economic thresholds are expressed as a percentage of plants with at least one egg mass. This study is the first study that explicitly incorporates variable management costs and crop values into western bean cutworm EIL calculations, and larval survival into ET calculations. PMID:23865192

  1. The use of ionising radiation from 60CO gamma source in controlling mouldiness in dried cocoa beans

    International Nuclear Information System (INIS)

    Mouldiness in stored cocoa beans in Ghana and the production of aflatoxin have been studied. Based on actual weight of discarded beans, mouldy beans have been estimated to constitute 0.13 % and 0.00002 % of marketable beans at the farmers' level and the buying agents' depots respectively in the Tafo District. This is contrasted with an estimated value of 0.16 % obtained in a questionnaire type study involving farmers. Estimated mouldy beans at the Tema port was 0.69 % per year (based on the cut test) representing a financial loss of $1,688,637.19 per year at $989/T should the mouldy beans be discarded. Fifty-eight (58) internally- and externally- borne fungal species were isolated from dried cocoa beans. Of these, forty-eight (48) were internally- borne and ten (10) were superficial. Twenty-nine (29) of the internally occurring fungi have been recorded for the first time on cocoa beans in Ghana. Twenty-six (26) of the fungi isolated belong to Aspergillus group. They included A. parasiticus and A. flavus, which can produce aflatoxins. Five (5) belong to Penicillium, eight (8) to Fusarium and nineteen (19) to other species. Ionising radiation effectively controlled fungi associated with mouldiness in cocoa beans in a dose - dependent manner. A radiation dose of 6 kGy completely inactivated the moulds. A. flavus and A. tamarii were the most radiation - resistant moulds encountered. The moisture content of the beans before, during and after irradiation influenced the effect of radiation. The relative humidity during storage and the type of packaging also influenced the radiation effect. Conidia of A. flavus subjected to moist heat at temperatures 20 0C to 60 0C for 2.5, 5 and 10 min respectively were not significantly affected by heating up to 50 0C. Heating an aqueous conidial suspension at 60 0C for at least 2.5 min reduced the number of fungal colonies by at least 5 log cycles when the suspension was assayed on agar plate media. Heating at 59 0C for 10 min

  2. Regulation of copper homeostasis and biotic interactions by microRNA 398b in common bean.

    Directory of Open Access Journals (Sweden)

    Loreto Naya

    Full Text Available MicroRNAs are recognized as important post-transcriptional regulators in plants. Information about the roles of miRNAs in common bean (Phaseolus vulgaris L., an agronomically important legume, is yet scant. The objective of this work was to functionally characterize the conserved miRNA: miR398b and its target Cu/Zn Superoxide Dismutase 1 (CSD1 in common bean. We experimentally validated a novel miR398 target: the stress up-regulated Nodulin 19 (Nod19. Expression analysis of miR398b and target genes -CSD1 and Nod19- in bean roots, nodules and leaves, indicated their role in copper (Cu homeostasis. In bean plants under Cu toxicity miR398b was decreased and Nod19 and CSD1, that participates in reactive oxygen species (ROS detoxification, were up-regulated. The opposite regulation was observed in Cu deficient bean plants; lower levels of CSD1 would allow Cu delivery to essential Cu-containing proteins. Composite common bean plants with transgenic roots over-expressing miR398 showed ca. 20-fold higher mature miR398b and almost negligible target transcript levels as well as increased anthocyanin content and expression of Cu-stress responsive genes, when subjected to Cu deficiency. The down-regulation of miR398b with the consequent up-regulation of its targets was observed in common bean roots during the oxidative burst resulting from short-time exposure to high Cu. A similar response occurred at early stage of bean roots inoculated with Rhizobium tropici, where an increase in ROS was observed. In addition, the miR398b down-regulation and an increase in CSD1 and Nod19 were observed in bean leaves challenged with Sclerotinia scleortiorum fungal pathogen. Transient over-expression of miR398b in Nicotiana benthamiana leaves infected with S. sclerotiorum resulted in enhanced fungal lesions. We conclude that the miR398b-mediated up-regulation of CSD and Nod19 is relevant for common bean plants to cope with oxidative stress generated in abiotic and biotic

  3. Radiation disinfestation of grains and cocoa beans

    International Nuclear Information System (INIS)

    A series of experiments has been performed by Ghanaian scientists from 1977 to 1987 to evaluate the seriousness of infestation and to establish effective doses for radiation disinfestation against insects and fungi which cause deterioration in grains and cocoa beans. Supporting investigations have been done on the effect of radiation disinfestation on some quality parameters and wholesomeness of grains (with maize as the test grain) and cocoa beans. A minimum dose of 0.8 kGy was established for effective control of insects present in stored grains and cocoa beans. For the decontamination against fungi and yeasts, a combination of moist heat (85% RH) applied to 60 deg. C for 30 min followed by a dose of 4 kGy was effective for maize and moist heat (85% RH) applied 80 deg. C and a dose of 4 kGy was recommended for cocoa beans. No significant difference was found between the organoleptic qualities of the products from maize and cocoa that had been treated with moist heat and radiation and the untreated samples. The cooling (solidifying) curves of cocoa butter prepared from untreated and treated cocoa beans were very similar. Irradiated cocoa beans were found to be wholesome. The prospects of radiation disinfestation of grains and cocoa beans have also been discussed. (author). 27 refs, 4 tabs

  4. Genome-wide association studies of morphological and agronomical traits in cultivated tepary beans (Phaseolus acutifolius)

    Science.gov (United States)

    Tepary bean (Phaseolus acutifolius A. Gray) is adapted to high temperature arid agroecological zones. In light of the ongoing and rapid changes in the world climate, the evaluation and development of alternate grain legume species that have similar nutritional and culinary characteristics as common ...

  5. ISOLATED PROTEIN FROM CASTOR BEAN, PEANUT, SOY BEAN AND SAFFLOWER MEALS

    OpenAIRE

    B.Tavasolian; S.Nikpour; B.Makanvand

    1981-01-01

    Castor bean, peanut, Soy bean and safflower protein isolates were prepared. The amino acid content of each of the protein isolates was analysed and the essential amino acid contents were compared with the FAO human requirements. The results indicated that castor bean has the highest oil and the protein content of defatted meal. Safflower 3148 (Marand, Iran) has the highest amount of essential amino acids. Peanut (Gilan Iran) has the lowest content of essential amino acids, however, in compari...

  6. RESPONSE OF THE JAMAICA-BEAN-CORN POLYCULTURE CROPPING SYSTEM TO THREE TREATMENTS OF FERTILIZATION IN VILLAFLORES, CHIAPAS, MEXICO

    Directory of Open Access Journals (Sweden)

    Rosey Obet Ruiz-González

    2014-07-01

    Full Text Available The corn (Zeamays Linneo and bean (Phaseolusvulgaris Linneo are the economic basis to meet the basic needs of rural families, but these crops are no longer economically viable for various reasons and jeopardize the family livelihood and productive alternatives are needed to improve the rural economy. The research was conducted during the spring-summer cycle from 1999 to 2000 in Villaflores , Chiapas, in order to evaluate the response of polyculturejamaica-bean-corn three fertilization treatments ( 00-00-00 , 60-60-60 and 120-60-60 . The experimental design was random blocks with three fertilization treatments, seven patterns of crops, and three replications and performance in the three plant species and vegetative variables were evaluated. With the data an ANOVA was performed and the treatment means were compared with the test of Tukey (p ≤ 0.05. The best vegetative response of the jamaica was to associate it with beans and corn with 60-60 fertilization treatment - 60, getting as much of: foliage (170 hojasplanta-1, branches (31 ramasplanta-1, acorns (54 bellotasplanta-1 and increased performance of dried calyxes (698 kgha-1.The beans associated with maize without fertilizations showed increase in foliage (62 hojasplanta-1 and in monoculture with fertilization 60-60 - 60 had the best performance (1,565 kgha-1of beans. Corn had the best vegetative response (18 hojasplanta-1 associated with beans and fertilization 120 - 60-60, and the best performance was when teamed with the beans and the jamaica (7,667 kgha-1. The best equivalent land-use was 3.31 in jamaica-bean-corn crop pattern. The analysis of the results indicates that the jamaica by associating it with corn and beans represents a biological and economic production alternative to improve the economy of rural families in Mexican soils which are acidified.

  7. Identificação e características culturais de espécies do gênero Aspergillus isoladas de sementes de feijão no Estado da Paraíba Identification and cultural characteristics of Aspergillus species isolated in common bean seeds from Paraíba State, Brazil

    Directory of Open Access Journals (Sweden)

    Vanilde Benicio

    2003-04-01

    Full Text Available A partir de sementes de feijão (Phaseulus vulgaris armazenadas no estado da Paraíba, foram isolados os fungos Aspergillus flavus, A. fumigatus, A. lucknowensis, A.niger, A.ochraceus e A. parasiticus. Os fungos foram identificados com base nas características culturais exibidas em meio de Czapek-Agar e morfológicas através de microscópio ótico composto. No oitavo dia de crescimento em meio de BDA, cada espécie apresentou diferenças quanto à curva de crescimento, taxa de crescimento durante o período de incubação e diâmetro das colônias no oitavo dia de acordo com a procedência das amostras de sementes.The fungi Aspergillus flavus, A. fumigatus, A. lucknowensis, A.niger, A.ochraceus and A. parasiticus were isolated from common bean (Phaseolus vulgaris seeds produced and stored by growers in the State of Paraíba, Brazil. These fungi were identified according to cultural characteristics on Czapek-agar medium and the structures viewed under compound microscope. The development of each fungal species on Potato-Dextrose-Agar (PDA medium presented differences for colony diameter, curve and rate of growth according to the seed samples from which were obtained.

  8. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    2011-01-01

    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  9. Control technology for fiber reinforced plastics industry at AMF Hatteras Yachts, New Bern Division, New Bern, North Carolina

    Science.gov (United States)

    Todd, W. F.

    1984-05-01

    Area and breathing zone samples were analyzed for styrene (100425) at AMF Hatteras Yachts (SIC-3079), New Bern, North Carolina, in September, 1983. Control technology at the facility was inspected. Breathing zone styrene concentrations were 8 to 74 parts per million (ppm), the highest concentrations occurring in the lamination and gel coating departments. Area samples ranged from 1 to 20ppm. The OSHA standard is 100ppm. The hull lamination and assembly areas were ventilated by air make up units and exhaust blowers. Air exhausted through the lamination booths in the small parts work area was considerably less than the supply air from the make up units. The air flow in two of the three lamination booths was considered inadequate. Respirators were available if needed. Industrial hygiene sampling at the facility was supervised by the industrial hygienist.

  10. Weed management strategies for castor bean crops

    OpenAIRE

    Augusto Guerreiro Fontoura Costa; Valdinei Sofiatti; Cleber Daniel de Góes Maciel; Juliana Parisotto Poletine; João Igor de Sousa

    2014-01-01

    Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide s...

  11. Spore population, colonization, species diversity and factors influencing the association of arbuscular mycorrhizal fungi with litchi trees in India.

    Science.gov (United States)

    Kumar, Vinod; Kumar, Rajesh; Kumar, Ajit; Anal, Dubedi

    2016-01-01

    Abundance and diversity of arbuscular mycorrhizal fungi (AMF) in association with litchi (Litchi chinensis Sonn.) trees were studied during 2012-2013, where orchard soil had high pH (7.42-9.53) and salinity (0.07- 0.39 dSm(-1)). A total of 105 rhizospheric soil and root samples were collected considering variables like location, age of tree, cultivar and production management. Results showed that spore count was in the range of 1-22 g(-1) soil. All the examined root segments had colonization of AMF, which ranged between 3.3 to 90.0%. AMF community comprised of Glomus mosseae, G. intaradices, G. constricta, G. coronatum, G. fasciculatum, G. albidum, G. hoi, G. multicauli, Acaulospora scrobiculata, A. laevis, Rhizophagus litchi and Entrophosphora infrequens. Higher spore density and AMF colonization were observed at medium level (13-28 kg ha(-1)) of available phosphorus that decreased ('r' = -0.21 for spore density, -0.48 for root colonization) with increasing soil phosphorus. While nitrogen did not influence the AMF association, a weak negative linear relationship with AMF colonization ('r' = -0.30) was apparent in the medium level (112-200 kg ha(-1)) of potash. Micronutrients (Zn, Fe, Cu, Mn and B) did not affect spore density (zero or a very weak linear correlation) but influenced root colonization ('r' = -0.53 to -0.44), the effect being more prominent above critical limits. Nutritionally sufficient, irrigated litchi orchards had greater spore count (46% samples having 5-22 spores g(-1) soil) and colonization (> 50% in 37.4% roots examined) than nutrient deficient, non-irrigated orchards, indicating essentiality of a threshold nutrients and moisture regime for the association. AMF symbiosis was influenced by cultivar (greater in 'China'), but tree age was not correlated to mycorrhizal association. A consortium of native species coupled with the understanding of nutrient effects on AMF would be useful for field application in litchi. PMID:26930865

  12. Apple latent spherical virus vector as vaccine for the prevention and treatment of mosaic diseases in pea, broad bean, and eustoma plants by bean yellow mosaic virus.

    Science.gov (United States)

    Satoh, Nozomi; Kon, Tatsuya; Yamagishi, Noriko; Takahashi, Tsubasa; Natsuaki, Tomohide; Yoshikawa, Nobuyuki

    2014-11-01

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases. PMID:25386843

  13. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Nozomi Satoh

    2014-11-01

    Full Text Available We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV harboring a segment of the Bean yellow mosaic virus (BYMV genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases.

  14. Disinfestation of copra, desiccated coconut and coffee beans by gamma radiation

    International Nuclear Information System (INIS)

    Nine insect pests were found associated with copra of which copra beetle, Necrobia rufipes, saw-toothed grain beetle, Oryzaephilus surinamensis, red flour beetle, Tribolium castaneum, cigarette beetle, Lasioderma serricorne and tropical warehouse moth, Ephestia cautella were found feeding on this food. While feeding on different coffee beans, coffee bean weevil, Araecerus fasciculatus De Geer showed preference on Arabica, Liberica and Excelsa but not in Robusta coffee beans. For mass rearing, the most suitable medium for copra beetle was desiccated coconut + yeast (2:1) and for coffee bean beetle, it was dried cassava chips + yeast (3:1). The life cycles completed in these food media were 43 to 60 and 42 to 56 days by copra beetle and coffee bean weevil respectively. Irradiation studies on these 2 species of insects showed that the eggs were most sensitive followed by larvae and pupae. A dose of 0.05 kGy prevented adult emergence from irradiated eggs and younger larvae, while doses of 0.10 to 0.25 kGy effected the survival of emerged adults. However, a dose of 0.50 kGy would be effective for the disinfestation of small packages (i.e. 0.25 to 0.50 kg in each) of copra or coffee beans initially infested with immature stages of beetles and weevils respectively. Packaging of irradiated commodities in polypropylene bags particularly those impregnated with permethrin prevented reinfestation by the insect pests. Toxic residues of permethrin in the prolypropylene film resulted in high mortality thereby preventing insect penetration of the packaging materials. Both copra beetles and coffee bean weevils were rather good invaders than penetrators as these species entered into the packages readily through existing openings in jute sack, woven polypropylene sack or flour bag. Organoleptic tests showed no change in aroma, flavour and general acceptability of irradiated coffee beans. In microbial studies it was observed that a dose of 0.6 kGy would eliminate Salmonella

  15. Marker-assisted selection in common beans and cassava

    International Nuclear Information System (INIS)

    (CGM) and cassava brown streak (CBS) resistance from a wild relative, M. esculenta sub spp. flabellifolia. The use of advanced backcrossing with additional wild relatives is proposed as a way to discover genes for high protein content, waxy starch, delayed post-harvest physiological deterioration, and resistance to whiteflies and hornworm. Other potential targets of MAS such as beta carotene and dry matter content as well as lower cyanogenic potential are given. In addition, suggestions are made for the use of molecular markers to estimate average heterozygosity during inbreeding of cassava and for the delineation of heterotic groups within the species. A final section describes the similarities and differences between the MAS schemes presented for the two crops. Differences between the species can be ascribed partially to the breeding and propagation systems of common beans (seed propagated, selfpollinating) and cassava (clonally propagated, cross-pollinating). In addition, differences in growth cycles, breeding methods, availability of genetic markers, access to selection environments and the accompanying opportunities for phenotypic selection influence the decisions in both crops of when and how to apply MAS. Recommendations are made for applying MAS in breeding of both crops including careful prioritization of traits, marker systems, genetic stocks, scaling up, planning of crosses and the balance between MAS and phenotypic selection. (author)

  16. Java EE 7 development with NetBeans 8

    CERN Document Server

    Heffelfinger, David R

    2015-01-01

    The book is aimed at Java developers who wish to develop Java EE applications while taking advantage of NetBeans functionality to automate repetitive tasks. Familiarity with NetBeans or Java EE is not assumed.

  17. Effects of enhanced UVB on growth and yield of two Syrian crops, wheat (Triticum durum desf. var. horani) and broad beans (Vicia Faba L.) under field conditions

    International Nuclear Information System (INIS)

    Wheat and broad beans were exposed, under field conditions, to a daily UVB of 20 % above the ambient UVB. The plant height, tiller number, number of flowers, spikletes, dry weight and leaf area in both species showed positive responses to UVB treatment. At harvest, the seeds weight of broad beans was virtually equal in exposed and unexposed plants. In wheat, seeds yield increased significantly by 15 %. In conclusion, broad beans can be considered as a tolerant cultivar to enhanced UVB, while wheat is more tolerant. (Author). 17 Tabs. 36 Refs

  18. Characterization of Glomerella strains recovered from anthracnose lesions on common bean plants in Brazil.

    Science.gov (United States)

    Barcelos, Quélen L; Pinto, Joyce M A; Vaillancourt, Lisa J; Souza, Elaine A

    2014-01-01

    Anthracnose caused by Colletotrichum lindemuthianum is an important disease of common bean, resulting in major economic losses worldwide. Genetic diversity of the C. lindemuthianum population contributes to its ability to adapt rapidly to new sources of host resistance. The origin of this diversity is unknown, but sexual recombination, via the Glomerella teleomorph, is one possibility. This study tested the hypothesis that Glomerella strains that are frequently recovered from bean anthracnose lesions represent the teleomorph of C. lindemuthianum. A large collection of Glomerella isolates could be separated into two groups based on phylogenetic analysis, morphology, and pathogenicity to beans. Both groups were unrelated to C. lindemuthianum. One group clustered with the C. gloeosporioides species complex and produced mild symptoms on bean tissues. The other group, which belonged to a clade that included the cucurbit anthracnose pathogen C. magna, caused no symptoms. Individual ascospores recovered from Glomerella perithecia gave rise to either fertile (perithecial) or infertile (conidial) colonies. Some pairings of perithecial and conidial strains resulted in induced homothallism in the conidial partner, while others led to apparent heterothallic matings. Pairings involving two perithecial, or two conidial, colonies produced neither outcome. Conidia efficiently formed conidial anastomosis tubes (CATs), but ascospores never formed CATs. The Glomerella strains formed appressoria and hyphae on the plant surface, but did not penetrate or form infection structures within the tissues. Their behavior was similar whether the beans were susceptible or resistant to anthracnose. These same Glomerella strains produced thick intracellular hyphae, and eventually acervuli, if host cell death was induced. When Glomerella was co-inoculated with C. lindemuthianum, it readily invaded anthracnose lesions. Thus, the hypothesis was not supported: Glomerella strains from anthracnose

  19. Allelopathic effects of redroot pigweed (Amaranthus retroflexus L. on germination & growth of cucumber, alfalfa, common bean and bread wheat

    Directory of Open Access Journals (Sweden)

    Hamideh BAKHSHAYESHAN-AGDAM

    2015-11-01

    Full Text Available Allelopathy is one of the important interactions among plants. Weeds can reduce crops productions in farms by their allelopathic effects. Redroot pigweed (Amaranthus retroflexus L. is the most common weed in Iran with well-known allelopathic potential. In the presented experiment, the allelopathic effects of redroot pigweed on germination and growth of four important crop species including cucumber (Cucumis sativus L., alfalfa (Medicago sativa L., common bean (Phaseulus vulgaris L. and bread wheat (Triticum aestivum L. was studied. The effect of different concentrations of redroot pigweed leachate on seed germination and seedlings growth parameters of tested plants was significant, but not same in all studied species. Bread wheat and cucumber were more resistance in seed germination stage in comparison to common bean and alfalfa. Except alfalfa, all plant species showed certain rate of resistance in the most measured parameters. According to the obtained results, bread wheat and common bean were the most resistant species, cucumber was resistant at low concentration but sensitive at high concentration, and alfalfa was the most sensitive species to the redroot pigweed leachate treatments. Therefore, the cultivation of resistant plant species (such as bread wheat and common bean plants in the regions with redroot pigweed’s invasion is appropriate way in management of the farms.

  20. Effects of fermented soya bean on digestion, absorption and diarrhoea

    OpenAIRE

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describes effects of fermented soya beans on gastrointestinal physiology and addresses digestion, absorption and diarrhoea.Using an in vitro digestion model it appeared that fermentation increased solubil...

  1. On the Specification of Components - the JavaBeans Example

    OpenAIRE

    Heisel, Maritta; Santen, Thomas; Souquières, Jeanine

    2002-01-01

    We specify the JavaBean component model and concrete beans using a combination of UML class diagrams, an extension of Object-Z, and life sequence charts. We extend Object-Z by keywords that allow one to concisely describe the interface of a bean by an Object-Z class specification. The component model specification provides specification templates consisting of class diagrams, Object-Z fragments, and life sequence charts that precisely capture the functional behavior of beans in general, inclu...

  2. Leaf development of soybean and bean crops and weeds

    International Nuclear Information System (INIS)

    The objective of this study was to compare the emission rate and expansion of the leaves, duration of the leaf area (DLA) and the extinction coefficient (k) for the crops soybean and of the bean, and for the weeds Euphorbia heterophylla sensitive and Euphorbia heterophylla resistant to the herbicides inhibiting of the ALS enzyme, Bidens pilosa and Desmodium tortuosum. The experiment was developed in the field, in soil classified as Red-Yellow Claysoil, in the period of october of 2000 to march of 2001. Each plant species consisted of a treatment. The treatments were arranged in a randomized complete block design with four replications. The mensurations of the photosynthetically active radiation (PAR) were accomplished in two points of the plants: above and bellow the canopy, by means of a light ceptometer. The emission rate and the expansion of leaves was calculated at the end of the cycle of the crops. The DLA and k were calculated before and after the plant flowering. It was not observed differences in the development of the biotypes of E. heterophylla with relation to the rate of appearance of leaves, expansion rate, DLA or k. Among the cultures, the bean presented smaller leaf emission rate (0.591 / day) compared to the soybean (0.933 / day). Among the weeds, the largest leaf emission rate was with D. tortuosum (0.699 / day). The leaf expansion rate observed by the soybean was superior to all the other species (6.77 cm2.day-1). All plant species presented larger value for DLA after the flowering compared before flowering. The soybean presented larger value of k (before and after the flowering 0.52 and 0.93, respectively) compared to the other species, demonstrating high potential of interception of solar radiation. (author)

  3. Evaluation of the recycle of nitrogen in a succession bean - corn -bean By means of the isotopic method

    International Nuclear Information System (INIS)

    To determine the recycle of Nitrogen in a succession bean - corn - bean a was developed I experience under field conditions, on Red Ferralitic soils (Rhodic Ferrasols) with the one I use of the stable isotope 15 Nitrogen

  4. 21 CFR 582.7343 - Locust bean gum.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Locust bean gum. 582.7343 Section 582.7343 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... bean gum. (a) Product. Locust (carob) bean gum. (b) Conditions of use. This substance is...

  5. Effects of fermented soya bean on digestion, absorption and diarrhoea

    NARCIS (Netherlands)

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describ

  6. Fungal decontamination and enhancement of shelf life of edible split beans of wild legume Canavalia maritima by the electron beam irradiation

    Science.gov (United States)

    Supriya, P.; Sridhar, K. R.; Ganesh, S.

    2014-03-01

    Ripened split beans of the coastal sand dune wild legume Canavalia maritima serve as one of the traditional nutritional sources of the coastal dwellers in Southwest coast of India. Nine fungi were isolated from the unirradiated dry beans by plating on the potato dextrose agar medium. Toxigenic fungus Aspergillus niger showed the highest incidence (33-50%) followed by Aspergillus flavus (14-20%) and Penicillium chrysogenum (7-13%). Unirradiated dry beans and irradiated dry beans with electron beam doses 2.5, 5, 10 and 15 kGy were monitored for occurrence of fungal species and their incidence during 0, 3 and 6 months storage period under laboratory conditions. Irradiation resulted in dose-dependent decrease in fungal species (5-7, 4-6, 3-6 and 0 on irradiation at 0, 2.5, 5 and 10 or 15 kGy, respectively) as well as incidence (80-99, 19-46, 13-21 and 0%, respectively). Although aflatoxins (B1 and B2) were found below detectable level (<2 ng/g) in 0, 3 and 6 months stored unirradiated and irradiated beans (2.5 and 5 kGy), they were not present in beans irradiated with 10 and 15 kGy. In spite of occurrence of toxigenic fungus Aspergillus ochraceus in unirradiated and irradiated beans (2.5 and 5 kGy) stored for 3 and 6 months, the beans were devoid of ochratoxin-A. Electron beam irradiation dose 10 kGy could be recommended for fungal decontamination and improvement of shelf life of C. maritima ripened dry split beans.

  7. Methyl bromide residues in fumigated cocoa beans

    International Nuclear Information System (INIS)

    The 14C activity in unroasted [14C]-methyl bromide fumigated cocoa beans was used to study the fate and persistence of CH3Br in the stored beans. About 70% of the residues occurred in the shells. Unchanged CH3Br could not be detected, all the sorbed CH3Br having reacted with bean constituents apparently to form 14C-methylated derivatives and inorganic bromide. No 14C activity was found in the lipid fraction. Roasting decreased the bound (non-volatile) residues, with corresponding changes in the activities and amounts of free sugars, free and protein amino acids. Roasted nibs and shells showed a two-fold increase in the volatile fraction of the 14C residue. This fraction may be related to the volatile aroma compounds formed by Maillard-type reactions. (author)

  8. Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.)

    OpenAIRE

    Yang Jun-Bo; Tian Bo; Yang Chun; Qiu Lijun; Liu Aizhong

    2010-01-01

    Abstract Background The castor bean (Ricinus communis L.), a monotypic species in the spurge family (Euphorbiaceae, 2n = 20), is an important non-edible oilseed crop widely cultivated in tropical, sub-tropical and temperate countries for its high economic value. Because of the high level of ricinoleic acid (over 85%) in its seed oil, the castor bean seed derivatives are often used in aviation oil, lubricants, nylon, dyes, inks, soaps, adhesive and biodiesel. Due to lack of efficient molecular...

  9. Agronomic performance of velvet bean at different spatial arrangement

    International Nuclear Information System (INIS)

    The objective of this work was to evaluate the effect of different plant spatial arrangements on agronomic performance of velvet-bean (Mucuna pruriens var. utilis). The experiment was performed with eight treatments, distributed in a randomized complete block design in a 2x4 factorial arrangement, with four replicates. The treatments were velvet bean sowing at two spacings between furrows (0.5 and 1.0 m) and four plant densities (2, 4, 8 and 16 plants m-1). Determinations were made for the soil covering and biological nitrogen fixation (BNF) rates, and for the dry matter yield and N accumulation in the plant shoots. Total soil cover was accomplished at 50 days after sowing at 16 plants m-1 density and 0.5 m spacing between furrows. The combination of 16 plants m-11density with the 1.0 m spacing between furrows provided the greatest dry matter yield and accumulated most N in the plant shoots. Irrespective of the plant spatial arrangement, the estimation of BNF in this species shows that about 70% N present in the shoot is derived from the atmosphere. (author)

  10. Stem Anatomy of Country Bean

    Directory of Open Access Journals (Sweden)

    M. Touhidul Islam

    2003-01-01

    Full Text Available Anatomical investigation has been made on the stem of country bean (Lablab purpureus (L. Sweet at different stages of growth following the standard paraffin method of microtechnique. The epidermis is single layered with multicellular hairs and glandular trichomes. Beneath the epidermis there are 5-10 layers of cortical cells. The primary vascular tissue appears after the elongation of the first internode of the stem. The vascular bundles are collateral and arranged in a ring. There are two types of vascular bundles, large and small. There are one or more small vascular bundles in between two large bundles. The large vascular bundle contains xylem and phloem but small bundle may or may not contain both xylem and phloem. There are several poles of primary phloem outside the primary xylem. The pericycle is discontinuous. Two adjacent groups of sclerenchyma are connected by one or two layers of sclerenchymatous cells. The cambium initiates in the primary vascular bundle between xylem and phloem at the basal part of the stem of 4 days old plant. Gradually it extends towards the upper part. The cambium is at first confined to the fascicular region. Subsequently it extends into the interfascicular region forming a complete cambial ring. After the formation of the fascicular cambium it gives rise to the secondary xylem adaxially and secondary phloem abaxially. In the mature stem, most of the vessels are multiple, some are paired while the others are solitary. Most of the fibre cells in the phloem region are found in groups. The fibre cells are arranged in such a way that the structure looks like a pyramid. Tannin cells are present in the phloem region of younger and mature stem. The secretory cells devoid of tanniniferous contents have been observed in the secondary phloem region of the mature stem. The phellogen appears in the deeper cortex and produces periderm with lenticel. The periderm consists of 3-5 layers of cork cells abaxially and 2-3 layers

  11. Características fisiológicas das culturas de soja e feijão e de três espécies de plantas daninhas Physiological caracteristics of soybean and common bean crops and three weed species

    Directory of Open Access Journals (Sweden)

    S.O. Procópio

    2004-06-01

    -yellow Clayoil, in a randomized complete block arrangement, with four replications, in a split-plot design. The species were the plots and the evaluation times the split-plots. Higher Wt of soybean was observed in relation to the weeds. The soybean and common bean crops showed higher L than the weeds. E. heterophylla biotypes presented the largest A and gs values. Except for D. tortuosum, the weeds presented larger WUE at the initial stage of crops development. No differences were observed between E. heterophylla biotypes.

  12. Potential of sunflower, castor bean, common buckwheat and vetiver as lead phytoaccumulators

    Directory of Open Access Journals (Sweden)

    Jailson do C. Alves

    2016-03-01

    Full Text Available ABSTRACT Studies concerning the tolerance, absorption and distribution of heavy metals in plants are essential for the success of phytoremediation programs. The present study was carried out in order to evaluate the potential of the sunflower, castor bean, common buckwheat and vetiver as lead phytoaccumulators. The species were grown in nutrient solution containing increasing doses of Pb (0, 50, 100, 200 and 400 mg L-1 during a 30-day exposure period. A completely randomized split-plot design was used, with a 4 x 5 factorial and three replicates. Significant reductions of dry matter of the root, shoot and whole plant were found in the all species under study as a function of the increased Pb doses. Vetiver showed higher tolerance to Pb contamination; sunflower and castor bean had intermediate tolerance and the common buckwheat proved to be the most sensitive species. The concentration and total content of Pb in plant compartments were significantly affected by the increased Pb doses in solution, and higher accumulation of this element was observed, in general, in the roots of the studied species. Common buckwheat proved to be not much promising for Pb-phytoremediation programs; sunflower showed potential for Pb phytoextraction and castor bean and vetiver were the most appropriate for Pb phytostabilization.

  13. Bonner sphere measurements of 241Am-B and 241Am-F neutron energy spectra unfolded using high-resolution a priori data

    International Nuclear Information System (INIS)

    High-resolution neutron energy spectra, covering the entire energy range of interest, for two standard radionuclide neutron sources (241Am-B and 241Am-F) have been derived from Bonner sphere measurements by using high-resolution a priori data in the unfolding process. In each case, two a priori spectra were used, one from a two-stage calculation and also one from a combination of the calculated spectrum with a high-resolution measured spectrum. The unfolded spectra are compared with those published elsewhere and show significant differences from the ISO- and IAEA-recommended spectra for 241Am-B and 241Am-F, respectively. Values for the fluence-average energy and fluence-to-dose-equivalent conversion coefficients are presented for the new spectra, and the implications of the new spectra for the emission rates of the sources when measured by the manganese bath technique are also determined. A combination of calculations and measurements has been performed to determine the spectral fluence from two reference neutron sources over the entire energy range of interest. For the Am-B source, this approach has supported the spectra of Marsh et al. and Zimbal and reduced confidence in the ISO 8529 spectrum. However, in terms of derived quantities, there is a good agreement between all the available spectra. In contrast, the new Am-F spectrum presented here is significantly different from those already published. The fluence to dose conversion coefficients derived from the new spectrum are 9 % lower than the currently accepted values, and the emission rates of Am-F sources measured by the manganese bath technique may need to be increased by up to 0.5 %. (authors)

  14. Enhanced accumulation of vitamins, nutraceuticals and minerals in lettuces associated with arbuscular mycorrhizal fungi (AMF): a question of interest for both vegetables and humans

    OpenAIRE

    Marouane Baslam; Nieves Goicoechea; Idoia Garmendia

    2013-01-01

    Lettuce ( Lactuca sativa L.) is extensively grown and is the most widely used food crop for the called “Fourth Range†of vegetables. Lettuce exhibits healthy properties mainly due to the presence of antioxidant compounds (vitamins C and E, carotenoids, polyphenols) alongside significant fibre content and useful amounts of certain minerals. Lettuce can establish a mutualistic association with arbuscular mycorrhizal fungi (AMF). The establishment of the symbiosis involves a continuous cellul...

  15. Effect of Superheated Steam Roasting on Radical Scavenging Activity and Phenolic Content of Robusta Coffee Beans

    Directory of Open Access Journals (Sweden)

    Ooi Ee Shan

    2015-04-01

    Full Text Available Robusta coffee is one of the coffee species grown in Malaysia. However, there is little research conducted on Robusta coffee beans as Arabica coffee is more popular among the consumers. Coffee is a rich source of antioxidants, therefore research on antioxidant properties of Robusta coffee beans is important to explore its market value. Nowadays, most of coffee analysis is on conventional roasted coffee which reduces their antioxidant properties. In this study, Robusta coffee beans (Coffea canephora were subjected to superheated steam roasting at 200, 220 and 240 ˚C for 20-40 min to obtain light, medium and dark roast. The effect of different roasting temperature and time on the total phenolic content (TPC and radical scavenging activity (RSA of Robusta coffee bean was investigated. Total phenolic content of coffee brews decreased with the increase of roasting degree due to the degradation of phenolic compounds. The highest phenolic content was found at 220 ˚C for 20 min. Meanwhile, brews extracted from light roasted coffee and medium roasted at 220 ˚C for 20 min showed a maximum scavenging activity than those from green coffee. Brews from dark roasted coffee showed lowest radical scavenging activity and total phenol content. Hence, based on the results from this study, the best superheated steam roasting condition is at 220 ˚C for 20 min (medium roast to achieve a maximum antioxidant activity and highest phenolic content.

  16. Dynamics of a Novel Highly Repetitive CACTA Family in Common Bean (Phaseolus vulgaris).

    Science.gov (United States)

    Gao, Dongying; Zhao, Dongyan; Abernathy, Brian; Iwata-Otsubo, Aiko; Herrera-Estrella, Alfredo; Jiang, Ning; Jackson, Scott A

    2016-01-01

    Transposons are ubiquitous genomic components that play pivotal roles in plant gene and genome evolution. We analyzed two genome sequences of common bean (Phaseolus vulgaris) and identified a new CACTA transposon family named pvCACTA1. The family is extremely abundant, as more than 12,000 pvCACTA1 elements were found. To our knowledge, this is the most abundant CACTA family reported thus far. The computational and fluorescence in situ hybridization (FISH) analyses indicated that the pvCACTA1 elements were concentrated in terminal regions of chromosomes and frequently generated AT-rich 3 bp target site duplications (TSD, WWW, W is A or T). Comparative analysis of the common bean genomes from two domesticated genetic pools revealed that new insertions or excisions of pvCACTA1 elements occurred after the divergence of the two common beans, and some of the polymorphic elements likely resulted in variation in gene sequences. pvCACTA1 elements were detected in related species but not outside the Phaseolus genus. We calculated the molecular evolutionary rate of pvCACTA1 transposons using orthologous elements that indicated that most transposition events likely occurred before the divergence of the two gene pools. These results reveal unique features and evolution of this new transposon family in the common bean genome. PMID:27185400

  17. Growth characteristics of mung beans and water convolvuluses exposed to 425-MHz electromagnetic fields.

    Science.gov (United States)

    Jinapang, Peeraya; Prakob, Panida; Wongwattananard, Pongtorn; Islam, Naz E; Kirawanich, Phumin

    2010-10-01

    Effects of high-frequency, continuous wave (CW) electromagnetic fields on mung beans (Vigna radiata L.) and water convolvuluses (Ipomoea aquatica Forssk.) were studied at different growth stages (pre-sown seed and early seedling). Specifically, the effects of the electromagnetic source's power and duration (defined as power-duration level) on the growth of the two species were studied. Mung beans and water convolvuluses were exposed to electromagnetic fields inside a specially designed chamber for optimum field absorption, and the responses of the seeds to a constant frequency at various power levels and durations of exposure were monitored. The frequency used in the experiments was 425 MHz, the field strengths were 1 mW, 100 mW, and 10 W, and the exposure durations were 1, 2, and 4 h. Results show that germination enhancement is optimum for the mung beans at 100 mW/1 h power-duration level, while for water convolvuluses the optimum germination power-duration level was 1 mW/2 h. When both seed types were exposed at the early sprouting phase with their respective optimum power-duration levels for optimum seed growth, water convolvuluses showed growth enhancement while mung bean sprouts showed no effects. Water content analysis of the seeds suggests thermal effects only at higher field strength. PMID:20564175

  18. Formulation of microbes inoculum: AMF, PSB and Rhizobium isolated of ex-coal mining site for Acacia crassicarpa Cunn. Ex-benth seedlings

    Directory of Open Access Journals (Sweden)

    ENNY WIDYATI

    2007-07-01

    Full Text Available The shoddier succeed land revegetation particularly caused by least adaptability of the seedlings planted on this site. To encourage their growth and survival rate it can be achieved by means do inoculation with the compatible functional microbes such as rhizobium, Psolubilizing bacteria (PSB and/or arbuscular-mycorrhiza fungy (AMF. This reserach is aimed to formulate the most compatible inoculant to support the growth of A. crassicarpa seedlings. Compatibility study is carried out in RCB design with 3 replications, each contain 5 seedlings. Height and biomass are accessed to measure the growth responses of the seedlings. The result showed that the best reponse is given by consortia that consist of the three kinds of these microbes. This increase the shoot biomass (137% compare to the control. The consortia also improved N 164%, P 335% and K 167% in the plant tissues. While pure AMF improved absorption of N plants 80%, P 383% and K 51% compare to the control. It is suggested that to prepare the A. crassicarpa seedlings is better inoculated by consortium of microbes or AMF as a sole inoculant.

  19. Performance of Amblyseius herbicolus on broad mites and on castor bean and sunnhemp pollen.

    Science.gov (United States)

    Rodríguez-Cruz, Fredy Alexander; Venzon, Madelaine; Pinto, Cleide Maria Ferreira

    2013-08-01

    Amblyseius herbicolus (Banks) is found associated with broad mites Polyphagotarsonemus latus in crops such as chili pepper in Brazil. The species has a potential for controlling P. latus, but little is known about its development and reproduction on this pest as well as on other food sources. We studied biological, reproductive and life table parameters of A. herbicolus on three different diets: broad mites, castor bean pollen (Ricinus communis) and sunnhemp pollen (Crotalaria juncea). The predator was able to develop and reproduce on all diets. However, its intrinsic growth rate was higher on the diet of broad mites or on castor bean pollen than on sunnhemp pollen. Differences among pollen species may be due to their nutritional content. Feeding on alternative food such as pollen can facilitate the predator's mass rearing and maintain its population on crops when prey is absent or scarce. Other strategies of using pollen to sustain predator population and reduce pest damage are discussed. PMID:23417701

  20. Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.

    Directory of Open Access Journals (Sweden)

    Yang Jun-Bo

    2010-12-01

    Full Text Available Abstract Background The castor bean (Ricinus communis L., a monotypic species in the spurge family (Euphorbiaceae, 2n = 20, is an important non-edible oilseed crop widely cultivated in tropical, sub-tropical and temperate countries for its high economic value. Because of the high level of ricinoleic acid (over 85% in its seed oil, the castor bean seed derivatives are often used in aviation oil, lubricants, nylon, dyes, inks, soaps, adhesive and biodiesel. Due to lack of efficient molecular markers, little is known about the population genetic diversity and the genetic relationships among castor bean germplasm. Efficient and robust molecular markers are increasingly needed for breeding and improving varieties in castor bean. The advent of modern genomics has produced large amounts of publicly available DNA sequence data. In particular, expressed sequence tags (ESTs provide valuable resources to develop gene-associated SSR markers. Results In total, 18,928 publicly available non-redundant castor bean EST sequences, representing approximately 17.03 Mb, were evaluated and 7732 SSR sites in 5,122 ESTs were identified by data mining. Castor bean exhibited considerably high frequency of EST-SSRs. We developed and characterized 118 polymorphic EST-SSR markers from 379 primer pairs flanking repeats by screening 24 castor bean samples collected from different countries. A total of 350 alleles were identified from 118 polymorphic SSR loci, ranging from 2-6 per locus (A with an average of 2.97. The EST-SSR markers developed displayed moderate gene diversity (He with an average of 0.41. Genetic relationships among 24 germplasms were investigated using the genotypes of 350 alleles, showing geographic pattern of genotypes across genetic diversity centers of castor bean. Conclusion Castor bean EST sequences exhibited considerably high frequency of SSR sites, and were rich resources for developing EST-SSR markers. These EST-SSR markers would be particularly

  1. Virus diseases of peas, beans, and faba bean in the Mediterranean region.

    Science.gov (United States)

    Makkouk, Khaled; Pappu, Hanu; Kumari, Safaa G

    2012-01-01

    In the Mediterranean region, pea, bean, and faba bean production is affected by around 17 major viruses. These viruses do not have the same ecology and consequently require a variety of different preventive measures to control them. Some of these viruses have a narrow host range, such as Faba bean necrotic yellows virus (FBNYV), and others, such as Alfalfa mosaic virus (AMV) and Cucumber mosaic virus (CMV), a very wide host range. Such features are important when identifying sources of virus inoculum in a region, and the vectors can transmit viruses from natural reservoirs to the crop plants. Some of these viruses are seed borne and, consequently, can be disseminated long distances through infected seeds. Crop losses caused by these viruses are variable, depending on the sensitivity and susceptibility of the crop to infection. Host resistance genes have been identified for some of these viruses, but in others, such as FBNYV, no resistance genes in faba bean have been identified yet. Significant progress was made in developing precise methods for the identification of these viruses, and new virus problems are being identified every year. This chapter is not intended to be a review for pea, bean, and faba bean viruses, but rather focuses on the major viruses which affect these crops in the Mediterranean basin with focus on the progress made over the past two decades. PMID:22682174

  2. Genetic divergence of common bean cultivars.

    Science.gov (United States)

    Veloso, J S; Silva, W; Pinheiro, L R; Dos Santos, J B; Fonseca, N S; Euzebio, M P

    2015-01-01

    The aim of this study was to evaluate genetic divergence in the 'Carioca' (beige with brown stripes) common bean cultivar used by different institutions and in 16 other common bean cultivars used in the Rede Cooperativa de Pesquisa de Feijão (Cooperative Network of Common Bean Research), by using simple sequence repeats associated with agronomic traits that are highly distributed in the common bean genome. We evaluated 22 polymorphic loci using bulks containing DNA from 30 plants. There was genetic divergence among the Carioca cultivar provided by the institutions. Nevertheless, there was lower divergence among them than among the other cultivars. The cultivar used by Instituto Agronômico do Paraná was the most divergent in relation to the Carioca samples. The least divergence was observed among the samples used by Universidade Federal de Lavras and by Embrapa Arroz e Feijão. Of all the cultivars, 'CNFP 10104' and 'BRSMG Realce' showed the greatest dissimilarity. The cultivars were separated in two groups of greatest similarity using the Structure software. Genetic variation among cultivars was greater than the variation within or between the groups formed. This fact, together with the high estimate of heterozygosity observed and the genetic divergence of the samples of the Carioca cultivar in relation to the original provided by Instituto Agronômico de Campinas, indicates a mixture of cultivars. The high divergence among cultivars provides potential for the utilization of this genetic variability in plant breeding. PMID:26400359

  3. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... beans (15 oz.) ½ medium onion 2 garlic cloves 2 tablespoons vegetable oil ½ teaspoon cumin (ground) ½ teaspoon salt ¼ ... pieces. Set the onions aside. Peel the garlic cloves and mince ... heat your cooking oil over medium high heat. Add the onions and ...

  4. Castor bean response to zinc fertilization

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Henrique Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Zinc is a trace element and it is absolutely essential for the normal healthy growth of plants. This element plays a part of several enzyme systems and other metabolic functions in the plants. Castor beans (Ricinus communis L.) crop is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor beans yield, few researches has been made on this issue, mainly on the use of zinc. In order to evaluate the effects of zinc on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Zn (0; 2; 4; 6 and 8 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Under conditions that the experiment was carried out the results showed that the Zn levels used, did not affect the castor bean plants growth. (author)

  5. Common bean and cowpea improvement in Angola

    Science.gov (United States)

    During 2014 and 2015, the Instituto de Investigação Agronómica (IIA) evaluated the performance of common bean (Phaselolus vulgaris L.) breeding lines and improved cowpea (Vigna unguiculata L. Walp.) varieties. The field experiments were planted in the lowlands at Mazozo and in the highlands at Chian...

  6. Seed coat darkening in Cowpea bean

    Science.gov (United States)

    Seed coat of cowpea bean (Vigna unguiculata L. Walp) slowly browns to a darker color during storage. High temperature and humidity during storage might contribute to this color change. Variation in browning rate among seeds in a lot leads to a mixture of seed colors creating an unacceptable product...

  7. Registration of ‘Eldorado’ pinto bean

    Science.gov (United States)

    ‘Eldorado’ (Reg. No. CV-302, PI 665012) pinto bean (Phaseolus vulgaris L.), which was developed by Michigan State University AgBioResearch, was released in 2012 as an upright, full-season,disease-resistant cultivar. Eldorado, tested as MSU breeding line P07863, was developed using the single-seed-de...

  8. Isolates of Rhizoctonia solani can produce both web blight and root rot symptoms in common bean (Phaseolus vulgaris L.)

    Science.gov (United States)

    Rhizoctonia solani Kühn (Rs) is an important pathogen in the tropics, causing web blight (WB), and a widespread soil-borne root rot (RR) pathogen of common bean (Phaseolus vulgaris L.) worldwide. This pathogen is a species complex classified into 14 anastomosis groups (AG). Some AGs have been report...

  9. Characterization of a panel of tepary bean (Phaseolus acutifolius) and its application to theimprovement of this orphan crop

    Science.gov (United States)

    High ambient temperature and drought stress as a result of climate change are increasingly critical factors affecting agriculture and specifically grain legume production. Tepary (Phaseolusacutifolius A. Gray), a drought and heat tolerant sister species of common bean (P. vulgaris L.), has long been...

  10. Competitivity of the common-bean plant relative to the weed alexandergrass [Brachiaria plantaginea (link) hitch.

    OpenAIRE

    Passini Telma; Christoffoleti Pedro Jacob; Yada Inês Fumiko Ubukata

    2003-01-01

    Methodologies of competitive interaction quantification between weeds and crops are not widely elucidated and compared in the literature. The competitive ability of common-bean (Phaseolus vulgaris) relative to alexandergrass (Brachiaria plantaginea) was assessed and two approaches of replacement series experiment analysis were compared. The response of the species to the presence of each other at different densities and proportion was evaluated. Replacement series at total densities of 625, 8...

  11. Site-specific distribution and competitive ability of indigenous bean-nodulating rhizobia isolated from organic fields in Minnesota.

    Science.gov (United States)

    Wongphatcharachai, Manoosak; Wang, Ping; Staley, Christopher; Chun, Chan Lan; Ferguson, John A; Moncada, Kristine M; Sheaffer, Craig C; Sadowsky, Michael J

    2015-11-20

    Organic dry bean production systems have received increasing interest in many regions of the US, including Minnesota. Thus, improving biological N2 fixation would be highly beneficial for organic crop production. To date, only limited work has been done to select efficient N2-fixing rhizobia for organic dry bean production. In this study, soil samples from 25 organic fields in Minnesota, with a previous cropping history of dry beans, soybeans or both, were collected during May to July 2012. Genetic diversity of indigenous dry bean-rhizobia (511 isolates) was determined by using horizontal, fluorophore-enhanced, repetitive, extragenic, and palindromic-PCR (HFERP) DNA fingerprinting and isolates were classified as belonging to 58 different genotypes. The more abundant rhizobia isolated from bean nodules comprised 35.6% of the population. None of the isolates were identical to commonly-used commercial strains used in the U.S., including Rhizobium tropici CIAT899. Seventeen predominant genotypes were shown to represent two main species, Rhizobium leguminosarum bv. phaseoli (67.1%) and Rhizobium etli (30.2%). One of the indigenous strains, orgK9, displayed efficient N2-fixation and competitive ability relative to the commercial strains tested. The lack of large numbers of indigenous dry bean-rhizobia at most study sites will be useful to avoid competition problems between inoculant strains and indigenous rhizobia. This will allow inoculation with highly effective N2-fixing rhizobia, thus resulting in improved crop productivity. Our results highlight the existence of site-specific rhizobial genotypes in different organic fields and identify strains that may prove useful as novel inoculants for organic dry bean production systems. PMID:26403588

  12. Construction of a comparative genetic map in faba bean (Vicia faba L.; conservation of genome structure with Lens culinaris

    Directory of Open Access Journals (Sweden)

    Avila Carmen M

    2008-08-01

    Full Text Available Abstract Background The development of genetic markers is complex and costly in species with little pre-existing genomic information. Faba bean possesses one of the largest and least studied genomes among cultivated crop plants and no gene-based genetic maps exist. Gene-based orthologous markers allow chromosomal regions and levels of synteny to be characterised between species, reveal phylogenetic relationships and chromosomal evolution, and enable targeted identification of markers for crop breeding. In this study orthologous codominant cross-species markers have been deployed to produce the first exclusively gene-based genetic linkage map of faba bean (Vicia faba, using an F6 population developed from a cross between the lines Vf6 (equina type and Vf27 (paucijuga type. Results Of 796 intron-targeted amplified polymorphic (ITAP markers screened, 151 markers could be used to construct a comparative genetic map. Linkage analysis revealed seven major and five small linkage groups (LGs, one pair and 12 unlinked markers. Each LG was comprised of three to 30 markers and varied in length from 23.6 cM to 324.8 cM. The map spanned a total length of 1685.8 cM. A simple and direct macrosyntenic relationship between faba bean and Medicago truncatula was evident, while faba bean and lentil shared a common rearrangement relative to M. truncatula. One hundred and four of the 127 mapped markers in the 12 LGs, which were previously assigned to M. truncatula genetic and physical maps, were found in regions syntenic between the faba bean and M. truncatula genomes. However chromosomal rearrangements were observed that could explain the difference in chromosome numbers between these three legume species. These rearrangements suggested high conservation of M. truncatula chromosomes 1, 5 and 8; moderate conservation of chromosomes 2, 3, 4 and 7 and no conservation with M. truncatula chromosome 6. Multiple PCR amplicons and comparative mapping were suggestive of

  13. Research progress on PGPR/AMF interactions%PGPR与AMF相互关系的研究进展

    Institute of Scientific and Technical Information of China (English)

    龙伟文; 王平; 冯新梅; 胡正嘉; 李阜棣

    2000-01-01

    深入研究和揭示植物促生根圈细菌(PGPR)与丛枝状菌根真菌(AMF)在植物根圈内的相互关系,对于进一步利用和调控根圈微生物的相互作用,促进和保护植物生长,具有深远的意义.大量研究结果表明,PGPR与AMF之间表现出互利作用.AMF对PGPR在根部散布过程中可起转移和媒介的作用;PGPR也能为AMF在根部的感染创造有利条件.而且它们可通过各自对植物生长的促进作用以间接提高对方在根圈的定殖或感染能力.它们之间又存在着对营养及生态位的竞争,并可能产生一些次生代谢产物,从而给对方造成不利影响,但它们这种互利或竞争的相互作用存在着明显的种间特异性.迄今为止,国内外对于它们相互关系的研究虽然面广,但在很多方面尚不系统,也不深入.但可以相信,随着分子生物学技术的发展和先进检测手段的不断应用,对于它们的研究和认识必将出现新的突破.

  14. Early interspecific interference in the wheat/faba bean (Triticum aestivum/ Vicia faba ssp. minor and rapeseed/squarrosum clover (Brassica napus var. oleifera/Trifolium squarrosum intercrops

    Directory of Open Access Journals (Sweden)

    Paolo Benincasa

    2012-04-01

    Full Text Available Most of research on intercrops evaluate performances and interference between species on the basis of final yield, while little knowledge is available on the interference in early stages and at the root level, at least for cultivated intercrops. In fact, in the few studies on this subject species are often combined minding at experimental needs (e.g. common substrate, temperature and water requirements, easy root separation more than at their actual use in the farm. The present work evaluates interspecific interference during early developmental stages for two intercrops of agricultural interest: soft wheat-faba bean and rapeseed-squarrosum clover. Improving this knowledge would help intercrop growth modelling and rational cultivation. The experiments were carried out on soft wheat (Triticum aestivum, faba bean (Vicia faba var. minor, rapeseed (Brassica napus var. oleifera and squarrosum clover (Trifolium squarrosum, germinated and grown until 32 days after sowing (DAS as one-species stands or as wheat/faba bean and rapeseed/squarrosum clover intercrops, with different densities and proportions for the two species in each couple. Germination was studied in controlled-temperature chamber, plantlet growth was studied on pots in the greenhouse. During germination no interspecific interference was observed for both wheat/faba bean and rapeseed/squarrosum clover intercrops. During plantlet growth, interspecific interference occurred in both intercrops causing variations in whole plant and root dry matter accumulation. In the wheat/faba bean intercrop each species suffered from the competitive effect of the companion species and faba bean was the dominant species when present in lower proportion than wheat. The unexpectedly high aggressivity of faba bean may be explained either with the greater seed size that could have represented an initial advantage within the short duration of the experiment or with the competition towards wheat for substrate N

  15. Arbuscular mycorrhizae of dominant plant species in Yungas forests, Argentina.

    Science.gov (United States)

    Becerra, Alejandra G; Cabello, Marta; Zak, Marcelo R; Bartoloni, Norberto

    2009-01-01

    In Argentina the Yungas forests are among the ecosystems most affected by human activity, with loss of biodiversity. To assess the arbuscular mycorrhizal (AM) colonization and the arbuscular mycorrhizal fungi (AMF) spore numbers in these ecosystems, the roots of the most dominant native plants (one tree, Alnus acuminata; three herbaceous, Duchesnea indica, Oxalis conorrhiza, Trifolium aff. repens; and one shrub, Sambucus peruviana) were studied throughout the year from two sites of Yungas forests. Assessments of mycorrhizal colonization (percent root length, intraradical structures) were made by washing and staining the roots. Soil samples of each plant species were pooled and subsamples were obtained to determine AM spore numbers. The herbaceous species formed both Arum- and Paris-type morphologies, whereas the tree and the shrub species formed respectively single structural types of Arum- and Paris-type. AM colonization, intraradical fungi structures and AMF spore numbers displayed variation in species, seasons and sites. D. indica showed the highest AM colonization, whereas the highest spore numbers was observed in the rhizosphere of A. acuminata. No correlation was observed between spore numbers and root length percentage colonized by AM fungi. Results of this study showed that Alnus acuminata is facultatively AM. The AM colonization, intraradical fungi structures and AMF spore numbers varied in species depending on phenological, climatic and edaphic conditions. PMID:19750940

  16. Effects of Atmospheric-Pressure N2, He, Air, and O2 Microplasmas on Mung Bean Seed Germination and Seedling Growth

    Science.gov (United States)

    Zhou, Renwu; Zhou, Rusen; Zhang, Xianhui; Zhuang, Jinxing; Yang, Size; Bazaka, Kateryna; (Ken) Ostrikov, Kostya

    2016-01-01

    Atmospheric-pressure N2, He, air, and O2 microplasma arrays have been used to investigate the effects of plasma treatment on seed germination and seedling growth of mung bean in aqueous solution. Seed germination and growth of mung bean were found to strongly depend on the feed gases used to generate plasma and plasma treatment time. Compared to the treatment with atmospheric-pressure O2, N2 and He microplasma arrays, treatment with air microplasma arrays was shown to be more efficient in improving both the seed germination rate and seedling growth, the effect attributed to solution acidification and interactions with plasma-generated reactive oxygen and nitrogen species. Acidic environment caused by air discharge in water may promote leathering of seed chaps, thus enhancing the germination rate of mung bean, and stimulating the growth of hypocotyl and radicle. The interactions between plasma-generated reactive species, such as hydrogen peroxide (H2O2) and nitrogen compounds, and seeds led to a significant acceleration of seed germination and an increase in seedling length of mung bean. Electrolyte leakage rate of mung bean seeds soaked in solution activated using air microplasma was the lowest, while the catalase activity of thus-treated mung bean seeds was the highest compared to other types of microplasma. PMID:27584560

  17. Effects of Atmospheric-Pressure N2, He, Air, and O2 Microplasmas on Mung Bean Seed Germination and Seedling Growth.

    Science.gov (United States)

    Zhou, Renwu; Zhou, Rusen; Zhang, Xianhui; Zhuang, Jinxing; Yang, Size; Bazaka, Kateryna; Ken Ostrikov, Kostya

    2016-01-01

    Atmospheric-pressure N2, He, air, and O2 microplasma arrays have been used to investigate the effects of plasma treatment on seed germination and seedling growth of mung bean in aqueous solution. Seed germination and growth of mung bean were found to strongly depend on the feed gases used to generate plasma and plasma treatment time. Compared to the treatment with atmospheric-pressure O2, N2 and He microplasma arrays, treatment with air microplasma arrays was shown to be more efficient in improving both the seed germination rate and seedling growth, the effect attributed to solution acidification and interactions with plasma-generated reactive oxygen and nitrogen species. Acidic environment caused by air discharge in water may promote leathering of seed chaps, thus enhancing the germination rate of mung bean, and stimulating the growth of hypocotyl and radicle. The interactions between plasma-generated reactive species, such as hydrogen peroxide (H2O2) and nitrogen compounds, and seeds led to a significant acceleration of seed germination and an increase in seedling length of mung bean. Electrolyte leakage rate of mung bean seeds soaked in solution activated using air microplasma was the lowest, while the catalase activity of thus-treated mung bean seeds was the highest compared to other types of microplasma. PMID:27584560

  18. Host preference of the bean weevil Zabrotes subfasciatus

    Institute of Scientific and Technical Information of China (English)

    Isabel Ribeiro do Valle Teixeira; Angel Roberto Barchuk; Fernando Sérgio Zucoloto

    2008-01-01

    It is largely known that the range of an insect diet is mostly determined by oviposition behavior, mainly in species with endophytic larvae such as Zabrotes subfasciatus.However, the proximate factors determining host choice and the subsequent steps leading to the expansion or reduction of the host number and occasional host shifts are largelyun known. We analyzed various factors determining host preference of Z. subfasciatus through the evaluation of: (i) oviposition preference of a wild population of Z. subfasciatus on the usual host (bean) and unusual hosts (lentil, chickpea and soy), and the performance of the offspring; (ii) artificial selection for increasing preference for hosts initially less frequently chosen; (iii) comparison of oviposition behavior between two different popula-tions (reared for~30 generations in beans or chickpeas, respectively); (iv) oviposition timing on usual and unusual hosts; and (v) identification of preference hierarchies. We found that when using unusual hosts, there is no correlation between performance and preference and that the preference hierarchy changes only slightly when the population passes through several generations on the less frequently accepted host. We also found a positive response to artificial selection for increasing oviposition on the less preferred host; however, when the host-choice experiment involved two varieties of the usual host, the response was faster than when the choice involved usual and unusual hosts. Finally, beetles reared on an unusual host (chickpea) for 26 generations showed similar good fitness on both usual and unusual hosts,indicating that the use of a new host does not necessarily result in the loss of performance on the original host. Nevertheless, this population showed lower fitness on the usual host than that of the original population, suggesting an underlying partial trade-off phenomenon which may contribute to a broadening of diet of this insect species.

  19. Zinc supplementation, production and quality of coffee beans

    Directory of Open Access Journals (Sweden)

    Herminia Emilia Prieto Martinez

    2013-04-01

    Full Text Available Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots and control without zinc supplementation (four plots. Plants were subjected to two treatments: zinc supplementation and control. Yield, number of defective beans, beans attacked by berry borers, bean size, cup quality, beans zinc concentration, potassium leaching, electrical conductivity, color index, total tritable acidity, pH, chlorogenic acids contents and ferric-reducing antioxidant activity of beans were evaluated. Zinc positively affected quality of coffee beans, which presented lower percentage of medium and small beans, lower berry borer incidence, lower potassium leaching and electrical conductivity, higher contents of zinc and chlorogenic acids and higher antioxidant activity in comparison with control beans.

  20. Selection of common bean (Phaseolus vulgaris L.) genotypes using a genotype plus genotype x environment interaction biplot.

    Science.gov (United States)

    Corrêa, A M; Teodoro, P E; Gonçalves, M C; Santos, A; Torres, F E

    2016-01-01

    Recently, the genotype plus genotype x environment interaction (GGE) biplot methodology has been used to investigate genotype x environment interactions in several crop species, but has not been applied to the common bean (Phaseolus vulgaris L.) crop in Brazil. The aim of this study was to identify common bean genotypes that exhibit high grain yield and stability in the State of Mato Grosso do Sul, Brazil. We conducted 12 trials from 2000 to 2006 in the municipalities of Aquidauana and Dourados, and evaluated 13 genotypes in a randomized block design with three replications. Grain yield data were subjected to individual and joint analyses of variance. After analyzing the GE interaction, the adaptability and phenotypic stability of the common bean genotypes were analyzed using GGE biplot methodology. The genotypes EMGOPA-201, Xamego, and Aporé are recommended for growing in Mato Grosso do Sul, because they exhibited high grain yield and phenotypic stability. PMID:27525915

  1. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    International Nuclear Information System (INIS)

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 μW cm-2; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H2O2) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at ≥2 h), and radicle and plumule growths (≥1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H2O2 accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  2. Bean Common Mosaic Virus and Bean Common Mosaic Necrosis Virus: Relationships, Biology, and Prospects for Control.

    Science.gov (United States)

    Worrall, Elizabeth A; Wamonje, Francis O; Mukeshimana, Gerardine; Harvey, Jagger J W; Carr, John P; Mitter, Neena

    2015-01-01

    The closely related potyviruses Bean common mosaic virus (BCMV) and Bean common mosaic necrosis virus (BCMNV) are major constraints on common bean (Phaseolus vulgaris) production. Crop losses caused by BCMV and BCMNV impact severely not only on commercial scale cultivation of this high-value crop but also on production by smallholder farmers in the developing world, where bean serves as a key source of dietary protein and mineral nutrition. In many parts of the world, progress has been made in combating BCMV through breeding bean varieties possessing the I gene, a dominant gene conferring resistance to most BCMV strains. However, in Africa, and in particular in Central and East Africa, BCMNV is endemic and this presents a serious problem for deployment of the I gene because this virus triggers systemic necrosis (black root disease) in plants possessing this resistance gene. Information on these two important viruses is scattered throughout the literature from 1917 onward, and although reviews on resistance to BCMV and BCMNV exist, there is currently no comprehensive review on the biology and taxonomy of BCMV and BCMNV. In this chapter, we discuss the current state of our knowledge of these two potyviruses including fundamental aspects of classification and phylogeny, molecular biology, host interactions, transmission through seed and by aphid vectors, geographic distribution, as well as current and future prospects for the control of these important viruses. PMID:26111585

  3. Safety assessment of the biogenic amines in fermented soya beans and fermented bean curd.

    Science.gov (United States)

    Yang, Juan; Ding, Xiaowen; Qin, Yingrui; Zeng, Yitao

    2014-08-01

    To evaluate the safety of biogenic amines, high performance liquid chromatography (HPLC) was used to evaluate the levels of biogenic amines in fermented soya beans and fermented bean curd. In fermented soya beans, the total biogenic amines content was in a relatively safe range in many samples, although the concentration of histamine, tyramine, and β-phenethylamine was high enough in some samples to cause a possible safety threat, and 8 of the 30 samples were deemed unsafe. In fermented bean curd, the total biogenic amines content was more than 900 mg/kg in 19 white sufu amples, a level that has been determined to pose a safety hazard; putrescine was the only one detected in all samples and also had the highest concentration, which made samples a safety hazard; the content of tryptamine, β-phenethylamine, tyramine, and histamine had reached the level of threat to human health in some white and green sufu samples, and that may imply another potential safety risk; and 25 of the 33 samples were unsafe. In conclusion, the content of biogenic amines in all fermented soya bean products should be studied and appropriate limits determined to ensure the safety of eating these foods. PMID:25029555

  4. Antioxidant activity of black bean (Phaseolus vulgaris L. protein hydrolysates

    Directory of Open Access Journals (Sweden)

    Jarine Amaral do EVANGELHO

    2016-01-01

    Full Text Available Abstract The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by electrophoresis and the antioxidant activity was evaluated by the capturing methods of free radicals ABTS●+ and DPPH. Electrophoretic results showed that the bands above 50 kDa disappeared, when the beans protein was subjected to hydrolysis with pepsin. The bean protein hydrolysate obtained by hydrolysis with alcalase enzyme, showed higher antioxidant activity for inhibition of the radical ABTS●+. However, the hydrolysates obtained by hydrolysis with pepsin had higher antioxidant activity for inhibition of the radical DPPH. The use of pepsin and alcalase enzymes, under the same reaction time, produced black bean protein hydrolysates with different molecular weight profiles and superior antioxidant activity than the native bean protein.

  5. Ion beam analysis of ground coffee and roasted coffee beans

    International Nuclear Information System (INIS)

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans

  6. Ion beam analysis of ground coffee and roasted coffee beans

    Energy Technology Data Exchange (ETDEWEB)

    Debastiani, R., E-mail: rafa_debas@yahoo.com.br; Santos, C.E.I. dos; Yoneama, M.L.; Amaral, L.; Dias, J.F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  7. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis Cultivars Differing in Chilling Tolerance under Cold Stress.

    Directory of Open Access Journals (Sweden)

    Huaqiang Tan

    Full Text Available Cowpea (V. unguiculata L. Walp. is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars-"Dubai bean" and "Ningjiang-3", which are tolerant and sensitive to chilling, respectively-were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18% had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic

  8. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis) Cultivars Differing in Chilling Tolerance under Cold Stress.

    Science.gov (United States)

    Tan, Huaqiang; Huang, Haitao; Tie, Manman; Tang, Yi; Lai, Yunsong; Li, Huanxiu

    2016-01-01

    Cowpea (V. unguiculata L. Walp.) is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars-"Dubai bean" and "Ningjiang-3", which are tolerant and sensitive to chilling, respectively-were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18%) had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs) in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic engineering, and

  9. Removal of antinutritional factors from bean (Phaseolus vulgaris L.) seeds

    OpenAIRE

    Bollini R.; Carnovale E.; Campion B.

    1999-01-01

    Phytohemagglutinin and the lectin-related proteins present in bean seeds are toxic to monogastric animals and lower the nutritional value of beans. Since these antimetabolites are present in substantial amounts, a breeding program aimed to the removal ofphytohemagglutinin was developed. The character ""absence of phytohemagglutinin"" was transferred into a bean cultivar by backcrossing. The lines obtained maintained the agronomic performance of the recurrent parent. Preliminary results show t...

  10. Biology of the Coconut Bug, Pseudotheraptus wayi, on French Beans

    OpenAIRE

    Egonyu, James Peter; Ekesi, Sunday; Kabaru, Jacques; Irungu, Lucy

    2014-01-01

    The coconut bug, Pseudotheraptus wayi Brown (Heteroptera: Coreidae), is a major pest of a wide range of economically important crops in Eastern and Southern Africa. The suitability of French beans, Phaseolus vulgaris L. (Fabales: Fabaceae) as an alternative food for mass rearing of P. wayi was determined by elucidating its development, survival, and reproduction on French bean pods in the laboratory. Development and survival of immatures on French beans was comparable to what is reported with...

  11. Castor Bean Organelle Genome Sequencing and Worldwide Genetic Diversity Analysis

    OpenAIRE

    Rivarola, Maximo; Foster, Jeffrey T.; Chan, Agnes P.; Williams, Amber L.; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M. J.; Khouri, Hoda M.; Beckstrom-Sternberg, Stephen M.; Allan, Gerard J; Keim, Paul; Ravel, Jacques

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and for...

  12. Intermittent drying of beans in a spouted bed

    OpenAIRE

    de Oliveira, C A; S.C.S. Rocha

    2007-01-01

    Carioca beans are a highly nutritious grain, in terms of the amount of protein, iron and potassium as well as carbohydrates and fiber and as a source of vitamins. The moisture content of recently picked beans is too high for good preservation and storage, resulting in the need for drying before packaging. In this work, the drying of Carioca beans in a laboratory scale spouted bed under intermittent conditions of the drying air was experimentally analyzed. Experiments carried out consisted of ...

  13. Effect of bean polyphenols on iron absorption in humans

    International Nuclear Information System (INIS)

    Iron deficiency and iron deficiency anaemia are major public health problems in many developing countries. Common beans are a staple food in various Eastern African countries. Beans contain high amounts of iron, but the iron is poorly absorbed due to the presence of the iron absorption inhibitors polyphenols and phytic acid. With the overall aim of increasing the intake of bioavailable iron from beans by plant breeding strategies, this study evaluates the importance bean polyphenols on iron absorption. In common beans the polyphenols are concentrated in the bean hulls. Therefore bean hulls were used as a source of natural bean polyphenols and added in three different amounts to a non-inhibitory test meal (phytic acid free bread rolls). Iron absorption from the test meals was measured in three groups of 16 apparently healthy female volunteers using stable iron isotope techniques. Each volunteer consumed a test meal with and a test meal without bean polyphenols extrinsically labeled with 57Fe and 58Fe respectively. Iron absorption was determined based on the incorporation of iron stable isotopes into red blood cells 14 days after administration. Isotopic analysis was performed by thermal ionization mass spectrometry. The results of the absorption studies showed a dose dependent negative effect of bean polyphenols on iron absorption in humans. At the lowest polyphenol content tested (20 mg per test meal) no impact on iron absorption was found (p 0.92). A polyphenol content of 50 mg reduced the mean iron absorption significantly from 20.3% to 17.3% (p 0.044). The highest polyphenol content of 200 mg significantly reduced the mean iron absorption from 14.3% to 7.9% (p 0.0001). Further studies are planned to evaluate the relative effect of polyphenols and phytic acid on iron absorption from beans to provide guidance for breeding beans with improved iron bioavailability. (author)

  14. Crushing of roasted arabica coffee beans

    Czech Academy of Sciences Publication Activity Database

    Nedomová, Š.; Trnka, Jan; Severa, L.; Stoklasová, Pavla; Buchar, J.

    Vol. 1. Nitra: Slovak University of Agriculture in Nitra, 2010 - (Vozárová, V.). s. 24-25 ISBN 978-80-552-0463-5. [International Conference on Food Physics ICFP 2010 /9./. 20.10.2010-21.10.2010, Nitra] R&D Projects: GA AV ČR(CZ) IAA201990701 Institutional research plan: CEZ:AV0Z20760514 Keywords : strain gauges * impactor * roasted beans Subject RIV: GM - Food Processing

  15. Presence of aspergillus and other fungal symbionts in coffee beans from Colombia

    International Nuclear Information System (INIS)

    Fungi are common inhabitants of plants and plant derived products. Some of these fungal species are potentially dangerous to human health since they are able to produce chemical substances that alter normal physiological activity. There are no studies about natural mycoflora associated with coffee beans in Colombia, and nothing is known about the presence and abundance of toxigenic fungal species in Colombian coffee. in this study 5,000 coffee beans were studied by plating them on potato based artificial culture medium and it was shown that potentially toxigenic fungal taxa (mostly from genera aspergillus, fusarium, penicillium), are currently found in Colombian coffee beans. This is true for all steps of coffee processing, from berries in trees to toasted grains, including packed coffee ready for retail in supermarkets. results show that the distribution of these fungi is not random among different steps of coffee processing, which means that some steps are more vulnerable to infection with some fungi that others. The convenience of establishing a program devoted to detect fungi and/or mycotoxins in colombian commodities, specially coffee, is discussed here.

  16. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  17. The Effective Design of Bean Bag as a Vibroimpact Damper

    Directory of Open Access Journals (Sweden)

    A.Q. Liu

    2000-01-01

    Full Text Available The technique of a bean bag damper has been effectively applied in many engineering fields to control the vibroimpact of a structural system. In this study, the basic parameters responsible for the design of an effective bean bag: the size of beans, the mass ratio of the bean bag to the structure to which it is attached, the clearance distance and the position of the bag, are studied by both theoretical and experimental analyses. These will provide a better understanding of the performance of the bean bag for optimisation of damper design. It was found that reducing the size of beans would increase the exchange of momentum in the system due to the increase in the effective contact areas. Within the range of mass ratios studied, the damping performance of the damper was found to improve with higher mass ratios. There was an optimum clearance for any specific damper whereby the maximum attenuation could be achieved. The position of the bag with respect to nodes and antipodes of the primary structure determined the magnitude of attenuation attainable. Furthermore, the limitations of bean bags have been identified and a general criteria for the design of a bean bag damper has been formulated based on the study undertaken. It was shown that an appropriately configured bean bag damper was capable of reducing the amplitude of vibration by 80% to 90%.

  18. The Moche Lima beans recording system, revisited

    Directory of Open Access Journals (Sweden)

    Tomi S. Melka

    2010-08-01

    Full Text Available One matter that has raised sufficient uncertainties among scholarsin the study of the Old Moche culture is a system that comprises patterned Lima beans. The marked beans, plus various associated effigies, appear painted by and large with a mixture of realism and symbolism on the surface of ceramic bottles and jugs, with many of them showing an unparalleled artistry in the great area of the South American subcontinent. A range of accounts has been offered as to what the real meaning of these items is: starting from a recreationaland/or a gambling game, to a divination scheme, to amulets, to an application for determining the length and order of funerary rites, to a device close to an accountancy and data storage medium, ending up with an ‘ideographic’, or even a ‘pre-alphabetic’ system.The investigation brings together structural, iconographic and cultural aspects, and indicates that we might be dealing with an original form of mnemotechnology, contrived to solve the problems of medium and long-distance communication among the once thriving Moche principalities. Likewise, by reviewing the literature, by searching for new material, and exploring the structure and combinatory properties of the marked Lima beans, as well as by placing emphasis on joint scholarly efforts, may enhance the studies.

  19. Antinutritional factors in anasazi and other pinto beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Weder, J K; Telek, L; Vozári-Hampe, M; Saini, H S

    1997-01-01

    Antinutritional factors of anasazi bean were compared to traditional pinto bean (Phaseolus vulgaris L.). Anasazi beans contained less (p0.05) in stachyose and raffinose content were found between the two bean types; verbascose was not detected at all. Significant (plectin content were observed between anasazi and pinto bean. The lectins of anasazi beans were classified as non toxic and those of the pinto beans as toxic types. No differences (p>0.05) in inhibitor activity against human and bovine trypsin and chymotrypsin were found between the two bean types. PMID:9527344

  20. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    OpenAIRE

    Bambang Drajat; Adang Agustian; Ade Supriatna

    2007-01-01

    The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments r...

  1. Mejora del diseño de un servicio mediante la metodología AMFE : una aplicación en una empersa hotelera

    OpenAIRE

    García Cánovas, Jesús

    2015-01-01

    La realización del proyecto ha permitido implementar una de las diversas herramientas de control de la calidad sobre un producto o servicio, denominada AMFE, al ser una herramienta sencilla de aplicar con coste cero, requirió de dedicación, comunicación de todo el personal implicado e interés para que los resultados finales resultaran satisfactorios. Se ha utilizado una hoja de registro, en la cual se buscó recoger todos los posibles modos de fallo del servicio de habitaciones ...

  2. Effects of the arbuscular mycorrhizal fungus Glomus mosseae on growth and metal uptake by four plant species in copper mine tailings

    International Nuclear Information System (INIS)

    A greenhouse experiment was conducted to evaluate the potential role of arbuscular mycorrhizal fungi (AMF) in encouraging revegetation of copper (Cu) mine tailings. Two native plant species, Coreopsis drummondii and Pteris vittata, together with a turf grass, Lolium perenne and a leguminous plant Trifolium repens associated with and without AMF Glomus mosseae were grown in Cu mine tailings to assess mycorrhizal effects on plant growth, mineral nutrition and metal uptake. Results indicated that symbiotic associations were successfully established between G. mosseae and all plants tested, and mycorrhizal colonization markedly increased plant dry matter yield except for L. perenne. The beneficial impacts of mycorrhizal colonization on plant growth could be largely explained by both improved P nutrition and decreased shoot Cu, As and Cd concentrations. The experiment provided evidence for the potential use of local plant species in combination with AMF for ecological restoration of metalliferous mine tailings. - This study demonstrated that AM associations can encourage plant survival in Cu mine tailings

  3. Effects of the arbuscular mycorrhizal fungus Glomus mosseae on growth and metal uptake by four plant species in copper mine tailings

    Energy Technology Data Exchange (ETDEWEB)

    Chen, B.D. [Department of Soil Environmental Science, Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China)]. E-mail: bdchen@rcees.ac.cn; Zhu, Y.-G. [Department of Soil Environmental Science, Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China); Duan, J. [Department of Soil Environmental Science, Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China); Xiao, X.Y. [Department of Soil Environmental Science, Research Center for Eco-environmental Sciences, Chinese Academy of Sciences, Beijing, 100085 (China); Smith, S.E. [Centre for Soil-Plant Interactions, School of Earth and Environmental Sciences, Waite Campus, University of Adelaide, South Australia 5005 (Australia)

    2007-05-15

    A greenhouse experiment was conducted to evaluate the potential role of arbuscular mycorrhizal fungi (AMF) in encouraging revegetation of copper (Cu) mine tailings. Two native plant species, Coreopsis drummondii and Pteris vittata, together with a turf grass, Lolium perenne and a leguminous plant Trifolium repens associated with and without AMF Glomus mosseae were grown in Cu mine tailings to assess mycorrhizal effects on plant growth, mineral nutrition and metal uptake. Results indicated that symbiotic associations were successfully established between G. mosseae and all plants tested, and mycorrhizal colonization markedly increased plant dry matter yield except for L. perenne. The beneficial impacts of mycorrhizal colonization on plant growth could be largely explained by both improved P nutrition and decreased shoot Cu, As and Cd concentrations. The experiment provided evidence for the potential use of local plant species in combination with AMF for ecological restoration of metalliferous mine tailings. - This study demonstrated that AM associations can encourage plant survival in Cu mine tailings.

  4. Induced mutation for accelerated domestication: a case study of winged bean (Psophocarpus tetragonolobus (L.) (DC)

    International Nuclear Information System (INIS)

    Induced mutations have the ability to increase the rate of domestication of the many under exploited species of plants that may be potentially useful as source of food, forage and industrial raw materials. The process of domestication has been conditioned by single or major gene mutations. The role of mutagenesis in speeding up domestication, which is species dependent, is outlined in this paper. A case study of the role of induced mutations in the domestication of winged bean (Psophocarpus tetragonobolus) is also presented (au)

  5. Chemical control of wild sorghum (sorghum arundinaceum Del. Stapf. in faba bean (vicia faba L.) in the Northern State of Sudan

    International Nuclear Information System (INIS)

    An experiment was conducted at Merowe Research Station farm, in the Northern State, Sudan, during 2008/2009 and 2009/2010 seasons. The objectives of the experiment were to determine the damage inflicted by a wild sorghum species (Sorghum arundinaceum (Del.) Stapf. ) on the yield of faba bean (Vicia faba L.) and to evaluate the efficacy of the post-emergence herbicide clodinafop-propargyl (Topik) on wild sorghum and its effect on faba bean yield. The wild sorghum reduced faba bean crop stand and straw and seed yields by 53% - 76%, 76% - 79% and 88% - 91%, respectively, compared with the hand-weeded control. Faba bean was tolerant to the herbicide. The herbicide, at all rates, effected complete (100%) and persistent control of the wild sorghum and resulted in faba bean seed yield comparable to the hand-weeded control. The lowest dose (0.075 kg a.i/ha) of the herbicide used was equal to 75% of the dose recommended for the control of wild sorghum in wheat. It is concluded that clodinafop-propargyl at 0.075 kg a.e/ha could be used in controlling wild sorghum in faba bean. At this rate, the marginal rate of return was about 35 which indicating that every monetary unit (SDG 1) invested in the mentioned treatment would be returned back, plus additional amount of 35 SDG.(Author)

  6. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    OpenAIRE

    Władysław Błaszczak; Grażyna Ellmann-Wąsik; Renata Lesiak-Jerzyk

    2013-01-01

    Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV) notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV) differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV) when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing prim...

  7. Sensitivity study of SO{sub 2} AMF and a special case study about SO{sub 2} emissions from Norilsk Smelter

    Energy Technology Data Exchange (ETDEWEB)

    Khokar, Mohammad Fahim [Institute for Environmental physics, Heidelberg (Germany)]|[Service d' Aeronomie, Universite Pierre and Marie Curie, Paris (France); Platt, Ulrich [Institute for Environmental Physics, Heidelberg (Germany); Granier, Claire; Law, Katey [Service d' Aeronomie, Universite Pierre and Marie Curie, Paris (France); Wagner, Thomas [Institute for Environmental physics, Heidelberg (Germany)]|[Max-Planck Institut for Chemistry, Mainz (Germany)

    2008-07-01

    Radiative transfer modelling is best tool to convert slant column densities into vertically integrated columns. In this Study, TRACY II model is used for SO{sub 2} AMF calculation for different scenarios. SO{sub 2} AMF exhibited high dependency towards surface albedo, SO{sub 2} vertical profile, SZA, wavelength, clouds and aerosol. Most of the non-ferrous metal ores contain sulfide and this is emitted as SO{sub 2} during the smelting process. Satellite observations of atmospheric sulfur dioxide (SO{sub 2}) emitted from heavy metal smelting industry in Siberia, Russia is presented. Global Ozone Monitoring Experiment (GOME) data for the years 1996 to 2002 is analyzed using a DOAS-based algorithm with the aim of retrieving SO{sub 2} column amounts. Besides, decreasing trends in the atmospheric SO{sub 2} observed by GOME, these point sources are still a dominant source of anthropogenic SO{sub 2} emissions in the region. Enhanced SO{sub 2} column amounts are clearly identified from GOME and SCIAMACHY observations over the Siberian region.

  8. IRON, ZINC, AND FERRITIN ACCUMULATION IN COMMON BEANS

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian; Sørensen, Kirsten; Jurkiewicz, Anna Malgorzata;

    common beans. We used micro-PIXE (Particle Induced X-ray Emission) and proton backscattering analysis to localize and quantify zinc and iron in mature bean seeds. In addition the iron distribution in different P. vulgaris genotypes was studied using Perl's Prussian blue staining. We show  that the...

  9. Incentives for cocoa bean production in Ghana: Does quality matter?

    NARCIS (Netherlands)

    Quarmine, W.; Haagsma, R.; Sakyi-Dawson, O.; Asante, F.; Huis, van A.; Obeng-Ofori, D.

    2012-01-01

    This paper investigates the institutional factors that constrain farmers’ incentives to enhance the quality of cocoa beans in Ghana. Data were collected at three levels of aggregation in the cocoa bean value chain: village, district, and national level. Multi-stage cluster sampling was employed to s

  10. Root rots of common and tepary beans in Puerto Rico

    Science.gov (United States)

    Root rots are a disease complex affecting common bean and can be severe in bean growing areas in the tropics and subtropics. The presence of several pathogens makes it difficult to breed for resistance because of the synergistic effect of the pathogens in the host and the interaction of soil factors...

  11. The composition of wax and oil in green coffee beans

    NARCIS (Netherlands)

    Folstar, P.

    1976-01-01

    Methods for the isolation of wax and oil from green coffee beans were studied and a method for the quantitative extraction of coffee oil from the beans was introduced. Coffee wax, coffee oil and wax-free coffee oil as well as the unsaponifiable matter prepared from each were fractionated by column c

  12. Diversity for cooking time in Andean dry beans

    Science.gov (United States)

    Dry beans (Phaseolus vulgaris L) are a nutrient dense, low cost food and therefore are an excellent value for consumers (Drewnowski and Rehm, 2013). In spite of this value, long cooking times limit bean consumption. This is true in developing countries where cooking fuel is sometimes scarce and in d...

  13. Occurrence of arbuscular mycorrhizal fungi in bromeliad species from the tropical Atlantic forest biome in Brazil.

    Science.gov (United States)

    Grippa, Carlos Roberto; Hoeltgebaum, Marcia Patricia; Stürmer, Sidney Luiz

    2007-05-01

    The mycorrhizal status of epiphytic, rupicolous, and terrestrial bromeliad species from the Brazilian Atlantic Rain Forest has been examined. Roots of 13 species of bromeliads were analyzed for the presence of mycorrhizal structures such as arbuscules, hyphae, and vesicles as well as other fungal structures. Rhizosphere soil was sampled to identify arbuscular mycorrhizal fungal (AMF) species associated only with terrestrial bromeliad species. Most specimens collected were epiphytic bromeliads in the genera Aechmea, Bilbergia, Nidularium, Tillandsia, and Vriesea. Differentiating structures of AMF were found in only three species of bromeliads. The pattern of mycorrhizal colonization was mainly internal, and external mycelium and arbuscules were observed only in the terrestrial Nidularium procerum. Root endophytes with dark brown septate mycelium, thin external hyphae, and Rhizoctonia-like sclerotia were also detected in some root segments. A total of ten spore morphotypes were recovered from the rhizosphere of N. procerum, with Acaulospora mellea, A. foveata, and Glomus sp. being the most common species recovered. Our study demonstrated that most of the epiphytic species are not associated with AMF. We attribute this mainly to the exposed bare root conditions found in epiphytic bromeliads. PMID:17151876

  14. Devising fertiliser recommendations for diverse cropping systems in a region: the case of low-input bean/maize intercropping in a tropical highland of Haïti

    OpenAIRE

    C. Clermont-Dauphin; Meynard, J; Cabidoche, Y.

    2003-01-01

    International audience Variability of the efficiency of N, P, K and Mg fertilisation on a low-input bean/maize intercrop (BMI) was analysed in an upland of Haïti using the combination of a simple equation predicting the fertiliser requirements and an agronomic diagnosis in farmers' fields. The study results in a classification of cropping systems according to factors limiting the fertiliser response of the intercrop species (mainly bean root necrosis and high soil K supply) and in fertilis...

  15. Occurrence and distribution of viruses infecting the bean in Serbia

    Directory of Open Access Journals (Sweden)

    Petrović Dragana

    2010-01-01

    Full Text Available This work describes the incidence and distribution of the most important bean viruses in Serbia: Bean common mosaic virus (BCMV, Bean common mosaic necrosis virus (BCMNV, Bean yellow mosaic virus (BYMV, Cucumber mosaic virus (CMV and Alfalfa mosaic virus (AMV. The viral isolates were characterized serologically and biologically. BCMV was found in the largest number of plants (30.53%, followed by BCMNV (2.67%, CMV (5.34%, and AMV (3.41%, since BYMV was not determined. Mixed viral infections were found in several samples. The RT-PCR method was used to prove that the tested isolates belong to the BCMV, family Potyviridae and strains Russian and NL-3 D. Results obtained in this work will enable further studies of the genetic variability of bean virus isolates from Serbia. .

  16. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis) Cultivars Differing in Chilling Tolerance under Cold Stress

    Science.gov (United States)

    Tan, Huaqiang; Huang, Haitao; Tie, Manman; Tang, Yi; Lai, Yunsong; Li, Huanxiu

    2016-01-01

    Cowpea (V. unguiculata L. Walp.) is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars—“Dubai bean” and “Ningjiang-3”, which are tolerant and sensitive to chilling, respectively—were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18%) had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs) in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic

  17. Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    Sukhjiwan Kaur

    2014-01-01

    Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.

  18. Isolation and characterization of culturable seed-associated bacterial endophytes from gnotobiotically grown Marama bean seedlings.

    Science.gov (United States)

    Chimwamurombe, Percy Maruwa; Grönemeyer, Jann Lasse; Reinhold-Hurek, Barbara

    2016-06-01

    Marama bean (Tylosema esculentum) is an indigenous non-nodulating legume to the arid agro-ecological parts of Southern Africa. It is a staple food for the Khoisan and Bantu people from these areas. It is intriguing how it is able to synthesize the high-protein content in the seeds since its natural habitat is nitrogen deficient. The aim of the study was to determine the presence of seed transmittable bacterial endophytes that may have growth promoting effects, which may be particularly important for the harsh conditions. Marama bean seeds were surface sterilized and gnotobiotically grown to 2 weeks old seedlings. From surface-sterilized shoots and roots, 123 distinct bacterial isolates were cultured using three media, and identified by BOX-PCR fingerprinting and sequence analyses of the 16S rRNA and nifH genes. Phylogenetic analyses of 73 putative endophytes assigned them to bacterial species from 14 genera including Proteobacteria (Rhizobium, Massilia, Kosakonia, Pseudorhodoferax, Caulobacter, Pantoea, Sphingomonas, Burkholderia, Methylobacterium), Firmicutes (Bacillus), Actinobacteria (Curtobacterium, Microbacterium) and Bacteroidetes (Mucilaginibacter, Chitinophaga). Screening for plant growth-promoting activities revealed that the isolates showed production of IAA, ACC deaminase, siderophores, endoglucanase, protease, AHLs and capacities to solubilize phosphate and fix nitrogen. This is the first report that marama bean seeds may harbor endophytes that can be cultivated from seedlings; in this community of bacteria, physiological characteristics that are potentially plant growth promoting are widespread. PMID:27118727

  19. Induction of ferritin synthesis by water deficit and iron excess in common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    DeLaat, Daiane Mariele; Colombo, Carlos Augusto; Chiorato, Alisson Fernando; Carbonell, Sergio Augusto Morais

    2014-03-01

    Ferritins are molecules for iron storage present in most living beings. In plants, ferritin is an essential iron homeostasis regulator and therefore plays a fundamental role in control of iron induced by oxidative stress or by excess of iron ions. Ferritin gene expression is modulated by various environmental factors, including the intensity of drought, cold, light and pathogenic attack. Common bean, one of the most important species in the Brazilian diet, is also affected by insufficiency or lack of water. Thus, the present study was conducted for the purpose of determining the levels of expression of ferritins transcripts in leaf tissues of three common bean cultivars (BAT 477, Carioca Comum and IAC-Diplomata) under osmotic shock caused by polyethylene glycol 6000 and by iron excess. The expression of three ferritins genes (PvFer1, PvFer2 and PvFer3), determined by quantitative PCR, indicated a difference in the expression kinetics among the cultivars. All the ferritin genes were actively transcribed under iron excess and water deficit conditions. The cultivars most responsive to treatments were BAT 477 and IAC-Diplomata. All the cultivars responded to treatments. Nevertheless, the ferritin genes were differentially regulated according to the cultivars. Analysis of variance indicated differences among cultivars in expression of the genes PvFer1 and PvFer3. Both genes were most responsive to treatments. This result suggests that ferritin genes may be functionally important in acclimatization of common bean under iron excess or water deficit conditions. PMID:24390245

  20. Antioxidant Activity of Phenolic Compounds from Fava Bean Sprouts.

    Science.gov (United States)

    Okumura, Koharu; Hosoya, Takahiro; Kawarazaki, Kai; Izawa, Norihiko; Kumazawa, Shigenori

    2016-06-01

    Fava beans are eaten all over the world and recently, marketing for their sprouts began in Japan. Fava bean sprouts contain more polyphenols and l-3,4-dihydroxyphenylalanine (l-DOPA) than the bean itself. Our antioxidant screening program has shown that fava bean sprouts also possess a higher antioxidant activity than other commercially available sprouts and mature beans. However, the individual constituents of fava bean sprouts are not entirely known. In the present study, we investigated the phenolic compounds of fava bean sprouts and their antioxidant activity. Air-dried fava bean sprouts were treated with 80% methanol and the extract was partitioned in water with chloroform and ethyl acetate. HPLC analysis had shown that the ethyl acetate-soluble parts contained phenolic compounds, separated by preparative HPLC to yield 5 compounds (1-5). Structural analysis using NMR and MS revealed that the compounds isolated were kaempferol glycosides. All isolated compounds had an α-rhamnose at the C-7 position with different sugars attached at the C-3 position. Compounds 1-5 had β-galactose, β-glucose, α-rhamnose, 6-acetyl-β-galactose and 6-acetyl-β-glucose, respectively, at the C-3 position. The amount of l-DOPA in fava bean sprouts was determined by the quantitative (1) H NMR technique. The l-DOPA content was 550.45 mg ± 11.34 /100 g of the raw sprouts. The antioxidant activities of compounds 2-5 and l-DOPA were evaluated using the 2,2-diphenyl-1-picrylhydrazyl scavenging assay. l-DOPA showed high antioxidant activity, but the isolated kaempferol glycosides showed weak activity. Therefore, it can be suggested that l-DOPA contributed to the antioxidant activity of fava bean sprouts. PMID:27155370

  1. Immunochromatographic purification of Bean Yellow Mosaic Virus.

    Science.gov (United States)

    Bujarski, J J; Wiatroszak, I

    1981-01-01

    The method of immunoadsorptional purification of Bean Yellow Mosaic Virus has been worked out. Immunosorbents were obtained by coupling the antibody (IgG) fraction isolated from anti-BYMV and anti-pea leaf protein antisera with CNBr-activated 1% agarose beads. Conditions for preparation of immunosorbents, for BYMV adsorption and elution as well as the method of plant protein separation from BYMV were pointed out. The purity of BYMV was checked by double immunodiffusion as well as by SDS-acrylamide gel electrophoresis. Also biological activity was determined. TMV was used as the model virus for further BYMV studies. PMID:7025790

  2. Fungal decontamination and enhancement of shelf life of edible split beans of wild legume Canavalia maritima by the electron beam irradiation

    International Nuclear Information System (INIS)

    Ripened split beans of the coastal sand dune wild legume Canavalia maritima serve as one of the traditional nutritional sources of the coastal dwellers in Southwest coast of India. Nine fungi were isolated from the unirradiated dry beans by plating on the potato dextrose agar medium. Toxigenic fungus Aspergillus niger showed the highest incidence (33–50%) followed by Aspergillus flavus (14–20%) and Penicillium chrysogenum (7–13%). Unirradiated dry beans and irradiated dry beans with electron beam doses 2.5, 5, 10 and 15 kGy were monitored for occurrence of fungal species and their incidence during 0, 3 and 6 months storage period under laboratory conditions. Irradiation resulted in dose-dependent decrease in fungal species (5–7, 4–6, 3–6 and 0 on irradiation at 0, 2.5, 5 and 10 or 15 kGy, respectively) as well as incidence (80–99, 19–46, 13–21 and 0%, respectively). Although aflatoxins (B1 and B2) were found below detectable level (1 and B2). • Irradiated split beans (10 kGy) showed improved shelf life up to six months without deterioration under normal laboratory conditions

  3. Effects of bioprocessed antinutritional factors on bean protein quality, with special emphasis on Phaseolus vulgaris L.

    NARCIS (Netherlands)

    Savelkoul, F.H.M.G.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional factors such as tannins, trypsin inhibitors and lectins respectively whic

  4. Proteomic analysis of common bean (Phaseolus vulgaris) by two-dimensional gel electrophoresis and mass spectrometry

    Science.gov (United States)

    The modern cultivated common bean (Phaseolus vulgaris) has evolved from wild common beans distributed in Central America, Mexico and the Andean region of South America. It has been reported that wild common bean accessions have higher levels of protein content than the domesticated dry bean cultiva...

  5. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L. Based on Transcriptome Data.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Rice bean (Vigna umbellata (Thunb. Ohwi & Ohashi is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length of 986 bp. Of these unigenes, 38,840 (33.2% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases. Furthermore, 30,170 (76.3% could be classified into gene ontology categories, 25,451 (64.4% into Swiss-Prot categories and 21,982 (55.6% into KOG database categories (E-value < 1.0E-5. A total of 9,301 (23.5% were mapped onto 118 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. A total of 3,011 genic SSRs were identified as potential molecular markers. AG/CT (30.3%, AAG/CTT (8.1% and AGAA/TTCT (20.0% are the three main repeat motifs. A total of 300 SSR loci were randomly selected for validation by using PCR amplification. Of these loci, 23 primer pairs were polymorphic among 32 rice bean accessions. A UPGMA dendrogram revealed three major clusters among 32 rice bean accessions. The large number of SSR-containing sequences and genic SSRs in this study will be valuable for the construction of high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  6. Effect of TiF4, ZrF4, HfF4 and AmF on erosion and erosion/abrasion of enamel and dentin in situ

    OpenAIRE

    Wiegand, Annette; Hiestand, Barbara; Sener, Beatrice; Magalhães, Ana C.; Roos, Malgorzata; Attin, Thomas

    2010-01-01

    OBJECTIVE: This in situ study aimed to analyse the impact of different tetrafluorides (TiF(4), ZrF(4) and HfF(4)) and AmF on erosion and erosion plus abrasion of enamel and dentin. DESIGN: Ten volunteers took part in this crossover and double-blind study performed in 8 phases of each 3 days. In each phase, 2 bovine enamel and 2 dentin specimens were fixed in intraoral appliances. One enamel and one dentin sample were pretreated once with TiF(4), ZrF(4), HfF(4) or AmF (all 0.5M F) for 60s, whi...

  7. Low-Income US Women Under-informed of the Specific Health Benefits of Consuming Beans

    OpenAIRE

    Winham, Donna M; Armstrong Florian, Traci L.; Thompson, Sharon V.

    2016-01-01

    Background Bean consumption can reduce chronic disease risk and improve nutrition status. Consumer knowledge of bean health benefits could lead to increased intakes. Low-income women have poorer health and nutrition, but their level of knowledge about bean health benefits is unknown. Beans are a familiar food of reasonable cost in most settings and are cultural staples for Hispanics and other ethnicities. Study objectives were to assess awareness of bean health benefits among low-income women...

  8. Fluorescence In Situ Hybridization (FISH)-Based Karyotyping Reveals Rapid Evolution of Centromeric and Subtelomeric Repeats in Common Bean (Phaseolus vulgaris) and Relatives.

    Science.gov (United States)

    Iwata-Otsubo, Aiko; Radke, Brittany; Findley, Seth; Abernathy, Brian; Vallejos, C Eduardo; Jackson, Scott A

    2016-01-01

    Fluorescence in situ hybridization (FISH)-based karyotyping is a powerful cytogenetics tool to study chromosome organization, behavior, and chromosome evolution. Here, we developed a FISH-based karyotyping system using a probe mixture comprised of centromeric and subtelomeric satellite repeats, 5S rDNA, and chromosome-specific BAC clones in common bean, which enables one to unambiguously distinguish all 11 chromosome pairs. Furthermore, we applied the karyotyping system to several wild relatives and landraces of common bean from two distinct gene pools, as well as other related Phaseolus species, to investigate repeat evolution in the genus Phaseolus Comparison of karyotype maps within common bean indicates that chromosomal distribution of the centromeric and subtelomeric satellite repeats is stable, whereas the copy number of the repeats was variable, indicating rapid amplification/reduction of the repeats in specific genomic regions. In Phaseolus species that diverged approximately 2-4 million yr ago, copy numbers of centromeric repeats were largely reduced or diverged, and chromosomal distributions have changed, suggesting rapid evolution of centromeric repeats. We also detected variation in the distribution pattern of subtelomeric repeats in Phaseolus species. The FISH-based karyotyping system revealed that satellite repeats are actively and rapidly evolving, forming genomic features unique to individual common bean accessions and Phaseolus species. PMID:26865698

  9. Fluorescence In Situ Hybridization (FISH-Based Karyotyping Reveals Rapid Evolution of Centromeric and Subtelomeric Repeats in Common Bean (Phaseolus vulgaris and Relatives

    Directory of Open Access Journals (Sweden)

    Aiko Iwata-Otsubo

    2016-04-01

    Full Text Available Fluorescence in situ hybridization (FISH-based karyotyping is a powerful cytogenetics tool to study chromosome organization, behavior, and chromosome evolution. Here, we developed a FISH-based karyotyping system using a probe mixture comprised of centromeric and subtelomeric satellite repeats, 5S rDNA, and chromosome-specific BAC clones in common bean, which enables one to unambiguously distinguish all 11 chromosome pairs. Furthermore, we applied the karyotyping system to several wild relatives and landraces of common bean from two distinct gene pools, as well as other related Phaseolus species, to investigate repeat evolution in the genus Phaseolus. Comparison of karyotype maps within common bean indicates that chromosomal distribution of the centromeric and subtelomeric satellite repeats is stable, whereas the copy number of the repeats was variable, indicating rapid amplification/reduction of the repeats in specific genomic regions. In Phaseolus species that diverged approximately 2–4 million yr ago, copy numbers of centromeric repeats were largely reduced or diverged, and chromosomal distributions have changed, suggesting rapid evolution of centromeric repeats. We also detected variation in the distribution pattern of subtelomeric repeats in Phaseolus species. The FISH-based karyotyping system revealed that satellite repeats are actively and rapidly evolving, forming genomic features unique to individual common bean accessions and Phaseolus species.

  10. Genetic architecture and evolution of the mating type locus in fusaria that cause soybean sudden death syndrome and bean root rot

    Science.gov (United States)

    Fusarium tucumaniae is the only known sexually reproducing species among the seven closely related fusaria that cause soybean sudden death syndrome (SDS) or bean root rot (BRR). Laboratory mating of F. tucumaniae required two mating-compatible strains, indicating that it is heterothallic. To assess ...

  11. Allelopathic effects of redroot pigweed (Amaranthus retroflexus L.) on germination & growth of cucumber, alfalfa, common bean and bread wheat

    OpenAIRE

    Hamideh BAKHSHAYESHAN-AGDAM; Seyed Yahya SALEHI-LISAR; Motafakkerazad, Rouhollah; Amirhosein TALEBPOUR; Nader FARSAD

    2015-01-01

    Allelopathy is one of the important interactions among plants. Weeds can reduce crops productions in farms by their allelopathic effects. Redroot pigweed (Amaranthus retroflexus L.) is the most common weed in Iran with well-known allelopathic potential. In the presented experiment, the allelopathic effects of redroot pigweed on germination and growth of four important crop species including cucumber (Cucumis sativus L.), alfalfa (Medicago sativa L.), common bean (Phaseulus vulgaris L.) and br...

  12. Removal of antinutritional factors from bean (Phaseolus vulgaris L. seeds

    Directory of Open Access Journals (Sweden)

    Bollini R.

    1999-01-01

    Full Text Available Phytohemagglutinin and the lectin-related proteins present in bean seeds are toxic to monogastric animals and lower the nutritional value of beans. Since these antimetabolites are present in substantial amounts, a breeding program aimed to the removal ofphytohemagglutinin was developed. The character ""absence of phytohemagglutinin"" was transferred into a bean cultivar by backcrossing. The lines obtained maintained the agronomic performance of the recurrent parent. Preliminary results show that removal of phytohemagglutinin results in a higher true protein digestibility. Further modification in the composition of the lectin-related protein family is now under way.

  13. The Paleobiolinguistics of the Common Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Cecil H. Brown

    2014-10-01

    Full Text Available Paleobiolinguistics is used to determine when and where the common bean (Phaseolus vulgaris L. developed significance for prehistoric groups of Native America. Dates and locations of proto-languages for which common bean terms reconstruct generally accord with crop-origin and dispersal information from plant genetics and archaeobotany. Paleobiolinguistic and other lines of evidence indicate that human interest in the common bean became significant primarily with the widespread development of a village‐farming way of life in the New World rather than earlier when squash and maize and a few other crops became important.

  14. Evidence of qualitative differences between soil-occupancy effects of invasive vs. native grassland plant species

    Science.gov (United States)

    Jordan, N.R.; Larson, D.L.; Huerd, S.C.

    2011-01-01

    Diversified grasslands that contain native plant species are being recognized as important elements of agricultural landscapes and for production of biofuel feedstocks as well as a variety of other ecosystem services. Unfortunately, establishment of such grasslands is often difficult, unpredictable, and highly vulnerable to interference and invasion by weeds. Evidence suggests that soil-microbial "legacies" of invasive perennial species can inhibit growth of native grassland species. However, previous assessments of legacy effects of soil occupancy by invasive species that invade grasslands have focused on single invasive species and on responses to invasive soil occupancy in only a few species. In this study, we tested the hypothesis that legacy effects of invasive species differ qualitatively from those of native grassland species. In a glasshouse, three invasive and three native grassland perennials and a native perennial mixture were grown separately through three cycles of growth and soil conditioning in soils with and without arbuscular mycorrhizal fungi (AMF), after which we assessed seedling growth in these soils. Native species differed categorically from invasives in their response to soil conditioning by native or invasive species, but these differences depended on the presence of AMF. When AMF were present, native species largely had facilitative effects on invasive species, relative to effects of invasives on other invasives. Invasive species did not facilitate native growth; neutral effects were predominant, but strong soil-mediated inhibitory effects on certain native species occurred. Our results support the hypothesis that successful plant invaders create biological legacies in soil that inhibit native growth, but suggest also this mechanism of invasion will have nuanced effects on community dynamics, as some natives may be unaffected by such legacies. Such native species may be valuable as nurse plants that provide cost-effective restoration of

  15. Heat-Induced Structural Changes in Faba Bean Starch Paste: The Effect of Steaming Faba Bean Seeds

    OpenAIRE

    Kaczynska, B.; Autio, K.; J. Fornal

    1993-01-01

    Heat-induced structural changes of faba bean starch dispersions were examined at a concentration range of 8-10% as a function of heat treatment. Faba bean starch was isolated from raw (RF-starch) and steamed (SF-starch) faba bean seeds. Hydrothermal treatment resulted in an increase in the amount of non-starch components in the isolated starch. Microstructure of low-sheared 8% starch suspensions heated at 75, 90 and 98°C (for 10 minutes) was studied by light microscopy. Heating induced huge s...

  16. In vivo mutagenicity studies in rats mice and Chinese hamsters fed irradiated foodstuffs - chicken, fish, dates, pulses, mangoes and cocoa beans

    International Nuclear Information System (INIS)

    Three in vivo genetic toxicity tests were performed in rats, mice and Chinese hamsters to detect possible mutagenic effects of irradiated chicken, dried dates, fish, cocoa beans, pulses and mangoes. The tests employed were the micronucleus test and sister-chromatid exchange (SCE) test for irradiated and unirradiated samples of all foodstuffs listed, and the spermatogonia test, (including SCE technique) in mice for irradiated and unirradiated chicken, fish and dates only. In the case of cocoa beans, the mutagenicity tests were performed on an additional test group fed beans fumigated with ethylene oxide. The different mammalian species used for the various experiments are given below. None of the tests provided any evidence of mutagenicity induced by irradiation in any of the foodstuffs studied. Moreover, these tests are currently considered to be the most sensitive in vivo mutagenicity tests in mammals. (orig.)

  17. Genome sequencing reveals a new lineage associated with lablab bean and genetic exchange between Xanthomonas axonopodis pv. phaseoli and Xanthomonas fuscans subsp. fuscans

    Directory of Open Access Journals (Sweden)

    Valente eAritua

    2015-10-01

    Full Text Available Common bacterial blight is a devastating seed-borne disease of common beans that also occurs on other legume species including lablab and Lima beans. We sequenced and analysed the genomes of 26 isolates of Xanthomonas axonopodis pv. phaseoli and X. fuscans subsp. fuscans, the causative agents of this disease, collected over four decades and six continents. This revealed considerable genetic variation within both taxa, encompassing both single-nucleotide variants and differences in gene content, that could be exploited for tracking pathogen spread. The bacterial isolate from Lima bean fell within the previously described Genetic Lineage 1, along with the pathovar type isolate (NCPPB 3035. The isolates from lablab represent a new, previously unknown genetic lineage closely related to strains of X. axonopodis pv. glycines. Finally, we identified more than 100 genes that appear to have been recently acquired by Xanthomonas axonopodis pv. phaseoli from X. fuscans subsp. fuscans.

  18. Linkage disequilibrium at the APA insecticidal seed protein locus of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Buendía Héctor F

    2010-04-01

    Full Text Available Abstract Background An interesting seed protein family with a role in preventing insect herbivory is the multi-gene, APA family encoding the α-amylase inhibitor, phytohemagglutinin and arcelin proteins of common bean (Phaseolus vulgaris. Variability for this gene family exists and has been exploited to breed for insect resistance. For example, the arcelin locus has been successfully transferred from wild to cultivated common bean genotypes to provide resistance against the bruchid species Zabrotes subfasciatus although the process has been hampered by a lack of genetic tools for and understanding about the locus. In this study, we analyzed linkage disequilibrium (LD between microsatellite markers at the APA locus and bruchid resistance in a germplasm survey of 105 resistant and susceptible genotypes and compared this with LD in other parts of the genome. Results Microsatellite allele diversity was found to vary with each of the eight APA-linked markers analyzed, and two markers within the APA locus were found to be diagnostic for bruchid resistance or susceptibility and for the different arcelin alleles inherited from the wild accessions. Arc1 was found to provide higher levels of resistance than Arc5 and the markers in the APA locus were highly associated with resistance showing that introgression of this gene-family from wild beans provides resistance in cultivated beans. LD around the APA locus was found to be intermediate compared to other regions of the genome and the highest LD was found within the APA locus itself for example between the markers PV-atct001 and PV-ag004. Conclusions We found the APA locus to be an important genetic determinant of bruchid resistance and also found that LD existed mostly within the APA locus but not beyond it. Moderate LD was also found for some other regions of the genome perhaps related to domestication genes. The LD pattern may reflect the introgression of arcelin from the wild into the cultivated

  19. Quinclorac-habituation of bean (Phaseolus vulgaris) cultured cells is related to an increase in their antioxidant capacity.

    Science.gov (United States)

    Largo-Gosens, Asier; de Castro, María; Alonso-Simón, Ana; García-Angulo, Penélope; Acebes, José L; Encina, Antonio; Álvarez, Jesús M

    2016-10-01

    The habituation of bean cells to quinclorac did not rely on cell wall modifications, contrary to what it was previously observed for the well-known cellulose biosynthesis inhibitors dichlobenil or isoxaben. The aim of the present study was to investigate whether or not the bean cells habituation to quinclorac is related to an enhancement of antioxidant activities involved in the scavenging capacity of reactive oxygen species. Treating non-habituated bean calluses with 10 μM quinclorac reduced the relative growth rate and induced a two-fold increase in lipid peroxidation. However, the exposition of quinclorac-habituated cells to a concentration of quinclorac up to 30 μM neither affected their growth rate nor increased their lipid peroxidation levels. Quinclorac-habituated calluses had significantly higher constitutive levels of three antioxidant activities (class-III peroxidase, glutathione reductase, and superoxide dismutase) than those observed in non-habituated calluses, and the treatment of habituated calluses with 30 μM quinclorac significantly increased the level of class III-peroxidase and superoxide dismutase. The results reported here indicate that the process of habituation to quinclorac in bean callus-cultured cells is related, at least partially, to the development of a stable antioxidant capacity that enables them to cope with the oxidative stress caused by quinclorac. Class-III peroxidase and superoxide dismutase activities could play a major role in the quinclorac-habituation. Changes in the antioxidant status of bean cells were stable, since the increase in the antioxidant activities were maintained in quinclorac-dehabituated cells. PMID:27318799

  20. Damage quantification and reaction of bean genotypes (Phaseolus vulgaris L. to Meloidogyne incognita race 3 and M. javanica

    Directory of Open Access Journals (Sweden)

    Leonardo Nazário Silva dos Santos

    2012-03-01

    Full Text Available The damage and the resistance levels of cultivars and accessions of common beans rescued in the South and mountain regions of Espírito Santo State, Brazil, to M. incognita race 3 and M. javanica parasitism were evaluated under a greenhouse. Four rescued bean genotypes ("FORT-10", "FORT-13", "FORT-16" and "FORT-19" and 2 commercial cultivars: "Pérola", and "Aporé", were tested. The cultivar "Rico-23" was included as standard of susceptibility to nematodes and non-inoculated plants constituted the control. Thus, the experiment was carried out in a completely randomized design in 3 (treatments considering nematodes x 7 (genotypes and bean cultivars factorial arrangement, with 7 replicates. Data were measured at 50 days after plant inoculation. For damage quantification, the following variables were evaluated: plant height (PHE, number of nodes (NNO, number of trifoliate leaves (NRT, fresh matter weight (FWE and dry matter weight (DWE of shoots, root weight (RWE, number of root nodules (NRO and final population (FPO of nematodes per root system. There were no significant differences between the effects caused by M. incognita and M. javanica, but both species showed inferior values of PHE, NNO, NRT, RWE, FWE and DWE compared to controls. Concerning the levels of resistance of bean plants to M. incognita, the genotypes "FORT-10", "FORT-13", "Aporé" and "FORT-16" behaved as moderately resistant, the cultivars "Rico 23" and "Pérola" low resistant, and the genotype "FORT-19" as highly susceptible. When parasitized by M. javanica, the beans "FORT-19", "Rico-23", "FORT-16" and "FORT-13" were low resistant, "Pérola" and "Aporé" susceptible and "FORT-10" highly susceptible.

  1. Carotenemia associated with green bean ingestion.

    Science.gov (United States)

    Sale, Tanya A; Stratman, Erik

    2004-01-01

    Carotenemia is a condition characterized by yellow discoloration of the skin and elevated blood carotene levels. Excessive and prolonged ingestion of carotene-rich, yellow- or orange-colored foods such as carrots and winter squash is the most common cause, but more rarely it may be associated with consumption of other foods as well as with hypothyroidism, diabetes mellitus, anorexia nervosa, liver disease, or kidney disease. Though not uncommon in children, there are few reports in the pediatric literature since its early descriptions in the late 1800s and early 1900s. Awareness of carotenemia can help the provider resolve confusion with jaundice and avoid unnecessary worry and costly tests. Herein we describe carotenemia in an 8-month-old Caucasian girl secondary to increased consumption of commercial infant food green beans. PMID:15575851

  2. Emulsification properties of soy bean protein

    Directory of Open Access Journals (Sweden)

    WENPU CHEN

    2014-12-01

    Full Text Available Chen W, Li X, Rahman MRT, Al-Hajj NQM, Dey KC, Raqib SM. 2014. Emulsification properties of soy bean protein. Nusantara Bioscience 6: 196-202. Emulsion stability and emulsifying ability are two important factors in food industry. Soy protein has the great of interest because of its amphilic structure. β-Conglycinnin and glycinin are main components in soy protein which can be used as emulsifiers in food processing. However, due to its size and molecular weight, the emulsifying ability of soy protein is limited. By chemical, physical and enzymatic modification, the emulsifying ability of soy protein can be improved. The addition of polysaccharides in emulsion is common. The interaction of polysaccharides and proteins are being discussed in this review. In some complex food emulsion, the function of soy protein molecules and emulsifier at the interface need to be investigated in the future study.

  3. Induced mutants in beans and peas resistant to rust

    International Nuclear Information System (INIS)

    Beans (Phaseolus vulgaris) and peas (Pisum sativum) are important leguminous vegetable crops in Egypt. The area planted with beans is about 40,000 acres and peas 22,000 acres. These crops suffer from several diseases, particularly rusts, (Uromyces phaseoli/Uromyces pisi), which are mainly spread in northern Egypt. In our mutation induction programme we used 60 Co gamma rays and ethyl methane sulphonate (EMS). Bean and pea seeds were soaked in water for two hours before exposure to 8, 10 and 12 krad. For chemical treatments, bean and pea seeds were soaked in water for eight hours and then treated with 0.5 and 1.5% EMS for four hours. The M1 was cultivated in 1978

  4. Simulated radiation disinfestation of infested cocoa beans in Ghana

    International Nuclear Information System (INIS)

    Four major insect pests persistently affect the cocoa industry in Ghana, the world's leading exporter of cocoa, despite the conventional methods of chemical control in practice. The Ghana Atomic Energy Commission currently is investigating the possible use of radiation for the control of both insect attack and microbial spoilage of cocoa beans in storage. Radiation response studies of the four major insect pests that significantly affect the quality of dried cocoa beans in storage have been evaluated. Results herein reported were based on simulated bulk infestation radiation disinfestation of dried cocoa under field and laboratory conditions at ambient temperature (25 to 320C). The comparative efficiency of locally available packaging materials best suited for bagging of the dried cocoa beans at and after irradiation have been assessed concurrently. The author concludes by identifying and discussing possible factors that could affect the technology of radiation disinfestation of cocoa beans under the Ghanaian context. (author)

  5. Intermittent drying of beans in a spouted bed

    Directory of Open Access Journals (Sweden)

    C. A. Oliveira

    2007-12-01

    Full Text Available Carioca beans are a highly nutritious grain, in terms of the amount of protein, iron and potassium as well as carbohydrates and fiber and as a source of vitamins. The moisture content of recently picked beans is too high for good preservation and storage, resulting in the need for drying before packaging. In this work, the drying of Carioca beans in a laboratory scale spouted bed under intermittent conditions of the drying air was experimentally analyzed. Experiments carried out consisted of two types of intermittent regime: intermittence in the spout regime, referred to as spouted/fixed bed and intermittence of the air supply to the bed, called spouted bed/rest. The results were compared to those for bean drying in a spouted bed dryer without intermittence.

  6. Effectiveness of rapid neutrons on small hoarse bean seed

    International Nuclear Information System (INIS)

    The small hoarse bean seeds were irradiated. The radiation doses 100-300 rads were used. The obtained mutants were applied in the breeding. The use of fast neutrons was successful and shortened the breeding cycle. (A.S.)

  7. Magnet systems for ''Bean-Shaped'' tokamak

    International Nuclear Information System (INIS)

    Bean-shaping of tokamak plasmas offers a method of reaching stable operation at (beta) > 10%. In order to establish the indentation of the ''bean'', a set of high- current ''pushing coils'' (> 5 MA in a reactor) must be located at the midplane as close as possible to the inboard edge of the plasma. If located in the bore of the TF coils, then maintenance of the pushing coils may be impossible, and the interlocking coils may prevent reactor modularity. If located outside, the required pushing-coil current may be unacceptably large. This dilemma is overcome with a unique TF coil design in which the inboard leg is bent outward in the form of an arc. The pushing coils are housed in the midplane indentation of this arc, just outside the TF coils but adequately close to the plasma. The arched coil transfers forces to the top and bottom legs, where it can be reacted by a clamp structure if necessary. This technique would allow demountable joints to be placed near the inoard leg (for copper TF coils). Another design approach to the pushing coils is to use liquid Li or Na as the conductor and coolant. The liquid metal ''coils'' can be placed immediately adjacent to the plasma, giving optimal control of the plasma shape with minimal coil current, although modularity of the reactor may have to be surrendered. Conceptual designs are presented of PF and TF coil systems for an ignition test reactor with about 14% and for a full-scale demonstration reactor with about 20%, both using copper TF coils

  8. Effects of extrusion cooking on the chemical composition and functional properties of dry common bean powders.

    Science.gov (United States)

    Ai, Yongfeng; Cichy, Karen A; Harte, Janice B; Kelly, James D; Ng, Perry K W

    2016-11-15

    The impact of extrusion cooking on the chemical composition and functional properties of bean powders from four common bean varieties was investigated. The raw bean powders were extruded under eight different conditions, and the extrudates were then dried and ground (particle size⩽0.5mm). Compared with corresponding non-extruded (raw) bean powders (particle size⩽0.5mm), the extrusion treatments did not substantially change the protein and starch contents of the bean powders and showed inconsistent effects on the sucrose, raffinose and stachyose contents. The extrusion cooking did cause complete starch gelatinization and protein denaturation of the bean powders and thus changed their pasting properties and solvent-retention capacities. The starch digestibilities of the cooked non-extruded and cooked extruded bean powders were comparable. The extruded bean powders displayed functional properties similar to those of two commercial bean powders. PMID:27283664

  9. Weed Control in White Bean with Various Halosulfuron Tankmixes

    OpenAIRE

    Nader Soltani; Robert E. Nurse; Christy Shropshire; Peter H. Sikkema

    2014-01-01

    Four field trials were conducted over a three-year period (2011–2013) in southwestern Ontario to evaluate the level of weed control provided by various halosulfuron tankmixes applied preplant incorporated (PPI) in white bean. Trifluralin, s-metolachlor, halosulfuron, and imazethapyr applied alone or in combination caused 4% or less visible injury 1 and 4 weeks after emergence (WAE) in white bean. Trifluralin, s-metolachlor, halosulfuron, and imazethapyr applied PPI provided 80–96%, 84–95%, 83...

  10. Zinc supplementation, production and quality of coffee beans

    OpenAIRE

    Herminia Emilia Prieto Martinez; Yonara Poltronieri; Adriana Farah; Daniel Perrone

    2013-01-01

    Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots) and control without zinc supplementation (four plots). Pla...

  11. Antioxidant activity of black bean (Phaseolus vulgaris L.) protein hydrolysates

    OpenAIRE

    Jarine Amaral do EVANGELHO; Jose de J. BERRIOS; Vânia Zanella PINTO; Mariana Dias ANTUNES; Nathan Levien VANIER; Elessandra da Rosa ZAVAREZE

    2016-01-01

    Abstract The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by electrophoresis and the antioxidant activity was evaluated by the capturing methods of free radicals ABTS●+ and DPPH. Electrophoretic results showed that the bands above 50 kDa disappeared,...

  12. Watershed responses to Amazon soya bean cropland expansion and intensification

    OpenAIRE

    Neill, Christopher; Coe, Michael T.; Riskin, Shelby H.; Krusche, Alex V.; Elsenbeer, Helmut; Macedo, Marcia N.; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A.; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A.

    2013-01-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compar...

  13. The polyphenolic profiles of common bean (Phaseolus vulgaris L.)

    OpenAIRE

    Lin, Long-Ze; HARNLY, JAMES M.; Pastor-Corrales, Marcial S.; Luthria, Devanand L.

    2008-01-01

    Based on the phenolic profiles obtained by high performance liquid chromatography-electrospray ionization mass spectrometry (HPLC-DAD-ESI/MS), 24 common bean samples, representing 17 varieties and 7 generic off-the-shelf items, belonging to ten US commercial market classes can be organized into six different groups. All of them contained the same hydroxycinnaminic acids, but the flavonoid components showed distinct differences. Black beans contained primarily the 3-O-glucosides of delphinidin...

  14. Toxicity of ricin present in castor bean seeds

    OpenAIRE

    Nayanna Brunna da Silva Fonseca; Benito Soto-Blanco

    2014-01-01

    The castor bean (Ricinus communis) is a bush from Euphorbiacea family cultivated for obtaining oil from the seeds. This oil has broad industrial employment, particularly for biodiesel. However, castor bean seeds exhibit a potent toxin, ricin. It is a glycoprotein with highly toxic action of inactivating ribosomes. The toxic action of ricin is due to inhibition of protein synthesis in eukaryotic cells, causing cell death. Only one molecule of ricin that enters the cytosol is able to inactivate...

  15. Watershed responses to Amazon soya bean cropland expansion and intensification.

    Science.gov (United States)

    Neill, Christopher; Coe, Michael T; Riskin, Shelby H; Krusche, Alex V; Elsenbeer, Helmut; Macedo, Marcia N; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A

    2013-06-01

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compared with forest. However, the deep and highly permeable soils on the broad plateaus on which much of the soya bean cultivation has expanded buffer small soya bean watersheds against increased stormflows. Concentrations of nitrate and phosphate do not differ between forest or soya bean watersheds because fixation of phosphorus fertilizer by iron and aluminium oxides and anion exchange of nitrate in deep soils restrict nutrient movement. Despite resistance to biogeochemical change, streams in soya bean watersheds have higher temperatures caused by impoundments and reduction of bordering riparian forest. In larger rivers, increased water flow, current velocities and sediment flux following deforestation can reshape stream morphology, suggesting that cumulative impacts of deforestation in small watersheds will occur at larger scales. PMID:23610178

  16. Modularity Reveals the Tendency of Arbuscular Mycorrhizal Fungi To Interact Differently with Generalist and Specialist Plant Species in Gypsum Soils

    OpenAIRE

    Torrecillas, Emma; del Mar Alguacil, Maria; Roldán, Antonio; Díaz, Gisela; Montesinos-Navarro, Alicia; Torres, Maria Pilar

    2014-01-01

    Patterns in plant–soil biota interactions could be influenced by the spatial distribution of species due to soil conditions or by the functional traits of species. Gypsum environments usually constitute a mosaic of heterogeneous soils where gypsum and nongypsum soils are imbricated at a local scale. A case study of the interactions of plants with arbuscular mycorrhizal fungi (AMF) in gypsum environments can be illustrative of patterns in biotic interactions. We hypothesized that (i) soil char...

  17. 76 FR 68057 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-11-03

    ... (76 FR 16700-16703, Docket No. APHIS-2010-0101) a proposal \\1\\ to amend the regulations by allowing... (Phaseolus vulgaris L.) and runner beans (Phaseolus coccineus L.) may be imported into the United States...

  18. Biological nitrogen fixation in common bean and faba bean using N-15 methodology and two reference crops

    International Nuclear Information System (INIS)

    A field was conducted on a Typic ustropepts soil located at 'La Tola', the experimental campus of the Agricultural Sciences Faculty at Tumbaco, Ecuador. The objectives were to quantify faba bean (Vicia faba) and common bean (Phaseolus vulgaris) biological nitrogen fixation, using quinoa (chenopodium quinoa) and maize (Zea mays) as reference crops. The average values were 80 and 70 per cent for faba bean and 42 and 14 per cent for common bean, respectively. It was assumed that nitrogen use eficiency was the same for fixing crops but observed that a crop with high nitrogen use efficiency overestimates legume biological nitrogen fixation. Results suggests that greater caution is needed when selecting reference crops for legumes with nitrogen fixation

  19. Effect of various fertilization levels on the crack resistance of horse beans

    Directory of Open Access Journals (Sweden)

    Gorzelany J.

    1999-06-01

    Full Text Available Static compression tests were carried out on horse bean seeds within the scope of tests on micro tensile tester, Model Zwick 1425. The maximum value of force [N] causing bean crack and sample deformation [mm] up to the bean crack moment, were determined. The variation of predetermined mechanical indicators was analysed depending on the mode of varied fertilization, bean moisture content and loading direction. It was shown that varied fertilizer dose has significant effect on value of force causing bean damage and bean deformation up to crack.

  20. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    Directory of Open Access Journals (Sweden)

    Władysław Błaszczak

    2013-12-01

    Full Text Available Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing primary leaves and the age-dependent resistance to infection increased faster in plants of the cv. 'Złota Saxa'. Both cultivars of bean showed also age-dependent resistance to infection by BYMV. All these viruses restricted growth and yield of plants. The decreases were greater when younger plants were inoculated. These dependences appeared most distinctly in pea cv. 'Sześciotygodniowy' infected with CMV and in two cultivars of bean infected with BYMV.

  1. Performance of faba bean genotypes with Orobanche foetida Poir. and Orobanche crenata Forsk. infestation in Tunisia

    Directory of Open Access Journals (Sweden)

    Imen Trabelsi

    2015-03-01

    Full Text Available Orobanche foetida Poir. and O. crenata Forsk. are major constraints to faba bean (Vicia faba L. cultivation in Tunisia. To evalúate the different levels of resistance of seven small-seeded faba bean genotypes to these parasitic weed species, three trials were conducted in fields infested and non-infested with O. foetida in the Oued Beja Agricultural Experimental Unit and O. crenata in an experimental field at Ariana of the National Institute of Agricultural Research during three cropping seasons. Compared to the susceptible cv. Bad'i, the seven genotypes showed moderate to high levels of resistance to both Orobanche species. The number and dry weight of emerged broomrapes and underground tubercles recorded on the new improved genotypes were lower than those recorded on released and resistant 'Najeh' and 'Baraca'. The parasitism index on the new genotypes varied from 2-6 times less than susceptible 'Bad'i' in both Oued-Beja and Ariana. Yield reduction due to O.foetida infection varied from 13.5% on genotype XAR-VF00.13-89-2-1-1-1-1 to 59.7% on 'Baraca', whereas the yield loss was about 92% on the susceptible control. Parasitic infection did not affect dry grain protein accumulation in the tested genotypes.

  2. Effects of combined traditional processing methods on the nutritional quality of beans

    Science.gov (United States)

    Nakitto, Aisha M; Muyonga, John H; Nakimbugwe, Dorothy

    2015-01-01

    Consumption of dry beans is limited by long cooking times thus high fuel requirement. The bioavailability of nutrients in beans is also limited due to presence of antinutrients such as phytates and tannins. Little research has been done on combined processing methods for production of nutritious fast cooking bean flour and the effect of combined treatments on nutritional quality of beans has not previously determined. The aim of this study was to reduce cooking time and enhance the nutritional value of dry beans. Specifically to: develop protocols for production of fast cooking bean flours and assess the effect of processing on the nutritional characteristics of the flours. Dry beans (K131 variety) were soaked for 12 h; sprouted for 48 h; dehulled and steamed for 25 and 15 min for whole and dehulled beans respectively or roasted at 170°C for 45 and 15 min for whole and dehulled beans respectively. Dehulling eliminated phytates and tannins and increased protein digestibility. In vitro protein digestibility and mineral (iron and zinc) extractability were negatively correlated with tannin and phytate content. Total available carbohydrates were highest in moist heat-treated bean flours. Overall, combined processing of beans improved the nutritional quality of dry beans and the resulting precooked flours need less cooking time compared to whole dry beans. PMID:25987998

  3. USE OF BOTANICAL INSECTICIDES AS AN ALTERNATIVE FOR THE MANAGEMENT OF THE MEXICAN BEAN WEEVIL

    Directory of Open Access Journals (Sweden)

    KAREN FERREIRA DA SILVA

    2016-01-01

    Full Text Available This study aimed to evaluate the insecticidal activity of eight botanical species in the behavior and biological development of Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae under laboratory conditions. The botanical species were applied on bean grains (Phaseolus vulgaris Linnaeus directly as powder or indirectly within TNT bags. Three laboratory assays were performed. First, a repellent activity test was performed by exposing twenty couples of Z. subfasciatus adults in a choice-test arena. Second, a mortality test was performed for seven days after infestation. Finally, the oviposition and emergency rates of adults (% and the development from egg to adult (in days were evaluated in seven couples (males and females for seven days inside of a vial containing 0.3g of the powder from each botanical species and 10 g of bean grains (3% w.w-1. The study was conducted in a completely randomized design, and the treatments were arranged as a factorial design (2 x 9 with two factors (factor 1= powder and TNT bag application forms and factor 2= eight botanical species and control with eight replications. The powder application form was more efficient in controlling Z. subfasciatus. Azadirachta indica (powder application, Ruta graveolens (powder application, and Piper aduncum (TNT bag reduced the infestation of adults. The species A. inidica, Piper tuberculatum, Trichilia catigua, Pfaffia glomerata, R. graveolens, and Mentha pulegium inhibited the oviposition of the insects regardless of the formulation applied. R. graveolens (powder application caused 100% of mortality. The powder application of R. graveolens and M. pulegium reduced egg viability and insect emergence; therefore, they are very promising alternatives to control Z. subfasciatus in stored grains.

  4. Nutritional response of growing rats to faba beans (Vicia faba L., minor) and faba bean fractions.

    Science.gov (United States)

    Rubio, L A; Grant, G; Bardocz, S; Dewey, P; Pusztai, A

    1991-11-01

    The effects of raw faba bean (Vicia faba L., minor) meal (VFM) and its fractions on the growth and nitrogen utilization of rats have been determined in two experiments. Two commercial varieties of VFM were tested, local VFM (409-439 g/kg diet) and Troy VFM (439 g/kg diet). The bean fractions tested were V. faba lectin-depleted protein (VFDP), V. faba lectin (VFL) and V. faba cotyledon residue (VFCR). All diets were supplemented with amino acids to target requirements. Body-weight, body N and lipid contents of rats fed on VFM were reduced significantly in comparison with control rats fed on lactalbumin. This was due, in part, to the lower digestibility of the protein, lipid and dry matter (DM) of VFM diets. As a result, net protein utilization (NPU) and biological value (BV) of faba bean proteins were less than expected. Urine and urea-N outputs of the VFM-fed rats were also elevated in both experiments. Increasing the energy content of local VFM diets led to significantly higher dry body-weight, body N and lipid contents, with the result that the NPU and BV values of the protein also increased. However, the NPU values for VFM-fed rats were still significantly lower than those for the controls in both experiments. In contrast, true N, lipid and DM digestibilities in rats given local VFM were not significantly affected by the difference in the energy content of the diets. The replacement of two-thirds of the lactalbumin in the diet with VFDP (65 g/kg) reduced dry body-weight, N and lipid contents, NPU and BV compared with the control rats, even though N, lipid and DM digestibilities were not significantly different. The nutritional performance of rats fed on lactalbumin-based diets containing 7 g VFL/kg was similar to that of the controls. Similarly, the inclusion of the cotyledon residue (237 g VFCR/kg diet) had no appreciable effect on any of the variables studied. As VFL and VFCR had no antinutritional effects in these rats, it appears that the low nutritional

  5. Consideraciones e importancia social en torno al cultivo del frijol en el centro de México Considerations and social importance of the bean crop in central Mexico

    Directory of Open Access Journals (Sweden)

    Dora Ma. Sangerman-Jarquín

    in national importance after maize. The production of pulses, mainly of dry beans, has dropped to a 3.2% rate, whereas population growth is higher than dry bean production. The dry bean seed is a natural source of protein and carbohydrates, is also rich in vitamin B such as niacin, folic acid and thiamine, provides iron, copper, zinc, phosphorus, potassium, magnesium and calcium, and contains high fiber content. There exist many classes of beans that are characterized by their seed size, color, shape and the type of plant growth. It is considered that in total there are 70 species in the genus, and at least 50 in Mexico; five species have been domesticated Phaseolus vulgaris L. (common bean, Phaseolus coccineus L. (runner bean, Phaseolus lunatus L. (lima bean, Phaseolus dumosus L. (fat kidney bean and Phaseolus acutifolius Gray (tepari bean. In Mexico, around 70 cultivars are grown, according to the standard seed classification they are: black, pinto, brown, yellow and pink. The bean crop possesses particular characteristics that are important in the context of food sovereignty, considering it as a staple food for rural and urban poor. The bean breeding program of the National Research Institute, Forestry, Agriculture and Livestock (INIFAP, at the Campo Experimental Valle de Mexico (CEVAMEX, has contributed in the development of the technology required for the country to achieve self-sufficiency in this crop. This technology includes improved varieties with higher yielding ability and better seed nutritive and cooking quality.

  6. Effect of gamma irradiation on the microbiological quality and on the functional properties of proteins in dry red kidney beans (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    Gamma-irradiation was found to affect the physicochemical properties of dry red kidney beans. The highest dose used (8 kGy) significantly (P≤0.05) modified the extent of deamidation, the number of sulfhydryl groups, as well as the solubility and the hydrophobicity of the protein. Deamidation, protein solubility and hydrophobicity all increased with the irradiation dose while the number of sulfhydryl groups was reduced by the treatment. Furthermore, irradiation also affected the outgrowth of natural filamentous fungi contaminants present on the dry beans. A dose of 1.5 kGy reduced the number of filamentous fungi by 2 log cycles immediately after treatment. However, the highest dose used (3 kGy) did not eliminate the filamentous fungi completely. Moreover, the filamentous fungi population was a lot less diversified on the irradiated samples. Species of Aspergillus sp. and Penicillium sp. were more abundant on the unirradiated beans while the beans irradiated at 3 kGy contained were predominantly infected by species of Rhizopus sp. , Cladosporium sp. and Alternaria sp. (author)

  7. Effect of gamma irradiation on the microbiological quality and on the functional properties of proteins in dry red kidney beans (Phaseolus vulgaris)

    Energy Technology Data Exchange (ETDEWEB)

    Dogbevi, M.K.; Vachon, C.; Lacroix, M. E-mail: Monique_Lacroix@iaf.uquebec.ca

    2000-03-01

    Gamma-irradiation was found to affect the physicochemical properties of dry red kidney beans. The highest dose used (8 kGy) significantly (P{<=}0.05) modified the extent of deamidation, the number of sulfhydryl groups, as well as the solubility and the hydrophobicity of the protein. Deamidation, protein solubility and hydrophobicity all increased with the irradiation dose while the number of sulfhydryl groups was reduced by the treatment. Furthermore, irradiation also affected the outgrowth of natural filamentous fungi contaminants present on the dry beans. A dose of 1.5 kGy reduced the number of filamentous fungi by 2 log cycles immediately after treatment. However, the highest dose used (3 kGy) did not eliminate the filamentous fungi completely. Moreover, the filamentous fungi population was a lot less diversified on the irradiated samples. Species of Aspergillus sp. and Penicillium sp. were more abundant on the unirradiated beans while the beans irradiated at 3 kGy contained were predominantly infected by species of Rhizopus sp. , Cladosporium sp. and Alternaria sp. (author)

  8. Results of preliminary investigations at radio sensitivity of bean (Vicia faba L.) on fast neutrons

    International Nuclear Information System (INIS)

    The seeds of bean (Vicia faba L.) were irradiated with fast neutrons. The radiation doses applied ranged from 40 to 600 rads. Then irradiated seeds were sowed. During bean vegetation radiation effects were observed. (A.S.)

  9. Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis

    Directory of Open Access Journals (Sweden)

    Rabinowicz Pablo D

    2010-01-01

    Full Text Available Abstract Background Castor bean (Ricinus communis is an agricultural crop and garden ornamental that is widely cultivated and has been introduced worldwide. Understanding population structure and the distribution of castor bean cultivars has been challenging because of limited genetic variability. We analyzed the population genetics of R. communis in a worldwide collection of plants from germplasm and from naturalized populations in Florida, U.S. To assess genetic diversity we conducted survey sequencing of the genomes of seven diverse cultivars and compared the data to a reference genome assembly of a widespread cultivar (Hale. We determined the population genetic structure of 676 samples using single nucleotide polymorphisms (SNPs at 48 loci. Results Bayesian clustering indicated five main groups worldwide and a repeated pattern of mixed genotypes in most countries. High levels of population differentiation occurred between most populations but this structure was not geographically based. Most molecular variance occurred within populations (74% followed by 22% among populations, and 4% among continents. Samples from naturalized populations in Florida indicated significant population structuring consistent with local demes. There was significant population differentiation for 56 of 78 comparisons in Florida (pairwise population ϕPT values, p Conclusion Low levels of genetic diversity and mixing of genotypes have led to minimal geographic structuring of castor bean populations worldwide. Relatively few lineages occur and these are widely distributed. Our approach of determining population genetic structure using SNPs from genome-wide comparisons constitutes a framework for high-throughput analyses of genetic diversity in plants, particularly in species with limited genetic diversity.

  10. EFFECT ASSESSMENT OF KELPAK SL ON THE BEAN YIELD (PHASEOLUS VULGARIS L.

    Directory of Open Access Journals (Sweden)

    Anna KOCIRA

    2013-06-01

    Full Text Available Biostimulators applied in the cultivation of plants stimulate the processes of life and increase their hardiness to stress conditions, contributing to greater and better quality of yield. One of them is Kelpak SL obtained from brown seaweed species Ecklonia maxima. The aim of experiment carried out was to assess a potential effect of Kelpak SL on bean (Phaseolus vulgaris L. cultivar Aura yield. The trial was carried out during 2010-2011 years on the experimental field of Institute of Agricultural Sciences The State School of Higher Education in Chem. Treatments with Kelpak were carried out in 2 different concentrations 0.2 percent and 0.4 percent and in two application frequencies (one application in the 2 3 leaves stage or two applications first in the 2 3 leaves stage and second at the beginning of the beans blooming. Received results were compared with the control where Kelpak was not applied. The number and the weight of seeds, the number of pods and the weight of thousand seeds per 1 m2 were recorded. The beneficial effect of seaweed extract of Ecklonia maxima on the yield of beans (Phaseolus vulgaris L. was demonstrated. The highest number and weight of seeds and number of pods were obtainment in the combination of once application with 0.2 % solution of Kelpak SL in 2010 and once application with 0.4 % solution of Kelpak SL in 2011. Application of Kelpak SL significantly increased number and weight of seeds and number of pods compared with the control where Kelpak SL was not applied.

  11. Irradiation disinfestation of stored cocoa beans

    International Nuclear Information System (INIS)

    The relationship between effective dosages to induce mortality and sterility in several important storage beetles was investigated. To induce 100% mortality, doses ranging from 0.05 to 0.1 kGy require 4-7 weeks, 0.2-1.0 kGy need 1.5-3 weeks and 2.0 kGy require 1 week for Tribolium castaneum, Oryzaephilus surinamensis and Lasioderma serricorne, respectively. Only at 5.0 kGy did instant mortality occur in the insects tested. Total prevention of F1 progeny was achieved at the lowest dosage (0.05 kGy) for T. castaneum and O. surinamensis; for L. serricorne, the sterility level achieved was 92-99% for doses ranging from 0.05 to 1.0 kGy. Semi-pilot scale tests (12 months) were carried out to evaluate the efficacy of gamma irradiation to control insects (artificially infested L. serricorne and T. castaneum) and moulds in cocoa beans packed in either jute or laminated polypropylene or unlaminated polypropylene bags. Good control against insect infestations was achieved for the whole duration of storage. Laminated polypropylene afforded the best protection against insect reinfestation. Other than a change in moisture content, no changes in the physicochemical properties were observed in the flavour or in the total protein, soluble protein, amino acid and free fatty acid contents. 15 refs, 10 tabs

  12. Melhoramento do feijoeiro Breeding of dry beans

    Directory of Open Access Journals (Sweden)

    Ibrahim O. Abrahão

    1960-01-01

    Full Text Available Os ensaios de variedades e linhagens de feijão, realizados no período de 1948 a 1957 pelo Seção de Genética e resumidamente aqui apresentados, vieram indicar que as variedades e linhagens do grupo Mulatinho e Chumbinho eram as mais produtivas. A partir dêste ano agrícola, novos ensaios comparativos de produção foram realizados, a fim de verificar o comportamento das variedades e linhagens existentes com as variedades recém-introduzidas e as novas linhagens selecionadas. As variedades comerciais e suas linhagens, estudadas neste trabalho, foram classificadas em oito grupos, com base nas observações realizadas principalmente sôbre o tipo de planta e característicos dos sementes, o saber: Mulatinho, Chumbinho, Rosinha, Roxinho, Manteiga, Prêto, Bico-de-Ouro e diversos. Dos oito ensaios analisados em detalhes e realizados em Campinas, chegou-se à conclusão de que as variedades dos grupos Prêta e Rosinha são as de maior capacidade produtiva, devendo ser intensificado o aproveitamento dêsses grupos no plano de melhoramento em execução. As do grupo Roxinho apresentam-se menos produtivas. A comparação das análises dos ensaios como látice e blocos ao acaso revelou uma eficiência média de ordem de 30% para o tipo látice nos oito ensaios analisados. A fim de observar se o pêso total de plantas por ocasião da colheita mostra correlação com a produção de grãos, determinou-se, para cada grupo, o índice entre essas duas variáveis. Observou-se que êstes índices são proporcionais à produção, servindo, assim, para melhor caracterizar os diversos grupos de variedades e linhagens de feijão.In spite of the fact that dry beans (Phaseolus vulgaris are one of the main sources of protein in the State of São Paulo, Brazil, they are considered a secondary crop and grown only in small patches or intercropped with coffee, sugar cane, or corn. The development of high yielding strains resistant to the most prevailing diseases, has

  13. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Directory of Open Access Journals (Sweden)

    Daniel Ambachew

    2015-08-01

    Full Text Available Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM. The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i water deficit at mid-pod fill, or ii unprotected against bean fly; iii irrigated, well watered conditions, or iv bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  14. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel Ambachew; Firew Mekbib; Asrat Asfaw; Stephen E. Beebe; Matthew W. Blaird

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly;iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  15. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel; Ambachew; Firew; Mekbib; Asrat; Asfaw; Stephen; E.Beebe; Matthew; W.Blair

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot(BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly; iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress.In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  16. The BEAN experiment - An EISCAT study of ion temperature anisotropies

    Directory of Open Access Journals (Sweden)

    I. W. McCrea

    Full Text Available Results are presented from a novel EISCAT special programme, SP-UK-BEAN, intended for the direct measurement of the ion temperature anisotropy during ion frictional heating events in the high-latitude F-region. The experiment employs a geometry which provides three simultaneous estimates of the ion temperature in a single F-region observing volume at a range of aspect angles from 0° to 36°. In contrast to most previous EISCAT experiments to study ion temperature anisotropies, field-aligned observations are made using the Sodankylä radar, while the Kiruna radar measures at an aspect angle of the order of 30°. Anisotropic effects can thus be studied within a small common volume whose size and altitude range is limited by the radar beamwidth, rather than in volumes which overlap but cover different altitudes. The derivation of line-of-sight ion temperature is made more complex by the presence of an unknown percentage of atomic and molecular ions at the observing altitude and the possibility of non-Maxwellian distortion of the ion thermal velocity distribution. The first problem has been partly accounted for by insisting that a constant value of electron temperature be maintained. This enables an estimate of the ion composition to be made, and facilitates the derivation of more realistic line-of-sight ion temperatures and temperature anisotropies. The latter problem has been addressed by assuming that the thermal velocity distribution remains bi-Maxwellian. The limitations of these approaches are discussed. The ion temperature anisotropies and temperature partition coefficients during two ion heating events give values intermediate between those expected for atomic and for molecular species. This result is consistent with an analysis which indicates that significant proportions of molecular ions (up to 50% were present at the times of greatest heating.

  17. EMS induced dwarf and high yielding mutant in yam bean (Pachyrrhizus erosus Linn.)

    International Nuclear Information System (INIS)

    The species Pachyrrhizus erosus Linn., commonly known as yam bean, is cultivated in many countries for its edible underground tubers. The young tubers can be eaten raw, cooked, or can be sliced and made into chips. As genetic variability is limited in this species, a mutation breeding programme, using physical and chemical mutagens, was initiated to induce variability in a locally adapted cultivar. Genetically pure seeds were treated with concentrations of EMS ranging from 0.25 to 2%. Evaluation of M2 raised from 1.25% treatment revealed a dwarf mutant showing a higher yield than the control. This mutant attained a height of 20 cm only in M3 as against 82 cm in the controls. Though the starch content of the tuber and rotenone content in the seeds were the same as that in the control, protein content was slightly higher and the sugar content slightly less

  18. Effects of combined traditional processing methods on the nutritional quality of beans

    OpenAIRE

    Nakitto, Aisha M; Muyonga, John H.; Nakimbugwe, Dorothy

    2015-01-01

    Consumption of dry beans is limited by long cooking times thus high fuel requirement. The bioavailability of nutrients in beans is also limited due to presence of antinutrients such as phytates and tannins. Little research has been done on combined processing methods for production of nutritious fast cooking bean flour and the effect of combined treatments on nutritional quality of beans has not previously determined. The aim of this study was to reduce cooking time and enhance the nutritiona...

  19. Effects of bioprocessed antinutritional factors on bean protein quality, with special emphasis on Phaseolus vulgaris L.

    OpenAIRE

    Savelkoul, F.H.M.G.

    1994-01-01

    Legumes, e.g. beans and peas, can contain antinutritional factors. Some varieties of faba beans (Vicia faba), soya beans (Glycine max ) and white kidney beans (Phaseolus vulgaris) can contain in their raw state antinutritional factors such as tannins, trypsin inhibitors and lectins respectively which negatively effect the protein digestibility by nonruminants e.g. pigs. Also the storage protein is not easily digested by nonruminants. The main aim of the present study was to find a reasonable ...

  20. Reduction of Microbe Contamination through Steaming Process to Cocoa Beans Using Steaming Chamber

    OpenAIRE

    Hendy Firmanto

    2014-01-01

    Dry cocoa bean quality is also determined by its microbe contamination level. Steaming process for dried cocoa beans as a pretreatment process was selected because of less effect on organic compound inside the dried cocoa bean. This experiment aim was to study microbial contamination level of cocoa beans using steaming process, determining its microbial population and evaluate its chemical changes. Experiment was carried out in Postharvest Laboratory of Indonesian Coffee and Cocoa Research In...

  1. Draft genome sequence of the ricin-producing oilseed castor bean

    OpenAIRE

    Chan, Agnes P.; Crabtree, Jonathan; Zhao, Qi; Lorenzi, Hernan; Orvis, Joshua; Puiu, Daniela; Melake-Berhan, Admasu; Kristine M Jones; Redman, Julia; Chen, Grace; Cahoon, Edgar B.; Gedil, Melaku; Stanke, Mario; Haas, Brian J.; Wortman, Jennifer R

    2010-01-01

    Castor bean (Ricinus communis) is an oil crop that belongs to the spurge (Euphorbiaceae) family. Its seeds are the source of castor oil, used for the production of high-quality lubricants due to its high proportion of the unusual fatty acid ricinoleic acid. Castor bean seeds also produce ricin, a highly toxic ribosome inactivating protein, making castor bean relevant for biosafety. We report here the 4.6X draft genome sequence of castor bean, representing the first reported Euphorbiaceae geno...

  2. Effect of toasting field beans and of grass-clover

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Vestergaard, Jannie Steensig; Fretté, Xavier; Lund, Peter; Weisbjerg, Martin Riis; Kristensen, Troels

    The effect of toasting field beans and of grass-clover: maize silage ratio on milk production, milk composition and the sensory quality of the milk was investigated in a 2   2 factorial experiment. Toasting of field beans resulted in lower milk contents of both fat (44.2 versus 46.1 g/kg, P = 0.......02) and protein (33.5 versus 34.2 g/kg, P = 0.008), whereas milk production, urea and somatic cell contents were unaffected compared with the untreated field beans. Increasing the proportion of maize silage (from 9 to 21% of DM) in the ration decreased the content of urea in milk (P = 0.002), whereas milk......-β-carotene (P = 0.04) and β-carotene (P = 0.05). Toasting of field beans compared with untreated field beans did not affect the milk content of carotenoids and had only small effects on fatty acid composition. Regarding the sensory quality, the four treatments resulted in milk being characterized by a...

  3. Navy bean flour particle size and protein content affect cake baking and batter quality

    Science.gov (United States)

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to three levels with navy bean starch. The effect...

  4. Comparative study of the chemical composition of wild and cultivated beans (Phaseolus vulgaris).

    Science.gov (United States)

    Sotelo, A; Sousa, H; Sánchez, M

    1995-02-01

    Five wild Phaseolus vulgaris beans were compared with five cultivated Phaseolus vulgaris beans in proximate composition, total (true) protein, amino acid composition, and toxic and antinutritional factors. The wild beans contained more protein (25.5% vs. 21.7%), ash (5.15 vs. 4.15%), crude fiber (7.08% vs. 5.04%) compared to cultivated beans while the former contained less fat (0.56 vs. 0.89%) and carbohydrates (61.64 vs. 68.05%). Sulfur amino acids were found to be limiting in both groups of bean as expected; however, the cultivated beans had a higher content of the limiting amino acids. Therefore, the cultivated beans showed a better amino acid profile than the wild beans. Toxic factors were not found in either type of bean; the determinations included saponins, alkaloids, and cyanogenic glycosides. The antinutritional factors investigated were hemagglutinins (lectins) and trypsin inhibitors. The wild beans presented a higher content of trypsin inhibitors (28 TUI per mg) and lectins (9.6) than the cultivated beans did (21 TUI per mg and 7 respectively). From the chemical point of view, domestication seems to be positive; however, the better protein nutritive quality of the cultivated beans should be further confirmed by biological assays. PMID:7792267

  5. Effects of extrusion cooking on the chemical composition and functional properties of dry bean powders

    Science.gov (United States)

    This study aimed to investigate the impacts of extrusion cooking on the chemical composition and functional properties of bean powders from four bean varieties. The raw bean powders were extruded under eight different conditions, and the extrudates were then dried and ground (particle size = 0.5 mm)...

  6. Snap beans (Phaseolus vulgaris L.) quality profile by sensory descriptive analysis

    OpenAIRE

    Vilanova de la Torre, María del Mar; Rodiño Míguez, Ana Paula; González Fernández, Ana María; Canosa Rodríguez, Pilar; Rodríguez Vega, Iria; Riveiro, Manuel; Santalla Ferradás, Marta

    2014-01-01

    Sensory quality of snap beans (Phaseolus vulgaris L.) influence consumer preferences. The application of sensory descriptive analysis (SDA) for snap bean quality is shown in this work. SDA has allowed generatin gdescriptors for appearance, aroma, flavor and texture, which could be used to characterize snap bean varieties.

  7. Interferência das plantas daninhas no feijoeiro carioca Weed interference in carioca beans (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    T.P. Salgado

    2007-09-01

    Full Text Available Este trabalho foi realizado com o objetivo de determinar os períodos de interferência das plantas daninhas na cultura do feijoeiro (Phaseolus vulgaris plantado em janeiro. A semeadura do cv. Carioca foi feita no sistema convencional e os tratamentos constaram de dois grupos: no primeiro, a cultura do feijão permaneceu livre da interferência das plantas daninhas desde a emergência até 10, 20, 30, 40, 50, 60 e 70 dias (todo o ciclo da cultura; no segundo, a cultura permaneceu sob interferência desde a semeadura até os mesmos períodos descritos anteriormente, totalizando assim 14 tratamentos. O delineamento experimental utilizado foi o de blocos casualizados com quatro repetições. A comunidade infestante foi composta por 13 espécies, com Alternanthera tenella, Blaenvillea rhomboidea e Cenchrus echinatus se destacandodas demais, representando 63,4% do total de indivíduos. O período anterior à interferência (PAI ocorreu até os 17 dias após emergência da cultura, e o período total de prevenção à interferência (PTPI ocorreu até 25 dias após a emergência da cultura. A interferência das plantas daninhas durante todo o ciclo de vida do feijoeiro reduziu-lhe a produtividade em 67%.This work aimed to determine the periods of weed interference in 'Carioca' bean (Phaseolus vulgaris during the dry season. The assay was conducted at the Experimental Farm of the Universidade do Estado de Sao Paulo-UNESP - Jaboticabal. The bean plants were sown under the conventional system. The experimental treatments consisted of two groups: in the first, the bean crop remained free of weed interference from emergence up to 10, 20, 30, 40, 50, 60, 70 days (the entire crop cycle. In the second, the bean crop remained under interference from the time of sowing up to the same periods previously described, totalizing fourteen experimental treatments. The experiments were arranged in a randomized block design with four replications. The weed community

  8. Hyperspectral imaging for differentiation of foreign materials from pinto beans

    Science.gov (United States)

    Mehrubeoglu, Mehrube; Zemlan, Michael; Henry, Sam

    2015-09-01

    Food safety and quality in packaged products are paramount in the food processing industry. To ensure that packaged products are free of foreign materials, such as debris and pests, unwanted materials mixed with the targeted products must be detected before packaging. A portable hyperspectral imaging system in the visible-to-NIR range has been used to acquire hyperspectral data cubes from pinto beans that have been mixed with foreign matter. Bands and band ratios have been identified as effective features to develop a classification scheme for detection of foreign materials in pinto beans. A support vector machine has been implemented with a quadratic kernel to separate pinto beans and background (Class 1) from all other materials (Class 2) in each scene. After creating a binary classification map for the scene, further analysis of these binary images allows separation of false positives from true positives for proper removal action during packaging.

  9. Simulation of fallout for translocation studies of 137Cs and 90Sr in bean plants (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    In case of an accident at a nuclear power plant with liberation of radioactive material into the atmosphere, knowledge on the behaviour of plant species when in contact with radionuclides is indispensable for safety reasons. The radioactive contamination of crops, due to fallout, should be carefully assessed since the consumption of contaminated food is the main route of population exposure. An important route through which agricultural products are contaminated by radionuclides is leaf-fruit translocation. In order to quantify the leaf-fruit translocation coefficients for Cs and Sr in the common bean (Phaseolus vulgaris), variety black diamond, an experiment was carried out in a greenhouse with completely randomised block design. The bean plants were contaminated inside a device especially designed to avoid environmental contamination. Cs activity was determined by gamma ray spectrometry, while chemical separation followed by beta counting of Y was used for Sr determination. The model used for translocation indicated functional dependence between the moment of tracer application and the level of physiological development of the bean plant. (author)

  10. Fungal and mycotoxin contamination of coffee beans in Benguet province, Philippines.

    Science.gov (United States)

    Culliao, Audrey Glenn L; Barcelo, Jonathan M

    2015-01-01

    Coffee remains an important agricultural product in Benguet province, Philippines, but is highly susceptible to fungal and mycotoxin contamination in various stages of growth and processing and in different local climates. In this study, pre- and post-harvest coffee bean samples from temperate and warm farming areas were assessed for their fungal and mycotoxin contaminants. One hundred eighty-five fungal isolates belonging to six genera were isolated representing 88.1% of mycotoxigenic fungi. The predominant species belonged to the genus Aspergillus, which are known producers of mycotoxins. Coffee beans from the post-harvest temperate group were found to have the highest percentage mycotoxigenic contamination of 98.4%, suggesting that the risk for fungal contamination is high after drying. Determination of the mycotoxins indicated 28.6% contamination. Ochratoxin A was found to be highest in dried whole cherries which contained 97.3 μg kg(-1), whilst sterigmatocystin was also highest in dried whole cherries at 193.7 μg kg(-1). These results indicate that there are risks of fungal and mycotoxin contamination of Benguet coffee at the post-harvest stage. PMID:25534333

  11. MINERALS, TRACE ELEMENTS AND FLAVONOIDS CONTENT IN WHITE AND COLOURED KIDNEY BEAN

    Directory of Open Access Journals (Sweden)

    Dalaram Ismael

    2011-02-01

    Full Text Available   The aim of the study was to determine the contents of mineral elements (Ca, K, Mg, N, P, trace elements (Cu, Fe, Mn, Cd, Pb, Ni, Co, Cr, and Zn, and certain phenolic compounds (flavonoids, isoflavones in the fourteen varieties of cultivated raw kidney beans (Phaseolus vulgaris L..Heavy metals and mineral elements were analyzed by AAS methods, phenolics were detected by HPLC. Compared with vegetables, legumes proved to be a good source of many minerals and elements, e.g., the contents of K, Mg, P, Fe, and Zn varied in the ranges 13.02 - 23.08 g.kg-1, 1.41 - 2.52 g.kg-1, 3.81 - 5.26 g.kg-1, 0.064 - 0.121 g.kg-1, and 0.026 - 0.037 g.kg-1 dw, respectively. Kidney beans, both species, contained no or few amounts of phenolics (only four cultivars and the levels of kaempferol and apigenin were comparable to isoflavone genistein and quite higher than isoflavon daidzein content. doi:10.5219/116

  12. Influence of Fermentation and Drying Materials on the Contamination of Cocoa Beans by Ochratoxin A

    Directory of Open Access Journals (Sweden)

    Sébastien Djédjé Dano

    2013-11-01

    Full Text Available Ochratoxin A (OTA is a mycotoxin produced mainly by species of Aspergillus and Penicillium. Contamination of food with OTA is a major consumer health hazard. In Cote D’Ivoire, preventing OTA contamination has been the subject of extensive study. The current study was conducted to evaluate the influence of fermentation and drying materials on the OTA content in cocoa. For each test, 7000 intact cocoa pods were collected, split open to remove the beans, fermented using 1 of 3 different materials, sun-dried on 1 of 3 different platform types and stored for 30 days. A total of 22 samples were collected at each stage of post-harvesting operations. The OTA content in the extracted samples was then quantified by high-performance liquid chromatography. OTA was detected in beans at all stages of post-harvesting operations at varying levels: pod-opening (0.025 ± 0.02 mg/kg, fermentation (0.275 ± 0.2 mg/kg, drying (0.569 ± 0.015 mg/kg, and storage (0.558 ± 0.04 mg/kg. No significant relationships between the detected OTA level and the materials used in the fermentation and drying of cocoa were observed.

  13. Green coffee bean extract improves human vasoreactivity.

    Science.gov (United States)

    Ochiai, Ryuji; Jokura, Hiroko; Suzuki, Atsushi; Tokimitsu, Ichiro; Ohishi, Mitsuru; Komai, Norio; Rakugi, Hiromi; Ogihara, Toshio

    2004-10-01

    Our previous study revealed the antihypertensive effects of green coffee bean extract (GCE) ingestion in spontaneously hypertensive rats. We suggested that this antihypertensive action was due to the fact that GCE contains chlorogenic acid (CQA) as a major phenolic compound, and CQA in turn contains ferulic acid as a metabolic component that acts on nitric oxide (NO) derived from the vascular endothelium. In this study, the effects of GCE on blood vessels were evaluated in healthy males. The subjects were 20 healthy males with reduced vasodilation responses measured by strain gauge plethysmograms (SPG) to ischemic reactive hyperemia. Of the 20 subjects, 10 (mean age, 37.2 years) ingested a test drink containing GCE (CQA: 140 mg/day), and the other 10 (mean age, 34.8 years) ingested a placebo drink for 4 months. During the ingestion period, SPG, pulse wave velocity (PWV), and serum biochemical parameters were measured, and acceleration plethysmograms (APG) were taken. The reactive hyperemia ratio (RHR) in the test drink group began to increase after ingestion for 1 month and was significantly higher (p <0.05) than that in the placebo group after ingestion for 3 months and 4 months. In addition, after ingestion for 4 months, the test drink group showed a significant decrease (p <0.01) in the plasma total homocysteine level compared with the pre-ingestion level. However, there were no significant differences in PWV or APG between the test drink group and the placebo drink group. The improvement in RHR after ingestion of a drink containing GCE suggested an improvement in vasoreactivity by this component. PMID:15785008

  14. Medical image of the week: coffee bean and whirlpool signs

    Directory of Open Access Journals (Sweden)

    Bartolome B

    2016-01-01

    Full Text Available A 79-year-old woman with a history of Parkinson’s disease presented with altered mental status, poor oral intake, and multiple episodes of nausea and vomiting. An abdominal x-ray demonstrated dilated loops of bowel and the coffee bean sign concerning for sigmoid volvulus (Figure 1. The coffee bean sign occurs when a thick “inner wall” represents the double wall thickness of opposed loops of bowel while the thinner outer walls due single thickness. A contrast CT abdomen showed dilated sigmoid loop and whirlpool sign confirming sigmoid volvulus (Figure 2. She underwent a total colectomy with ileorectal anastomosis and full recovery.

  15. Technique of irradiation sterilization of local flavor bean products

    International Nuclear Information System (INIS)

    Local flavor bean products were packed with 0.07 - 0.10 mm nylon-polythene plastic bags, vacuumed, sealed and irradiated by 60Co γ-rays of 5 - 10 kGy and stored for 30 days at normal temperature (25 degree C) and for 90 days at (2 - 7) degree C, respectively. The results show that the bacteria number of irradiated bean products accords with the national standard and the protein and fat contents have no obvious change compared with the CK

  16. Effect of gamma-radiation on major aroma compounds and vanillin glucoside of cured vanilla beans (Vanilla planifolia)

    International Nuclear Information System (INIS)

    Radiation processing of food materials by gamma-radiation is a well established method for microbial decontamination and insect disinfestation. Irradiation of spices at doses ranging from 10 to 30 kGy has been reported to result in complete elimination of microorganisms with negligible changes in the flavour quality. The effect of gamma-radiation on microflora and vanillin content of cured vanilla beans in the dose range of 5-50 kGy has been investigated, but its effect on other major aroma compounds and vanillin glucoside (vanillin aroma precursor) remaining after curing have not been studied so far. Vanillin (4-hydroxy-3-methoxybenzaldehyde) is one such compound used as a flavouring agent and as a dietary component. It is the major component of natural vanilla, which is one of the most widely used and important flavouring materials throughout the world. Vanillin is an antioxidant capable of protecting membrane against lipid peroxidation and DNA against strand breaks induced by reactive oxygen species. The present work was aimed to study the effect of gamma-radiation processing on the major aroma compounds of cured vanilla beans and also to investigate possible enhancement in vanillin content by the radiolytic breakdown of vanillin glucoside present already. Cured vanilla beans were irradiated (5, 10, 15, 20 and 30 kGy) and the vanillin content of control and irradiated samples were analysed, respectively for a possible enhancement of vanillin content by radiolysis of vanillin glucoside. Radiolytic breakdown of glycosidic precursors of aroma constituents and consequent release of free aroma was shown to result in the enhancement of aroma quality of these products. Since a considerable amount of vanillin exists as its glycosidic precursor in cured vanilla pods, a possible enhancement in yield of vanillin by radiation processing is thus expected. Hence the highly stable oxygen-carbon linkage between vanillin and glucose limits the possible enhancement of aroma

  17. Response of an endangered tree species from Caatinga to mycorrhization and phosphorus fertilization

    Directory of Open Access Journals (Sweden)

    João Ricardo Gonçalves de Oliveira

    2015-03-01

    Full Text Available Schinopsis brasiliensis is an endangered tree species found in the Caatinga biome. It presents a characteristic slow development and difficult propagation, although it has been traditionally exploited in the region. Application of arbuscular mycorrhizal fungi (AMF and phosphorus (P fertilization may be beneficial to S. brasiliensis development at the seedling stage, which at the same time may help species conservation and the recovery of degraded areas in the Caatinga biome. We assessed the response of S. brasiliensis to AMF inoculation (Claroideoglomus etunicatum and Acaulospora longula and P fertilization (0, 12, 24, and 48 mg dm−3 addition of P2O5. S. brasiliensis responded positively to both AMF inoculation and P fertilization. At low P concentrations, the inoculated plants showed higher leaf area and enhanced vegetative development, nutrient content and biomass production compared with non-inoculated plants. Conversely, increasing levels of P fertilization decreased the level of mycorrhizal colonization, plant responsiveness to inoculation, and spore production in C. etunicatum. Thus, P concentrations were able to influence the response of S. brasiliensis to mycorrhization and responsiveness to increased mycorrhization with the decrease in P availability. These results showed that mycorrhizal symbiosis plays an essential role in the development of S. brasiliensis.

  18. Determination of trace elements in various kinds of bean by X-ray spectrometric techniques (1995-96)

    International Nuclear Information System (INIS)

    Various kinds of bean such as Peanut, Gram Whole, Black Eye Bean, Small Red Bean, Lab Lab Bean, Green Mung Bean, Filed Pea, Seasame Seed, Sultani, Maize, Butter Bean, Dolichos Lab Lab, Toor Whole, Small Yellow Bean, Cow Pea have been collected and analysed by EDXRF analysis for trace elements. The measurement system consists of a Cd-109 annual excitation source, a Si (Li) detector, H V power supply, a spectrometry amplifier, a multichannel analyser and a personal computer. The samples were prepared as pressed pellets and measured by Emission Transmission Technique. The accuracy was determined by analysing standard reference material, SOIL-7 form IAEA. (author)

  19. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P

    2011-10-01

    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  20. Comparison of Marine Boundary Layer Cloud Properties from CERES-MODIS Edition 4 and DOE ARM AMF Measurements at the Azores

    Science.gov (United States)

    Xi, Baike; Dong, Xiquan; Minnis, Patrick; Sun-Mack, Sunny

    2014-01-01

    Marine boundary layer (MBL) cloud properties derived from the NASA Clouds and the Earth's Radiant Energy System (CERES) project using Terra and Aqua Moderate Resolution Imaging Spectroradiometer (MODIS) data are compared with observations taken at the Department of Energy Atmospheric Radiation Measurement (ARM) Mobile Facility at the Azores (AMF-Azores) site from June 2009 through December 2010. Cloud properties derived from ARM ground-based observations were averaged over a 1 h interval centered at the satellite overpass time, while the CERES-MODIS (CM) results were averaged within a 30 km×30 km grid box centered over the Azores site. A total of 63 daytime and 92 nighttime single-layered overcast MBL cloud cases were selected from 19 months of ARM radar-lidar and satellite observations. The CM cloud top/base heights (Htop/Hbase) were determined from cloud top/base temperatures (Ttop/Tbase) using a regional boundary layer lapse rate method. For daytime comparisons, the CM-derived Htop (Hbase), on average, is 0.063 km (0.068 km) higher (lower) than its ARM radar-lidar-observed counterpart, and the CM-derived Ttop and Tbase are 0.9 K less and 2.5 K greater than the surface values with high correlations (R(sup 2) = 0.82 and 0.84, respectively). In general, the cloud top comparisons agree better than the cloud base comparisons, because the CM cloud base temperatures and heights are secondary products determined from cloud top temperatures and heights. No significant day-night difference was found in the analyses. The comparisons of MBL cloud microphysical properties reveal that when averaged over a 30 km× 30 km area, the CM-retrieved cloud droplet effective radius (re) at 3.7 micrometers is 1.3 micrometers larger than that from the ARM retrievals (12.8 micrometers), while the CM-retrieved cloud liquid water path (LWP) is 13.5 gm( exp -2) less than its ARM counterpart (114.2 gm( exp-2) due to its small optical depth (9.6 versus 13.7). The differences are reduced by 50

  1. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1. PMID:25437743

  2. Within-plant distribution and seasonal population dynamics of flower thrips (Thysanoptera: Thripidae) infesting French beans (Phaseolus vulgaris L.) in Kenya

    Energy Technology Data Exchange (ETDEWEB)

    Kasina, M.; Nderitu, J.; Nyamasyo, G.; Waturu, C.; Olubayo, F.; Obudho, E.; Yobera, D.

    2009-07-01

    The aim of this research was to study spatial distribution of flower thrips on French beans (Phaseolus vulgaris L.) in Kenya. Their build up and seasonal population dynamics was monitored using sticky blue colour traps and sampling of leaves and flowers in two seasons in 2002. Thrips infested French beans from the second week after crop emergence. Their population peaked at peak flowering. The sticky trap catches were linearly related to the actual presence of thrips on the crop and could estimate population build up of adult thrips on leaves and flowers. On the plants, most adults were on flowers. Larvae mainly inhabited leaves, buds and pods. The two thrips species, Frankliniella occidentalis (Pergande) and Megalurothrips sjostedti Trybom were spatially separated. The former colonized lower-canopy leaves and early flowers while the latter inhabited middle-canopy leaves and mature flowers. Overall, M. sjostedti was less than 5% of the total thrips population, implying that F. occidentalis was the main thrips pest of French beans. This study suggests that French bean growers should monitor thrips population before initiating any control measure. In addition, they should commence thrips control early, at pre-flowering, using larvicides to reduce the thrips pool and their migration to flowers. A combination of monitoring with sticky traps and proper sampling would contribute to sustainable thrips management. (Author) 36 refs.

  3. Adaptive Potential for the Invasion of Novel Host Plants in the Bean Weevil: Patterns of the Reproductive Behavior in Populations That Used Different Host Plants

    Directory of Open Access Journals (Sweden)

    Dragana Milanović

    2007-01-01

    Full Text Available The goal of this work was to examine interpopulation patterns in the reproductive behavior of populations of bean weevil (Acanthoscelides obtectus Say; Coleoptera: Bruchidae that had different levels of specialization on their native host plant – the bean (Phaseolus vulgaris L., as well as on a novel host plant – the chickpea (Cicer arietinum Thorn. The obtained pattern of interpopulation mating behavior seemed exactly as if the males on chickpea had evolved a specific odor and/or a courtship ritual that females of populationson bean found repulsive. Unlike females, the males of bean populations seemed to be willing to mate with females from the population on chickpea equally as with their own females. Such an asymmetric pattern of reproductive isolation between populations ofa species has been often considered an initial phase of a process of speciation. Thus, our results could be a good starting point for further, thorough examination of both the role of the level of host specialization in females and the role of biochemical characteristics of male pheromone (and/or their cuticular hydrocarbones in the evolution of pre-reproductive isolation between insect populations.As the results of this study, together those of previous studies on A. obtectus, suggest great evolutionary potential for invasions of and fast specialization on novel host plants, they could provide valuable information for the development of long-term strategiesunder the programmes of Integrated Pest Management.

  4. ADMINISTRATION OF CACAO BEANS (Theobroma cacao L. EXTRACTS DECREASE MALONDIALDEHYDE CONCENTRATION AND INCREASE BLOOD NOx CONCENTRATION IN WHITE RAT (Ra"us norvegicus INDUCED BY PSYCHOSOCIAL STRESS

    Directory of Open Access Journals (Sweden)

    Dewi Wiryanthini IA

    2013-04-01

    Full Text Available Increased production of reactive oxygen species (ROS causing accumulation of oxidative damage caused by exceeding anti oxidant capacity in the body. Psychological stress as psychosocial stress can induce oxidative stress which subsequently cause increase blood malondialdehyde (MDA and decrease blood nitrate and nitrite (NOx concentration as intermediate product of nitric oxide (NO. Cacao beans extracts contained anti oxidant flavanols consist of catechin, epicatechin and procyanidin. The aims of this study is to investigate the effect of cacao beans (Theobroma cacao L. extracts for decreasing MDA and increasing NOx concentration in white rat (Ra$us norvegicus blood in stress oxidative state induced by psychosocial stress. It is an experimental study with Pretest-Postest Control Group Design. This study revealed decrease MDA concentration in group P1 (11.47 vs 8.04, P2 (11.92 vs 5.44 and P3 (11.69 vs 2.87 with P = 0.000 and increase NOx concentration in oxidative stress white rat induced by psychosocial stress a[er administration of cacao beans extract in group P1 (1909.83 vs 2085.16, P2 (1912.5 vs 2231.83 and P3 (1871.5 vs 2339.83 with P = 0.005. This study showed that cacao beans extract can inhibit oxidative stress caused by psychosocial stress.

  5. Physicochemical properties and antioxidant capacity of raw, roasted and puffed cacao beans.

    Science.gov (United States)

    Hu, SuJung; Kim, Byung-Yong; Baik, Moo-Yeol

    2016-03-01

    The antioxidant capacity and attributable bioactive compounds of puffed cacao beans were investigated. Roasting was carried out at 190°C for 15min and puffing was performed at 4-7kgf/cm(2). Cacao beans puffed at 4kgf/cm(2) showed the highest total polyphenols (23.16mgGAE/gsample) and total flavonoids (10.65mgCE/gsample) (pcacao beans reflected the total polyphenols and flavonoids measured. The quantities of theobromine, catechin, epicatechin, and procyanidin B2 were higher in cacao beans puffed at 4kgf/cm(2) than in roasted cacao beans. Puffed cacao beans received a good sensory score in flavor, but sourness increased as puffing pressure increased. Thus, these results suggest that, in cacao bean processing, puffing could be an alternative to roasting, which provide a rich taste and high antioxidant capacity. PMID:26471657

  6. Pinto Beans (Phaseolus vulgaris L. as a Functional Food: Implications on Human Health

    Directory of Open Access Journals (Sweden)

    Vicki Schlegel

    2013-02-01

    Full Text Available Most foods are considered functional in terms of providing nutrients and energy to sustain daily life, but dietary systems that are capable of preventing or remediating a stressed or diseased state are classified as functional foods. Dry beans (Phaseolus vulgaris L. contain high levels of chemically diverse components (phenols, resistance starch, vitamins, fructooligosaccharides that have shown to protect against such conditions as oxidative stress, cardiovascular disease, diabetes, metabolic syndrome, and many types of cancer, thereby positioning this legume as an excellent functional food. Moreover, the United States has a rich dry bean history and is currently a top producer of dry beans in the world with pinto beans accounting for the vast majority. Despite these attributes, dry bean consumption in the US remains relatively low. Therefore, the objective of this manuscript is to review dry beans as an important US agricultural crop and as functional food for the present age with an emphasis on pinto beans.

  7. Effect of plant species on P cycle-related microorganisms associated with litter decomposition and P soil availability: implications for agroforestry management

    Directory of Open Access Journals (Sweden)

    Correa E

    2016-04-01

    Full Text Available Cutting dry deciduous forest (preserved site for wood supply in semi-arid Brazil has led to invasion of a pioneer shrub vegetation called “Carrasco” (disturbed site, which inhibits the sprouting of native species. A land restoration project was undertaken in a cleared Carrasco area where a mixed plantation of native species and Eucalyptus spp. (experimental site was established to preserve the forest and ensure wood supply for the local population. We considered phosphorus as a limiting soil nutrient to plant growth, and we addressed the roles of litter decomposition and microbial activity on phosphorus release in the disturbed, preserved and experimental sites. The phosphorus released from leaf litter was affected by the vegetation type, which favored specific soil microbial populations during decomposition. The Carrasco vegetation predominantly favored arbuscular mycorrhizal fungi (AMF, as shown by root colonization in the litter bags; the Eucalyptus plants favored AMF and ectomycorrhizal fungi (EM, as well as phosphate solubilizing microorganisms (PSM, and the intercropping system favored AMF and PSM groups. In contrast, the preserved site favored the PSM population. High phosphatase activity was found in the preserved and experimental sites in contrast to the Carrasco soil. Principal component analysis showed that AMF root colonization and phosphatase activity were the main parameters influencing the increase in soil phosphorus. Based on the above results, rehabilitation appeared to be underway in the experimental site, since the samples were more similar to the preserved site than to the disturbed site. This effect was attributed to Eucalyptus camaldulensis that promote the establishment of all phosphorus cycle-related microorganisms (AMF, EM and PSF. E. camaldulensis associated with mycorrhizal fungi and PSM are recommended for inclusion in agroforestry systems.

  8. Impact of an invasive nitrogen-fixing tree on arbuscular mycorrhizal fungi and the development of native species

    OpenAIRE

    Guisande-Collazo, Alejandra; González, Luís; Souza-Alonso, Pablo

    2016-01-01

    This study contributes to knowledge on the effect of the invasive N2-fixing tree, Acacia dealbata, on soil microbial communities and consequences on plant species that are dependent on symbiotic relationships as in the case of Plantago lanceolata. The main results of this work indicate that Acacia dealbata modifies the structure of arbuscular mycorrhizal fungi in the invaded shrublands and consequently the growth and development of plants that depend on AMF. Plantago lanceolata showed a subst...

  9. Inoculation of drought-stressed strawberry with a mixed inoculum of two arbuscular mycorrhizal fungi: effects on population dynamics of fungal species in roots and consequential plant tolerance to water deficiency.

    Science.gov (United States)

    Boyer, Louisa Robinson; Brain, Philip; Xu, Xiang-Ming; Jeffries, Peter

    2015-04-01

    The effect of inoculation with two arbuscular mycorrhizal fungi (AMF) on growth and drought tolerance of cultivated strawberry (Fragaria × ananassa) was studied. Three treatments (a single treatment either of Funneliformis mosseae BEG25, Funneliformis geosporus BEG11 or a 50:50 mixed inoculation treatment of both species) were compared to uninoculated plants. Species-specific primers for qPCR quantification of F. geosporus and F. mosseae DNA were developed to quantify the relative abundance of each fungus in roots of strawberry under different conditions of water stress. Co-occupation of the same root by both species was shown to commonly occur, but their relative abundance varied with water stress (reduced irrigation of up to 40%). Greater root colonisation was observed microscopically under water stress, but this increased colonisation was often accompanied with decreased amounts of fungal DNA in the root. F. mosseae tended to become more abundant under water stress relative to F. geosporus. There was significant correlation in the fungal colonisation measurements from the microscopic and qPCR methods under some conditions, but the nature of this relationship varied greatly with AMF inoculum and abiotic conditions. Single-species inoculation treatments gave similar benefits to the host to the mixed inoculation treatment regardless of irrigation regime; here, amount of colonisation was of greater importance than functional diversity. The addition of AMF inocula to plants subjected to reduced irrigation restored plant growth to the same or higher values as the non-mycorrhizal, fully-watered plants. The water use efficiency of plants was greater under the regulated deficit irrigation (RDI) regime and in AMF-inoculated plants, but there were no significant differences between plants inoculated with the single or combined inoculum. This study demonstrated that the increase in plant growth was directly influenced by an increase in root colonisation by AMF when

  10. Inconsistent genetic structure among members of a multitrophic system: did bruchid parasitoids (Horismenus spp.) escape the effects of bean domestication?

    Science.gov (United States)

    Laurin-Lemay, S; Angers, B; Benrey, B; Brodeur, J

    2013-04-01

    Anthropogenic range expansion and cultural practices have modified the distribution, abundance and genetic diversity of domesticated organisms, thereby altering multitrophic assemblages through space and time. The putative Mesoamerican domestication centre of the common bean, Phaseolus vulgaris L., in Mexico allows investigating the effects of plant domestication on the genetic structure of members of a multitrophic system. The aim of this study was to compare the evolutionary history of Horismenus parasitoids (Hymenoptera: Eulophidae) to those of their bruchid beetle hosts (Coleoptera: Bruchidae) and their domesticated host plant (P. vulgaris), in the context of traditional agriculture in Mexico. We analyzed the population genetic structure of four Horismenus species in Mexico using mitochondrial COI haplotype data. The two most abundant parasitoid species were Horismenus depressus and Horismenus missouriensis. Horismenus missouriensis were infected by Wolbachia endosymbionts and had little to no population differentiation (F(ST) = 0.06). We suspect the mitochondrial history of H. missouriensis to be blurred by Wolbachia, because differentiation among infected vs. non-infected individuals exists (F(ST) = 0.11). Populations of H. depressus were found to be highly differentiated (F(ST) = 0.34), but the genetic structuring could not be explained by tested spatial components. We then compared the genetic structure observed in this parasitoid species to previously published studies on bruchid beetles and their host plants. Despite extensive human-mediated migration and likely population homogenization of its two Acanthoscelides bruchid beetle hosts, H. depressus populations are structured like its host plant, by a recent dispersal from a diverse ancestral gene pool. Distinct evolutionary dynamics may explain inconsistent patterns among trophic levels. Parasitoids likely migrate from wild bean populations and are poorly adapted to bean storage conditions similar to

  11. Germination test for identification of gamma-irradiated bean seeds

    International Nuclear Information System (INIS)

    The feasibility of germination test for the practical detection of irradiated beans has not been investigated. The objective of this study was to determine if the relationship between the root growth rate and radiation dose could be used to produce a rapid analytical method for identification of irradiated beans. Such detection method could be potentially used for both (a) identification of irradiated food, and (b) for quarantine inspection (to certify that the agricultural product has been irradiated, and the pests present in it do not pose a quarantine risk). Results presented in this paper indicate that the germination test is not always capable of discriminating satisfactorily between irradiated and unirradiated samples of bean seeds, because the sensitivity of the test is often higher than the low doses which are suggested for disinfestation purposes. However, using the germination test, an unexperienced person can easily discriminate untreated bean seeds from those irradiated with 0.3-1.5 kGy doses of gamma radiation. (orig./vhe)

  12. Evaluation of essential minerals in carioquinha beans by EDXRF

    International Nuclear Information System (INIS)

    In this study, the levels of essential minerals in the carioquinha beans were analyzed by Energy Dispersive X-ray Fluorescence technique (EDXRF), searching determine the possible minerals, quantities and the correlation among different sources of same variety and the possible contribution of each to the human diet

  13. Microbiological safety of kinema: a fermented soya bean food.

    NARCIS (Netherlands)

    Nout, M.J.R.; Bakshi, D.; Sarkar, P.K.

    1998-01-01

    Kinema is a fermented soya bean food of Nepal and the hilly regions of Northeastern States of India. Generally, the fermentation is dominated by Bacillus spp. that often cause alkalinity and desirable stickiness in the product. The present study was undertaken in a limited number of commercial (mark

  14. Detection of radiation treatment of beans using DNA comet assay

    International Nuclear Information System (INIS)

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5 kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60 min in 2.5% SDS and electrophoresis was carried out at a voltage of 2 V/cm for 2-2.5 min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans

  15. Detection of radiation treatment of beans using DNA comet assay

    Science.gov (United States)

    Khan, Ashfaq A.; Khan, Hasan M.; Delincée, Henry

    2002-03-01

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60min in 2.5% SDS and electrophoresis was carried out at a voltage of 2V/cm for 2-2.5min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans.

  16. Uptake studies of environmentally hazardous 51Cr in Mung beans

    International Nuclear Information System (INIS)

    Attempt has been made to study the accumulation behaviour of a common plant, Mung bean (Vigna radiata) towards Cr(III) and Cr(VI) to have an insight on the migration and bio-magnification of Cr. For this purpose healthy germinated Mung bean seeds were sown in the sand in the presence of Hoagland's nutrient solution containing measured amount of K251Cr2O7 and 51Cr(NO3)3.9H2O. Growth rate was also studied in the presence and absence of phosphate salts in the medium. It has been found that the transfer of chromium from soil to plant is significantly low (maximum 5% for both Cr(III) and Cr(VI)). Maximum accumulation of Cr occurs in the root with respect to the total chromium accumulation by the plant. Other parts of the Mung bean plant, e.g. cotyledons, shoot and leaves, show negligible accumulation. Therefore, the chance of direct intake of Cr through food as well as through the grazing animals to human body is less. - The chance of bio-magnification of Cr(III) or Cr(VI) to human body via direct or indirect intake of Mung bean is negligible

  17. Phenolic compound in beans as protection against mycotoxins.

    Science.gov (United States)

    Telles, Annie Campello; Kupski, Larine; Furlong, Eliana Badiale

    2017-01-01

    Phenolic compounds, their inhibitory activity against fungal amylase and the occurrence of aflatoxins were determined in edible beans. The free, conjugated and bounded phenolic compounds and their phenolic acid profiles were determined in ten bean varieties. A method for aflatoxin B1, B2, G1 and G2 determination and confirmation by LC-MS/MS was validated. The red and carioca beans presented the highest total phenolic content (1.8 and 1.2mg.g(-1), respectively); the fradinho and white beans the lowest (0.18 and 0.19mg.g(-1), respectively). In the free and conjugated forms, chlorogenic acid was present in 60% of the samples, while in the bounded phenolic, ferulic acid was in 90% of the samples. The phenolic extracts were able to inhibit fungal amylase, and the PCA analysis confirmed that the relation between the chlorogenic and gallic acids is important to this effect. The absence of aflatoxins in samples confirm the protector effects of these phenolic compounds. PMID:27507478

  18. Utilization of half-embryo test to identify irradiated beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Federal Research Centre for Nutrition - BFE, Karlsruhe (Germany)

    1996-07-01

    Germination tests were carried out in irradiated and non-irradiated bean seeds which allow to observe characteristically variations on the shoots and roots. The methodology used in this work, is based upon biological changes which occur in two Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, irradiated in a {sup 60} Co source, with doses of 0,0.5, 1.0, 2.5, 5.0 and 10.0 kGy. The shoots and roots were observed during 3 days of culturing period under specified conditions. The differences observed in these two varieties were analysed immediately after irradiation and after 6 months of storage period at room temperature. Irradiated half-embryos showed markedly reduced root grow and almost totally retarded shoot elongation. Differences between irradiated and nonirradiated half-embryo could be observed after irradiation when different beans and storage time were varied. The shoots of half-embryos irradiated with more than 2.5 kGy did not undergo any elongation, whereas, the shoots of non-irradiated or those beans irradiated under 1.0 kGy elongated significantly within the 3 day test period. (author)

  19. Performance Evaluation of Rotating Cylinder Type Coffee Bean Roaster

    Directory of Open Access Journals (Sweden)

    Sutarsi

    2010-04-01

    Full Text Available One strategy attempts to reduce dependence on primary commodity markets are overseas market expansion and development of secondary products. In the secondary product processing coffee beans is required of supporting equipment to facilitate these efforts. Research Center for Indonesian Coffee and Cocoa has developed coffee bean roaster. However, there are still many people who do not know about the technical aspects of roaster machine type of rotating cylinder so that more people use traditional ways to roast coffee beans. In order for the benefits of this machine is better known society it is necessary to study on the technical aspects. The purpose of this research is to evaluate the technical performance of the coffee beans roaster machine type of rotating cylinder. These include the technical aspects of work capacity of the machine, roasting technical efficiency, fuel requirements, and power requirements of using roaster machine. Research methods are including data collection, calculation and analysis. The results showed that the roaster machine type of a rotating cylinder has capacity of 12.3 kg/hour. Roasting efficiency is 80%. Fuel consumption is 0.6 kg. The calculated amount of the used power of current measurement is the average of 0.616 kW.

  20. 21 CFR 184.1343 - Locust (carob) bean gum.

    Science.gov (United States)

    2010-04-01

    ... ingredient meets the specifications of the “Food Chemicals Codex,” 3d Ed. (1981), pp. 174-175, which is... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Locust (carob) bean gum. 184.1343 Section 184.1343 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED)...

  1. Diversity for cooking time in Andean dry bean

    Science.gov (United States)

    A diversity panel of 250 dry bean lines from the Andean gene pool was evaluated for cooking time. Cooking time ranged from 17 to 90 min with an average of 36 min. A faster cooking time was also correlated with a number of other seed characteristics, most notably, higher levels of boron and potassium...

  2. Studies on interference between newly defined bean-infecting potyviruses.

    NARCIS (Netherlands)

    Khan, J.A.

    1993-01-01

    Bean common mosaic virus (BCMV) and blackeye cowpea mosaic virus (BICMV) belonging to the genus Potyvirus of the plant virus family Potyviridae (Barnett, 1991, 1992) are of great economic importance. A large number of strains of BCMV and BlCMV are found to occur in nature, either in single or in mix

  3. Kinetic Analysis of Strains of Lactic Acid Bacteria and Acetic Acid Bacteria in Cocoa Pulp Simulation Media toward Development of a Starter Culture for Cocoa Bean Fermentation ▿

    OpenAIRE

    Lefeber, Timothy; Janssens, Maarten; Camu, Nicholas; De Vuyst, Luc

    2010-01-01

    The composition of cocoa pulp simulation media (PSM) was optimized with species-specific strains of lactic acid bacteria (PSM-LAB) and acetic acid bacteria (PSM-AAB). Also, laboratory fermentations were carried out in PSM to investigate growth and metabolite production of strains of Lactobacillus plantarum and Lactobacillus fermentum and of Acetobacter pasteurianus isolated from Ghanaian cocoa bean heap fermentations, in view of the development of a defined starter culture. In a first step, a...

  4. WATER NEEDS FOR WINTER BEAN CROP

    Directory of Open Access Journals (Sweden)

    A.E. Klar

    1997-09-01

    Full Text Available A study of water use by bean winter crop (Phaseolus vulgaris, L., cv. Carioca was carried out in a Red Yellow Latosol, clay texture. A furrow irrigation system maintained soil water potentials higher than -40 KPa. Two broadcast nitrogen treatments (0 and 30 kg N/ha were applied 25 days after planting. The major objectives were to study the nitrogen and evapotranspiration interaction and measure the crop coefficients (Kc. The maximum average evapotranspiration (ETm was 1.71 mm/day, or 157.16 mm over 92 days of observations; the ETm values for the vegetative (1, flowering (2 and pod formation (3 phases were 1.48, 2.35, and 1.50 mm/day, respectively, for the 30 kg/ha nitrogen treatment, and 1.48, 1.88 and 1.45 mm/day for the no nitrogen treatment. The crop coefficients (Kc = ETm / ETo were 0.62 and 0.78 for the phase 1, 0.80 and 1.10 for the phase 2, 0.45 and 0.55 for the phase 3 and 0.61 and 0.80 for the entire cycle, based on the FAO-Penman and Class A Pan reference methods (ETo, respectively. The latter one was the best approach to estimate maximum water use by winter bean crop. Nitrogen treatments did not affect evapotranspiration significantly. However, the measured evapotranspiration obtained from the water balance method was 59.78 and 27.12% higher in the flowering than in the vegetative phase, respectively, under 30 and 0 kg N/ha.Um estudo sobre o uso de água do feijoeiro de inverno (Phaseolus vulgaris L. cv. Carioca foi realizado num solo Latossol Vermelho Amarelo de textura argilosa. Um sistema de sulcos de infiltração foi usado para proceder a irrigação com o intuito de manter o solo em potenciais de água superiores a -40,0 KPa. Duas doses de aplicação de N em cobertura (0 a 30 Kg N/ha foram colocados 25 dias após o plantio. Os principais objetivos do estudo foram: avaliar a interação entre as duas doses de N com a evapotranspiração e medir os coeficientes de cultura (Kc. A evapotranspiração média máxima (ETm foi 1,71 mm

  5. Evaluation of some bean lines tolerance to alkaline soil

    Directory of Open Access Journals (Sweden)

    Abeer A. Radi

    2012-01-01

    Full Text Available Introduction: In less arid climates, salts are less concentrated and sodium dominates in carbonate and bicarbonate forms, which enhance the formation of alkaline soils. The development and identification of salt-tolerant crop cultivars or lines would complement salt management programs to improve the productivity and yields of salt stressed plants.Materials and methods: This work was to study the evaluation of alkalinity tolerance of some bean lines grown under different levels of sodium carbonate (Na2CO3 to select the most alkalinity tolerant lines versus the most-sensitive ones out of 6 lines of the test plants.Results: The symptoms induced by alkalinity included reduction in root, shoot growth, and leaf area which were more severe in some bean lines. Potassium leakage was severely affected by alkalinity in some lines at all tested levels, while in some others a moderate damage was manifested only at the higher levels. The increase in Na2CO3 level was associated with a gradual fall in chlorophyll a and b biosynthesis of all the test bean lines. However, alkalinity at low and moderate levels had a favorable effect on the biosynthesis of carotenoids in all the test bean lines. The increase in Na2CO3 supply had a considerable stimulatory effect on sodium accumulation, while potassium accumulation fluctuated in organs of bean lines.Conclusion: Assiut 1104 out of all the different lines investigated was found to display the lowest sensitivity to alkalinity stress, while Assiut 12/104 was the most sensitive one.

  6. The normal mycoflora of commodities from Thailand. 2. Beans, rice, small grains and other commodities.

    Science.gov (United States)

    Pitt, J I; Hocking, A D; Bhudhasamai, K; Miscamble, B F; Wheeler, K A; Tanboon-Ek, P

    1994-09-01

    Part of a comprehensive study of fungi occurring in commodities in Thailand, this paper reports results from 276 samples of mung beans, rice, sorghum and soybeans as well as other minor crops. Samples for major commodities were taken from farmers' stocks, middlemen and retail outlets, while those for minor crops were mostly from retail. Each sample was divided into two portions, one being examined in Bangkok and the second at North Ryde. Mycological examinations were carried out by direct plating after surface disinfection in chlorine. Media used were dichloran rose bengal chloramphenicol agar, dichloran 18% glycerol agar, Aspergillus flavus and parasiticus agar and dichloran chloramphenicol peptone agar. Fungi were identified to species level and percentage infection of samples calculated. The dominant fungus found in mung beans was Fusarium semitectum, which was present in 40% of samples and at a high level (18% of all seeds) overall. Aspergillus flavus was also found in 40% of samples, but only in 2% of seeds overall. Lasiodiplodia theobromae was the only other fungus exceeding 1% total infection. The major fungi found in soybeans were A. flavus (67% of samples; 6% overall) and Cladosporium cladosporioides (49% of samples; 9% overall). Storage fungi were more common in soybeans than the other commodities, indicating longer or adverse storage. Paddy rice contained high levels of a wide variety of field fungi, notably Fusarium semitectum, Bipolaris oryzae, and Curvularia, Phoma and Colletotrichum species. However, probably due to the heat generated by milling, milled rice contained very few fungi, which were mostly of storage origin. Only 3% of particles examined contained internal fungi. Infection in sorghum was typical of oilseeds, dominated by Aspergillus flavus, which was present in 86% of samples, with an overall infection rate of 12%. Beans other than soybeans were infected by a wide range of field fungi, but at low levels, with less than half of seeds

  7. Nutritional composition and cooking characteristics of tepary bean (Phaseolus acutifolius Gray) in comparison with common bean (Phaseolus vulgaris L.)

    Science.gov (United States)

    Tepary bean is a highly abiotic stress tolerant orphan crop, however, there has been limited research on its nutritional value and cooking characteristics, key aspects when considering the potential for broader adoption globally. The goal of this study was to evaluate a large set of seed composition...

  8. Assessment of the contribution of cocoa-derived strains of Acetobacter ghanensis and Acetobacter senegalensis to the cocoa bean fermentation process through a genomic approach.

    Science.gov (United States)

    Illeghems, Koen; Pelicaen, Rudy; De Vuyst, Luc; Weckx, Stefan

    2016-09-01

    Acetobacter ghanensis LMG 23848(T) and Acetobacter senegalensis 108B are acetic acid bacteria that originate from a spontaneous cocoa bean heap fermentation process and that have been characterised as strains with interesting functionalities through metabolic and kinetic studies. As there is currently little genetic information available for these species, whole-genome sequencing of A. ghanensis LMG 23848(T) and A. senegalensis 108B and subsequent data analysis was performed. This approach not only revealed characteristics such as the metabolic potential and genomic architecture, but also allowed to indicate the genetic adaptations related to the cocoa bean fermentation process. Indeed, evidence was found that both species possessed the genetic ability to be involved in citrate assimilation and displayed adaptations in their respiratory chain that might improve their competitiveness during the cocoa bean fermentation process. In contrast, other properties such as the dependence on glycerol or mannitol and lactate as energy sources or a less efficient acid stress response may explain their low competitiveness. The presence of a gene coding for a proton-translocating transhydrogenase in A. ghanensis LMG 23848(T) and the genes involved in two aromatic compound degradation pathways in A. senegalensis 108B indicate that these strains have an extended functionality compared to Acetobacter species isolated from other ecosystems. PMID:27217361

  9. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    Directory of Open Access Journals (Sweden)

    Bambang Drajat

    2007-07-01

    Full Text Available The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments referring to organic coffee development as an alternative export development. Data used in this study wastime series data ranging from 1995 to 2004 supported with some primary data.The export data were analyzed descriptively and the Revealed ComparativeAdvantage (RCA Index employed to analyze the competitiveness of Indonesian coffee bean export. The results of the analysis gave some conclusions, asfollows : (1 The export of Indonesian coffee bean was product oriented notmarket oriented. (2 The Indonesian coffee bean export was characterized withlow quality with no premium price, different from that of Vietnam coffee export. (3 Besides quality, the uncompetitive Indonesian coffee export was related to market hegemony by buyers, emerging issue of Ochratoxin A. contamination and high cost economy in export. (4 The competitiveness of Indonesian coffee export was lower than those other countries, such as Columbia,Honduras, Peru, Brazil, and Vietnam. (5 Indonesia still held opportunity todevelop organic coffee for export. Some policy implications emerged from thediscussion were as follows : (1 The Government should facilitate market development through the provisions of market information and export incentives.(2 The Government should develop and applied national standard of coffeebean referring to that of international, as well as, improve processing technology equipments in the farm level for both wet and dry process. (3 Besides improving quality, the improvement

  10. Disinfestation of copra, desiccated coconut and coffee beans using gamma irradiation

    International Nuclear Information System (INIS)

    Several pests attack copra in storage, the most prevalent of which is the copra beetle (CB), Necrobia rufipes De Geer. More coffee bean weevils (CBW), Araecerus fasciculatus De Geer, were found on the Arabica, Liberica and Excelsa coffee varieties than on Robusta. For mass rearing, the most efficient diet for CB was a combination of desiccated coconut + yeast (2:1) and for CBW, dried cassava chips + yeast (3:1). Using the above diets, the life cycle of CB was completed in 43-60 days and CBW in 42-56 days. The eggs of the two species were the most radiosensitive, followed by the larvae and the pupae. A dose of 0.05 kGy prevented adult emergency from the irradiated eggs and younger larvae, while doses of 0.10-0.25 kGy eliminated adult survival from the irradiated older larvae and pupae. However, 0.50 kGy was required to disinfest small packages of copra or coffee beans initially infested with immature stages of CB or CBW, respectively. Also, packaging irradiated commodities in polypropylene film bags, particularly those impregnated with permethrin, prevented reinfestation. The toxic residues of permethrin in the polypropylene film produced high insect mortality. Both CB and CBW were invaders rather than penetrators, since both species entered the packaging materials readily through existing openings in the jute, woven polypropylene or cotton bags. A dose of 6.0 kGy was required to eliminate Salmonella enteritidis from desiccated coconut. (author). 15 refs, 14 tabs

  11. Bean yellow disorder virus: Parameters of transmission by Bemisia tabaci and host plant range

    Institute of Scientific and Technical Information of China (English)

    German Martín; Isabel Maria Cuadrado; Dirk Janssen

    2011-01-01

    Bean yellow disorder virus(BnYDV)was recently identified as the first crinivirus(family Closteroviridae)that infects members of the family Leguminosae.It was first observed during the autumn of 2003,causing heavy losses in French bean (Phaseolus vulgaris L.)grown commercially in Spain.The virus is transmitted by the sweetpotato whitefly,Bemisia tabaci(Hemiptera:Aleyrodidae)Q-biotype,and disease symptoms resemble nutritional disorders consisting of interveinal mottling and yellowing in leaves,combined with stiffness or brittleness,and are typically produced on the middle to lower parts of the plant.Transmission experiments showed that 50% and 100% of B.tabaci adults acquired the virus after a feeding period of 3 and 7 h,respectively.Viruliferous whiteflies infected 66% and 100% of P.vulgaris plants after a feeding period of 12 and 24 h,respectively.The transmission efficiency of single whiteflies was 37% and persistence of BnYDV in the vector lasted up to 2 weeks with a half-life of 9 days.BnYDV was transmitted to P.vulgaris,Pisum sativum L.,Lens culinaris Medik.,and Vicia faba L.,but not to Vigna unguiculata L.,Glycine max(L.) Merr.,Cicer arietum L.,and to crop species belonging to families of the Solanaceae and Cucurbitaceae.No virus was detected in field samples collected from 30 different species from Boraginaceae,Asteraceae,Geraniaceae,Lamiaceae,Leguminosae,Malvaceae,Scrophulariaceae,Thymelaeaceae and Verbenaceae.The restricted host range and efficient management of crops regarding whitefly infestation may be key elements in the control of BnYDV.

  12. The environmental and intrinsic yeast diversity of Cuban cocoa bean heap fermentations.

    Science.gov (United States)

    Fernández Maura, Yurelkys; Balzarini, Tom; Clapé Borges, Pablo; Evrard, Pierre; De Vuyst, Luc; Daniel, H-M

    2016-09-16

    The environmental yeast diversity of spontaneous cocoa bean fermentations in east Cuba was investigated. Seven fermentations, 25 equipment- and handling-related samples, and 115 environmental samples, such as flowers, leaf and cocoa pod surfaces, as well as drosophilid insects, were analysed. The basic fermentation parameters temperature and pH were recorded during five fermentations for at least six days. A total of 435 yeast isolates were identified by a combination of PCR-fingerprinting of genomic DNA with the M13 primer and sequence analysis of DNA from representative isolates, using the internal transcribed spacer region, the D1/D2 region of the large subunit rRNA gene, and an actin gene-encoding fragment, as required. Among 65 yeast species detected, Pichia manshurica and Hanseniaspora opuntiae were the most frequently isolated species, obtained from five and four fermentations, followed in frequency by Pichia kudriavzevii from two fermentations. Saccharomyces cerevisiae was isolated only occasionally. Cocoa fermentation yeast species were also present on processing equipment. The repeated isolation of a preliminarily as Yamadazyma sp. classified species, a group of strains similar to Saccharomycopsis crataegensis from fermentations and equipment, and the isolation of fifteen other potentially novel yeast species in low numbers provides material for further studies. Environmental samples showed higher yeast diversity compared to the fermentations, included the most frequent fermentation species, whereas the most frequently isolated environmental species were Candida carpophila, Candida conglobata, and Candida quercitrusa. Potential selective advantages of the most frequently isolated species were only partly explained by the physiological traits tested. For instance, tolerance to higher ethanol concentrations was more frequent in strains of Pichia spp. and S. cerevisiae compared to Hanseniaspora spp.; the ability to also assimilate ethanol might have

  13. Phenotypic Variability and Diversity Analysis of Bean Traits of Some Cocoa Hybrids in Nigeria

    Directory of Open Access Journals (Sweden)

    A.V. Oyedokun

    2011-03-01

    Full Text Available It is essential to understand the economic potential and superiority among cocoa hybrids. Therefore, the present study aims at detecting variability among cocoa hybrids for bean index in Nigeria. Dried bean of fourteen genotypes of cocoa were evaluated for their bean values. Analysis of variance (ANOVA was used to understand the variability among the fourteen genotypes and Principal Component Analysis (PCA was employed to identify distinguishing traits and the grouping of the genotypes based on similarities. The fourteen cocoa genotypes were significantly (p≤0.05 different from each other with respect to weight of one bean, bean length, width, thickness, 100 bean weight, bean length to width, length to thickness and width to thickness ratio. All the studied morphometric characters exhibited high (>70% broad sense heritability. G8, the hybrid between T53/5 and N38 was the most superior genotype for bean weight and some other bean characteristics. The mass of seventy-four dried cocoa bean of G8 approximated 100 g. The first three Principal Component axes explained 91% of the total variation and the PCA grouped the fourteen genotypes into four distinct clusters. Genotypes could be selected for specific traits and improvement of traits seemed to be genetically reliable.

  14. Influence of the environment in 40K concentration in Brazilian common beans

    International Nuclear Information System (INIS)

    The consumption of beans constitutes an important dietary habit in many Latin American, Asian and African countries. Carioca beans and the black type stand out among the many consumed common beans in Brazil. 40K was used as a natural radiotracer to evaluate the influence of the season growing and the bean type in the potassium content into grain. The activity concentrations of 40K and 137Cs were evaluated on samples of beans by γ-ray spectrometry. 137Cs was less than 1.3 Bq kg-1. The highest potassium content in the grain were observed in the dry and winter seasons. The black beans showed higher potassium content than the carioca type. The potassium levels were compared with that of beans grown and consumed in other regions of the world. A method to estimate the bean consumption rates in Brazil independently of the location of the meal is proposed. The ingestion of common beans was estimated in 14.6 kg year-1 per person. The two regions with the highest consumption are the Southeast (19.2 kg year-1) and the Middle West (18.7 kg year-1), whose account for about 60 % of the intake of common beans is related to consumption out home. (author)

  15. Changes of sour taste and the composition of carboxylic acids induced in brewed coffee by γ-irradiation on green beans and storage of roast beans

    International Nuclear Information System (INIS)

    Brazil santos green coffee beans were irradiated with 60Co-γ rays at doses of 0, 0.05, 0.5 and 1.5 Mrad respectively and changes of the composition of carboxylic acids in roast beans were analyzed by means of GLC together with those of the organoleptic properties of roast beans during storage by use of the cup testing. The total acid content immediately after roasting was about 6,000 mg/100 g (roast beans) and the composition of carboxylic acids was as follows. Chlorogenic acid: hydroxy-carboxylic acids: mono-carboxylic acid: others = 73 : 18 : 7 : 2. Fresh coffee flavour was influenced markedly especially in acid taste by both irradiation of γ-rays on green beans and storage of roast beans, because of the change of above acids composition. On γ-ray irradiation, the change of the acid composition were more clear than that of stored roast beans. Therefore, the quality of γ-irradiated coffee beans seems to be closely associated with the ratio of hydroxy-carboxylic acids mg/ monocarboxylic acids mg, but little with total acid content. (author)

  16. Interactions Between QTL SAP6 and SU91 on Resistance to Common Bacterial Blight in Red Kidney Bean and Pinto Bean Populations

    Science.gov (United States)

    Resistance to common bacterial blight in common bean is a complex trait that is quantitatively inherited. We examined the interaction between two independent QTL, SAP6 and SU91, which condition resistance to CBB.The QTL were studied in a pinto bean F2 population a cross between Othello (sap6 sap6 //...

  17. Effects of Arbuscular Mycorrhizal Fungi on Cadmium Tolerance and Rhizospheric Fixation of Rice%AMF 对镉污染条件下水稻抗逆性及根际固定性的影响

    Institute of Scientific and Technical Information of China (English)

    王立; 安广楠; 马放; 吴洁婷; 张雪; 王敏

    2014-01-01

    为研究丛枝菌根真菌对重金属 Cd 胁迫条件下水稻生长及生理过程的影响,选用两种丛枝菌根真菌(Arbuscularmycorrhizal fungi,AMF):摩西球囊霉(Glomus mosseae, GM)和根内球囊霉(Glomus intraradice, GI),接种在不同 Cd 浓度(0、0.5、1、2、5 mg·kg-1)的污染土壤中,研究两种菌剂对水稻株高、光合作用、抗逆生理过程以及 Cd 在植株地上及根系分配的影响。结果表明,AMF 菌剂的接种显著减轻了 Cd 胁迫对水稻生长的抑制程度,GM 组与 GI 组水稻株高分别比对照组提高了13.8豫和10.3豫,且菌剂处理有助于缓解 Cd 胁迫对水稻光合作用的抑制。在5 mg·kg-1 Cd 胁迫下,水稻叶片中 MDA(丙二醛)含量显著降低, SOD(超氧化物歧化酶)活性和 Pro(脯氨酸)的含量显著提高(P<0.05)。两种菌剂处理下水稻对 Cd 的富集系数与转运系数均低于对照,表明 AMF 处理有助于缓解 Cd 对地上部分的毒害,并且促进了水稻对 Cd 的根际固定化过程,抑制了 Cd 向地上部分转移的趋势。%Arbuscular mycorrhizal fungi(AMF)have showed to improve plant resistance to and reduce translocation of heavy metals. Here we investigated the effects of Glomus mosseae(GM)and Glomus intraradices(GI)on the growth and physiological processes of paddy rice (Oryza sativa L.)grown in soil spiked with 0, 0.5, 1.0, 2.0 and 5.0 mg Cd·kg-1. Mycorrhizal inoculation significantly alleviated the inhibi-tion of rice growth caused by Cd stress. Plant height increased by 13.8%(GM)and 10.3%(GI)compared to the control; Inoculating AMF also relieved the inhibitory effect of Cd on rice photosynthesis. At the highest concentration of Cd in this experiment(5.0 mg·kg-1), the con-tent of malondialdehyde(MDA)decreased significantly while superoxide dismutase(SOD)activity and proline(Pro)concentration in-creased remarkbly(P<0.05). Compared with the control, AMF inoculation promoted the

  18. Distinction of Ecuadorian varieties of fermented cocoa beans using Raman spectroscopy.

    Science.gov (United States)

    Vargas Jentzsch, Paul; Ciobotă, Valerian; Salinas, Wilson; Kampe, Bernd; Aponte, Pedro M; Rösch, Petra; Popp, Jürgen; Ramos, Luis A

    2016-11-15

    Cocoa (Theobroma cacao) is a crop of economic importance. In Ecuador, there are two predominant cocoa varieties: National and CCN-51. The National variety is the most demanded, since its cocoa beans are used to produce the finest chocolates. Raman measurements of fermented, dried and unpeeled cocoa beans were performed using a handheld spectrometer. Samples of the National and CCN-51 varieties were collected from different provinces and studied in this work. For each sample, 25 cocoa beans were considered and each bean was measured at 4 different spots. The most important Raman features of the spectra were assigned and discussed. The spectroscopic data were processed using chemometrics, resulting in a distinction of varieties with 91.8% of total accuracy. Differences in the average Raman spectra of cocoa beans from different sites but within the same variety can be attributed to environmental factors affecting the cocoa beans during the fermentation and drying processes. PMID:27283632

  19. Algae as a Feedstock for Biofuels. An Assessment of the Current Status and Potential for Algal Biofuels Production. Joint Summary report of IEA-AMF Annex XXXIV-2 and IEA Bioenergy Task 39

    Energy Technology Data Exchange (ETDEWEB)

    O' Conner, D. [S and T2 Consultants, Inc. (Canada)

    2011-09-15

    In 2010, the IEA Advanced Motor Fuels Implementing Agreement and the IEA Bioenergy Task 39 both commissioned reports on the status and potential opportunities for Algal Biofuels. While there were substantial similarities in the findings of the two reports, each report provides unique perspectives on different aspects of the technology and the opportunities. This summary draws on both of those reports. The Task 39 report (Bioenergy Algal Biofuels.pdf) was authored by Al Darzins and Philip Pienkos (NREL, US) and Les Edye (BioIndustry Partners, Australia). The IEA AMF report was prepared by Karen Sikes and Ralph McGill (Sentech, Inc. US) and Martijn Van Walwijk (Independent Researcher).

  20. Total phenolic content, antioxidant and antimicrobial activities of stink bean (Parkia speciosa Hassk.) pod extracts

    OpenAIRE

    Suchanuch Wonghirundecha; Soottawat Benjakul; Punnanee Sumpavapol

    2014-01-01

    Parkia speciosa Hassk. is a stink bean known as “Sataw”. This bean is popular in the Southern part of Thailand and believed by the locals to have the medical properties. Stink bean pod, regarded as waste material, was reported to possess various biological activities. The aim of the present study was to investigate the total phenolic content, antioxidant and antimicrobial activities of Sataw-Khao and Sataw-Dan pod extracts. It was found that the extraction yield, total phenolic and ...

  1. Effects of Faba Bean (Vicia faba L.) Flour on Viability of Probiotic Bacteria During Kefir Storage

    OpenAIRE

    Souhila Boudjou; Farid Zaidi; Farah Hosseinian; B. Dave Oomah

    2014-01-01

    Whole ground faba bean was investigated for its capability and efficiency to enhance bacterial survival and growth during kefir storage. Microbial analyses, pH and total titratable acidity (TTA) were measured in kefir samples, containing starter cultures with or without probiotic bacteria, (Lactobacillus acidophilus and Bifidobacterium lactis) supplemented with whole ground faba bean during 28 days cold storage at 4 ºC. Faba bean flour supplementation (4%) stimulated bifidogenic microbial gro...

  2. Research on Development Strategy of Industry of Edible Beans in West China

    OpenAIRE

    Zhu, Zhou-ping; Xie, Song-feng; Li, Hai-ju; Zhou, Tao; Liu, Yun-hua; Zhang, Bao-jun

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the...

  3. Viruses of faba bean (Vicia faba L.) in Morocco; surveying, identification, and ecological aspects.

    OpenAIRE

    Fortass, M

    1993-01-01

    A systematic virus survey covering the main areas where faba bean ( Viciafaba L.) is grown in Morocco was conducted in 1988 and 1990. From the 240 leaf samples collected on the basis of symptoms suggestive of virus infection from 52 fields, the following viruses were detected by means of electron microscopy, biological indexing, and serology, and their incidence and geographical distribution were assessed: alfalfa mosaic virus (AMV), bean yellow mosaic virus (BYMV), broad bean mottle virus (B...

  4. Italian Common Bean Landraces: History, Genetic Diversity and Seed Quality

    Directory of Open Access Journals (Sweden)

    Angela R. Piergiovanni

    2010-05-01

    Full Text Available The long tradition of common bean cultivation in Italy has allowed the evolution of many landraces adapted to restricted areas. Nowadays, in response to market demands, old landraces are gradually being replaced by improved cultivars. However, landraces still survive in marginal areas of several Italian regions. Most of them appear severely endangered with risk of extinction due to the advanced age of the farmers and the socio-cultural context where they are cultivated. The present contribution is an overview of the state of the art about the knowledge of Italian common bean germplasm, describing the most important and recent progresses made in its characterization, including genetic diversity and nutritional aspects.

  5. ALIMENTARY ALLERGY AND HYPERSENSIVITY TO SOYA BEAN PROTEINS

    Directory of Open Access Journals (Sweden)

    V. B. Gervazieva

    2014-07-01

    Full Text Available Abstract. In connection with the increasing number of allergic diseases in Russia and in the world, the exogenic factor responsible for the development of food allergy in children have been discussed. The main types of alimentary allergens have been determined; their biochemical features, as well as aggravation of the food allergy clinical symptoms to the extent of anaphylaxis, have been reported. With the development of genetic engineering food products, the special attention has been paid to hypersensitivity to soya bean proteins. The major and minor allergens of soya beans, their homologues in other vegetable allergens, e.g. birch pollen allergens, have been described. (Med. Immunol., 2005, vol.7, № 1, pp. 15520

  6. Formaldehyde exposure affects growth and metabolism of common bean

    International Nuclear Information System (INIS)

    Recent state and federal directives have slated a substantial increase in the use of methanol as an alternative to gasoline in both fleet and private vehicles in the coming decade. The incomplete combustion of methanol produces formaldehyde vapor, and catalytic converter technology that completely oxidizes formaldehyde has yet to be developed. The approach of this study was to use a range of methanol concentrations encompassing levels currently found or that may occur in the future in the ambient air of some heavily polluted areas to test the potential phytotoxicity of formaldehyde. The study had the following objectives: (1) design and build a formaldehyde vapor generator with sufficient capacity for long-term plant fumigations; (2) determine growth response of common bean to formaldehyde; (3) evaluate physiological and biochemical changes of bean plants associated with formaldehyde exposures. 20 refs., 2 figs., 2 tabs

  7. BEANS - a software package for distributed Big Data analysis

    CERN Document Server

    Hypki, Arkadiusz

    2016-01-01

    BEANS software is a web based, easy to install and maintain, new tool to store and analyse data in a distributed way for a massive amount of data. It provides a clear interface for querying, filtering, aggregating, and plotting data from an arbitrary number of datasets. Its main purpose is to simplify the process of storing, examining and finding new relations in the so-called Big Data. Creation of BEANS software is an answer to the growing needs of the astronomical community to have a versatile tool to store, analyse and compare the complex astrophysical numerical simulations with observations (e.g. simulations of the Galaxy or star clusters with the Gaia archive). However, this software was built in a general form and it is ready to use in any other research field or open source software.

  8. Irradiation Effect on the symbiotic fixation of nitrogen in Bean (Phaseolus vulgaris L)

    International Nuclear Information System (INIS)

    The efficiency of legume - Rhizobium association is determined by biological (plant and bacteria) and environmental factors (soil and climate); for that reason, the best cultivars -Rhizobium strains combinations for each specie of legume must be selected according to the specifics environmental conditions. One of the most important sun light qualities are the irradiance levels to which the plants are exposed, because these levels have a close relation with the photosynthetic process, and also affect the biological nitrogen fixation, which has a high energetic requirements for symbiosis. The propose of this work was to determine the effect of irradiance on the Biological Nitrogen Fixation in common bean seedlings, under two environments conditions 100 and 500 moles m-2 seg-1 (IA and IB respectively), an nutrition control. The experimental results suggest that in the case of common bean, the irradiance requirements change depending on the Rhizobium strain that has be used in the symbiotic association. Both inoculated and non-inoculated plants with Rhizobium showed different behavior according to the levels of irradiance under which the plants were exposed. Under the irradiance of 500 moles m2 seg-1 (IA) the highest values of weight, area of plants, number and weight of nodules, nitrogen and phosphors content in leaves were founded, however under the lowest irradiance 100 μ moles m2 seg-1 (IB), the plants showed the largest root and steam, as a result of increase of bud distance, this behavior is known etiolation. The irradiance levels under which the plants are exposed determine the efficiency of symbiosis. The experimental results showed that the irradiance levels, no only affect the plant growth, but also the strains behavior. These results were easily observed in the treatments where ICA P-12 and ICA P-19 strains were used, for the dry weight of leaves, root and leaves area, number and weight of nodules, and nitrogen content of leaves in the plant. The ICA P-12

  9. Effects of Companion Crops (Bean, Soybean and Mungbean) on Uptake of Cadmium from Soil by Corn and Sunflower as the Main Crops

    OpenAIRE

    A. Hassanpour; M Zahedi; A. H. Khoshgoftarmanesh

    2014-01-01

    In a pot experiment, the effect of soybeans, mung beans and beans on the corn and sunflowers in a cadmium contaminated soil was studied in a completely randomized design with three replications. The treatments consisted of intercropping of corn and mung bean corn and beans, corn and soybean, sunflower and mung bean, sunflower and beans, sunflower and soybean monoculture of corn, and monoculture of sunflower. There were significant effects of cocropping of companion crops on shoot dry weigh, t...

  10. Susceptibility of leguminous green manure species to Rhizoctonia solani and Sclerotium rolfsii

    Directory of Open Access Journals (Sweden)

    Trazilbo José de Paula Júnior

    2011-12-01

    Full Text Available We studied the susceptibility of species used as green manure in common bean fields to root rot (Rhizoctonia solani and southern blight (Sclerotium rolfsii. Seeds of Crotalaria breviflora, Canavalia ensiformis, Cajanus cajan, Dolichos lablab, Stizolobium cinereum, S. aterrimum, and the bean cvs. "Pérola", "Valente" and "Carnaval" were sown in soil infested by either R. solani AG-4 or S. rolfsii in greenhouse. The emergence of D. lablab seedlings in soil infested by R. solani dropped to 62%. C. breviflora, C. ensiformis and cv. "Valente" presented the lowest root rot severity. The pathogen S. rolfsii drastically reduced seedling emergence in all species; no C. cajan and S. cinereum seedling emerged. All plant species presented high southern blight severity. We conclude that leguminous crops are not suitable as green manure for areas of bean cultivation with high R. solani and S. rolfsii populations.

  11. FLEXIBLE, RISK-ORIENTED MARKETING STRATEGIES FOR PINTO BEAN PRODUCERS

    OpenAIRE

    King, Robert P.; Lybecker, Donald W.

    1983-01-01

    A model designed to identify preferred postharvest marketing strategies for pinto bean producers is presented. The model evaluates flexible strategies that use current market information to determine whether or not storage should continue. Explicit consideration is given to price uncertainty and risk preferences. The results indicate that nearly all decision makers prefer flexible strategies to fixed strategies that call for a predetermined pattern of sales. They also show that the choice of ...

  12. Protein determination in soya bean by fast neutron activation analysis

    International Nuclear Information System (INIS)

    For a non-destructive determination of the protein content in soya bean samples, 14-MeV neutron activation analysis was applied. To check the method, the results obtained by X-ray fluorescence analysis and the Kjeldahl procedure were compared. For pressed pellet samples of about 1 g with 15 min irradiation and 10 min measuring times the accuracy of the protein determination was found to be 15%. (author) 7 refs.; 4 figs.; 3 tabs

  13. Co-application of herbicides and insecticides in dry bean

    OpenAIRE

    Peter H. Sikkema; Christy Shropshire; Robert E. Nurse; Nader Soltani

    2012-01-01

    Eight field trials were conducted from 2006 to 2008 at various locations in Ontario to evaluate the co-application of postemergence herbicides with cyhalothrin-lambda or dimethoate insecticides in cranberry and white bean. At 2 weeks after treatment, the addition of cyhalothrin-lambda or dimethoate insecticides to sethoxydim, quizalofop-p-ethyl, bentazon, fomesafen and bentazon plus fomesafen did not increase injury at the Exeter and Ridgetown locations except for bentazon plus dimethoate whi...

  14. Radiation disinfestation of dry leaf tobacco and coffee beans

    International Nuclear Information System (INIS)

    Preliminary tests conducted to determine the effect of gamma radiation in Araecerus fasciculatus De Geer indicated little differences in the mortality of insects exposed to 0.10-0.40 kGy. Other insects in the 2 kg bean lots were minimally affected by a dose of 0.05 kGy, but doses of 0.10-0.40 kGy resulted in nearly complete mortality. In 60 kg jute bags of export coffee exposed to 0.665-0.958 kGy, all the insects were dead when examined 1 month after irradiation. At 6 months, most of the untreated beans were damaged. In 15 kg tin cans, all the insects in both the irradiated and untreated cans were dead within 1 month; the insects in the untreated cans probably died from lack of oxygen and an increase in carbon dioxide. Irradiation had no detectable effect on the caffeine, fat and moisture contents, or on the pH. No moisture was gained by the coffee beans in cans, while the moisture in beans in jute bags increased from 9.6% to about 13.7% within 1 month. Export bales of leaf tobacco (about 100 kg, 100 cm x 75 cm x 40 cm) were artificially infested with Lasioderma serricorne (F.) and irradiated with 0.30-0.60 kGy at a rate of 0.5-1.0 kGy per hour. The bales were repositioned 12 times to provide thorough exposure to the gamma rays. There was no increase in the number of insects during the 6 months of storage; however, live insects were found at 2 months. Live insects found at the initial examination in phosphine fumigated bales indicated inadequate fumigation. A dose of 5 kGy had no effect on the nicotine content, the volatile oil content or composition, or the pH. (author). 11 refs, 3 figs, 10 tabs

  15. Microstructural Differences Among Adzuki Bean (Vigna Angularis) Cultivars

    OpenAIRE

    Engquist, Anup; Swanson, Barry G.

    1992-01-01

    Scanning electron microscopy (SEM) was used to study microstructural differences among five adzuki bean cultivars: Erimo, Express, Hatsune, Takara and VBSC. Seed coat surfaces showed different patterns of cracks, pits and deposits . Cross-sections of the seed coats revealed well organized layers of elongated palisade cells followed by many layers of amorphous parenchyma cells. Typical sub-epidermal layers of organized columnar, hour-glass cells were characteristica11y absent in the five culti...

  16. 力争第二的Coffee Bean

    Institute of Scientific and Technical Information of China (English)

    蔡正蓁

    2003-01-01

    一个小雨的午后,在新加坡繁华的Orchard大街上的连锁咖啡店“Coffee Bean & Tea Leaf”里,维克多·沙宣从他的座位上一跃而起,脱口而出:“下雨了,我得把屋顶打开。”短短几秒钟之内,在天井上方。

  17. Water infiltration in an ultisol after cultivation of common bean

    OpenAIRE

    Maria Aparecida do Nascimento dos Santos; Elói Panachuki; Teodorico Alves Sobrinho; Paulo Tarso Sanches de Oliveira; Dulce Buchala Bicca Rodrigues

    2014-01-01

    Water infiltration in the soil is an important hydrological process that occurs at the interface of the soil-atmosphere system; thus, the soil management practice used has a strong influence on this process. The aim of this study was to evaluate water infiltration in the soil and compare equations for estimating the water infiltration rate in an Ultisol after harvesting common bean (Phaseolus vulgaris L.) under simulated rainfall. Field tests with a rainfall simulator were carried out in thre...

  18. The cholesterol-raising factor from coffee beans.

    OpenAIRE

    Urgert, R.; Katan, M B

    1996-01-01

    Coffee beans and some types of coffee brew - not the regular types of coffee prepared with a paper filter or with soluble coffee granules - contain the diterpenes cafestol and kahweol. Cafestol and kahweol raise the serum concentration of cholesterol and triglycerides in humans, and they also appear mildly to affect the integrity of liver cells. Both effects are transient after withdrawal of the diterpenes, and it is as yet unsure whether these effects are associated. Patients at increased ri...

  19. Trichoderma spp. decrease Fusarium root rot in common bean

    Directory of Open Access Journals (Sweden)

    Hudson Teixeira

    2012-12-01

    Full Text Available The effectiveness of six Trichoderma-based commercial products (TCP in controlling Fusarium root rot (FRR in common bean was assessed under field conditions. Three TCP, used for seed treatment or applied in the furrow, increased seedling emergence as much as the fungicide fludioxonil. FRR incidence was not affected, but all TCP and fludioxonil reduced the disease severity, compared to control. Application of Trichoderma-based products was as effective as that of fludioxonil in FRR management.

  20. Disinfestation of copra and coffee beans by gamma-radiation: Studies on population density, rearing, biology, and adult irradiation

    International Nuclear Information System (INIS)

    This paper reports on the various studies conducted on some pests of copra and coffee beans in the Philippines with the ultimate goal of utilizing gamma-radiation for commodity treatment. Samples of copra collected from various warehouses in the three major islands yielded six species of beetles, one moth, one earwig, one psocid and three mites. The most prevalent among the pests in the copra beetle (CB), Necrobia rufipes De Geer. For the coffee bean weevil (CBW), Araecerus fasciculatus De Geer, robusta coffee was the least preferred as a host as compared with the other three commercial species. For rearing, the most efficient medium for CB was a combination of desiccated coconut + yeast (2:1); for CBW it was ground corn or copra pellet + wheat germ + yeast (5:3:1). Adult irradiation showed CBW to be more resistant than CB. A dose level of 0.50 to 0.75 kGy is needed for the control of CB and a dose level of 1.00 to 1.50 kGy for CBW

  1. Tannins, trypsin inhibitors and lectin cytotoxicity in tepary (Phaseolus acutifolius) and common (Phaseolus vulgaris) beans.

    Science.gov (United States)

    De Mejia, Elvira Gonzalez; Del Carmen Valadez-Vega, Maria; Reynoso-Camacho, Rosalia; Loarca-Pina, Guadalupe

    2005-09-01

    This study compared the levels of antinutritional components and cytotoxic effect of extracts, from tepary (Phaseolus acutifolius) and common (Phaseolus vulgaris) beans. Antinutritional factors were evaluated by determining their effect on the viability of epithelial cells isolated from rat small intestine. The protein and carbohydrates content were similar in all the genotypes studied (20 and 60%, respectively). Common beans presented higher content of trypsin inhibitors, tannins and lectins than tepary beans. There was not a significant correlation between tannins and cooking time. However, water absorption and cooking time correlated significantly (p lectin activity (1302-18161 Ul/mg) of extracts from different beans. Tannins, lectins, trypsin inhibitors and fat content differed between bean varieties whereas protein content was similar. The percent cellularity on rat epithelial cells was significantly different among protein extracts from different bean cultivars and ranged between 53.5% and 87.4% (p < 0.05). These results suggest that the incorporation of tepary beans in the diet would not alter the current nutritional contribution of common beans or introduce adverse toxic effects. The agronomic characteristics of tepary beans make them attractive for cultivation. However, the harder to cook phenomenon may be a limiting factor that needs further consideration. PMID:16187017

  2. Impact of Molecular Technologies on Faba Bean (Vicia faba L. Breeding Strategies

    Directory of Open Access Journals (Sweden)

    Tao Yang

    2012-07-01

    Full Text Available Faba bean (Vicia faba L. is a major food and feed legume because of the high nutritional value of its seeds. The main objectives of faba bean breeding are to improve yield, disease resistance, abiotic stress tolerance, seed quality and other agronomic traits. The partial cross-pollinated nature of faba bean introduces both challenges and opportunities for population development and breeding. Breeding methods that are applicable to self-pollinated crops or open-pollinated crops are not highly suitable for faba bean. However, traditional breeding methods such as recurrent mass selection have been established in faba bean and used successfully in breeding for resistance to diseases. Molecular breeding strategies that integrate the latest innovations in genetics and genomics with traditional breeding strategies have many potential applications for future faba bean cultivar development. Hence, considerable efforts have been undertaken in identifying molecular markers, enriching genetic and genomic resources using high-throughput sequencing technologies and improving genetic transformation techniques in faba bean. However, the impact of research on practical faba bean breeding and cultivar release to farmers has been limited due to disconnects between research and breeding objectives and the high costs of research and implementation. The situation with faba bean is similar to other small crops and highlights the need for coordinated, collaborative research programs that interact closely with commercially focused breeding programs to ensure that technologies are implemented effectively.

  3. Navy Bean Flour Particle Size and Protein Content Affect Cake Baking and Batter Quality(1).

    Science.gov (United States)

    Singh, Mukti; Byars, Jeffrey A; Liu, Sean X

    2015-06-01

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to 3 levels with navy bean starch. The effect of navy bean flour and its fractions at 3 levels of protein on cake batter rheology and cake quality was studied and compared with wheat flour samples. Batters prepared from navy bean flour and its fractions had higher viscosity than the cake flour. Reducing the protein content by addition of starch significantly lowered the viscosity of cake batters. The whole navy bean flour and coarse bean fraction cakes were softer than cakes made with wheat flour but had reduced springiness. Principal component analysis showed a clear discrimination of cakes according to protein. It also showed that low protein navy bean flour cakes were similar to wheat flour cakes. Navy bean flour with protein content adjusted to the level of cake (wheat) flour has potential as a healthy alternative in gluten-free cakes. PMID:25922214

  4. Changes in flavour and taste of irradiated coffee beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50krad, producing an insect mortality rate of 98.33% +-2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  5. Changes in Flavour and Taste of Irradiated Coffee Beans

    International Nuclear Information System (INIS)

    The possibility of changes in the smell and taste of coffee from beans submitted to irradiation for preservation is a significant gap in the programme devoted to increasing the product life time with such a process. Therefore, the main objective of the paper was to evaluate changes in aroma and flavour that can be noticed by the consumer. Coffee beans were given disinfestation doses of 50 krad, producing an insect mortality rate of 98.33% ± 2.89 in Araecerus fasciculatus (adult stage). The samples, provided by IBC, were from the same crop and free from pesticides. Some of the material was kept by that Institute for organoleptic tests. The remainder was sent to the National Institute of Technology for gas-chromatographic analysis. Should any significant changes be noticed, it could be assumed that the gamma-irradiation process would be rejected by the consumer. However, no significant change was observed in the most important characteristics, flavour and aroma, that might induce the consumer to reject irradiated coffee beans. (author)

  6. Caracterização de um isolado do Bean rugose mosaic virus (BRMV de Minas Gerais e estimativa de perdas em feijoeiro em infecção simples ou em conjunto com o BCMV Characterization of a Bean rugose mosaic virus (BRMV isolate from Minas Gerais, and yield loss estimate in beans upon single infection and double infection with BCMV

    Directory of Open Access Journals (Sweden)

    Gloria P. Castillo-Urquiza

    2006-10-01

    virus (BCMV. The protocol adopted for virus purification led to purified preparations with high yield, and the antisera obtained reacted with the maximum dilution tested (1:70.000 in indirect ELISA. From the 22 plant species tested as hosts, Chenopodium quinoa reacted with chlorotic local lesions, which evolved to mosaic and leaf distortion in non-inoculated leaves. Bean and soybean cultivars reacted with mosaic and leaf distortion of varying intensity, as expected for BRMV. The isolate was transmitted by Cerotoma arcuata to 33.3% of the inoculated plants. Single infection of 'Ouro Negro' and 'Novirex' beans caused a reduction in the total weight of pods per plant of 3.4% and 84.9%, respectively. Mixed infection with BCMV caused a reduction of pod weight per plant of up to 70.1% in 'Novirex' and up to 90.8% in 'Ouro Negro'.

  7. Genetic variability induced in winter rye (Secale cereale l.), soya bean (Glicine max merill.) and china aster (Callistephus chinensis L. Nees)

    International Nuclear Information System (INIS)

    Optimal treatments for mutation induction were established as follows: for China aster - treating seeds with gamma rays of 6-9 rad; for soya bean - irradiating seeds with fast neutrons of 100 rad, for rye - soaking the grains in water solutions of NEU (0.04% concentration) and of SA (1.5-2.0-2.5 mM concentration). The most interesting mutants of each species are kept in collection. They include the following mutants of China aster (homogamic) of soya bean (with tall and strong stems, with great leaves) and of winter rye (short-straw mutants, xanthina, with horizontal type of growth and with late senescence, combined with long spikes). (author)

  8. Effect of Gamma Radiation and Electron Beam on Microbiological Quality and Protein Patterns of 4 Selected Beans

    International Nuclear Information System (INIS)

    The aim of the present study was to evaluate the effect of gamma ray and electron beam on microbiological quality and protein pattern of four selected beans: mung beans, soy beans, peanuts and black beans. All beans samples were exposed to irradiation at doses of 0, 0.5, 1, and 2 kGy before evaluated for their microbiological quality using AOAC method and protein analysis by gel electrophoresis. Results showed that the amount of bacteria, yeast and mold of irradiated mung beans and peanuts were reduced, whereas these microbiological quality values remained relatively the same for irradiated soy beans and black beans compared to non-irradiated samples. In terms of protein analysis, the protein patterns of the irradiated beans were of the same quality as the non-irradiated samples. To further tested the effect of irradiation on the bean's protein at higher doses, all four selected beans were exposed to gamma ray at 10, 50, 100, 150 and 200 kGy. We found that the protein patterns of mung beans, peanuts and black beans were altered at doses above 50 kGy.

  9. Effect of Salt Stress on Three Green Bean (Phaseolus vulgaris L. Cultivars

    Directory of Open Access Journals (Sweden)

    Anna ASSIMAKOPOULOU

    2015-04-01

    Full Text Available Agriculture is increasingly forced to utilize marginal waters to meet its increasing demands, which in turn increases the risks of soil salinization and yield reduction in the arid and semi-arid areas of the Mediterranean basin. Given that the bean is an extremely salt sensitive species, the purpose of the present work was to study the effect of 0 and 75 mM sodium chloride (NaCl on leaf characteristics, growth, pod yield and ion accumulation of three green bean (Phaseolus vulgaris L. cultivars (‘Corallo Nano’, ‘Romano Bush Plaja’ and ‘Starazagorski’, widely used in Greece. Plants were grown in a greenhouse of Technological Educational Institute of Peloponnese in Messinia, Southern Greece, from April to June 2014, in hydroponics. The experimental design was the factorial completely randomized one with five replications; each replication consisted of the three plants grown on the same rockwool slab. The results of the majority of growth and yield parameters determined showed the superiority of ‘Corallo’ over ‘Romano’ whereas ‘Starazagorski’ tolerance was found to be intermediate. ‘Corallo’ tolerated NaCl salinity better due to its capacity for Na retention in the roots and maintaining appropriate K/Na and Ca/Na ratios, limiting the accumulation of toxic ions into actively growing shoots. The salt sensitivity of ‘Romano’ was related to its higher concentration of Na in the leaves and lower in the roots, to the greater decrease of the leaf number and leaf water content, as well as to the specific leaf area increase compared to the other two cultivars under saline conditions.

  10. Survey of Philippine coffee beans for the presence of ochratoxigenic fungi.

    Science.gov (United States)

    Alvindia, Dionisio G; de Guzman, Monica F

    2016-05-01

    In 2012 to 2014, Philippine green coffee beans from Coffea arabica in Benguet and Ifugao; Coffea canephora var. Robusta in Abra, Cavite, and Ifugao; and Coffea liberica and Coffea excelsea from Cavite were collected and assessed for the distribution of fungi with the potential to produce ochratoxin A (OTA). The presence of fungal species was evaluated both before and after surface sterilization. There were remarkable ecological and varietal differences in the population of OTA-producing species from the five provinces. Aspergillus ochraceus, A. westerdijkiae, and Penicillium verruculosum were detected from Arabica in Benguet and Ifugao while Aspergillus carbonarius, Aspergillus niger, and Aspergillus japonicus were isolated in Excelsa, Liberica, and Robusta varieties from Abra, Cavite, and Davao. Contamination by Aspergillus and Penicillium species was found on 59 and 19 %, respectively, of the 57 samples from five provinces. After disinfection with 1 % sodium hypochlorite, the levels of infection by Aspergillus and Penicillium fell to 40 and 17 %, respectively. A total of 1184 fungal isolates were identified to species level comprising Aspergillus sections Circumdati (four species), Clavati (one), Flavi (one), Fumigati (one), Nigri (three), and Terrie (one). Within section Circumdati, 70 % of A. ochraceus produced OTA as high as 16238 ng g(-1) while 40 % of A. westerdijkiae produced maximum OTA of 36561 ng g(-1) in solid agar. Within section Nigri, 16.76 % of A. niger produced OTA at the highest 18439 ng g(-1), 10 % of A. japonicus at maximum level of 174 ng g(-1), and 21.21 % of A. carbonarius yielded maximum OTA of 1900 ng g(-1). Of the 12 species of Penicillium isolated, P. verruculosum was ochratoxigenic, with a maximum OTA production of 12 ng g(-1). PMID:26814977

  11. Effects of AMF on soil improvement and maize growth in mining area under drought stress%干旱胁迫下AM真菌对矿区土壤改良与玉米生长的影响

    Institute of Scientific and Technical Information of China (English)

    李少朋; 毕银丽; 陈昢圳; 陈书琳; 张延旭; 孔维平; 王瑾

    2013-01-01

    以神东矿区塌陷区退化土壤为供试基质,以玉米为宿主植物,研究在干旱胁迫下,丛枝菌根真菌(arbuscular mycorrhizalfungi)对玉米生长和养分吸收的影响,以及对矿区退化土壤的改良作用.结果表明:干旱胁迫下,接种AMF显著提高了玉米根系侵染率和生物量,玉米叶片相对含水量和叶色值明显高于对照组;接种组玉米地上部分磷、氮、钙和根系部分磷、钾、钙含量显著增加;接种AMF后,玉米根际土壤总球囊霉素和易提取球囊霉素含量分别增加了36.2%和33%,且根际土壤中有机质含量显著增加.由此可见,接种AMF促进了玉米对矿质养分的吸收,缓解了干旱造成的玉米生长的不利影响,提高了根际土壤中有机质含量,对矿区退化土壤改良有重要意义.%Shendong mining area is one of the largest coalfield and the most important coal production base in China.Water is an important limiting factor of ecological and environmental protection in this area which belongs to the typical semi-arid,semi-desert plateau continental climate.Underground mining is the main form of coal mining,which would inevitably lead to ground subsidence.Surface moisture and nutrient loss form a large number of cracks were caused by the process.Water shortage have become a serious problem in mining area.However water is necessary for biological survival.Lack of water would hinder the growth of crop and exacerbate the agricultural drought.Arbuscular mycorrhizal fungi (AMF) is a ubiquitous symbiotic fungi.The symbionts body could be formed by AMF with more than 80% of terrestrial plant.It find that using AMF could promote to absorb mineral nutrients and water by plant,enhance the stress resistance and disease resistance of corn,improve the soil structure,increase the soil fertility,raise the survival rate of seedlings transplanting and ameliorate the vegetation restoration of land reclamation in coal mining subsidence area.Under drought

  12. The uptake of radionuclides by beans, squash, and corn growing in contaminated alluvial soils at Los Alamos National Laboratory

    International Nuclear Information System (INIS)

    Pinto beans (Phaselous vulgaris), sweet corn (Zea mays), and zucchini squash (Cucurbita pepo) were grown in a field pot study using alluvial floodplain soils contaminated with various radionuclides within Los Alamos Canyon (LAC) at Los Alamos National Laboratory, New Mexico. Soils as well as washed edible (fruit) and nonedible (stems and leaves) crop tissues were analyzed for tritium (3H), cesium (137Cs), strontium (90Sr), plutonium (238Pu and 239,240Pu), americium (241Am), and total uranium (totU). Most radionuclides, with the exception of 3H and totU, in soil and crop tissues from LAC were detected in significantly higher concentrations (p < 0.05) than in soil or crop tissues collected from regional background locations. Significant differences in radionuclide concentrations among crop species (squash were generally higher than beans or corn) and plant parts (nonedible tissue were generally higher than edible tissue) were observed. Most soil-to-plant concentration ratios for radionuclides in edible and nonedible crop tissues grown in soils from LAC were within default values in the literature commonly used in dose and risk assessment models. Overall, the maximum net positive committed effective dose equivalent (CEDE)--the CEDE plus two sigma for each radioisotope minus background and then all positive doses summed--to a hypothetical 50-year resident that ingested 352 lb ([160 kg]; the maximum ingestion rate per person per year) of beans, corn, and squash in equal proportions was 74 mrem y-1 (740 microS y-1). This upper bound dose was below the International Commission on Radiological Protection permissible dose limit of 100 mrem y-1 (1000 microS y-1) from all pathways and corresponds to a risk of an excess cancer fatality of 3.7 x 10s (37 in a million), which is also below the U.S. Environmental Protection Agency's guideline of 10-4. (author)

  13. Above- and belowground interactions drive habitat segregation between two cryptic species of tropical trees.

    Science.gov (United States)

    Pizano, Camila; Mangan, Scott A; Herre, Edward Allen; Eom, Ahn-Heum; Dalling, James W

    2011-01-01

    In the lowlands of central Panama, the Neotropical pioneer tree Trema micrantha (sensu lato) exists as two cryptic species: "landslide" Trema is restricted to landslides and road embankments, while "gap" Trema occurs mostly in treefall gaps. In this study, we explored the relative contributions of biotic interactions and physical factors to habitat segregation in T. micrantha. Field surveys showed that soils from landslides were significantly richer in available phosphorus and harbored distinct arbuscular mycorrhizal fungal (AMF) communities compared to gap soils. Greenhouse experiments designed to determine the effect of these abiotic and biotic differences showed that: (1) both landslide and gap species performed better in sterilized soil from their own habitat, (2) the availability of phosphorus and nitrogen was limiting in gap and landslide soils, respectively, (3) a standardized AMF inoculum increased performance of both species, but primarily on gap soils, and (4) landslide and gap species performed better when sterilized soils were inoculated with the microbial inoculum from their own habitat. A field experiment confirmed that survival and growth of each species was highest in its corresponding habitat. This experiment also showed that browsing damage significantly decreased survival of gap Trema on landslides. We conclude that belowground interactions with soil microbes and aboveground interactions with herbivores contribute in fundamental ways to processes that may promote and reinforce adaptive speciation. PMID:21560675

  14. Evaluation of the tepary bean (Phaseolus acutifolius) diversity panel for response to the NL 3 strain of Bean Common Mosaic Necrosis Virus (BCMNV) and for biological nitrogen fixation with Bradyrhizobium strains

    Science.gov (United States)

    Aphid-transmitted Bean Common Mosaic Necrosis Virus (BCMNV) and Bean Common Mosaic Virus (BCMV) are potyviruses that are seed transmitted in tepary bean. Developing resistance to these viruses will be critical for expanding production in areas where they are endemic. Biological nitrogen fixation (BN...

  15. Detecção do Southern bean mosaic virus no Paraná, e separação do Bean rugose mosaic virus em feijoeiro Detection of Southern bean mosaic virus in the State of Paraná and separation from Bean rugose mosaic virus in bean

    Directory of Open Access Journals (Sweden)

    Marcos D. G. Gasparin

    2005-02-01

    Full Text Available Em lavouras de feijoeiro (Phaseolus vulgaris da cultivar Carioca Comum, no município de Londrina, Estado do Paraná, foram encontradas plantas com sintomas de necrose da haste, mosaico clorótico leve e porte reduzido, semelhantes aos sintomas causados por infecção viral. Exames de microscopia eletrônica revelaram a presença de partículas isométricas. Em testes de imunodifusão dupla em gel de ágar os extratos foliares de plantas infetadas reagiram positivamente com anti-soro específico para o Southern bean mosaic virus (SBMV. O vírus foi purificado e a massa molecular de sua proteína capsidial foi estimada em 30 kDa, valor esperado para proteínas do capsídeo de vírus do gênero Sobemovirus. A gama de hospedeiras do SBMV isolado no Paraná foi restrita ao feijoeiro e a algumas cultivares de soja (Glycine max. A separação de dois vírus isométricos comuns em infecções mistas no feijoeiro foi possível através da reação de imunidade ao SBMV apresentada por Crotalaria sp, Chenopodium quinoa e Mucuna deeringiana, e da reação de susceptibilidade dessas mesmas hospedeiras ao Bean rugose mosaic virus (BRMV.Plants of bean (Phaseolus vulgaris, showing symptoms of stunt, stem necrosis and chlorotic mosaic, similar to those induced by virus infection were found in a bean field in Londrina, Paraná. Electron microscopy examinations showed isometric virus particles in the cell cytoplasm. Double immunodifusion serological tests with antiserum for Southern bean mosaic virus (SBMV gave positive results when tested against plant sap from infected bean plants. The virus was purified and the molecular mass of its coat protein was estimated as 30 kDa, the expected value for the coat protein of viruses from the genus Sobemovirus. The host range of the virus was restricted to bean and some soybean (Glycine max cultivars. It was possible to separate two isometric viruses commonly found in bean based on the immunity reaction of Crotalaria sp

  16. Hydrology and cycling of nitrogen and phosphorus in Little Bean Marsh : a remnant riparian wetland along the Missouri River in Platte County, Missouri, 1996-97

    Science.gov (United States)

    Blevins, Dale W.

    2004-01-01

    accounted for only 5 percent of the losses. Large residence times allows the marsh to greatly affect water quality before water escapes as ground-water recharge or surface outflow. The shallowness of Little Bean Marsh and ion exclusion during ice formation caused the highest specific conductances of 1,100 to 1,300 microsiemens per centimeter at 25 degrees Celsius to occur during the winter. This concentration of dissolved solutes under ice can make wetlands more vulnerable to toxic contaminants than deeper surface-water bodies. Dissolved oxygen was less than 5 mg/L (milligrams per liter) for 3 to 4 months and near 0 mg/L for about 1 month in summer. Despite depths of less than 1 meter, temperature stratification persisted more than 3 months during the summers of 1996 and 1997, preventing mixing and contributing to periods of anoxia. Shallow depths and extended periods of anoxia in the marsh limit the ability of some organisms to escape high-temperature stress. Turbidity in Little Bean Marsh usually was low for several reasons: sediment loadings from the largely flood-plain drainage were low, emergent vegetation shade out algae and shield the water from wind, and high concentrations of bivalent cations increase flocculation rates of inorganic suspended material. The high concentrations of bivalent cations was largely because of a substantial amount of ground-water seepage into the marsh. Dissolved organic nitrogen was the dominant nitrogen species in Little Bean Marsh. Denitrification and biotic uptake kept more than 62 percent of nitrate (NO3) and 43 percent of ammonium (NH4) concentrations in marsh samples less than a detection limit of 0.005 mg/L. This contrasts with the Missouri River where inorganic NO3 dominates. Consequently, artificial flood-plain drainage that bypasses riparian wetlands likely deliver substantially more biotically available inorganic nitrogen to receiving waters than surface water that has been routed through a remnant wetland. Aver

  17. Identification of quantitative trait loci associated with fructose, glucose and sucrose concentration in snap bean (Phaseolus Vulgaris L.) pods

    Science.gov (United States)

    Sugars, including fructose, glucose, and sucrose contribute significantly to the flavor and consumer acceptance of snap beans (Phaseolus vulgaris L.). Differences between dry and snap bean cultivars and among snap bean cultivars in the patterns of accumulation of sugars have been observed. In ‘Eagle...

  18. 78 FR 25623 - Importation of Fresh Beans, Shelled or in Pods, From Jordan Into the Continental United States

    Science.gov (United States)

    2013-05-02

    ... distributed within the United States. Currently, we do not allow the importation of fresh beans (Phaseolus... accessing Regulations.gov ). The PRA, titled ``Importation of Fresh Beans (Phaseolus vulgaris L.), Shelled... allow the importation of commercial shipments of fresh beans (Phaseolus vulgaris L.), shelled or in...

  19. Effect of partial genetic resistance on efficacy of Topsin fungicide for control of white mold disease in pinto bean

    Science.gov (United States)

    Pinto bean is the most important dry bean market class grown in the U.S., but is one of the most susceptible to white mold disease. Developing pinto bean with partial resistance is a major goal of plant breeders, but the effect of partial resistance on efficacy of fungicide application for disease m...

  20. A new method to select the drought resistance azuki bean germplasm

    Institute of Scientific and Technical Information of China (English)

    Chen Xin; Peerasak Srinives

    2006-01-01

    120 azuki bean germplasms from different regions of China were selected for drought-resistance. Results showed that there is a significant positive correlation between drought-resistance and photooxidation-resistance. So, the detecting technique for photooxidation-resistance should be suggested as a reference method to select the drought-resistance germplasms in azuki bean.

  1. Iron and zinc bioavailabilities to pigs from red and white beans (Phaseolus vulgaris L.) are similar

    Science.gov (United States)

    Common beans contain relatively high concentrations of iron (Fe) and zinc (Zn) but are also high in polyphenols and phytates, factors that may inhibit Fe and Zn absorption. In vitro (Caco-2 cells) and in vivo (pigs) models were used to compare Fe and Zn bioavailabilities between red and white beans,...

  2. Evaluation of tolerance to Bacillus thuringiensis toxins among laboratory-reared western bean cutworm (Lepidoptera: Noctuidae)

    Science.gov (United States)

    The Western bean cutworm (WBC), Striacosta albicosta, is a destructive insect pest of dry beans within its native range of western Nebraska and eastern Colorado. However, starting in the early 1990s, a range expansion of S. albicosta has resulted in damage to corn crops through the Midwest and more...

  3. Evaluation of common bean (Phaseolus vulgaris L.) collection for agromorphological and seed mineral concentration

    Science.gov (United States)

    A collection of common bean comprising totally 223 genotypes of which 176 genotypes from the USDA, 37 common bean landraces and 10 commercial cultivars from Turkey, evaluated for several agromorphological plant characters and mineral concentrations in seeds. There were wide range of variations for t...

  4. Yields and quality of Phaseolus bean cultivars under farmers’ conditions in eastern and southern Africa

    DEFF Research Database (Denmark)

    Jensen, Henning Høgh; Kamalongo, Donwell; Ngwira, Amos;

    2014-01-01

    Common bean (Phaseolus vulgaris L.) is a dominant grain legume in eastern and southern Africa, where it constitutes a major source of protein and microminerals in peoples’ diet. The current studies aimed at determining how initially promising genotypes of bean responded in terms of yield and grai...

  5. Registration of Drought Tolerant, Rust Resistant, High Yielding Pinto Bean Germplasm Line CO46348

    Science.gov (United States)

    Drought stress reduces dry bean (Phaseolus vulgaris L.) yield in more than 60 % of the production regions worldwide. The release of CO465348 will provide plant breeders with drought tolerant, pinto bean germplasm that takes advantage of full-growing season (95 to 98 d), has high yield potential, exc...

  6. Pinto Bean Hull Extract Supplementation Favorably Affects Markers of Bone Metabolism and Bone Structure in Mice

    Science.gov (United States)

    Dry edible beans (Phaseolus vulgaris) have many health benefits attributed to their high content of protein, non-digestible starches, fiber, and other bioactive components. Hulls from dry beans are rich in phenolics known to possess antioxidant activity that is beneficial to human health. The object...

  7. Selenium from Pinto Beans is Bioavailable to Support Bone Structure in Mice

    Science.gov (United States)

    Deficiency of selenium (Se), an essential trace mineral for animals and humans, has been shown to induce growth retardation and to impair bone metabolism. The objective of the study was to determine whether Se from pinto beans (SeBean) is as bioavailable as Se from selenomethionine (SeMet) to suppor...

  8. Draft Genome Sequence of Arthrobacter chlorophenolicus Strain Mor30.16, Isolated from the Bean Rhizosphere

    OpenAIRE

    Miranda-Ríos, José Antonio; Ramírez-Trujillo, José Augusto; Nova-Franco, Bárbara; Lozano-Aguirre Beltrán, Luis Fernando; Iturriaga, Gabriel; Suárez-Rodríguez, Ramón

    2015-01-01

    Bacteria of the genus Arthrobacter are commonly found in the soil and plant rhizosphere. In this study we report the draft genome of Arthrobacter chlorophenolicus strain Mor30.16 that was isolated from rhizosphere of beans grown in Cuernavaca Morelos, Mexico. This strain promotes growth and ameliorates drought stress in bean plants.

  9. Phenotype and seed production among hyacinth bean (Lablab purpureus L. Sweet) accessions rescued using hydroponic techniques

    Science.gov (United States)

    Hyacinth bean, Lablab purpureus L. (Sweet) is a legume used as a vegetable, forage, and in home gardens as an ornamental plant. Many accessions do not flower during their juvenile period in Byron, GA. Other hyacinth bean accessions produce few seed when regenerated in the field. This study was condu...

  10. Selection of markers for mapping and cloning disease resistance in common bean

    Science.gov (United States)

    Infestation of diseases is one of the major constraints of subsistence production and economic yield of common bean. Genetic resistance is an important component of integrated strategies to combat problematic diseases in common bean and development of cultivars with improved resistance to pest and d...

  11. A reference genome for common bean and genome wide analysis of dual domestications

    Science.gov (United States)

    Common bean (Phaseolus vulgaris) is the single most important grain legume for human consumption and, due to its ability to fix atmospheric nitrogen via symbioses with soil-borne microorganisms, has a valuable place in sustainable agriculture. We assembled 473 Mb of the common bean genome and geneti...

  12. Characterization of a Panela cheese with added probiotics and fava bean starch

    Science.gov (United States)

    Twenty Lactobacillus spp. and eight Bifidobacterium spp. were screened for their ability to ferment fava bean starch. B. breve ATCC 15700 and L. rhamnosus GG ATCC 53103 were selected as probiotics for use in fresh style Panela cheese. Two types of fresh cheese (with and without 3% fava bean starch) ...

  13. Response of Andean and Mesoamerican common bean genotypes to inoculation with rhizobium strains.

    Science.gov (United States)

    In most common bean (Phaseolus vulgaris L.) production regions of Latin America, inoculants are rarely used by farmers in spite of several studies that demonstrate the importance of Rhizobium inoculation on commercial production of legume crops. This study investigated specific bean host plant-Rhizo...

  14. Variability of root traits in common bean genotypes at different levels of phosphorus supply and ontogenetic stages

    Directory of Open Access Journals (Sweden)

    Roberto dos Santos Trindade

    2014-08-01

    Full Text Available Selection of common bean (Phaseolus vulgaris L. cultivars with enhanced root growth would be a strategy for increasing P uptake and grain yield in tropical soils, but the strong plasticity of root traits may compromise their inclusion in breeding programs. The aim of this study was to evaluate the magnitude of the genotypic variability of root traits in common bean plants at two ontogenetic stages and two soil P levels. Twenty-four common bean genotypes, comprising the four growth habits that exist in the species and two wild genotypes, were grown in 4 kg pots at two levels of applied P (20 and 80 mg kg-1 and harvested at the stages of pod setting and early pod filling. Root area and root length were measured by digital image analysis. Significant genotype × P level and genotype × harvest interactions in analysis of variance indicate that the genotypic variation of root traits depended on soil nutrient availability and the stage at which evaluation was made. Genotypes differed for taproot mass, basal and lateral root mass, root area and root length at both P levels and growth stages; differences in specific root area and length were small. Genotypes with growth habits II (upright indeterminate and III (prostrate indeterminate showed better adaptation to limited P supply than genotypes of groups I (determinate and IV (indeterminate climbing. Between the two harvests, genotypes of groups II and III increased the mass of basal and lateral roots by 40 and 50 %, respectively, whereas genotypes of groups I and IV by only 7 and 19 %. Values of the genotypic coefficient of determination, which estimates the proportion of phenotypic variance resulting from genetic effects, were higher at early pod filling than at pod setting. Correlations between shoot mass and root mass, which could indicate indirect selection of root systems via aboveground biomass, were higher at early pod filling than at pod setting. The results indicate that selection for root

  15. Coefficients of leaf-fruit translocation for 60Co, 90Sr and 137Cs in bean plant (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    Due to the increasing use of nuclear fission for the generation of electrical energy, the safety aspects of power plants must be minutely appraised. In case of an accident, with liberation of radioactive material into the atmosphere, knowledge about the behavior of plant species when in contact with radionuclides is indispensable. An important route through which agricultural products are contaminated by radionuclides is leaf-fruit translocation. This phenomenon can be evaluated by simulating a fallout contamination in a controlled atmosphere using as a tracer man-made radionuclides. In order to quantity the leaf-fruit translocation coefficients for 60Co, 90Sr and 137Cs in the common bean (Phaseolus vulgaris), variety black diamond, an experiment was carried out in a greenhouse with completely randomized blocks design with six treatments and four blocks. A mixture of these three radionuclides was prepared and used to determine their translocation coefficients. The bean plants were contaminated inside a device especially designed to avoid environmental contamination. In each treatment four vases were sprinkled and one was used to estimate the initial activity of the other three vases. High-resolution gamma-ray spectrometry was used for 60Co and 137Cs activity determinations and chemical separation followed by beta counting of 90Y was used for 90Sr determinations. The number of treatments was reduced from six to four sprayings corresponding to 30, 45, 60 and 75 days after planting. This reduction was due to the attack of common and gold mosaic viroses. Symptoms were observed on the diseased bean plants 50 days after planting. It was possible, however, to verify a functional dependence between instant of tracer application and the level of physiological development of the bean plant. It was verified that the temporal relationship values for leaf-fruit translocation were similar for 60Co and 137Cs. For the 90Sr, the translocation was below 2,5 mBq kg-1/Bq kg-1, 0

  16. Effect of sunflower climbing bean intercroping system on insect pest incidence and crop productivity

    International Nuclear Information System (INIS)

    Intercropping of sunflower and climping beans were evaluated for pest incidence and yield advantages during the main season of 2000/2001 at KARI-NPBRC, Njoro. Three sunflower varieties, Fedha, Record, PAN-7553 and three climbing beans varieties, Puebla, Omukingi and Flora were laid out in a complete randomised block design with four replications. Sunflower was spaced at 75 x 30 cm while the climbing beans were spaced at 50 x 37.5 cm. Assessment of pest damage on various treatments commenced 17 days after planting. Results showed that low plant germination was mainly a result of dry weather and taht cutworm damage was insignificant. There was a sunflower x climbing bean variety interaction, which regulated the aphid infestation of the climbing beans. Sunflower variety PAN-7553 recorded significantly (P<0.01) more pecked heads than the other two varieties. (author)

  17. Effect of 60Co-γ ray irradiation on green coffee beans, 1

    International Nuclear Information System (INIS)

    Green coffee beans were irradiated with 60Co-γ rays at doses of 0, 0.05, 0.5, 5.0 and 10.0 Mrad and the changes of general components in green and roast coffee beans were investigated together with those of the organoleptic properties of roast beans during storage according to the cup testing. In case of Brazil santos beans, irradiation of some 0.05 Mrad 60Co-γ ray gave rather favourable mild flavour and no harmful influence on the quality of coffee, and moreover, would tend to extend the shelf life of roast beans. But influence of irradiation on the quality of coffee differed somewhat between two cultivars, Brazil santos and Colombia. (auth.)

  18. Uncertainty measurement in the homogenization and sample reduction in the physical classification of rice and beans

    Directory of Open Access Journals (Sweden)

    Dieisson Pivoto

    2016-04-01

    Full Text Available ABSTRACT: The study aimed to i quantify the measurement uncertainty in the physical tests of rice and beans for a hypothetical defect, ii verify whether homogenization and sample reduction in the physical classification tests of rice and beans is effective to reduce the measurement uncertainty of the process and iii determine whether the increase in size of beans sample increases accuracy and reduces measurement uncertainty in a significant way. Hypothetical defects in rice and beans with different damage levels were simulated according to the testing methodology determined by the Normative Ruling of each product. The homogenization and sample reduction in the physical classification of rice and beans are not effective, transferring to the final test result a high measurement uncertainty. The sample size indicated by the Normative Ruling did not allow an appropriate homogenization and should be increased.

  19. Mineral composition of some varieties of beans from Mediterranean and Tropical areas.

    Science.gov (United States)

    Di Bella, Giuseppa; Naccari, Clara; Bua, Giuseppe Daniel; Rastrelli, Luca; Lo Turco, Vincenzo; Potortì, Angela Giorgia; Dugo, Giacomo

    2016-01-01

    In this study has been evaluated the mineral composition (Cd, Pb, As, Hg, Ba, Cr, Co, Ni, Se, Sb, V, Cu, Fe, Zn, Mo, Na, K, Ca, Mg) of some varieties of bean (Phaseolus vulgaris, Vigna unguiculata and V. angularis) from Mediterranean and Tropical areas of the world (Italy, Mexico, India, Japan, Ghana and Ivory Coast); the correlation between beans mineral composition in micro and macroelements and botanical and/or geographical origin; trace elements dietary intake by beans consumption. The results showed a correlation between beans mineral composition and their geographical origin, with higher values in Ivory Coast samples. Moreover, minerals content found confirmed the importance of these legumes in the diet for the significant content of essential micro and macroelements and a safe consumption of beans for the low residual levels of toxic metals. PMID:26940501

  20. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    OpenAIRE

    Nozomi Satoh; Tatsuya Kon; Noriko Yamagishi; Tsubasa Takahashi; Tomohide Natsuaki; Nobuyuki Yoshikawa

    2014-01-01

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic sym...

  1. Reduction of viral load in whitefly (Bemisia tabaci Gen.) feeding on RNAi-mediated bean golden mosaic virus resistant transgenic bean plants.

    Science.gov (United States)

    de Paula, Nayhanne T; de Faria, Josias C; Aragão, Francisco J L

    2015-12-01

    The RNAi concept was explored to silence the rep gene from the bean golden mosaic virus (BGMV) and a genetically modified (GM) bean immune to the virus was previously generated. We investigated if BGMV-viruliferous whiteflies would reduce viral amount after feeding on GM plants. BGMV DNA amount was significantly reduced in whiteflies feeding in GM-plants (compared with insects feeding on non-GM plants) for a period of 4 and 8 days in 52% and 84% respectively. PMID:26297125

  2. Short term toxicity studies of irradiated black beans (P. vulgaris)

    International Nuclear Information System (INIS)

    In 1980, we presented a paper on irradiated black beans with the dose levels of 0.2 and 0.5 kGy to verify the mutagenic potentiality, using male mice. The dose level required for insect disinfestation of the legume referred to is 0.1 kGy. At this time, we resolved to repeat the dominant lethal test with the same product and kind of animals, but with increasing dose levels to appraise its effects on the reproduction of these animals. In this study we carried out work related to the evaluation of the mutagenic potential of the irradiated black beans with 0, 1.0, 5.0, 10.0, 15.0 and 20.0 kGy, and the biological value evaluation of the same irradiated legume with 0, 0.5, 5.0 and 10.0 kGy respectively, in male mice and rats. For the dominant lethal test, the following parameters were analysed: body weight (only males), pregnancy rates, total implants, live implants, dead implants, distribution of sexes and abnormality in foetuses. In general, the variations found cannot be considered as being the result of radiation. This can be verified through the outcome from the groups which were fed non-irradiated and irradiated black beans, and commercial rations. For biological protein value, the following parameters were tested: alimentary efficacy ratio, protein efficacy ratio, net protein utilization, biological value and digestibility. We observed small variations in the results obtained. These small differences were considered not significant and not attributable to the irradiation treatment. (author)

  3. Gamma Radiosensitivity Study on Long Bean (Vigna sesquipedalis

    Directory of Open Access Journals (Sweden)

    Ellyfa Kon

    2007-01-01

    Full Text Available This study was conducted to determine the LD50 and effect of gamma ray on germination percentage, plant height, survival percentage, root length, root dry weight and shoot dry weight of seedlings derived from seeds of long bean (Vigna sesquipedalis. Seeds of this crop were treated with 300, 400, 500, 600 and 800 Gy gamma rays at Malaysian Institute of Nuclear Technology (MINT. The treated seeds including control were sown in sand beds in size 4.6 x 0.7 m2 in a greenhouse at Horticulture Unit, Universiti Putra Malaysia Bintulu Campus (UPMKB. After germination, plants were transferred into polybags. Each polybag contained 1.2 kg blended growth medium with top soil, sand, and processed chicken dung ratio of 3:2:1. Standard procedures were used to observe and record the variables studied in this research. The experiment was designed as a 4 x 6 factorial Completely Randomized Design with 3 replications. Lethal dose 50 % of population (LD50 was assayed. The study revealed that germination percentage, plant height, survival percentage, root length, root dry weight and shoot dry weight decreased with increasing dose of gamma ray. The 800 Gy gamma ray dose in particular had a pronounced effect on these morphological characteristics probably because of injury it might have caused to the seeds of the long bean. As a result, poor growth and development was noticed. The LD50 for survival and height ranged between 600-800 Gy and 400-500 Gy, respectively. Generally, higher gamma ray doses particularly 800 Gy significantly affected the morphological characteristics of long bean seedlings obtained from irradiated seeds.

  4. Induced mutations for the improvement of bambara groundnut (Voandzeia subterranea (L.) Thou.), cowpea (Vigna unguiculata (L.) Walp.) and winged bean (Psophocarpus tetragonolobus (L.) D.C.)

    International Nuclear Information System (INIS)

    A mutation breeding programme to produce mutants with resistance to weevil damage in cowpea, high yield in bambara groundnut and erect growth habit in winged bean was started in 1985. Dry seeds were irradiated using a 60Co source of gamma rays at doses of 350, 250 and 0-350 Gy for cowpea, winged bean, and bambara, respectively. The highest percentage of germination and greatest variability in pods per plant and seed yield per plant occurred at the 150 Gy dose, while vegetative mutants were more frequent at higher doses in bambara groundnut. Several forms of abnormal stem and leaf characteristics occurring within the first to sixth leaf stages of growth were observed in M1 winged bean plants. Seeds with lighter testa colour which showed some resistance to weevil damage were observed in the M1 seed lot of the cowpea variety TVX 1843-1C. Single plant selection for the desirable agronomic traits will be done in the M2 generation for the three crop species. (author). 6 refs, 3 figs, 3 tabs

  5. A study of arsenic speciation in soil, irrigation water and plant tissue: A case study of the broad bean plant, Vicia faba.

    Science.gov (United States)

    Sadee, Bashdar A; Foulkes, Mike E; Hill, Steve J

    2016-11-01

    Samples of soil, the broad bean plant, Vicia faba and irrigation water were collected from the same agricultural site in Dokan, in the Kurdistan region of Iraq. Total arsenic and arsenic speciation were determined in all materials by ICP-MS and HPLC-ICP-MS, respectively. Available arsenic (11%) was also determined within the soil, together with Cd, Cr, Cu, Ni, Zn, Fe and Mn. The concentrations of total arsenic were: soil (5.32μgg(-1)), irrigation water (1.06μgL(-1)), roots (2.065μgg(-1)) and bean (0.133μgg(-1)). Stems, leaves and pods were also measured. Inorganic As(V) dominated soil (90%) and root (78%) samples. However, organo-arsenic (MMA, 48% and DMA, 19%) was the more dominant species in the edible bean. The study provides an insight into the uptake, preferred disposal route, speciation changes and loss mechanism involved for arsenic with this food source. PMID:27211659

  6. Agronomic performance of velvet bean at different spatial arrangement; Desempenho agronomico de mucuna-verde em diferentes arranjos espaciais

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Aijanio Gomes de Brito; Goncalves Junior, Murilo [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil); Guerra, Jose Guilherme Marinho; Costa, Janaina Ribeiro; Espindola, Jose Antonio Azevedo; Araujo, Ednaldo da Silva, E-mail: gmguerra@cnpab.embrapa.b, E-mail: janaina@cnpab.embrapa.b, E-mail: jose@cnpab.embrapa.b, E-mail: ednaldo@cnpab.EMBRAP [EMBRAPA Agrobiologia, Seropedica, RJ (Brazil)

    2011-06-15

    The objective of this work was to evaluate the effect of different plant spatial arrangements on agronomic performance of velvet-bean (Mucuna pruriens var. utilis). The experiment was performed with eight treatments, distributed in a randomized complete block design in a 2x4 factorial arrangement, with four replicates. The treatments were velvet bean sowing at two spacings between furrows (0.5 and 1.0 m) and four plant densities (2, 4, 8 and 16 plants m{sup -1}). Determinations were made for the soil covering and biological nitrogen fixation (BNF) rates, and for the dry matter yield and N accumulation in the plant shoots. Total soil cover was accomplished at 50 days after sowing at 16 plants m{sup -1} density and 0.5 m spacing between furrows. The combination of 16 plants m{sup -1}1density with the 1.0 m spacing between furrows provided the greatest dry matter yield and accumulated most N in the plant shoots. Irrespective of the plant spatial arrangement, the estimation of BNF in this species shows that about 70% N present in the shoot is derived from the atmosphere. (author)

  7. Studies on semi-technical separation of Mung bean starch

    Energy Technology Data Exchange (ETDEWEB)

    Haase, N.U.; Tegge, G.; Thu, N.M. (Bundesforschungsanstalt fuer Getreide- und Kartoffelverarbeitung, Detmold (Germany, F.R.))

    1991-02-01

    Starch of mung beans is the raw material for high grade glass noodles, but until now industrial starch separation is often less efficient. For testing new fields of commercial use it is of benerfit to experiment with very pure starches. Regarding this, possibilities of starch isolation on a semi-technical scale are described, which resulted in most pure starches. Crude protein content could be lowered down to 0.3% and crude fibre content down to 0.5% dry matter base. (orig.).

  8. Use of 32P in aluminum sensibility tests with bean

    International Nuclear Information System (INIS)

    Four greenhouse experiments were conducted to study the possibility of using 32P in aluminium tolerance tests of bean (Phaseolus vulgaris L.). The cultivars were previously classified according to dry matter yield date by regression analysis as aluminium tolerant (C20-Mulatinho Paulista; C26-Ricobaio 1014 and C33-Roxo 750) and aluminium sensitive (C17-Jamapa; C28-Rio Tibagi and C34-Tambo). Chopped roots from plant grown in a complete nutrient solution during 30 days and submerged in another solution containing aluminium showed to be a reliable indicator of 32P absorption efficiency to aluminium tolerant and sensitive cultivars. (M.A.C.)

  9. Drought resistance characters of induced mung bean mutants

    International Nuclear Information System (INIS)

    The induced mung bean mutants were studied at three stages (the seedling stage, the flower and pod stage, the filling stage) by the means of synthetical indexes and the theory of grey systems. An excellent mutant with better drought resistance character than CK1 in all three stages and than CK2 in the seedling and the filling stages was found. As the orders of the drought resistance varied with the growth period, the drought resistance of one period can not replace that of the whole life period

  10. Response of Dry Bean to Sulfentrazone Plus Imazethapyr

    OpenAIRE

    Nader Soltani; Christy Shropshire; Peter H. Sikkema

    2014-01-01

    Field studies were conducted in 2010 and 2011 at the Huron Research Station, Exeter, Ontario and from 2009 to 2011 at the University of Guelph Ridgetown Campus, Ridgetown, Ontario to evaluate the sensitivity of four market classes of dry bean to sulfentrazone applied preemergence at 105, 140, and 280 g ai/ha alone and in combination with imazethapyr at 37.5 g ai/ha. At 1 week after emergence (WAE), sulfentrazone alone or in combination with imazethapyr at all doses evaluated caused no signifi...

  11. Osmoregulation and nutritional relationships between Orobanche foetida and faba bean

    OpenAIRE

    Abbes, Zouhaier; Kharrat, Mohamed; Delavault, Philippe; Chaïbi, Wided; Simier, Philippe

    2009-01-01

    The present study aims at comparing the phloem composition of the tolerant XBJ90.03-16-1-1-1 and the susceptible Bachaar genotypes and the impact of the faba bean genotype on the levels of the major solutes and invertase activities in the parasite Orobanche foetida. In comparison to Bachaar, the XBJ90.03-161-1-1 genotype limited the growth of orobanche tubercles under in vitro conditions. The limited growth was due to low soluble invertase activity, low osmotic potential of the infected roots...

  12. Texture losses of green beans along frozen storage

    OpenAIRE

    R.C. Martins; Silva, C. L. M.

    2000-01-01

    The texture loss of frozen green beans ( Phaseolus vulgaris, L., variety Bencanta) was macroscopically evaluated by a puncture test, using the INSTRON (Universal Testing Machine, model 4500) with a 4,85 mm diameter plunger, along 250 days of isothermal storage at -7, -15 and -30°C. The force deformation curves were recorded for data analysis of: i) Energy - the area below the force deformation curve, as a measurement of the resistance to compression by the plunger, ii) Stress at the fai...

  13. Induced mutations for a determinate habit in rice bean

    International Nuclear Information System (INIS)

    Induced mutation techniques were used to create polygenic variability in rice bean (Vigna umbellata). Dry seeds of the genotype (sel. I) were irradiated with 40-80 kR of gamma rays at 10 kR intervals. A wide variation in quantitative characters was induced in both the M2 and M3 generations. Some mutants were isolated that showed a determinate growth habit, earliness, a high yield and photoinsensitivity. These mutants were found to be breeding true. (author). 5 refs, 1 tab

  14. Influence of Rhizoctonia solani and Trichoderma spp. in growth of bean (Phaseolus vulgaris, L. and in the induction of plant defence-related genes

    Directory of Open Access Journals (Sweden)

    Sara eMayo

    2015-09-01

    Full Text Available Many Trichoderma species are well-known for their ability to promote plant growth and defence. We study how the interaction of bean plants with R. solani and/or Trichoderma affect the plants growth and the level of expression of defence-related genes. Trichoderma isolates were evaluated in vitro for their potential to antagonize R. solani. Bioassays were performed in climatic chambers and development of the plants was evaluated. The effect of Trichoderma treatment and/or R. solani infection on the expression of bean defence-related genes was analysed by real-time PCR and the production of ergosterol and squalene was quantified. In vitro growth inhibition of R. solani was between 86% and 58%. In In in vivo assays, the bean plants treated with Trichoderma harzianum T019 always had an increased size respect to control and the plants treated with this isolate did not decrease their size in presence of R. solani. The interaction of plants with R. solani and/or Trichoderma affects the level of expression of seven defence-related genes. Squalene and ergosterol production differences were found among the Trichoderma isolates, T019 showing the highest values for both compounds. T. harzianum T019 shows a positive effect on the level of resistance of bean plants to R. solani. This strain induces the expression of plant defence-related genes and produces a higher level of ergosterol, indicating its ability to grow at a higher rate in the soil, which would explain its positive effects on plant growth and defence in the presence of the pathogen.

  15. Syntenic relationships among legumes revealed using a gene-based genetic linkage map of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    McConnell, Melody; Mamidi, Sujan; Lee, Rian; Chikara, Shireen; Rossi, Monica; Papa, Roberto; McClean, Phillip

    2010-10-01

    Molecular linkage maps are an important tool for gene discovery and cloning, crop improvement, further genetic studies, studies on diversity and evolutionary history, and cross-species comparisons. Linkage maps differ in both the type of marker and type of population used. In this study, gene-based markers were used for mapping in a recombinant inbred (RI) population of Phaseolus vulgaris L. P. vulgaris, common dry bean, is an important food source, economic product, and model organism for the legumes. Gene-based markers were developed that corresponded to genes controlling mutant phenotypes in Arabidopsis thaliana, genes undergoing selection during domestication in maize, and genes that function in a biochemical pathway in A. thaliana. Sequence information, including introns and 3' UTR, was generated for over 550 genes in the two genotypes of P. vulgaris. Over 1,800 single nucleotide polymorphisms and indels were found, 300 of which were screened in the RI population. The resulting LOD 2.0 map is 1,545 cM in length and consists of 275 gene-based and previously mapped core markers. An additional 153 markers that mapped at LOD <1.0 were placed in genetic bins. By screening the parents of other mapping populations, it was determined that the markers were useful for other common Mesoamerican × Andean mapping populations. The location of the mapped genes relative to their homologs in Arabidopsis thaliana (At), Medicago truncatula (Mt), and Lotus japonicus (Lj) were determine by using a tblastx analysis with the current psedouchromosome builds for each of the species. While only short blocks of synteny were observed with At, large-scale macrosyntenic blocks were observed with Mt and Lj. By using Mt and Lj as bridging species, the syntenic relationship between the common bean and peanut was inferred. PMID:20607211

  16. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean

    Institute of Scientific and Technical Information of China (English)

    Yau Sang Chan; Jack Ho Wong; Evandro Fei Fang; Wen Liang Pan; Tzi Bun Ng

    2012-01-01

    A 5.4-kDa antifungal peptide,with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC5o=3 μM),Setospaeria turcica and Bipolaris maydis,was isolated from the seeds of Phaseolus vulgaris cv.brown kidney bean.The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75.The antifungal activity of the peptide against M.arachidicola was stable in the pH range 3-12 and in the temperature range 0℃ to 80℃.There was a slight reduction of the antifungal activity at pH 2 and 13,and the activity was indiscernible at pH 0,1,and 14.The activity at 90℃ and 100℃ was slightly diminished.Deposition of Congo red at the hyphal tips of M.arachidicola was induced by the peptide indicating inhibition of hyphal growth.The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells,in contrast to the presence of such activity of other antifungal peptides,indicates that different domains are responsible for the antifungal and antiproliferative activities.

  17. Improvement of tuber yield in yam bean by mutation induction

    International Nuclear Information System (INIS)

    Full text: The genus Pachyrrhizus, a native of Mexico and Central America is now widely distributed throughout the tropics. Pachyrrhizus erosus (L.) Urb., commonly known as the yam bean is cultivated in many parts of India for its edible tubers. The young tubers have a crisp and juicy flesh and can be eaten raw or cooked. Genetic variability for agronomically important characters is rare. It was therefore felt desirable to increase it by mutation induction. Seeds of a locally adapted variety were subjected to gamma irradiation (10, 15, 20 and 25 kR). Evaluation of the M3 raised from the different treatments unveiled mutants possessing significantly higher yields than the control. While the control plants showed a mean tuber yield of 168 g, one of the higher yielding mutants from the progenies of 10 kR treatment recorded 415 g. Two other mutants selected from the 25 kR treatment showed yields of 401 and 411 g. These mutants, first identified in M2, were found to breed true in M3-M5 generations. Yield trials conducted in M5 generation showed more than two-fold increase in yield by the mutants. Apparently there are remarkable possibilities of improving the yield potential in yam bean by mutation induction. (author)

  18. Molecular assessment of genetic diversity in mung bean germplasm

    Indian Academy of Sciences (India)

    G. Roopa Lavanya; Jyoti Srivastava; Shirish A. Ranade

    2008-04-01

    RAPD profiles were used to identify the extent of diversity among 54 accessions of mung bean that included both improved and local land races. Out of the 40 primers screened, seven primers generated 174 amplification products with an average of 24.85 bands per primer. The RAPD profiles were analysed for Jaccard’s similarity coefficients that was found to be in the range from 0 to 0.48, indicating the presence of wide range of genetic diversity at molecular level. Cluster analysis was carried out based on distances (1-similarity coefficient) using neighbour-joining method in Free Tree package. The dendrogram resolved all the accessions into two major clusters, I (with 11 accessions) and II (with 43 accessions). However, the cluster was further divided into four subclusters (II A with six, II B with nine, II C with 15 and II D with 13 accessions). The distribution of the accessions in different clusters and subclusters appeares to be related to their performance in field conditions for 10 morphological traits that were scored. This study indicated that the RAPD profiles provide an easy and simple technique for preliminary genetic diversity assessment of mung bean accessions that may reflect morphological trait differences among them.

  19. Effect of copper on castor bean (Ricinus communis L.) growth

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Castor beans crop (Ricinus communis L.) is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor yield, few research has been made on this issue, mainly on the use de copper. In order to evaluate the effects of copper on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Cu (0; 1; 2; 3 and 4 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Copper levels used, in general, did not affect the plant height, stem diameter and leaf area, however they influenced the leaves and shoot biomass dry mass and the quadratic trend was the best to show the behavior of these. (author)

  20. Faba bean hulls as a potential source of pectin.

    Science.gov (United States)

    Korish, Mohamed

    2015-09-01

    This study aimed for the first time to assess the potential use of faba bean hulls as a source of pectin. The study involved extracting pectin under various conditions of pH, temperature and extraction time and determining how these conditions affected pectin yield and its characteristics. The maximum yield of extracted pectin did not coincide with the highest degree of esterification since the maximum yield (15.75 %) was recorded at pH 1.5 and at a temperature of 85 °C for an 80-min extraction period and solid to liquid (1: 25) ratio, while the highest degree of esterification (54.62 %) occurred at pH 2.5 and at temperature of 90 °C for a 60-min extraction period. The composition of the pectin varied according to the extraction conditions: the neutral sugars galactose, arabinose and rhamnose increased under milder extraction conditions while glucose, mannose and xylose sugars predominated under harsher extraction conditions. The results indicated that faba bean hulls contains adequate amount of pectin, suitable for commercial utilization. PMID:26345029

  1. Breeding common bean populations for traits using selection index

    Directory of Open Access Journals (Sweden)

    Dayane Cristina Lima

    2015-02-01

    Full Text Available A common bean (Phaseolus vulgarisL. cultivar must combine desirable genotypes for several traits in order to be accepted by producers and consumers. This study aimed to evaluate selection efficiency when segregating bean populations for traits, by means of a selection index, in order to obtain superior progenies for traits considered. A total of 16 populations from the F4 and F5generations were evaluated in 2011 and 2012, respectively. The traits evaluated were plant architecture, plant disease, grain type and yield. Using standard scores (Z, the sum of the four traits (∑Z was obtained and, based on this information, the best populations were identified. The evaluation of selection effectiveness was performed on 31 progenies from each population. The 496 progenies plus eight controls were evaluated in the F5:6and F5:7 generations for the same traits in July and November 2012, respectively. The selection, using the index based on the sum of standardized variables (∑Z, was efficient for identifying populations with superior progenies for all the traits considered.

  2. Biological treatment to bean seeds before sowing them.

    Directory of Open Access Journals (Sweden)

    Silvano Edel Castro Mayo

    2013-09-01

    Full Text Available Even in some bibliography about the bean cultivation is recommended the use of Rhizobium which association with the cultivation is very advantageous for the fixation of the atmospheric nitrogen, as well as the employment of the antagonistic mushroom Trichoderma spp., for the control of fungous illnesses of the floor and knowing that the cultivation has its fertilization demands and of the plagues control and illnesses that are in definitive the causes that limit the yields of the cultivation, these practices are not used. We proceeded to the disinfection of bean seeds with the resulting solution of the laundry of 1Kg of Trichoderma harzianum of the stock A-34 with 2 liters of water and the mixture of this fluid with 1 Kg of Rhizobium, more a package (134 grams of Gaucho PS 70 for 45.35 kg (100 pounds of t seed. The disinfection of the seed was made by hand, 12 hour before sowing them and the results were very encouraging, so much in the delay of days in appearing the illnesses and the plagues and its low attack intensity as the increase of the yields with relationship to the not treated seed.

  3. Effect of gamma irradiation on antinutritional factors in broad bean

    International Nuclear Information System (INIS)

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view

  4. Effect of gamma irradiation on antinutritional factors in broad bean

    Science.gov (United States)

    Al-Kaisey, Mahdi T.; Alwan, Abdul-Kader H.; Mohammad, Manal H.; Saeed, Amjed H.

    2003-06-01

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view.

  5. Sunning as a technique for disinfecting stored beans

    International Nuclear Information System (INIS)

    The effectiveness of sunning (solar heating) as a small farm technique for controlling the bean bruchids Zabrotes subfasciatus (Boheman) and Acanthoscelides obtectus (Say) was investigated. Bean seeds infested with mixed-stage larvae were placed on clear or black polyethylene sheets or inside polyethylene pouches with clear upper and black lower surfaces and exposed to the sun for five hours each day for 0, 3 and 5 successive days. No live insects emerged from seeds heated in the pouches while the few that emerged from seeds on the black sheets resulted in damage to less than 1% of the seeds. Of the three polyethylene systems used, the clear sheet was the least useful, while the pouches even for only 3 days, were the most effective in eliminating infestations. These studies demonstrated that effective bruchid control can be achieved with daily 5-h exposure periods of seeds for a successive 5-day duration. However, the success of the method of control may be influenced by the time of the year and prevailing environmental conditions

  6. Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean Genome

    Directory of Open Access Journals (Sweden)

    Aihua Wang

    2012-09-01

    Full Text Available In this study, 13 polymorphic microsatellite markers were isolated from the Phaseolus vulgaris L. (common bean by using the Fast Isolation by AFLP of Sequence COntaining Repeats (FIASCO protocol. These markers revealed two to seven alleles, with an average of 3.64 alleles per locus. The polymorphic information content (PIC values ranged from 0.055 to 0.721 over 13 loci, with a mean value of 0.492, and 7 loci having PIC greater than 0.5. The expected heterozygosity (HE and observed heterozygosity (HO levels ranged from 0.057 to 0.814 and from 0.026 to 0.531, respectively. Cross-species amplification of the 13 prime pairs was performed in its related specie of Vigna unguiculata L. Seven out of all these markers showed cross-species transferability. These markers will be useful for future genetic diversity and population genetics studies for this agricultural specie and its related species.

  7. Diversity and the role of yeast in spontaneous cocoa bean fermentation from Southeast Sulawesi, Indonesia

    Directory of Open Access Journals (Sweden)

    JAMILI

    2016-06-01

    Full Text Available Abstract. Jamili, Yanti NA, Susilowati PE. 2016. Diversity and the role of yeast in spontaneous cocoa bean fermentation from Southeast Sulawesi, Indonesia. Biodiversitas 17: 90-95. Yeast is one of the microbial group which is role in the process of cocoa spontaneously fermentation. The objective of this study was to determinate and to know the diversity of yeast that role on cocoa bean fermentation. Yeast was isolated by pour plate method from cocoa bean that was naturally fermented by a cocoa farmer in Kolaka District, Southeast Sulawesi using yeast mannitol agar (YMA media. Yeast was characterized and identified using phenotypic characters based on numeric-phenetic analysis. Yeast isolates applied to cocoa bean to determine its role in cocoa bean fermentation. The result was obtained seven isolates the dominant yeast during cocoa bean fermentation in Kolaka District, Southeast Sulawesi. The result of numerical-phenetic analysis based on phenotypic characters to seven yeast isolates showed that 1 isolates (Klk1 identical with Candida krusei. Three isolates (Klk4, Klk5 and Klk7 identical with Candida tropicalis, one isolate (Klk2 identical with Saccharomycopsis fibuligera, one isolate (Klk3 identical with Kloeckera sp. and one isolate (Klk6 identical with Saccharomyces cerevisiae. The result also showed that fermentation of cocoa with seeding of yeast inoculums served to increase the quality of cocoa beans than spontaneous fermentation. Therefore, the seven yeast isolates potentially be used as an inoculum to improve the cocoa quality.

  8. Effect of Radiation processing on sensory and chemical characteristics of broad beans (Giza,2)(Vicia Faba)

    International Nuclear Information System (INIS)

    Broad bean is the important leguminous protein consumed in egypt as a source of protein diet. The most popular way of preparing beans is the stewd form (Fool Medames). However, great losses due to insect infestation occur during storage. To combat these losses radiation processing has been used as an effective alternative of chemical fumigants to combat insect pets. The beans were irradiated at 25.5, 10 and kgy. The effects of treatments were investigated on sensory and chemical characteristics and on the solubility of broad beans protein, the amino acids content and on the nutritive value of bean protein from the view of its amino acids profile. The results of study indicate that the sensory evaluation of sewed irradiated 2.5 and 5 kGy samples revealed no significantdiffference in hardness, gumminess and acceptability. moreover, no significant changes in adhesivess, between samples irradiated at 5, 10 and 20 KGy, irradiation up to 20 KGy was found to improve the hardness of stewed broad bean which would improve the quality of broad of bean

  9. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    International Nuclear Information System (INIS)

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g-1 dry basis, 1.8 mg g-1 dry basis and 13.5 μmol g-1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g-1 dry basis, 0.42 mg g-1 dry basis and 7.5 μmol g-1 dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties

  10. In Vivo Antistress and Antioxidant Effects of Fermented and Germinated Mung Bean

    Directory of Open Access Journals (Sweden)

    Swee Keong Yeap

    2014-01-01

    Full Text Available Mung bean has been traditionally used to alleviate heat stress. This effect may be contributed by the presence of flavonoids and γ-aminobutyric acid (GABA. On the other hand, fermentation and germination have been practised to enhance the nutritional and antioxidant properties of certain food products. The main focus of current study was to compare the antistress effect of none-process, fermented and germinated mung bean extracts. Acute and chronic restraint stresses were observed to promote the elevation of serum biochemical markers including cholesterol, triglyceride, total protein, liver enzymes, and glucose. Chronic cold restraint stress was observed to increase theadrenal gland weight, brain 5-hydroxytryptamine (5-HT, and malondialdehyde (MDA level while reducing brain antioxidant enzyme level. However, these parameters were found reverted in mice treated with diazepam, high concentration of fermented mung bean and high concentration of germinated mung bean. Moreover, enhanced level of antioxidant on the chronic stress mice was observed in fermented and germinated mung bean treated groups. In comparison between germinated and fermented mung bean, fermented mung bean always showed better antistress and antioxidant effects throughout this study.

  11. Hydration properties and texture fingerprints of easy- and hard-to-cook bean varieties.

    Science.gov (United States)

    Kinyanjui, Peter K; Njoroge, Daniel M; Makokha, Anselimo O; Christiaens, Stefanie; Ndaka, Daniel S; Hendrickx, Marc

    2015-01-01

    The objective of this study was to understand the factors that affect the hydration and cooking profiles of different bean varieties. During this study, nine bean varieties were classified as either easy-to-cook (ETC) or hard-to-cook (HTC) based on a subjective finger pressing test and an objective cutting test. Rose coco, Red haricot, and Zebra beans were classified as ETC, while Canadian wonder, Soya fupi, Pinto, non-nodulating, Mwezi moja, Gwaku, and New mwezi moja were HTC. The effect of different soaking (pre)-treatments on the cooking behavior and/or water absorption of whole or dehulled beans was investigated. Dehulling, soaking in high pH and monovalent salt solutions reduced the cooking time of beans, while soaking in low pH and CaCl2 solutions increased the cooking time. Moisture uptake was faster in ETC and dehulled beans. Soaking at high temperatures also increased the hydration rate. The results point to pectin-related aspects and the rate of water uptake as possible factors that influence the cooking rate of beans. PMID:25650021

  12. Influence of relative humidity on radiosensitivity of Aspergillus flavus Link. infecting cocoa beans

    International Nuclear Information System (INIS)

    The first part of this paper deals with the moisture sorption isotherms of dried cocoa beans under different relative humidities of 55, 65, 75, 85 or 95%. The second part evaluates the effects of relative humidity (RH), initial moisture content (m.c.) of cocoa beans, and different radiation exposure doses (0, 250, 350, 450, 500 or 550 krad) on Aspergillus flavus spore inoculated cocoa beans kept in fixed RH environmental chamber of 75 or 85% RH post-irradiation for forty days. The results discussed suggest that the m.c. of beans increased from an initial level of 6.4% to 7, 7.8 and 8.9% at 55, 65, and 75% respectively, after a storage period of 6-8 days. However, beans stored under 85% or 95% RH continued to absorb moisture from their respective environments indefinitely during the 64-day storage period. Furthermore, the ambient relative humidity to which the beans are subjected before or after irradiation significantly affect the radiosensitivity of toxigenic A. flavus; the differences in such radiosensitivity are influenced by either the available moisture or the initial m.c. of the beans to the inoculum. The authors conclude from their study that high environmental RH increased the radio-resistance of A. flavus spores making it difficult to establish a radiation decontamination level of practical value under a tropical environment with high ambient relative humidity. (author)

  13. Influence of Relative Humidity on Radiosensitivity of Aspergillus Flavus Link Infecting Cocoa Beans

    International Nuclear Information System (INIS)

    The first part of this paper deals with the moisture sorption isotherms of dried cocoa beans under different relative humidities of 55, 65, 75, 85 or 95%. The second part evaluates the effects of relative humidity (RH), initial moisture content (m.c.) of cocoa beans, and different radiation exposure doses (0, 250, 350, 450, 500 or 550 krad) on Aspergillus flavus spore inoculated cocoa beans kept in fixed RH environmental chamber of 75 or 85% RH postirradiation for forty days. The results discussed suggest that the m.c. of beans increased from an initial level of 6.4% to 7, 7.8 and 8.9% at 55, 65, and 75% respectively, after a storage period of 6-8 days. However, beans stored under 85% or 95% RH continued to absorb moisture from their respective environments indefinitely during the 64-day storage period. Furthermore, the ambient relative humidity to which the beans are subjected before or after irradiation significantly affect the radiosensitivity of toxigenic A. flavus; the differences in such radiosensitivity are influenced by either the available moisture or the initial m.c. of the beans to the inoculum. The authors conclude from their study that high environmental RH increased the radio-resistance of A. flavus spores making it difficult to establish a radiation decontamination level of practical value under a tropical environment with high ambient relative humidity. (author)

  14. Effect of edible coating on the aromatic attributes of roasted coffee beans.

    Science.gov (United States)

    Rattan, Supriya; Parande, A K; Ramalakshmi, K; Nagaraju, V D

    2015-09-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was made to minimise the loss of volatile from roasted coffee beans by coating with Carboxymethyl cellulose (CMC), Hydroxypropylmethyl cellulose (HPMC) and Whey protein concentrate. Coffee volatiles were analysed by Gas chromatography and 14 major compounds were identified and compared in this study. Results showed an increase in the relative area of major volatile compounds in coated roasted coffee beans when compared with unroasted coffee beans for consecutive two months. Moreover, effect of coating on textural properties and non-volatiles were also analysed. The results have indicated that edible coatings preserve the sensory properties of roasted coffee beans for a longer shelf life and cellulose derivatives, as an edible coating, exhibited the best protecting effect on roasted coffee beans. PMID:26344962

  15. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Science.gov (United States)

    Villavicencio, Anna Lucia C. H.; Mancini-Filho, Jorge; Delincée, Henry; Greiner, Ralf

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macaçar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g -1 dry basis, 1.8 mg g -1 dry basis and 13.5 μmol g -1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g -1 dry basis, 0.42 mg g -1 dry basis and 7.5 μmol g -1 dry basis in the raw non-irradiated Macaçar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macaçar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  16. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. E-mail: villavic@net.ipen.br; Mancini-Filho, Jorge E-mail: jmancini@usp.br; Delincee, Henry; Greiner, Ralf E-mail: ralf.greiner@bfe.uni-karlsruhe.de

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g{sup -1} dry basis, 1.8 mg g{sup -1} dry basis and 13.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Carioca beans and 0.30 mg g{sup -1} dry basis, 0.42 mg g{sup -1} dry basis and 7.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  17. The effects of nitrogen form on root morphological and physiological adaptations of maize, white lupin and faba bean under phosphorus deficiency.

    Science.gov (United States)

    Liu, Haitao; Tang, Caixian; Li, Chunjian

    2016-01-01

    Root morphological/physiological modifications are important for phosphorus (P) acquisition of plants under P deficiency, but strategies differ among plant species. Detailed studies on the response of maize roots to P deficiency are limited. Nitrogen (N) form influences root morphology/physiology, and thus may influence root responses to P deficiency. This work investigated adaptive mechanisms of maize roots to low P by comparison with white lupin and faba bean supplied with two N forms. Plants were grown for 7-16 days in hydroponics with sufficient (250 µmol L(-1)) and deficient P supply (1 µmol L(-1)) under supply of NH4NO3 or Ca(NO3)2 Plant growth and P uptake were measured, and release of protons and organic acid anions, and acid phosphatase activity in the root were monitored. The results showed that P deficiency significantly decreased shoot growth while increased root growth and total root length of maize and faba bean, but not white lupin. It enhanced the release of protons and organic acid anions, and acid phosphatase activity, from the roots of both legumes but not maize. Compared with Ca(NO3)2, NH4NO3 dramatically increased proton release by roots but did not alter root morphology or physiology of the three species in response to low P. It is concluded that the N form did not fundamentally change root morphological/physiological responses of the three species to P deficiency. Morphological variation in maize and morpho-physiological modifications in white lupin and faba bean were the main adaptive strategies to P deficiency. PMID:27519912

  18. Relationship between Physiological Characteristic and Bean Quality on Some Cocoa Clones (Theobroma cacao L.

    Directory of Open Access Journals (Sweden)

    Indah Anita Sari

    2015-12-01

    Full Text Available Photosynthesis is one of the physiological process that influence the bean weight and this process related with the efectiveness of the stomata character and chlorophyll content in the leaves. The research was conducted at Kaliwining Research Station, Indonesian Coffee and Cocoa Research Institute. Design of experiment was randomized complete block design (RCBD consisted of six clones as treatment were Sulawesi 1, Sulawesi 2, Sca 6, ICS 60, TSH 858, ICCRI 03, PA 300. Each treatment was replicated three times.  Stomata resistance diffusion, tranpiration,the content of chlorophyll a, chlorophyll b, chlorophyll total (a+b, bean number and bean weight were observed. The resuts  of experiment showed that  difference in chlorophyll a, chlorophyll b, chlorophyll total (a+b, stomata resistance diffusion, bean number and bean weight existed within  six clones tested. Transpiration rate did not show the significantly different between six clones tested. Sulawesi 1 showed the highest content of chlorophyll a and  ICS 60 and ICCRI 03 showed higher content of chlorophyll b than the other clones. Chlorophyll a, b and total (a+b showed positively influence on bean number and bean weight. Transpiration rate had negatively influence to bean number per pod, on the otherhand it showed positively influence to bean weight. Chlorophyll total (a+b showed high genetic variance (σg2, high phenotypic variance (σf2  and high estimated value of heritability (H.  The chlorophyll a,b had moderate genetic variance, moderate phenotypic variance and high of estimated value of heritability.  Chlorophyll total (a+b could be used a selection criteria based on the value of correlation, genetic variance, phenotypic variance and estimated value of heritability would give high opportunity in selection process. 

  19. Diets enriched with cranberry beans alter the microbiota and mitigate colitis severity and associated inflammation.

    Science.gov (United States)

    Monk, Jennifer M; Lepp, Dion; Zhang, Claire P; Wu, Wenqing; Zarepoor, Leila; Lu, Jenifer T; Pauls, K Peter; Tsao, Rong; Wood, Geoffrey A; Robinson, Lindsay E; Power, Krista A

    2016-02-01

    Common beans are rich in phenolic compounds and nondigestible fermentable components, which may help alleviate intestinal diseases. We assessed the gut health priming effect of a 20% cranberry bean flour diet from two bean varieties with differing profiles of phenolic compounds [darkening (DC) and nondarkening (NDC) cranberry beans vs. basal diet control (BD)] on critical aspects of gut health in unchallenged mice, and during dextran sodium sulfate (DSS)-induced colitis (2% DSS wt/vol, 7 days). In unchallenged mice, NDC and DC increased (i) cecal short-chain fatty acids, (ii) colon crypt height, (iii) crypt goblet cell number and mucus content and (iv) Muc1, Klf4, Relmβ and Reg3γ gene expression vs. BD, indicative of enhanced microbial activity and gut barrier function. Fecal 16S rRNA sequencing determined that beans reduced abundance of the Lactobacillaceae (Ruminococcus gnavus), Clostridiaceae (Clostridium perfringens), Peptococcaceae, Peptostreptococcaceae, Rikenellaceae and Pophyromonadaceae families, and increased abundance of S24-7 and Prevotellaceae. During colitis, beans reduced (i) disease severity and colonic histological damage, (ii) increased gene expression of barrier function promoting genes (Muc1-3, Relmβ, and Reg3γ) and (iii) reduced colonic and circulating inflammatory cytokines (IL-1β, IL-6, IFNγ and TNFα). Therefore, prior to disease induction, bean supplementation enhanced multiple concurrent gut health promoting parameters that translated into reduced colitis severity. Moreover, both bean diets exerted similar effects, indicating that differing phenolic content did not influence the endpoints assessed. These data demonstrate a proof-of-concept regarding the gut-priming potential of beans in colitis, which could be extended to mitigate the severity of other gut barrier-associated pathologies. PMID:26878790

  20. Bean responds to Endospor 33® at reduced dose of Nitrogen and

    Directory of Open Access Journals (Sweden)

    Juan Manuel Sanchez-Yañez

    2014-06-01

    Full Text Available Bean is a legume its production requires nitrogen (N combined as ammonium (NH4 or nitrate (NO3 and phosphates (NPF, its indiscriminate application causes soil lost productivity. An alternative solution for reducing and optimizing NPF is applying mixed inoculant which could be improved by plant growth promoting bacteria (PGPB and mycohrrizae. The objective of this research was to analyze the response of beans to mixed inoculant Endospor 33® at 50% reduced dose of NPF. In that sense a red ferralitic soil poor in N and organic matter was used. By experimental design: 5 treatments and 6 replications. Results showed a positive bean responds achieving 100% germination at 20mg/seed with Endospor 33® at 50% NPF dose. At seedling level bean was 6.63g of total fresh weight (TFW and 0.66g total dry weight (TDW with the same Endospor 33® dose compared to 0.28g of TDW of bean used as relative control (RC at 100% NPF dose. At flowering with 30 mg/plant got 1.5 g of TDW compared to 1.0g TDW of bean as CR. At physiological maturity bean with 30mg/plant had 34.83g/100 grains compared to 20.39g/grains of bean as CR. Those data supporting that Endopre 33® is an excellent choice in bean’s production at NPF 50% dose but not adverse effect on bean growth and yield in protected agriculture.

  1. In vitro starch digestibility and predicted glycemic index of corn tortilla, black beans, and tortilla-bean mixture: effect of cold storage.

    Science.gov (United States)

    Sáyago-Ayerdi, S G; Tovar, Juscelino; Osorio-Díaz, P; Paredes-López, Octavio; Bello-Pérez, Luis A

    2005-02-23

    People in the rural areas of Mexico consume corn tortillas and beans as basic components of their diet. However, little is known about the nutritionally relevant features of starch present in such combined meals. The objective of the present study was to evaluate the in vitro bioavailability of starch in tortilla-bean mixtures stored at 4 degrees C for different times, as compared to that of corn tortilla and boiled black beans kept separately under the same conditions. Available starch (AS), resistant starch (RS), and retrograded resistant starch (RRS) contents were measured. The in vitro starch hydrolysis indices (HI) of freshly cooked and cold-stored samples were evaluated using a chewing/dialysis digestion protocol. HIs were used to predict glycemic indices (pGI) of the samples. AS in tortilla and beans decreased between 3 and 6% after 48-72 h, whereas values in the mixture fell by 3% after 48 h, with no further change by 72 h. Only minor rises in RS contents (1.5-1.6%) were recorded for tortilla and beans after 72 h of storage, and a lower increase (0.4%) was recorded in the mixture. Judging from RRS values, an important proportion of RS is due to starch retrogradation. The HI and pGI were higher in tortilla than in bean and the mixture. Hydrolysis rate values decreased in the stored samples, a pattern that corresponded with RS and RRS changes. The slow digestion features of common beans are largely retained by the legume-tortilla combination. Data support the perceived health beneficial properties of starch in this traditional cereal-legume food. PMID:15713053

  2. Nutritional status and specific leaf area of mahogany and tonka bean under two light environments Estado nutricional e área foliar específica de mogno e cumaru sob dois ambientes de luz

    OpenAIRE

    José Francisco de C. Gonçalves; Gil Vieira; Ricardo A. Marenco; João Baptista S. Ferraz; Ulysses Moreira dos Santos Junior; Francisco Cleber F. Barros

    2005-01-01

    Studies on nutritional status and leaf traits were carried out in two tropical tree species Swietenia macrophylla King (mahogany) and Dipetryx odorata Aubl. Willd. (tonka bean) planted under contrasting light environments in Presidente Figueiredo-AM, Brazil. Leaves of S. macrophylla and D. odorata were collected in three year-old trees grown under full sunlight (about 2000 µmol m-2 s-1) and natural shade under a closed canopy of Balsa-wood plantation (Ochroma pyramidale Cav. Ex. Lam.Urb) abou...

  3. Competitivity of the common-bean plant relative to the weed alexandergrass [Brachiaria plantaginea (link) hitch.] Competitividade do feijoeiro-comum com o capim-marmelada [Brachiaria plantaginea (link) hitch.

    OpenAIRE

    Telma Passini; Pedro Jacob Christoffoleti; Inês Fumiko Ubukata Yada

    2003-01-01

    Methodologies of competitive interaction quantification between weeds and crops are not widely elucidated and compared in the literature. The competitive ability of common-bean (Phaseolus vulgaris) relative to alexandergrass (Brachiaria plantaginea) was assessed and two approaches of replacement series experiment analysis were compared. The response of the species to the presence of each other at different densities and proportion was evaluated. Replacement series at total densities of 625, 8...

  4. Antimicrobial Effects of Ionizing Radiation on Artificially and Naturally Contaminated Cacao Beans

    OpenAIRE

    Restaino, L; Myron, J. J. J.; Lenovich, L M; Bills, S.; Tscherneff, K.

    1984-01-01

    With an initial microbial level of ca. 107 microorganisms per g of Ivory Coast cacao beans, 5 kGy of gamma radiation under an atmosphere of air reduced the microflora per g by 2.49 and 3.03 logs at temperatures of 35 and 50°C, respectively. Bahia cacao beans were artificially contaminated with dried spores of Aspergillus flavus and Penicillium citrinum, giving initial fungal levels of 1.9 × 104 and 1.4 × 103 spores per g of whole Bahia cacao beans, respectively. The average D10 values for A. ...

  5. Electron spin resonance (ESR) studies on irradiated cocoa beans and niger seeds

    International Nuclear Information System (INIS)

    Electron spin resonance (ESR) spectra of irradiated (10kGy) and unirradiated cocoa beans and niger seeds have been compared. Unirradiated cocoa beans failed to give any ESR signal, whereas after irradiation (10kGy) an ESR signal at g = 2.0042 was observed. However, ESR signals are given by both irradiated and unirradiated niger seeds. The intensity of signal was found to be dose-dependent up to 10kGy for both seeds. The signals were stable up to 180 days in both cases. The results indicate the possibility of using ESR for distinguishing between irradiated and unirradiated cocoa beans but not for niger seeds

  6. Pendimethalin Residues from Weed Management in Dry Bean Can Cause Injury in Autumn Seeded Winter Wheat

    OpenAIRE

    Nader Soltani; Christy Shropshire; Peter H. Sikkema

    2015-01-01

    There is little information on effect of pendimethalin residues in the soil used for weed management in dry bean, on winter wheat seeded 3 to 4 months after application in Ontario. A total of four field experiments were conducted over a four-year period (2008-2011) in Ontario to evaluate the effect of pendimethalin residues on winter wheat injury and yield grown in rotation with dry bean. Pendimethalin, applied PPI in dry bean, at 1080 and 2160 g ai ha-1 caused 1% to 3%...

  7. Hydration properties and texture fingerprints of easy- and hard-to-cook bean varieties

    OpenAIRE

    Kinyanjui, Peter; Njoroge, Daniel; Makokha, Anselimo; Christiaens, Stefanie; Sila, Daniel Ndaka; Hendrickx, Marc

    2014-01-01

    The objective of this study was to understand the factors that affect the hydration and cooking profiles of different bean varieties. During this study, nine bean varieties were classified as either easy-to-cook (ETC) or hard-to-cook (HTC) based on a subjective finger pressing test and an objective cutting test. Rose coco, Red haricot, and Zebra beans were classified as ETC, while Canadian wonder, Soya fupi, Pinto, non-nodulating, Mwezi moja, Gwaku, and New mwezi moja were HTC. The effect of ...

  8. Impact of Market Information System (E-Soko) on Beans Markets Integration: Case of Rwanda

    OpenAIRE

    Bizimana, Jean-Claude; Bessler, David A.; Angerer, Jay P.

    2013-01-01

    The goal of this study was to analyze the impact of a newly introduced market information system “E-Soko”, on beans markets integration by comparing the period before and after the system was implemented in Rwanda. Beans, both bush and climbing, are the most important traded crop in rural areas of Rwanda, and third most important in urban areas in terms of value. Bi-weekly prices on beans were analyzed for the two time periods: one before the introduction of the market information system “E-S...

  9. On the Peirce's "balancing reasons rule" failure in his "large bag of beans" example

    CERN Document Server

    D'Agostini, G

    2010-01-01

    Take a large bag of black and white beans, with all possible proportions considered initially equally likely, and imagine to make random extractions with reintroduction. Twenty consecutive observations of black make us highly confident that the next bean will be black too. On the contrary, the observation of 1010 black beans and 990 white ones leads us to judge the two possible outcomes about equally probable. According to C.S. Peirce this reasoning violates what he called "rule of balancing reasons", because the difference of "arguments" in favor and against the outcome of black is 20 in both cases. Why? (I.e. why does that rule not apply here?)

  10. Effect of processing methods on nutritional, sensory, and physicochemical characteristics of biofortified bean flour.

    Science.gov (United States)

    Nkundabombi, Marie Grace; Nakimbugwe, Dorothy; Muyonga, John H

    2016-05-01

    Common beans (Phaseolus vulgaris L.) are rich nutritious and affordable by vulnerable groups, thus a good choice for biofortification to address malnutrition. However, increasing micronutrients content of beans, without improving micronutrients bioavailability will not improve the micronutrients status of consumers. Effect of different processing methods on the physicochemical characteristics of biofortified bean flour was determined. Processing methods used in this study were malting (48 h), roasting (170°C/45 min), and extrusion cooking using a twin screw extruder with three heating sections, the first set at 60°C, the second at 130°C, and the last one at 150°C. The screw was set at a speed of 35 Hz (123g) and bean flour moisture content was 15%. Mineral extractability, in vitro protein digestibility, pasting properties, and sensory acceptability of porridge and sauce from processed flour were determined. All processing methods significantly increased (P < 0.05) mineral extractability, iron from 38.9% to 79.5% for K131 and from 40.7% to 83.4% for ROBA1, in vitro protein digestibility from 58.2% to 82% for ROBA1 and from 56.2% to 79% for K131. Pasting viscosities of both bean varieties reduced with processing. There was no significant difference (P < 0.05) between sensory acceptability of porridge or sauce from extruded biofortified bean flour and malted/roasted biofortified bean flour. Acceptability was also not affected by the bean variety used. Mineral bioavailability and in vitro protein digestibility increased more for extruded flour than for malted/roasted flours. Sauce and porridge prepared from processed biofortified bean flour had lower viscosity (extruded flour had the lowest viscosity), thus higher nutrient and energy density than those prepared from unprocessed biofortified bean flour. Estimated nutritional contribution of sauce and porridge made from processed ROBA1 flour to daily requirement of children below 5 years and women of

  11. Transcriptome sequencing of mung bean (Vigna radiate L. genes and the identification of EST-SSR markers.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Mung bean (Vigna radiate (L. Wilczek is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0% and 23,235 (47.7% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5% could be classified into gene ontology categories, 18,316 (37.6% into Swiss-Prot categories and 10,918 (22.4% into KOG database categories (E-value < 1.0E-5. A total of 6,585 (8.3% were mapped onto 244 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. Among the unigenes, 10,053 sequences contained a unique simple sequence repeat (SSR, and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST. A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%, GAA/TTC (12.6%, AAAT/ATTT (6.8%, AAAAT/ATTTT (6.2% and AAAAAT/ATTTTT (1.9%. A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association

  12. Faba bean induced mutants for resistance to broomrape (Orobanche crenata L.)

    International Nuclear Information System (INIS)

    Seed samples from two widely grown faba bean cultivars were treated with gamma rays, ethyl methane-sulphonate (EMS) or NaN3, with the objective being to select mutants tolerant or resistant to broomrape. The M2 populations resulting from the mutagenized material were grown in a field highly infested with the parasite seeds. A number of M2 individual plants that were resistant (i.e. escaped infestation) or were tolerant (infected, but tolerated the parasite) were selected. M3 families descending from the selected M2 plants were grown under heavy infestation for checking. Some M3 families showed a relatively higher degree of tolerance (or resistance) to the parasite. The character seems to be genetically controlled by a polygenic system. Further selection cycles are needed to stabilize tolerant (or resistant) lines. Four Orobanche species could be identified in the Egyptian flora, viz. O. crenata, 2n = 38 chromosomes; O. ramosa, 2n = 24 chromosomes; O. aegyptiaca, 2n = 38 chromosomes; and O. uniflora, 2n = 72 chromosomes. (author). 12 refs, 12 tabs

  13. Viability and stability of biological control agents on cotton and snap bean seeds.

    Science.gov (United States)

    Elliott, M L; Des Jardin, E A; Batson, W E; Caceres, J; Brannen, P M; Howell, C R; Benson, D M; Conway, K E; Rothrock, C S; Schneider, R W; Ownley, B H; Canaday, C H; Keinath, A P; Huber, D M; Sumner, D R; Motsenbocker, C E; Thaxton, P M; Cubeta, M A; Adams, P D; Backman, P A; Fajardo, J; Newman, M A; Pereira, R M

    2001-08-01

    Cotton and snap bean were selected for a multi-year, multi-state regional (south-eastern USA) research project to evaluate the efficacy of both commercial and experimental bacterial and fungal biological control agents for the management of damping-off diseases. The goal for this portion of the project was to determine the viability and stability of biological agents after application to seed. The biological seed treatments used included: (1) Bacillaceae bacteria, (2) non-Bacillaceae bacteria, (3) the fungus Trichoderma and (4) the fungus Beauveria bassiana. Seed assays were conducted to evaluate the following application factors: short-term (seed treatment; quality (i.e. isolate purity); compatibility with chemical pesticides and other biocontrol agents; application uniformity between years and plant species. For the bacterial treatments, the Bacillaceae genera (Bacillus and Paenibacillus) maintained the greatest population of bacteria per seed, the best viability over time and the best application uniformity across years and seed type. The non-Bacillaceae genera Burkholderia and Pseudomonas had the least viability and uniformity. Although Beauveria bassiana was only evaluated one year, the seed fungal populations were high and uniform. The seed fungal populations and uniformity for the Trichoderma isolates were more variable, except for the commercial product T-22. However, this product was contaminated with a Streptomyces isolate in both the years that it was evaluated. The study demonstrated that Bacillaceae can be mixed with Trichoderma isolates or with numerous pesticides to provide an integrated pest control/growth enhancement package. PMID:11517723

  14. Genetic mapping of two genes conferring resistance to powdery mildew in common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Pérez-Vega, Elena; Trabanco, Noemí; Campa, Ana; Ferreira, Juan José

    2013-06-01

    Powdery mildew (PM) is a serious disease in many legume species, including the common bean (Phaseolus vulgaris L.). This study investigated the genetic control behind resistance reaction to PM in the bean genotype, Cornell 49242. The results revealed evidence supporting a qualitative mode of inheritance for resistance and the involvement of two independent genes in the resistance reaction. The location of these resistance genes was investigated in a linkage genetic map developed for the XC RIL population. Contingency tests revealed significant associations for 28 loci out of a total of 329 mapped loci. Fifteen were isolated or formed groups with less than two loci. The thirteen remaining loci were located at three regions in linkage groups Pv04, Pv09, and Pv11. The involvement of Pv09 was discarded due to the observed segregation in the subpopulation obtained from the Xana genotype for the loci located in this region. In contrast, the two subpopulations obtained from the Xana genotype for the BM161 locus, linked to the Co-3/9 anthracnose resistance gene (Pv04), and from the Xana genotype for the SCAReoli locus, linked to the Co-2 anthracnose resistance gene (Pv11), exhibited monogenic segregations, suggesting that both regions were involved in the genetic control of resistance. A genetic dissection was carried out to verify the involvement of both regions in the reaction to PM. Two resistant recombinant lines were selected, according to their genotypes, for the block of loci included in the Co-2 and Co-3/9 regions, and they were crossed with the susceptible parent, Xana. Linkage analysis in the respective F2 populations supported the hypothesis that a dominant gene (Pm1) was located in the linkage group Pv11 and another gene (Pm2) was located in the linkage group Pv04. This is the first report showing the localization of resistance genes against powdery mildew in Phaseolus vulgaris and the results offer the opportunity to increase the efficiency of breeding

  15. A comparison of antioxidative and anti-inflammatory activities of sword beans and soybeans fermented with Bacillus subtilis.

    Science.gov (United States)

    Han, Seon Su; Hur, Sun Jin; Lee, Si Kyung

    2015-08-01

    This study was conducted to determine the antioxidative and anti-inflammatory activities of non-fermented or Bacillus subtilis-fermented soybeans and sword beans (red and white). The total flavonoid content in both sword bean types was higher (1.9-2.5-fold) than that in soybeans. The total phenolic content in fermented red sword beans was 2.5-fold greater than that in non-fermented red sword beans. HPLC profiles revealed that gallic acid, methyl gallate, and ellagic acid were major phenolic components of non-fermented/fermented red sword beans. DPPH radical scavenging activity and ferric-reducing antioxidant power were higher in fermented red sword beans than in other beans. Non-fermented/fermented red sword beans had higher nitrite scavenging activity than butylated hydroxytoluene and non-fermented/fermented soybeans. The hyaluronidase inhibitory activity of non-fermented/fermented red sword beans was higher (1.5-2.6-fold) than that of non-fermented/fermented soybeans. These results suggest that B. subtilis-fermented sword beans are potential natural antioxidant sources and anti-inflammatory agents for the food industry. PMID:26149963

  16. Review: The Potential of the Common Bean (Phaseolus vulgaris as a Vehicle for Iron Biofortification

    Directory of Open Access Journals (Sweden)

    Nicolai Petry

    2015-02-01

    Full Text Available Common beans are a staple food and the major source of iron for populations in Eastern Africa and Latin America. Bean iron concentration is high and can be further increased by biofortification. A major constraint to bean iron biofortification is low iron absorption, attributed to inhibitory compounds such as phytic acid (PA and polyphenol(s (PP. We have evaluated the usefulness of the common bean as a vehicle for iron biofortification. High iron concentrations and wide genetic variability have enabled plant breeders to develop high iron bean varieties (up to 10 mg/100 g. PA concentrations in beans are high and tend to increase with iron biofortification. Short-term human isotope studies indicate that iron absorption from beans is low, PA is the major inhibitor, and bean PP play a minor role. Multiple composite meal studies indicate that decreasing the PA level in the biofortified varieties substantially increases iron absorption. Fractional iron absorption from composite meals was 4%–7% in iron deficient women; thus the consumption of 100 g biofortified beans/day would provide about 30%–50% of their daily iron requirement. Beans are a good vehicle for iron biofortification, and regular high consumption would be expected to help combat iron deficiency (ID.

  17. Effect of several strains of rizobium in soybean and dry bean Efecto de varios inoculos de leguminosas sobre soya y fríjol

    Directory of Open Access Journals (Sweden)

    Prieto Hennio

    1990-12-01

    Full Text Available A study was carried out of the Instituto Colombiano Agropecuario-ICA of Palmira between the second semester of 1987 and second of 1989 with the objetive to see of nodulation form and the response of soybean and beans to seven strains of Rizobium of soybean, beans, mungobean, caupí, peanuts, crotalaria and Desmodium. All of especies nodulated after 15 days of emergence also, the nodules lasted in all of especies up to 60 days after emergence except in beans which deteriorated nodules were evident after flowering. The position of nodules were in the main root and secundaries except for beans that only presented nodules in secundary roots; besides, all species presented global shapes nodules except for Crotalaria which showed oval, astragal and baton shape. The size was small in all especies, however, soybean presented big nodules so as 5 mm of diameter. The soybean nodulated specifically with its strain; however, beans presented effective nodulation with other strains suggesting gesting a wide types strains for this legume and permitting more studies about it.El estudio se realizó en el Instituto Colombiano Agropecuario-ICA en Palmira, durante los semestres 87B y 89B. Todas las especies nodularon a partir de los primeros 15 días después de emergencia, exceptuando Cassia tora. El resto de materiales presentaron nódulos efectivos. La posición de los nódulos fue en toda la raíz menos en las variedades de fríjol que sólo los presentaron en las raíces secundarias. La forma fue globosa excepto en Crotalaria (ovales, astragaloides yen forma de bastón y el tamaño fue pequeño (hasta 2.5 mm de diámetro excepto en soya (5 mm. En otro ensayo se probaron en soya y fríjol las cepas aisladas de Rizobios de soya, frijol, maní, frijolillo, Desmodium, Crotalaria y mungo. La soya únicamente noduló con su cepa especifica, mientras que el fríjol hizo con todas las cepas, por lo cual se recomienda que se hagan evaluaciones de fijación de nitr

  18. Comparative Study on Seed Storage Protein of Faba Bean%蚕豆种子贮藏蛋白质组分的比较研究

    Institute of Scientific and Technical Information of China (English)

    石建斌; 侯万伟; 刘玉皎

    2012-01-01

    In order to investigate the difference of seed storage proteins in Faba bean, seed storage proteins extracted from ten species of Faba bean were analyzed with SDS-PAGE. The result showed that it is different among the seed storage proteins of faba bean, a total of 23 subunits of different Rf were detected, counting 13 polymorphic protein subunits. The similarity index of seed storage proteins subunits in Faba bean is 0. 619 ~0. 947, with an average of 0. 744. Cluster analysis divided the accessions into three major clusters in the level of 0. 8260 GS, the second cluster showed higher polymorphism, and 7 pair Faba bean were identified as the parents.%以10份蚕豆品种为材料,利用SDS-PAGE方法,对其种子贮藏蛋白亚基组成进行了分析,结果表明:不同品种间的种子贮藏蛋白具有一定的差异,表现出一定的多态性;共分离出23条迁移率不同的亚基条带,13条具有多态性;利用贮藏蛋白亚基条带的信息,分析了品种间的蛋白相似度,相似度指数0.619 ~0.947,平均0.744;并通过聚类分析,在遗传相似系数0.8260水平上,将供试材料分为了3类,其中第2类具有较丰富的多样性,多样性指数达3.9296;共筛选出7对亲缘关系较远的杂交组合,可为蚕豆品种选育提供一定的科学依据.

  19. Effect of γ-irradiation on soya bean proteins

    International Nuclear Information System (INIS)

    The properties of soya beans proteins following γ-irradiation (5-20 kGy) were investigated in connection with protein denaturation. Irradiation doses above 10 kGy caused a decrease in 7S and 11S components and an increase in 2S and 15S components (P < 0.05). However, subunit patterns determined by electrophoresis were not changed appreciably over the entire irradiation dose range. In the differential scanning calorimetry thermogram, the denaturation temperatures of 11S and 7S components were not affected by γ-irradiation, while increased irradiation dose caused a decrease in the enthalpy values of 11S and 7S components due to protein denaturation. Changes in the circular dichroism spectra and tryptophan fluorescence intensity (P < 0.05) were observed only at 20 kGy. (author)

  20. Three mimic mutants for reclining foliage in common bean

    International Nuclear Information System (INIS)

    Two new mutants for the reclining foliage (RF) character were induced by treating seed of dry bean (Phaseolus vulgaris L.) breeding lines B-351 and 182-1 with 20 krad of .gamma.-radiation. These two mutants were shown to be monogenic and recessive. Allelism tests between the common RF gene rf and the two new mimic mutants for RF indicated that each of the three mutants has an independent locus. The symbols rf2 and rf3 were given to the new mutants. F2 data from the allelism tests showed that the rf2 stock carries a recessive epistatic gene in that does not affect rf2 but suppresses expression of rf and rf3. The rf locus was shown to be independent of the Sur locus for RF in linkage group VII

  1. NOTE - Contribution of components of production on snap bean yield

    Directory of Open Access Journals (Sweden)

    Rogério Figueiredo Daher

    2012-09-01

    Full Text Available Aiming to estimate the path coefficients among morphological traits and effects of production components on the yield of grains and pods, thirty snap bean genotypes (27 lines and three commercial controls were evaluated in Bom Jesus of Itabapoana-RJ. The experiments were carried out in a randomized block design, with four replications, from May to June, in 2009 and 2010. Eight traits were evaluated and the number of pods per plant, associated with high genetic correlation, is the character with the most significant direct effect on productivity. There is a high rate of genotypic association between the yields of pods and grains, as well as direct effects of high magnitude and positive signal between them, indicating that the selection for increased pod yield allows increased grain yield.

  2. Water dynamics in a bean crop (Phaseolus vulgaris)

    International Nuclear Information System (INIS)

    The dynamics of water was studied at 'La Tola', Experimental Teaching Center of the Central University of Ecuador, in a Sandy-Ioan, typic Haplustoll soil, in wich beans were growing. All the components of the crop water balance were determined. Real evapotranspiration was in direct relation to the growth of the crop, reaching its maximum value of 4.9 mm day-1, at pod setting, then decreasing slowly until maturation of the kernels. Up to 1 meter depth, water loss by drainage depended on rainfall, reaching up to 24% of the total water loss: the soil layer supplying most of the water for the use of the crop was between 0-40 cm, where the root activity was greatest

  3. Early selection of agronomic traits in segregating black bean populations

    Directory of Open Access Journals (Sweden)

    Juliano Garcia Bertoldo

    2010-01-01

    Full Text Available This study evaluated the agronomic performance of six segregating populations of black bean (BRS Supremo x CHP 97-01, BRS Supremo x CHP 97-04, BRS Supremo x CHP 97-05-16, BRS Supremo x CHP 97-26, BRS Supremo x IPR Graúna and BRS Supremo x Uirapuru IPR in the F3 generation, conducted by the bulk method. Populations and parents were evaluated in the 2007/08 growing season in a randomized block design with four replications. Results show promising traits of the segregating population BRS Supremo x CHP 97-04, which was superior to parent BRS Supremo, indicating the line for further selection. The segregating populations and their parents were grouped by Ward’s method, indicating the similarity of the selected lines.

  4. Confirmation of bean leaf beetle, Cerotoma trifurcata, feeding on cucurbits

    Directory of Open Access Journals (Sweden)

    R.L. Koch

    2004-02-01

    Full Text Available The objective of these studies was to assess the degree to which bean leaf beetle, Cerotoma trifurcata (Forster, will feed on cucurbits. In 2003, we documented an infestation of C. trifurcata in a commercial pumpkin field near Rosemount, MN, USA. To evaluate C. trifurcata feeding on cucurbits, we conducted laboratory no-choice and choice test feeding studies. In the laboratory, C. trifurcata fed most heavily on cotyledon-stage cucumber plants, followed by pumpkin and squash. With soybean plants present, C. trifurcata still fed on cucumber plants. However, C. trifurcata appeared to prefer soybeans until the quality of the soybean plants was diminished through feeding damage. This is the first known report of C. trifurcata feeding on cucurbits. The pest potential of C. trifurcata in cucurbit cropping systems should be further evaluated.

  5. Fate of labelled allitin in bean plant and mosquito

    International Nuclear Information System (INIS)

    Allitin, the insecticidal principle of garlic (Allium sativum L) is a mixture of diallyl di- and tri-sulfides. 35S-labelled allitin has been synthesised using different methods and used for the evaluation of its persistence in water. Results of these experiments showed that allitin has low persistence; more than 80% of the initial radioactivity was lost in 24 hr. when an aqueous emulsion of labelled allitin was exposed under the laboratory conditions. Fate of labelled allitin was studied in larvae and pupae of mosquitoes, Culex pipiens quinquefasciatus Say. Assimilation of allitin was found to be faster in larva compared to pupa. Intake of allitin by bean plant was also studied. Implications of the results obtained in the above experiments will be discussed. (author)

  6. Reforestation Sites Show Similar and Nested AMF Communities to an Adjacent Pristine Forest in a Tropical Mountain Area of South Ecuador

    OpenAIRE

    Ingeborg Haug; Sabrina Setaro; Juan Pablo Suárez

    2013-01-01

    Arbuscular mycorrhizae are important for growth and survival of tropical trees. We studied the community of arbuscular mycorrhizal fungi in a tropical mountain rain forest and in neighbouring reforestation plots in the area of Reserva Biológica San Francisco (South Ecuador). The arbuscular mycorrhizal fungi were analysed with molecular methods sequencing part of the 18 S rDNA. The sequences were classified as Operational Taxonomic Units (OTUs). We found high fungal species richness with OTUs ...

  7. Antimicrobial effects of ionizing radiation on artificially and naturally contaminated cacao beans

    International Nuclear Information System (INIS)

    With an initial microbial level of ca. 107 microorganisms per g of Ivory Coast cacao beans, 5 kGy of gamma radiation from a Co60 source under an atmosphere of air reduced the microflora per g by 2.49 and 3.03 logs at temperatures of 35 and 500C, respectively. Bahia cacao beans were artificially contaminated with dried spores of Aspergillus flavus and Penicillium citrinum, giving initial fungal levels of 1.9 x 104 and 1.4 x 103 spores per g of whole Bahia cacao beans, respectively. The average D10 values for A. flavus and P. citrinum spores on Bahia cacao beans were 0.66 and 0.88 kGy, respectively. 12 references

  8. Crop physiological analysis of seed quality variation in common bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Muasya, R.M.

    2001-01-01

    Keywords : Physiological maturity, harvest maturity, earliness, common bean, Phaseolus vulgaris L., morphological markers, variation, moisture content, dry weight, viability, vigour, electrical conductivity, tetrazolium, seed lot, seed filling, maturation drying, temperature, rainfa

  9. Analysis of Determinants of Productivity and Technical Efficiency among Smallholder Common Bean Farmers in Eastern Uganda

    Directory of Open Access Journals (Sweden)

    K.W. Sibiko

    2013-09-01

    Full Text Available The study evaluated factors influencing bean productivity and technical efficiency among smallholder farmers in Eastern Uganda, using a stochastic frontier model and a Tobit model. Findings showed that bean productivity was significantly influenced by plot-size, seeds and planting fertilizer; mean technical efficiency for sampled farms was 48.2%. The Tobit model estimation revealed that technical efficiency was positively influenced by value of assets (at 1% level, extension service and group membership (at 5% level; while age and distance to the factor market negatively influenced technical efficiency at 10 and 5% levels respectively. Hence the study recommended the need for increased provision of extension service and training on correct input application and improved farming technologies to increase bean productivity. It also suggested the need for policy to discourage land fragmentation, develop road and market infrastructure in rural areas and encourage further formation of well managed farmer groups to improve production efficiency of bean farms.

  10. Nutritional analyses for proteins and amino acids in beans (Phaseolus sp.

    Directory of Open Access Journals (Sweden)

    Wathelet B.

    1999-01-01

    Full Text Available The chemical index is a good estimator of seed protein quality of Phaseolus beans. In order to estimate this value, a protein hydrolysis and amino acid quantification are realised. The problems inherent to these techniques are presented.

  11. INFLUENCE OF ROOT COLONIZING BACTERIA ON THE DEFENSE RESPONSES OF BEAN

    Science.gov (United States)

    Colonization of plant roots by fluorescent pseudomonads has been correlated with disease suppression. ne mechanism may involve altered defense responses in the plant upon colonization. ltered defense responses were observed in bean (Phaseolus vulgaris) inoculated with fluorescent...

  12. Research on Development Strategy of Industry of Edible Beans in West China

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the industrialization is not sound; the information is restricted. Corresponding suggestions are put forward in this paper as follows, in order to ensure the healthy development of industry of edible beans in China: formulate preferential policies; establish high-quality edible producing bases; promote the brand effect; pay attention to post-production development; develop the idea of new agricultural planting and cultivation.

  13. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  14. The effect of bean origin and temperature on grinding roasted coffee

    Science.gov (United States)

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-04-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily.

  15. Toxic metabolities of disulfoton: behavior in bean-seedlings, in soil, and in nutrient solution

    International Nuclear Information System (INIS)

    The absorption, translocation and degradation in bean-seedlings of three toxic metabolites of the pesticide 14C- disulfoton from nutrient solution or three different types of Brazilian soils is studied. (M.A.C.)

  16. Stem Rot on Adzuki Bean (Vigna angularis) Caused by Rhizoctonia solani AG 4 HGI in China.

    Science.gov (United States)

    Sun, Suli; Xia, Changjian; Zhang, Jiqing; Duan, Canxing; Wang, Xiaoming; Wu, Xiaofei; Lee, Suk-Ha; Zhu, Zhendong

    2015-03-01

    During late August and early September 2011, stem rot symptoms were observed on adzuki bean plants (Vigna angularis) growing in fields located in Beijing and Hebei Province, China, respectively. In this study, four isolates were obtained from infected stems of adzuki bean plants. Based on their morphology, and sequence and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analyses of the ribosomal DNA internal transcribed spacers (rDNA-ITS) region, the four isolates were identified as Rhizoctonia solani in anastomosis group (AG) 4 HGI. Pathogenicity tests showed that all isolates were strongly pathogenic to adzuki bean and resulted in serious wilt symptoms which was similar to observations in the fields. Additionally, the isolates infected several other crops and induced related rot on the roots and basal stems. To our knowledge, this is the first report of Rhizoctonia solani AG 4 HGI causing stem rot on adzuki bean. PMID:25774112

  17. Black bean (Phaseolus vulgaris L.) protein hydrolysates: Physicochemical and functional properties.

    Science.gov (United States)

    Evangelho, Jarine Amaral do; Vanier, Nathan Levien; Pinto, Vânia Zanella; Berrios, Jose J De; Dias, Alvaro Renato Guerra; Zavareze, Elessandra da Rosa

    2017-01-01

    Black bean protein hydrolysates obtained from pepsin and alcalase digestions until 120min of hydrolysis were evaluated by gel electrophoresis, relative fluorescence intensity, emulsifying properties, light micrograph of emulsions and in vitro antioxidant activity. The emulsion stability of the bean protein hydrolysates were evaluated during 30days of storage. The pepsin-treated bean protein hydrolysates presented higher degree of hydrolysis than the alcalase-treated protein hydrolysates. The alcalase-treated bean protein hydrolysates showed higher surface hydrophobicity. Moreover, the protein hydrolysates obtained with alcalase digestion presented higher emulsion stability during 30-days than those obtained from pepsin digestion. The protein concentrate and especially the hydrolysates obtained from alcalase digestion had good emulsion stability and antioxidant activity. Thus, they could be exploited as protein supplements in the diet as nutritional and bioactive foods. PMID:27507499

  18. [Comparison of green coffee beans volatiles chemical composition of Hainan main area].

    Science.gov (United States)

    Hu, Rong-Suo; Chu, Zhong; Gu, Feng-Lin; Lu, Min-Quan; Lu, Shao-Fang; Wu, Gui-Ping; Tan, Le-He

    2013-02-01

    Chemical component of Hainan green coffee beans was analyzed with solid phase microextraction-gas chromatography-mass spectrometry, and the discrepancy between two green coffee beans was differentiated through the spectrum database retrieval and retention index of compound characterization. The experimental results show that: the chemical composition of Wanning coffee beans and Chengmai coffee beans is basically the same. The quantity of analyzed compound in Wanning area coffee is 91, and in Chengmai area coffee is 106, the quantity of the same compound is 66, and the percent of the same component is 75.52%. The same compounds accounted for 89.86% of the total content of Wanning area coffee, and accounted for 85.70% of the total content of Chengmai area coffee. PMID:23697152

  19. Glycolic acid synthesis during dark glucose U14C metabolism, in French Bean and Maize leaves

    International Nuclear Information System (INIS)

    Serine, glycerate and glycolate are among the first radioactive compounds when French Bean and Maize leaves are fed with glucose U14C. Failing to detect radioactive glycine suggests that glycolate so synthesized is unavailable for the photorespiration glycolate pool

  20. Interaction of cold radiofrequency plasma with seeds of beans (Phaseolus vulgaris)

    OpenAIRE

    Bormashenko, Edward; Shapira, Yekaterina; Grynyov, Roman; Whyman, Gene; Bormashenko, Yelena; Drori, Elyashiv

    2015-01-01

    Highlight The impact of cold plasma on the wetting, water absorption, and germination of beans (Phaseolus vulgaris) is reported. Plasma treatment accelerated the water absorption and germination of seeds.

  1. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    2011-01-01

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  2. Anatomy of Lignosus Bean (Dipogon lignosus III. Stem

    Directory of Open Access Journals (Sweden)

    S.M. Abdul Bari

    2001-01-01

    Full Text Available Anatomical investigation has been made on the stem of lignosus bean (Dipogon lignosus (L. Verde. at different stages of growth. The epidermis is single layered consisting of small and large cells. The epidermis bears multicellular hair and glandular trichomes. Beneath the epidermis there are 5-6 layers of cortical cells in the stem. The primary vascular tissue appears after the elongation of the first internode of the stem of lignosus bean. The internode between cotyledonary node and first leaf is considered as the first internode of the stem. The vascular bundles are collateral and arranged in a ring. The secretory cells devoid of tanniniferous contents have been observed in the phloem region of the younger stem but not in older ones. The cambium initiates in the primary vascular bundle between xylem and phloem at the basal part of the stem of 7 days old plant. The cambium is at first confined to the fascicular region. Subsequently it extends into the interfascicular region forming a complete cambial ring. After the formation of fascicular cambium it gives rise to secondary xylem adaxially and secondary phloem abaxially. Some vessel members are paired while the others are solitary. Most of the paired vessels are radially arranged. The paired vessel members are more in number in the mature stem compared to that of the younger stem. The parenchyma covers the major area of the secondary xylem. The sclerenchymatous band abaxial to all large and small vascular bundles is discontinuous. The pith resembles a typical dicotyledonous stem. The phellogen appears in the deeper cortex and gives rise to 4-5 layers of cork cells abaxially and 3-4 layers of phelloderm adaxially

  3. Common bean cultivars and lines interactions with environments

    Directory of Open Access Journals (Sweden)

    Carbonell Sérgio Augusto Morais

    2004-01-01

    Full Text Available The performance of bean lines brought forth in breeding programs or of cultivars in use can be affected by environmental variability. The adaptability and stability of grain yield of 18 common bean cultivars and lines in 23 environments (combinations of seasons, years and locations were evaluated in the State of São Paulo, Brazil. 'IAC-Carioca' and 'IAC-Carioca Eté' were used as standard cultivars for the carioca grain type, while 'FT-Nobre' and 'IAC-Una' represented the standard for black grains. The experiment was set up in a randomized complete block design with four replications and plots consisting of two, two central five meters rows flanked by border rows. Stability parameters were estimated by the methods Maximum Yield Deviations (MYD and by the Additive Main Effects and Multiplicative Interaction Analysis (AMMI. For the identification of the most stable cultivars, the two methods led to consistent results, although by MYD the highest stability was always associated to the highest yield. 'MAC-733327' and 'LP 9637' were the most suitable cultivars and lines for the joint seasons, while 'LP 9637' and 'FT-Nobre' were the most suitable for the dry season. The MYD method combined a simple procedure, easiness of result interpretation, uniqueness of parameters, and association between stability and yield. On the other hand, the AMMI method simplified the identification of stable cultivars by visual inspection, also providing information on the environments. However, the complex nature which combines uni-and multivariate techniques hampers its widespread use in breeding programs.

  4. Induced mutations for disease resistance in wheat and field beans

    International Nuclear Information System (INIS)

    Wheat disease in Egypt is reviewed and results of mutation breeding by γ irradiation for disease resistance in wheat and field beans are described. Wheat mutants of the variety Giza 155 resistant to leaf rust, Giza 156 resistant to both leaf and yellow rusts, and Tosson with a reasonable level of combined resistance to the three rusts in addition to mutants of the tetraploid variety Dakar 52 with a good level of stem and yellow rust resistance are required. Their seeds were subjected to 10, 15 and 20 krad. Of 3000-3700 M2 plants from each variety and dosage, 22 plants from both Giza 155 and Giza 156, although susceptible, showed a lower level of disease development. In 1975, M3 families of these selected plants and 6000 plants from bulked material were grown from each variety and dosage at two locations. Simultaneously, an additional population consisting of 3000 mutagen-treated seeds was grown to have a reasonable chance of detecting mutants; 2 heads from each plant were harvested. These will be grown next season (1976) to make a population of 25,000-30,000 M2 plants and screened to composite cultures of specific rusts. Vicia faba seeds of field bean varieties Giza 1, Giza 2 and Rebaya 40, equally susceptible to rust and chocolate spot, were subjected to 3, 5 and 7 krad of 60Co gamma radiation and 800 M1 plants were grown in 1972 per variety and dose. Up to this later growing season (M3) no resistance was detected in M3 plank

  5. Radiation disinfestation of tobacco leaves and coffee beans

    International Nuclear Information System (INIS)

    The most important insects found on coffee and tobacco in storage are A. fasciculatus and L. serricorne, respectively. Some genera of mold, such as Rhyzopus, Aspergillus, Penicillium and Mucor, were found on stored coffee. A preliminary study of radiation disinfestation of coffee beans was carried out using 24 bags (each l.5 kg) of Arabica coffee. Each bag was infested with l00 adults of l-day-old to 8-day old A. fasciculatus. One month after infestation, the bags were divided into 6 groups (4 bags each). Five groups were irradiated with doses of 0, 0.05, 0.l0, 0.20, and 0.40 kGy, while the sixth group was fumigated with about 3 g phosphine-m/sup 3/. The work is still in progress. The preliminary data (insect density, percentage weight loss of coffee beans, and mold infestation) from l0 observation periods during 20 weeks of storage after treatment was reported. Radiation disinfestation of tobacco was done on 36 export-size bales (each l00 x 75 x 40 cm in size and about k00 kg in weight) of tobacco. Each bale was infested with larvae, pupae, and adults of L. serricorne. One week after infestation, the bales were divided into 3 groups, the first group kept untreated as controls, the second group irradiated at a dose range of 0.30 to 0.60 kGy, and the third group fumigated with about 3 g phosphine/m/sup 3/. Insect density, leaf moisture content and mold infestation will be observed after 0, 2, 4, and 6 months of storage. The work was begun in October l983 and data presently are being collected

  6. Effects of gravistimuli on osmoregulation in azuki bean epicotyls

    Science.gov (United States)

    Zhang, Yan; Soga, Kouichi; Wakabayashi, Kazuyuki; Hoson, Takayuki

    2013-02-01

    The effects of hypergravity on growth and osmoregulation were examined in dark-grown azuki bean epicotyls. Elongation growth of epicotyls was promptly suppressed by hypergravity at 300g. On the contrary, the increase in fresh weight of epicotyls during incubation was not suppressed by hypergravity at 300g at least up to 6 h. Also, the level of total osmotic solutes increased during epicotyl growth for 6 h, which was not affected by hypergravity. These results suggest that azuki bean epicotyls are capable of maintaining osmoregulation even under 300g conditions for a short period. On the other hand, the increase in fresh weight of epicotyls was suppressed, in addition to suppression of elongation growth, when seedlings were treated with 300g for 24 h. The increase in level of total osmotic solutes was also inhibited by 24 h hypergravity treatment, which was accounted by the reduced levels of organic solutes, such as sugars and amino acids. Furthermore, the dry weight of seeds decreased during incubation for 24 h, but the decrease was inhibited by hypergravity at 300g. Hypergravity treatment at 300g for 24 h also increased the pH value of apoplastic solution in epicotyls. Taken together, these results suggest that the translocation of organic solutes from the seed to epicotyls is inhibited by prolonged hypergravity treatment, which may underlie the suppression of epicotyl growth, and that the breakdown of H+ gradient across the plasma membrane in epicotyl cells may be at least partly involved in the reduction of organic solute accumulation under hypergravity conditions.

  7. Identification and analysis of common bean (Phaseolus vulgaris L. transcriptomes by massively parallel pyrosequencing

    Directory of Open Access Journals (Sweden)

    Thimmapuram Jyothi

    2011-10-01

    Full Text Available Abstract Background Common bean (Phaseolus vulgaris is the most important food legume in the world. Although this crop is very important to both the developed and developing world as a means of dietary protein supply, resources available in common bean are limited. Global transcriptome analysis is important to better understand gene expression, genetic variation, and gene structure annotation in addition to other important features. However, the number and description of common bean sequences are very limited, which greatly inhibits genome and transcriptome research. Here we used 454 pyrosequencing to obtain a substantial transcriptome dataset for common bean. Results We obtained 1,692,972 reads with an average read length of 207 nucleotides (nt. These reads were assembled into 59,295 unigenes including 39,572 contigs and 19,723 singletons, in addition to 35,328 singletons less than 100 bp. Comparing the unigenes to common bean ESTs deposited in GenBank, we found that 53.40% or 31,664 of these unigenes had no matches to this dataset and can be considered as new common bean transcripts. Functional annotation of the unigenes carried out by Gene Ontology assignments from hits to Arabidopsis and soybean indicated coverage of a broad range of GO categories. The common bean unigenes were also compared to the bean bacterial artificial chromosome (BAC end sequences, and a total of 21% of the unigenes (12,724 including 9,199 contigs and 3,256 singletons match to the 8,823 BAC-end sequences. In addition, a large number of simple sequence repeats (SSRs and transcription factors were also identified in this study. Conclusions This work provides the first large scale identification of the common bean transcriptome derived by 454 pyrosequencing. This research has resulted in a 150% increase in the number of Phaseolus vulgaris ESTs. The dataset obtained through this analysis will provide a platform for functional genomics in common bean and related legumes and

  8. Nutritional and Biochemical Studies on Irradiated Broad Beans (Giza-2)(Vicia Faba)

    International Nuclear Information System (INIS)

    Broad bean is an important source of dietary protein in Egypt. High losses due to insect infestation occur after each harvest. Radiation processing is an excellent alternative method which could be used to combat these losses. The beans were irradiated at doses of 2.5,5, 10 and 20 kGy. The effects of treatments were investigated on trypsin inhibitor, hemagglutination activity, in vitro protein digestibility, in vivo protein efficiency ratio (PER) and short-term rats feeding. A dose of 20 kGy significantly caused a great reduction in trypsin inhibitor (by 67.12%) and hemagglutination activity (by 87.5%) in broad bean, whereas its in vitro protein digestibility increased from 67.15 to 80, 68% and PER also increased from 1.01 to 1.22. The results of short term of rat feeding experiments indicated that the growth of young rats given raw or irradiated beans at 2.5 and 5 kGy was much lower than that of rats given diet based upon casein or irradiated beans up to 20 kGy. Feeding raw and processed beans at 2.5 and 5 kGy, caused a significant increase in the relative weight of pancreas while feeding irradiated beans at 10 and 20 kGy normalized the relative pancreas weight. No changes have been observed in relative weight for stomach, heart, liver, spleen, kidney and lungs in rats fed casein diet as compared with those fed raw and irradiated beans up to 20 kGy for 8 weeks

  9. Leaf traits associated with drought adaptation in faba bean (Vicia faba L.)

    OpenAIRE

    Khazaei, Hamid

    2014-01-01

    The potential for use of faba bean (Vicia faba L.) is increasing worldwide due to its positive environmental impact and nutritional interest, but there are many challenges for faba bean breeding and cultivation. These include its mixed breeding system, its unknown origin and wild progenitor, its large genome being the biggest diploid genome among field crops, and its relative sensitivity to biotic and abiotic stresses (e.g., drought). Little is known about the ecological adaptation of faba be...

  10. Performance of Disk Mill Type Mechanical Grinder for Size Reducing Process of Robusta Roasted Beans

    Directory of Open Access Journals (Sweden)

    Sri Mulato

    2006-12-01

    Full Text Available One of improtant steps in secondary coffee processing that influence on final product quality such as consistency and uniformity is milling process. Usually, Indonesian smallholder used "lumpang" for milling coffee roasted beans to coffee powder product which caused the final product not uniformed and consistent, and low productivity. Milling process of coffee roasted beans can be done by disk mill type mechanical grinder which is used by smallholder for milling several cereals. Indonesian Coffee and Cocoa Research Institute have developed disk mill type grinding machine for milling coffee roasted beans. Objective of this research is to find performance of disk mill type grinding machine for size reducing process of Robusta roasted beans from several size dried beans and roasting level treatments. Robusta dried beans which are taken from dry processing method have 13—14% moisture content (wet basis, 680—685 kg/m3 density, and classified in 3 sizes level. The result showed that the disk mill type of grinding machine could be used for milling Robusta roasted beans. Machine hascapacity 31—54 kg/h on 5,310—5,610 rpm axle rotation and depend on roasting level. Other technical parameters were 91—98% process efficientcy, 19—31 ml/ kg fuel consumption, 0.3—1% slips, 50—55% particles had diameter less than 230 mesh and 38—44% particles had diameter bigger than 100 mesh, 32—38% lightness was increased, 0.6—12.6% density was decreased, and solubility of coffee powder between 28—30%. Cost milling process per kilogram of Robusta roasted beans which light roast on capacity 30 kg/hour was Rp362.9. Key words : Coffee roasted, Robusta, disk mill, mechanical grinder, size reduction.

  11. Polyphenol Content and Antiradical Activity of “Sarconi” Beans (Phaseolus vulgaris L.) Ecotype

    OpenAIRE

    A. Romani; P. VIGNOLINI; M.A. Falvino; D. HEIMLER

    2013-01-01

    The aim of this study was to establish the distribution and content of polyphenols (anthocyans, flavonols and hydroxycinnamic acids) in hulls and seeds of Sarconi beans having different colours and shapes. Sarconi beans are protected by the indication of geographic provenance (IGP) denomination and include different ecotypes. The seeds sampled in the study area (Basilicata, val d’Agri) exhibited different colours from white (Riso bianco) to dark yellow (Tabacchino), to green (Verdolino) and t...

  12. Soluble and Insoluble Dietary Fiber in Cooked Common Bean (Phaseolus Vulgaris) Seeds

    OpenAIRE

    Hughes, Joe S.; Swanson, Barry G.

    1989-01-01

    The common bean (Phaseolus vulgaris) requires cooking for extended periods of time prior to consumption. In this investigation both quantitative and microstructural changes in common bean dietary fiber as a result of cooking were examined. Cooking resulted in a slight decrease in soluble dietary fiber and a marked increase in insoluble dietary fiber. The increase in insoluble dietary fiber was responsible for a 15 -30 percent increase in total dietary fiber. Scanning electron microscopy wa...

  13. CULTIVAR RELEASE-BRS Cometa: a carioca common bean cultivar with erect growth habit

    OpenAIRE

    Luis Cláudio de Faria; Maria José Del Peloso; Leonardo Cunha Melo; Joaquim Geraldo Cáprio da Costa; Carlos Agustín Rava; José Luiz Cabrera Díaz; Josias Correia de Faria; Heloisa Torres da Silva; Aloisio Sartorato; Priscila Zaczuk Bassinello; José Benedito de Freitas Trovo

    2008-01-01

    BRS Cometa was developed by Embrapa Rice and Beans and registered by the Ministério da Agricultura,Pecuária e Abastecimento (MAPA) for the states of Santa Catarina, São Paulo, Tocantins, Goiás and the Federal District ofBrazil in view of its erect growth habit, earliness, good lodging resistance and resistance to Colletotrichum lindemuthianumand to bean common mosaic virus.

  14. CULTIVAR RELEASE-BRS Cometa: a carioca common bean cultivar with erect growth habit

    Directory of Open Access Journals (Sweden)

    Luis Cláudio de Faria

    2008-01-01

    Full Text Available BRS Cometa was developed by Embrapa Rice and Beans and registered by the Ministério da Agricultura,Pecuária e Abastecimento (MAPA for the states of Santa Catarina, São Paulo, Tocantins, Goiás and the Federal District ofBrazil in view of its erect growth habit, earliness, good lodging resistance and resistance to Colletotrichum lindemuthianumand to bean common mosaic virus.

  15. Analysis of Determinants of Productivity and Technical Efficiency among Smallholder Common Bean Farmers in Eastern Uganda

    OpenAIRE

    Sibiko, K.W.; G Owuor; Birachi, E.; Gido, E.O.; O.I. Ayuya; Mwangi, J.K.

    2013-01-01

    The study evaluated factors influencing bean productivity and technical efficiency among smallholder farmers in Eastern Uganda, using a stochastic frontier model and a Tobit model. Findings showed that bean productivity was significantly influenced by plot-size, seeds and planting fertilizer; mean technical efficiency for sampled farms was 48.2%. The Tobit model estimation revealed that technical efficiency was positively influenced by value of assets (at 1% level), extension service and grou...

  16. Iron and zinc retention in common beans (Phaseolus vulgaris L.) after home cooking

    OpenAIRE

    Lucia M. J. Carvalho; Corrêa, Mariana M.; Elenilda J. Pereira; Nutti, Marília R.; Carvalho, José L. V.; Ribeiro, Ediane M. G.; Freitas, Sidinéa C.

    2012-01-01

    Background: According to the World Health Organization (WHO), iron, iodine, and Vitamin A deficiencies are the most common forms of malnutrition, leading to severe public health consequences. The importance of iron and zinc in human nutrition and the number of children found to be deficient in these nutrients make further studies on retention in cooked grains and cooked bean broth important. Objectives: This work aimed to evaluate iron and zinc retention in six common bean (Phaseolus vulgaris...

  17. Yield stability and relationships among stability parameters in faba bean (Vicia faba L.) genotypes

    OpenAIRE

    Tamene Temesgen; Gemechu Keneni; Tadese Sefera; Mussa Jarso

    2015-01-01

    Sixteen faba bean genotypes were evaluated in 13 environments in Ethiopia during the main cropping season for three years (2009–2011). The objectives of the study were to evaluate the yield stability of the genotypes and the relative importance of different stability parameters for improving selection in faba bean. The study was conducted using a randomized complete block design with four replications. G × E interaction and yield stability were estimated using 17 different stability parameter...

  18. Phytochemical Characteristics of Coffee Bean Treated by Coating of Ginseng Extract

    OpenAIRE

    Choi, Sang Yoon; Hong, Hee-Do; Bae, Hye-Min; Choi, Changsun; Kim, Kyung-Tack

    2011-01-01

    The principal objective of this study was to assess the instrumental and sensory characteristics of ginseng coffee with different ratios of the ingredients: type of coffee bean (Colombia, Brazil, and Indonesia), type of ginseng extract (white ginseng, red ginseng, and America ginseng) and concentration of ginseng extract (3, 6, and 9 w/v %). The sensory optimal condition of white ginseng coffee, red ginseng coffee and America ginseng coffee were as follows: 3% Indonesian coffee bean coated wi...

  19. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    Science.gov (United States)

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. PMID:26838420

  20. Protein Rich Flour from Hyacinth Bean as Functional Food Ingredient with Low Glycemic Index

    OpenAIRE

    *Ahmad Nafi’; Wiwik Siti Windrati; Andri Pamungkas; Achmad Subagio

    2014-01-01

    Protein-rich flour (PRF) produced from Hyacinth bean (Lablab purpureus (L) Sweet) shows good potency as a functional food ingredient. The PRF was extracted from hyacinth bean using water followed by protein precipitation at its isoelectric point. The precipitate was neutralized using 1 N NaOH and the slurry was dried, ground and sieved. The objective of this research was to characterize the nutritive value of PRF i.e., protein content and amino acid profile, trypsin inhibitors activity, conte...