WorldWideScience

Sample records for amf species beans

  1. Assess suitability of hydroaeroponic culture to establish tripartite symbiosis between different AMF species, beans, and rhizobia

    Directory of Open Access Journals (Sweden)

    Jansa Jan

    2009-06-01

    Full Text Available Abstract Background Like other species of the Phaseoleae tribe, common bean (Phaseolus vulgaris L. has the potential to establish symbiosis with rhizobia and to fix the atmospheric dinitrogen (N2 for its N nutrition. Common bean has also the potential to establish symbiosis with arbuscular mycorrhizal fungi (AMF that improves the uptake of low mobile nutrients such as phosphorus, from the soil. Both rhizobial and mycorrhizal symbioses can act synergistically in benefits on plant. Results The tripartite symbiosis of common bean with rhizobia and arbuscular mycorrhizal fungi (AMF was assessed in hydroaeroponic culture with common bean (Phaseolus vulgaris L., by comparing the effects of three fungi spp. on growth, nodulation and mycorrhization of the roots under sufficient versus deficient P supplies, after transfer from initial sand culture. Although Glomus intraradices Schenck & Smith colonized intensely the roots of common bean in both sand and hydroaeroponic cultures, Gigaspora rosea Nicolson & Schenck only established well under sand culture conditions, and no root-colonization was found with Acaulospora mellea Spain & Schenck under either culture conditions. Interestingly, mycorrhization by Glomus was also obtained by contact with mycorrhized Stylosanthes guianensis (Aubl. sw in sand culture under deficient P before transfer into hydroaeroponic culture. The effect of bean genotype on both rhizobial and mycorrhizal symbioses with Glomus was subsequently assessed with the common bean recombinant inbreed line 7, 28, 83, 115 and 147, and the cultivar Flamingo. Significant differences among colonization and nodulation of the roots and growth among genotypes were found. Conclusion The hydroaeroponic culture is a valuable tool for further scrutinizing the physiological interactions and nutrient partitioning within the tripartite symbiosis.

  2. Impact of water regimes on an experimental community of four desert arbuscular mycorrhizal fungal (AMF) species, as affected by the introduction of a non-native AMF species.

    Science.gov (United States)

    Symanczik, Sarah; Courty, Pierre-Emmanuel; Boller, Thomas; Wiemken, Andres; Al-Yahya'ei, Mohamed N

    2015-11-01

    Field studies have revealed the impact of changing water regimes on the structure of arbuscular mycorrhizal fungal (AMF) communities, but it is not known what happens to the abundance of individual AMF species within the community when the water conditions in the rhizosphere change. The behavior of four AMF species isolated from the Arabian desert (Diversispora aurantia, Diversispora omaniana, Septoglomus africanum, and an undescribed Paraglomus species) was investigated when assembled in microcosms containing Sorghum bicolor as host plant, and treated with various water regimes. Furthermore, the impact of invasion of these assemblages by Rhizophagus irregularis, an AMF species widely used in commercial inocula, was studied. The abundance of each AMF species in sorghum roots was measured by determining the transcript numbers of their large ribosomal subunit (rLSU) by real-time PCR, using cDNA and species-specific primers. Plant biomass and length of AMF extraradical hyphae were also measured. The abundance of each AMF species within the sorghum roots was influenced by both the water regime and the introduction of R. irregularis. Under dry conditions, the introduction of R. irregularis reduced the total abundance of all native AMF species in roots and also led to a reduction in the amount of extraradical mycelium, as well as to a partial decrease in plant biomass. The results indicate that both water regime and the introduction of an invasive AMF species can strongly alter the structure of an AMF native assemblage with a consequent impact on the entire symbiotic mycorrhizal relationship.

  3. Effect of ryegrass (Lolium perenne L.) roots inoculation using different arbuscular mycorrhizal fungi (AMF) species on sorption of iron-cyanide (Fe-CN) complexes

    Science.gov (United States)

    Sut, Magdalena; Boldt-Burisch, Katja; Raab, Thomas

    2016-04-01

    Soils and groundwater on sites of the former Manufactured Gas Plants (MGPs) are contaminated with various complex iron-cyanides (Fe-CN). Phytoremediation is a promising tool in stabilization and remediation of Fe-CN affected soils, however, it can be a challenging task due to extreme adverse and toxic conditions. Phytoremediation may be enhanced via rhizosphere microbial activity, which can cooperate on the degradation, transformation and uptake of the contaminants. Recently, increasing number of scientist reports improved plants performance in the removal of toxic compounds with the support of arbuscular mycorrhizae fungi (AMF). Series of batch experiments using potassium hexacyanoferrate (II) solutions, in varying concentrations, were used to study the effect of ryegrass roots (Lolium perenne L.) inoculation with Rhizophagus irregularis and a mixture of Rhizophagus irregularis, Funneliformis mosseae, Rhizophagus aggregatus, and Claroideoglomus etunicatum on Fe-CN sorption. Results indicated significantly higher colonization of R. irregularis than for the mixture of AMF species on ryegrass roots. Sorption experiments revealed significantly higher reduction of total CN and free CN content in the mycorrhizal roots, indicating greater cyanide decrease in the treatment inoculated with R. irregularis. Our study indicates contribution of AM fungi in phytoremediation of Fe-CN contaminated soil.

  4. AMF 1 Site Science

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Mark Alan [Rutgers Univ., New Brunswick, NJ (United States)

    2016-08-18

    This report documents progress on DOE Grant# DE-FG02-08ER64531 funded by the Department of Energy’s Atmospheric Systems Research (ASR) program covering the period between its inception in 2008 and its conclusion in 2014. The Atmospheric Radiation Measurement (ARM) Program’s Mobile Facility #1 (AMF#1) is a collection of state-of-the art atmospheric sensing systems including remote and in situ instrumentation designed to characterize the atmospheric column above and in the immediate vicinity of the deployment location. The grant discussed in this report funded the activities of the AMF#1 Site Scientist Team. Broad responsibilities of this team included examining new deployment sites and recommending instrument deployment configurations; data quality control during the early stages of deployments and for certain instruments through the course of the deployment; scientific outreach in the host country or location (particularly international deployments); scientific research oriented toward basic questions about cloud physics and radiation transfer in the deployment region; and training of Ph.D. students to conduct future research relevant to the Atmospheric Systems Research (ASR) program.

  5. Petroleum hydrocarbon contamination, plant identity and arbuscular mycorrhizal fungal (AMF) community determine assemblages of the AMF spore-associated microbes.

    Science.gov (United States)

    Iffis, Bachir; St-Arnaud, Marc; Hijri, Mohamed

    2016-09-01

    The root-associated microbiome is a key determinant of pollutant degradation, soil nutrient availability and plant biomass productivity, but could not be examined in depth prior to recent advances in high-throughput sequencing. Arbuscular mycorrhizal fungi (AMF) form symbioses with the majority of vascular plants. They are known to enhance mineral uptake and promote plant growth and are postulated to influence the processes involved in phytoremediation. Amplicon sequencing approaches have previously shown that petroleum hydrocarbon pollutant (PHP) concentration strongly influences AMF community structure in in situ phytoremediation experiments. We examined how AMF communities and their spore-associated microbiomes were structured within the rhizosphere of three plant species growing spontaneously in three distinct waste decantation basins of a former petrochemical plant. Our results show that the AMF community was only affected by PHP concentrations, while the AMF-associated fungal and bacterial communities were significantly affected by both PHP concentrations and plant species identity. We also found that some AMF taxa were either positively or negatively correlated with some fungal and bacterial groups. Our results suggest that in addition to PHP concentrations and plant species identity, AMF community composition may also shape the community structure of bacteria and fungi associated with AMF spores.

  6. Development and reproduction of Bemisia tabaci (Homoptera: Aleyrodidae) on three bean species

    Institute of Scientific and Technical Information of China (English)

    PETERD.MUSA; SHUN-XIANGREN

    2005-01-01

    The development, survivorship and reproduction of Bemisia tabaci B-biotype on three bean species were studied at 26 ± 1 ℃ in the laboratory. The developmental periods from egg to adult varied from 27.80 days on garden beans to 18.20 days on soybeans. The survivorship from egg to adult on soybeans, cowpeas and garden beans was 77.14, 70.14 and 64.28%, respectively. The average longevity of female adults ranged from 12.30 days on soybeans to 9.80 days on garden beans, and the oviposition of B. tabaci varied from 160.85 eggs on soybeans to 98.00 eggs on garden beans. Life table parameters were calculated as biological attributes for Bemisia tabaci populations fed on three bean species. The results indicated that the intrinsic rate of increase (rm), the finite rate of increase ( λ ) and net reproductive rate (R0) were high for populations fed on soybeans, with values of 0.1857,1.2041 and 82.1576, respectively. The corresponding values were less for populations fed on garden beans, with values of 0.1097, 1.1159 and 31.2661, respectively. The parametric values for cowpeas were intermediate between soybeans and garden beans but no significant difference were observed for the rm values for soybeans and cowpeas. Experimental evidence in our investigation indicated that Bemisia tabaci is best adapted and shows the greatest preference for soybean of the three bean species tested in this study.

  7. Two novel species of Aspergillus section Nigri from Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, Paramee; Mahakarnchanakul, Warapa; Varga, Janos

    2008-01-01

    Two novel species of Aspergillus section Nigri from Thai coffee beans are described as Aspergillus aculeatinus sp. nov. and Aspergillus sclerotiicarbonarius sp. nov. Their taxonomic status was determined using a polyphasic taxonomic approach with phenotypic (morphology and extrolite profiles...

  8. Use of Wild Relatives and Closely Related Species to Adapt Common Bean to Climate Change

    Directory of Open Access Journals (Sweden)

    James D. Kelly

    2013-05-01

    Full Text Available Common bean (Phaseolus vulgaris L. is an important legume crop worldwide. However, abiotic and biotic stress limits bean yields to <600 kg ha−1 in low-income countries. Current low yields result in food insecurity, while demands for increased yields to match the rate of population growth combined with the threat of climate change are significant. Novel and significant advances in genetic improvement using untapped genetic diversity available in crop wild relatives and closely related species must be further explored. A meeting was organized by the Global Crop Diversity Trust to consider strategies for common bean improvement. This review resulted from that meeting and considers our current understanding of the genetic resources available for common bean improvement and the progress that has been achieved thus far through introgression of genetic diversity from wild relatives of common bean, and from closely related species, including: P. acutifolius, P. coccineus, P. costaricensis and P. dumosus. Newly developed genomic tools and their potential applications are presented. A broad outline of research for use of these genetic resources for common bean improvement in a ten-year multi-disciplinary effort is presented.

  9. Characterization of Resistance Mechanisms in Faba Bean (Vicia faba) against Broomrape Species (Orobanche and Phelipanche spp.)

    Science.gov (United States)

    Rubiales, Diego; Rojas-Molina, Maria M.; Sillero, Josefina C.

    2016-01-01

    Faba bean (Vicia faba) production in Mediterranean and Near East agriculture is severely constrained by broomrape infection. The most widely distributed broomrape species affecting faba bean is Orobanche crenata, although O. foetida and Phelipanche aegyptiaca are of local importance. Only moderately resistant cultivars are available to farmers. Rizotrons studies allowed the dissection of resistance components in faba bean accessions against the very infective species O. crenata, O. foetida var. broteri and P. aegyptiaca, and to the inappropriate P. ramosa and O. foetida var. foetida. Results confirm that some levels of incomplete resistance are available, resulting in a reduced number of broomrape tubercles successfully formed per faba bean plant. Interestingly, the intermediate levels of resistance of cv. Baraca were operative against all broomrape populations and species studied, confirming previous reports on the stability of resistance of Baraca in field trials in different countries. Low induction of seed germination played a major role in the resistance against the inappropriate O. foetida var. foetida but not against the also inappropriate P. ramosa, neither to the infective species O. crenata, O. foetida var. broteri, or P. aegyptiaca. Negative tropism of germinated seeds with radicles growing away from faba bean roots was marked for both inappropriate species but was not observed in any of the infective species. Also, a proportion of radicles that had successfully contacted faba bean roots became necrotic, failing in starting tubercle development, particularly frequent for the two inappropriate species. Such necrosis was significant also on radicles contacting resistant faba bean accessions, being particularly relevant for Spanish O. crenata population, and lower although still significant in some accessions against Syrian O. crenata and P. aegyptiaca, suggesting that this might also be an operative mechanism to be selected and further exploited in faba

  10. Characterization resistance mechanisms in faba bean (Vicia faba against broomrape species (Orobanche and Phelipanche spp.

    Directory of Open Access Journals (Sweden)

    Diego Rubiales

    2016-11-01

    Full Text Available Faba bean (Vicia faba production in Mediterranean and Near East agriculture is severely constrained by broomrape infection. The most widely distributed broomrape species affecting faba bean is Orobanche crenata, although O. foetida and Phelipanche aegyptiaca are of local importance. Only moderately resistant cultivars are available to farmers. Rizotrons studies allowed the dissection of resistance components in faba bean accessions against the very infective species O. crenata, O. foetida var. broteri and P. aegyptiaca, and to the inappropriate P. ramosa and O. foetida var. foetida. Results confirm that some levels of incomplete resistance are available, resulting in a reduced number of broomrape tubercles successfully formed per faba bean plant. Interestingly, the intermediate levels of resistance of cv. Baraca were operative against all broomrape populations and species studied, confirming previous reports on the stability of resistance of Baraca in field trials in different countries. Low induction of seed germination played a major role in the resistance against the inappropriate O. foetida var. foetida but not against the also inappropriate P. ramosa, neither to the infective species O. crenata, O. foetida var. broteri or P. aegyptiaca. Negative tropism of germinated seeds with radicles growing away from faba bean roots was marked for both inappropriate species but was not observed in any of the infective species. Also, a proportion of radicles that had successfully contacted faba bean roots became necrotic, failing in starting tubercle development, particularly frequent for the two inappropriate species. Such necrosis was significant also on radicles contacting resistant faba bean accessions, being particularly relevant for Spanish O. crenata population, and lower although still significant in some accessions against Syrian O. crenata and P. aegytiaca, suggesting that this might also be an operative mechanism to be selected and further

  11. Susceptibility of six cultivars of bean to different isolates of two species of Fusariumin greenhouse.

    Science.gov (United States)

    Faraji, M; Okhovvat, S M

    2005-01-01

    In greenhouse, susceptibility of 6 cultivars of bean (b1, green bean cv. contender, b2, Pinto b. cv. Cos-16, b3, green b. Sun Ray, b4, white b. cv. Daneshkadeh, b5, red b. cv. Naz, b6, red b. cv. Goli) evaluated to 7 isolates of 2 species of Fusarium (6 isolates of F. oxysporum and 1 isolate of F. solani from Varamin, Iran) in 4 pots (as replications) in factoriel experiment. The seedlings of each bean cultivars soaked in a suspension of the fungi (106 spores/ml.) for 5 minutes and transplanted into the pots contained sterilized soil, for control, the roots soaked in distilled water. After 35 days of inoculating and transplanting in greenhouse conditions (with 18-26 degrees C and 12 h light & 12 h dark) the percentage of necrotic roots and stems of the seedlings affected to the isolates of the fungi, also height and weight of them in different treatments datermined and calculated. The results showed that, the average of necrotic percent of the cultivars of bean seedlings grouped in 3 category (b1, b2, b3, b4 with 25.15% in group a and b5, red bean cv. Naz with 16.29% in group b and b6 red bean cv. Goli with 10.02% in group c) based on cluster analysis. But by Dunken method the infection set on 5 groups as respectively b4, 28,72% (a), b2, 25.83% (ab), b1 & b3, 23,18% & 22.84% (b), b5, 16.29% (c) and b6, 10.02% (d). So, red bean cv. Goli was more resistant and white bean cv. Daneshkadeh was more susceptible than of another cultivars, but averse the effect of the fungi on growth factors were different.

  12. AMF和饭豆根瘤菌对饭豆、玉米套种促生作用的研究%Effects of AMF and Rhizobium co-inoculation on alternative plantation of rice bean and corn

    Institute of Scientific and Technical Information of China (English)

    周小宇; 郑慧芬; 潘峰; 何绍江; 胡正嘉; 冯新梅

    2003-01-01

    将从饭豆根瘤中分离的饭豆根瘤菌(Rhizobium sp.CYY3302,Rhizobium sp.HCY9101,Rhizobium SP.JMC1C1402)与AMF(Arbuscular Mycorrhizal Fungi)共同接种于饭豆,进行饭豆、玉米田间小区套种试验.结果表明,接种饭豆根瘤菌和AMF的处理与未接种的处理相比,饭豆的结瘤率比对照提高52%~134%;饭豆及玉米的菌根感染率比对照分别增加43.1%~80%和46.8%~97.6%;饭豆的产量提高了54%~67%,而玉米的产量提高了2.4%~19.5%.研究结果还表明:豆科作物接种根瘤菌,即使在种过豆科作物的老区,也是有效的.

  13. Selection of Aruscular Mycorrhizal Fungi (AMF Indigeneus in Ultisol for Promoting The Production of Glmalin and Aggregate Formation Processes

    Directory of Open Access Journals (Sweden)

    Amrizal Saidi

    2014-01-01

    Full Text Available The muatualism symbiosis of arbuscular mycorrhizal fungi ( AMF with plants  are able to increase the capacity of plants to absorb nutrients and water from the soil. Recently, research was indicated that AMF hyphae containing glomalin as a glycoprotein that serves to glue the between dispersed soil particles. The content of glomalin in soil was positively correlated with soil aggregate stability. The research potential of AMF species indigenous of Ultisol Darmasraya District of West Sumatra and glomalin production in experimental pots of sterile sand medium has been carried out. The purpose of this study was to determine the diversity of AMF species on Ultisol and to seeking indigenous AMF isolates that have the best glomalin production capability. AMF spores were isolated and identified from the rhizosphere soil of corn in Ultisol. AMF species that have been identified experimentally tested culture medium pot of sand and zeolite (w / w 1:1 using corn crops. The results showed that the AMF species indigenous of Ultisol Darmasraya found 9 species, namely Acaulospora scrobiculata, Glomus etunicatum, Glomus luteum, Glomus mosseae, Glomus verruculosum, Glomus versiforme, Scutellospora gregaria, Scutellospora heterogama and Gigaspora sp. AMF species that showed better colonization ability in maize is G. luteum, G. verruculosum and G. versiforme. All three species can produce glomalin was significantly higher than the other species, ie 1.29 mg.g-1; 1.17 mg.g-1; 1.15 mg.g-1 respectively.

  14. Conservation of Plasmid-Encoded Traits among Bean-Nodulating Rhizobium Species

    OpenAIRE

    Brom, Susana; Girard, Lourdes; García-de los Santos, Alejandro; Sanjuan-Pinilla, Julio M.; Olivares, José; Sanjuan, Juan

    2002-01-01

    Rhizobium etli type strain CFN42 contains six plasmids. We analyzed the distribution of genetic markers from some of these plasmids in bean-nodulating strains belonging to different species (Rhizobium etli, Rhizobium gallicum, Rhizobium giardinii, Rhizobium leguminosarum, and Sinorhizobium fredii). Our results indicate that independent of geographic origin, R. etli strains usually share not only the pSym plasmid but also other plasmids containing symbiosis-related genes, with a similar organi...

  15. OIL CONTENT OF GREEN BEANS FROM SOME COFFEE SPECIES

    Directory of Open Access Journals (Sweden)

    MAZZAFERA PAULO

    1998-01-01

    Full Text Available The oil content was determined in seeds of several continental African species of the coffee germplasm bank of Instituto Agronômico de Campinas, State of São Paulo, Brazil. Oil was extracted from seeds with hexane in Soxhlet apparatus. Due to the economic importance, C. arabica and C. canephora have been the best studied species concerning oil content and composition, and the results obtained are in agreement with the reported in the literature. On the other hand, only one report in the literature describes the results of oil analyses in other few species of the African continent, although it does not allow comparison with our results. The oil content of most of the species varied from 9 to 15%, therefore, similar to the range observed for C. arabica and C. canephora. The exception was C. salvatrix, with 29% of oil in the seeds.

  16. Species Diversity, Community Dynamics, and Metabolite Kinetics of the Microbiota Associated with Traditional Ecuadorian Spontaneous Cocoa Bean Fermentations▿

    Science.gov (United States)

    Papalexandratou, Zoi; Falony, Gwen; Romanens, Edwina; Jimenez, Juan Carlos; Amores, Freddy; Daniel, Heide-Marie; De Vuyst, Luc

    2011-01-01

    Traditional fermentations of the local Ecuadorian cocoa type Nacional, with its fine flavor, are carried out in boxes and on platforms for a short time. A multiphasic approach, encompassing culture-dependent and -independent microbiological analyses of fermenting cocoa pulp-bean samples, metabolite target analyses of both cocoa pulp and beans, and sensory analysis of chocolates produced from the respective fermented dry beans, was applied for the investigation of the influence of these fermentation practices on the yeast and bacterial species diversity and community dynamics during cocoa bean fermentation. A wide microbial species diversity was found during the first 3 days of all fermentations carried out. The prevailing ethanol-producing yeast species were Pichia kudriavzevii and Pichia manshurica, followed by Saccharomyces cerevisiae. Leuconostoc pseudomesenteroides (glucose and fructose fermenting), Fructobacillus tropaeoli-like (fructose fermenting), and Lactobacillus fermentum (citrate converting, mannitol producing) represented the main lactic acid bacterial species in the fermentations studied, resulting in intensive heterolactate metabolism of the pulp substrates. Tatumella saanichensis and Tatumella punctata were among the members of the family Enterobacteriaceae present during the initial phase of the cocoa bean fermentations and could be responsible for the production of gluconic acid in some cases. Also, a potential new yeast species was isolated, namely, Candida sorbosivorans-like. Acetic acid bacteria, whose main representative was Acetobacter pasteurianus, generally appeared later during fermentation and oxidized ethanol to acetic acid. However, acetic acid bacteria were not always present during the main course of the platform fermentations. All of the data taken together indicated that short box and platform fermentation methods caused incomplete fermentation, which had a serious impact on the quality of the fermented dry cocoa beans. PMID

  17. Species diversity, community dynamics, and metabolite kinetics of the microbiota associated with traditional ecuadorian spontaneous cocoa bean fermentations.

    Science.gov (United States)

    Papalexandratou, Zoi; Falony, Gwen; Romanens, Edwina; Jimenez, Juan Carlos; Amores, Freddy; Daniel, Heide-Marie; De Vuyst, Luc

    2011-11-01

    Traditional fermentations of the local Ecuadorian cocoa type Nacional, with its fine flavor, are carried out in boxes and on platforms for a short time. A multiphasic approach, encompassing culture-dependent and -independent microbiological analyses of fermenting cocoa pulp-bean samples, metabolite target analyses of both cocoa pulp and beans, and sensory analysis of chocolates produced from the respective fermented dry beans, was applied for the investigation of the influence of these fermentation practices on the yeast and bacterial species diversity and community dynamics during cocoa bean fermentation. A wide microbial species diversity was found during the first 3 days of all fermentations carried out. The prevailing ethanol-producing yeast species were Pichia kudriavzevii and Pichia manshurica, followed by Saccharomyces cerevisiae. Leuconostoc pseudomesenteroides (glucose and fructose fermenting), Fructobacillus tropaeoli-like (fructose fermenting), and Lactobacillus fermentum (citrate converting, mannitol producing) represented the main lactic acid bacterial species in the fermentations studied, resulting in intensive heterolactate metabolism of the pulp substrates. Tatumella saanichensis and Tatumella punctata were among the members of the family Enterobacteriaceae present during the initial phase of the cocoa bean fermentations and could be responsible for the production of gluconic acid in some cases. Also, a potential new yeast species was isolated, namely, Candida sorbosivorans-like. Acetic acid bacteria, whose main representative was Acetobacter pasteurianus, generally appeared later during fermentation and oxidized ethanol to acetic acid. However, acetic acid bacteria were not always present during the main course of the platform fermentations. All of the data taken together indicated that short box and platform fermentation methods caused incomplete fermentation, which had a serious impact on the quality of the fermented dry cocoa beans.

  18. Investigating the context-dependency of plant-soil-AMF-microbe interactions along a pollution gradient

    Science.gov (United States)

    Glassman, S. I.; Casper, B. B.

    2010-12-01

    Background/Question/Methods Investigating how arbuscular mycorrhizal fungi (AMF)-plant interactions vary with edaphic conditions provides an opportunity to test the context-dependency of interspecific interactions, which is currently recognized as a major avenue of future research. We study plant-mycorrhiza symbiotic relationships along a gradient of heavy metal contamination at a recently revegetated “Superfund” site on Blue Mountain, in Palmerton, Pennsylvania. We investigated the interactions involving the native mycorrhizal fungi, non-mycorrhizal soil microbes, soil, and two plant species (a C3 and C4 grass) along the contamination gradient. The native C3 study species Deschampsia flexuosa, is dominant along the gradient and established naturally; the C4 Sorghastrum nutans, is native to Pennsylvania but not to the site and was introduced during restoration. Because C4 grasses are obligate mycotrophs, we expected S. nutans to have a different effect on and response to the soil symbiont community than the C3 grass. We carried out a full factorial greenhouse experiment using field-collected seeds of D. flexuosa and S. nutans, soil, AMF spores, and non-mycorrhizal microbes from both high and low contaminated ends of the gradient. After 11 weeks of growth in the greenhouses, we harvested above and belowground plant biomass, and quantified AMF root colonization and AMF sporulation. Results/Conclusions Our results indicate that context-dependent function is an important factor driving specific ecological interactions between plants and soil microbes. We found that soil origin significantly affected plant growth. Plants from both species grew much larger in soil from low contaminated (LC) origin than high contaminated (HC) origin. Furthermore, we found that the efficacy of AMF in promoting plant growth depended on AMF origin. Specifically, AMF from LC improved growth of D. flexuosa best in either soil background and improved survivorship of S. nutans in HC soil

  19. Detection of genome donor species of neglected tetraploid crop Vigna reflexo-pilosa (creole bean, and genetic structure of diploid species based on newly developed EST-SSR markers from azuki bean (Vigna angularis.

    Directory of Open Access Journals (Sweden)

    Sompong Chankaew

    Full Text Available Vigna reflexo-pilosa, which includes a neglected crop, is the only one tetraploid species in genus Vigna. The ancestral species that make up this allotetraploid species have not conclusively been identified, although previous studies suggested that a donor genome of V. reflexo-pilosa is V. trinervia. In this study, 1,429 azuki bean EST-SSR markers were developed of which 38 EST-SSR primer pairs that amplified one product in diploid species and two discrete products in tetraploid species were selected to analyze 268 accessions from eight taxa of seven Asian Vigna species including V. reflexo-pilosa var. glabra, V. reflexo-pilosa var. reflexo-pilosa, V. exilis, V. hirtella, V. minima, V. radiata var. sublobata, V. tenuicaulis and V. trinervia to identify genome donor of V. reflexo-pilosa. Since both diploid and tetraploid species were analyzed and each SSR primer pair detected two loci in the tetraploid species, we separated genomes of the tetraploid species into two different diploid types, viz. A and B. In total, 445 alleles were detected by 38 EST-SSR markers. The highest gene diversity was observed in V. hirtella. By assigning the discrete PCR products of V. reflexo-pilosa into two distinguished genomes, we were able to identify the two genome donor parents of créole bean. Phylogenetic and principal coordinate analyses suggested that V. hirtella is a species complex and may be composed of at least three distinct taxa. Both analyses also clearly demonstrated that V. trinervia and one taxon of V. hirtella are the genome donors of V. reflexo-pilosa. Gene diversity indicates that the evolution rate of EST-SSRs on genome B of créole bean might be faster than that on genome A. Species relationship among the Vigna species in relation to genetic data, morphology and geographical distribution are presented.

  20. Detection of genome donor species of neglected tetraploid crop Vigna reflexo-pilosa (créole bean), and genetic structure of diploid species based on newly developed EST-SSR markers from azuki bean (Vigna angularis).

    Science.gov (United States)

    Chankaew, Sompong; Isemura, Takehisa; Isobe, Sachiko; Kaga, Akito; Tomooka, Norihiko; Somta, Prakit; Hirakawa, Hideki; Shirasawa, Kenta; Vaughan, Duncan A; Srinives, Peerasak

    2014-01-01

    Vigna reflexo-pilosa, which includes a neglected crop, is the only one tetraploid species in genus Vigna. The ancestral species that make up this allotetraploid species have not conclusively been identified, although previous studies suggested that a donor genome of V. reflexo-pilosa is V. trinervia. In this study, 1,429 azuki bean EST-SSR markers were developed of which 38 EST-SSR primer pairs that amplified one product in diploid species and two discrete products in tetraploid species were selected to analyze 268 accessions from eight taxa of seven Asian Vigna species including V. reflexo-pilosa var. glabra, V. reflexo-pilosa var. reflexo-pilosa, V. exilis, V. hirtella, V. minima, V. radiata var. sublobata, V. tenuicaulis and V. trinervia to identify genome donor of V. reflexo-pilosa. Since both diploid and tetraploid species were analyzed and each SSR primer pair detected two loci in the tetraploid species, we separated genomes of the tetraploid species into two different diploid types, viz. A and B. In total, 445 alleles were detected by 38 EST-SSR markers. The highest gene diversity was observed in V. hirtella. By assigning the discrete PCR products of V. reflexo-pilosa into two distinguished genomes, we were able to identify the two genome donor parents of créole bean. Phylogenetic and principal coordinate analyses suggested that V. hirtella is a species complex and may be composed of at least three distinct taxa. Both analyses also clearly demonstrated that V. trinervia and one taxon of V. hirtella are the genome donors of V. reflexo-pilosa. Gene diversity indicates that the evolution rate of EST-SSRs on genome B of créole bean might be faster than that on genome A. Species relationship among the Vigna species in relation to genetic data, morphology and geographical distribution are presented.

  1. Comparative Proximate and Elemental Analysis of Four Species of Cowpea Beans Seed Coat (Vigna Ungucuilata in Enugu State Nigeria

    Directory of Open Access Journals (Sweden)

    Ape David I

    2015-10-01

    Full Text Available Cowpea is an important bean which play significant role in the diets of Africans. It serves as a major source of protein in the absence of sufficient animal protein for the population. Four varieties large white beans seed coat (LWB small white beans seed coat (SWB large brown beans seed coat (LBB and small brown beans seed coat (SBB of cowpeas (Vigna unguiculata were analyzed for their proximate and elemental contents. These varieties belong to the same species in the family leguminosae. The brown and white seed coats were found to be nutritious. Both contained carbohydrate, protein, fibres and minerals such as calcium, magnesium, manganese and phosphorus. The moisture content was found to be 9.70 and 14.0% for (LWB and (SWB, and 11.20 and 10.80% for (LBB and (SBB respectively with the (SWB having the higher amount. The carbohydrate content analyzed was found to be 9.0 and 10.81% for (LWB and (SWB, and 8.40 and 7.80% for (LBB and (SBB with the (SWB having the higher value. The oil content was 0.37 and 0.21% for (LWB AND (SWB and 0.41 and 0.29% for (LBB and (SBB. The crude fibre was 70.55 and 68.20% (LWB AND (SWB and 68.17 and 70.01% for (LBB and (SBB respectively. The protein was 2.28 and 1.98% for (LWB AND (SWB and 2.52 and 2.40% for (LBB and (SBB respectively. The ash content was 8.1 and 4.8% for (LWB AND (SWB and 9.3 and 8.7% for (LBB and (SBB. The elemental analysis in the four species gave the following ranges:- Mg from 0.72 – 0.49ppm with (SWB having highest concentration and (LBB with lowest, Ca from 3.10 – 2.29ppm with (LBB highest and (LWB lowest, Mn from 0.31 – 0.18ppm with (LWB highest concentration and (SBB having the least, and finally P from 0.03 – 0.01ppm with (LBB with highest concentration and (SWB least concentration. From the analyses carried out it shows that cowpea beans seed coats are a good nutritional food source with higher crude fibre content.

  2. Isolation, identification and toxigenic potential of ochratoxin A-producing Aspergillus species from coffee beans grown in two regions of Thailand

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanakul, W.; Nielsen, Kristian Fog

    2008-01-01

    In 2006 and 2007, 32 Thai dried coffee bean samples (Coffea arabica) from two growing sites of Chiang Mai Province, and 32 Thai dried coffee bean samples (Coffea canephora var. robusta) from two growing sites of Chumphon Province, Thailand, were collected and assessed for the distribution of fungi...... with the potential to produce ochratoxin A (OTA). The overall percentage of fungal contamination in coffee was 98% and reduced to 60% after surface disinfection. There were remarkable ecological differences in the composition of ochratoxigenic species present in these two regions. Arabica coffee bean samples from...... the North had an average of 78% incidence of colonization with Aspergillus of section Circumdati with Aspergillus westerdijkiae and A. melleus as the predominant species. Aspergillus spp. of section Nigri were found in 75% of the samples whereas A. ochraceus was not detected. Robusta coffee beans from...

  3. Nitric oxide increases tolerance responses to moderate water deficit in leaves of Phaseolus vulgaris and Vigna unguiculata bean species.

    Science.gov (United States)

    Zimmer-Prados, Lucas Martins; Moreira, Ana Sílvia Franco Pinheiro; Magalhaes, Jose Ronaldo; França, Marcel Giovanni Costa

    2014-07-01

    Drought stress is one of the most intensively studied and widespread constraints, and nitric oxide (NO) is a key signaling molecule involved in the mediation of abiotic stresses in plants. We demonstrated that a sprayed solution of NO from donor sodium nitroprusside increased drought stress tolerance responses in both sensitive (Phaseolus vulgaris) and tolerant (Vigna unguiculata) beans. In intact plants subjected to halting irrigation, NO increased the leaf relative water content and stomatal conductance in both species. After cutting leaf discs and washing them, NO induced increased electrolyte leakage, which was more evident in the tolerant species. These leaf discs were then subjected to different water deficits, simulating moderate and severe drought stress conditions through polyethylene glycol solutions. NO supplied at moderate drought stress revealed a reduced membrane injury index in sensitive species. In hydrated discs and at this level of water deficit, NO increased the electron transport rate in both species, and a reduction of these rates was observed at severe stress levels. Taken together, it can be shown that NO has an effective role in ameliorating drought stress effects, activating tolerance responses at moderate water deficit levels and in both bean species which present differential drought tolerance.

  4. Dynamics and species diversity of communities of lactic acid bacteria and acetic acid bacteria during spontaneous cocoa bean fermentation in vessels.

    Science.gov (United States)

    Lefeber, Timothy; Gobert, William; Vrancken, Gino; Camu, Nicholas; De Vuyst, Luc

    2011-05-01

    To speed up research on the usefulness and selection of bacterial starter cultures for cocoa bean fermentation, a benchmark cocoa bean fermentation process under natural fermentation conditions was developed successfully. Therefore, spontaneous fermentations of cocoa pulp-bean mass in vessels on a 20 kg scale were tried out in triplicate. The community dynamics and kinetics of these fermentations were studied through a multiphasic approach. Microbiological analysis revealed a limited bacterial species diversity and targeted community dynamics of both lactic acid bacteria (LAB) and acetic acid bacteria (AAB) during fermentation, as was the case during cocoa bean fermentations processes carried out in the field. LAB isolates belonged to two main (GTG)(5)-PCR clusters, namely Lactobacillus plantarum and Lactobacillus fermentum, with Fructobacillus pseudofilculneus occurring occasionally; one main (GTG)(5)-PCR cluster, composed of Acetobacter pasteurianus, was found among the AAB isolates, besides minor clusters of Acetobacter ghanensis and Acetobacter senegalensis. 16S rRNA-PCR-DGGE revealed that L. plantarum and L. fermentum dominated the fermentations from day two until the end and Acetobacter was the only AAB species present at the end of the fermentations. Also, species of Tatumella and Pantoea were detected culture-independently at the beginning of the fermentations. Further, it was shown through metabolite target analyses that similar substrate consumption and metabolite production kinetics occurred in the vessels compared to spontaneous cocoa bean fermentation processes. Current drawbacks of the vessel fermentations encompassed an insufficient mixing of the cocoa pulp-bean mass and retarded yeast growth.

  5. DIVERSITY OF TUBER CROPS AND ARBUSCULAR MYCORRHIZAE FUNGI (AMF UNDER COMMUNITY FOREST STAND IN SOUTH SULAWESI

    Directory of Open Access Journals (Sweden)

    Retno Prayudyaningsih

    2015-05-01

    Full Text Available Implementation of agroforestry system in community forest that incorporate local species Vitex cofassus (bitti, Toona sinensis (suren, Tectona grandis (teak and Aleurites moluccana (candlenut with seasonal crops such as tuber crops would create opportunities for local  people to improve the economic and food security. Tuber crops as the understory could be expected to reduce the rate of soil erosion and expand habitat of beneficia soil microorganisms such as arbuscular mycorrhizal fungi (AMF. The research aims to determine the diversity of tuber crops and AMF in the rhizosphere of tuber crops grown under community forest stands of bitti, suren, teak and candlelnut in South Sulawesi. Results showed that (1 there are 12 kinds of tuber crops that grow under community forest stands in which the 7 types are as alternative food sources, (2 Amorphophallus campanulatus (iles-iles/suweg and Xanthosoma violaceum (kimpul are species of tuber crops that is found growing under all of the commnunity forest stands, (3 all kinds of tuber crops that grow under the community forest stand associated with AMF, in which there are 3 AMF genus i.e Glomus sp. Acaulospora sp. and Gigaspora sp.with low spore density.

  6. Spontaneous organic cocoa bean box fermentations in Brazil are characterized by a restricted species diversity of lactic acid bacteria and acetic acid bacteria.

    Science.gov (United States)

    Papalexandratou, Zoi; Vrancken, Gino; De Bruyne, Katrien; Vandamme, Peter; De Vuyst, Luc

    2011-10-01

    Spontaneous organic cocoa bean box fermentations were carried out on two different farms in Brazil. Physical parameters, microbial growth, bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the fermented dry cocoa beans. The main end-products of the catabolism of the pulp substrates (glucose, fructose, and citric acid) by yeasts, LAB, and AAB were ethanol, lactic acid, mannitol, and/or acetic acid. Lactobacillus fermentum and Acetobacter pasteurianus were the predominating bacterial species of the fermentations as revealed through (GTG)(5)-PCR fingerprinting of isolates and PCR-DGGE of 16S rRNA gene PCR amplicons of DNA directly extracted from fermentation samples. Fructobacillus pseudoficulneus, Lactobacillus plantarum, and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Also, three novel LAB species were found. This study emphasized the possible participation of Enterobacteriaceae in the cocoa bean fermentation process. Tatumella ptyseos and Tatumella citrea were the prevailing enterobacterial species in the beginning of the fermentations as revealed by 16S rRNA gene-PCR-DGGE. Finally, it turned out that control over a restricted bacterial species diversity during fermentation through an ideal post-harvest handling of the cocoa beans will allow the production of high-quality cocoa and chocolates produced thereof, independent of the fermentation method or farm.

  7. Assessment of the yeast species composition of cocoa bean fermentations in different cocoa-producing regions using denaturing gradient gel electrophoresis.

    Science.gov (United States)

    Papalexandratou, Zoi; De Vuyst, Luc

    2011-11-01

    The yeast species composition of 12 cocoa bean fermentations carried out in Brazil, Ecuador, Ivory Coast and Malaysia was investigated culture-independently. Denaturing gradient gel electrophoresis of 26S rRNA gene fragments, obtained through polymerase chain reaction with universal eukaryotic primers, was carried out with two different commercial apparatus (the DCode and CBS systems). In general, this molecular method allowed a rapid monitoring of the yeast species prevailing during fermentation. Under similar and optimal denaturing gradient gel electrophoresis conditions, the CBS system allowed a better separated band pattern than the DCode system and an unambiguous detection of the prevailing species present in the fermentation samples. The most frequent yeast species were Hanseniaspora sp., followed by Pichia kudriavzevii and Saccharomyces cerevisiae, independent of the origin of the cocoa. This indicates a restricted yeast species composition of the cocoa bean fermentation process. Exceptionally, the Ivorian cocoa bean box fermentation samples showed a wider yeast species composition, with Hyphopichia burtonii and Meyerozyma caribbica among the main representatives. Yeasts were not detected in the samples when the temperature inside the fermenting cocoa pulp-bean mass reached values higher than 45 °C or under early acetic acid production conditions.

  8. Enhancement of faba bean competitive ability by arbuscular mycorrhizal fungi is highly correlated with dynamic nutrient acquisition by competing wheat.

    Science.gov (United States)

    Qiao, Xu; Bei, Shuikuan; Li, Chunjie; Dong, Yan; Li, Haigang; Christie, Peter; Zhang, Fusuo; Zhang, Junling

    2015-01-01

    The mechanistic understanding of the dynamic processes linking nutrient acquisition and biomass production of competing individuals can be instructive in optimizing intercropping systems. Here, we examine the effect of inoculation with Funneliformis mosseae on competitive dynamics between wheat and faba bean. Wheat is less responsive to mycorrhizal inoculation. Both inoculated and uninoculated wheat attained the maximum instantaneous N and P capture approximately five days before it attained the maximum instantaneous biomass production, indicating that wheat detected the competitor and responded physiologically to resource limitation prior to the biomass response. By contrast, the instantaneous N and P capture by uninoculated faba bean remained low throughout the growth period, and plant growth was not significantly affected by competing wheat. However, inoculation substantially enhanced biomass production and N and P acquisition of faba bean. The exudation of citrate and malate acids and acid phosphatase activity were greater in mycorrhizal than in uninoculated faba bean, and rhizosphere pH tended to decrease. We conclude that under N and P limiting conditions, temporal separation of N and P acquisition by competing plant species and enhancement of complementary resource use in the presence of AMF might be attributable to the competitive co-existence of faba bean and wheat.

  9. Damaged-self recognition in common bean (Phaseolus vulgaris shows taxonomic specificity and triggers signalling via reactive oxygen species (ROS

    Directory of Open Access Journals (Sweden)

    Dalia eDuran

    2014-10-01

    Full Text Available Plants require reliable mechanisms to detect injury. Danger signals or 'damage-associated molecular patterns' (DAMPs are released from stressed host cells and allow injury detection independently of enemy-derived molecules. We studied the response of common bean (Phaseolus vulgaris to the application of leaf homogenate as a source of DAMPs and measured the production of reactive oxygen species (ROS as an early response and the secretion of extrafloral nectar (EFN as a jasmonic acid (JA–dependent late response. We observed a strong taxonomic signal in the response to different leaf homogenates. ROS formation and EFN secretion were highly correlated and responded most strongly to leaf homogenates produced using the same cultivar or closely related accessions, less to a distantly related cultivar of common bean or each of the two congeneric species, P. lunatus and P. coccineus, and not at all to homogenates prepared from species in different genera, not even when using other Fabaceae. Interestingly, leaf homogenates also reduced the infection by the bacterial pathogen, Pseudomonas syringae, when they were applied directly before challenging, although the same homogenates exhibited no direct in vitro inhibitory effect in the bacterium. We conclude that ROS signaling is associated to the induction of EFN secretion and that the specific blend of DAMPs that are released from damaged cells allows the plant to distinguish the 'damaged self' from the damaged 'non-self'. The very early responses of plants to DAMPs can trigger resistance to both, herbivores and pathogens, which should be adaptive because injury facilitates infection, independently of its causal reason.

  10. Environment and Host Affects Arbuscular Mycorrhiza Fungi (AMF) Population

    Science.gov (United States)

    Rahim, Norahizah Abd; Jais, Hasnah Md; Hassan, Hasnuri Mat

    2016-01-01

    The association of arbuscular mycorrhiza fungi (AMF) and roots undoubtedly gives positive advantages to the host plant. However, heavily fertilised soil such as in oil palm plantation, inhibit the growth of mycorrhiza. Thus, the aim of this research is to distinguish and quantify the availability of AMF population and propagules at different sites of an oil palm plantation by Most Probable Number (MPN) assay. In addition, root infection method was employed to observe host compatibility through the propagation of AMF using two different types of hosts, monocotyledon (Echinochloa cruss-galli) and dicotyledon (Vigna radiata). Three different locations at an oil palm plantation were chosen for sampling. Each location was represented by a distinctive soil series, and were further divided into two sites, that is canopy and midway area. Midway site had a greater population of AMF compared to canopy. The result showed that different environments affect the availability of AMF in the soil. Higher number of AMF infection observed in monocotyledon host suggests that the fibrous root system provide a better association with mycorrhiza. PMID:27965735

  11. Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus predominate during well-performed Malaysian cocoa bean box fermentations, underlining the importance of these microbial species for a successful cocoa bean fermentation process.

    Science.gov (United States)

    Papalexandratou, Zoi; Lefeber, Timothy; Bahrim, Bakhtiar; Lee, Ong Seng; Daniel, Heide-Marie; De Vuyst, Luc

    2013-09-01

    Two spontaneous Malaysian cocoa bean box fermentations (one farm, two plantation plots) were investigated. Physical parameters, microbial community dynamics, yeast and bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the respective fermented dry cocoa beans. Similar microbial growth and metabolite profiles were obtained for the two fermentations. Low concentrations of citric acid were found in the fresh pulp, revealing low acidity of the raw material. The main end-products of the catabolism of the pulp substrates glucose, fructose, and citric acid by yeasts, LAB, and AAB were ethanol, lactic acid, acetic acid, and/or mannitol. Hanseniaspora opuntiae, Lactobacillus fermentum, and Acetobacter pasteurianus were the prevalent species of the two fermentations. Saccharomyces cerevisiae, Lactobacillus plantarum, Lactobacillus pentosus, and Acetobacter ghanensis were also found during the mid-phase of the fermentation processes. Leuconostoc pseudomesenteroides and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Tatumella saanichensis and Enterobacter sp. were present in the beginning of the fermentations and they could be responsible for the degradation of citric acid and/or the production of gluconic acid and lactic acid, respectively. The presence of facultative heterofermentative LAB during the fermentations caused a high production of lactic acid. Finally, as these fermentations were carried out with high-quality raw material and were characterised by a restricted microbial species diversity, resulting in successfully fermented dry cocoa beans and good chocolates produced thereof, it is likely that the prevailing species H. opuntiae, S. cerevisiae, Lb. fermentum, and A. pasteurianus were responsible for it.

  12. The Combined Effects of Arbuscular Mycorrhizal Fungi (AMF and Lead (Pb Stress on Pb Accumulation, Plant Growth Parameters, Photosynthesis, and Antioxidant Enzymes in Robinia pseudoacacia L.

    Directory of Open Access Journals (Sweden)

    Yurong Yang

    Full Text Available Arbuscular mycorrhizal fungi (AMF are considered as a potential biotechnological tool for improving phytostabilization efficiency and plant tolerance to heavy metal-contaminated soils. However, the mechanisms through which AMF help to alleviate metal toxicity in plants are still poorly understood. A greenhouse experiment was conducted to evaluate the effects of two AMF species (Funneliformis mosseae and Rhizophagus intraradices on the growth, Pb accumulation, photosynthesis and antioxidant enzyme activities of a leguminous tree (Robinia pseudoacacia L. at Pb addition levels of 0, 500, 1000 and 2000 mg kg(-1 soil. AMF symbiosis decreased Pb concentrations in the leaves and promoted the accumulation of biomass as well as photosynthetic pigment contents. Mycorrhizal plants had higher gas exchange capacity, non-photochemistry efficiency, and photochemistry efficiency compared with non-mycorrhizal plants. The enzymatic activities of superoxide dismutase (SOD, ascorbate peroxidases (APX and glutathione peroxidase (GPX were enhanced, and hydrogen peroxide (H2O2 and malondialdehyde (MDA contents were reduced in mycorrhizal plants. These findings suggested that AMF symbiosis could protect plants by alleviating cellular oxidative damage in response to Pb stress. Furthermore, mycorrhizal dependency on plants increased with increasing Pb stress levels, indicating that AMF inoculation likely played a more important role in plant Pb tolerance in heavily contaminated soils. Overall, both F. mosseae and R. intraradices were able to maintain efficient symbiosis with R. pseudoacacia in Pb polluted soils. AMF symbiosis can improve photosynthesis and reactive oxygen species (ROS scavenging capabilities and decrease Pb concentrations in leaves to alleviate Pb toxicity in R. pseudoacacia. Our results suggest that the application of the two AMF species associated with R. pseudoacacia could be a promising strategy for enhancing the phytostabilization efficiency of Pb

  13. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) and comparison with the broader species.

    Science.gov (United States)

    Xu, Pei; Wu, Xiaohua; Wang, Baogen; Liu, Yonghua; Ehlers, Jeffery D; Close, Timothy J; Roberts, Philip A; Diop, Ndeye-Ndack; Qin, Dehui; Hu, Tingting; Lu, Zhongfu; Li, Guojing

    2011-01-06

    Asparagus bean (Vigna. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea [Vigna. unguiculata (L.) Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs), with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs) identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  14. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis and comparison with the broader species.

    Directory of Open Access Journals (Sweden)

    Pei Xu

    Full Text Available Asparagus bean (Vigna. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea [Vigna. unguiculata (L. Walp.] that apparently originated in East Asia and is characterized by extremely long and thin pods and an aggressive climbing growth habit. The crop is widely cultivated throughout Asia for the production of immature pods known as 'long beans' or 'asparagus beans'. While the genome of cowpea ssp. unguiculata has been characterized recently by high-density genetic mapping and partial sequencing, little is known about the genome of asparagus bean. We report here the first genetic map of asparagus bean based on SNP and SSR markers. The current map consists of 375 loci mapped onto 11 linkage groups (LGs, with 191 loci detected by SNP markers and 184 loci by SSR markers. The overall map length is 745 cM, with an average marker distance of 1.98 cM. There are four high marker-density blocks distributed on three LGs and three regions of segregation distortion (SDRs identified on two other LGs, two of which co-locate in chromosomal regions syntenic to SDRs in soybean. Synteny between asparagus bean and the model legume Lotus. japonica was also established. This work provides the basis for mapping and functional analysis of genes/QTLs of particular interest in asparagus bean, as well as for comparative genomics study of cowpea at the subspecies level.

  15. Bacillus isolates from the spermosphere of peas and dwarf French beans with antifungal activity against Botrytis cinerea and Pythium species.

    Science.gov (United States)

    Walker, R; Powell, A A; Seddon, B

    1998-05-01

    A range of isolation procedures including washing, sonication and incubation in nutrient broth were used separately and in combination to obtain potential bacterial antagonists to Botrytis cinerea and Pythium mamillatum from the testae and cotyledons of peas and dwarf French beans. Heat treatment was also used to bias this selection towards spore-forming bacteria. Ninety-two bacterial isolates were obtained, 72 of which were provisionally characterized as species of Bacillus. Four of these Bacillus isolates (B3, C1, D4 and J7) displayed distinct antagonism in vitro against Botrytis cinerea and P. mamillatum when screened using dual culture analysis. Further characterization of these antagonists using API 50CHB biochemical profiling identified isolate D4 as Bacillus polymyxa and isolates B3, C1 and J7 as strains of B. subtilis. In vitro screening techniques, using cell-free and heat-killed extracts of liquid cultures against Botrytis cinerea, demonstrated the production of antifungal compounds by these four Bacillus antagonists. With each isolate the antifungal activity was found not to be either exclusively spore-bound nor released entirely into the medium but present in both fractions. The antifungal compounds produced by these isolates were shown to be heat-stable. Their identification, production and release require further study for exploitation as biocontrol systems.

  16. EFFECT OF DROUGHT STRESS AND ADDITION OF ARBUSCULA MYCORRHIZAL FUNGI (AMF ON GROWTH AND PRODUCTIVITY OF TROPICAL GRASSES (Chloris gayana, Paspalum dilatatum, and Paspalum notatum

    Directory of Open Access Journals (Sweden)

    Pebriansyah A

    2014-06-01

    Full Text Available Grasses productivity is affected by soil water availability. Arbuscular Mycorrhizal Fungi (AMF was innoculated to support plant to overcome drought stress during its growth. The aim of this study was to understand the role of  Arbuscular Mycorrhizal Fungi (AMF to support growth and the production of grasses in drought stress condition. Three species of tropical grasses : Chloris    gayana,    Paspalum    notatum,    and  Paspalum dilatatum were used. The research used completely randomized design with 4 treatments consisting of M0S0 = without AMF and daily watering, M0S1 = without AMF and without watering; M1S0 = with mycorrhiza and daily watering; M1S1 = with AMF and without watering. and 5 replications. The four treatments research were as follows; Each type of grasses were obsereved in a separate study. The result showed that AMF played significant role in improving growth and root dry weight biomass of Chloris    gayana in drought condition. Paspalum notatum is the most adaptive grass in the drought condition. Chloris gayana has the growth and a better production than Paspalum dilatatum.

  17. Comparison of the bacterial species diversity of spontaneous cocoa bean fermentations carried out at selected farms in Ivory Coast and Brazil.

    Science.gov (United States)

    Papalexandratou, Zoi; Camu, Nicholas; Falony, Gwen; De Vuyst, Luc

    2011-08-01

    To compare the spontaneous cocoa bean fermentation process carried out in different cocoa-producing regions, heap and box (one Ivorian farm) and box (two Brazilian farms) fermentations were carried out. All fermentations were studied through a multiphasic approach. In general, the temperature inside the fermenting mass increased throughout all fermentations and reached end-values of 42-48 °C. The main end-products of pulp carbohydrate catabolism were ethanol, lactic acid, acetic acid, and/or mannitol. In the case of the fermentations on the selected Ivorian farm, the species diversity of lactic acid bacteria (LAB) and acetic acid bacteria (AAB) was restricted. Lactobacillus fermentum and Leuconostoc pseudomesenteroides were the predominant LAB species, due to their ethanol and acid tolerance and citrate consumption. The levels of mannitol, ascribed to growth of L. fermentum, were fermentation-dependent. Also, enterobacterial species, such as Erwinia soli and Pantoea sp., were among the predominating microbiota during the early stages of both heap and box fermentations in Ivory Coast, which could be responsible for gluconic acid production. Consumption of gluconic acid at the initial phases of the Ivorian fermentations could be due to yeast growth. A wider microbial species diversity throughout the fermentation process was seen in the case of the box fermentations on the selected Brazilian farms, which differed, amongst other factors, regarding pod/bean selection on these farms as compared to fermentations on the selected Ivorian farm. This microbiota included Lactobacillus plantarum, Lactobacillus durianis, L. fermentum, Lactobacillus mali, Lactobacillus nagelii, L. pseudomesenteroides, and Pediococcus acidilactici, as well as Bacillus subtilis that was present at late fermentation, when the temperature inside the fermenting mass reached values higher than 50 °C. Moreover, AAB seemed to dominate the Brazilian box fermentations studied, explaining higher acetic

  18. Impacts of fertilization regimes on arbuscular mycorrhizal fungal (AMF community composition were correlated with organic matter composition in maize rhizosphere soil

    Directory of Open Access Journals (Sweden)

    Chen Zhu

    2016-11-01

    Full Text Available The understanding of the response of arbuscular mycorrhizal fungi (AMF community composition to fertilization is of great significance in sustainable agriculture. However, how fertilization influences AMF diversity and composition is not well established yet. A field experiment located in northeast China in typical black soil (Chernozem was conducted and high-throughput sequencing approach was used to investigate the effects of different fertilizations on the variation of AMF community in the rhizosphere soil of maize crop. The results showed that AMF diversity in the maize rhizosphere was significantly altered by different fertilization regimes. As revealed by redundancy analysis, the application of organic manure was the most important factor impacting AMF community composition between samples with and without organic manure, followed by N fertilizer and P fertilizer inputs. Moreover, the organic matter composition in the rhizosphere, determined by GC-MS, was significantly altered by the organic manure amendment. Many of the chemical components displayed significant relationships with the AMF community composition according to the Mantel test, among those, 2-ethylnaphthalene explained the highest percentage (54.2% of the variation. The relative contents of 2-ethylnaphthalene and 2, 6, 10-trimethyltetradecane had a negative correlation with Glomus relative abundance, while the relative content of 3-methylbiphenyl displayed a positive correlation with Rhizophagus. The co-occurrence patterns in treatments with and without organic manure amendment were analysed, and more hubs were detected in the network of soils with organic manure amendment. Additionally, three OTUs belonging to Glomerales were identified as hubs in all treatments, indicating these OTUs likely occupied broad ecological niches and were always active for mediating AMF species interaction in the maize rhizosphere. Taken together, impacts of fertilization regimes on AMF community

  19. Effect of Arbuscular Mycorrhiza Fungi (AMF and The Organic Material to The Glomalin Production and The Soil Physical Properties of Ultisols

    Directory of Open Access Journals (Sweden)

    Amrizal Saidi

    2015-01-01

    Full Text Available Metabolism of Arbuscular mycorrhiza fungi (AMF requires nitrogen from organic matter to produce glomalin on hyphae. Glomalin able to granulate the soil particles are dispersed to form a stable soil aggregates to create good soil structure. Improvement of soil structure will provide optimal conditions for the development of organisms and plant roots. AMF and the use of organic matter as a source of N for the AMF has done research on Sitiung Ultisol. The purpose of this study was to determine the effect of AMF and organic material to the glomalin production, as well as its relationship with the soil physical properties. This research was conducted at the greenhouse of Faculty Agriculture Andalas University Padang. West Sumatra Indonesia. Soil samples of soil physical properties observed in the area of mycorrhiza hyphae found (mycorhizalsphere which is influenced by differences glomalin generated by the AMF. The results of the reserach showed that treatment of AMF and Nitrogen organic ingredients affect significantly on the glomalin, whereas the effect of treatment it gives a different effect on soil physical properties. Organic materials do not affect significantly on the availability of soil water content, but very significant effect on water content at 2.54 pF. AMF species that produce a higher glomalin can be significant in improving soil physical properties, ie versiforme G. and G. luteum although without the use of organic materials or organic. Both these species give a positive response to the growth of maize by mycorrhizalsphere (MGR = mycorrhizal growth response and nutrient uptake of maize.

  20. AMF3 ARM's Research Facility at Oliktok Point Alaska

    Science.gov (United States)

    Helsel, F.; Lucero, D. A.; Ivey, M.; Dexheimer, D.; Hardesty, J.; Roesler, E. L.

    2015-12-01

    Scientific Infrastructure To Support Atmospheric Science And Aerosol Science For The Department Of Energy's Atmospheric Radiation Measurement Programs Mobile Facility 3 Located At Oliktok Point, Alaska.The Atmospheric Radiation Measurement (ARM) Program's Mobile Facility 3 (AMF3) located at Oliktok Point, Alaska is a U.S. Department of Energy (DOE) site. The site provides a scientific infrastructure and data archives for the international Arctic research community. The infrastructure at Oliktok is designed to be mobile and it may be relocated in the future to support other ARM science missions. AMF-3 instruments include: scanning precipitation Radar-cloud radar, Raman Lidar, Eddy correlation flux systems, Ceilometer, Balloon sounding system, Atmospheric Emitted Radiance Interferometer (AERI), Micro-pulse Lidar (MPL), Millimeter cloud radar along with all the standard metrological measurements. Data from these instruments is placed in the ARM data archives and are available to the international research community. This poster will discuss what instruments are at AMF3 and the challenges of powering an Arctic site without the use of grid power.

  1. Molecular identification and safety of Bacillus species involved in the fermentation of African oil beans (Pentaclethra macrophylla Benth) for production of Ugba.

    Science.gov (United States)

    Ahaotu, I; Anyogu, A; Njoku, O H; Odu, N N; Sutherland, J P; Ouoba, L I I

    2013-03-01

    Molecular identification of Bacillus spp. involved in the fermentation of African oil bean seeds for production of Ugba, as well as ability of the Bacillus spp. isolated to produce toxins, were investigated. Forty-nine bacteria were isolated from Ugba produced in different areas of South Eastern Nigeria and identified by phenotyping and sequencing of 16S rRNA, gyrB and rpoB genes. Genotypic diversities at interspecies and intraspecies level of the isolates were screened by PCR amplification of the 16S-23S rDNA intergenic transcribed spacer (ITS-PCR) and repetitive sequence-based PCR (rep-PCR). The ability of the bacteria to produce toxins was also investigated by detection of genes encoding production of haemolysin BL (HblA, HblC, HblD), non-haemolytic enterotoxin (NheA, NheB, NheC), cytotoxin K (CytK) and emetic toxin (EM1) using PCR with specific primers. Moreover, a Bacillus cereus Enterotoxin Reverse Passive Latex Agglutination test kit (BCET-RPLA) was used to screen ability of the isolates to produce haemolysin in broth and during fermentation of African oil bean seeds. The isolates were characterized as motile, rod-shaped, endospore forming, catalase positive, Gram-positive bacteria. They were identified as Bacillus cereus sensu lato (42), Lysinibacillus xylanilyticus (3), Bacillus clausii (1), Bacillus licheniformis (1), Bacillus subtilis (1), and Bacillus safensis (1). B. cereus was the predominant Bacillus species and was present in all samples studied. Using ITS-PCR, interspecies diversity was observed among isolates, with six clusters representing each of the pre-cited species. Rep-PCR was more discriminatory (eight clusters) and allowed further differentiation at intraspecies level for the B. cereus and L. xylanilyticus isolates with two genotypes for each species. Genes encoding production of non-haemolytic enterotoxin (NheA, NheB, NheC) and cytotoxin K (CytK) genes were detected in all B. cereus isolates, while Hbl genes (HblA, HblC, HblD) were

  2. Fractionation of phosphorus and trace elements species in soybean flour and common white bean seeds by size exclusion chromatography-inductively coupled plasma mass spectrometry.

    Science.gov (United States)

    Koplík, Richard; Pavelková, Hana; Cincibuchová, Jana; Mestek, Oto; Kvasnicka, Frantisek; Suchánek, Miloslav

    2002-04-25

    Soluble species of phosphorus, sulfur, selenium and eight metals (Mn, Fe, Co, Ni, Cu, Zn, Mo and Cd) in soybean flour and common white bean seeds were investigated by size exclusion chromatography (SEC) and inductively coupled plasma mass spectrometry (ICP-MS). Samples were extracted by 0.02 mol l(-1) Tris-HCI buffer solution (pH 7.5). Fractionation of sample extracts by preparative scale SEC was accomplished using a Fractogel EMD BioSEC column (600 x 16 mm) and 0.02 mol l(-1) Tris-HCl buffer solution (pH 7.5) as mobile phase (flow rate: 2 ml min(-1)). A 2-ml sample was injected. Contents of elements in chromatographic fractions were determined by AAS, ICP-AES and ICP-MS. The elution profiles of P, Fe, Co, Ni, Cu, Zn and Mo in both samples were similar. Main species of Co, Ni, Cu, Zn and Mo were found in the low molecular weight region (2-5 kDa), whereas Fe is predominantly bound to high molecular weight compounds (180 kDa). The dominant phosphorus fraction was detected in the medium molecular weight region (10-30 kDa) and the other fraction in the low molecular weight region. Isotachophoretic analysis of chromatographic fractions revealed that the main phosphorus compound in the medium molecular weight region is phytic acid. SEC on Superdex 75 and Superdex Peptide columns (300 x 10 mm) was performed in on-line hyphenation with ICP-MS. The same mobile phase was used with a flow rate of 0.5 ml min(-1); volume of injected sample was 200 microl. Element specific chromatograms were obtained by continuous nebulization of effluent into ICP-mass spectrometer measuring intensities of 47(PO)+ and 48(SO)+ oxide ions and 55Mn, 57Fe, 59Co, 62Ni, 65Cu, 66Zn, 82Se, 95Mo and 114Cd nuclides. Chromatographic profiles of elements are generally analogous to those obtained with a Fractogel column, but better chromatographic resolution of separated species was achieved so that slight differences between samples were revealed. Estimated molecular weights of major phosphorus species in

  3. Yeasts are essential for cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2014-03-17

    Cocoa beans (Theobroma cacao) are the major raw material for chocolate production and fermentation of the beans is essential for the development of chocolate flavor precursors. In this study, a novel approach was used to determine the role of yeasts in cocoa fermentation and their contribution to chocolate quality. Cocoa bean fermentations were conducted with the addition of 200ppm Natamycin to inhibit the growth of yeasts, and the resultant microbial ecology and metabolism, bean chemistry and chocolate quality were compared with those of normal (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii and Kluyveromyces marxianus, the lactic acid bacteria Lactobacillus plantarum and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in the control fermentation. In fermentations with the presence of Natamycin, the same bacterial species grew but yeast growth was inhibited. Physical and chemical analyses showed that beans fermented without yeasts had increased shell content, lower production of ethanol, higher alcohols and esters throughout fermentation and lesser presence of pyrazines in the roasted product. Quality tests revealed that beans fermented without yeasts were purplish-violet in color and not fully brown, and chocolate prepared from these beans tasted more acid and lacked characteristic chocolate flavor. Beans fermented with yeast growth were fully brown in color and gave chocolate with typical characters which were clearly preferred by sensory panels. Our findings demonstrate that yeast growth and activity were essential for cocoa bean fermentation and the development of chocolate characteristics.

  4. Isolation, identification and toxigenic potential of ochratoxin A-producing Aspergillus species from coffee beans grown in two regions of Thailand.

    NARCIS (Netherlands)

    Noonim, P.; Mahakarnchanakul, W.; Nielsen, K.F.; Frisvad, J.C.; Samson, R.A.

    2008-01-01

    In 2006 and 2007, 32 Thai dried coffee bean samples (Coffea arabica) from two growing sites of Chiang Mai Province, and 32 Thai dried coffee bean samples (Coffea canephora var. robusta) from two growing sites of Chumphon Province, Thailand, were collected and assessed for the distribution of fungi w

  5. Habitat-specific AMF symbioses enhance drought tolerance of a native Kenyan grass

    Science.gov (United States)

    Petipas, Renee H.; González, Jonathan B.; Palmer, Todd M.; Brody, Alison K.

    2017-01-01

    The role of arbuscular mycorrhizal fungi (AMF) in enhancing plant tolerance to drought is well known. However, the degree to which AMF-plant symbioses are locally adapted has been suggested but is less well understood, especially at small spatial scales. Here, we examined the effects of two arbuscular mycorrhizal fungal communities on drought tolerance of Themeda triandra, a native African perennial bunchgrass. In our study area, mound building activities of Odontotermes sp. termites produce heterogeneous habitat, particularly with respect to water availability, and do so over small spatial scales (grasses inoculated with AMF from termite mounds closed stomata less, and produced 60% more leaves than those inoculated with off-mound AMF, thus exhibiting higher levels of tolerance. Mound-inoculated plants that were drought stressed also produced more than twice as many leaves as non-inoculated plants. Longer-term productivity measurements indicate both on- and off-mound inoculated plants were able to recover to a greater extent than non-inoculated plants, indicating that AMF associations in general help plants recover from drought. These findings highlight the important role that AMF play in mitigating drought stress and indicate that AMF affect how plants experience drought in a small scale, habitat-specific manner.

  6. Nonlinear Filter Based Image Denoising Using AMF Approach

    CERN Document Server

    Thivakaran, T K

    2010-01-01

    This paper proposes a new technique based on nonlinear Adaptive Median filter (AMF) for image restoration. Image denoising is a common procedure in digital image processing aiming at the removal of noise, which may corrupt an image during its acquisition or transmission, while retaining its quality. This procedure is traditionally performed in the spatial or frequency domain by filtering. The aim of image enhancement is to reconstruct the true image from the corrupted image. The process of image acquisition frequently leads to degradation and the quality of the digitized image becomes inferior to the original image. Filtering is a technique for enhancing the image. Linear filter is the filtering in which the value of an output pixel is a linear combination of neighborhood values, which can produce blur in the image. Thus a variety of smoothing techniques have been developed that are non linear. Median filter is the one of the most popular non-linear filter. When considering a small neighborhood it is highly e...

  7. Outbreaks of Chrysodeixis includens (Walker (Lepidoptera: Noctuidae in common bean and castor bean in São Paulo State, Brazil

    Directory of Open Access Journals (Sweden)

    Edson Luiz Lopes Baldin

    2014-12-01

    Full Text Available Since 2009, increasing populations of Chrysodeixis includens (Walker (Lepidoptera: Noctuidae have been observed in cultivated common bean (Phaseolus vulgaris L. and castor bean (Ricinus communis L. at the Lageado Experimental Farm, belonging to the FCA/UNESP, Botucatu, São Paulo State, Brazil. Defoliations around 80% and 50% were observed in the common bean cv. Pérola and castor bean cv. IAC-2028, respectively. Samples of individuals (caterpillars and pupae were collected in the field, and kept in laboratory until adult emergence aiming to confirm the species. These are new observations for common bean in São Paulo State and, in the case of castor bean, unpublished in Brazil. It suggests that C. includens has adapted to attack other agricultural crops, demanding attention of common bean and castor bean producers.

  8. Interferência entre espécies de planta daninha e duas cultivares de feijoeiro em duas épocas de semeadura Interference between weed species and two bean cultivars in two times of sowing

    Directory of Open Access Journals (Sweden)

    Arthur Arrobas Martins Barroso

    2010-01-01

    Full Text Available O Brasil é o maior produtor mundial de feijão, mas a interferência das plantas daninhas pode causar reduções de produtividade entre 15% e 80%, devido a fatores como cultivar de feijoeiro e espécies de plantas daninhas presentes na área. Objetivou-se com este trabalho avaliar os efeitos de seis espécies de plantas daninhas sobre o crescimento e a produtividade de duas cultivares de feijoeiro, em duas safras. Observou-se que as plantas eudicotiledôneas causam maior interferência na cultura, principalmente Amaranthus viridis e Raphanus raphanistrum. Todas causam perdas na produção do feijoeiro, exceto Eleusine indica, a menos competitiva. A cultivar ´Rubi´ é mais produtiva e mais competitiva que a ´Carioca´, e a maior produtividade é atingida na safra da seca. A escolha da cultivar e da data correta para a semeadura podem ser estratégias de manejo no controle de invasoras.Brazil is the world's largest producer of bean, but weed interference can cause yield losses between 15 to 80% due several factors such as bean cultivar and weed species in the area. The objective of this study was to evaluate the effects of six weed species on growth and productivity of two bean cultivars, in two sowing seasons. It was observed that the dicot plants cause more interference in the crop, especially Amaranthus viridis and Raphanus raphanistrum. All cause losses in bean yield except Eleusine indica that was less competitive. The ´Rubi´ bean cultivar is more productive and competitive than ´Carioca´, and the higher production is achieved during the drought sowing season. The choice of cultivar and correct season for sowing may be management strategy as in weeds control.

  9. Effects of AMF on soil enzyme activity and carbon sequestration capacity in reclaimed mine soil

    Institute of Scientific and Technical Information of China (English)

    Qian Kuimei; Wang Liping; Yin Ningning

    2012-01-01

    A series of pot experiments and field trials were carried out to evaluate the effects of arbuscular mycorrhizal fungi (AMF) on activities of soil enzymes and carbon sequestration capacity in reclaimed mine soil.A complex substrate of coal gangue,fly ash and sludge was used as reclaimed mine soil,and ryegrass was planted with AMF inoculation to construct a plant-complex substrate-microbe ecological restoration system.The changes to the soil organic carbon (SOC),activities of soil enzymes and glomalin-related soil protein (GRSP) were measured and the effects of AMF on activities of soil enzymes and carbon sequestration capacity in reclaimed mine soil were analyzed.The results show that the contents of GRSP (total glomalin (TG) and easily extractable glomalin (EEG)),SOC and activities of enzymes increased,and the increments were higher in the AMF inoculation treated plant-complex substrate-microbe ecological restoration systems than those with no AMF inoculated treatments after 12 months of ryegrass growth.TG,EEG and soil enzyme activity have a significant positive correlation,and the correlative coefficient was 0.427-0.573; SOC and TG,EEG have a significant positive correlation (p < 0.01 ),indicating that AMF plays an important role in carbon sequestration of reclaimed mine soils.

  10. Peppery Hot Bean Curd

    Institute of Scientific and Technical Information of China (English)

    1997-01-01

    Peppery Hot Bean Curd is a famous dish that originated in Chengdu,Sichuan Province.Dating back to the year under the reign of Emperor Tongzhi during the Qing Dynasty(1862-1875),a woman chef named Chen created this dish.In Chinese it is called Mapo Bean Curd. Ingredients:Three pieces of bean curd,100 grams lean pork,25 grams green soy beans or garlic

  11. Prunus persica crop management as step toward AMF diversity conservation for the sustainable soil management

    Science.gov (United States)

    Alguacil, M. M.; Torrecillas, E.; Lozano, Z.; Garcia-Orenes, F.; Roldan, A.

    2012-04-01

    We investigated the diversity of arbuscular mycorrhizal fungi (AMF) in roots of Prunus persica under two fertilization treatments (CF: consisted of application of chicken manure (1400 kg.ha-1), urea (140 kg.ha-1), complex fertilizer 12-12-17/2 (280 kg.ha-1), and potassium sulfate (40 kg.ha-1) and IF: consisted of application of urea (140 kg.ha-1), complex fertilizer 12-12-17/2 (400 kg.ha-1) and potassium sulfate (70 kg.ha-1)) combined with integrated pest management (IM) or chemical pest management (CM), in a tropical agroecosystem in the north of Venezuela. Our goal was to ascertain how different fertilizers/pest management can modify the AMF diversity colonizing P. persica roots as an important step towards sustainable soil use and therefore protection of biodiversity. The AM fungal small-subunit (SSU) rRNA genes were subjected to PCR, cloning, sequencing and phylogenetic analyses. Twenty-one different phylotypes were identified, which were grouped in five families: Glomeraceae, Paraglomeraceae, Acaulosporaceae, Gigasporaceae and Archaeosporaceae. Sixteen of these sequence groups belonged to the genus Glomus, two to Paraglomus, one to Acaulospora, one to Scutellospora and one to Archaeospora. A different distribution of the AMF phylotypes as consequence of the difference between treatments was observed. Thus, the AMF communities of tree roots in the (IF+CM) treatment had the lowest diversity (H'=1.78) with the lowest total number of AMF sequence types (9). The trees from both (CF+IM) and (IF+IM) treatments had similar AMF diversity (H'?2.00); while the treatment (CF+CM) yielded the highest number of different AMF sequence types (17) and showed the highest diversity index (H'=2.69). In conclusion, the crop management including combination of organic and inorganic fertilization and chemical pest control appears to be the most suitable strategy with respect to reactivate the AMF diversity in the roots of this crop and thus, the agricultural and environmental

  12. AMF Development under.Net Platform%.Net平台下的AMF开发

    Institute of Scientific and Technical Information of China (English)

    易学武

    2010-01-01

    AMF是基于FLASH的一种轻量级的、高效能的网络通信协议,它目前有AMF0和AMF3两个版本,现已被广泛应用到互联网的各个领域.FluorineFx是基于.net的专门用于处理AMF数据的免费组件,该文将介绍在Visual Studio 2005平台下使用VB.NET结合FluorineFx组件进行高效率AMF开发的基本方法.

  13. Complete genome sequence of bean leaf crumple virus, a novel begomovirus infecting common bean in Colombia.

    Science.gov (United States)

    Carvajal-Yepes, Monica; Zambrano, Leidy; Bueno, Juan M; Raatz, Bodo; Cuellar, Wilmer J

    2017-02-10

    A copy of the complete genome of a novel bipartite begomovirus infecting common bean (Phaseolus vulgaris L.) in Colombia was obtained by rolling-circle amplification (RCA), cloned, and sequenced. The virus is associated with leaf crumple symptoms and significant yield losses in Andean and Mesoamerican beans. Such symptoms have been reported increasingly in Colombia since at least 2002, and we detected the virus in leaf material collected since 2008. Sequence analysis showed that the virus is a member of a distinct species, sharing 81% and 76% nucleotide (nt) sequence identity (in DNA-A and DNA-B, respectively) to other begomoviruses infecting common bean in the Americas. The data obtained support the taxonomic status of this virus (putatively named 'bean leaf crumple virus', BLCrV) as a member of a novel species in the genus Begomovirus.

  14. Evaluation of Genetic Diversity of Castor Bean for Biodiesel Utilization

    Science.gov (United States)

    Castor bean (Ricinus communis L., 2n=20) is a cross-pollinated diploid species belonging to the family Euphorbiaceae instead of the Leguminosae. It is a native of Africa but may have originated in India. Castor bean plants grow as annual or perennial, depending on geographical locations, climate a...

  15. Arbuscular mycorrhizal fungi (AMF) as bio protector agents against wilt induced by Verticillium spp. in pepper

    Energy Technology Data Exchange (ETDEWEB)

    Goicoechea, N.; Garmendia, I.; Sanchez-Diaz, M.; Aguirreolea, J.

    2010-07-01

    Verticillium dahliae Kleb. is a vascular pathogen that alters water status and growth of pepper plants and causes drastic reductions in yield. Its control is difficult because it can survive in field soil for several years. The application of arbuscular mycorrhizal fungi (AMF) as bio protector agents against V. dahliae is an alternative to the use of chemicals which, in addition, is more respectful with the environment. The establishment of the mutualistic association of plant roots and AMF involves a continuous cellular and molecular dialogue between both symbionts that includes the pre activation of plant defense responses that may enhance the resistance or tolerance of mycorrhizal plants to soil-borne pathogens. Some AMF can improve the resistance of Capsicum annuum L. against V. dahliae. This is especially relevant for pepper cultivars (i.e. cv. Piquillo) that exhibit high susceptibility to this pathogen. Compared with non-mycorrhizal plants, mycorrhizal pepper can exhibit more balanced antioxidant metabolism in leaves along the first month after pathogen inoculation, which may contribute to delay both the development of disease symptoms and the decrease of photosynthesis in Verticillium-inoculated plants with the subsequent benefit for yield. In stems, mycorrhizal pepper show earlier and higher deposition of lignin in xylem vessels than non mycorrhizal plants, even in absence of the pathogen. Moreover, AMF can induce new isoforms of acidic chitinases and superoxide dismutase in roots. Mycorrhizal-specific induction of these enzymatic activities together with enhanced peroxidase and phenylalanine ammonia-lyase in roots may also be involved in the bio protection of Verticillium-induced wilt in pepper by AMF. (Author) 81 refs.

  16. The effect of lactic acid bacteria on cocoa bean fermentation.

    Science.gov (United States)

    Ho, Van Thi Thuy; Zhao, Jian; Fleet, Graham

    2015-07-16

    Cocoa beans (Theobroma cacao L.) are the raw material for chocolate production. Fermentation of cocoa pulp by microorganisms is crucial for developing chocolate flavor precursors. Yeasts conduct an alcoholic fermentation within the bean pulp that is essential for the production of good quality beans, giving typical chocolate characters. However, the roles of bacteria such as lactic acid bacteria and acetic acid bacteria in contributing to the quality of cocoa bean and chocolate are not fully understood. Using controlled laboratory fermentations, this study investigated the contribution of lactic acid bacteria to cocoa bean fermentation. Cocoa beans were fermented under conditions where the growth of lactic acid bacteria was restricted by the use of nisin and lysozyme. The resultant microbial ecology, chemistry and chocolate quality of beans from these fermentations were compared with those of indigenous (control) fermentations. The yeasts Hanseniaspora guilliermondii, Pichia kudriavzevii, Kluyveromyces marxianus and Saccharomyces cerevisiae, the lactic acid bacteria Lactobacillus plantarum, Lactobacillus pentosus and Lactobacillus fermentum and the acetic acid bacteria Acetobacter pasteurianus and Gluconobacter frateurii were the major species found in control fermentations. In fermentations with the presence of nisin and lysozyme, the same species of yeasts and acetic acid bacteria grew but the growth of lactic acid bacteria was prevented or restricted. These beans underwent characteristic alcoholic fermentation where the utilization of sugars and the production of ethanol, organic acids and volatile compounds in the bean pulp and nibs were similar for beans fermented in the presence of lactic acid bacteria. Lactic acid was produced during both fermentations but more so when lactic acid bacteria grew. Beans fermented in the presence or absence of lactic acid bacteria were fully fermented, had similar shell weights and gave acceptable chocolates with no differences

  17. Airborne and Maritime/Fixed Station Joint Tactical Radio System (AMF JTRS)

    Science.gov (United States)

    2015-12-01

    objective. A Program Deviation Report was submitted in January 2016 as formal notification that a threshold breach to the APB occurred. SANR acquisition...previously reported in the September 2015 SAR. A Program Deviation Report was submitted in January 2016. Threshold Breaches AMF JTRS December 2015 SAR...routing and retransmission Objective waveforms that are same in mode (voice, data, or video) and use like data rates and operate at permissible

  18. Use of ARM Mobile Facility (AMF) Data to Study Aerosol Indirect Effects in China

    Energy Technology Data Exchange (ETDEWEB)

    Li, Zhanqing [Univ. of Maryland, College Park, MD (United States)

    2012-12-19

    General goals: 1) Facilitating the deployment of the ARM Mobile Facility (AMF) and Ancillary Facility (AAF) in China in 2008, 2) Processing, retrieving, improving and analyzing observation data from ground-based, air-borne and space-borne instruments; 3) Conducting a series of studies to gain insights into the direct and indirect effects of these aerosols on radiation, clouds, and precipitation using both

  19. Influence of Arbuscular Mycorrhizal Fungus (AMF) on degradation of iron-cyanide complexes

    Science.gov (United States)

    Sut, Magdalena; Boldt-Burisch, Katja; Raab, Thomas

    2015-04-01

    Soil contamination in the vicinities of former Manufactured Gas Plant (MGP) sites is a worldwide known environmental issue. The pollutants, in form of iron-cyanide complexes, originating from the gas purification process, create a risk for human health due to potential release of toxic free cyanide, CN(aq) and HCN(g), (aq).The management and remediation of cyanide contaminated soil can be very challenging due to the complex chemistry and toxicity of CN compounds. The employment of phytoremediation to remove or stabilize contaminants at a former MGP site is an inexpensive process, but can be limited through shallow rotting, decreased biomass, poor growing and the risk of secondary accumulation. However, this adaptation may be enhanced via arbuscular mycorrhizal fungi (AMF) activity, which may cooperate on the degradation, transformation or uptake of the contaminants. We would like to present our preliminary results from the ongoing project concerning toxic substrate-AMF-plant relation, based on studying the site of a former MGP site. In situ experiments contributed to identifying those fungi that are likely to persist in extremely acidic and toxic conditions. Subsequently, commercially available Rhizophagus irregularis was grown in sterilized, un-spiked soil with the roots of the host plant Calamagrostis epigejos. Extracted roots and AMF hyphae were used in the batch experiment, were the potential of this association on degradation of iron-cyanide complexes, in form of potassium ferrocyanide solution, was assessed.

  20. Baked Bean Curd

    Institute of Scientific and Technical Information of China (English)

    1996-01-01

    Ingredients: Two pieces of tender bean curd, shredded shrimp, minced fat and lean pork, minced ham, minced fresh mushrooms, fried dried shrimps, mashed scallion, ginger and garlic, cooking wine, salad oil, salt, MSG and pepper powder. Directions:

  1. Response of castor bean to arbuscular mycorrhizal fungi and levels of phosphorusResposta da mamoneira a fungos micorrízicos arbusculares e a níveis de fósforo

    Directory of Open Access Journals (Sweden)

    José Roberto Pinto de Souza

    2011-12-01

    Full Text Available The aim of this study was to evaluate the response of castor bean inoculated with arbuscular mycorrhizal fungi (AMF and different levels of P in the soil. The experiment was carried out under greenhouse condition, in Londrina-PR, using disinfected sandy soil (LVd as substrate, in pots with capacity of 4 kg. The treatments were conducted in a randomized factorial design, using Iris castor bean cultivar. The treatments with mycorrhizal were: Control, Gigaspora margarita, Glomus clarum, and a mixture of species, and five levels of P (0, 20, 40, 80, 160 mg P kg soil-1, with four replicates. There were evaluated: dry mass, content of P in the shoot and mycorrhization. There was a significant effect of arbuscular mycorrhizal fungi inoculation on the dry mass and in the P content in the shoot. The addition of P influenced, significantly, the production of dry mass and P content in the plant tissue, however it decreases the root colonization and mycorrhizal sporulation. The castor bean show dependence of AMF in soil with low levels of P.O objetivo no presente estudo foi avaliar a resposta da mamoneira inoculada com fungos micorrízicos arbusculares (FMA e diferentes níveis de P no solo. O experimento foi conduzido em casa de vegetação, em Londrina-PR, com a utilização de solo arenoso (LVd autoclavado como substrato, em vasos com capacidade de 4 kg. Os tratamentos foram instalados em um esquema fatorial A x B, casualizados, sendo utilizado o híbrido de mamona Iris. Fator A: representado pela inoculação dos fungos micorrízicos: Controle, Gigaspora margarita, Glomus clarum, e uma mistura de espécies, e o fator B pelos cinco níveis de P (0, 20, 40, 80, 160 mg P kg solo-1, com quatro repetições. Foram avaliados: massa seca de plantas, micorrização e o teor de P na parte aérea. Houve efeito significativo da inoculação de fungos micorrizícos arbusculares na massa seca e no teor de P na parte área. A adição de doses de P influenciou de

  2. Friend or Foe-Light Availability Determines the Relationship between Mycorrhizal Fungi, Rhizobia and Lima Bean (Phaseolus lunatus L..

    Directory of Open Access Journals (Sweden)

    Daniel J Ballhorn

    Full Text Available Plant associations with root microbes represent some of the most important symbioses on earth. While often critically promoting plant fitness, nitrogen-fixing rhizobia and arbuscular mycorrhizal fungi (AMF also demand significant carbohydrate allocation in exchange for key nutrients. Though plants may often compensate for carbon loss, constraints may arise under light limitation when plants cannot extensively increase photosynthesis. Under such conditions, costs for maintaining symbioses may outweigh benefits, turning mutualist microbes into parasites, resulting in reduced plant growth and reproduction. In natural systems plants commonly grow with different symbionts simultaneously which again may interact with each other. This might add complexity to the responses of such multipartite relationships. We experimented with lima bean (Phaseolus lunatus, which efficiently forms associations with both types of root symbionts. We applied full light and low-light to each of four treatments of microbial inoculation. After an incubation period of 14 weeks, we quantified vegetative aboveground and belowground biomass and number and viability of seeds to determine effects of combined inoculant and light treatment on plant fitness. Under light-limited conditions, vegetative and reproductive traits were inhibited in AMF and rhizobia inoculated lima bean plants relative to controls (un-colonized plants. Strikingly, reductions in seed production were most critical in combined treatments with rhizobia x AMF. Our findings suggest microbial root symbionts create additive costs resulting in decreased plant fitness under light-limited conditions.

  3. Friend or Foe-Light Availability Determines the Relationship between Mycorrhizal Fungi, Rhizobia and Lima Bean (Phaseolus lunatus L.).

    Science.gov (United States)

    Ballhorn, Daniel J; Schädler, Martin; Elias, Jacob D; Millar, Jess A; Kautz, Stefanie

    2016-01-01

    Plant associations with root microbes represent some of the most important symbioses on earth. While often critically promoting plant fitness, nitrogen-fixing rhizobia and arbuscular mycorrhizal fungi (AMF) also demand significant carbohydrate allocation in exchange for key nutrients. Though plants may often compensate for carbon loss, constraints may arise under light limitation when plants cannot extensively increase photosynthesis. Under such conditions, costs for maintaining symbioses may outweigh benefits, turning mutualist microbes into parasites, resulting in reduced plant growth and reproduction. In natural systems plants commonly grow with different symbionts simultaneously which again may interact with each other. This might add complexity to the responses of such multipartite relationships. We experimented with lima bean (Phaseolus lunatus), which efficiently forms associations with both types of root symbionts. We applied full light and low-light to each of four treatments of microbial inoculation. After an incubation period of 14 weeks, we quantified vegetative aboveground and belowground biomass and number and viability of seeds to determine effects of combined inoculant and light treatment on plant fitness. Under light-limited conditions, vegetative and reproductive traits were inhibited in AMF and rhizobia inoculated lima bean plants relative to controls (un-colonized plants). Strikingly, reductions in seed production were most critical in combined treatments with rhizobia x AMF. Our findings suggest microbial root symbionts create additive costs resulting in decreased plant fitness under light-limited conditions.

  4. AGRICULTURAL PRACTICES, MORPHOLOGIC, PROTEINIC AND CULINARY DESCRIPTION OF THE GRAIN OF BEAN CULTIVARS SOWED IN THE REGION OF TLATZALA, GUERRERO

    Directory of Open Access Journals (Sweden)

    Fausto Solano Cervantes

    2009-08-01

    Full Text Available The research had for object describe the productive process of the of bean culture in the community of Tlatzala, Guerrero and the species diversity by means of the morphologic characteristics of the grain, protein content and the culinary quality. 30 questionnaires were applied to bean producers and 20 varieties of bean were collected from which the morphologic characters of the grain, protein content and the culinary characters were obtained. The production cycle of bean initiates in May and finishes in October. The technology used is traditional, characterized by the use of the yoke in the labors of the culture that demands workforce to realize the activities of manual form. The biological cycle of the varieties begins in June, the variation at time is determinated for the cultivated genotype. The determinate or indeterminate bush beans are predominant (65 %. The sowing systems are intercalated (50 % and associated with maize (30 % and monoculture (20 %. The varieties Rojito and Blanco have special uses, the first one has the attribute of being consumed as green-bean all the year around and the second one is used to prepare the dish called Chile-ajo. The Black beans were the most frequent (45 % followed by the Red beans (35 % and the least frequent were the Striped one (5 % and Muddy-like (5 %. The kidney shape of grain was the most abundant (85 % and the oval one was the least frequent (5 %. The grain weight changed from 14.4 up to 38.5 g. The sizes of grains founded were medium (50 % and small (50 %. The protein content registered was: White beans 24.68 %, Red bean 24.64 %, Black beans 23.5 % and Striped beans of guide 22.27 %. The Rojito Enano had the major protein content (27.6 %. The cooking times were: Red beans 73 minutes, Striped of guide bean 65.5, Blacks bean 64.6 and Whites bean 59. The Black bean Enano-1 used less time (54 minutes. The Striped of guide bean registered the major amount of solid (0.32 %, followed by the Black beans

  5. Species richness of arbuscular mycorrhizal fungi: associations with grassland plant richness and biomass.

    Science.gov (United States)

    Hiiesalu, Inga; Pärtel, Meelis; Davison, John; Gerhold, Pille; Metsis, Madis; Moora, Mari; Öpik, Maarja; Vasar, Martti; Zobel, Martin; Wilson, Scott D

    2014-07-01

    Although experiments show a positive association between vascular plant and arbuscular mycorrhizal fungal (AMF) species richness, evidence from natural ecosystems is scarce. Furthermore, there is little knowledge about how AMF richness varies with belowground plant richness and biomass. We examined relationships among AMF richness, above- and belowground plant richness, and plant root and shoot biomass in a native North American grassland. Root-colonizing AMF richness and belowground plant richness were detected from the same bulk root samples by 454-sequencing of the AMF SSU rRNA and plant trnL genes. In total we detected 63 AMF taxa. Plant richness was 1.5 times greater belowground than aboveground. AMF richness was significantly positively correlated with plant species richness, and more strongly with below- than aboveground plant richness. Belowground plant richness was positively correlated with belowground plant biomass and total plant biomass, whereas aboveground plant richness was positively correlated only with belowground plant biomass. By contrast, AMF richness was negatively correlated with belowground and total plant biomass. Our results indicate that AMF richness and plant belowground richness are more strongly related with each other and with plant community biomass than with the plant aboveground richness measures that have been almost exclusively considered to date.

  6. Tethered Balloon Operations at ARM AMF3 Site at Oliktok Point, AK

    Science.gov (United States)

    Dexheimer, D.; Lucero, D. A.; Helsel, F.; Hardesty, J.; Ivey, M.

    2015-12-01

    Oliktok Point has been the home of the Atmospheric Radiation Measurement Program's (ARM) third ARM Mobile Facility, or AMF3, since October 2013. The AMF3 is operated through Sandia National Laboratories and hosts instrumentation collecting continuous measurements of clouds, aerosols, precipitation, energy, and other meteorological variables. The Arctic region is warming more quickly than any other region due to climate change and Arctic sea ice is declining to record lows. Sparsity of atmospheric data from the Arctic leads to uncertainty in process comprehension, and atmospheric general circulation models (AGCM) are understood to underestimate low cloud presence in the Arctic. Increased vertical resolution of meteorological properties and cloud measurements will improve process understanding and help AGCMs better characterize Arctic clouds. SNL is developing a tethered balloon system capable of regular operation at AMF3 in order to provide increased vertical resolution atmospheric data. The tethered balloon can be operated within clouds at altitudes up to 7,000' AGL within DOE's R-2204 restricted area. Pressure, relative humidity, temperature, wind speed, and wind direction are recorded at multiple altitudes along the tether. These data were validated against stationary met tower data in Albuquerque, NM. The altitudes of the sensors were determined by GPS and calculated using a line counter and clinometer and compared. Wireless wetness sensors and supercooled liquid water content sensors have also been deployed and their data has been compared with other sensors. This presentation will provide an overview of the balloons, sensors, and test flights flown, and will provide a preliminary look at data from sensor validation campaigns and test flights.

  7. AMF Inoculation Enhances Growth and Improves the Nutrient Uptake Rates of Transplanted, Salt-Stressed Tomato Seedlings

    Directory of Open Access Journals (Sweden)

    Astrit Balliu

    2015-12-01

    Full Text Available The study aimed to investigate the effects of commercially available AMF inoculate (Glomus sp. mixture on the growth and the nutrient acquisition in tomato (Solanumlycopersicum L. plants directly after transplanting and under different levels of salinity. Inoculated (AMF+ and non-inoculated (AMF− tomato plants were subjected to three levels of NaCl salinity (0, 50, and 100 mM·NaCl. Seven days after transplanting, plants were analyzed for dry matter and RGR of whole plants and root systems. Leaf tissue was analyzed for mineral concentration before and after transplanting; leaf nutrient content and relative uptake rates (RUR were calculated. AMF inoculation did not affect plant dry matter or RGR under fresh water-irrigation. The growth rate of AMF−plants did significantly decline under both moderate (77% and severe (61% salt stress compared to the fresh water-irrigated controls, while the decline was much less (88% and 75%,respectivelyand statistically non-significant in salt-stressed AMF+ plants. Interestingly, root system dry matter of AMF+ plants (0.098 g plant–1 remained significantly greater under severe soil salinity compared to non-inoculated seedlings (0.082 g plant–1. The relative uptake rates of N, P, Mg, Ca, Mn, and Fe were enhanced in inoculated tomato seedlings and remained higher under (moderate salt stress compared to AMF− plants This study suggests that inoculation with commercial AMF during nursery establishment contributes to alleviation of salt stress by maintaining a favorable nutrient profile. Therefore, nursery inoculation seems to be a viable solution to attenuate the effects of increasing soil salinity levels, especially in greenhouses with low natural abundance of AMF spores.

  8. STORED COCOA BEANS QUALITY AFFECTED BY FERMENTATION AND EPHESTIA CAUTELLA WALKER (LEPIDOPTERA: PHYCITIDAE INFESTATION

    Directory of Open Access Journals (Sweden)

    OK.KY S. DHARMAPUTRA

    2000-01-01

    fluctuated during storage. The highest percentage of mouldy beans was on unfermented and infested cocoa beans. Twenty-one fungal species were isolated from all treatments of coco a beans during storage. The total fungal population on fermented and unfermented beans had the same pattern. The population on fermented cocoa beans was lower than that on unfermented beans. Total lipid content on fermented cocoa beans either infested or not with £. cautella having initial moisture content of 7 or 9%, was lower than that of unfermented beans. The content either on fermented or unfermented cocoa beans and either infested or not decreased during storage. Free fatty acid content on cocoa beans infested with £. cautella was higher and significantly different than that on not infested. The content for both types increased during storage.

  9. Thermocouples in an alternating magnetic field (AMF) for studying magnetic nanoparticle hyperthermia

    Science.gov (United States)

    Hartzell, S.; Boekelheide, Z.

    Magnetic nanoparticle hyperthermia, a method of cancer therapy, is currently a subject of active research. A critical parameter during therapy or laboratory research is the temperature of the system (tissue or nanoparticle suspension). Thermocouples are affordable and ubiquitous temperature sensors which could be used in this capacity; however, their metallic nature results in self-heating due to eddy currents when placed in an AMF. This presentation will quantitatively discuss calculations and measurements of the self-heating of three common types of thermocouples. Type T, K, and E thermocouples of both thin (40 gauge) and thick (20 gauge) wires were tested in a range of applied magnetic field magnitudes (235 kHz, 0-0.4 T rms). Among the thermocouples, all three types demonstrated large self-heating in 20 gauge wires. For the 40 gauge wires, type K showed large self-heating, while type T showed small but significant self-heating and type E showed no significant self-heating in comparison to the background. Our results indicate that thin type E thermocouples can be accurately used as temperature sensors in an AMF environment similar to the one used here, and type T thermocouples may be appropriate under conditions with lower magnetic field strength or frequency.

  10. Functional diversity in arbuscular mycorrhizas: Exploitation of soil patches with different phosphate enrichment differs among fungal species

    DEFF Research Database (Denmark)

    Cavagnaro, T.R.; Smith, F.A.; Smith, S.E.;

    2005-01-01

    Most terrestrial plant species form associations with arbuscular mycorrhizal fungi (AMF) that transfer soil P to the plant via their external hyphae. The distribution of nutrients in soils is typically patchy (heterogeneous) but little is known about the ability of AMF to exploit P patches in soi...... by decreased P uptake by other parts of the mycelium. This is the first demonstration of variation in growth and nutrient uptake by an AMF as influenced by a localized P enrichment of the soil. The results are discussed in the context of functional diversity of AMF....

  11. Phenotyping common beans for adaptation to drought

    Directory of Open Access Journals (Sweden)

    Stephen eBeebe

    2013-03-01

    Full Text Available Common beans (Phaseolus vulgaris L. originated in the New World and are the grain legume of greatest production for direct human consumption. Common bean production is subject to frequent droughts in highland Mexico, in the Pacific coast of Central America, in northeast Brazil, and in eastern and southern Africa from Ethiopia to South Africa. This article reviews efforts to improve common bean for drought tolerance, referring to genetic diversity for drought response, the physiology of of drought tolerance mechanisms, and breeding strategies. Different races of common bean respond differently to drought, with race Durango of highland Mexico being a major source of genes. Sister species of P. vulgaris likewise have unique traits, especially P. acutifolius which is well adapted to dryland conditions. Diverse sources of tolerance may have different mechanisms of plant response, implying the need for different methods of phenotyping to recognize the relevant traits. Practical considerations of field management are discussed including: trial planning; water management; and field preparation.

  12. Diversification and population structure in common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Matthew W Blair

    Full Text Available Wild accessions of crops and landraces are valuable genetic resources for plant breeding and for conserving alleles and gene combinations in planta. The primary genepool of cultivated common beans includes wild accessions of Phaseolus vulgaris. These are of the same species as the domesticates and therefore are easily crossable with cultivated accessions. Molecular marker assessment of wild beans and landraces is important for the proper utilization and conservation of these important genetic resources. The goal of this research was to evaluate a collection of wild beans with fluorescent microsatellite or simple sequence repeat markers and to determine the population structure in combination with cultivated beans of all known races. Marker diversity in terms of average number of alleles per marker was high (13 for the combination of 36 markers and 104 wild genotypes that was similar to the average of 14 alleles per marker found for the 606 cultivated genotypes. Diversity in wild beans appears to be somewhat higher than in cultivated beans on a per genotype basis. Five populations or genepools were identified in structure analysis of the wild beans corresponding to segments of the geographical range, including Mesoamerican (Mexican, Guatemalan, Colombian, Ecuadorian-northern Peruvian and Andean (Argentina, Bolivia and Southern Peru. The combined analysis of wild and cultivated accessions showed that the first and last of these genepools were related to the cultivated genepools of the same names and the penultimate was found to be distinct but not ancestral to the others. The Guatemalan genepool was very novel and perhaps related to cultivars of race Guatemala, while the Colombian population was also distinct. Results suggest geographic isolation, founder effects or natural selection could have created the different semi-discrete populations of wild beans and that multiple domestications and introgression were involved in creating the diversity of

  13. Arbuscular Mycorrhizal Fungus Species Dependency Governs Better Plant Physiological Characteristics and Leaf Quality of Mulberry (Morus alba L.) Seedlings

    Science.gov (United States)

    Shi, Song-Mei; Chen, Ke; Gao, Yuan; Liu, Bei; Yang, Xiao-Hong; Huang, Xian-Zhi; Liu, Gui-Xi; Zhu, Li-Quan; He, Xin-Hua

    2016-01-01

    Understanding the synergic interactions between arbuscular mycorrhizal fungi (AMF) and its host mulberry (Morus alba L.), an important perennial multipurpose plant, has theoretical and practical significance in mulberry plantation, silkworm cultivation, and relevant textile industry. In a greenhouse study, we compared functional distinctions of three genetically different AMF species (Acaulospora scrobiculata, Funneliformis mosseae, and Rhizophagus intraradices) on physiological and growth characteristics as well as leaf quality of 6-month-old mulberry seedlings. Results showed that mulberry was AMF-species dependent, and AMF colonization significantly increased shoot height and taproot length, stem base and taproot diameter, leaf and fibrous root numbers, and shoot and root biomass production. Meanwhile, leaf chlorophyll a or b and carotenoid concentrations, net photosynthetic rate, transpiration rate and stomatal conductance were generally significantly greater, while intercellular CO2 concentration was significantly lower in AMF-inoculated seedlings than in non-AMF-inoculated counterparts. These trends were also generally true for leaf moisture, total nitrogen, all essential amino acids, histidine, proline, soluble protein, sugar, and fatty acid as they were significantly increased under mycorrhization. Among these three tested AMFs, significantly greater effects of AMF on above-mentioned mulberry physiological and growth characteristics ranked as F. mosseae > A. scrobiculata > R. intraradices, whilst on mulberry leaf quality (e.g., nutraceutical values) for better silkworm growth as F. mosseae ≈A. scrobiculata > R. intraradices. In conclusion, our results showed that greater mulberry biomass production, and nutritional quality varied with AMF species or was AMF-species dependent. Such improvements were mainly attributed to AMF-induced positive alterations of mulberry leaf photosynthetic pigments, net photosynthetic rate, transpiration rate, and N

  14. The composition of arbuscular mycorrhizal fungal communities differs among the roots, spores and extraradical mycelia associated with five Mediterranean plant species.

    Science.gov (United States)

    Varela-Cervero, Sara; Vasar, Martti; Davison, John; Barea, José Miguel; Öpik, Maarja; Azcón-Aguilar, Concepción

    2015-08-01

    Arbuscular mycorrhizal fungi (AMF) are essential constituents of most terrestrial ecosystems. AMF species differ in terms of propagation strategies and the major propagules they form. This study compared the AMF community composition of different propagule fractions - colonized roots, spores and extraradical mycelium (ERM) - associated with five Mediterranean plant species in Sierra de Baza Natural Park (Granada, Spain). AMF were identified using 454 pyrosequencing of the SSU rRNA gene. A total of 96 AMF phylogroups [virtual taxa (VT)] were detected in the study site, including 31 novel VT. After per-sample sequencing depth standardization, 71 VT were recorded from plant roots, and 47 from each of the spore and ERM fractions. AMF communities differed significantly among the propagule fractions, and the root-colonizing fraction differed among host plant species. Indicator VT were detected for the root (13 Glomus VT), spore (Paraglomus VT281, VT336, Pacispora VT284) and ERM (Diversispora VT62) fractions. This study provides detailed evidence from a natural system that AMF taxa are differentially allocated among soil mycelium, soil spores and colonized root propagules. This has important implications for interpreting AMF diversity surveys and designing applications of AMF in vegetation restoration.

  15. The onset of faba bean farming in the Southern Levant

    Science.gov (United States)

    Caracuta, Valentina; Barzilai, Omry; Khalaily, Hamudi; Milevski, Ianir; Paz, Yitzhak; Vardi, Jacob; Regev, Lior; Boaretto, Elisabetta

    2015-10-01

    Even though the faba bean (Vicia faba L.) is among the most ubiquitously cultivated crops, very little is known about its origins. Here, we report discoveries of charred faba beans from three adjacent Neolithic sites in the lower Galilee region, in the southern Levant, that offer new insights into the early history of this species. Biometric measurements, radiocarbon dating and stable carbon isotope analyses of the archaeological remains, supported by experiments on modern material, date the earliest farming of this crop to ~10,200 cal BP. The large quantity of faba beans found in these adjacent sites indicates intensive production of faba beans in the region that can only have been achieved by planting non-dormant seeds. Selection of mutant-non-dormant stock suggests that the domestication of the crop occurred as early as the 11th millennium cal BP. Plant domestication| Vicia faba L.| Pre-Pottery Neolithic B| radiocarbon dating| Δ13C analysis.

  16. Evolutionary analysis of the APA genes in the Phaseolus genus: wild and cultivated bean species as sources of lectin-related resistance factors?

    Science.gov (United States)

    Lioi, L; Galasso, I; Lanave, C; Daminati, M G; Bollini, R; Sparvoli, F

    2007-11-01

    The APA (Arcelin/Phytohemagglutinin/alpha-Amylase inhibitor) gene family is composed of various members, present in Phaseolus species and coding for lectin and lectin-related seed proteins having the double role of storage and defense proteins. Here members of the APA family have been identified by immunological, functional, and molecular analyses and representative genes were sequenced in nine wild species of Phaseolus. All taxa possessed at least one member of the true lectin gene. No arcelin type sequences have been isolated from the species examined. Among the wild species studied, only P. costaricensis contained an alpha-amylase inhibitor (alpha-AI). In addition P. augusti, P. maculatus, P. microcarpus, and P. oligospermus showed the presence of the lectin-related alpha-amylase inhibitor-like (AIL) genes and alpha-AI activity. Data from Southern blot analysis indicated the presence of only one lectin gene in P. parvulus and P. filiformis, while an extensive gene duplication of the APA locus was found in the other Phaseolus species. Phylogenetic analysis carried out on the nucleotide sequences showed the existence of two main clusters and clearly indicated that lectin-related genes originated from a paralogous duplication event preceding the development of the ancestor to the Phaseolus genus. The finding of detectable alpha-AI activity in species containing AIL genes suggests that exploiting APA genes variability in the Phaseolus genus may represent a valuable tool to find new members that may have acquired insecticidal activities.

  17. Experimental investigation and numerical simulation of triggered vacuum arc behavior under TMF/RMF-AMF contact

    Science.gov (United States)

    Wang, Lijun; Deng, Jie; Qin, Kang; Zhang, Xiao; Jia, Shenli

    2016-06-01

    A series of triggering experiments was carried out to investigate the characteristics of vacuum arc controlled by TMF/RMF-AMF contacts. During all the experiments, the current ranged from 5-20 kA (rms) and both the arc appearance and behavior of cathode spots were captured by high-speed camera with corresponding arc current and arc voltage. A 3D steady magnetohydrodynamics (MHD) model was built to simulate and analyze the vacuum arc behavior under TMF/RMF-AMF contacts, and arc plasma parameters were calculated based on the above model. The experimental results showed that arc deflection was visible under both low and high current. Under high current, arc core formed, which meant the arc contracted significantly. In addition, the anode became much more active under high current. The behavior of the cathode spots showed that they split themselves into other new cathode spots. Under high current, the bulk of the spots rotated along a clockwise direction on a transverse magnetic field (TMF) plate, which caused much noise and oscillation in the arc voltage. The simulation results show that ions are likely to gather on the branches of the TMF plate on the anode plane, as a result of the effects between the electromagnetic force and pressure gradient of the arc plasma. The current contracts in the center of the TMF plate on the cathode which was due to the thin connecting rod there. The anode contraction of the current is caused by the Hall effect. Ions move along a clockwise direction on the TMF plate, which is driven by Ampere force. The current contraction resulted in significant melting in the center of the cathode surface while the other region suffered from uniform melting. The melting caused by the anode contraction is more significant than that of the cathode.

  18. Agronomic performance of naked oat (Avena nuda L. and faba bean intercropping

    Directory of Open Access Journals (Sweden)

    Agnieszka Klimek-Kopyra

    2015-06-01

    Full Text Available The most common cereals for faba bean (Vicia faba L. used in intercrops is conventional oat (Avena sativa L. An alternative to oat may be naked oat (Avena nuda L., whose oil content and quality is double. Here, intercropping of naked oat with two different faba bean cultivars (determinate-high tannin and indeterminate-low tannin was compared with sole crops of each species in 2006-2008. The treatments were: sole naked oat at 500 kernels m², indeterminate sole faba bean at 50 seeds m², determinate sole faba bean at 70 seeds m², and an additive series of 25%, 50%, and 75% of faba bean seeding rate mixed with the naked oat seeding rate. Our results demonstrated that intercropping increased the Land Equivalent Ratio by +3% to +9% over sole cropping. Raising the faba bean seeding rate in a mixture from 25% to 75% reduced oat grain yield from 630 (determinate cultivar to 760 kg ha-1 (indeterminate cultivar but increased faba bean grain yield from 760 kg ha-1. Higher yield and leaf area index (LAI and photosynthetically active radiation (PAR values show that the indeterminate cultivar of faba bean is more suitable in mixture with naked oat. The high value of competition index (CR > 1 indicates domination and aggressiveness of faba bean towards naked oat. Regardless of cultivar type, mixture of faba bean with naked oat is less productive than pure sowing.

  19. SEQUENCE OF THE STRUCTURAL GENE FOR GRANULE-BOUND STARCH SYNTHASE OF POTATO (SOLANUM-TUBEROSUM L) AND EVIDENCE FOR A SINGLE POINT DELETION IN THE AMF ALLELE

    NARCIS (Netherlands)

    van der Leij, Feike R.; VISSER, RGF; Ponstein, Anne S.; Jacobsen, Evert; Feenstra, Willem

    1991-01-01

    The genomic sequence of the potato gene for starch granule-bound starch synthase (GBSS; "waxy protein") has been determined for the wild-type allele of a monoploid genotype from which an amylose-free (amf) mutant was derived, and for the mutant part of the amf allele. Comparison of the wild-type seq

  20. Revertants of the amylose-free (amf) potato clone 86.040 (2n=1x=12)

    NARCIS (Netherlands)

    Jacobsen, Evert; KRIJGSHELD, HT; Hermelink, J; Ponstein, A.S.; Witholt, Bernard; Feenstra, W.J.

    1990-01-01

    The amylose-free (amf) potato clone 86.040 (2n = 1x = 12), in which the enzyme granule bound starch synthase (GBSS) is affected, has been used for the induction and isolation of revertants with loosely branched amylopectin. Screening of 5500 microtubers, which were induced on stem segments of 685 ir

  1. [Effects of arbuscular mycorrhiza fungi (AMF) on the plant growth, fruit yield, and fruit quality of cucumber under salt stress].

    Science.gov (United States)

    Han, Bing; Guo, Shi-Rong; He, Chao-Xing; Yan, Yan; Yu, Xian-Chang

    2012-01-01

    By adopting organic substrate culture, and salt-sensitive cucumber variety 'Jinchun No. 2' was used as test material, this paper studied the effects of inoculating arbuscular mycorrhiza fungi (AMF) on the plant growth, fruit yield, and fruit quality of cucumber under salt stress. AMF-inoculation could effectively promote the plant growth and nutrient uptake, and improve the fruit yield and fruit nutrient quality, compared with ordinary cultivation. Under salt stress, the plant growth was inhibited, and the plant N, P, K, Cu, and Zn contents and K+/Na+ ratio, fruit yield, and fruit soluble protein, total sugar, vitamin C, and nitrate contents decreased, while inoculation with AMF could mitigate the inhibitory effect of salt stress on the plant growth, made the plant N, P, K, Cu, and Zn contents increased by 7.3%, 11.7%, 28.2%, 13.5%, and 9.9%, respectively, and made the plant K+/Na+ ratio, fruit yield, and fruit soluble protein, total sugar, and vitamin C contents have an obvious increase and the fruit nitrate content have a significant decrease. It was suggested that AMF could promote the plant growth and nutrient uptake of cucumber under salt stress, increase the plant salt-tolerance, and improve the fruit yield and its nutrient quality.

  2. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Johansen, Ida Elisabeth

    2011-01-01

    Reporter tagged virus clones can provide detailed information on virus–host interactions. In Phaseolus vulgaris (bean), four recessive and one dominant gene are known to control infection by strains of the potyvirus species Bean common mosaic virus (BCMV). To study the interactions between BCMV...

  3. Tannins in faba beans (Vicia faba L.) : antinutritional properties in monogastric animals

    NARCIS (Netherlands)

    Jansman, A.J.M.

    1993-01-01

    Condensed tannins are found in coloured-flowering varieties of faba beans ( Viciafaba L.). They are considered as antinutritional factors for nonruminant species. High-tannin hulls of faba beans and isolated tannins were shown to induce a rapid hypertrophy of the parotid glands in rats and increase

  4. Tannins in faba beans (Vicia Faba L.)- antinutritional properties in monogastric animals.

    NARCIS (Netherlands)

    Jansman, A.J.M.

    1993-01-01

    Condensed tannins are found in coloured-flowering varieties of faba beans ( Viciafaba L.). They are considered as antinutritional factors for nonruminant species. High-tannin hulls of faba beans and isolated tannins were shown to induce a rapid hypertrophy of the parotid glands in rats

  5. Faba bean in cropping systems

    DEFF Research Database (Denmark)

    Steen Jensen, Erik; Peoples, Mark B.; Hauggaard-Nielsen, Henrik

    2010-01-01

    bean may prove to be a key component of future arable cropping systems where declining supplies and high prices of fossil energy are likely to constrain the affordability and use of fertilizers. This will help address the increasing demand by consumers and governments for agriculture to reduce its...... impact on the environment and climate through new, more sustainable approaches to food production. The aims of this paper are to review the role of faba bean in global plant production systems, the requirements for optimal faba bean production and to highlight the beneficial effects of faba bean...

  6. Co-inoculation with rhizobia and AMF inhibited soybean red crown rot: from field study to plant defense-related gene expression analysis.

    Directory of Open Access Journals (Sweden)

    Xiang Gao

    Full Text Available BACKGROUND: Soybean red crown rot is a major soil-borne disease all over the world, which severely affects soybean production. Efficient and sustainable methods are strongly desired to control the soil-borne diseases. PRINCIPAL FINDINGS: We firstly investigated the disease incidence and index of soybean red crown rot under different phosphorus (P additions in field and found that the natural inoculation of rhizobia and arbuscular mycorrhizal fungi (AMF could affect soybean red crown rot, particularly without P addition. Further studies in sand culture experiments showed that inoculation with rhizobia or AMF significantly decreased severity and incidence of soybean red crown rot, especially for co-inoculation with rhizobia and AMF at low P. The root colony forming unit (CFU decreased over 50% when inoculated by rhizobia and/or AMF at low P. However, P addition only enhanced CFU when inoculated with AMF. Furthermore, root exudates of soybean inoculated with rhizobia and/or AMF significantly inhibited pathogen growth and reproduction. Quantitative RT-PCR results indicated that the transcripts of the most tested pathogen defense-related (PR genes in roots were significantly increased by rhizobium and/or AMF inoculation. Among them, PR2, PR3, PR4 and PR10 reached the highest level with co-inoculation of rhizobium and AMF. CONCLUSIONS: Our results indicated that inoculation with rhizobia and AMF could directly inhibit pathogen growth and reproduction, and activate the plant overall defense system through increasing PR gene expressions. Combined with optimal P fertilization, inoculation with rhizobia and AMF could be considered as an efficient method to control soybean red crown rot in acid soils.

  7. Transcriptome Sequencing of Lima Bean (Phaseolus lunatus to Identify Putative Positive Selection in Phaseolus and Legumes

    Directory of Open Access Journals (Sweden)

    Fengqi Li

    2015-07-01

    Full Text Available The identification of genes under positive selection is a central goal of evolutionary biology. Many legume species, including Phaseolus vulgaris (common bean and Phaseolus lunatus (lima bean, have important ecological and economic value. In this study, we sequenced and assembled the transcriptome of one Phaseolus species, lima bean. A comparison with the genomes of six other legume species, including the common bean, Medicago, lotus, soybean, chickpea, and pigeonpea, revealed 15 and 4 orthologous groups with signatures of positive selection among the two Phaseolus species and among the seven legume species, respectively. Characterization of these positively selected genes using Non redundant (nr annotation, gene ontology (GO classification, GO term enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG pathway analyses revealed that these genes are mostly involved in thylakoids, photosynthesis and metabolism. This study identified genes that may be related to the divergence of the Phaseolus and legume species. These detected genes are particularly good candidates for subsequent functional studies.

  8. Arbuscular mycorrhizal fungi alter the response of growth and nutrient uptake of snap bean (Phaseolus vulgaris L.) to O3

    Institute of Scientific and Technical Information of China (English)

    Shuguang Wang; Zhaozhong Feng; Xiaoke Wang; Wenliang Gong

    2011-01-01

    The effects of arbuscular mycorrhizal fungi (AMF) Glomus mosseae on the responses to elevated O3 in growth and nutrition of snap bean (Phaseolus vulgaris L. cv Guangzhouyuan) were investigated. Exposure was conducted in growth chambers by using three O3 concentrations (20 (CF), 80 (CFO1) and 120 nL/L (CFO2); 8 hr/day for 75 days). Results showed that elevated O3 slightly impacted overall mycorrhizal colonization, but significantly decreased the proportional frequency of hypha and increased the proportional frequency of spores and vesicles, suggesting that O3 had significant effects on mycorrhizal structure. Elevated O3 significantly decreased yield, dry mass and nutrient contents (N, P, K, Ca and Mg) in both non-mycorrhizal and mycorrhizal plants. However, significant interactive effects were found in most variables due to that the reduction by O3 in the mycorrhizal plants was less than that in the non-mycorrhizal plants. Additionally, AMF increased the concentrations of N, P, Ca, and Mg in shoot and root. It can be concluded that AMF alleviated detrimental effects of increasing O3 on host plant through improving plant nutrition and growth.

  9. Insects diversity in lima bean (Phaseolus lunatus

    Directory of Open Access Journals (Sweden)

    WIWIN SETIAWATI

    2005-10-01

    Full Text Available Lima bean (Phaseolus lunatus is a vegetable which usually made as a home yard plant for Indonesian people to fulfill their daily needs. This plant has not been produced in the large number by the farmer. So it is hard to find in the market. Lima bean is light by many kind of insect. Inventory, identification and the study of insect taxon to this plant is being done to collect some information about the insect who life in the plant. The research was done in Balitsa experiment garden in the district of Lembang in Bandung regency on November 2003-February 2004, the experiment start at 4 weeks age, at the height of 1260 m over the sea level. The observation was made systematically by absolute method (D-vac macine and relative method (sweeping net. The research so that there were 26 species of phytofagous insect, 9 species of predator insect, 6 species of parasitoid insect, 4 species of pollinator and 14 species of scavenger insect. According to the research the highest species number was got in the 8th week (3rd sampling, which had 27 variety of species, so the highest diversity was also got in this with 2,113 point. Aphididae and Cicadellidae was the most insect found in roay plant. The research also had high number of species insect so the diversity of insect and evenness become high. A community will have the high stability if it is a long with the high diversity. High evenness in community that has low species dominance and high species number of insect so the high of species richness.

  10. An effective virus-based gene silencing method for functional genomics studies in common bean

    Directory of Open Access Journals (Sweden)

    Kachroo Aardra

    2011-06-01

    Full Text Available Abstract Background Common bean (Phaseolus vulgaris L. is a crop of economic and nutritious importance in many parts of the world. The lack of genomic resources have impeded the advancement of common bean genomics and thereby crop improvement. Although concerted efforts from the "Phaseomics" consortium have resulted in the development of several genomic resources, functional studies have continued to lag due to the recalcitrance of this crop for genetic transformation. Results Here we describe the use of a bean pod mottle virus (BPMV-based vector for silencing of endogenous genes in common bean as well as for protein expression. This BPMV-based vector was originally developed for use in soybean. It has been successfully employed for both protein expression and gene silencing in this species. We tested this vector for applications in common bean by targeting common bean genes encoding nodulin 22 and stearoyl-acyl carrier protein desaturase for silencing. Our results indicate that the BPMV vector can indeed be employed for reverse genetics studies of diverse biological processes in common bean. We also used the BPMV-based vector for expressing the green fluorescent protein (GFP in common bean and demonstrate stable GFP expression in all common bean tissues where BPMV was detected. Conclusions The availability of this vector is an important advance for the common bean research community not only because it provides a rapid means for functional studies in common bean, but also because it does so without generating genetically modified plants. Here we describe the detailed methodology and provide essential guidelines for the use of this vector for both gene silencing and protein expression in common bean. The entire VIGS procedure can be completed in 4-5 weeks.

  11. THE OCCURRENCE OF INSECTS, FUNGI AND ORGANOLEPTIC CHARACTERISTICS IN STORED COFFEE BEANS IN LAMPUNG

    Directory of Open Access Journals (Sweden)

    OKKY s. DHARMAPUTRA

    1999-01-01

    Full Text Available A survey on postharvest handling and technology processing of coffee beans at farmer, trader and exporter levels was conducted in West Lampung a nd Tanggamus regencies of Lampung province during harvest time (July 1998. Interviews and sampling of coffee beans were carried out during the survey. The number of respondents at farmer, trader and exporter levels was 22, 20 and 4, respectively, while the number of samples collected from each level was 20. All samples were analyzed for moisture content, physical quality, insect and fungal infestation, reducing sugar content, and coffee cupping. The results of the interviews indicated that posth arvest handling and technol ogy processing became better from farmers to exporters. Moisture contents of coffee beans collected from farmers and traders were higher than the tolerable limit recommended by SNI (13%. Physical quality of coffee beans collected from exporters was higher than that collected from farmers and traders. Insects were found on coffee beans collected from farmers, traders and exporters, but the number of species and the percentage of samples infested by insects from each level were relatively low. The predominant species was Liposcelis entomophila. The number of fungal species on coffee beans collected from farmers was higher than that collected from traders and exporters. The predominant species at the three levels was Aspergillus niger, but the lowest percentage of beans infected by this fungus was found on coffee beans collected from expo rters. The lowest percentage of samples infected by all fungi was also found on coffee beans collected from exporters. Reducing sugar content of coffee beans collected from exporters was lower than that from farmers and traders. Aroma and flavor values tended to increase from farmers through traders to exporters, while the body decreased. Some off-flavors (i.e. earthy, mouldy, fermented and woody were encountered in a few coffee samples from farmers as

  12. Increased photosynthetic acclimation in alfalfa associated with arbuscular mycorrhizal fungi (AMF) and cultivated in greenhouse under elevated CO2.

    Science.gov (United States)

    Goicoechea, Nieves; Baslam, Marouane; Erice, Gorka; Irigoyen, Juan José

    2014-11-15

    Medicago sativa L. (alfalfa) can exhibit photosynthetic down-regulation when grown in greenhouse conditions under elevated atmospheric CO2. This forage legume can establish a double symbiosis with nitrogen fixing bacteria and arbuscular mycorrhizal fungi (AMF), which may increase the carbon sink effect of roots. Our aim was to assess whether the association of alfalfa with AMF can avoid, diminish or delay the photosynthetic acclimation observed in previous studies performed with nodulated plants. The results, however, showed that mycorrhizal (M) alfalfa at the end of their vegetative period had lower carbon (C) discrimination than non-mycorrhizal (NM) controls, indicating photosynthetic acclimation under ECO2 in plants associated with AMF. Decreased C discrimination was due to the acclimation of conductance, since the amount of Rubisco and the expression of genes codifying both large and small subunits of Rubisco were similar or slightly higher in M than in NM plants. Moreover, M alfalfa accumulated a greater amount of soluble sugars in leaves than NM plants, thus favoring a down-regulation effect on photosynthetic rates. The enhanced contents of sugars in leaves coincided with a reduced percentage of arbuscules in roots, suggesting decreased sink of carbohydrates from shoots to roots in M plants. The shorter life cycle of alfalfa associated with AMF in comparison with the NM controls may also be related to the accelerated photosynthetic acclimation in M plants. Further research is needed to clarify to what extent this behavior could be extrapolated to alfalfa cultivated in the field and subjected to periodic cutting of shoots under climatic change scenarios.

  13. Irradiated cocoa beans

    Energy Technology Data Exchange (ETDEWEB)

    Ashby, R.; Tesh, J.M.

    1982-11-01

    Groups of 40 male and 40 female CD rats were fed powdered rodent diet containing 25% (w/w) of either non-irradiated, irradiated or fumigated cocoa beans. The diets were supplemented with certain essential dietary constituents designed to satisfy normal nutritional requirements. An additional 40 male and 40 female rats received basal rodent diet alone (ground) and acted as an untreated control. After 70 days of treatment, 15 male and 15 female rats from each group were used to assess reproductive function of the F/sub 0/ animals and growth and development of the F/sub 1/ offspring up to weaning; the remaining animals were killed after 91 days of treatment.

  14. Effect of plant growth-promoting bacteria (PGPR) and arbuscular mycorrhizal fungi (AMF) inoculation on oats in saline-alkali soil contaminated by petroleum to enhance phytoremediation.

    Science.gov (United States)

    Xun, Feifei; Xie, Baoming; Liu, Shasha; Guo, Changhong

    2015-01-01

    To investigate the effect of plant growth-promoting bacteria (PGPR) and arbuscular mycorrhizal fungi (AMF) on phytoremediation in saline-alkali soil contaminated by petroleum, saline-alkali soil samples were artificially mixed with different amount of oil, 5 and 10 g/kg, respectively. Pot experiments with oat plants (Avena sativa) were conducted under greenhouse condition for 60 days. Plant biomass, physiological parameters in leaves, soil enzymes, and degradation rate of total petroleum hydrocarbon were measured. The result demonstrated that petroleum inhibited the growth of the plant; however, inoculation with PGPR in combination with AMF resulted in an increase in dry weight and stem height compared with noninoculated controls. Petroleum stress increased the accumulation of malondialdehyde (MDA) and free proline and the activities of the antioxidant enzyme such as superoxide dismutase, catalase, and peroxidase. Application of PGPR and AMF augmented the activities of three enzymes compared to their respective uninoculated controls, but decreased the MDA and free proline contents, indicating that PGPR and AMF could make the plants more tolerant to harmful hydrocarbon contaminants. It also improved the soil quality by increasing the activities of soil enzyme such as urease, sucrase, and dehydrogenase. In addition, the degradation rate of total petroleum hydrocarbon during treatment with PGPR and AMF in moderately contaminated soil reached a maximum of 49.73%. Therefore, we concluded the plants treated with a combination of PGPR and AMF had a high potential to contribute to remediation of saline-alkali soil contaminated with petroleum.

  15. Effect of fungal infection on phenolic compounds during the storage of coffee beans

    Directory of Open Access Journals (Sweden)

    Amal, A. A.

    2013-12-01

    Full Text Available Aims: This work was undertaken to study the effect of Aspergillus infection on phenolic compounds in beans from four cultivars of the coffee plant (Coffea arabica L.. The effects of storage conditions of the coffee beans were also examined. Methodology and results: Beans from four varieties of coffee were artificially infected with three species of Aspergillus: A. niger, A. melleus and A. alliacus, and stored at 0, 8 and 25 ± 2 °C. After 3, 6 and 9 months, the contents of phenolic compounds in the beans were determined using high performance liquid chromatography (HPLC. Conclusion, significance and impact study: The results of this study showed that phenolic compounds were qualitatively and quantitatively higher in the inoculated beans as compared with the uninfected control beans, reflecting a possible induced defense mechanism in the infected beans. Increased storage periods resulted in higher levels of phenols, but the average total, bound and free phenols did not differ between the cultivars tested. Effective control of Apergillus infection in coffee beans can prevent such changes in phenolics that may affect their commercial value.

  16. Effects of organic fertilizers on the growth and yield of bush bean, winged bean and yard long bean

    Directory of Open Access Journals (Sweden)

    Mohammad Aminul Islam

    Full Text Available ABSTRACT VC (20%, TC (20% and N:P:K fertilizer (farmer's practice were used to determine the growth and yield attributes of bush bean (Phaseolus vulgaris, winged bean (Psophocarpus tetragonolobus and yard long bean (Vigna unguiculata. Plants grown with VC (20% produced the highest fresh biomass for bush bean (527.55 g m-2, winged bean (1168.61 g m-2 and yard long bean (409.84 g m-2. In all the tested legumes the highest pod weight, pod number, pod dry weight and pod length were found in the VC (20% treatment. Photosynthetic rates in the three legumes peaked at pod formation stage in all treatments, with the highest photosynthetic rate observed in winged bean (56.17 µmol m-2s-1 grown with VC (20%. The highest yield for bush bean (2.98 ton ha-1, winged bean (7.28 ton ha-1 and yard long bean (2.22 ton ha-1 were also found in VC (20% treatment. Furthermore, protein content was highest in bush bean (26.50 g/100g, followed by yard long bean (24.74 g/100g and winged bean (22.04 g/100g, under VC (20% treatment. It can be concluded that legumes grown with VC (20% produced the highest yield and yield attributes.

  17. Arbuscular mycorrhizal fungi: new species and records in Northeast of Brazil

    Directory of Open Access Journals (Sweden)

    Danielle Karla Alves da Silva

    2014-10-01

    Full Text Available Arbuscular mycorrhizal fungi (AMF comprise the largest association of plants and fungi in nature yet have only recently been considered within the context of conservation biology. The aim of this work was to document the occurrence of AMF species and highlight recent advances in our knowledge of their diversity in Northeast Brazil. This new information has been generated by the Sisbiota-Brazil Program (National System of Biodiversity Research and provides the basis for a discussion on the AMF species found in the region. The work included a bibliographic review of the records from natural and agricultural area plus data generated by collections made in natural areas in six of the nine northeastern states during the period 2010-2013. Overall we recorded 28 genera and 125 species of AMF. Of these, 11 were new species, 13 represented new records for Brazil and six were unique to the Northeast. This represents a 25% increase in our knowledge of the diversity of AMF in the region. We can now estimate that the Northeast represents about 50% of the AMF species described worldwide. This finding reinforces the need for more studies in areas that are poorly studied in order to extend our understanding of this biodiversity and to help to define future strategies for management and conservation.

  18. Identity recognition in response to different levels of genetic relatedness in commercial soya bean

    Science.gov (United States)

    Van Acker, Rene; Rajcan, Istvan; Swanton, Clarence J.

    2017-01-01

    Identity recognition systems allow plants to tailor competitive phenotypes in response to the genetic relatedness of neighbours. There is limited evidence for the existence of recognition systems in crop species and whether they operate at a level that would allow for identification of different degrees of relatedness. Here, we test the responses of commercial soya bean cultivars to neighbours of varying genetic relatedness consisting of other commercial cultivars (intraspecific), its wild progenitor Glycine soja, and another leguminous species Phaseolus vulgaris (interspecific). We found, for the first time to our knowledge, that a commercial soya bean cultivar, OAC Wallace, showed identity recognition responses to neighbours at different levels of genetic relatedness. OAC Wallace showed no response when grown with other commercial soya bean cultivars (intra-specific neighbours), showed increased allocation to leaves compared with stems with wild soya beans (highly related wild progenitor species), and increased allocation to leaves compared with stems and roots with white beans (interspecific neighbours). Wild soya bean also responded to identity recognition but these responses involved changes in biomass allocation towards stems instead of leaves suggesting that identity recognition responses are species-specific and consistent with the ecology of the species. In conclusion, elucidating identity recognition in crops may provide further knowledge into mechanisms of crop competition and the relationship between crop density and yield. PMID:28280587

  19. 9 CFR 319.310 - Lima beans with ham in sauce, beans with ham in sauce, beans with bacon in sauce, and similar...

    Science.gov (United States)

    2010-01-01

    ... with ham in sauce, beans with bacon in sauce, and similar products. 319.310 Section 319.310 Animals and....310 Lima beans with ham in sauce, beans with ham in sauce, beans with bacon in sauce, and similar products. “Lima Beans with Ham in Sauce,” “Beans with Ham in Sauce,” “Beans with Bacon in Sauce,”...

  20. Growth responses of maritime sand dune plant species to arbuscular mycorrhizal fungi

    Directory of Open Access Journals (Sweden)

    Mariusz Tadych

    2014-08-01

    Full Text Available In a pot experiment conducted in a greenhouse, the response of 6 plant species dominating in the succession of vegetation of a deflation hollow of the Łeba Bar to inoculation with arbuscular mycorrhizal fungi (AMF was investigated. The inoculum was a mixture of soil, roots and spores of 5 species of AMF with the dominant species Glomus aggregatum. Except for Corynephorus canescens and Festuca rubra subsp. arenaria, both the growth and the dry matter of above-ground parts of plants of Agrostis stolonifera, Ammophila arenaria, Corynephorus canescens, Juncus articulatus and J. balticus inoculated with AMF were higher than those growing in soils lacking infection propagules of these fungi. Inoculation with AMF decreased the dry matter of root: shoot ratios in 5 plant species. This property was not determined in Festuca rubra subsp. arenaria due to the death of all control plants. The level of mycorrhizal infection was low and did not correlate with the growth responses found. The high growth reaction of Juncus spp. to AMF found in this study suggests that the opinion of non-mycotrophy or low dependence of plants of Juncaceae on AMF was based on results of investigations of plants growing in wet sites known to inhibit the formation of mycorrhizae.

  1. Healthy food trends -- beans and legumes

    Science.gov (United States)

    ... B-vitamins, iron, folate, calcium, potassium, phosphorus, and zinc. Most beans are also low in fat. Legumes ... pressure, heart rate, and other heart disease and diabetes risks. Beans and legumes contain antioxidants that help ...

  2. Rhizosphere acidification of faba bean, soybean and maize

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, L.L. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Peking Union Medical College, Beijing, 100094 (China); Cao, J. [School of Life Science, Key Laboratory of Arid and Grassland Ecology, Lanzhou University, Lanzhou 730000 (China); Zhang, F.S. [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China); Li, L., E-mail: lilong@cau.edu.cn [College of Resources and Environmental Sciences, China Agricultural University, Key Laboratory of Plant and Soil Interactions, Ministry of Education, Beijing, 100094 (China)

    2009-07-01

    Interspecific facilitation on phosphorus uptake was observed in faba bean/maize intercropping systems in previous studies. The mechanism behind this, however, remained unknown. Under nitrate supply, the difference in rhizosphere acidification potential was studied by directly measuring pH of the solution and by visualizing and quantifying proton efflux of roots between faba bean (Vicia faba L. cv. Lincan No.5), soybean (Glycine max L. cv. Zhonghuang No. 17) and maize (Zea mays L. cv. Zhongdan No.2) in monoculture and intercrop, supplied without or with 0.2 mmol L{sup -1} P as KH{sub 2}PO{sub 4}. The pH of the nutrient solution grown faba bean was lower than initial pH of 6.0 from day 1 to day 22 under P deficiency, whereas the pH of the solution with maize was declined from day 13 after treatment. Growing soybean increased solution pH irrespective of P supply. Under P deficiency, the proton efflux of faba bean both total (315.25 nmol h{sup -1} plant{sup -1}) and specific proton efflux (0.47 nmol h{sup -1} cm{sup -1}) was greater than that those of soybean (21.80 nmol h{sup -1} plant{sup -1} and 0.05 nmol h{sup -1} cm{sup -1}, respectively). Faba bean had much more ability of rhizosphere acidification than soybean and maize. The result can explain partly why faba bean utilizes sparingly soluble P more effectively than soybean and maize do, and has an important implication in understanding the mechanism behind interspecific facilitation on P uptake by intercropped species.

  3. NetBeans IDE 8 cookbook

    CERN Document Server

    Salter, David

    2014-01-01

    If you're a Java developer of any level using NetBeans and want to learn how to get the most out of NetBeans, then this book is for you. Learning how to utilize NetBeans will provide a firm foundation for your Java application development.

  4. Chlorotic mottle of bean (Phaseolus vulgaris L.)

    NARCIS (Netherlands)

    Jayasinghe, W.U.

    1982-01-01

    For the past years there have been outbreaks of a disease of bean ( Phaseolus vulgaris L.) in Colombia called bean chlorotic mottle. The etiology of bean chlorotic mottle was not known, but the disease was generally believed to be incited by the same whitefly-transmitted virus that causes variegatio

  5. TaqMan real-time PCR assays to assess arbuscular mycorrhizal responses to field manipulation of grassland biodiversity: effects of soil characteristics, plant species richness, and functional traits.

    Science.gov (United States)

    König, Stephan; Wubet, Tesfaye; Dormann, Carsten F; Hempel, Stefan; Renker, Carsten; Buscot, François

    2010-06-01

    Large-scale (temporal and/or spatial) molecular investigations of the diversity and distribution of arbuscular mycorrhizal fungi (AMF) require considerable sampling efforts and high-throughput analysis. To facilitate such efforts, we have developed a TaqMan real-time PCR assay to detect and identify AMF in environmental samples. First, we screened the diversity in clone libraries, generated by nested PCR, of the nuclear ribosomal DNA internal transcribed spacer (ITS) of AMF in environmental samples. We then generated probes and forward primers based on the detected sequences, enabling AMF sequence type-specific detection in TaqMan multiplex real-time PCR assays. In comparisons to conventional clone library screening and Sanger sequencing, the TaqMan assay approach provided similar accuracy but higher sensitivity with cost and time savings. The TaqMan assays were applied to analyze the AMF community composition within plots of a large-scale plant biodiversity manipulation experiment, the Jena Experiment, primarily designed to investigate the interactive effects of plant biodiversity on element cycling and trophic interactions. The results show that environmental variables hierarchically shape AMF communities and that the sequence type spectrum is strongly affected by previous land use and disturbance, which appears to favor disturbance-tolerant members of the genus Glomus. The AMF species richness of disturbance-associated communities can be largely explained by richness of plant species and plant functional groups, while plant productivity and soil parameters appear to have only weak effects on the AMF community.

  6. Arbuscular mycorrhizal fungi alter above- and below-ground chemical defense expression differentially among Asclepias species

    Directory of Open Access Journals (Sweden)

    Rachel L Vannette

    2013-09-01

    Full Text Available Belowground symbionts of plants can have substantial influence on plant growth and nutrition. Recent work demonstrates that mycorrhizal fungi can affect plant resistance to herbivory and the performance of above and belowground herbivores. Although these examples emerge from diverse systems, it is unclear if plant species that express similar defensive traits respond similarly to fungal colonization, but comparative work may inform this question. To examine the effects of arbuscular mycorrhizal fungi (AMF on the expression of chemical resistance, we inoculated 8 species of Asclepias (milkweed--which all produce toxic cardenolides--with a community of AMF. We quantified plant biomass, foliar and root cardenolide concentration and composition, and assessed evidence for a growth-defense tradeoff in the presence and absence of AMF. As expected, total foliar and root cardenolide concentration varied among milkweed species. Importantly, the effect of mycorrhizal fungi on total foliar cardenolide concentration also varied among milkweed species, with foliar cardenolides increasing or decreasing, depending on the plant species. We detected a phylogenetic signal to this variation; AMF fungi reduced foliar cardenolide concentrations to a greater extent in the clade including A. curassavica than in the clade including A. syriaca. Moreover, AMF inoculation shifted the composition of cardenolides in above- and below-ground plant tissues in a species-specific fashion. Mycorrhizal inoculation changed the relative distribution of cardenolides between root and shoot tissue in a species-specific fashion, but did not affect cardenolide diversity or polarity. Finally, a tradeoff between plant growth and defense in non-mycorrhizal plants was mitigated completely by AMF inoculation. Overall, we conclude that the effects of AMF inoculation on the expression of chemical resistance can vary among congeneric plant species, and ameliorate tradeoffs between growth and

  7. Advances in faba bean genetics and genomics

    Directory of Open Access Journals (Sweden)

    Donal Martin O'Sullivan

    2016-08-01

    Full Text Available Vicia faba L, is a globally important grain legume whose main centres of diversity are the Fertile Crescent and Mediterranean basin. Because of its small number (six of exceptionally large and easily observed chromosomes it became a model species for plant cytogenetics the 70s and 80s. It is somewhat ironic therefore, that the emergence of more genomically tractable model plant species such as Arabidopsis and Medicago coincided with a marked decline in genome research on the formerly favoured plant cytogenetic model. Thus, as ever higher density molecular marker coverage and dense genetic and even complete genome sequence maps of key crop and model species emerged through the 1990s and early 2000s, genetic and genome knowledge of Vicia faba lagged far behind other grain legumes such as soybean, common bean and pea.However, cheap sequencing technologies have stimulated the production of deep transcriptome coverage from several tissue types and numerous distinct cultivars in recent years. This has permitted the reconstruction of the faba bean meta-transcriptome and has fuelled development of extensive sets of Simple Sequence Repeat and Single Nucleotide Polymorphism (SNP markers. Genetics of faba bean stretches back to the 1930s, but it was not until 1993 that DNA markers were used to construct genetic maps. A series of Random Amplified Polymorphic DNA-based genetic studies mainly targeted at quantitative loci underlying resistance to a series of biotic and abiotic stresses were conducted during the 1990’s and early 2000s. More recently, SNP-based genetic maps have permitted chromosome intervals of interest to be aligned to collinear segments of sequenced legume genomes such as the model legume Medicago truncatula, which in turn opens up the possibility for hypotheses on gene content, order and function to be translated from model to crop. Some examples of where knowledge of gene content and function have already been productively exploited are

  8. Weed Interference Affects Dry Bean Yield and Growth

    Directory of Open Access Journals (Sweden)

    Hossein GHAMARI

    2012-08-01

    Full Text Available Dry bean is one of the most important pulse crops in Iran. Field study was conducted in 2011 to evaluate effects of weed competition from a natural flora on growth and yield of dry bean (Phaseolus vulgaris L.. The treatments consisted of weed infestation and weed removal periods (10, 20, 30, 40 and 50 days after crop emergence. Control plots kept weed-infested and weed-free throughout growing season. To assess the weed competition effect on crop characteristics, Richards, Gompertz and logistic equations were fitted to the data. The most abundant weed species were Chenopodium album and Amaranthus retroflexus. Increase in duration of weed interference decreased the stem height of dry bean. At the end of the growing season, dry bean was 20 cm taller in season-long weed-free treatment compared to the season-long weed-infested treatment. As the number of days of weed interference increased, a declining trend of LAI and number of pods was observed. The minimum number of pods was obtained in season-long weed-infested treatment (5.01 pods/plant. Weed interference during the whole growing season, caused a 60% reduction in yield. Considering 5% and 10% acceptable yield lost, the critical period of weed competition was determined from 20 to 68 and 23 to 55 days after planting (DAE, respectively.

  9. Allelopathic potential of a noxious weed on mung bean

    Directory of Open Access Journals (Sweden)

    Parthapratim Maiti

    2013-10-01

    Full Text Available Eupatorium odoratum have invaded the waste lands of South West Bengal, India. A field study indicated a gradual and also significant increase in Eupatorium odoratum accompanied with significant decrease in other coexisting species. Considering the above in mind, a study was undertaken to evaluate the existence of inhibitory effect of leaf extracts and leaf leachates noxious weed Eupatorium odoratum using fully viable seeds of mung bean (Vigna radiata as the bioassay material. The study showed the reduced the percentage germination and TTC stainability along with extended T50 values of mung bean seeds. The levels of protein, DNA and RNA, activities of dehydrogenase and catalase enzymes were significantly retarded in pretreated seed samples. Amino acid and sugar levels were increased in the leachates of seeds pretreated with leaf extracts and leaf leachates. Thus, from the overall results it can be concluded that various inhibitors present in E. odoratum can impart strong inhibitory effect on mung bean. The study suggests that the leaves of E. odoratum possess phytotoxic or allelopathic chemicals which potentially rendered the inhibitory action on mung bean seeds.

  10. Angus McBean - Portraits

    NARCIS (Netherlands)

    Pepper, T.

    2007-01-01

    Angus McBean (1904-90) was one of the most extraordinary British photographers of the twentieth century. In a career that spanned the start of the Second World War through the birth of the 'Swinging Sixties' to the 1980s, he became the most prominent theatre photographer of his generation and, along

  11. THE OCCURRENCE OF INSECTS AND MOULDS IN STORED COCOA BEANS AT SOUTH SULAWESI

    Directory of Open Access Journals (Sweden)

    OKKY S. DHARMAPUTRA

    1999-01-01

    Full Text Available Surveys on postharvest handling and technology processing of cocoa beans at farmer, trader and exporter levels in South Sulawesi were conducted together with investigations on moisture content, pest infestation (insect and mould and quality characteris tics in terms of reducing sugar, free amino acid and free fatty acid content. Surveys were conducted during dry (July 1997 and wet seasons (February 1998 in three regencies (Pinrang, Polewali-Mamasa and Luwu and Ujung Pandang, South Sulawesi province. Interviews were carried out during surveys in the dry season. Number of respondents from farmers, trailers and exporters was 38, 15 and 5, respectively. In each season, number of samples taken from farmers, traders and exporters was 9, 21 and 15, respectively. In general, farmers, traders and exporters did not carry out postharvest handling and technology processing properly. Moisture content of cocoa beans collected from farmers, traders and exporters were higher than the tolerabl e limit recommended by SNI (7.5%. Moisture content of cocoa beans collected during the wet season was higher than in the dry season. Insects were found on cocoa beans collected from traders and exporters. Species composition and the presence of each insect species were varied among the two seasons, but the predominant species was Tribolium castaneum. At trader level the percentage of insect-damaged beans during the wet season was higher than that during the dry season, while at exporter le vel it was lower. During the two seasons the percentage of mouldy beans at farmer level was lower than the tolerable limit recommended by SNI (4%, while those from some samples at trader and exporter levels were higher than 4%, but based on the direct plating method, all of the samples at trader and exporter levels were mouldy. Species composition and the percentage of beans infected by each mould species at farmer, trader and exporter levels during the two seasons were va ried. The

  12. Protein Quality of Irradiated Brazilian Beans

    Energy Technology Data Exchange (ETDEWEB)

    Delincee, Henry; Villavicencio, Anna-Lucia C.H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macacar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein ({approx}10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfestation process, without impairing the biological quality of the valuable bean protein.

  13. Protein Quality of Irradiated Brazilian Beans

    Science.gov (United States)

    Delincée, Henry; Villavicencio, Anna-Lucia C. H.; Mancini-Filho, Jorge

    1998-06-01

    Beans are a major source of dietary protein in Brazil. However, high losses due to insect infestation occur after each harvest. To combat these losses, radiation processing of beans offers promise as an alternative to chemical treatment, provided the nutritional quality of beans is not impaired by the radiation treatment. Conflicting results have been published about the effect of radiation on the biological value of legume proteins. Therefore, two varieties of Brazilian beans were studied: 1) Phaseolus vulgaris L., var. carioca and 2) Vigna unguiculata (L.) Walp, var. macaçar. The beans were irradiated with doses of 0, 0.5, 1.0, 2.5, 5.0 and 10 kGy. Since irradiated beans will be consumed after appropriate storage, the beans under study were stored for 6 months at ambient temperature. Protein quality was measured by a biological assay employing the nitrogen balance approach in weanling rats. The animals were fed with optimally cooked beans, which were the only source of protein (˜10%). Nitrogen contents of legumes, diets, animal urine and faeces were determined by Kjeldahl analysis. The indices for apparent protein quality: net protein utilisation, digestibility and biological value were not influenced by irradiation. Thus, radiation treatment of Brazilian beans offers considerable promise as an effective insect disinfection process, without impairing the biological quality of the valuable bean protein.

  14. The content of polyphenolic compounds in cocoa beans (Theobroma cacao L.), depending on variety, growing region, and processing operations: a review.

    Science.gov (United States)

    Oracz, Joanna; Zyzelewicz, Dorota; Nebesny, Ewa

    2015-01-01

    Polyphenols form the largest group of compounds among natural antioxidants, which largely affect the overall antioxidant and anti-free radical activity of cocoa beans. The qualitative and quantitative composition of individual fractions of polyphenolic compounds, even within one species, is very diverse and depends on many factors, mainly on the area of cocoa trees cultivation, bean maturity, climatic conditions during growth, and the harvest season and storage time after harvest. Thermal processing of cocoa beans and cocoa derivative products at relatively high temperatures may in addition to favorable physicochemical, microbiological, and organoleptic changes result in a decrease of polyphenols concentration. Technological processing of cocoa beans negatively affects the content of polyphenolic compounds.

  15. Development of a quantitative PCR assay for rapid detection of Lactobacillus plantarum and Lactobacillus fermentum in cocoa bean fermentation.

    Science.gov (United States)

    Schwendimann, Livia; Kauf, Peter; Fieseler, Lars; Gantenbein-Demarchi, Corinne; Miescher Schwenninger, Susanne

    2015-08-01

    To monitor dominant species of lactic acid bacteria during cocoa bean fermentation, i.e. Lactobacillus plantarum and Lactobacillus fermentum, a fast and reliable culture-independent qPCR assay was developed. A modified DNA isolation procedure using a commercial kit followed by two species-specific qPCR assays resulted in 100% sensitivity for L. plantarum and L. fermentum. Kruskal-Wallis and post-hoc analyses of data obtained from experiments with cocoa beans that were artificially spiked with decimal concentrations of L. plantarum and L. fermentum strains allowed the calculation of a regression line suitable for the estimation of both species with a detection limit of 3 to 4 Log cells/g cocoa beans. This process was successfully tested for efficacy through the analyses of samples from laboratory-scale cocoa bean fermentations with both the qPCR assay and a culture-dependent method which resulted in comparable results.

  16. Species richness and spore abundance of arbuscular mycorrhizal fungi across distinct land uses in western Brazilian Amazon.

    Science.gov (United States)

    Stürmer, Sidney Luiz; Siqueira, José Oswaldo

    2011-05-01

    Arbuscular mycorrhizal fungi (AMF) were surveyed for species richness and abundance in sporulation in six distinct land uses in the western Amazon region of Brazil. Areas included mature pristine forest and sites converted to pasture, crops, agroforestry, young and old secondary forest. A total of 61 AMF morphotypes were recovered and 30% of them could not be identified to known species. Fungal communities were dominated by Glomus species but Acaulospora species produced the most abundant sporulation. Acaulospora gedanensis cf., Acaulospora foveata, Acaulospora spinosa, Acaulospora tuberculata, Glomus corymbiforme, Glomus sp15, Scutellospora pellucida, and Archaeospora trappei sporulated in all land use areas. Total spore numbers were highly variable among land uses. Mean species richness in crop, agroforestry, young and old secondary forest sites was twice that in pristine forest and pasture. fungal communities were dominated in all land use areas except young secondary forest by two or three species which accounted for 48% to 63% of all sporulation. Land uses influenced AMF community in (1) frequency of occurrence of sporulating AMF species, (2) mean species diversity, and (3) relative spore abundance. Conversion of pristine forest into distinct land uses does not appear to reduce AMF diversity. Cultural practices adopted in this region maintain a high diversity of arbuscular mycorrhizal fungi.

  17. Reflective Polyethylene Mulch Reduces Mexican Bean Beetle (Coleoptera: Coccinellidae) Densities and Damage in Snap Beans.

    Science.gov (United States)

    Nottingham, L B; Kuhar, T P

    2016-08-01

    Mexican bean beetle, Epilachna varivestis Mulsant, is a serious pest of snap beans, Phaseolus vulgaris L., in the eastern United States. These beetles are intolerant to direct sunlight, explaining why individuals are typically found on the undersides of leaves and in the lower portion of the plant canopy. We hypothesized that snap beans grown on reflective, agricultural polyethylene (plastic mulch) would have fewer Mexican bean beetles and less injury than those grown on black plastic or bare soil. In 2014 and 2015, beans were seeded into beds of metallized, white, and black plastic, and bare soil, in field plots near Blacksburg, VA. Mexican bean beetle density, feeding injury, predatory arthropods, and snap bean yield were sampled. Reflected light intensity, temperature, and humidity were monitored using data loggers. Pyranometer readings showed that reflected light intensity was highest over metallized plastic and second highest over white plastic; black plastic and bare soil were similarly low. Temperature and humidity were unaffected by treatments. Significant reductions in Mexican bean beetle densities and feeding injury were observed in both metallized and white plastic plots compared to black plastic and bare soil, with metallized plastic having the fewest Mexican bean beetle life stages and injury. Predatory arthropod densities were not reduced by reflective plastic. Metallized plots produced the highest yields, followed by white. The results of this study suggest that growing snap beans on reflective plastic mulch can suppress the incidence and damage of Mexican bean beetle, and increase yield in snap beans.

  18. Kinetics model development of cocoa bean fermentation

    Science.gov (United States)

    Kresnowati, M. T. A. P.; Gunawan, Agus Yodi; Muliyadini, Winny

    2015-12-01

    Although Indonesia is one of the biggest cocoa beans producers in the world, Indonesian cocoa beans are oftenly of low quality and thereby frequently priced low in the world market. In order to improve the quality, adequate post-harvest cocoa processing techniques are required. Fermentation is the vital stage in series of cocoa beans post harvest processing which could improve the quality of cocoa beans, in particular taste, aroma, and colours. During the fermentation process, combination of microbes grow producing metabolites that serve as the precursors for cocoa beans flavour. Microbial composition and thereby their activities will affect the fermentation performance and influence the properties of cocoa beans. The correlation could be reviewed using a kinetic model that includes unstructured microbial growth, substrate utilization and metabolic product formation. The developed kinetic model could be further used to design cocoa bean fermentation process to meet the expected quality. Further the development of kinetic model of cocoa bean fermentation also serve as a good case study of mixed culture solid state fermentation, that has rarely been studied. This paper presents the development of a kinetic model for solid-state cocoa beans fermentation using an empirical approach. Series of lab scale cocoa bean fermentations, either natural fermentations without starter addition or fermentations with mixed yeast and lactic acid bacteria starter addition, were used for model parameters estimation. The results showed that cocoa beans fermentation can be modelled mathematically and the best model included substrate utilization, microbial growth, metabolites production and its transport. Although the developed model still can not explain the dynamics in microbial population, this model can sufficiently explained the observed changes in sugar concentration as well as metabolic products in the cocoa bean pulp.

  19. Transaction costs in beans market in Brazil

    Directory of Open Access Journals (Sweden)

    Paulo Eterno Venâncio Assunção

    2015-05-01

    Full Text Available This paper aimed to evaluate the presence of transaction costs in the beans market in Brazil. Therefore, threshold autoregressive (TAR models were used to check co-integration and the existence of transaction costs in the Brazilian beans market. The results confirmed the presence of transaction costs in the beans market, which are mainly related to the freight component of production, since the markets are often far away from the producing regions.

  20. Two Newly Described Begomoviruses of Macroptilium lathyroides and Common Bean.

    Science.gov (United States)

    Idris, A M; Hiebert, E; Bird, J; Brown, J K

    2003-07-01

    ABSTRACT Macroptilium lathyroides, a perennial weed in the Caribbean region and Central America, is a host of Macroptilium yellow mosaic Florida virus (MaYMFV) and Macroptilium mosaic Puerto Rico virus (MaMPRV). The genomes of MaYMFV and MaMPRV were cloned from M. lathyroides and/or field-infected bean and the DNA sequences were determined. Cloned A and B components for both viruses were infectious when inoculated to M. lathyroides and common bean. Comparison of the DNA sequences for cloned A and B components with well-studied begomovirus indicated that MaMPRV (bean and M. lathyroides) and MaYMFV (M. lathyroides) are unique, previously undescribed begomo-viruses from the Western Hemisphere. Phylogenetic analysis of viral A components indicated that the closest relative of MaYMFV are members of the Bean golden yellow mosaic virus (BGYMV) group, at 76 to 78% nucleotide identity, whereas the closest relative for the A component of MaMPRV was Rhynchosia golden mosaic virus at 78% nucleotide identity. In contrast, BGYMV is the closest relative for the B component of both MaYMFV and MaMPRV, with which they share approximately 68.0 and approximately 72% identity, respectively. The incongruent taxonomic placement for the bipartite components for MaMPRV indicates that they did not evolve entirely along a common path. MaYMFV and MaMPRV caused distinctive symptoms in bean and M. lathyroides and were transmissible by the whitefly vector and by grafting; however, only MaYMFV was mechanically transmissible. The experimental host range for the two viruses was similar and included species within the families Fabaceae and Malvaceae, but only MaYMFV infected Malva parviflora and soybean. These results collectively indicate that MaMPRV and MaYMFV are new, previously undescribed species of the BGYMV group, a clade previously known to contain only strains and isolates of BGYMV from the Caribbean region that infect Phaseolus spp. Both MaYMFV and MaMPRV may pose an economic threat to

  1. Yeast diversity of Ghanaian cocoa bean heap fermentations.

    Science.gov (United States)

    Daniel, Heide-Marie; Vrancken, Gino; Takrama, Jemmy F; Camu, Nicholas; De Vos, Paul; De Vuyst, Luc

    2009-08-01

    The fermentation of the Theobroma cacao beans, involving yeasts, lactic acid bacteria, and acetic acid bacteria, has a major influence on the quality of the resulting cocoa. An assessment of the microbial community of cocoa bean heap fermentations in Ghana resulted in 91 yeast isolates. These were grouped by PCR-fingerprinting with the primer M13. Representative isolates were identified using the D1/D2 region of the large subunit rRNA gene, internal transcribed spacer sequences and partial actin gene sequences leading to the detection of 15 species. Properties of importance for cocoa bean fermentation, namely sucrose, glucose, and citrate assimilation capacity, pH-, ethanol-, and heat-tolerance, were examined for selected isolates. Pichia kudriavzevii (Issatchenkia orientalis), Saccharomyces cerevisiae, and Hanseniaspora opuntiae formed the major components of the yeast community. Hanseniaspora opuntiae was identified conclusively for the first time from cocoa fermentations. Among the less frequently encountered species, Candida carpophila, Candida orthopsilosis, Kodamaea ohmeri, Meyerozyma (Pichia) caribbica, Pichia manshurica, Saccharomycodes ludwigii, and Yamadazyma (Pichia) mexicana were not yet documented from this substrate. Hanseniaspora opuntiae was preferably growing during the earlier phase of fermentation, reflecting its tolerance to low pH and its citrate-negative phenotype, while no specific temporal distribution was recognized for P. kudriavzevii and S. cerevisiae.

  2. Interference of redroot pigweed (Amaranthus retroflexus L.) in green bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Mirshekari, B; Dabbagh Mohammadi Nasab, A; Biroonara, A

    2006-01-01

    Several species of Amaranthus are known to reduce crop yields and interference with harvest throughout the Iran. In the past few years, the occurrence of some Amaranthus species including of redroot pigweed (Amaranthus retroflexus L.) increased throughout the East Azerbaijan province in Iran, supplanting all the other Amaranthus species in large areas of the region and causing concern among farmers and researchers. Green bean (Phaseolus vulgaris L.) is one of the tropical pulse crops, that C4 weeds such as redroot pigweed can cause yield loss in this crop production. In order to determine the critical period of redroot pigweed control in green bean, two experiments were conducted in Islamic Azad University of Tabriz, Iran, at 2004 and 2005. The experimental designs in both year was a randomized complete blocks with three replications. The treatments were weed-infested and weed-free in the same periods. Both year, in weed-infested experiment, redroot pigweed was seeded immediately after green bean planting and removed after 0, 2, 4, 6, 8, 10 and 14 weeks after green bean emergence (WAE). In weed-free experiment, redroot pigweed seeds were transplanted to green bean plots at 0, 2, 4, 6, 8, 10 and 14 WAE. Data were analyzed using the MSTATC software and means were compared using Duncan's Multiple Ranges Test. Regression analysis was performed to describe the relationship between green bean yield and duration of redroot pigweed interference using the REG PROCEDURE of SAS. Results indicated that the difference between years with a view to influence on all traits except stem height at the harvesting stage and pod yield at the first and second harvesting time were significant. Also, differences between treatments with a view to influence on all traits were significant. Contemporary growing of pigweed and green bean for early first month and weed interference 10 WAE had not significant effect on green bean above ground biomass. In both years, the highest green bean yield

  3. Drought tolerance in wild plant populations: the case of common beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Cortés, Andrés J; Monserrate, Fredy A; Ramírez-Villegas, Julián; Madriñán, Santiago; Blair, Matthew W

    2013-01-01

    Reliable estimations of drought tolerance in wild plant populations have proved to be challenging and more accessible alternatives are desirable. With that in mind, an ecological diversity study was conducted based on the geographical origin of 104 wild common bean accessions to estimate drought tolerance in their natural habitats. Our wild population sample covered a range of mesic to very dry habitats from Mexico to Argentina. Two potential evapotranspiration models that considered the effects of temperature and radiation were coupled with the precipitation regimes of the last fifty years for each collection site based on geographical information system analysis. We found that wild accessions were distributed among different precipitation regimes following a latitudinal gradient and that habitat ecological diversity of the collection sites was associated with natural sub-populations. We also detected a broader geographic distribution of wild beans across ecologies compared to cultivated common beans in a reference collection of 297 cultivars. Habitat drought stress index based on the Thornthwaite potential evapotranspiration model was equivalent to the Hamon estimator. Both ecological drought stress indexes would be useful together with population structure for the genealogical analysis of gene families in common bean, for genome-wide genetic-environmental associations, and for postulating the evolutionary history and diversification processes that have occurred for the species. Finally, we propose that wild common bean should be taken into account to exploit variation for drought tolerance in cultivated common bean which is generally considered susceptible as a crop to drought stress.

  4. Drought tolerance in wild plant populations: the case of common beans (Phaseolus vulgaris L..

    Directory of Open Access Journals (Sweden)

    Andrés J Cortés

    Full Text Available Reliable estimations of drought tolerance in wild plant populations have proved to be challenging and more accessible alternatives are desirable. With that in mind, an ecological diversity study was conducted based on the geographical origin of 104 wild common bean accessions to estimate drought tolerance in their natural habitats. Our wild population sample covered a range of mesic to very dry habitats from Mexico to Argentina. Two potential evapotranspiration models that considered the effects of temperature and radiation were coupled with the precipitation regimes of the last fifty years for each collection site based on geographical information system analysis. We found that wild accessions were distributed among different precipitation regimes following a latitudinal gradient and that habitat ecological diversity of the collection sites was associated with natural sub-populations. We also detected a broader geographic distribution of wild beans across ecologies compared to cultivated common beans in a reference collection of 297 cultivars. Habitat drought stress index based on the Thornthwaite potential evapotranspiration model was equivalent to the Hamon estimator. Both ecological drought stress indexes would be useful together with population structure for the genealogical analysis of gene families in common bean, for genome-wide genetic-environmental associations, and for postulating the evolutionary history and diversification processes that have occurred for the species. Finally, we propose that wild common bean should be taken into account to exploit variation for drought tolerance in cultivated common bean which is generally considered susceptible as a crop to drought stress.

  5. Identification of 14-3-3 Family in Common Bean and Their Response to Abiotic Stress.

    Directory of Open Access Journals (Sweden)

    Ruihua Li

    Full Text Available 14-3-3s are a class of conserved regulatory proteins ubiquitously found in eukaryotes, which play important roles in a variety of cellular processes including response to diverse stresses. Although much has been learned about 14-3-3s in several plant species, it remains unknown in common bean. In this study, 9 common bean 14-3-3s (PvGF14s were identified by exhaustive data mining against the publicly available common bean genomic database. A phylogenetic analysis revealed that each predicted PvGF14 was clustered with two GmSGF14 paralogs from soybean. Both epsilon-like and non-epsilon classes of PvGF14s were found in common bean, and the PvGF14s belonging to each class exhibited similar gene structure. Among 9 PvGF14s, only 8 are transcribed in common bean. Expression patterns of PvGF14s varied depending on tissue type, developmental stage and exposure of plants to stress. A protein-protein interaction study revealed that PvGF14a forms dimer with itself and with other PvGF14 isoforms. This study provides a first comprehensive look at common bean 14-3-3 proteins, a family of proteins with diverse functions in many cellular processes, especially in response to stresses.

  6. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus.

    Science.gov (United States)

    Pinheiro, Patrícia V; Quintela, Eliane D; Junqueira, Ana Maria R; Aragão, Francisco J L; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) by expressing a mutated REP protein, which is essential for virus replication. Biosafety studies were performed for a period of three years under field conditions. The abundance of some species was significantly higher in specific treatments in a particular year, but not consistently different in other years. A regular pattern was not observed in the distribution of insects between genetically modified and conventional treatments. Data analyses showed that minor differences observed can be attributed to random variation and were not consistent enough to conclude that the treatments were different. Therefore the present study indicates that the relative abundance of species are similar in transgenic and non-transgenic fields.

  7. Integrating and Processing XML Documents with JavaBeans Components

    Directory of Open Access Journals (Sweden)

    Yin-Wah Chiou

    2003-02-01

    Full Text Available The eXtensible Markup Language (XML and JavaBeans component model have gained wide popularity in the Object Web computing. This paper explores how JavaBeans components can be used to integrate and process the XML documents. It covers Bean Markup Language (BML, XML BeanMaker, XML Bean Suite, and Xbeans. The most powerful JavaBeans connection language is BML, which represents an integration of XML and JavaBeans components to provide a mechanism for implementing active content. XML BeanMaker is used to generate JavaBeans from XML DTD files. XML Bean Suite is a toolkit of JavaBeans components to provide a comprehensive set of functionality to manipulate XML content. The Xbean is a powerful paradigm to process XML-based distributed applications.

  8. Analysis of simple sequence repeats in rice bean (Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; SukHa Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    rice bean and other Vigna species.

  9. Analysis of simple sequence repeats in rice bean (Vigna umbellata using an SSR-enriched library

    Directory of Open Access Journals (Sweden)

    Lixia Wang

    2016-02-01

    -assisted selection in rice bean and other Vigna species.

  10. Mung Bean: Technological and Nutritional Potential

    NARCIS (Netherlands)

    Dahiya, P.K.; Linnemann, A.R.; Boekel, van M.A.J.S.; Khetarpaul, N.; Grewal, R.B.; Nout, M.J.R.

    2015-01-01

    Mung bean (Vigna radiata (L.) R.Wilczek) has been intensively researched; scattered data are available on various properties. Data on physical, chemical, food processing, and nutritional properties were collected for whole mung bean grains and reviewed to assess the crop’s potential as food and to s

  11. Weed management strategies for castor bean crops

    Directory of Open Access Journals (Sweden)

    Augusto Guerreiro Fontoura Costa

    2014-04-01

    Full Text Available Castor bean crops are agriculturally relevant due to the quality and versatility of their oil, both for the chemical industry and for biodiesel production. Proper weed management is important for both the cultivation and the yield of castor bean crops; therefore, the intention of the present work is to review pertinent information regarding weed management, including the studies regarding weed interference periods, chemical controls for use in different crop production systems and herbicide selectivity, for castor bean crops. Weed science research for castor bean crops is scarce. One of the main weed management challenges for castor bean crops is the absence of herbicides registered with the Ministry of Agriculture, Livestock and Food Supply (MALFS. Research for viable herbicides for weed control in castor bean crops should be directed by research and/or rural extension institutions, associations and farmers cooperatives, as well as by manufactures, for the registration of these selective herbicides, which would be primarily used to control eudicotyledons in castor bean crops. New studies involving the integration of weed control methods in castor bean also may increase the efficiency of weed management, for both small farmers using traditional crop methods in the Brazilian Northeast region, as well as for areas with the potential for large scale production, using conservation tillage systems, such as the no-tillage crop production system.

  12. Registration of ‘Samurai’ Otebo Bean

    Science.gov (United States)

    ‘Samurai’ otebo bean (Phaseolus vulgaris L.) (Reg. no. CV- , PI ), developed by Michigan State University AgBioResearch was released in 2015 as an upright, full-season cultivar with virus [caused by Bean common mosaic virus (BCMV)] resistance and high-yield potential. Samurai was developed using ped...

  13. Nutritional and health benefits of dried beans.

    Science.gov (United States)

    Messina, Virginia

    2014-07-01

    Dried beans (often referred to as grain legumes) may contribute to some of the health benefits associated with plant-based diets. Beans are rich in a number of important micronutrients, including potassium, magnesium, folate, iron, and zinc, and are important sources of protein in vegetarian diets. In particular, they are among the only plant foods that provide significant amounts of the indispensable amino acid lysine. Commonly consumed dried beans are also rich in total and soluble fiber as well as in resistant starch, all of which contribute to the low glycemic index of these foods. They also provide ample amounts of polyphenols, many of which are potent antioxidants. Intervention and prospective research suggests that diets that include beans reduce low-density lipoprotein cholesterol, favorably affect risk factors for metabolic syndrome, and reduce risk of ischemic heart disease and diabetes. The relatively low bean intakes of North Americans and northern Europeans can be attributed to a negative culinary image as well as to intestinal discomfort attributable to the oligosaccharide content of beans. Cooking practices such as sprouting beans, soaking and discarding soaking water before cooking, and cooking in water with a more alkaline pH can reduce oligosaccharide content. Promotional efforts are needed to increase bean intake.

  14. Performance of the Bean-protein Fiber

    Institute of Scientific and Technical Information of China (English)

    韩光亭; 杜宁; 孙亚宁

    2003-01-01

    The methods in testing the bean-protein fiber and the standards used were simply introduced. The fiber's mechanical and chemical performances were further analyzed. And the correlative performance of the bean-protein fibers and other natural fibers have been compared, then full knowledge of the fiber's performance was concluded.

  15. Characterization of non-host resistance in broad bean to the wheat stripe rust pathogen

    Directory of Open Access Journals (Sweden)

    Cheng Yulin

    2012-06-01

    Full Text Available Abstract Background Non-host resistance (NHR confers plant species immunity against the majority of microbial pathogens and represents the most robust and durable form of plant resistance in nature. As one of the main genera of rust fungi with economic and biological importance, Puccinia infects almost all cereals but is unable to cause diseases on legumes. Little is known about the mechanism of this kind of effective defense in legumes to these non-host pathogens. Results In this study, the basis of NHR in broad bean (Vicia faba L. against the wheat stripe rust pathogen, Puccinia striiformis f. sp. tritici (Pst, was characterized. No visible symptoms were observed on broad bean leaves inoculated with Pst. Microscopic observations showed that successful location of stomata and haustoria formation were significantly reduced in Pst infection of broad bean. Attempted infection induced the formation of papillae, cell wall thickening, production of reactive oxygen species, callose deposition and accumulation of phenolic compounds in plant cell walls. The few Pst haustoria that did form in broad bean cells were encased in reactive oxygen and callose materials and those cells elicited cell death. Furthermore, a total of seven defense-related genes were identified and found to be up-regulated during the Pst infection. Conclusions The results indicate that NHR in broad bean against Pst results from a continuum of layered defenses, including basic incompatibility, structural and chemical strengthening of cell wall, posthaustorial hypersensitive response and induction of several defense-related genes, demonstrating the multi-layered feature of NHR. This work also provides useful information for further determination of resistance mechanisms in broad bean to rust fungi, especially the adapted important broad bean rust pathogen, Uromyces viciae-fabae, because of strong similarity and association between NHR of plants to unadapted pathogens and basal

  16. Improvement in bioavailability of tricalcium phosphate to Cymbopogon martinii var. motia by rhizobacteria, AMF and Azospirillum inoculation.

    Science.gov (United States)

    Ratti, N; Kumar, S; Verma, H N; Gautam, S P

    2001-01-01

    The interactive effects of phosphate solubilizing bacteria, N2 fixing bacteria and arbuscular mycorrhizal fungi (AMF) were studied in a low phosphate alkaline soil amended with tricalcium insoluble source of inorganic phosphate on the growth of an aromatic grass palmarosa (Cymbopogon martinii). The microbial inocula consisted of the AM fungus Glomus aggregatum, phosphate solubilizing rhizobacteria Bacillus polymyxa and N2 fixing bacteria Azospirillum brasilense. These rhizobacteria behaved as "mycorrhiza helper" and enhanced root colonization by G. aggregatum in presence of tricalcium phosphate at the rate of 200 mg kg(-1) soil (P1 level). Dual inoculation of G. aggregatum and B. polymyxa yielded 21.5 g plant dry weight (biomass), while it was 21.7 g in B. polymyxa and A. brasilense inoculated plants as compared to 14.9 g of control at the same level. Phosphate content was maximum (0.167%) in the combined treatment of G. aggregatum, B. polymyxa and A. brasilense at P1 level, however acid phosphatase activity was recorded to be 4.75 pmol mg(-1) min(-1) in G. aggregatum, B. polymyxa and A. brasilense treatment at P0 level. This study indicates that all microbes inoculated together help in the uptake of tricalcium phosphate which is otherwise not used by the plants and their addition at 200 mg kg(-1) of soil gave higher productivity to palmarosa plants.

  17. Enterprise JavaBeans 31

    CERN Document Server

    Rubinger, Andrew

    2010-01-01

    Learn how to code, package, deploy, and test functional Enterprise JavaBeans with the latest edition of this bestselling guide. Written by the developers of JBoss EJB 3.1, this book not only brings you up to speed on each component type and container service in this implementation, it also provides a workbook with several hands-on examples to help you gain immediate experience with these components. With version 3.1, EJB's server-side component model for building distributed business applications is simpler than ever. But it's still a complex technology that requires study and lots of practi

  18. 21 CFR 184.1343 - Locust (carob) bean gum.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Locust (carob) bean gum. 184.1343 Section 184.1343... Listing of Specific Substances Affirmed as GRAS § 184.1343 Locust (carob) bean gum. (a) Locust (carob) bean gum is primarily the macerated endosperm of the seed of the locust (carob) bean tree,...

  19. Key odorants in cured Madagascar vanilla beans (Vanilla planiforia) of differing bean quality.

    Science.gov (United States)

    Takahashi, Makoto; Inai, Yoko; Miyazawa, Norio; Kurobayashi, Yoshiko; Fujita, Akira

    2013-01-01

    The odor-active volatiles in Madagascar vanilla beans (Vanilla planiforia) of two grades, red whole beans as standard quality and cuts beans as substandard quality, were characterized by instrumental and sensory analyses. The higher contents of vanillin and β-damascenone in red whole beans than in cuts beans respectively contributed to significant differences in the sweet and dried fruit-like notes, while the higher contents of guaiacol and 3-phenylpropanoic acid in cuts beans than in red whole beans respectively contributed to significant differences in the phenolic and metallic notes. A sensory evaluation to compare red whole beans and their reconstituted aroma characterized both samples as being similar, while in respect of the phenolic note, the reconstituted aroma significantly differed from the reconstituted aroma with guaiacol added at the concentration ratio of vanillin and guaiacol in cuts beans. It is suggested from these results that the concentration ratio of vanillin and guaiacol could be used as an index for the quality of Madagascar vanilla beans.

  20. Breeding for culinary and nutritional quality of common bean (Phaseolus vulgaris L. in intercropping systems with maize (Zea mays L.

    Directory of Open Access Journals (Sweden)

    Rodino A.P.

    1999-01-01

    Full Text Available Common bean (Phaseolus vulgaris L. is widely intercropped with maize (Zea mays L. in the North of Spain. Breeding beans for multiple cropping systems is important for the development of a productive and sustainable agriculture, and is mainly oriented to minimize intercrop competition and to stabilize complementarity with maize. Most agricultural research on intercropping to date has focused on the agronomic and overall yield effects of the different species, but characters related with socio-economic and food quality aspects are also important. The effect of intercropping beans with maize on food seed quality traits was studied for thirty-five bush bean varieties under different environments in Galicia (Northwestern Spain. Parameters determining Asturian (Northern Spain white bean commercial and culinary quality have also been evaluated in fifteen accessions. There are significant differences between varieties in the selected cropping systems (sole crop, intercrop with field maize and intercrop with sweet maize for dry and soaked seed weight, coat proportion, crude protein, crude fat and moisture. Different white bean accessions have been chosen according to their culinary quality. Under these environmental conditions it appears that intercropping systems with sweet maize give higher returns than sole cropping system. It is also suggested that the culinary and nutritional quality potential of some white bean accessions could be the base material in a breeding programme the objectives of which are to develop varieties giving seeds with high food quality.

  1. Spore population, colonization, species diversity and factors influencing the association of arbuscular mycorrhizal fungi with litchi trees in India.

    Science.gov (United States)

    Kumar, Vinod; Kumar, Rajesh; Kumar, Ajit; Anal, Dubedi

    2016-01-01

    Abundance and diversity of arbuscular mycorrhizal fungi (AMF) in association with litchi (Litchi chinensis Sonn.) trees were studied during 2012-2013, where orchard soil had high pH (7.42-9.53) and salinity (0.07- 0.39 dSm(-1)). A total of 105 rhizospheric soil and root samples were collected considering variables like location, age of tree, cultivar and production management. Results showed that spore count was in the range of 1-22 g(-1) soil. All the examined root segments had colonization of AMF, which ranged between 3.3 to 90.0%. AMF community comprised of Glomus mosseae, G. intaradices, G. constricta, G. coronatum, G. fasciculatum, G. albidum, G. hoi, G. multicauli, Acaulospora scrobiculata, A. laevis, Rhizophagus litchi and Entrophosphora infrequens. Higher spore density and AMF colonization were observed at medium level (13-28 kg ha(-1)) of available phosphorus that decreased ('r' = -0.21 for spore density, -0.48 for root colonization) with increasing soil phosphorus. While nitrogen did not influence the AMF association, a weak negative linear relationship with AMF colonization ('r' = -0.30) was apparent in the medium level (112-200 kg ha(-1)) of potash. Micronutrients (Zn, Fe, Cu, Mn and B) did not affect spore density (zero or a very weak linear correlation) but influenced root colonization ('r' = -0.53 to -0.44), the effect being more prominent above critical limits. Nutritionally sufficient, irrigated litchi orchards had greater spore count (46% samples having 5-22 spores g(-1) soil) and colonization (> 50% in 37.4% roots examined) than nutrient deficient, non-irrigated orchards, indicating essentiality of a threshold nutrients and moisture regime for the association. AMF symbiosis was influenced by cultivar (greater in 'China'), but tree age was not correlated to mycorrhizal association. A consortium of native species coupled with the understanding of nutrient effects on AMF would be useful for field application in litchi.

  2. Regulation of copper homeostasis and biotic interactions by microRNA 398b in common bean.

    Directory of Open Access Journals (Sweden)

    Loreto Naya

    Full Text Available MicroRNAs are recognized as important post-transcriptional regulators in plants. Information about the roles of miRNAs in common bean (Phaseolus vulgaris L., an agronomically important legume, is yet scant. The objective of this work was to functionally characterize the conserved miRNA: miR398b and its target Cu/Zn Superoxide Dismutase 1 (CSD1 in common bean. We experimentally validated a novel miR398 target: the stress up-regulated Nodulin 19 (Nod19. Expression analysis of miR398b and target genes -CSD1 and Nod19- in bean roots, nodules and leaves, indicated their role in copper (Cu homeostasis. In bean plants under Cu toxicity miR398b was decreased and Nod19 and CSD1, that participates in reactive oxygen species (ROS detoxification, were up-regulated. The opposite regulation was observed in Cu deficient bean plants; lower levels of CSD1 would allow Cu delivery to essential Cu-containing proteins. Composite common bean plants with transgenic roots over-expressing miR398 showed ca. 20-fold higher mature miR398b and almost negligible target transcript levels as well as increased anthocyanin content and expression of Cu-stress responsive genes, when subjected to Cu deficiency. The down-regulation of miR398b with the consequent up-regulation of its targets was observed in common bean roots during the oxidative burst resulting from short-time exposure to high Cu. A similar response occurred at early stage of bean roots inoculated with Rhizobium tropici, where an increase in ROS was observed. In addition, the miR398b down-regulation and an increase in CSD1 and Nod19 were observed in bean leaves challenged with Sclerotinia scleortiorum fungal pathogen. Transient over-expression of miR398b in Nicotiana benthamiana leaves infected with S. sclerotiorum resulted in enhanced fungal lesions. We conclude that the miR398b-mediated up-regulation of CSD and Nod19 is relevant for common bean plants to cope with oxidative stress generated in abiotic and biotic

  3. Formulation of microbes inoculum: AMF, PSB and Rhizobium isolated of ex-coal mining site for Acacia crassicarpa Cunn. Ex-benth seedlings

    Directory of Open Access Journals (Sweden)

    ENNY WIDYATI

    2007-07-01

    Full Text Available The shoddier succeed land revegetation particularly caused by least adaptability of the seedlings planted on this site. To encourage their growth and survival rate it can be achieved by means do inoculation with the compatible functional microbes such as rhizobium, Psolubilizing bacteria (PSB and/or arbuscular-mycorrhiza fungy (AMF. This reserach is aimed to formulate the most compatible inoculant to support the growth of A. crassicarpa seedlings. Compatibility study is carried out in RCB design with 3 replications, each contain 5 seedlings. Height and biomass are accessed to measure the growth responses of the seedlings. The result showed that the best reponse is given by consortia that consist of the three kinds of these microbes. This increase the shoot biomass (137% compare to the control. The consortia also improved N 164%, P 335% and K 167% in the plant tissues. While pure AMF improved absorption of N plants 80%, P 383% and K 51% compare to the control. It is suggested that to prepare the A. crassicarpa seedlings is better inoculated by consortium of microbes or AMF as a sole inoculant.

  4. Fumonisin B2 production by Aspergillus niger in Thai coffee beans

    DEFF Research Database (Denmark)

    Noonim, P.; Mahakarnchanaku, W.; Nielsen, Kristian Fog

    2009-01-01

    by black Aspergilli. No Fusarium species known to produce fumonisin were detected, but black Aspergilli had high incidences on both Arabica and Robusta Thai coffee beans. Liquid chromatography (LC) with high-resolution mass spectrometric (HRMS) detection showed that 67% of Aspergillus niger isolates from...

  5. RESPONSE OF THE JAMAICA-BEAN-CORN POLYCULTURE CROPPING SYSTEM TO THREE TREATMENTS OF FERTILIZATION IN VILLAFLORES, CHIAPAS, MEXICO

    Directory of Open Access Journals (Sweden)

    Rosey Obet Ruiz-González

    2014-07-01

    Full Text Available The corn (Zeamays Linneo and bean (Phaseolusvulgaris Linneo are the economic basis to meet the basic needs of rural families, but these crops are no longer economically viable for various reasons and jeopardize the family livelihood and productive alternatives are needed to improve the rural economy. The research was conducted during the spring-summer cycle from 1999 to 2000 in Villaflores , Chiapas, in order to evaluate the response of polyculturejamaica-bean-corn three fertilization treatments ( 00-00-00 , 60-60-60 and 120-60-60 . The experimental design was random blocks with three fertilization treatments, seven patterns of crops, and three replications and performance in the three plant species and vegetative variables were evaluated. With the data an ANOVA was performed and the treatment means were compared with the test of Tukey (p ≤ 0.05. The best vegetative response of the jamaica was to associate it with beans and corn with 60-60 fertilization treatment - 60, getting as much of: foliage (170 hojasplanta-1, branches (31 ramasplanta-1, acorns (54 bellotasplanta-1 and increased performance of dried calyxes (698 kgha-1.The beans associated with maize without fertilizations showed increase in foliage (62 hojasplanta-1 and in monoculture with fertilization 60-60 - 60 had the best performance (1,565 kgha-1of beans. Corn had the best vegetative response (18 hojasplanta-1 associated with beans and fertilization 120 - 60-60, and the best performance was when teamed with the beans and the jamaica (7,667 kgha-1. The best equivalent land-use was 3.31 in jamaica-bean-corn crop pattern. The analysis of the results indicates that the jamaica by associating it with corn and beans represents a biological and economic production alternative to improve the economy of rural families in Mexican soils which are acidified.

  6. Genetic diversity in cultivated carioca common beans based on molecular marker analysis

    Directory of Open Access Journals (Sweden)

    Juliana Morini Küpper Cardoso Perseguini

    2011-01-01

    Full Text Available A wide array of molecular markers has been used to investigate the genetic diversity among common bean species. However, the best combination of markers for studying such diversity among common bean cultivars has yet to be determined. Few reports have examined the genetic diversity of the carioca bean, commercially one of the most important common beans in Brazil. In this study, we examined the usefulness of two molecular marker systems (simple sequence repeats - SSRs and amplified fragment length polymorphisms - AFLPs for assessing the genetic diversity of carioca beans. The amount of information provided by Roger's modified genetic distance was used to analyze SSR data and Jaccards similarity coefficient was used for AFLP data. Seventy SSRs were polymorphic and 20 AFLP primer combinations produced 635 polymorphic bands. Molecular analysis showed that carioca genotypes were quite diverse. AFLPs revealed greater genetic differentiation and variation within the carioca genotypes (Gst = 98% and Fst = 0.83, respectively than SSRs and provided better resolution for clustering the carioca genotypes. SSRs and AFLPs were both suitable for assessing the genetic diversity of Brazilian carioca genotypes since the number of markers used in each system provided a low coefficient of variation. However, fingerprint profiles were generated faster with AFLPs, making them a better choice for assessing genetic diversity in the carioca germplasm.

  7. Market strategies for Central American dry beans.

    OpenAIRE

    Mertínez, Lourdes; Bernsten, Richard; Zamora, Miguel

    2004-01-01

    In the past few years, the dry bean sub-sector in CentralAmerica has witnessed many dynamic changes. Unless wefind ways to increase the competitiveness of the regionalbean sub-sector, Central American countries will likelyexperience significant negative social and economic impacts,especially since these countries are facing the challenge ofadjusting to new open markets, such as the Central AmericanFree Trade Agreement (CAFTA). Bean traders, retailers, andknowledgeable government official in C...

  8. Repertoire of SSRs in the Castor Bean Genome and Their Utilization in Genetic Diversity Analysis in Jatropha curcas

    Directory of Open Access Journals (Sweden)

    Arti Sharma

    2011-01-01

    Full Text Available Castor bean and Jatropha contain seed oil of industrial importance, share taxonomical and biochemical similarities, which can be explored for identifying SSRs in the whole genome sequence of castor bean and utilized in Jatropha curcas. Whole genome analysis of castor bean identified 5,80,986 SSRs with a frequency of 1 per 680 bp. Genomic distribution of SSRs revealed that 27% were present in the non-genic region whereas 73% were also present in the putative genic regions with 26% in 5′UTRs, 25% in introns, 16% in 3′UTRs and 6% in the exons. Dinucleotide repeats were more frequent in introns, 5′UTRs and 3′UTRs whereas trinucleotide repeats were predominant in the exons. The transferability of randomly selected 302 SSRs, from castor bean to 49 J. curcas genotypes and 8 Jatropha species other than J. curcas, showed that 211 (~70% amplified on Jatropha out of which 7.58% showed polymorphisms in J. curcas genotypes and 12.32% in Jatropha species. The higher rate of transferability of SSR markers from castor bean to Jatropha coupled with a good level of PIC (polymorphic information content value (0.2 in J. curcas genotypes and 0.6 in Jatropha species suggested that SSRs would be useful in germplasm analysis, linkage mapping, diversity studies and phylogenetic relationships, and so forth, in J. curcas as well as other Jatropha species.

  9. Repertoire of SSRs in the Castor Bean Genome and Their Utilization in Genetic Diversity Analysis in Jatropha curcas.

    Science.gov (United States)

    Sharma, Arti; Chauhan, Rajinder Singh

    2011-01-01

    Castor bean and Jatropha contain seed oil of industrial importance, share taxonomical and biochemical similarities, which can be explored for identifying SSRs in the whole genome sequence of castor bean and utilized in Jatropha curcas. Whole genome analysis of castor bean identified 5,80,986 SSRs with a frequency of 1 per 680 bp. Genomic distribution of SSRs revealed that 27% were present in the non-genic region whereas 73% were also present in the putative genic regions with 26% in 5'UTRs, 25% in introns, 16% in 3'UTRs and 6% in the exons. Dinucleotide repeats were more frequent in introns, 5'UTRs and 3'UTRs whereas trinucleotide repeats were predominant in the exons. The transferability of randomly selected 302 SSRs, from castor bean to 49 J. curcas genotypes and 8 Jatropha species other than J. curcas, showed that 211 (∼70%) amplified on Jatropha out of which 7.58% showed polymorphisms in J. curcas genotypes and 12.32% in Jatropha species. The higher rate of transferability of SSR markers from castor bean to Jatropha coupled with a good level of PIC (polymorphic information content) value (0.2 in J. curcas genotypes and 0.6 in Jatropha species) suggested that SSRs would be useful in germplasm analysis, linkage mapping, diversity studies and phylogenetic relationships, and so forth, in J. curcas as well as other Jatropha species.

  10. Occurrence of broad bean (Vicia faba L. diseases in Olsztyn-Elbąg and Bydgoszcz Provinces

    Directory of Open Access Journals (Sweden)

    Stanisław Sadowski

    2013-12-01

    Full Text Available During the years 1981-1985, there were conducted studies of the healthiness of broad bean,'Nadwiślański' variety, cultivated in different soil and climate conditions of the two regions: i.e. Bydgoszcz - comparatively warmer and drier, and Olsztyn-Elbląg - colder and moister. It was found that the main reason for a premature broad bean leaves dry in up in the Olsztyn-Elbląg Region was caused by the fungi Cercospora and Botrytis, and in the Bydgoszcz Region - the root rot which occurs here to a greater extent. Root gangrene was greater intensity in drier and lighter soils. Rotting broad bean roots were most frequently occupied by the fungi of the Fusarium family (ca. 70%. The prevailing species were Fusarium oxysporum, next F. solani and more rarely F. culmorum and F. avenaceum. Climate conditions and soil species affected considerably the species composition of the root fungi.

  11. Apple Latent Spherical Virus Vector as Vaccine for the Prevention and Treatment of Mosaic Diseases in Pea, Broad Bean, and Eustoma Plants by Bean Yellow Mosaic Virus

    Directory of Open Access Journals (Sweden)

    Nozomi Satoh

    2014-11-01

    Full Text Available We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV harboring a segment of the Bean yellow mosaic virus (BYMV genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases.

  12. Apple latent spherical virus vector as vaccine for the prevention and treatment of mosaic diseases in pea, broad bean, and eustoma plants by bean yellow mosaic virus.

    Science.gov (United States)

    Satoh, Nozomi; Kon, Tatsuya; Yamagishi, Noriko; Takahashi, Tsubasa; Natsuaki, Tomohide; Yoshikawa, Nobuyuki

    2014-11-07

    We investigated the protective effects of a viral vector based on an Apple latent spherical virus (ALSV) harboring a segment of the Bean yellow mosaic virus (BYMV) genome against mosaic diseases in pea, broad bean, and eustoma plants caused by BYMV infection. In pea plants pre-inoculated with the ALSV vaccine and challenge inoculated with BYMV expressing green fluorescence protein, BYMV multiplication occurred in inoculated leaves, but was markedly inhibited in the upper leaves. No mosaic symptoms due to BYMV infection were observed in the challenged plants pre-inoculated with the ALSV vaccine. Simultaneous inoculation with the ALSV vaccine and BYMV also prevented mosaic symptoms in broad bean and eustoma plants, and BYMV accumulation was strongly inhibited in the upper leaves of plants treated with the ALSV vaccine. Pea and eustoma plants were pre-inoculated with BYMV followed by inoculation with the ALSV vaccine to investigate the curative effects of the ALSV vaccine. In both plant species, recovery from mosaic symptoms was observed in upper leaves and BYMV accumulation was inhibited in leaves developing post-ALSV vaccination. These results show that ALSV vaccination not only prevents mosaic diseases in pea, broad bean, and eustoma, but that it is also effective in curing these diseases.

  13. Effect of cooking and germination on phenolic composition and biological properties of dark beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    López, Ana; El-Naggar, Tarek; Dueñas, Montserrat; Ortega, Teresa; Estrella, Isabel; Hernández, Teresa; Gómez-Serranillos, M Pilar; Palomino, Olga M; Carretero, M Emilia

    2013-05-01

    Legumes are the basés diet in several countries. They hold a high nutritional value, but other properties related to human health are nowadays being studied. The aim of this work was to study the influence of processes (boiling or germination) on the phenolic composition of dark beans (Phaseolus vulgaris L. c.v. Tolosana) and their effect on their antioxidant, neuroprotective and anticancer ability. Phenolic composition of raw and processed dark beans was analysed by HPLC-PAD and HPLC-ESI/MS. The antioxidant activity was evaluated by ORAC. Astrocytes cultures (U-373) have been used to test their neuroprotective effect. Anticancer activities were evaluated on three different cell lines (renal adenocarcinoma (TK-10), breast adenocarcinoma (MCF-7) and melanoma (UACC-62)) by sulphorhodamine B method. Qualitative and quantitative differences in phenolic composition have been observed between raw and processed dark beans that influence the antioxidant activity, mainly for germinated samples which show a decrease of antioxidant capacity. Although every assayed extracts decreased reactive oxygen species release and exhibited cytotoxicity activities on cancer cell lines, raw beans proved to be the most active in neuroprotective and antitumoral effects; this sample is especially rich in phenolic compounds, mainly anthocyanins. This study further demonstrated that phenolic composition of dark beans is related with cooking process and so with their neuroprotective and anticancer activity; cooking of dark beans improves their digestion and absorption at intestinal level, while maintaining its protective ability on oxidative process at cellular level.

  14. Cadmium accumulation by jack-bean and sorghum in hydroponic culture.

    Science.gov (United States)

    Francato Zancheta, Ariana Carramaschi; De Abreu, Cleide Aparecida; Zambrosi, Fernando César Bachiega; de Magalhães Erismann, Norma; Andrade Lagôa, Ana Maria Magalhães

    2015-01-01

    Among the technologies used to recuperate cadmium (Cd) contaminated soils, phytoextraction are particularly important, where the selection of suitable plants is critical to the success of the soil remediation. Thus, the objectives of this study were to evaluate the responses of jack-bean and sorghum to Cd supply and to quantify Cd accumulation by these species grown in hydroponic culture. The plants were subjected to 0, 15, 30, or 60 μmol Cd L(-1) in the nutrient solution, and gas exchange, plant growth and Cd accumulation were measured at 25 days after starting Cd treatments. The Cd supply severely reduced growth of shoots and roots in both species. In jack-bean, Cd decreased photosynthesis by 56-86%, stomatal conductance by 59-85% and transpiration by 48-80%. The concentrations and amounts of Cd accumulated in the plant tissues were proportional to the metal supply in the nutrient solution. Sorghum was more tolerant than jack-bean to Cd toxicity, but the latter showed a greater metal concentration and accumulation in the shoot. Therefore, jack-bean would be more suitable than sorghum for use in Cd phytoremediation programs based on phytoextraction.

  15. Java EE 7 development with NetBeans 8

    CERN Document Server

    Heffelfinger, David R

    2015-01-01

    The book is aimed at Java developers who wish to develop Java EE applications while taking advantage of NetBeans functionality to automate repetitive tasks. Familiarity with NetBeans or Java EE is not assumed.

  16. Analysis of simple sequence repeats in rice bean(Vigna umbellata) using an SSR-enriched library

    Institute of Scientific and Technical Information of China (English)

    Lixia Wang; Kyung Do Kim; Dongying Gao; Honglin Chen; Suhua Wang; Suk Ha Lee; Scott A. Jackson; Xuzhen Cheng

    2016-01-01

    bean and other Vigna species.

  17. Effect of cooking methods on selected physicochemical and nutritional properties of barlotto bean, chickpea, faba bean, and white kidney bean.

    Science.gov (United States)

    Güzel, Demet; Sayar, Sedat

    2012-02-01

    The effects of atmospheric pressure cooking (APC) and high-pressure cooking (HPC) on the physicochemical and nutritional properties of barlotto bean, chickpea, faba bean, and white kidney bean were investigated. The hardness of the legumes cooked by APC or HPC were not statistically different (P > 0.05). APC resulted in higher percentage of seed coat splits than HPC. Both cooking methods decreased Hunter "L" value significantly (P < 0.05). The "a" and "b" values of dark-colored seeds decreased after cooking, while these values tended to increase for the light-colored seeds. The total amounts of solid lost from legume seeds were higher after HPC compared with APC. Rapidly digestible starch (RDS) percentages increased considerably after both cooking methods. High pressure cooked legumes resulted in higher levels of resistant starch (RS) but lower levels of slowly digestible starch (SDS) than the atmospheric pressure cooked legumes.

  18. Blanching of green bean (Phaseolus vulgaris).

    Science.gov (United States)

    Kaack, K

    1994-12-01

    Experiments with one and two steps blanching of green beans have been carried out. Inactivation of the peroxydase requires more heating than inactivation of the enzymes which gives rise to off flavour from aldehydes. When blanching for about one minute to inactivate lipoxygenase, aldehyde formation of flavour ceases. The content of vitamin C decreases during blanching according to a first order reaction. Since considerable loss of vitamin C occurs during blanching, the treatment time should be reduced to a minimum. During preblanching at 65-75 degrees C and final blanching, chlorophyll is degraded to pheophytin and the surface colour expressed by the Hunter-values (-a/b) increases with time which means that the colour of the beans changes from green to yellow. The firmness of beans, which was measured by use of a tenderometer, decreases during blanching according to a first order reaction with 40 kcal/mole activation energy. Preblanching at 65-75 degrees C increases the firmness of the beans linearly with treatment time. This increase in firmness is stable after final blanching at 95 degrees C and even after thawing of frozen beans.

  19. Effect of hydrocolloids on functional properties of navy bean starch

    Science.gov (United States)

    The effects of hydrocolloid replacement on the pasting properties of navy bean starch and on the properties of navy bean starch gels were studied. Navy bean starch was isolated, and blends were prepared with beta-glucan, guar gum, pectin and xanthan gum solutions. The total solids concentration was ...

  20. Effects of fermented soya bean on digestion, absorption and diarrhoea

    NARCIS (Netherlands)

    Kiers, J.L.

    2001-01-01

    For many centuries Asian people have consumed soya beans in various forms of traditional fermented soya bean foods. Major desirable aspects of fermented soya bean foods are their attractive flavour and texture, certain nutritional properties, and possible health promoting effects. This study describ

  1. 9 CFR 319.301 - Chili con carne with beans.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Chili con carne with beans. 319.301 Section 319.301 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE... Dehydrated Meat Food Products § 319.301 Chili con carne with beans. Chili con carne with beans shall...

  2. 7 CFR 457.150 - Dry bean crop insurance provisions.

    Science.gov (United States)

    2010-01-01

    ...; (f) Earthquake; (g) Volcanic eruption; or (h) Failure of the irrigation water supply, if caused by an..., or that could be received, for contract seed beans under a seed bean processor contract if the... total production under contract with the seed company. Beans—Dry beans and contract seed...

  3. New bean seeds and the struggle for their dissemination

    NARCIS (Netherlands)

    Almekinders, C.J.M.; Aguilar, E.; Herrera, R.

    2007-01-01

    The northern region of Nicaragua has always been an important bean and maize producing area. But a widespread presence of the Golden Mosaic Virus made it impossible to grow beans in the last years. A Participatory Plant Breeding programme started in 1999, aiming to develop new bean varieties that wo

  4. Fungal decontamination and enhancement of shelf life of edible split beans of wild legume Canavalia maritima by the electron beam irradiation

    Science.gov (United States)

    Supriya, P.; Sridhar, K. R.; Ganesh, S.

    2014-03-01

    Ripened split beans of the coastal sand dune wild legume Canavalia maritima serve as one of the traditional nutritional sources of the coastal dwellers in Southwest coast of India. Nine fungi were isolated from the unirradiated dry beans by plating on the potato dextrose agar medium. Toxigenic fungus Aspergillus niger showed the highest incidence (33-50%) followed by Aspergillus flavus (14-20%) and Penicillium chrysogenum (7-13%). Unirradiated dry beans and irradiated dry beans with electron beam doses 2.5, 5, 10 and 15 kGy were monitored for occurrence of fungal species and their incidence during 0, 3 and 6 months storage period under laboratory conditions. Irradiation resulted in dose-dependent decrease in fungal species (5-7, 4-6, 3-6 and 0 on irradiation at 0, 2.5, 5 and 10 or 15 kGy, respectively) as well as incidence (80-99, 19-46, 13-21 and 0%, respectively). Although aflatoxins (B1 and B2) were found below detectable level (<2 ng/g) in 0, 3 and 6 months stored unirradiated and irradiated beans (2.5 and 5 kGy), they were not present in beans irradiated with 10 and 15 kGy. In spite of occurrence of toxigenic fungus Aspergillus ochraceus in unirradiated and irradiated beans (2.5 and 5 kGy) stored for 3 and 6 months, the beans were devoid of ochratoxin-A. Electron beam irradiation dose 10 kGy could be recommended for fungal decontamination and improvement of shelf life of C. maritima ripened dry split beans.

  5. Transcriptome-wide identification and characterization of microRNAs from castor bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Wei Xu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are endogenously encoded small RNAs that post-transcriptionally regulate gene expression and play essential roles in numerous developmental and physiological processes. Currently, little information on the transcriptome and tissue-specific expression of miRNAs is available in the model non-edible oilseed crop castor bean (Ricinus communis L., one of the most important non-edible oilseed crops cultivated worldwide. Recent advances in sequencing technologies have allowed the identification of conserved and novel miRNAs in many plant species. Here, we used high-throughput sequencing technologies to identify and characterize the miRNAs in castor bean. RESULTS: Five small RNA libraries were constructed for deep sequencing from root tips, leaves, developing seeds (at the initial stage, seed1; and at the fast oil accumulation stage, seed2 and endosperms in castor bean. High-throughput sequencing generated a large number of sequence reads of small RNAs in this study. In total, 86 conserved miRNAs were identified, including 63 known and 23 newly identified. Sixteen miRNA isoform variants in length were found from the conserved miRNAs of castor bean. MiRNAs displayed diverse organ-specific expression levels among five libraries. Combined with criteria for miRNA annotation and a RT-PCR approach, 72 novel miRNAs and their potential precursors were annotated and 20 miRNAs newly identified were validated. In addition, new target candidates for miRNAs newly identified in this study were proposed. CONCLUSIONS: The current study presents the first high-throughput small RNA sequencing study performed in castor bean to identify its miRNA population. It characterizes and increases the number of miRNAs and their isoforms identified in castor bean. The miRNA expression analysis provides a foundation for understanding castor bean miRNA organ-specific expression patterns. The present study offers an expanded picture of miRNAs for castor

  6. Purification and biochemical properties of a thermostable, haloalkaline cellulase from Bacillus licheniformis AMF-07 and its application for hydrolysis of different cellulosic substrates to bioethanol production

    Science.gov (United States)

    Azadian, Fatemeh; Badoei-dalfard, Arastoo; Namaki-Shoushtari, Abdolhamid; Hassanshahian, Mehdi

    2016-01-01

    A thermophilic strain AMF-07, hydrolyzing carboxymethylcellulose (CMC) was isolated from Kerman hot spring and was identified as Bacillus licheniformis based on 16S rRNA sequence homology. The carboxymethylcellulase (CMCase) enzyme produced by the B. licheniformis was purified by (NH4)2SO4 precipitation, ion exchange and gel filtration chromatography. The purified enzyme gave a single band on SDS- PAGE with a molecular weight of 37 kDa. The CMCase enzyme was highly active and stable over broad ranges of temperature (40-80ºC), pH (6.0-10.0) and NaCl concentration (10-25%) with an optimum at 70ºC, pH 9.0 and 20% NaCl, which showed excellent thermostable, alkali-stable and halostable properties. Moreover, it displayed high activity in the presence of cyclohexane (134%) and chloroform (120%). Saccharification of rice bran and wheat bran by the CMCase enzyme resulted in respective yields of 24 and 32 g L-1 reducing sugars. The enzymatic hydrolysates of rice bran were then used as the substrate for ethanol production by Saccharomyces cerevisiae. Fermentation of cellulosic hydrolysate using S. cerevisiae, reached maximum ethanol production about 0.125 g g-1 dry substrate (pretreated wheat bran). Thus, the purified cellulase from B. licheniformis AMF-07 utilizing lignocellulosic biomass could be greatly useful to develop industrial processes. PMID:28097168

  7. Purification and biochemical properties of a thermostable, haloalkaline cellulase from Bacillus licheniformis AMF-07 and its application for hydrolysis of different cellulosic substrates to bioethanol production

    Directory of Open Access Journals (Sweden)

    Fatemeh Azadian

    2016-09-01

    Full Text Available A thermophilic strain AMF-07, hydrolyzing carboxymethylcellulose (CMC was isolated from Kerman hot spring and was identified as Bacillus licheniformis based on 16S rRNA sequence homology. The carboxymethylcellulase (CMCase enzyme produced by the B. licheniformis was purified by (NH42SO4 precipitation, ion exchange and gel filtration chromatography. The purified enzyme gave a single band on SDS-PAGE with a molecular weight of 37 kDa. The CMCase enzyme was highly active and stable over broad ranges of temperature (40-80 ºC, pH (6.0-10.0 and NaCl concentration (10-25% with an optimum at 70 ºC, pH 9.0 and 20% NaCl, which showed excellent thermostable, alkali-stable and halostable properties. Moreover, it displayed high activity in the presence of cyclohexane (134% and chloroform (120%. Saccharification of rice bran and wheat bran by the CMCase enzyme resulted in respective yields of 24 and 32 g L-1 reducing sugars. The enzymatic hydrolysates of rice bran were then used as the substrate for ethanol production by Saccharomyces cerevisiae. Fermentation of cellulosic hydrolysate using S. cerevisiae, reached maximum ethanol production about 0.125 g g-1 dry substrate (pretreated wheat bran. Thus, the purified cellulase from B. licheniformis AMF-07 utilizing lignocellulosic biomass could be greatly useful to develop industrial processes.

  8. Evaluation of the reaction oof interspecific hybrids of common bean and tepary bean to Bradyrhizobium y Rhizobium

    Science.gov (United States)

    Interspecific hybrids between common bean, Phaseolus vulgaris L., and tepary bean, Phaseolus acutifolius A. Gray, have the potential to increase bean production in regions where rainfall is limited. In 2014, an experiment was initiated using a split-plot design. The treatments included inoculation, ...

  9. 76 FR 16700 - Importation of French Beans and Runner Beans From the Republic of Kenya Into the United States

    Science.gov (United States)

    2011-03-25

    ... individual beans. We would require the beans to be inspected by the Kenyan NPPO and found to be free of..., primarily to the European Union (EU). The EU provides a well-established market and it is unlikely that there would be a large diversion of French bean exports by Kenya from this market to the United...

  10. Arbuscular mycorrhizae of dominant plant species in Yungas forests, Argentina.

    Science.gov (United States)

    Becerra, Alejandra G; Cabello, Marta; Zak, Marcelo R; Bartoloni, Norberto

    2009-01-01

    In Argentina the Yungas forests are among the ecosystems most affected by human activity, with loss of biodiversity. To assess the arbuscular mycorrhizal (AM) colonization and the arbuscular mycorrhizal fungi (AMF) spore numbers in these ecosystems, the roots of the most dominant native plants (one tree, Alnus acuminata; three herbaceous, Duchesnea indica, Oxalis conorrhiza, Trifolium aff. repens; and one shrub, Sambucus peruviana) were studied throughout the year from two sites of Yungas forests. Assessments of mycorrhizal colonization (percent root length, intraradical structures) were made by washing and staining the roots. Soil samples of each plant species were pooled and subsamples were obtained to determine AM spore numbers. The herbaceous species formed both Arum- and Paris-type morphologies, whereas the tree and the shrub species formed respectively single structural types of Arum- and Paris-type. AM colonization, intraradical fungi structures and AMF spore numbers displayed variation in species, seasons and sites. D. indica showed the highest AM colonization, whereas the highest spore numbers was observed in the rhizosphere of A. acuminata. No correlation was observed between spore numbers and root length percentage colonized by AM fungi. Results of this study showed that Alnus acuminata is facultatively AM. The AM colonization, intraradical fungi structures and AMF spore numbers varied in species depending on phenological, climatic and edaphic conditions.

  11. Características fisiológicas das culturas de soja e feijão e de três espécies de plantas daninhas Physiological caracteristics of soybean and common bean crops and three weed species

    Directory of Open Access Journals (Sweden)

    S.O. Procópio

    2004-06-01

    -yellow Clayoil, in a randomized complete block arrangement, with four replications, in a split-plot design. The species were the plots and the evaluation times the split-plots. Higher Wt of soybean was observed in relation to the weeds. The soybean and common bean crops showed higher L than the weeds. E. heterophylla biotypes presented the largest A and gs values. Except for D. tortuosum, the weeds presented larger WUE at the initial stage of crops development. No differences were observed between E. heterophylla biotypes.

  12. Potential of sunflower, castor bean, common buckwheat and vetiver as lead phytoaccumulators

    Directory of Open Access Journals (Sweden)

    Jailson do C. Alves

    2016-03-01

    Full Text Available ABSTRACT Studies concerning the tolerance, absorption and distribution of heavy metals in plants are essential for the success of phytoremediation programs. The present study was carried out in order to evaluate the potential of the sunflower, castor bean, common buckwheat and vetiver as lead phytoaccumulators. The species were grown in nutrient solution containing increasing doses of Pb (0, 50, 100, 200 and 400 mg L-1 during a 30-day exposure period. A completely randomized split-plot design was used, with a 4 x 5 factorial and three replicates. Significant reductions of dry matter of the root, shoot and whole plant were found in the all species under study as a function of the increased Pb doses. Vetiver showed higher tolerance to Pb contamination; sunflower and castor bean had intermediate tolerance and the common buckwheat proved to be the most sensitive species. The concentration and total content of Pb in plant compartments were significantly affected by the increased Pb doses in solution, and higher accumulation of this element was observed, in general, in the roots of the studied species. Common buckwheat proved to be not much promising for Pb-phytoremediation programs; sunflower showed potential for Pb phytoextraction and castor bean and vetiver were the most appropriate for Pb phytostabilization.

  13. Growth characteristics of mung beans and water convolvuluses exposed to 425-MHz electromagnetic fields.

    Science.gov (United States)

    Jinapang, Peeraya; Prakob, Panida; Wongwattananard, Pongtorn; Islam, Naz E; Kirawanich, Phumin

    2010-10-01

    Effects of high-frequency, continuous wave (CW) electromagnetic fields on mung beans (Vigna radiata L.) and water convolvuluses (Ipomoea aquatica Forssk.) were studied at different growth stages (pre-sown seed and early seedling). Specifically, the effects of the electromagnetic source's power and duration (defined as power-duration level) on the growth of the two species were studied. Mung beans and water convolvuluses were exposed to electromagnetic fields inside a specially designed chamber for optimum field absorption, and the responses of the seeds to a constant frequency at various power levels and durations of exposure were monitored. The frequency used in the experiments was 425 MHz, the field strengths were 1 mW, 100 mW, and 10 W, and the exposure durations were 1, 2, and 4 h. Results show that germination enhancement is optimum for the mung beans at 100 mW/1 h power-duration level, while for water convolvuluses the optimum germination power-duration level was 1 mW/2 h. When both seed types were exposed at the early sprouting phase with their respective optimum power-duration levels for optimum seed growth, water convolvuluses showed growth enhancement while mung bean sprouts showed no effects. Water content analysis of the seeds suggests thermal effects only at higher field strength.

  14. Characterization of a Panela cheese with added probiotics and fava bean starch.

    Science.gov (United States)

    Escobar, M C; Van Tassell, M L; Martínez-Bustos, F; Singh, M; Castaño-Tostado, E; Amaya-Llano, S L; Miller, M J

    2012-06-01

    Of 20 Lactobacillus and 8 Bifidobacterium species examined, only Bifidobacterium breve ATCC 15700 was able to ferment starch from fava beans. Bifidobacterium breve ATCC 15700 and Lactobacillus rhamnosus GG ATCC 53103 were selected as probiotics for use in fresh-style Panela cheese. Two types of fresh cheese (with and without 3% fava bean starch) were manufactured with 3 combinations of probiotics: L. rhamnosus GG only, B. breve only, or both L. rhamnosus GG and B. breve. During 4 wk of storage at 4°C, the addition of fava bean starch to the cheese was not found to cause significant differences in the viability of either probiotic strain. However, the microstructure and texture of Panela cheese were altered, resulting in a much softer product. A sensory panel showed that the presence of added fava bean starch in Panela cheese was less desirable to consumers, whereas probiotic supplementation had no effect on perceived taste or appearance. Panela cheese could be a suitable food for inclusion of probiotic bacteria.

  15. Apis mellifera pollination improves agronomic productivity of anemophilous castor bean (Ricinus communis).

    Science.gov (United States)

    Rizzardo, Rômulo A G; Milfont, Marcelo O; Silva, Eva M S da; Freitas, Breno M

    2012-12-01

    Castor bean (Ricinus communis L.) is cultivated mainly for biodiesel production because of its oil-rich seeds; it is assumed to be an anemophylous species. But pollination deficit can lead to low productivity often attributed to other reasons. In this paper, we investigated pollination requirements, pollination mechanism, occurrence of pollination deficit, and the role of biotic pollinators in a large commercial plantation of castor bean. Our results show that R. communis bears a mixed breeding system favoring selfing by geitonogamy, although the wind promotes mostly outcrossing. We also found that the honey bee (Apis mellifera L.) foraging on castor bean can both transfer pollen from male to female flowers within the same raceme and boost the release of airborne pollen by male flowers. Both situations increase geitonogamy rates, raising significantly fruit set and seed yield. This is the first report of an animal foraging activity increasing seed yield in an anemophilous and geitonogamous crop and elucidates the role of biotic pollinators in castor bean reproduction.

  16. Effect of Superheated Steam Roasting on Radical Scavenging Activity and Phenolic Content of Robusta Coffee Beans

    Directory of Open Access Journals (Sweden)

    Ooi Ee Shan

    2015-04-01

    Full Text Available Robusta coffee is one of the coffee species grown in Malaysia. However, there is little research conducted on Robusta coffee beans as Arabica coffee is more popular among the consumers. Coffee is a rich source of antioxidants, therefore research on antioxidant properties of Robusta coffee beans is important to explore its market value. Nowadays, most of coffee analysis is on conventional roasted coffee which reduces their antioxidant properties. In this study, Robusta coffee beans (Coffea canephora were subjected to superheated steam roasting at 200, 220 and 240 ˚C for 20-40 min to obtain light, medium and dark roast. The effect of different roasting temperature and time on the total phenolic content (TPC and radical scavenging activity (RSA of Robusta coffee bean was investigated. Total phenolic content of coffee brews decreased with the increase of roasting degree due to the degradation of phenolic compounds. The highest phenolic content was found at 220 ˚C for 20 min. Meanwhile, brews extracted from light roasted coffee and medium roasted at 220 ˚C for 20 min showed a maximum scavenging activity than those from green coffee. Brews from dark roasted coffee showed lowest radical scavenging activity and total phenol content. Hence, based on the results from this study, the best superheated steam roasting condition is at 220 ˚C for 20 min (medium roast to achieve a maximum antioxidant activity and highest phenolic content.

  17. Dynamics of a Novel Highly Repetitive CACTA Family in Common Bean (Phaseolus vulgaris).

    Science.gov (United States)

    Gao, Dongying; Zhao, Dongyan; Abernathy, Brian; Iwata-Otsubo, Aiko; Herrera-Estrella, Alfredo; Jiang, Ning; Jackson, Scott A

    2016-07-07

    Transposons are ubiquitous genomic components that play pivotal roles in plant gene and genome evolution. We analyzed two genome sequences of common bean (Phaseolus vulgaris) and identified a new CACTA transposon family named pvCACTA1. The family is extremely abundant, as more than 12,000 pvCACTA1 elements were found. To our knowledge, this is the most abundant CACTA family reported thus far. The computational and fluorescence in situ hybridization (FISH) analyses indicated that the pvCACTA1 elements were concentrated in terminal regions of chromosomes and frequently generated AT-rich 3 bp target site duplications (TSD, WWW, W is A or T). Comparative analysis of the common bean genomes from two domesticated genetic pools revealed that new insertions or excisions of pvCACTA1 elements occurred after the divergence of the two common beans, and some of the polymorphic elements likely resulted in variation in gene sequences. pvCACTA1 elements were detected in related species but not outside the Phaseolus genus. We calculated the molecular evolutionary rate of pvCACTA1 transposons using orthologous elements that indicated that most transposition events likely occurred before the divergence of the two gene pools. These results reveal unique features and evolution of this new transposon family in the common bean genome.

  18. Population Development of Zabrotes subfasciatus (Coleoptera: Chrysomelidae) in Landrace Bean Varieties Occurring in Southwestern Amazonia.

    Science.gov (United States)

    Lopes, L M; Araújo, A E F; Santos, A C V; Santos, V B; Sousa, A H

    2016-02-01

    The common bean, Phaseolus vulgaris (L.), is one of the most important sources of protein worldwide, and Latin America is one of the recognized centers of diversity of this species. However, storage of this product after harvest is not feasible because of bruchid attacks. This study determined the accumulated normalized rate of emergence and the daily emergence rate of Zabrotes subfasciatus (Boheman) (Coleoptera: Chrysomelidae:Bruchinae) in five landrace varieties of common bean (BRL 01, SNA 01, RDR 01, RBC 01, and RBC 13) that occurin southwestern Amazonia. These varieties were selected for this study because they are well-distributed throughout the Amazonian communities. Beans of each variety were infested with 50 unsexed adults, and the insects were removed 13 d after beginning the bioassays. The adult progeny obtained from the feeding substrate were counted and removed every other day after the first emergence, until the end of the emergence period. Differences were observed in the calculated rates of development; however, the time required for development and emergence of the insects was independent. Of the five varieties of bean investigated, we observed that the RDR 01, BRL 01, and SNA 01 cultivars are resistant to Z. subfasciatus; the results indicate that the use of these three varieties can reduce problems associated with bruchid attacks and enable storage of the product after harvesting.

  19. Management of the broad bean weevil (Bruchus rufimanus Boh.) in faba bean (Vicia faba L.)

    OpenAIRE

    Roubinet, Eve

    2016-01-01

    Summary Bruchus rufimanus Boh. is a common pest on faba beans (Vicia faba L.) all over Europe and worldwide. The area of faba bean production is increasing in Sweden and in Europe, partly encouraged by the CAP subsidies for legume crops and diversified crop rotations. At the same time, number of the insecticides commonly used against B. rufimanus have been removed from the market as pollinators risk to be harmed as the treatment timing corresponds to crop flowering. In Sweden, only one ins...

  20. Exploiting EST databases for the development and characterization of EST-SSR markers in castor bean (Ricinus communis L.

    Directory of Open Access Journals (Sweden)

    Yang Jun-Bo

    2010-12-01

    Full Text Available Abstract Background The castor bean (Ricinus communis L., a monotypic species in the spurge family (Euphorbiaceae, 2n = 20, is an important non-edible oilseed crop widely cultivated in tropical, sub-tropical and temperate countries for its high economic value. Because of the high level of ricinoleic acid (over 85% in its seed oil, the castor bean seed derivatives are often used in aviation oil, lubricants, nylon, dyes, inks, soaps, adhesive and biodiesel. Due to lack of efficient molecular markers, little is known about the population genetic diversity and the genetic relationships among castor bean germplasm. Efficient and robust molecular markers are increasingly needed for breeding and improving varieties in castor bean. The advent of modern genomics has produced large amounts of publicly available DNA sequence data. In particular, expressed sequence tags (ESTs provide valuable resources to develop gene-associated SSR markers. Results In total, 18,928 publicly available non-redundant castor bean EST sequences, representing approximately 17.03 Mb, were evaluated and 7732 SSR sites in 5,122 ESTs were identified by data mining. Castor bean exhibited considerably high frequency of EST-SSRs. We developed and characterized 118 polymorphic EST-SSR markers from 379 primer pairs flanking repeats by screening 24 castor bean samples collected from different countries. A total of 350 alleles were identified from 118 polymorphic SSR loci, ranging from 2-6 per locus (A with an average of 2.97. The EST-SSR markers developed displayed moderate gene diversity (He with an average of 0.41. Genetic relationships among 24 germplasms were investigated using the genotypes of 350 alleles, showing geographic pattern of genotypes across genetic diversity centers of castor bean. Conclusion Castor bean EST sequences exhibited considerably high frequency of SSR sites, and were rich resources for developing EST-SSR markers. These EST-SSR markers would be particularly

  1. Arbuscular mycorrhiza in species of Commelinidae (Liliopsida in the state of Pernambuco (Brazil

    Directory of Open Access Journals (Sweden)

    Silva Gladstone Alves da

    2001-01-01

    Full Text Available Mycorrhiza are a mutualistic symbiosis between fungi and plant roots, the main benefit to the plant being increased nutrient uptake. The arbuscular is the most important kind of mycorrhiza for agriculture and it is widespread in occurrence and distribution in most ecosystems. The aim of this work was to study the mycorrhizal status of the species of Commelinidae that occur in the State of Pernambuco. Plant roots, collected in ten municipalities, were washed, cleared in KOH, stained with Trypan blue in lactoglycerol and observed under a light microscope in order to assess presence and identification of the mycorrhizal type. Percentage of root colonization was evaluated by the gridline intersect method. Forty specimens representing 30 species were observed. From these specimens, 70% were colonized by arbuscular mycorrhizal fungi (AMF. In one family (Typhaceae, mycorrhizal structures were not observed, in two of them (Eriocaulaceae and Juncaceae all specimens showed the association, and three families (Commelinaceae, Cyperaceae and Poaceae presented specimens with or without AMF. In some of the roots, other fungi were observed together with the AMF. The results indicate that AMF are widely distributed among species of Commelinidae in Pernambuco, being probably important for their establishment in the areas visited.

  2. The Effect of Weeds Interference Time and Plant Density on Weeds Control and Broad Bean (Vicia faba L. Yield

    Directory of Open Access Journals (Sweden)

    M Dabaghzadeh

    2016-10-01

    m-2 of broad-beans, the highest frequency was recorded for mallow, clover and wild beet (15.2, 14.18 and 13.68 plants m-2. With the increased interference time period, from V9 broad-bean phenological stage on, the weed density was reduced due to "within species"(intra_species competition of weeds and "between species" (inter_species competition of weeds and the crop. As the time period of weeds interference increased, the dry weight reached its highest level, so that in full season weeding treatment, it reached 172.99 g m-2. Increasing the density of broad-bean from 8 to -14 plants m-2, decreased the weeds total dry weight from 92.42 to 83.76 g m-2 .Also increasing the weeds interference duration, reduced the seed yield, so that the highest yield, with the average of 2473.5 kg ha-1, was obtained in full season weeding treatments. Among the treatments of broad-bean density, the highest seed yield of 1342 kg ha-1 in average, was obtained from density treatment of 14 plants m-2. Among the treatments of interaction, weeds interference and Broad-bean density, Broad-bean density had a significant effect on the seed yield. The highest seed yield was observed in full season weeding treatment and the density of 14 plants m-2, with an average of 2699.87 kg ha-1, and the lowest seed yield was recorede in the treatment of full season interference and density of 14 plants m-2 with an average of 228.309 kg ha-1. Considering the results of this study, where weeding is not to be applied in V13 broad -bean phenological stage and next stages, the minimum density (8 plants m-2 is recommended, because density had no significant effect on broad-bean yield, this would reduce the cost of production. Conclusions It can be concluded that increasing the duration of weeds interference, reduced the seed yield and weeds density while it increased the weeds dry weight. Increased broad-bean density, also, reduced the density and dry weight of all the weeds. The best time to control weeds for

  3. Castor bean response to zinc fertilization

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Henrique Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Zinc is a trace element and it is absolutely essential for the normal healthy growth of plants. This element plays a part of several enzyme systems and other metabolic functions in the plants. Castor beans (Ricinus communis L.) crop is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor beans yield, few researches has been made on this issue, mainly on the use of zinc. In order to evaluate the effects of zinc on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Zn (0; 2; 4; 6 and 8 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Under conditions that the experiment was carried out the results showed that the Zn levels used, did not affect the castor bean plants growth. (author)

  4. Synthesis of a jojoba bean disaccharide.

    Science.gov (United States)

    Kornienko, A; Marnera, G; d'Alarcao, M

    1998-08-01

    A synthesis of the disaccharide recently isolated from jojoba beans, 2-O-alpha-D-galactopyranosyl-D-chiro-inositol, has been achieved. The suitably protected chiro-inositol unit was prepared by an enantiospecific synthesis from L-xylose utilizing SmI2-mediated pinacol coupling as a key step.

  5. Seed coat darkening in Cowpea bean

    Science.gov (United States)

    Seed coat of cowpea bean (Vigna unguiculata L. Walp) slowly browns to a darker color during storage. High temperature and humidity during storage might contribute to this color change. Variation in browning rate among seeds in a lot leads to a mixture of seed colors creating an unacceptable product...

  6. Common bean and cowpea improvement in Angola

    Science.gov (United States)

    During 2014 and 2015, the Instituto de Investigação Agronómica (IIA) evaluated the performance of common bean (Phaselolus vulgaris L.) breeding lines and improved cowpea (Vigna unguiculata L. Walp.) varieties. The field experiments were planted in the lowlands at Mazozo and in the highlands at Chian...

  7. Evolutionary dynamics of satellite DNA repeats from Phaseolus beans.

    Science.gov (United States)

    Ribeiro, Tiago; Dos Santos, Karla G B; Richard, Manon M S; Sévignac, Mireille; Thareau, Vincent; Geffroy, Valérie; Pedrosa-Harand, Andrea

    2017-03-01

    Common bean (Phaseolus vulgaris) subtelomeres are highly enriched for khipu, the main satellite DNA identified so far in this genome. Here, we comparatively investigate khipu genomic organization in Phaseolus species from different clades. Additionally, we identified and characterized another satellite repeat, named jumper, associated to khipu. A mixture of P. vulgaris khipu clones hybridized in situ confirmed the presence of khipu-like sequences on subterminal chromosome regions in all Phaseolus species, with differences in the number and intensity of signals between species and when species-specific clones were used. Khipu is present as multimers of ∼500 bp and sequence analyses of cloned fragments revealed close relationship among khipu repeats. The new repeat, named jumper, is a 170-bp satellite sequence present in all Phaseolus species and inserted into the nontranscribed spacer (NTS) of the 5S rDNA in the P. vulgaris genome. Nevertheless, jumper was found as a high-copy repeat at subtelomeres and/or pericentromeres in the Phaseolus microcarpus lineage only. Our data argue for khipu as an important subtelomeric satellite DNA in the genus and for a complex satellite repeat composition of P. microcarpus subtelomeres, which also contain jumper. Furthermore, the differential amplification of these repeats in subtelomeres or pericentromeres reinforces the presence of a dynamic satellite DNA library in Phaseolus.

  8. Site-specific distribution and competitive ability of indigenous bean-nodulating rhizobia isolated from organic fields in Minnesota.

    Science.gov (United States)

    Wongphatcharachai, Manoosak; Wang, Ping; Staley, Christopher; Chun, Chan Lan; Ferguson, John A; Moncada, Kristine M; Sheaffer, Craig C; Sadowsky, Michael J

    2015-11-20

    Organic dry bean production systems have received increasing interest in many regions of the US, including Minnesota. Thus, improving biological N2 fixation would be highly beneficial for organic crop production. To date, only limited work has been done to select efficient N2-fixing rhizobia for organic dry bean production. In this study, soil samples from 25 organic fields in Minnesota, with a previous cropping history of dry beans, soybeans or both, were collected during May to July 2012. Genetic diversity of indigenous dry bean-rhizobia (511 isolates) was determined by using horizontal, fluorophore-enhanced, repetitive, extragenic, and palindromic-PCR (HFERP) DNA fingerprinting and isolates were classified as belonging to 58 different genotypes. The more abundant rhizobia isolated from bean nodules comprised 35.6% of the population. None of the isolates were identical to commonly-used commercial strains used in the U.S., including Rhizobium tropici CIAT899. Seventeen predominant genotypes were shown to represent two main species, Rhizobium leguminosarum bv. phaseoli (67.1%) and Rhizobium etli (30.2%). One of the indigenous strains, orgK9, displayed efficient N2-fixation and competitive ability relative to the commercial strains tested. The lack of large numbers of indigenous dry bean-rhizobia at most study sites will be useful to avoid competition problems between inoculant strains and indigenous rhizobia. This will allow inoculation with highly effective N2-fixing rhizobia, thus resulting in improved crop productivity. Our results highlight the existence of site-specific rhizobial genotypes in different organic fields and identify strains that may prove useful as novel inoculants for organic dry bean production systems.

  9. Construction of a comparative genetic map in faba bean (Vicia faba L.; conservation of genome structure with Lens culinaris

    Directory of Open Access Journals (Sweden)

    Avila Carmen M

    2008-08-01

    Full Text Available Abstract Background The development of genetic markers is complex and costly in species with little pre-existing genomic information. Faba bean possesses one of the largest and least studied genomes among cultivated crop plants and no gene-based genetic maps exist. Gene-based orthologous markers allow chromosomal regions and levels of synteny to be characterised between species, reveal phylogenetic relationships and chromosomal evolution, and enable targeted identification of markers for crop breeding. In this study orthologous codominant cross-species markers have been deployed to produce the first exclusively gene-based genetic linkage map of faba bean (Vicia faba, using an F6 population developed from a cross between the lines Vf6 (equina type and Vf27 (paucijuga type. Results Of 796 intron-targeted amplified polymorphic (ITAP markers screened, 151 markers could be used to construct a comparative genetic map. Linkage analysis revealed seven major and five small linkage groups (LGs, one pair and 12 unlinked markers. Each LG was comprised of three to 30 markers and varied in length from 23.6 cM to 324.8 cM. The map spanned a total length of 1685.8 cM. A simple and direct macrosyntenic relationship between faba bean and Medicago truncatula was evident, while faba bean and lentil shared a common rearrangement relative to M. truncatula. One hundred and four of the 127 mapped markers in the 12 LGs, which were previously assigned to M. truncatula genetic and physical maps, were found in regions syntenic between the faba bean and M. truncatula genomes. However chromosomal rearrangements were observed that could explain the difference in chromosome numbers between these three legume species. These rearrangements suggested high conservation of M. truncatula chromosomes 1, 5 and 8; moderate conservation of chromosomes 2, 3, 4 and 7 and no conservation with M. truncatula chromosome 6. Multiple PCR amplicons and comparative mapping were suggestive of

  10. A kinetic study of jack-bean urease denaturation by a new dithiocarbamate bismuth compound

    Science.gov (United States)

    Menezes, D. C.; Borges, E.; Torres, M. F.; Braga, J. P.

    2012-10-01

    A kinetic study concerning enzymatic inhibitory effect of a new bismuth dithiocarbamate complex on jack-bean urease is reported. A neural network approach is used to solve the ill-posed inverse problem arising from numerical treatment of the subject. A reaction mechanism for the urease denaturation process is proposed and the rate constants, relaxation time constants, equilibrium constants, activation Gibbs free energies for each reaction step and Gibbs free energies for the transition species are determined.

  11. Determination Of Some Morphological And Phenological Characteristics Of Local Dry Bean (Phaseolus vulgaris L.) Genotypes

    OpenAIRE

    2014-01-01

    It is extremely crucial that botanic gene resources are recorded and preserved in developing new species. Even though the materials are collected in a single city, there can emerge numerous variations to be observed among them. Detecting these variations is highly important for breeding studies. In this study, local dry bean genotypes have been collected from the city center of Giresun and other provinces in order to use on breeding studies for various purposes. It has been aimed that some mo...

  12. Field evaluation of effective microorganisms (EM) application for growth, nodulation, and nutrition of mung bean

    OpenAIRE

    Javaid, Arshad; BAJWA, Rukhsana

    2011-01-01

    Effective microorganisms (EM) is a commercial biofertilizer that contains a mixture of co-existing beneficial microorganisms collected from natural environments. Predominantly it consists of species of photosynthetic and lactic acid bacteria, yeast, and actinomycetes. The present study was conducted to evaluate the effect of EM application on growth, nodulation, yield, and nutrient uptake in mung bean [Vigna radiata (L.) Wilczek] var. NIAB Mung 98 under field conditions. Field soil was amende...

  13. Field evaluation of effective microorganisms (EM) application for growth, nodulation, and nutrition of mung bean

    OpenAIRE

    Javaid, Arshad; BAJWA, Rukhsana

    2014-01-01

    Effective microorganisms (EM) is a commercial biofertilizer that contains a mixture of co-existing beneficial microorganisms collected from natural environments. Predominantly it consists of species of photosynthetic and lactic acid bacteria, yeast, and actinomycetes. The present study was conducted to evaluate the effect of EM application on growth, nodulation, yield, and nutrient uptake in mung bean [Vigna radiata (L.) Wilczek] var. NIAB Mung 98 under field conditions. Field soil was amende...

  14. Microsatellite Markers for the Yam Bean Pachyrhizus (Fabaceae

    Directory of Open Access Journals (Sweden)

    Marc Delêtre

    2013-06-01

    Full Text Available Premise of the study: Microsatellite loci were developed for the understudied root crop yam bean (Pachyrhizus spp. to investigate intraspecific diversity and interspecific relationships within the genus Pachyrhizus. Methods and Results: Seventeen nuclear simple sequence repeat (SSR markers with perfect di- and trinucleotide repeats were developed from 454 pyrosequencing of SSR-enriched genomic libraries. Loci were characterized in P. ahipa and wild and cultivated populations of four closely related species. All loci successfully cross-amplified and showed high levels of polymorphism, with number of alleles ranging from three to 12 and expected heterozygosity ranging from 0.095 to 0.831 across the genus. Conclusions: By enabling rapid assessment of genetic diversity in three native neotropical crops, P. ahipa, P. erosus, and P. tuberosus, and two wild relatives, P. ferrugineus and P. panamensis, these markers will allow exploration of the genetic diversity and evolutionary history of the genus Pachyrhizus.

  15. Early interspecific interference in the wheat/faba bean (Triticum aestivum/ Vicia faba ssp. minor and rapeseed/squarrosum clover (Brassica napus var. oleifera/Trifolium squarrosum intercrops

    Directory of Open Access Journals (Sweden)

    Paolo Benincasa

    2012-04-01

    Full Text Available Most of research on intercrops evaluate performances and interference between species on the basis of final yield, while little knowledge is available on the interference in early stages and at the root level, at least for cultivated intercrops. In fact, in the few studies on this subject species are often combined minding at experimental needs (e.g. common substrate, temperature and water requirements, easy root separation more than at their actual use in the farm. The present work evaluates interspecific interference during early developmental stages for two intercrops of agricultural interest: soft wheat-faba bean and rapeseed-squarrosum clover. Improving this knowledge would help intercrop growth modelling and rational cultivation. The experiments were carried out on soft wheat (Triticum aestivum, faba bean (Vicia faba var. minor, rapeseed (Brassica napus var. oleifera and squarrosum clover (Trifolium squarrosum, germinated and grown until 32 days after sowing (DAS as one-species stands or as wheat/faba bean and rapeseed/squarrosum clover intercrops, with different densities and proportions for the two species in each couple. Germination was studied in controlled-temperature chamber, plantlet growth was studied on pots in the greenhouse. During germination no interspecific interference was observed for both wheat/faba bean and rapeseed/squarrosum clover intercrops. During plantlet growth, interspecific interference occurred in both intercrops causing variations in whole plant and root dry matter accumulation. In the wheat/faba bean intercrop each species suffered from the competitive effect of the companion species and faba bean was the dominant species when present in lower proportion than wheat. The unexpectedly high aggressivity of faba bean may be explained either with the greater seed size that could have represented an initial advantage within the short duration of the experiment or with the competition towards wheat for substrate N

  16. Effects of Atmospheric-Pressure N2, He, Air, and O2 Microplasmas on Mung Bean Seed Germination and Seedling Growth

    Science.gov (United States)

    Zhou, Renwu; Zhou, Rusen; Zhang, Xianhui; Zhuang, Jinxing; Yang, Size; Bazaka, Kateryna; (Ken) Ostrikov, Kostya

    2016-01-01

    Atmospheric-pressure N2, He, air, and O2 microplasma arrays have been used to investigate the effects of plasma treatment on seed germination and seedling growth of mung bean in aqueous solution. Seed germination and growth of mung bean were found to strongly depend on the feed gases used to generate plasma and plasma treatment time. Compared to the treatment with atmospheric-pressure O2, N2 and He microplasma arrays, treatment with air microplasma arrays was shown to be more efficient in improving both the seed germination rate and seedling growth, the effect attributed to solution acidification and interactions with plasma-generated reactive oxygen and nitrogen species. Acidic environment caused by air discharge in water may promote leathering of seed chaps, thus enhancing the germination rate of mung bean, and stimulating the growth of hypocotyl and radicle. The interactions between plasma-generated reactive species, such as hydrogen peroxide (H2O2) and nitrogen compounds, and seeds led to a significant acceleration of seed germination and an increase in seedling length of mung bean. Electrolyte leakage rate of mung bean seeds soaked in solution activated using air microplasma was the lowest, while the catalase activity of thus-treated mung bean seeds was the highest compared to other types of microplasma. PMID:27584560

  17. Effects of Atmospheric-Pressure N2, He, Air, and O2 Microplasmas on Mung Bean Seed Germination and Seedling Growth

    Science.gov (United States)

    Zhou, Renwu; Zhou, Rusen; Zhang, Xianhui; Zhuang, Jinxing; Yang, Size; Bazaka, Kateryna; (Ken) Ostrikov, Kostya

    2016-09-01

    Atmospheric-pressure N2, He, air, and O2 microplasma arrays have been used to investigate the effects of plasma treatment on seed germination and seedling growth of mung bean in aqueous solution. Seed germination and growth of mung bean were found to strongly depend on the feed gases used to generate plasma and plasma treatment time. Compared to the treatment with atmospheric-pressure O2, N2 and He microplasma arrays, treatment with air microplasma arrays was shown to be more efficient in improving both the seed germination rate and seedling growth, the effect attributed to solution acidification and interactions with plasma-generated reactive oxygen and nitrogen species. Acidic environment caused by air discharge in water may promote leathering of seed chaps, thus enhancing the germination rate of mung bean, and stimulating the growth of hypocotyl and radicle. The interactions between plasma-generated reactive species, such as hydrogen peroxide (H2O2) and nitrogen compounds, and seeds led to a significant acceleration of seed germination and an increase in seedling length of mung bean. Electrolyte leakage rate of mung bean seeds soaked in solution activated using air microplasma was the lowest, while the catalase activity of thus-treated mung bean seeds was the highest compared to other types of microplasma.

  18. Host preference of the bean weevil Zabrotes subfasciatus

    Institute of Scientific and Technical Information of China (English)

    Isabel Ribeiro do Valle Teixeira; Angel Roberto Barchuk; Fernando Sérgio Zucoloto

    2008-01-01

    It is largely known that the range of an insect diet is mostly determined by oviposition behavior, mainly in species with endophytic larvae such as Zabrotes subfasciatus.However, the proximate factors determining host choice and the subsequent steps leading to the expansion or reduction of the host number and occasional host shifts are largelyun known. We analyzed various factors determining host preference of Z. subfasciatus through the evaluation of: (i) oviposition preference of a wild population of Z. subfasciatus on the usual host (bean) and unusual hosts (lentil, chickpea and soy), and the performance of the offspring; (ii) artificial selection for increasing preference for hosts initially less frequently chosen; (iii) comparison of oviposition behavior between two different popula-tions (reared for~30 generations in beans or chickpeas, respectively); (iv) oviposition timing on usual and unusual hosts; and (v) identification of preference hierarchies. We found that when using unusual hosts, there is no correlation between performance and preference and that the preference hierarchy changes only slightly when the population passes through several generations on the less frequently accepted host. We also found a positive response to artificial selection for increasing oviposition on the less preferred host; however, when the host-choice experiment involved two varieties of the usual host, the response was faster than when the choice involved usual and unusual hosts. Finally, beetles reared on an unusual host (chickpea) for 26 generations showed similar good fitness on both usual and unusual hosts,indicating that the use of a new host does not necessarily result in the loss of performance on the original host. Nevertheless, this population showed lower fitness on the usual host than that of the original population, suggesting an underlying partial trade-off phenomenon which may contribute to a broadening of diet of this insect species.

  19. Zinc supplementation, production and quality of coffee beans

    Directory of Open Access Journals (Sweden)

    Herminia Emilia Prieto Martinez

    2013-04-01

    Full Text Available Besides its importance in the coffee tree nutrition, there is almost no information relating zinc nutrition and bean quality. This work evaluated the effect of zinc on the coffee yield and bean quality. The experiment was conducted with Coffea arabica L. in "Zona da Mata" region, Minas Gerais, Brazil. Twelve plots were established at random with 4 competitive plants each. Treatments included plants supplemented with zinc (eight plots and control without zinc supplementation (four plots. Plants were subjected to two treatments: zinc supplementation and control. Yield, number of defective beans, beans attacked by berry borers, bean size, cup quality, beans zinc concentration, potassium leaching, electrical conductivity, color index, total tritable acidity, pH, chlorogenic acids contents and ferric-reducing antioxidant activity of beans were evaluated. Zinc positively affected quality of coffee beans, which presented lower percentage of medium and small beans, lower berry borer incidence, lower potassium leaching and electrical conductivity, higher contents of zinc and chlorogenic acids and higher antioxidant activity in comparison with control beans.

  20. Selection of common bean (Phaseolus vulgaris L.) genotypes using a genotype plus genotype x environment interaction biplot.

    Science.gov (United States)

    Corrêa, A M; Teodoro, P E; Gonçalves, M C; Santos, A; Torres, F E

    2016-08-05

    Recently, the genotype plus genotype x environment interaction (GGE) biplot methodology has been used to investigate genotype x environment interactions in several crop species, but has not been applied to the common bean (Phaseolus vulgaris L.) crop in Brazil. The aim of this study was to identify common bean genotypes that exhibit high grain yield and stability in the State of Mato Grosso do Sul, Brazil. We conducted 12 trials from 2000 to 2006 in the municipalities of Aquidauana and Dourados, and evaluated 13 genotypes in a randomized block design with three replications. Grain yield data were subjected to individual and joint analyses of variance. After analyzing the GE interaction, the adaptability and phenotypic stability of the common bean genotypes were analyzed using GGE biplot methodology. The genotypes EMGOPA-201, Xamego, and Aporé are recommended for growing in Mato Grosso do Sul, because they exhibited high grain yield and phenotypic stability.

  1. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress.

    Science.gov (United States)

    Sharma, Ved Parkash; Singh, Harminder Pal; Kohli, Ravinder Kumar; Batish, Daizy Rani

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 microW cm(-2); 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H(2)O(2)) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at > or =2 h), and radicle and plumule growths (> or =1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H(2)O(2) accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  2. Deficiency symptoms and uptake of micronutrients by castor bean grown in nutrient solution

    Directory of Open Access Journals (Sweden)

    José Lavres Junior

    2012-02-01

    Full Text Available Castor bean is a nutrient-demanding species, but there is still little information on its micronutrient requirements. The objectives of this study were to evaluate the effects of levels of B (2.5, 12.5 and 25.0 µmol L-1, Cu (0.05, 0.25 and 0.50 µmol L-1, Mn (0.2, 1.0 and 2.0 µmol L-1 and Zn (0.2, 1.0 and 2.0 µmol L-1 in a nutrient solution on plant B, Cu, Mn and Zn concentrations and uptake, vegetative growth and fruit yield of castor bean "Iris", grown in greenhouse. The experiment was arranged in a completely randomized block design with three replicates. The first deficiency symptoms were observed for B, followed by Zn, Cu and Mn. The main changes in the cell ultrastructure due to lack of B were thickening of the cell walls and middle lamellae, distorted chloroplasts and tightly stacked thylakoids, besides the absence of starch grains. The Mn, Zn and Cu deficiencies led to disruption of chloroplasts, disintegration of thylakoids and absence of amyloplasts. The concentration and uptake of B, Cu, Mn, and Zn in castor bean plants increased with micronutrient supply in the solution. Fruit yield was drastically reduced by B and Mn deficiencies. On the other hand, the dry matter yield of the shoot and root of castor bean plants was not. In the treatment with full nutrient solution, the leaves accumulated 56 and 48 % of the total B and Mn taken up by the plants, respectively, and the seeds and roots 85 and 61 % of the total Cu and Zn taken up, respectively. This shows the high demand of castor bean Iris for B and Mn for fruit yield.

  3. Mobile phone radiation inhibits Vigna radiata (mung bean) root growth by inducing oxidative stress

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ved Parkash [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Department of Zoology, Panjab University, Chandigarh 160014 (India); Singh, Harminder Pal, E-mail: hpsingh_01@yahoo.com [Department of Environment and Vocational Studies, Panjab University, Chandigarh 160014 (India); Kohli, Ravinder Kumar; Batish, Daizy Rani [Department of Botany, Panjab University, Chandigarh 160014 (India)

    2009-10-15

    During the last couple of decades, there has been a tremendous increase in the use of cell phones. It has significantly added to the rapidly increasing EMF smog, an unprecedented type of pollution consisting of radiation in the environment, thereby prompting the scientists to study the effects on humans. However, not many studies have been conducted to explore the effects of cell phone EMFr on growth and biochemical changes in plants. We investigated whether EMFr from cell phones inhibit growth of Vigna radiata (mung bean) through induction of conventional stress responses. Effects of cell phone EMFr (power density: 8.55 {mu}W cm{sup -2}; 900 MHz band width; for 1/2, 1, 2, and 4 h) were determined by measuring the generation of reactive oxygen species (ROS) in terms of malondialdehyde and hydrogen peroxide (H{sub 2}O{sub 2}) content, root oxidizability and changes in levels of antioxidant enzymes. Our results showed that cell phone EMFr significantly inhibited the germination (at {>=}2 h), and radicle and plumule growths ({>=}1 h) in mung bean in a time-dependent manner. Further, cell phone EMFr enhanced MDA content (indicating lipid peroxidation), and increased H{sub 2}O{sub 2} accumulation and root oxidizability in mung bean roots, thereby inducing oxidative stress and cellular damage. In response to EMFr, there was a significant upregulation in the activities of scavenging enzymes, such as superoxide dismutases, ascorbate peroxidases, guaiacol peroxidases, catalases and glutathione reductases, in mung bean roots. The study concluded that cell phone EMFr inhibit root growth of mung bean by inducing ROS-generated oxidative stress despite increased activities of antioxidant enzymes.

  4. Methylxanthine and catechin content of fresh and fermented cocoa beans, dried cocoa beans, and cocoa liquor

    Directory of Open Access Journals (Sweden)

    Pedro P. Peláez

    2016-01-01

    Full Text Available The theobromine and catechin content can affect the quality of cocoa liquor and is influenced by cacao variety, production area (PA, and fermentation, as well as the method of drying beans (FDB and cocoa liquor production (CLP. This study examined variationsin methylxanthine and catechin levels in fresh and fermented cocoa beans, dried cocoa grains, and in cocoa liquor from Trinitario, Criollo, and Forastero cacao varieties. A total of 123 cocoa bean samples from three Peruvian PAs at different altitudes, Tingo María (TM, San Alejandro (SA, and Curimana (CU, were evaluated. The theobromine (Tb and caffeine (Cf contents in fresh cocoa beans were affected by both cocoa type and PA. The caffeine content was higher in Trinitario cacao than in Criollo and Forastero varieties (p ≤ 0.05. The Tb and CF contents decreased in dry cocoa grain and was affected by FDB (p ≤ 0.05 (1.449 ± 0.004 to 1.140 ± 0.010 and 0.410 ± 0.03 to 0.165 ± 0.02 g Tb and C, respectively, per 100 g dry weight. Cocoa beans from Tingo María, which has thehighest altitude, had higher Tb and CF contents than those from other PAs. The catechin (C and epicatechin (EC contents were affected by the FDB and CLP, and were highestin fresh cocoa beans from the Tingo María area (range: 0.065 ± 0.01 to 0.020 ± 0.00 g C/100 g. The C and EC contents decreased during FDB and CLP (0.001 g C/100 g of cocoa liquor. Taken together, these results show that higher concentrations of Tb, Cf, C,and EC are present in fresh cocoa beans. Moreover, the cocoa variety influenced cocoa liquor quality. Overall, cocoa from the Tingo María PA had the most desirable chemical composition.

  5. An SSR-based linkage map of yardlong bean (Vigna unguiculata (L.) Walp. subsp. unguiculata Sesquipedalis Group) and QTL analysis of pod length.

    Science.gov (United States)

    Kongjaimun, Alisa; Kaga, Akito; Tomooka, Norihiko; Somta, Prakit; Shimizu, Takehiko; Shu, Yujian; Isemura, Takehisa; Vaughan, Duncan A; Srinives, Peerasak

    2012-02-01

    Yardlong bean (Vigna unguiculata (L.) Walp. subsp. unguiculata Sesquipedalis Group) (2n = 2x = 22) is one of the most important vegetable legumes of Asia. The objectives of this study were to develop a genetic linkage map of yardlong bean using SSR makers from related Vigna species and to identify QTLs for pod length. The map was constructed from 226 simple sequence repeat (SSR) markers from cowpea (Vigna unguiculata (L.) Walp. subsp. unguiculata Unguiculata Group), azuki bean (Vigna angularis (Willd.) Ohwi & Ohashi), and mungbean (Vigna radiata (L.) Wilczek) in a BC(1)F(1) ((JP81610 × TVnu457) × JP81610) population derived from the cross between yardlong bean accession JP81610 and wild cowpea (Vigna unguiculata subsp. unguiculata var. spontanea) accession TVnu457. The markers were clustered into 11 linkage groups (LGs) spanning 852.4 cM in total length with a mean distance between adjacent markers of 3.96 cM. All markers on LG11 showed segregation distortion towards the homozygous yardlong bean JP81610 genotype. The markers on LG11 were also distorted in the rice bean (Vigna umbellata (Thunb.) Ohwi & Ohashi) map, suggesting the presence of common segregation distortion factors in Vigna species on this LG. One major and six minor QTLs were identified for pod length variation between yardlong bean and wild cowpea. Using flanking markers, six of the seven QTLs were confirmed in an F(2) population of JP81610 × TVnu457. The molecular linkage map developed and markers linked to pod length QTLs would be potentially useful for yardlong bean and cowpea breeding.

  6. Genetic diversity of Rhizobium from nodulating beans grown in a variety of Mediterranean climate soils of Chile.

    Science.gov (United States)

    Baginsky, Cecilia; Brito, Belén; Scherson, Rosita; Pertuzé, Ricardo; Seguel, Oscar; Cañete, Alejandro; Araneda, Cristian; Johnson, Warren E

    2015-04-01

    In spite of potentially being an important source of rhizobial diversity and a key determinant of common bean productivity, there is a paucity of data on Rhizobium genetic variation and species composition in the important bean producing area of Chile and only one species has been documented (Rhizobium leguminosarum). In this study, 240 Rhizobium isolates from Torcaza bean (Phaseolus vulgaris L.) nodules established in the highest bean producing area in Chile (33°34'S-70°38'W and 37°36'S-71°47'W) were characterized by PCR-RFLP markers for nodC gene, revealing eight banding patterns with the polymorphic enzyme Hinf I. The locality of San Agustín de Aurora in Central Chile (35°32'S-71°29'W) had the highest level of diversity. Isolates were classified by species using PCR-RFLP markers for 16S rDNA gene and were confirmed by sequencing an internal fragment of the 16S rDNA gene. The results confirmed the presence of R. leguminosarum and three other species of rhizobia nodulating beans in South Central Chile (R. etli, R. tropici and R. leucaenae). R. tropici and R. leucaenae showed the least genetic variation and were most commonly identified in acid soils, while R. etli was the most common species in slightly acidic to moderately alkaline soils, with higher levels of organic matter content. R. leguminosarum was identified in almost all soils, was the most genetically diverse, and was the most common, being documented in soils with pH that ranged between 5.3 and 8.2, and with organic matter content between 2.1 and 4 %.

  7. Rutaceae sampled from Germany, Malta, and Mallorca (Spain) are associated with AMF clustering with Glomus hoi Berch & Trappe.

    Science.gov (United States)

    Appelhans, M; Weber, H Chr; Imhof, S

    2008-07-01

    Six Rutaceae species collected from natural habitats (Malta, Mallorca (Spain), and Tenerife (Spain)) and the Botanical Garden in Marburg were examined with respect to mycorrhizal structures and fungal identity. All species have the same gross colonization pattern of arbuscular mycorrhiza (AM) with distinct intracellular and intercellular phases but show remarkable differences in details, especially in terms of the extent of the intracellular phase. The associated AM fungi, identified using molecular methods, cluster together with Glomus hoi Berch & Trappe, although the plants were collected from very distant locations.

  8. Ion beam analysis of ground coffee and roasted coffee beans

    Science.gov (United States)

    Debastiani, R.; dos Santos, C. E. I.; Yoneama, M. L.; Amaral, L.; Dias, J. F.

    2014-01-01

    The way that coffee is prepared (using roasted ground coffee or roasted coffee beans) may influence the quality of beverage. Therefore, the aim of this work is to use ion beam techniques to perform a full elemental analysis of packed roasted ground coffee and packed roasted coffee beans, as well as green coffee beans. The samples were analyzed by PIXE (particle-induced X-ray emission). Light elements were measured through RBS (Rutherford backscattering spectrometry) experiments. Micro-PIXE experiments were carried out in order to check the elemental distribution in the roasted and green coffee beans. In general, the elements found in ground coffee were Mg, P, S, Cl, K, Ca, Ti, Mn, Fe, Cu, Zn, Rb and Sr. A comparison between ground coffee and grinded roasted beans shows significant differences for several elements. Elemental maps reveal that P and K are correlated and practically homogeneously distributed over the beans.

  9. Safety assessment of the biogenic amines in fermented soya beans and fermented bean curd.

    Science.gov (United States)

    Yang, Juan; Ding, Xiaowen; Qin, Yingrui; Zeng, Yitao

    2014-08-06

    To evaluate the safety of biogenic amines, high performance liquid chromatography (HPLC) was used to evaluate the levels of biogenic amines in fermented soya beans and fermented bean curd. In fermented soya beans, the total biogenic amines content was in a relatively safe range in many samples, although the concentration of histamine, tyramine, and β-phenethylamine was high enough in some samples to cause a possible safety threat, and 8 of the 30 samples were deemed unsafe. In fermented bean curd, the total biogenic amines content was more than 900 mg/kg in 19 white sufu amples, a level that has been determined to pose a safety hazard; putrescine was the only one detected in all samples and also had the highest concentration, which made samples a safety hazard; the content of tryptamine, β-phenethylamine, tyramine, and histamine had reached the level of threat to human health in some white and green sufu samples, and that may imply another potential safety risk; and 25 of the 33 samples were unsafe. In conclusion, the content of biogenic amines in all fermented soya bean products should be studied and appropriate limits determined to ensure the safety of eating these foods.

  10. Dynamics of Cocoa Bean Pulp Degradation during Cocoa Bean Fermentation: Effects of Yeast Starter Culture Addition

    Directory of Open Access Journals (Sweden)

    Laras Cempaka

    2014-07-01

    Full Text Available Fermentation is a crucial step in the post-harvest processing of cocoa beans. This process comprises mixed culture microbial activities on the cocoa bean pulp, producing metabolites that act as important precursors for cocoa flavour development. Variations in the microbial population dynamics during the fermentation process may induce changes in the overall process. Thus, the introduction of a specific microbial starter culture may improve the quality of the fermentation. This article discusses the effects ofthe addition of Saccharomyces cerevisae var. Chevalieri starter culture on cocoa bean fermentation. The dynamics in the yeast concentration, sugary pulp compounds and metabolic products were measured during fermentation. The alterations in the dynamic metabolite profile were significant, although only a slight difference was observed in the yeast population. A higher fermentation index was measured for the cocoa bean fermentation with yeast starter culture, 1.13 compared to 0.84. In conclusion, this method can potentially be applied to shorten the cocoa bean fermentation time.

  11. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis) Cultivars Differing in Chilling Tolerance under Cold Stress.

    Science.gov (United States)

    Tan, Huaqiang; Huang, Haitao; Tie, Manman; Tang, Yi; Lai, Yunsong; Li, Huanxiu

    2016-01-01

    Cowpea (V. unguiculata L. Walp.) is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars-"Dubai bean" and "Ningjiang-3", which are tolerant and sensitive to chilling, respectively-were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18%) had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs) in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic engineering, and

  12. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis Cultivars Differing in Chilling Tolerance under Cold Stress.

    Directory of Open Access Journals (Sweden)

    Huaqiang Tan

    Full Text Available Cowpea (V. unguiculata L. Walp. is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars-"Dubai bean" and "Ningjiang-3", which are tolerant and sensitive to chilling, respectively-were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18% had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic

  13. Chemical and Sensorial Evaluation of a Newly Developed Bean Jam

    OpenAIRE

    Guiné, Raquel; Figueiredo, Ana; Correia, Paula; Gonçalves, Fernando

    2015-01-01

    The purpose of the present work was to develop an innovative food product with nutritional properties as well as appealing organoleptic qualities. The product, a jam, was prepared with the beans’ cooking water combined with fresh apple or carrot, without the addition of any conservatives. Three different jams were produced: bean and carrot, bean and apple and bean, apple and cinnamon. The developed products underwent a sensorial...

  14. Bean grain hysteresis with induced mechanical damage

    Directory of Open Access Journals (Sweden)

    Renata C. Campos

    Full Text Available ABSTRACT This study aimed to evaluate the effect of mechanical damage on the hysteresis of beans with induced mechanical damage under different conditions of temperature and relative humidity. Beans (Phaseolus vulgaris L. harvested manually with 35% water content (w.b. were used. Part of this product was subjected to induced mechanical damage by Stein Breakage Tester and controlled drying (damaged and control sample, for sorption processes. The sorption isotherms of water were analyzed for different temperature conditions: 20, 30, 40 and 50 oC; and relative humidity: 0.3; 0.4; 0.5; 0.7 and 0.9 (decimal. Equilibrium moisture content data were correlated with six mathematical models, and the Modified Oswin model was the one that best fitted to the experimental data. According to the above mentioned isotherms, it was possible to observe the phenomenon of hysteresis of damaged and control samples, and this phenomenon was more pronounced in control ones.

  15. Nutritional characteristics of biofortified common beans

    Directory of Open Access Journals (Sweden)

    Priscila Brigide

    2014-09-01

    Full Text Available Iron and zinc deficiency can cause anemia and alterations in the immune response and impair work capacity. To minimize this problem, biofortification has been developed to improve and/or maintain the nutritional status of the population. Beans are an important source of carbohydrates, proteins, and minerals. The objective of this study is to characterize biofortified beans, quantify the minerals in different cultivars, and determine mineral dialysis. Grains of raw and cooked beans were analyzed for moisture, protein, lipids, fiber, minerals, and in vitro availability using four treatments and one control. The data were analyzed using ANOVA, and the Tukey test (p<0.05. The chemical composition of the raw and cooked treatments showed a moisture content ranging from 13.4 to 81.4%, protein from 22.24 to 31.59%, lipids from 1.66 to 2.22%, fiber from 16.81 to 40.63%, carbohydrates from 27.80 to 34.78%, and ash from 4.1 to 4.82%. Different varieties of beans showed statistically significant differences in iron and zinc content compared to the control cultivar (Pérola. The iron content differed significantly from that of the Pérola cultivar in the raw treatment, while in the cooked treatment, the control cultivar did not differ from the Piratã. The same behavior was observed for the zinc content in both treatments. There was no significant difference between the cultivars in the treatments in terms of the content of the dialysis of Calcium (Ca, Iron (Fe, Magnesium (Mg, and Zinc (Zn.

  16. Presence of Aspergillus and other fungal symbionts in coffee beans from Colombia

    Directory of Open Access Journals (Sweden)

    Gamboa-Gaitán Miguel Ángel

    2012-04-01

    Full Text Available Fungi are common inhabitants of plants and plant-derived products. Some of these fungal species are potentially dangerous to human health since they are able to produce chemical substances that alter normal physiological activity. There are no studies about natural mycoflora associated with coffee beans in Colombia, and nothing is known about the presence and abundance of toxigenic fungal species in Colombian coffee. In this study 5,000 coffee beans were studied by plating them on potato-based artificial culture medium and it was shown that potentially toxigenic fungal taxa (mostly from genera Aspergillus, Fusarium, Penicillium, are currently found in Colombian coffee beans. This is true for all steps of coffee processing, from berries in trees to toasted grains, including packed coffee ready for retail in supermarkets. Results show that the distribution of these fungi is not random among different steps of coffee processing, which means that some steps are more vulnerable to infection with some fungi that others. The convenience of establishing a program devoted to detect fungi and/or mycotoxins in Colombian commodities, specially coffee, is discussed here.

  17. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  18. The Effective Design of Bean Bag as a Vibroimpact Damper

    Directory of Open Access Journals (Sweden)

    A.Q. Liu

    2000-01-01

    Full Text Available The technique of a bean bag damper has been effectively applied in many engineering fields to control the vibroimpact of a structural system. In this study, the basic parameters responsible for the design of an effective bean bag: the size of beans, the mass ratio of the bean bag to the structure to which it is attached, the clearance distance and the position of the bag, are studied by both theoretical and experimental analyses. These will provide a better understanding of the performance of the bean bag for optimisation of damper design. It was found that reducing the size of beans would increase the exchange of momentum in the system due to the increase in the effective contact areas. Within the range of mass ratios studied, the damping performance of the damper was found to improve with higher mass ratios. There was an optimum clearance for any specific damper whereby the maximum attenuation could be achieved. The position of the bag with respect to nodes and antipodes of the primary structure determined the magnitude of attenuation attainable. Furthermore, the limitations of bean bags have been identified and a general criteria for the design of a bean bag damper has been formulated based on the study undertaken. It was shown that an appropriately configured bean bag damper was capable of reducing the amplitude of vibration by 80% to 90%.

  19. Yam bean oleoresin and seed quality of common bean infested by Acanthoscelides obtectus Say.

    OpenAIRE

    Rangel-Lucio, José Antonio; Juárez-Goiz, José Mayolo; García-Moya, Edmundo; Fernández-Andrés, María Dolores; Rodríguez-Hernández, Cesáreo; Alvarado-Bárcenas, Estéfana

    2011-01-01

    The objective of this investigation was to evaluate the effect of yam bean oleoresin on common bean seed quality and bean weevil control. The oleoresin extract was obtained by the HPLC technique, the presence of rotenone was detected(15 mg/l). Three concentrations of oleoresin extract were tested (Ci, g/ml): C1 (5x10-7, 5x10-6, …5x10-2); C2 (1x10-2, 2x10-2,…6x10-2); C3 (5x10-1, 6x10-1,…9x10-1) and one control treatment per concentration, applied to recipients of 300 ml with 50 g of common bea...

  20. Fate of allelopathic substances in space--allelopathy of velvet bean plant and gravity.

    Science.gov (United States)

    Tomita-Yokotani, Kaori; Hashimoto, Hirofumi; Fujii, Yoshiharu; Nakamura, Teruko; Yamashita, Masamichi

    2004-11-01

    Interactions between organisms and species have been long known. It has not been known that the interactive phenomena (allelopathy) may (or may not) differ in space from those on earth. We have studied the gravitational effects on allelopathy by exposing a plant-plant system to pseudo-microgravity, which was generated by a 3D-clinostat. We hypothesized that allelopathy would be modified under altered gravity. L-DOPA (L-3,4-dihydroxyphenylalanine) is known to be the major substance in the allelopathy of velvet bean, released from its root. It has been found that there have been some differences of the allelopathic action of velvet bean plant under pseudo-microgravity. Biosynthesis, release, transport and sensing mechanism associated with allelopathy might be affected by gravity.

  1. Populational survey of arthropods on transgenic common bean expressing the rep gene from Bean golden mosaic virus

    OpenAIRE

    Pinheiro, Patrícia V; Quintela, Eliane D; Ana Maria R. Junqueira; Aragão, Francisco JL; Faria, Josias C

    2014-01-01

    Genetically modified (GM) crops is considered the fastest adopted crop technology in the history of modern agriculture. However, possible undesirable and unintended effects must be considered during the research steps toward development of a commercial product. In this report we evaluated effects of a common bean virus resistant line on arthropod populations, considered as non-target organisms. This GM bean line (named M1/4) was modified for resistance against Bean golden mosaic virus (BGMV) ...

  2. Impact of Long Dry Season on Bean Characteristics of Robusta Coffee (Coffea canephora

    Directory of Open Access Journals (Sweden)

    Ucu Sumirat

    2008-07-01

    Full Text Available Bean characteristics in Robusta coffee (Coffea canephora should be taken into considerations in coffee breeding. Beside genetic factor, environment has been known as an important factor in the formation and change of composition of bean characteristics. This research aimed to find out the effect of long dry season on changes of bean characteristics. The population observed consisted of 277 genotypes originated from reciprocal crossings of three parental namely BP 409, BP 961 and Q 121. Observation was conducted in Kaliwining Experimental Garden of ICCRI in Jember, East Java during two years with different drought intensity i.e. 2005—2006 and 2006—2007 production years. The result showed that long dry season decreased the range value of population of normal beans, pea beans and triage beans, and followed by decreasing in the mean value except for normal beans. Long dry season also influence the change of value range of empty bean to higher proportion, and followed by increasing in the mean value. Distribution pattern of normal beans tend in to remain at high proportion, in contrast to those of pea and triage beans. In other side, long dry season tended to change distribution pattern of empty beans to at high proportion. Correlation analysis among beans characteristics showed that normal beans had negative correlations with pea beans and empty beans. Pea beans had a positive correlation with empty beans. Long dry season decreased proportion of pea bean and triage bean, in contrast to those of empty beans. Increasing proportion of empty bean was caused by failure of growth to normal bean under stress condition. Key words : Coffee canephora, bean characteristics, long dry season, variation, correlation, composition.

  3. Pretreatment of African yam bean (Sphenostylis stenocarpa): effect of soaking and blanching on the quality of African yam bean seed.

    Science.gov (United States)

    Aminigo, Ebiokpo R; Metzger, Lloyd E

    2005-12-01

    The effect of pretreatment (soaking in sodium salts and blanching) on hydration coefficient (HC), chemical composition, texture, and color of African yam bean (AYB) was investigated. Soaking in water and in salt solutions increased the HC and about 90% of final HC values were attained at 12 and 4 hr of soaking for whole and dehulled beans, respectively. Protein content was slightly increased by soaking and blanching while ash and fat contents were reduced. Generally, a combination of dehulling and wet-processing reduced firmness of the beans more than soaking or blanching of the whole beans. Antioxidant activity was lowest (3260 TE(3)100 g) in cream-colored beans and highest (16,600 TE/100 g) in brown-colored beans. The tannin contents of unprocessed cream-colored beans and dehulled wet-processed marble variety were not significantly different (p > 0.05). The levels of tannins in the marble variety were reduced by blanching for 40 min (19.2%), soaking for 12 hr (16.0%), dehulling (72.0%), dehulling and blanching (88.8%). The whiteness of bean flours was increased significantly by dehulling, slightly by wet-processing of marble variety, and reduced significantly by wet-processing of cream-colored beans.

  4. Novel Rhizobium lineages isolated from root nodules of the common bean (Phaseolus vulgaris L.) in Andean and Mesoamerican areas.

    Science.gov (United States)

    Ribeiro, Renan Augusto; Ormeño-Orrillo, Ernesto; Dall'Agnol, Rebeca Fuzinatto; Graham, Peter H; Martinez-Romero, Esperanza; Hungria, Mariangela

    2013-09-01

    The taxonomic affiliations of nineteen root-nodule bacteria isolated from the common bean (Phaseolus vulgaris L.) in Mexico, Ecuador and Brazil were investigated by analyses of 16S rRNA and of four protein-coding housekeeping genes. One strain from Mexico could be assigned to Rhizobium etli and two from Brazil to Rhizobium leucaenae, whereas another from Mexico corresponded to a recently described bean-nodulating species-level lineage related to R. etli and Rhizobium phaseoli. Ten strains isolated in Ecuador and Mexico corresponded to three novel Rhizobium lineages that fall into the R. phaseoli/R. etli/Rhizobium leguminosarum clade. One of those lineages, with representatives isolated mostly from Ecuador, seems to be dominant in beans from that Andean region. Only one of the Mexican strains clustered within the Rhizobium tropici clade, but as an independent lineage. Interestingly, four strains were affiliated with species within the Rhizobium radiobacter clade. The existence of yet non-described native Rhizobium lineages in both the Andean and Mesoamerican areas is discussed in relation to common-bean diversity and environmental conditions.

  5. Antioxidant activity of black bean (Phaseolus vulgaris L.) protein hydrolysates

    Science.gov (United States)

    The objective of this work was to study the effect of enzymatic hydrolysis of black bean protein concentrate using different enzymes. Bean proteins were extracted and hydrolyzed over a period of 120 min using the enzymes pepsin or alcalase. The protein hydrolysates’ molecular weight was assayed by e...

  6. Examining growth, yield and bean quality of Ethiopian coffee trees

    NARCIS (Netherlands)

    Bote, Adugna

    2016-01-01

    Coffee (Coffeaarabica L.)bean production and quality are determined by a diversity of interacting factors (e.g. shade, nitrogen, crop traits). Bean yield increases with increase in radiation, but adequate fertilizer suppliesare needed to sustain the productivity. This thesis analysed coffee tree gro

  7. Incentives for cocoa bean production in Ghana: Does quality matter?

    NARCIS (Netherlands)

    Quarmine, W.; Haagsma, R.; Sakyi-Dawson, O.; Asante, F.; Huis, van A.; Obeng-Ofori, D.

    2012-01-01

    This paper investigates the institutional factors that constrain farmers’ incentives to enhance the quality of cocoa beans in Ghana. Data were collected at three levels of aggregation in the cocoa bean value chain: village, district, and national level. Multi-stage cluster sampling was employed to s

  8. Variability for Biological Nitrogen Fixation Capacity in Beans

    Science.gov (United States)

    As legumes, common beans have the capacity to form a symbiotic relationship with soil bacteria called rhizobia and fix nitrogen from the atmosphere. Common beans however are considered to be poor nitrogen fixers as compared to other legumes. Identification of genetic variability for N fixation capac...

  9. The composition of wax and oil in green coffee beans

    NARCIS (Netherlands)

    Folstar, P.

    1976-01-01

    Methods for the isolation of wax and oil from green coffee beans were studied and a method for the quantitative extraction of coffee oil from the beans was introduced. Coffee wax, coffee oil and wax-free coffee oil as well as the unsaponifiable matter prepared from each were fractionated by column c

  10. IRON, ZINC, AND FERRITIN ACCUMULATION IN COMMON BEANS

    DEFF Research Database (Denmark)

    Urbanski, Dorian Fabian; Sørensen, Kirsten; Jurkiewicz, Anna Malgorzata

      that the distribution of iron is dependant on the genotype. Using immunolocalization, we visualized the localization of  ferritin in mature common bean seeds.   This knowledge can contribute to the discovery of factors that affect the bioavailability of micronutrients and  can contribute to breeding common beans...

  11. Occurrence and distribution of viruses infecting the bean in Serbia

    Directory of Open Access Journals (Sweden)

    Petrović Dragana

    2010-01-01

    Full Text Available This work describes the incidence and distribution of the most important bean viruses in Serbia: Bean common mosaic virus (BCMV, Bean common mosaic necrosis virus (BCMNV, Bean yellow mosaic virus (BYMV, Cucumber mosaic virus (CMV and Alfalfa mosaic virus (AMV. The viral isolates were characterized serologically and biologically. BCMV was found in the largest number of plants (30.53%, followed by BCMNV (2.67%, CMV (5.34%, and AMV (3.41%, since BYMV was not determined. Mixed viral infections were found in several samples. The RT-PCR method was used to prove that the tested isolates belong to the BCMV, family Potyviridae and strains Russian and NL-3 D. Results obtained in this work will enable further studies of the genetic variability of bean virus isolates from Serbia. .

  12. Transcriptome Profiling of Two Asparagus Bean (Vigna unguiculata subsp. sesquipedalis) Cultivars Differing in Chilling Tolerance under Cold Stress

    Science.gov (United States)

    Tan, Huaqiang; Huang, Haitao; Tie, Manman; Tang, Yi; Lai, Yunsong; Li, Huanxiu

    2016-01-01

    Cowpea (V. unguiculata L. Walp.) is an important tropical grain legume. Asparagus bean (V. unguiculata ssp. sesquipedialis) is a distinctive subspecies of cowpea, which is considered one of the top ten Asian vegetables. It can be adapted to a wide range of environmental stimuli such as drought and heat. Nevertheless, it is an extremely cold-sensitive tropical species. Improvement of chilling tolerance in asparagus bean may significantly increase its production and prolong its supply. However, gene regulation and signaling pathways related to cold response in this crop remain unknown. Using Illumina sequencing technology, modification of global gene expression in response to chilling stress in two asparagus bean cultivars—“Dubai bean” and “Ningjiang-3”, which are tolerant and sensitive to chilling, respectively—were investigated. More than 1.8 million clean reads were obtained from each sample. After de novo assembly, 88,869 unigenes were finally generated with a mean length of 635 bp. Of these unigenes, 41,925 (47.18%) had functional annotations when aligned to public protein databases. Further, we identified 3,510 differentially expressed genes (DEGs) in Dubai bean, including 2,103 up-regulated genes and 1,407 down-regulated genes. While in Ningjiang-3, we found 2,868 DEGs, 1,786 of which were increasing and the others were decreasing. 1,744 DEGs were commonly regulated in two cultivars, suggesting that some genes play fundamental roles in asparagus bean during cold stress. Functional classification of the DEGs in two cultivars using Mercator pipeline indicated that RNA, protein, signaling, stress and hormone metabolism were five major groups. In RNA group, analysis of TFs in DREB subfamily showed that ICE1-CBF3-COR cold responsive cascade may also exist in asparagus bean. Our study is the first to provide the transcriptome sequence resource for asparagus bean, which will accelerate breeding cold resistant asparagus bean varieties through genetic

  13. Isolation and characterization of culturable seed-associated bacterial endophytes from gnotobiotically grown Marama bean seedlings.

    Science.gov (United States)

    Chimwamurombe, Percy Maruwa; Grönemeyer, Jann Lasse; Reinhold-Hurek, Barbara

    2016-06-01

    Marama bean (Tylosema esculentum) is an indigenous non-nodulating legume to the arid agro-ecological parts of Southern Africa. It is a staple food for the Khoisan and Bantu people from these areas. It is intriguing how it is able to synthesize the high-protein content in the seeds since its natural habitat is nitrogen deficient. The aim of the study was to determine the presence of seed transmittable bacterial endophytes that may have growth promoting effects, which may be particularly important for the harsh conditions. Marama bean seeds were surface sterilized and gnotobiotically grown to 2 weeks old seedlings. From surface-sterilized shoots and roots, 123 distinct bacterial isolates were cultured using three media, and identified by BOX-PCR fingerprinting and sequence analyses of the 16S rRNA and nifH genes. Phylogenetic analyses of 73 putative endophytes assigned them to bacterial species from 14 genera including Proteobacteria (Rhizobium, Massilia, Kosakonia, Pseudorhodoferax, Caulobacter, Pantoea, Sphingomonas, Burkholderia, Methylobacterium), Firmicutes (Bacillus), Actinobacteria (Curtobacterium, Microbacterium) and Bacteroidetes (Mucilaginibacter, Chitinophaga). Screening for plant growth-promoting activities revealed that the isolates showed production of IAA, ACC deaminase, siderophores, endoglucanase, protease, AHLs and capacities to solubilize phosphate and fix nitrogen. This is the first report that marama bean seeds may harbor endophytes that can be cultivated from seedlings; in this community of bacteria, physiological characteristics that are potentially plant growth promoting are widespread.

  14. Impact of industrial treatments on ochratoxin A content in artificially contaminated cocoa beans.

    Science.gov (United States)

    Manda, Pierre; Dano, Djédjé Sébastien; Kouadio, James Halbin; Diakité, Aïssata; Sangaré-Tigori, Béatrice; Ezoulin, Miezan Jean Marc; Soumahoro, Awa; Dembele, Ardjouma; Fourny, Gérard

    2009-07-01

    Ochratoxin A (OTA) is a mycotoxin mainly produced by mould species of the genera Aspergillus and Penicillium, which grow on a variety of agricultural products. OTA-contaminated foodstuffs pose a major health hazard to consumers, including human and animal. In Cote d'Ivoire, numerous studies are being carried out to find the best way of preventing OTA contamination of cocoa raw material. The objectives of this investigation were to assess the impact of industrial treatment on OTA content in cocoa-derived products. Samples of cocoa pods were prepared under specific conditions promoting fungal proliferation on cocoa beans before processing. The beans underwent the usual industrial treatments - roasting, shelling, crushing, pressing and additive addition - and samples were taken at each stage. OTA was extracted with a methanol/3% sodium hydrogen carbonate solution and purified using an immunoaffinity column prior to HPLC analysis with fluorescence detection. OTA was detected in artificially contaminated cocoa beans at levels ranging from 3.4 to 44.7 microg kg(-1) with a mean value of 22.9 +/- 3.6 microg kg(-1). OTA was mainly concentrated in the shell (93%). Roasting, shelling and additive addition significantly decreased levels of OTA by 24-40, 76 and 52%, respectively, with an overall reduction of approximately 91%. These results indicate that industrial processing of cocoa has a real impact on the reduction of OTA in final cocoa products.

  15. Characterization and Expression Analysis of Common Bean Histone Deacetylase 6 during Development and Cold Stress Response

    Science.gov (United States)

    Ligaba-Osena, Ayalew; Subramani, Mayavan; Brown, Adrianne; Melmaiee, Kalpalatha; Hossain, Khwaja

    2017-01-01

    Histone deacetylases (HDACs) are important regulators of gene transcription thus controlling multiple cellular processes. Despite its essential role in plants, HDA6 is yet to be validated in common bean. In this study, we show that HDA6 is involved in plant development and stress response. Differential expression of HDA6 was determined in various tissues and the expression was seen to be upregulated with plant age (seedling < flowering < maturity). Higher expression was observed in flowers and pods than in stem, leaf, and root. Upregulation of HDA6 gene during cold stress implies its prominent role in abiotic stress. Furthermore, the HDA6 gene was isolated from three common bean genotypes and sequence analyses revealed homology with functionally characterized homologs in model species. The 53 kDa translated product was detected using an HDA6 specific antibody and recombinant protein overexpressed in Escherichia coli showed HDAC activity in vitro. To our knowledge, this is the first report in the agriculturally important crop common bean describing the functional characterization and biological role of HDA6. PMID:28127547

  16. Assessment of Genetic Diversity in Faba Bean Based on Single Nucleotide Polymorphism

    Directory of Open Access Journals (Sweden)

    Sukhjiwan Kaur

    2014-01-01

    Full Text Available Detection of genetic diversity is important for characterisation of crop plant collections in order to detect the presence of valuable trait variation for use in breeding programs. A collection of faba bean (Vicia faba L. genotypes was evaluated for intra- and inter-population diversity using a set of 768 genome-wide distributed single nucleotide polymorphism (SNP markers, of which 657 obtained successful amplification and detected polymorphisms. Gene diversity and polymorphism information content (PIC values varied between 0.022–0.500 and 0.023–1.00, with averages of 0.363 and 0.287, respectively. The genetic structure of the germplasm collection was analysed and a neighbour-joining (NJ dendrogram was constructed. The faba bean accessions grouped into two major groups, with several additional smaller sub-groups, predominantly on the basis of geographical origin. These results were further supported by principal co-ordinate analysis (PCoA, deriving two major groupings which were differentiated on the basis of site of origin and pedigree relationships. In general, high levels of heterozygosity were observed, presumably due to the partially allogamous nature of the species. The results will facilitate targeted crossing strategies in future faba bean breeding programs in order to achieve genetic gain.

  17. Induction of ferritin synthesis by water deficit and iron excess in common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    DeLaat, Daiane Mariele; Colombo, Carlos Augusto; Chiorato, Alisson Fernando; Carbonell, Sergio Augusto Morais

    2014-03-01

    Ferritins are molecules for iron storage present in most living beings. In plants, ferritin is an essential iron homeostasis regulator and therefore plays a fundamental role in control of iron induced by oxidative stress or by excess of iron ions. Ferritin gene expression is modulated by various environmental factors, including the intensity of drought, cold, light and pathogenic attack. Common bean, one of the most important species in the Brazilian diet, is also affected by insufficiency or lack of water. Thus, the present study was conducted for the purpose of determining the levels of expression of ferritins transcripts in leaf tissues of three common bean cultivars (BAT 477, Carioca Comum and IAC-Diplomata) under osmotic shock caused by polyethylene glycol 6000 and by iron excess. The expression of three ferritins genes (PvFer1, PvFer2 and PvFer3), determined by quantitative PCR, indicated a difference in the expression kinetics among the cultivars. All the ferritin genes were actively transcribed under iron excess and water deficit conditions. The cultivars most responsive to treatments were BAT 477 and IAC-Diplomata. All the cultivars responded to treatments. Nevertheless, the ferritin genes were differentially regulated according to the cultivars. Analysis of variance indicated differences among cultivars in expression of the genes PvFer1 and PvFer3. Both genes were most responsive to treatments. This result suggests that ferritin genes may be functionally important in acclimatization of common bean under iron excess or water deficit conditions.

  18. Laser-Induced Breakdown Spectroscopy (LIBS) for spectral characterization of regular coffee beans and luwak coffee bean

    Science.gov (United States)

    Nufiqurakhmah, Nufiqurakhmah; Nasution, Aulia; Suyanto, Hery

    2016-11-01

    Luwak (civet) coffee refers to a type of coffee, where the cherries have been priorly digested and then defecated by a civet (Paradoxurus Hermaphroditus), a catlike animals typically habited in Indonesia. Luwak will only selectively select ripe cherries, and digesting them by enzymatic fermentation in its digestive system. The defecated beans is then removed and cleaned from the feces. It is regarded as the world's most expensive coffee, Traditionally the quality of the coffee is subjectively determined by a tester. This research is motivated by the needs to study and develop quantitative parameters in determining the quality of coffee bean, which are more objective to measure the quality of coffee products. LIBS technique was used to identify the elemental contents of coffee beans based on its spectral characteristics in the range 200-900 nm. Samples of green beans from variant of arabica and robusta, either regular and luwak, were collected from 5 plantations in East Java. From the recorded spectra, intensity ratio of nitrogen (N), hydrogen (H), and oxygen (O) as essential elements in coffee is applied. In general, values extracted from luwak coffee bean is higher with increases 0.03% - 79.93%. A Discriminant Function Analysis (DFA) also applied to identify marker elements that characterize the regular and luwak beans. Elements of Ca, W, Sr, Mg, and H are the ones used to differentiate the regular and luwak beans from arabica variant, while Ca and W are the ones used to differentiate the regular and luwak beans of robusta variant.

  19. Sensory analysis of beans (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Sanz-Calvo M.

    1999-01-01

    Full Text Available The methodology of sensory profiling constitutes the basis of a descriptive quantitative analysis, defining a product with the minimum number of words and with maximum efficiency, using a precise tasting sheet, which can be reproduced and is understood by all. In this work, the texture profiling for different bean varieties that are characteristic of the Spanish market was carried out. Optimum conditions for samples and a tasting card were established, and a panel was trained. The texture profile results show significant differences amongst varieties and even amongst different origins for the same variety.

  20. Proteomic analysis of common bean (Phaseolus vulgaris) by two-dimensional gel electrophoresis and mass spectrometry

    Science.gov (United States)

    The modern cultivated common bean (Phaseolus vulgaris) has evolved from wild common beans distributed in Central America, Mexico and the Andean region of South America. It has been reported that wild common bean accessions have higher levels of protein content than the domesticated dry bean cultiva...

  1. Registration of PR1146-138 yellow dry bean germplasm line

    Science.gov (United States)

    The yellow bean (Phaseolus vulgaris L.) is an important market class in Haiti. However, there have been no previous attempts to genetically improve this seed type for the Caribbean. Landrace varieties of yellow beans in Haiti are susceptible to Bean golden yellow mosaic virus (BGYMV) and bean common...

  2. Development of the yellow common bean germplasm PR1146-138

    Science.gov (United States)

    The yellow bean (Phaseolus vulgaris L.) is an important market class in Haiti. There have been, however, no previous attempts to genetically improve this seed type for the Caribbean. Landrace varieties of yellow beans in Haiti are susceptible to Bean golden yellow mosaic virus (BGYMV) and bean commo...

  3. Development of Gene-Based SSR Markers in Rice Bean (Vigna umbellata L. Based on Transcriptome Data.

    Directory of Open Access Journals (Sweden)

    Honglin Chen

    Full Text Available Rice bean (Vigna umbellata (Thunb. Ohwi & Ohashi is a warm season annual legume mainly grown in East Asia. Only scarce genomic resources are currently available for this legume crop species and no simple sequence repeat (SSR markers have been specifically developed for rice bean yet. In this study, approximately 26 million high quality cDNA sequence reads were obtained from rice bean using Illumina paired-end sequencing technology and assembled into 71,929 unigenes with an average length of 986 bp. Of these unigenes, 38,840 (33.2% showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases. Furthermore, 30,170 (76.3% could be classified into gene ontology categories, 25,451 (64.4% into Swiss-Prot categories and 21,982 (55.6% into KOG database categories (E-value < 1.0E-5. A total of 9,301 (23.5% were mapped onto 118 pathways using the Kyoto Encyclopedia of Genes and Genome (KEGG pathway database. A total of 3,011 genic SSRs were identified as potential molecular markers. AG/CT (30.3%, AAG/CTT (8.1% and AGAA/TTCT (20.0% are the three main repeat motifs. A total of 300 SSR loci were randomly selected for validation by using PCR amplification. Of these loci, 23 primer pairs were polymorphic among 32 rice bean accessions. A UPGMA dendrogram revealed three major clusters among 32 rice bean accessions. The large number of SSR-containing sequences and genic SSRs in this study will be valuable for the construction of high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  4. Evidence of qualitative differences between soil-occupancy effects of invasive vs. native grassland plant species

    Science.gov (United States)

    Jordan, N.R.; Larson, D.L.; Huerd, S.C.

    2011-01-01

    Diversified grasslands that contain native plant species are being recognized as important elements of agricultural landscapes and for production of biofuel feedstocks as well as a variety of other ecosystem services. Unfortunately, establishment of such grasslands is often difficult, unpredictable, and highly vulnerable to interference and invasion by weeds. Evidence suggests that soil-microbial "legacies" of invasive perennial species can inhibit growth of native grassland species. However, previous assessments of legacy effects of soil occupancy by invasive species that invade grasslands have focused on single invasive species and on responses to invasive soil occupancy in only a few species. In this study, we tested the hypothesis that legacy effects of invasive species differ qualitatively from those of native grassland species. In a glasshouse, three invasive and three native grassland perennials and a native perennial mixture were grown separately through three cycles of growth and soil conditioning in soils with and without arbuscular mycorrhizal fungi (AMF), after which we assessed seedling growth in these soils. Native species differed categorically from invasives in their response to soil conditioning by native or invasive species, but these differences depended on the presence of AMF. When AMF were present, native species largely had facilitative effects on invasive species, relative to effects of invasives on other invasives. Invasive species did not facilitate native growth; neutral effects were predominant, but strong soil-mediated inhibitory effects on certain native species occurred. Our results support the hypothesis that successful plant invaders create biological legacies in soil that inhibit native growth, but suggest also this mechanism of invasion will have nuanced effects on community dynamics, as some natives may be unaffected by such legacies. Such native species may be valuable as nurse plants that provide cost-effective restoration of

  5. Geographical Distribution of Wild Relatives of Mesoamerican Gene Pool of Lima Bean (Phaseolus lunatus L. in Mexico

    Directory of Open Access Journals (Sweden)

    Rubén H. Andueza-Noh

    2016-03-01

    Full Text Available The Mesoamerican gene pool of wild Lima bean (Phaseolus lunatus L., Fabaceae is an important source of genes for genetic improvement of the species. Is widely distributed from northern Mexico to northern Argentina. Reports in Mexico indicate that this gene pool is distributed from Sinaloa to Chiapas on the Pacific Coast and southern Tamaulipas to the Yucatan Peninsula on the Coast of Gulf of Mexico, as well as, in the Isthmus of Tehuantepec. However, despite the knowledge we have about the distribution of this gene pool, in Mexico there are still collecting gaps and unexplored regions. The objective of this study was to collect wild populations of Lima bean in Mexico to know its current distribution and establish management and conservation strategies. To do this, we collected within the natural distribution range of the Mesoamerican gene pool of Lima bean in Mexico, with the passport data was designed a geographical distribution map and assessed the conservation status of populations. Results indicated that wild populations of Lima bean have a wide geographical distribution localized mainly in tropical deciduous forest and semideciduous and elevations from zero to 2, 292 meters. In most wild population collected a low conservation status was observed, in consequence was proposed the development of strategies for in situ and ex situ conservation for wild populations with higher degree of erosion.

  6. EARLY DEVELOPMENT OF CASTOR BEANS GROWN UNDER SALINITY CONDITIONS (VARIETIES BRS ENERGIA, MPA 34 AND MPB 01

    Directory of Open Access Journals (Sweden)

    RAFAEL ANTÔNIO PRESOTTO

    2016-01-01

    Full Text Available Studies have shown that some plant species exhibit satisfactory production levels when grown under high salinity levels, whereas others exhibit decreased production due to sodium sensitivity even at low sodium concentrations. The castor bean is moderately sensitive to salinity. The aim of the present study was to evaluate the early growth of three castor bean varieties (BRS Energia, MPA 34 and MPB 01 grown in nutrient solution with increasing sodium concentrations (control, 25, 50, 75 and 100 mmol L - 1 . A completely randomized split - plot experimental design was used, with a 5x3 factorial scheme and three replicates per treatment. Salinity resulted in decreased dry weight of all castor bean varieties grown for 31 days under hydroponic conditions. The dry weight accumulation was less affected at the root than at the shoot level. Nevertheless, the shoot dry weight decreased with the increasing salinity. MPA 34 exhibited higher early growth than the remaining tested varieties. Salinity affected the early development of the tested castor bean varieties, and this effect was more pronounced at the shoot than at the root. Variety MPA 34 is promising for cultivation under moderate salinity levels.

  7. Physical and chemical characteristics of common bean varieties

    Directory of Open Access Journals (Sweden)

    Marcio de Barros

    2016-04-01

    Full Text Available The common bean (Phaseolus vulgaris L. is one of the most widely consumed legumes in the world, but nevertheless different varieties vary with respect to their physical and chemical aspects. This study evaluated the physical and chemical characteristics (color, hardness after cooking, water absorption capacity, cooking time, integrity of the beans after cooking, proximate composition and mineral composition of the following varieties of the common bean: Carioca, IAPAR 81, Saracura, Juriti, Pérola, Colibri and IAPAR 31, all destined for both the internal Brazilian and external markets. The varieties studied had different proximate compositions and contents of the following minerals: K, Ca, N, Mg, S, Cu, Fe and Mn; but identical contents of P, Zn and B. The beans were classified as small in size. The Carioca variety showed the lowest values for L* (41.29 and H* (57.22, and the highest values for a* (12.17, its beans being redder and darker than the others. The Saracura variety showed the lowest degree of hydration (95.70 g/100g, cooking time (22.67 min. and whole beans after cooking (30%, while the Pérola variety showed the highest values for these same parameters, 106.77 g/100g, 43.67 min. and 82.16%, respectively. No correlation was observed between the calcium and magnesium contents of the beans and the hardness of the raw bean, degree of hydration during maceration, cooking time and integrity of the cooked beans. According to the characteristics studied, the Saracura variety is a good option for both industrial and domestic use.

  8. Root-inhabiting fungi in alien plant species in relation to invasion status and soil chemical properties.

    Science.gov (United States)

    Majewska, Marta L; Błaszkowski, Janusz; Nobis, Marcin; Rola, Kaja; Nobis, Agnieszka; Łakomiec, Daria; Czachura, Paweł; Zubek, Szymon

    In order to recognize interactions between alien vascular plants and soil microorganisms and thus better understand the mechanisms of plant invasions, we examined the mycorrhizal status, arbuscular mycorrhizal fungi (AMF) colonization rate, arbuscular mycorrhiza (AM) morphology and presence of fungal root endophytes in 37 non-native species in Central Europe. We also studied the AMF diversity and chemical properties of soils from under these species. The plant and soil materials were collected in southern Poland. We found that 35 of the species formed AM and their mycorrhizal status depended on species identity. Thirty-three taxa had AM of Arum-type alone. Lycopersicon esculentum showed intermediate AM morphology and Eragrostis albensis developed both Arum and Paris. The mycelia of dark septate endophytes (DSE) were observed in 32 of the species, while sporangia of Olpidium spp. were found in the roots of 10. Thirteen common and worldwide occurring AMF species as well as three unidentified spore morphotypes were isolated from trap cultures established with the soils from under the plant species. Claroideoglomus claroideum, Funneliformis mosseae and Septoglomus constrictum were found the most frequently. The presence of root-inhabiting fungi and the intensity of their colonization were not correlated with soil chemical properties, plant invasion status, their local abundance and habitat type. No relationships were also found between the presence of AMF, DSE and Olpidium spp. These suggest that other edaphic conditions, plant and fungal species identity or the abundance of these fungi in soils might have an impact on the occurrence and intensity of fungal root colonization in the plants under study.

  9. Phaseolus vulgaris endornavirus 1 and Phaseolus vulgaris endornavirus 2 infecting common bean Phaseolus vulgaris genotypes show differential infection patterns between gene pools

    Science.gov (United States)

    We investigated the occurrence of two plant endornaviruses, Phaseolus vulgaris endornavirus 1 (PvEV-1) and Phaseolus vulgaris endornavirus 2 (PvEV-2), in breeding-lines, cultivars, landraces, and wild genotypes of common bean (Phaseolus vulgaris) as well as other Phaseolus species collected from two...

  10. Fluorescence In Situ Hybridization (FISH-Based Karyotyping Reveals Rapid Evolution of Centromeric and Subtelomeric Repeats in Common Bean (Phaseolus vulgaris and Relatives

    Directory of Open Access Journals (Sweden)

    Aiko Iwata-Otsubo

    2016-04-01

    Full Text Available Fluorescence in situ hybridization (FISH-based karyotyping is a powerful cytogenetics tool to study chromosome organization, behavior, and chromosome evolution. Here, we developed a FISH-based karyotyping system using a probe mixture comprised of centromeric and subtelomeric satellite repeats, 5S rDNA, and chromosome-specific BAC clones in common bean, which enables one to unambiguously distinguish all 11 chromosome pairs. Furthermore, we applied the karyotyping system to several wild relatives and landraces of common bean from two distinct gene pools, as well as other related Phaseolus species, to investigate repeat evolution in the genus Phaseolus. Comparison of karyotype maps within common bean indicates that chromosomal distribution of the centromeric and subtelomeric satellite repeats is stable, whereas the copy number of the repeats was variable, indicating rapid amplification/reduction of the repeats in specific genomic regions. In Phaseolus species that diverged approximately 2–4 million yr ago, copy numbers of centromeric repeats were largely reduced or diverged, and chromosomal distributions have changed, suggesting rapid evolution of centromeric repeats. We also detected variation in the distribution pattern of subtelomeric repeats in Phaseolus species. The FISH-based karyotyping system revealed that satellite repeats are actively and rapidly evolving, forming genomic features unique to individual common bean accessions and Phaseolus species.

  11. The Paleobiolinguistics of the Common Bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Cecil H. Brown

    2014-10-01

    Full Text Available Paleobiolinguistics is used to determine when and where the common bean (Phaseolus vulgaris L. developed significance for prehistoric groups of Native America. Dates and locations of proto-languages for which common bean terms reconstruct generally accord with crop-origin and dispersal information from plant genetics and archaeobotany. Paleobiolinguistic and other lines of evidence indicate that human interest in the common bean became significant primarily with the widespread development of a village‐farming way of life in the New World rather than earlier when squash and maize and a few other crops became important.

  12. Comparison of marine boundary layer cloud properties from CERES-MODIS Edition 4 and DOE ARM AMF measurements at the Azores

    Science.gov (United States)

    Xi, Baike; Dong, Xiquan; Minnis, Patrick; Sun-Mack, Sunny

    2014-08-01

    Marine boundary layer (MBL) cloud properties derived from the NASA Clouds and the Earth's Radiant Energy System (CERES) project using Terra and Aqua Moderate Resolution Imaging Spectroradiometer (MODIS) data are compared with observations taken at the Department of Energy Atmospheric Radiation Measurement (ARM) Mobile Facility at the Azores (AMF-Azores) site from June 2009 through December 2010. Cloud properties derived from ARM ground-based observations were averaged over a 1 h interval centered at the satellite overpass time, while the CERES-MODIS (CM) results were averaged within a 30 km × 30 km grid box centered over the Azores site. A total of 63 daytime and 92 nighttime single-layered overcast MBL cloud cases were selected from 19 months of ARM radar-lidar and satellite observations. The CM cloud top/base heights (Htop/Hbase) were determined from cloud top/base temperatures (Ttop/Tbase) using a regional boundary layer lapse rate method. For daytime comparisons, the CM-derived Htop (Hbase), on average, is 0.063 km (0.068 km) higher (lower) than its ARM radar-lidar-observed counterpart, and the CM-derived Ttop and Tbase are 0.9 K less and 2.5 K greater than the surface values with high correlations (R2 = 0.82 and 0.84, respectively). In general, the cloud top comparisons agree better than the cloud base comparisons, because the CM cloud base temperatures and heights are secondary products determined from cloud top temperatures and heights. No significant day-night difference was found in the analyses. The comparisons of MBL cloud microphysical properties reveal that when averaged over a 30 km × 30 km area, the CM-retrieved cloud droplet effective radius (re) at 3.7 µm is 1.3 µm larger than that from the ARM retrievals (12.8 µm), while the CM-retrieved cloud liquid water path (LWP) is 13.5 gm-2 less than its ARM counterpart (114.2 gm-2) due to its small optical depth (9.6 versus 13.7). The differences are reduced by 50% when the CM averages are computed

  13. Functional properties and fatty acids profile of different beans varieties.

    Science.gov (United States)

    Lo Turco, Vincenzo; Potortì, Angela Giorgia; Rando, Rossana; Ravenda, Pietro; Dugo, Giacomo; Di Bella, Giuseppa

    2016-10-01

    Dried seeds of four varieties of Phaseolus vulgaris, three of Vigna unguiculata ssp. unguiculata and two of Vigna angularis grown and marketed in Italy, Mexico, India, Japan, Ghana and Ivory Coast were analysed for fatty acids content. In oils from seeds of P. vulgaris, the main fatty acids were linolenic (34.7-41.5%) and linoleic (30.7-40.3%), followed by palmitic (10.7-16.8%). The first three aforementioned fatty acids in the lipid fraction of V. unguiculata varieties were 28.4, 28.7 and 26.2%, respectively; while in V. angularis varieties, main fatty acids were linoleic (36.4-39.1%) and palmitic (26.9-33.3%), followed by linolenic (17.9-22.2%). Statistical analyses indicate that botanical species play a rule in bean fatty acids distribution, while the same was not verified for geographical origin. Furthermore, the atherogenic index (AI) and the thrombogenic index (TI) were investigated for health and nutritional information. The results showed that these wide spread legumes have functional features to human health.

  14. Influence of turning and environmental contamination on the dynamics of populations of lactic acid and acetic acid bacteria involved in spontaneous cocoa bean heap fermentation in Ghana.

    Science.gov (United States)

    Camu, Nicholas; González, Angel; De Winter, Tom; Van Schoor, Ann; De Bruyne, Katrien; Vandamme, Peter; Takrama, Jemmy S; Addo, Solomon K; De Vuyst, Luc

    2008-01-01

    The influence of turning and environmental contamination on six spontaneous cocoa bean heap fermentations performed in Ghana was studied through a multiphasic approach, encompassing both microbiological (culture-dependent and culture-independent techniques) and metabolite target analyses. A sensory analysis of chocolate made from the fermented, dried beans was performed as well. Only four clusters were found among the isolates of acetic acid bacteria (AAB) identified: Acetobacter pasteurianus, Acetobacter ghanensis, Acetobacter senegalensis, and a potential new Acetobacter lovaniensis-like species. Two main clusters were identified among the lactic acid bacteria (LAB) isolated, namely, Lactobacillus plantarum and Lactobacillus fermentum. No differences in biodiversity of LAB and AAB were seen for fermentations carried out at the farm and factory sites, indicating the cocoa pod surfaces and not the general environment as the main inoculum for spontaneous cocoa bean heap fermentation. Turning of the heaps enhanced aeration and increased the relative population size of AAB and the production of acetic acid. This in turn gave a more sour taste to chocolate made from these beans. Bitterness was reduced through losses of polyphenols and alkaloids upon fermentation and cocoa bean processing.

  15. In vivo mutagenicity studies in rats mice and Chinese hamsters fed irradiated foodstuffs - chicken, fish, dates, pulses, mangoes and cocoa beans

    Energy Technology Data Exchange (ETDEWEB)

    Renner, H.W.

    1982-11-01

    Three in vivo genetic toxicity tests were performed in rats, mice and Chinese hamsters to detect possible mutagenic effects of irradiated chicken, dried dates, fish, cocoa beans, pulses and mangoes. The tests employed were the micronucleus test and sister-chromatid exchange (SCE) test for irradiated and unirradiated samples of all foodstuffs listed, and the spermatogonia test, (including SCE technique) in mice for irradiated and unirradiated chicken, fish and dates only. In the case of cocoa beans, the mutagenicity tests were performed on an additional test group fed beans fumigated with ethylene oxide. The different mammalian species used for the various experiments are given below. None of the tests provided any evidence of mutagenicity induced by irradiation in any of the foodstuffs studied. Moreover, these tests are currently considered to be the most sensitive in vivo mutagenicity tests in mammals.

  16. Genome sequencing reveals a new lineage associated with lablab bean and genetic exchange between Xanthomonas axonopodis pv. phaseoli and Xanthomonas fuscans subsp. fuscans

    Directory of Open Access Journals (Sweden)

    Valente eAritua

    2015-10-01

    Full Text Available Common bacterial blight is a devastating seed-borne disease of common beans that also occurs on other legume species including lablab and Lima beans. We sequenced and analysed the genomes of 26 isolates of Xanthomonas axonopodis pv. phaseoli and X. fuscans subsp. fuscans, the causative agents of this disease, collected over four decades and six continents. This revealed considerable genetic variation within both taxa, encompassing both single-nucleotide variants and differences in gene content, that could be exploited for tracking pathogen spread. The bacterial isolate from Lima bean fell within the previously described Genetic Lineage 1, along with the pathovar type isolate (NCPPB 3035. The isolates from lablab represent a new, previously unknown genetic lineage closely related to strains of X. axonopodis pv. glycines. Finally, we identified more than 100 genes that appear to have been recently acquired by Xanthomonas axonopodis pv. phaseoli from X. fuscans subsp. fuscans.

  17. Evaluation of the effect of pretreatment and preservation on macro- and microelements retention in flageolet (Phaseolus vulgaris L. bean seeds

    Directory of Open Access Journals (Sweden)

    Jacek Słupski

    2011-12-01

    Full Text Available   Background. Legume seeds, including beans, are a good source of mineral constituents. The level of these compounds depends among other factors, on the species, cultivar and the methods of processing applied. However, there are no studies in the literature which deal with the content of mineral constituents in physiologically immature bean seeds. Material and methods. The aim of this study was to evaluate the retention of ash and 13 mineral constituents in immature seeds of three bean cultivars. The investigation included raw, blanched and cooked seeds and three products prepared for consumption after 12-month storage: a frozen product obtained using the traditional method (blanching-freezing-frozen storage-cooking; a frozen product obtained using the modified method (cooking-freezing-frozen storage-defrosting and heating in a microwave oven; and a sterilized canned product. Results. The application of technological processes; the storage of frozen and sterilized products; and the preparation of frozen products for consumption had an effect on minerals content in finished products. The frozen product obtained using the modified method retained greater amounts of the investigated elements (apart from calcium, lead and cadmium than the traditional frozen product. Canned bean seeds retained less ash, phosphorus, potassium, calcium, magnesium, sodium and iron than the products of the two ways of freezing, while the retention of the remaining constituents depended on the cultivar. Conclusions. Modified method of freezing of immature bean seeds resulted in greater retention of the investigated components in products prepared for consumption than the traditional method of freezing or canning.  

  18. The introduction of the common bean (Phaseolus vulgaris L.) into Western Europe and the phenotypic variation of dry beans collected in the Netherlands.

    NARCIS (Netherlands)

    Zeven, A.C.

    1997-01-01

    The first introduction of common bean from Central/South America into Western Europe most likely took place around 1500. The attractive bean seeds and their easy transportation warranted numerous additional introductions, not only from the Americas, but also from other areas where the common bean ha

  19. Responses of symbiotic nitrogen-fixing common bean to aluminum toxicity and delineation of nodule responsive microRNAs

    Directory of Open Access Journals (Sweden)

    Ana Belén Mendoza-Soto

    2015-07-01

    Full Text Available Aluminum (Al toxicity is widespread in acidic soils where the common bean (Phaseolus vulgaris, the most important legume for human consumption, is produced and it is a limiting factor for crop production and symbiotic nitrogen fixation. We characterized the nodule responses of common bean plants inoculated with Rhizobioum tropici CIAT899 and the root responses of nitrate-fertilized plants exposed to excess Al in low pH, for long or short periods. A 43 - 50% reduction in nitrogenase activity indicates that Al toxicity highly affected nitrogen fixation in common bean. Bean roots and nodules showed characteristic symptoms for Al toxicity. In mature nodules Al accumulation and lipoperoxidation were observed in the infected zone, while callose deposition and cell death occurred mainly in the nodule cortex. Regulatory mechanisms of plant responses to metal toxicity involve microRNAs (miRNAs along other regulators. Using a miRNA-macroarray hybridization approach we identified 28 (14 up-regulated Al toxicity nodule-responsive miRNAs. We validated (qRT-PCR the expression of eight nodule responsive miRNAs in roots and in nodules exposed to high Al for long or short periods. The inverse correlation between the target and miRNA expression ratio (stress:control was observed in every case. Generally, miRNAs showed a higher earlier response in roots than in nodules. Some of the common bean Alt responsive miRNAs identified have also been reported as differentially expressed in other plant species subjected to similar stress condition. miRNA/target nodes analyzed in this work are known to be involved in relevant signaling pathways, thus we propose that the participation of miR164/NAC1 and miR393/TIR1 in auxin and of miR170/SCL in gibberellin signaling is relevant for common bean response/adaptation to Al stress. Our data provide a foundation for evaluating the individual roles of miRNAs in the response of common bean nodules to Al toxicity.

  20. Responses of symbiotic nitrogen-fixing common bean to aluminum toxicity and delineation of nodule responsive microRNAs.

    Science.gov (United States)

    Mendoza-Soto, Ana B; Naya, Loreto; Leija, Alfonso; Hernández, Georgina

    2015-01-01

    Aluminum (Al) toxicity is widespread in acidic soils where the common bean (Phaseolus vulgaris), the most important legume for human consumption, is produced and it is a limiting factor for crop production and symbiotic nitrogen fixation. We characterized the nodule responses of common bean plants inoculated with Rhizobioum tropici CIAT899 and the root responses of nitrate-fertilized plants exposed to excess Al in low pH, for long or short periods. A 43-50% reduction in nitrogenase activity indicates that Al toxicity (Alt) highly affected nitrogen fixation in common bean. Bean roots and nodules showed characteristic symptoms for Alt. In mature nodules Al accumulation and lipoperoxidation were observed in the infected zone, while callose deposition and cell death occurred mainly in the nodule cortex. Regulatory mechanisms of plant responses to metal toxicity involve microRNAs (miRNAs) along other regulators. Using a miRNA-macroarray hybridization approach we identified 28 (14 up-regulated) Alt nodule-responsive miRNAs. We validated (quantitative reverse transcriptase-PCR) the expression of eight nodule responsive miRNAs in roots and in nodules exposed to high Al for long or short periods. The inverse correlation between the target and miRNA expression ratio (stress:control) was observed in every case. Generally, miRNAs showed a higher earlier response in roots than in nodules. Some of the common bean Alt-responsive miRNAs identified has also been reported as differentially expressed in other plant species subjected to similar stress condition. miRNA/target nodes analyzed in this work are known to be involved in relevant signaling pathways, thus we propose that the participation of miR164/NAC1 (NAM/ATAF/CUC transcription factor) and miR393/TIR1 (TRANSPORT INHIBITOR RESPONSE 1-like protein) in auxin and of miR170/SCL (SCARECROW-like protein transcription factor) in gibberellin signaling is relevant for common bean response/adaptation to Al stress. Our data provide a

  1. Phenolic antioxidants in some Vigna species of legumes and their distinct inhibitory effects on α-glucosidase and pancreatic lipase activities.

    Science.gov (United States)

    Sreerama, Yadahally N; Takahashi, Yoko; Yamaki, Kohji

    2012-09-01

    Phenolic extracts of 4 Vigna species of legumes (mung bean, moth bean, and black and red varieties of adzuki beans) were evaluated for phenolic contents, antioxidant activities, and inhibitory properties against α-glucosidase and pancreatic lipase. Results showed that adzuki bean varieties contain higher phenolic indexes than mung bean and moth beans. Adzuki bean (black) variety was found to be the most active 2,2'-diphenyl-1-picrylhydrazyl and superoxide anion scavenger. However, the hydrogen peroxide scavenging and metal chelating abilities were significantly higher in adzuki bean (red) variety. Mung bean exhibited least antioxidant activities in all the methods tested. Phenolic extracts from these legumes also showed distinct variations in the inhibition of enzymes associated with hyperglycemia and hyperlipidemia. Inhibitory activities of all the extracts against lipase were found to be more potent than α-glucosidase. Although, α-glucosidase inhibitory activity was superior in the black variety of adzuki bean (IC(50,) 26.28 mg/mL), both adzuki bean varieties (black and red) along with moth bean showed strong inhibitory activities on lipase with no significant difference in their IC(50) values (7.32 to 9.85 mg/mL). These results suggest that Vigna species of legumes are potential source of antioxidant phenolics and also great sources of strong natural inhibitors for α-glucosidase and lipase activities. This information may help for effective utilization of these legumes as functional food ingredients for promoting health. Practical Application:  Vigna species of legumes are good sources of phenolic antioxidants and strong natural inhibitors of enzymes associated with diabetes and obesity. Therefore, utilization of these legumes in the development of functional foods with increased therapeutic value would be a significant step toward health promotion and wellness.

  2. Inactivation of jack bean urease by allicin.

    Science.gov (United States)

    Juszkiewicz, Adam; Zaborska, Wiesława; Sepioł, Janusz; Góra, Maciej; Zaborska, Anna

    2003-10-01

    Allicin--diallyl thiosulfinate--is the main biologically active component of freshly crushed garlic. Allicin was synthesized as described elsewhere and was tested for its inhibitory ability against jack bean urease in 20 mM phosphate buffer, pH 7.0 at 22 degrees C. The results indicate that allicin is an enzymatic inactivator. The loss of urease activity was irreversible, time- and concentration dependent and the kinetics of the inactivation was biphasic; each phase, obeyed pseudo-first-order kinetics. The rate constants for inactivation were measured for the fast and slow phases and for several concentrations of allicin. Thiol reagents, and competitive inhibitor (boric acid) protected the enzyme from loss of enzymatic activity. The studies demonstrate that urease inactivation results from the reaction between allicin and the SH-group, situated in the urease active site (Cys592).

  3. An antifungal peptide from baby lima bean.

    Science.gov (United States)

    Wang, H X; Ng, T B

    2006-12-01

    A 6-kDa antifungal peptide with inhibitory activity on mycelial growth in Fusarium oxysporum, Mycosphaerella arachidicola, and Physalospora piricola was isolated from baby lima beans. The peptide suppressed growth in M. arachidicola with an IC(50) of 0.87 muM and inhibited activity of HIV-1 reverse transcriptase with an IC(50) of 4 muM. The peptide exhibited an N-terminal amino acid sequence similar to those of leguminous defensins. The isolation procedure comprised ion exchange chromatography on diethylaminoethyl (DEAE)-cellulose, affinity chromatography on Affi-gel blue gel, ion exchange chromatography on carboxymethyl (CM)-cellulose, and gel filtration by fast protein liquid chromatography on Superdex 75. The peptide was unadsorbed on DEAE-cellulose and Affi-gel blue gel but was adsorbed on CM-cellulose.

  4. Ethiopian soya bean and sunflower value chains : Opportunities and challenges

    NARCIS (Netherlands)

    Wijnands, J.H.M.; Dufera Gurmesa, N.; Lute, J.C.M.; Loo, van E.N.

    2011-01-01

    This report analyses the business opportunities of soya beans and sunflowers. The opportunities are addressed to firms in all levels of the value chain ranging from consumers to farmers in the Ethiopian agriculture.

  5. Caffeine content of Ethiopian Coffea arabica beans

    Directory of Open Access Journals (Sweden)

    Maria Bernadete Silvarolla

    2000-03-01

    Full Text Available The coffee germplasm bank of the Instituto Agronômico de Campinas has many Coffea arabica accessions from Ethiopia, which is considered the primary center of genetic diversity in coffee plants. An evaluation of the caffeine content of beans from 99 progenies revealed intra- and inter-progeny variability. In 68 progenies from the Kaffa region we found caffeine values in the range 0.46-2.82% (mean 1.18%, and in 22 progenies from Illubabor region these values ranged from 0.42 to 2.90% (mean 1.10%. This variability could be exploited in a breeding program aimed at producing beans with low-caffeine content.O banco de germoplasma de café do Instituto Agronômico de Campinas contém grande número de introduções de Coffea arabica provenientes da Etiópia, considerada centro de diversidade genética desta espécie. A avaliação dos teores de cafeína nas sementes de 99 progênies revelou a presença de variabilidade entre e dentro das progênies, de acordo com a região de origem das introduções. Entre as 68 progênies da região de Kaffa encontraram-se valores de cafeína entre 0.46 e 2.82% (média 1.18% e entre as 22 progênies de Illubabor obtiveram-se plantas cujos teores de cafeína variaram de 0.42 a 2.90% (média 1.10%. A variabilidade aqui relatada poderá ser explorada na produção de uma variedade de café com baixos teores de cafeína nas sementes.

  6. Effects of processing on bean (Phaseolus vulgaris L.) protein quality.

    OpenAIRE

    Poel, van der, A.F.B.

    1990-01-01

    In animal production, feeding has an important impact on productivity and health of animals and feed composition is known to influence protein and energy metabolism directly. For monogastric animals complete diets are manufactured in which feed ingredients are used to supply the energy yielding and other nutrients. The common bean ( Phaseolus vulgaris L.) is such an ingredient.In common beans ( Phaseolus vulgaris L.) the supply of nutrients is often lower than is expected from its chemical an...

  7. Arbuscular mycorrhizal fungi from New Caledonian ultramafic soils improve tolerance to nickel of endemic plant species.

    Science.gov (United States)

    Amir, Hamid; Lagrange, Alexandre; Hassaïne, Nadine; Cavaloc, Yvon

    2013-10-01

    In order to improve knowledge about the role of arbuscular mycorrhizal fungi (AMF) in the tolerance to heavy metals in ultramafic soils, the present study investigated the influence of two Glomus etunicatum isolates from New Caledonian ultramafic maquis (shrubland), on nickel tolerance of a model plant species Sorghum vulgare, and of two ultramafic endemic plant species, Alphitonia neocaledonica and Cloezia artensis. In a first step, plants were grown in a greenhouse, on sand with defined concentrations of Ni, to appreciate the effects of the two isolates on the alleviation of Ni toxicity in controlled conditions. In a second step, the influence of the AMF on A. neocaledonica and C. artensis plants grown in a New Caledonian ultramafic soil rich in extractable nickel was investigated. Ni reduced mycorrhizal colonization and sporulation of the fungal isolates, but the symbionts increased plant growth and adaptation of endemic plant species to ultramafic conditions. One of the two G. etunicatum isolates showed a stronger positive effect on plant biomass and phosphorus uptake, and a greater reduction in toxicity symptoms and Ni concentration in roots and shoots. The symbionts seemed to act as a barrier to the absorption of Ni by the plant and reduced root-to-shoot Ni translocation. Results indicate the potential of selected native AMF isolates from ultramafic areas for ecological restoration of such degraded ecosystems.

  8. Watershed responses to Amazon soya bean cropland expansion and intensification.

    Science.gov (United States)

    Neill, Christopher; Coe, Michael T; Riskin, Shelby H; Krusche, Alex V; Elsenbeer, Helmut; Macedo, Marcia N; McHorney, Richard; Lefebvre, Paul; Davidson, Eric A; Scheffler, Raphael; Figueira, Adelaine Michela e Silva; Porder, Stephen; Deegan, Linda A

    2013-06-05

    The expansion and intensification of soya bean agriculture in southeastern Amazonia can alter watershed hydrology and biogeochemistry by changing the land cover, water balance and nutrient inputs. Several new insights on the responses of watershed hydrology and biogeochemistry to deforestation in Mato Grosso have emerged from recent intensive field campaigns in this region. Because of reduced evapotranspiration, total water export increases threefold to fourfold in soya bean watersheds compared with forest. However, the deep and highly permeable soils on the broad plateaus on which much of the soya bean cultivation has expanded buffer small soya bean watersheds against increased stormflows. Concentrations of nitrate and phosphate do not differ between forest or soya bean watersheds because fixation of phosphorus fertilizer by iron and aluminium oxides and anion exchange of nitrate in deep soils restrict nutrient movement. Despite resistance to biogeochemical change, streams in soya bean watersheds have higher temperatures caused by impoundments and reduction of bordering riparian forest. In larger rivers, increased water flow, current velocities and sediment flux following deforestation can reshape stream morphology, suggesting that cumulative impacts of deforestation in small watersheds will occur at larger scales.

  9. Variation in caffeine concentration in single coffee beans.

    Science.gov (United States)

    Fox, Glen P; Wu, Alex; Yiran, Liang; Force, Lesleigh

    2013-11-13

    Twenty-eight coffee samples from around the world were tested for caffeine levels to develop near-infrared reflectance spectroscopy (NIRS) calibrations for whole and ground coffee. Twenty-five individual beans from five of those coffees were used to develop a NIRS calibration for caffeine concentration in single beans. An international standard high-performance liquid chromatography method was used to analyze for caffeine content. Coffee is a legal stimulant and possesses a number of heath properties. However, there is variation in the level of caffeine in brewed coffee and other caffeinated beverages. Being able to sort beans on the basis of caffeine concentration will improve quality control in the level of caffeine in those beverages. The range in caffeine concentration was from 0.01 mg/g (decaffeinated coffee) to 19.9 mg/g (Italian coffee). The majority of coffees were around 10.0-12.0 mg/g. The NIRS results showed r(2) values for bulk unground and ground coffees were >0.90 with standard errors caffeine concentration of individual coffee beans. One application of this calibration could be sorting beans on caffeine concentration to provide greater quality control for high-end markets. Furthermore, bean sorting may open new markets for novel coffee products.

  10. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    Directory of Open Access Journals (Sweden)

    Maximo Rivarola

    Full Text Available Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  11. Castor bean organelle genome sequencing and worldwide genetic diversity analysis.

    Science.gov (United States)

    Rivarola, Maximo; Foster, Jeffrey T; Chan, Agnes P; Williams, Amber L; Rice, Danny W; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M J; Khouri, Hoda M; Beckstrom-Sternberg, Stephen M; Allan, Gerard J; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade.

  12. Castor Bean Organelle Genome Sequencing and Worldwide Genetic Diversity Analysis

    Science.gov (United States)

    Chan, Agnes P.; Williams, Amber L.; Rice, Danny W.; Liu, Xinyue; Melake-Berhan, Admasu; Huot Creasy, Heather; Puiu, Daniela; Rosovitz, M. J.; Khouri, Hoda M.; Beckstrom-Sternberg, Stephen M.; Allan, Gerard J.; Keim, Paul; Ravel, Jacques; Rabinowicz, Pablo D.

    2011-01-01

    Castor bean is an important oil-producing plant in the Euphorbiaceae family. Its high-quality oil contains up to 90% of the unusual fatty acid ricinoleate, which has many industrial and medical applications. Castor bean seeds also contain ricin, a highly toxic Type 2 ribosome-inactivating protein, which has gained relevance in recent years due to biosafety concerns. In order to gain knowledge on global genetic diversity in castor bean and to ultimately help the development of breeding and forensic tools, we carried out an extensive chloroplast sequence diversity analysis. Taking advantage of the recently published genome sequence of castor bean, we assembled the chloroplast and mitochondrion genomes extracting selected reads from the available whole genome shotgun reads. Using the chloroplast reference genome we used the methylation filtration technique to readily obtain draft genome sequences of 7 geographically and genetically diverse castor bean accessions. These sequence data were used to identify single nucleotide polymorphism markers and phylogenetic analysis resulted in the identification of two major clades that were not apparent in previous population genetic studies using genetic markers derived from nuclear DNA. Two distinct sub-clades could be defined within each major clade and large-scale genotyping of castor bean populations worldwide confirmed previously observed low levels of genetic diversity and showed a broad geographic distribution of each sub-clade. PMID:21750729

  13. Bacillus vanillea sp. nov., Isolated from the Cured Vanilla Bean.

    Science.gov (United States)

    Chen, Yong-gan; Gu, Feng-lin; Li, Ji-hua; Xu, Fei; He, Shu-zhen; Fang, Yi-ming

    2015-02-01

    A Gram-positive bacterium, designated strain XY18(T), was isolated from a cured vanilla bean in Hainan province, China. Cells were rod-shaped, endospore producing, and peritrichous flagella. Strain XY18(T) grew at salinities of 0-8 % (w/v) NaCl (optimally 1-4 %), pH 4.0-8.0 (optimally 5.0-7.0 %) and temperature range 20-45 °C (optimally 28-35 °C). The predominant menaquinone was MK-7. The major cellular fatty acids were anteiso-C15:0, iso-C15:0, anteiso-C17:0, and iso-C17:0. Phylogenetic analysis based on 16S rRNA gene sequence indicated that strain XY18(T) was a member of the genus Bacillus, and closely related to B. amyloliquefaciens NBRC 15535(T) and B. siamensis PD-A10(T), with 99.1 and 99.2 % sequence similarity, respectively. However, the DNA-DNA hybridization value between strain XY18(T) and B. amyloliquefaciens NBRC 15535(T) was 35.7 %. The genomic DNA G+C content of strain XY18(T) was 46.4 mol%, significantly differed from B. siamensis PD-A10(T) (41.4 %), which was higher than the range of 4 % indicative of species. On the basis of polyphasic taxonomic study, including phenotypic features, chemotaxonomy, and phylogenetic analyses, strain XY18(T) represents a novel species within the genus Bacillus, for which the name Bacillus vanillea sp. nov. is proposed. The type strain is XY18(T) (=CGMCC 8629 = NCCB 100507).

  14. Susceptibility of pea, horse bean and bean to viruses in dependence on the age of the inoculated plants

    Directory of Open Access Journals (Sweden)

    Władysław Błaszczak

    2013-12-01

    Full Text Available Three cultivars of pea did not differ in their susceptibility to Cucumber Mosaic Virus (CMV notwithstanding the age of the inoculated plants. But their susceptibility to infection with Bean Yellow Mosaic Virus (BYMV differed. Horse bean cultivars 'Nadwiślański' and 'Major' proved to be less susceptible to Broad Bean True Mosaic Virus (BBTMV when older plants were-inoculated. Two bean cultivars 'Złota Saxa' and 'Earle' appeared to be susceptible to BBTMV only in the phase of developing primary leaves and the age-dependent resistance to infection increased faster in plants of the cv. 'Złota Saxa'. Both cultivars of bean showed also age-dependent resistance to infection by BYMV. All these viruses restricted growth and yield of plants. The decreases were greater when younger plants were inoculated. These dependences appeared most distinctly in pea cv. 'Sześciotygodniowy' infected with CMV and in two cultivars of bean infected with BYMV.

  15. The effect of herbicides on Chenopodium album L. phenology in fodder beet, spring wheat and faba bean crops

    Directory of Open Access Journals (Sweden)

    Marian Wesołowski

    2012-12-01

    Full Text Available The objective of the study was to determine the time of occurrence of the emergence, budding, fruiting and seed shedding stages, as well as the degree of advancement of the white goosefoot fruiting and diaspores shedding stages in fodder beet, spring wheat and faba bean crops under mechanical and chemical weed control. Phenological observations were conducted in the years 2000-2002 at 10-day intervals, starting from the day of crop sowing on alluvial soil made of light loam. Chemically weed controlled objects were treated with herbicides: fodder beet - lenacil 80%; spring wheat - MCPA 30% + dicamba 4%; faba bean - linuron 50%. It was proven that the times of occurrence and the scale of the studied phenological stages of white goosefoot depended on the crop species, the in-crop weed control method and the pattern of weather conditions in the study years. White goosefoot had the most favourable conditions of growth in the fodder beet crop. The herbicides in the fodder beet and faba bean crops delayed the emergence and the time of occurrence of successive white goosefoot growth stages. These agents also decreased the degree of diaspores shedding by the weed species studied. The most white goosefoot specimens shed fruits on the mechanically weed controlled plots. The diaspores dissemination was promoted by a warm and moist growing season.

  16. Phylogenetic multilocus sequence analysis of native rhizobia nodulating faba bean (Vicia faba L.) in Egypt.

    Science.gov (United States)

    Youseif, Sameh H; Abd El-Megeed, Fayrouz H; Ageez, Amr; Cocking, Edward C; Saleh, Saleh A

    2014-12-01

    The taxonomic diversity of forty-two Rhizobium strains, isolated from nodules of faba bean grown in Egypt, was studied using 16S rRNA sequencing, multilocus sequence analyses (MLSA) of three chromosomal housekeeping loci and one nodulation gene (nodA). Based on the 16S rRNA gene sequences, most of the strains were related to Rhizobium leguminosarum, Rhizobium etli, and Rhizobium radiobacter (syn. Agrobacterium tumefaciens). A maximum likelihood (ML) tree built from the concatenated sequences of housekeeping proteins encoded by glnA, gyrB and recA, revealed the existence of three distinct genospecies (I, II and III) affiliated to the defined species within the genus Rhizobium/Agrobacterium. Seventeen strains in genospecies I could be classified as R. leguminosarum sv. viciae. Whereas, a single strain of genospecies II was linked to R. etli. Interestingly, twenty-four strains of genospecies III were identified as A. tumefaciens. Strains of R. etli and A. tumefaciens have been shown to harbor the nodA gene and formed effective symbioses with faba bean plants in Leonard jar assemblies. In the nodA tree, strains belonging to the putative genospecies were closely related to each other and were clustered tightly to R. leguminosarum sv. viciae, supporting the hypothesis that symbiotic and core genome of the species have different evolutionary histories and indicative of horizontal gene transfer among these rhizobia.

  17. Evaluation of chemical variability of cured vanilla beans (Vanilla tahitensis and Vanilla planifolia).

    Science.gov (United States)

    Brunschwig, Christel; Collard, François Xavier; Bianchini, Jean-Pierre; Raharivelomanana, Phila

    2009-10-01

    In order to establish a chemical fingerprint of vanilla diversity, thirty samples of V. planifolia J. W. Moore and V. tahitensis G. Jackson cured beans from seven producing countries were examined for their aroma and fatty acid contents. Both fatty acid and aroma compositions were found to vary between vanilla species and origins. Vanillin was found in higher amounts in V. planifolia (1.7-3.6% of dry matter) than in V. tahitensis (1.0-2.0%), and anisyl compounds were found in lower amounts in V. planifolia (0.05%) than in V. tahitensis (1.4%-2.1%). Ten common and long chain monounsaturated fatty acids (LCFA) were identified and were found to be characteristic of the vanilla origin. LCFA derived from secondary metabolites have discriminating compositions as they reach 5.9% and 15.8% of total fatty acids, respectively in V. tahitensis and V. planifolia. This study highlights the role of the curing method as vanilla cured beans of two different species cultivated in the same country were found to have quite similar fatty acid compositions.

  18. Performance of faba bean genotypes with Orobanche foetida Poir. and Orobanche crenata Forsk. infestation in Tunisia

    Directory of Open Access Journals (Sweden)

    Imen Trabelsi

    2015-03-01

    Full Text Available Orobanche foetida Poir. and O. crenata Forsk. are major constraints to faba bean (Vicia faba L. cultivation in Tunisia. To evalúate the different levels of resistance of seven small-seeded faba bean genotypes to these parasitic weed species, three trials were conducted in fields infested and non-infested with O. foetida in the Oued Beja Agricultural Experimental Unit and O. crenata in an experimental field at Ariana of the National Institute of Agricultural Research during three cropping seasons. Compared to the susceptible cv. Bad'i, the seven genotypes showed moderate to high levels of resistance to both Orobanche species. The number and dry weight of emerged broomrapes and underground tubercles recorded on the new improved genotypes were lower than those recorded on released and resistant 'Najeh' and 'Baraca'. The parasitism index on the new genotypes varied from 2-6 times less than susceptible 'Bad'i' in both Oued-Beja and Ariana. Yield reduction due to O.foetida infection varied from 13.5% on genotype XAR-VF00.13-89-2-1-1-1-1 to 59.7% on 'Baraca', whereas the yield loss was about 92% on the susceptible control. Parasitic infection did not affect dry grain protein accumulation in the tested genotypes.

  19. Fast microwave-assisted extraction of rotenone for its quantification in seeds of yam bean (Pachyrhizus sp.).

    Science.gov (United States)

    Lautié, Emmanuelle; Rasse, Catherine; Rozet, Eric; Mourgues, Claire; Vanhelleputte, Jean-Paul; Quetin-Leclercq, Joëlle

    2013-02-01

    The aim of this study was to find if fast microwave-assisted extraction could be an alternative to the conventional Soxhlet extraction for the quantification of rotenone in yam bean seeds by SPE and HPLC-UV. For this purpose, an experimental design was used to determine the optimal conditions of the microwave extraction. Then the values of the quantification on three accessions from two different species of yam bean seeds were compared using the two different kinds of extraction. A microwave extraction of 11 min at 55°C using methanol/dichloromethane (50:50) allowed rotenone extraction either equivalently or more efficiently than the 8-h-Soxhlet extraction method and was less sensitive to moisture content. The selectivity, precision, trueness, accuracy, and limit of quantification of the method with microwave extraction were also demonstrated.

  20. Genetic Diversity and Symbiotic Efficiency of Nodulating Rhizobia Isolated from Root Nodules of Faba Bean in One Field

    Science.gov (United States)

    Lan, Qin; Wang, Ke; Liu, Ming; Peng, Dan; Zhang, Xiaoping; Chen, Qiang; Zhao, Ke; Zeng, Xiangzhong; Xu, Kai Wei

    2016-01-01

    Thirty-one nodulating rhizobium strains were collected from root nodules of spring and winter type faba bean cultivars grown in micro ecoarea, i.e. the same field in Chengdu plain, China. The symbiotic efficiency and phylogeny of these strains were studied. Effectively nitrogen fixing strains were isolated from both winter type and spring type cultivars. Based on phylogenetic analysis of 16S rRNA gene and concatenated sequence of atpD, glnII and recA genes, the isolates were assigned as Rhizobium anhuiense and a potential new Rhizobium species. The isolates were diverse on symbiosis related gene level, carrying five, four and three variants of nifH, nodC and nodD, respectively. Strains carrying similar gene combinations were trapped by both winter and spring cultivars, disagreeing with the specificity of symbiotic genotypes to reported earlier faba bean ecotypes. PMID:27936180

  1. Absorção de metais pesados do lodo de esgoto pelo feijoeiro (Phaseolus vulgaris L. Heavy Metal Uptake Of The Sewage Sludge By Bean Plants(Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Mário Miyazawa

    1998-06-01

    Full Text Available Toxicity and uptake of heavy metals of sewage sludge by beans (Phaseolus vulgaris L. were evaluated in green house experiments. Treatments consisted of 1,0 ; 2,0 and 5,0% (m/m of dry sewage sludge, collected from Londrina (Bom Retiro and ETE-Sul and Curitiba (ETE-Belém and RALF. Bean ( variety IAPAR 57 was sown three times at 0, 120 and 240 days after the treatments have been applied. Contents of Cd, Cr, Co, Cu, Ni, and Pb in bean tissues cultivated with 5,0% (m/m of all sewage sludge were similar to the control and Ba contents were reduced by increasing the quantity of sewage sludge in the soil. The Zn content in tissue bean incresed from 86 mg kg-1 of control to 462 mg kg-1 by applying 5% (m/m of sewage sludge in soil, but plant beans did not show toxicity symptons. The addition of 5% (m/m of sewage sludge increased Mn content in plants, from 193 mg kg-1 of control to 1.960 mg kg-1, showing toxity in bean leaves when the contents were more than 500 mg kg-1. The addition of sewage sludges in soils increased only available Zn carbonate and Cu organic species.

  2. Consideraciones e importancia social en torno al cultivo del frijol en el centro de México Considerations and social importance of the bean crop in central Mexico

    Directory of Open Access Journals (Sweden)

    Dora Ma. Sangerman-Jarquín

    in national importance after maize. The production of pulses, mainly of dry beans, has dropped to a 3.2% rate, whereas population growth is higher than dry bean production. The dry bean seed is a natural source of protein and carbohydrates, is also rich in vitamin B such as niacin, folic acid and thiamine, provides iron, copper, zinc, phosphorus, potassium, magnesium and calcium, and contains high fiber content. There exist many classes of beans that are characterized by their seed size, color, shape and the type of plant growth. It is considered that in total there are 70 species in the genus, and at least 50 in Mexico; five species have been domesticated Phaseolus vulgaris L. (common bean, Phaseolus coccineus L. (runner bean, Phaseolus lunatus L. (lima bean, Phaseolus dumosus L. (fat kidney bean and Phaseolus acutifolius Gray (tepari bean. In Mexico, around 70 cultivars are grown, according to the standard seed classification they are: black, pinto, brown, yellow and pink. The bean crop possesses particular characteristics that are important in the context of food sovereignty, considering it as a staple food for rural and urban poor. The bean breeding program of the National Research Institute, Forestry, Agriculture and Livestock (INIFAP, at the Campo Experimental Valle de Mexico (CEVAMEX, has contributed in the development of the technology required for the country to achieve self-sufficiency in this crop. This technology includes improved varieties with higher yielding ability and better seed nutritive and cooking quality.

  3. USE OF BOTANICAL INSECTICIDES AS AN ALTERNATIVE FOR THE MANAGEMENT OF THE MEXICAN BEAN WEEVIL

    Directory of Open Access Journals (Sweden)

    KAREN FERREIRA DA SILVA

    2016-01-01

    Full Text Available This study aimed to evaluate the insecticidal activity of eight botanical species in the behavior and biological development of Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae under laboratory conditions. The botanical species were applied on bean grains (Phaseolus vulgaris Linnaeus directly as powder or indirectly within TNT bags. Three laboratory assays were performed. First, a repellent activity test was performed by exposing twenty couples of Z. subfasciatus adults in a choice-test arena. Second, a mortality test was performed for seven days after infestation. Finally, the oviposition and emergency rates of adults (% and the development from egg to adult (in days were evaluated in seven couples (males and females for seven days inside of a vial containing 0.3g of the powder from each botanical species and 10 g of bean grains (3% w.w-1. The study was conducted in a completely randomized design, and the treatments were arranged as a factorial design (2 x 9 with two factors (factor 1= powder and TNT bag application forms and factor 2= eight botanical species and control with eight replications. The powder application form was more efficient in controlling Z. subfasciatus. Azadirachta indica (powder application, Ruta graveolens (powder application, and Piper aduncum (TNT bag reduced the infestation of adults. The species A. inidica, Piper tuberculatum, Trichilia catigua, Pfaffia glomerata, R. graveolens, and Mentha pulegium inhibited the oviposition of the insects regardless of the formulation applied. R. graveolens (powder application caused 100% of mortality. The powder application of R. graveolens and M. pulegium reduced egg viability and insect emergence; therefore, they are very promising alternatives to control Z. subfasciatus in stored grains.

  4. Effect of gamma irradiation on the microbiological quality and on the functional properties of proteins in dry red kidney beans (Phaseolus vulgaris)

    Energy Technology Data Exchange (ETDEWEB)

    Dogbevi, M.K.; Vachon, C.; Lacroix, M. E-mail: Monique_Lacroix@iaf.uquebec.ca

    2000-03-01

    Gamma-irradiation was found to affect the physicochemical properties of dry red kidney beans. The highest dose used (8 kGy) significantly (P{<=}0.05) modified the extent of deamidation, the number of sulfhydryl groups, as well as the solubility and the hydrophobicity of the protein. Deamidation, protein solubility and hydrophobicity all increased with the irradiation dose while the number of sulfhydryl groups was reduced by the treatment. Furthermore, irradiation also affected the outgrowth of natural filamentous fungi contaminants present on the dry beans. A dose of 1.5 kGy reduced the number of filamentous fungi by 2 log cycles immediately after treatment. However, the highest dose used (3 kGy) did not eliminate the filamentous fungi completely. Moreover, the filamentous fungi population was a lot less diversified on the irradiated samples. Species of Aspergillus sp. and Penicillium sp. were more abundant on the unirradiated beans while the beans irradiated at 3 kGy contained were predominantly infected by species of Rhizopus sp. , Cladosporium sp. and Alternaria sp. (author)

  5. 外源磷与AMF对间作玉米种植红壤无机磷形态的影响%Effect of phosphorus addition and different AMF on inorganic phosphorus forms in red soil under intercropping maize plants

    Institute of Scientific and Technical Information of China (English)

    张丽; 柳勇; 谷林静; 岳献荣; 顾凯; 字国健; 夏运生

    2016-01-01

    通过三室隔网分室盆栽模拟试验,研究了分室不同磷( P)源[无机磷(磷酸二氢钾)和有机磷(大豆卵磷脂), P添加量均为50 mg·kg-1]添加和根室接种不同丛枝菌根真菌( AMF)[ Glomus mosseae ( GM)、 Glo-mus etunicatum ( GE)]对间作玉米种植红壤无机磷形态的影响。结果表明:无论接种与否,间作处理使根室土壤有效磷含量显著降低,说明间作能够促进玉米植株对土壤有效磷的吸收,且有效磷的耗竭从根际土壤开始。除OP50-单作玉米处理的Org-P外,接种AMF均一定程度增加了各形态无机磷含量。此外,根室土壤有效磷的主要组分为Ca2-P、 Al-P和Org-P,其中Org-P与土壤有效磷有着极显著的负相关关系。%A pot simulation experiment was conducted to study the phosphorus ( P ) forms in red soil under different P sources [ inorganic phosphorus ( potassium dihydrogen phosphate) and organic phosphorus ( soy lecithin) ] addition to com-partment chamber ( P 50 mg · kg-1 soil respectively ) and two different kinds of arbuscular mycorrhizal fungi ( AMF ) , i. e. Glomus mosseae ( GM) and Glomus etunicatum ( GE) , inoculation for intercropping maize planting condition. The re-search results showed that regardless of the inoculation of AMF, intercropping treatment significantly decreased the available P content in soil of root chamber, which indicated that intercropping promoted the absorption of available P by maize plants from soil, and the available P exhaust began from the rhizosphere soil. Except the Org-P under OP50 addition and mono-maize treatment, AMF inoculation increased the contents of all inorganic P forms to a certain extent. Ca2-P, Al-P and Org-P were the main group of soil available P in the soil of root chamber, and the Org-P was significantly negative correlated with available P in red soil.

  6. Implementación de metodología Amfe Análisis de Modo de Falla y Efecto en la línea de cocinas de la empresa Induglob S.A.

    OpenAIRE

    Tamariz Silva, Francisco Xavier

    2012-01-01

    La visión de los empresarios actuales está centrada en la exportación de sus productos como vía de su crecimiento, la de sus colaboradores y la comunidad en la que se desarrollan. Pero ante un mundo globalizado de alternativas el cliente de hoy exige que sus necesidades sean cubiertas a un precio justo y con buena calidad. Ante ésta realidad las empresas deben ser altamente competitivas y estrategas para entender y dar al cliente lo que necesita. La metodología del AMFE aplicada en el present...

  7. Algae as a Feedstock for Biofuels. An Assessment of the Current Status and Potential for Algal Biofuels Production. Joint Summary report of IEA-AMF Annex XXXIV-2 and IEA Bioenergy Task 39

    Energy Technology Data Exchange (ETDEWEB)

    O' Conner, D. [S and T2 Consultants, Inc. (Canada)

    2011-09-15

    In 2010, the IEA Advanced Motor Fuels Implementing Agreement and the IEA Bioenergy Task 39 both commissioned reports on the status and potential opportunities for Algal Biofuels. While there were substantial similarities in the findings of the two reports, each report provides unique perspectives on different aspects of the technology and the opportunities. This summary draws on both of those reports. The Task 39 report (Bioenergy Algal Biofuels.pdf) was authored by Al Darzins and Philip Pienkos (NREL, US) and Les Edye (BioIndustry Partners, Australia). The IEA AMF report was prepared by Karen Sikes and Ralph McGill (Sentech, Inc. US) and Martijn Van Walwijk (Independent Researcher).

  8. Response of an endangered tree species from Caatinga to mycorrhization and phosphorus fertilization

    Directory of Open Access Journals (Sweden)

    João Ricardo Gonçalves de Oliveira

    2015-03-01

    Full Text Available Schinopsis brasiliensis is an endangered tree species found in the Caatinga biome. It presents a characteristic slow development and difficult propagation, although it has been traditionally exploited in the region. Application of arbuscular mycorrhizal fungi (AMF and phosphorus (P fertilization may be beneficial to S. brasiliensis development at the seedling stage, which at the same time may help species conservation and the recovery of degraded areas in the Caatinga biome. We assessed the response of S. brasiliensis to AMF inoculation (Claroideoglomus etunicatum and Acaulospora longula and P fertilization (0, 12, 24, and 48 mg dm−3 addition of P2O5. S. brasiliensis responded positively to both AMF inoculation and P fertilization. At low P concentrations, the inoculated plants showed higher leaf area and enhanced vegetative development, nutrient content and biomass production compared with non-inoculated plants. Conversely, increasing levels of P fertilization decreased the level of mycorrhizal colonization, plant responsiveness to inoculation, and spore production in C. etunicatum. Thus, P concentrations were able to influence the response of S. brasiliensis to mycorrhization and responsiveness to increased mycorrhization with the decrease in P availability. These results showed that mycorrhizal symbiosis plays an essential role in the development of S. brasiliensis.

  9. Single nucleotide polymorphisms for assessing genetic diversity in castor bean (Ricinus communis

    Directory of Open Access Journals (Sweden)

    Rabinowicz Pablo D

    2010-01-01

    Full Text Available Abstract Background Castor bean (Ricinus communis is an agricultural crop and garden ornamental that is widely cultivated and has been introduced worldwide. Understanding population structure and the distribution of castor bean cultivars has been challenging because of limited genetic variability. We analyzed the population genetics of R. communis in a worldwide collection of plants from germplasm and from naturalized populations in Florida, U.S. To assess genetic diversity we conducted survey sequencing of the genomes of seven diverse cultivars and compared the data to a reference genome assembly of a widespread cultivar (Hale. We determined the population genetic structure of 676 samples using single nucleotide polymorphisms (SNPs at 48 loci. Results Bayesian clustering indicated five main groups worldwide and a repeated pattern of mixed genotypes in most countries. High levels of population differentiation occurred between most populations but this structure was not geographically based. Most molecular variance occurred within populations (74% followed by 22% among populations, and 4% among continents. Samples from naturalized populations in Florida indicated significant population structuring consistent with local demes. There was significant population differentiation for 56 of 78 comparisons in Florida (pairwise population ϕPT values, p Conclusion Low levels of genetic diversity and mixing of genotypes have led to minimal geographic structuring of castor bean populations worldwide. Relatively few lineages occur and these are widely distributed. Our approach of determining population genetic structure using SNPs from genome-wide comparisons constitutes a framework for high-throughput analyses of genetic diversity in plants, particularly in species with limited genetic diversity.

  10. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel; Ambachew; Firew; Mekbib; Asrat; Asfaw; Stephen; E.Beebe; Matthew; W.Blair

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot(BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly; iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress.In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  11. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Directory of Open Access Journals (Sweden)

    Daniel Ambachew

    2015-08-01

    Full Text Available Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM. The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i water deficit at mid-pod fill, or ii unprotected against bean fly; iii irrigated, well watered conditions, or iv bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  12. Trait associations in common bean genotypes grown under drought stress and field infestation by BSM bean fly

    Institute of Scientific and Technical Information of China (English)

    Daniel Ambachew; Firew Mekbib; Asrat Asfaw; Stephen E. Beebe; Matthew W. Blaird

    2015-01-01

    Understanding functional relations among plant traits and their modulation by growing conditions is imperative in designing selection strategies for breeding programs. This study assessed trait relationships among 196 common bean genotypes exposed to stresses for drought and field infestation of bean fly or bean stem maggot (BSM). The study was carried out at two locations and data was analyzed with linear correlation, path coefficient and genotype × trait biplot analyses. Multiple trait data related to mechanisms of drought and bean fly tolerance were collected on 196 genotypes grown under i) water deficit at mid-pod fill, or ii) unprotected against bean fly;iii) irrigated, well watered conditions, or iv) bean fly protection with chemicals. Seed yield exhibited positive and significant correlations with leaf chlorophyll content, vertical root pulling resistance, pod harvest index, pods per plant and seeds per pod at both phenotypic and genotypic levels under stress and non-stress conditions. Genotypic correlations of traits with seed yield were greater than their respective phenotypic correlations across environments indicating the greater contribution of genotypic factors to the trait correlation. Pods per plant and seeds per pod had high positive direct effects on seed yield both under stress and non-stress whereas pods per plant had the highest indirect effect on seed yield through pod harvest index under stress. In general, our results suggest that vertical root pulling resistance and pod harvest index are important selection objectives for improving seed yield in common beans under non-stress and stress conditions, and particularly useful for drought and BSM tolerance evaluation.

  13. Major proteins of yam bean tubers.

    Science.gov (United States)

    Gomes, A V; Sirju-Charran, G; Barnes, J A

    1997-09-01

    The tuberous roots of the Mexican yam bean, jicama, (Pachyrhizus erosus L. Urban) contained large quantities of two acidic glycoproteins which accounted for more than 70% of the total soluble proteins (about 3 g per 100 g of tuber on a dry weight basis). The two major proteins, tentatively named YBG1 and YBG2, had apparent M(r)s of 28,000 and 26,000, respectively, by SDS-PAGE. A third protein named YBP22 which accounted for 2-5% of the total soluble proteins had an M(r) of 22,000. YBG1 and YBG2 exhibited great similarity on the basis of their amino acid composition and had identical N-terminal amino acid sequences. The first 23 amino acids in the N-terminal region of YBG2 were DDLPDYVDWRDYGAVTRIKNQGQ which showed strong homology with the papain class of cysteine proteases. YBG1 and YBG2 were found to bind to a Concanavalin A-Sepharose column and were also stained positively by a sensitive glycoprotein stain. Both glycoproteins exhibited cysteine proteolytic activity. In contrast, YBP22 showed sequence homology with several known protease inhibitors, and a polyclonal antibody raised against this protein cross reacted with soybean trypsin inhibitor.

  14. Melhoramento do feijoeiro Breeding of dry beans

    Directory of Open Access Journals (Sweden)

    Ibrahim O. Abrahão

    1960-01-01

    Full Text Available Os ensaios de variedades e linhagens de feijão, realizados no período de 1948 a 1957 pelo Seção de Genética e resumidamente aqui apresentados, vieram indicar que as variedades e linhagens do grupo Mulatinho e Chumbinho eram as mais produtivas. A partir dêste ano agrícola, novos ensaios comparativos de produção foram realizados, a fim de verificar o comportamento das variedades e linhagens existentes com as variedades recém-introduzidas e as novas linhagens selecionadas. As variedades comerciais e suas linhagens, estudadas neste trabalho, foram classificadas em oito grupos, com base nas observações realizadas principalmente sôbre o tipo de planta e característicos dos sementes, o saber: Mulatinho, Chumbinho, Rosinha, Roxinho, Manteiga, Prêto, Bico-de-Ouro e diversos. Dos oito ensaios analisados em detalhes e realizados em Campinas, chegou-se à conclusão de que as variedades dos grupos Prêta e Rosinha são as de maior capacidade produtiva, devendo ser intensificado o aproveitamento dêsses grupos no plano de melhoramento em execução. As do grupo Roxinho apresentam-se menos produtivas. A comparação das análises dos ensaios como látice e blocos ao acaso revelou uma eficiência média de ordem de 30% para o tipo látice nos oito ensaios analisados. A fim de observar se o pêso total de plantas por ocasião da colheita mostra correlação com a produção de grãos, determinou-se, para cada grupo, o índice entre essas duas variáveis. Observou-se que êstes índices são proporcionais à produção, servindo, assim, para melhor caracterizar os diversos grupos de variedades e linhagens de feijão.In spite of the fact that dry beans (Phaseolus vulgaris are one of the main sources of protein in the State of São Paulo, Brazil, they are considered a secondary crop and grown only in small patches or intercropped with coffee, sugar cane, or corn. The development of high yielding strains resistant to the most prevailing diseases, has

  15. Effect of plant species on P cycle-related microorganisms associated with litter decomposition and P soil availability: implications for agroforestry management

    Directory of Open Access Journals (Sweden)

    Correa E

    2016-04-01

    Full Text Available Cutting dry deciduous forest (preserved site for wood supply in semi-arid Brazil has led to invasion of a pioneer shrub vegetation called “Carrasco” (disturbed site, which inhibits the sprouting of native species. A land restoration project was undertaken in a cleared Carrasco area where a mixed plantation of native species and Eucalyptus spp. (experimental site was established to preserve the forest and ensure wood supply for the local population. We considered phosphorus as a limiting soil nutrient to plant growth, and we addressed the roles of litter decomposition and microbial activity on phosphorus release in the disturbed, preserved and experimental sites. The phosphorus released from leaf litter was affected by the vegetation type, which favored specific soil microbial populations during decomposition. The Carrasco vegetation predominantly favored arbuscular mycorrhizal fungi (AMF, as shown by root colonization in the litter bags; the Eucalyptus plants favored AMF and ectomycorrhizal fungi (EM, as well as phosphate solubilizing microorganisms (PSM, and the intercropping system favored AMF and PSM groups. In contrast, the preserved site favored the PSM population. High phosphatase activity was found in the preserved and experimental sites in contrast to the Carrasco soil. Principal component analysis showed that AMF root colonization and phosphatase activity were the main parameters influencing the increase in soil phosphorus. Based on the above results, rehabilitation appeared to be underway in the experimental site, since the samples were more similar to the preserved site than to the disturbed site. This effect was attributed to Eucalyptus camaldulensis that promote the establishment of all phosphorus cycle-related microorganisms (AMF, EM and PSF. E. camaldulensis associated with mycorrhizal fungi and PSM are recommended for inclusion in agroforestry systems.

  16. The BEAN experiment - An EISCAT study of ion temperature anisotropies

    Directory of Open Access Journals (Sweden)

    I. W. McCrea

    Full Text Available Results are presented from a novel EISCAT special programme, SP-UK-BEAN, intended for the direct measurement of the ion temperature anisotropy during ion frictional heating events in the high-latitude F-region. The experiment employs a geometry which provides three simultaneous estimates of the ion temperature in a single F-region observing volume at a range of aspect angles from 0° to 36°. In contrast to most previous EISCAT experiments to study ion temperature anisotropies, field-aligned observations are made using the Sodankylä radar, while the Kiruna radar measures at an aspect angle of the order of 30°. Anisotropic effects can thus be studied within a small common volume whose size and altitude range is limited by the radar beamwidth, rather than in volumes which overlap but cover different altitudes. The derivation of line-of-sight ion temperature is made more complex by the presence of an unknown percentage of atomic and molecular ions at the observing altitude and the possibility of non-Maxwellian distortion of the ion thermal velocity distribution. The first problem has been partly accounted for by insisting that a constant value of electron temperature be maintained. This enables an estimate of the ion composition to be made, and facilitates the derivation of more realistic line-of-sight ion temperatures and temperature anisotropies. The latter problem has been addressed by assuming that the thermal velocity distribution remains bi-Maxwellian. The limitations of these approaches are discussed. The ion temperature anisotropies and temperature partition coefficients during two ion heating events give values intermediate between those expected for atomic and for molecular species. This result is consistent with an analysis which indicates that significant proportions of molecular ions (up to 50% were present at the times of greatest heating.

  17. The fate of phosphorus fertilizer in Amazon soya bean fields.

    Science.gov (United States)

    Riskin, Shelby H; Porder, Stephen; Neill, Christopher; Figueira, Adelaine Michela e Silva; Tubbesing, Carmen; Mahowald, Natalie

    2013-06-05

    Fertilizer-intensive soya bean agriculture has recently expanded in southeastern Amazonia, and whereas intensive fertilizer use in the temperate zone has led to widespread eutrophication of freshwater ecosystems, the effects in tropical systems are less well understood. We examined the fate of fertilizer phosphorus (P) by comparing P forms and budgets across a chronosequence of soya bean fields (converted to soya beans between 2003 and 2008) and forests on an 800 km(2) soya bean farm in Mato Grosso, Brazil. Soya bean fields were fertilized with 50 kg P ha(-1) yr(-1) (30 kg P ha(-1) yr(-1) above what is removed in crops). We used modified Hedley fractionation to quantify soil P pools and found increases in less-plant-available inorganic pools and decreases in organic pools in agricultural soils compared with forest. Fertilizer P did not move below 20 cm. Measurements of P sorption capacity suggest that while fertilizer inputs quench close to half of the sorption capacity of fast-reacting pools, most added P is bound in more slowly reacting pools. Our data suggest that this agricultural system currently has a low risk of P losses to waterways and that long time-scales are required to reach critical soil thresholds that would allow continued high yields with reduced fertilizer inputs.

  18. Inoculation of drought-stressed strawberry with a mixed inoculum of two arbuscular mycorrhizal fungi: effects on population dynamics of fungal species in roots and consequential plant tolerance to water deficiency.

    Science.gov (United States)

    Boyer, Louisa Robinson; Brain, Philip; Xu, Xiang-Ming; Jeffries, Peter

    2015-04-01

    The effect of inoculation with two arbuscular mycorrhizal fungi (AMF) on growth and drought tolerance of cultivated strawberry (Fragaria × ananassa) was studied. Three treatments (a single treatment either of Funneliformis mosseae BEG25, Funneliformis geosporus BEG11 or a 50:50 mixed inoculation treatment of both species) were compared to uninoculated plants. Species-specific primers for qPCR quantification of F. geosporus and F. mosseae DNA were developed to quantify the relative abundance of each fungus in roots of strawberry under different conditions of water stress. Co-occupation of the same root by both species was shown to commonly occur, but their relative abundance varied with water stress (reduced irrigation of up to 40%). Greater root colonisation was observed microscopically under water stress, but this increased colonisation was often accompanied with decreased amounts of fungal DNA in the root. F. mosseae tended to become more abundant under water stress relative to F. geosporus. There was significant correlation in the fungal colonisation measurements from the microscopic and qPCR methods under some conditions, but the nature of this relationship varied greatly with AMF inoculum and abiotic conditions. Single-species inoculation treatments gave similar benefits to the host to the mixed inoculation treatment regardless of irrigation regime; here, amount of colonisation was of greater importance than functional diversity. The addition of AMF inocula to plants subjected to reduced irrigation restored plant growth to the same or higher values as the non-mycorrhizal, fully-watered plants. The water use efficiency of plants was greater under the regulated deficit irrigation (RDI) regime and in AMF-inoculated plants, but there were no significant differences between plants inoculated with the single or combined inoculum. This study demonstrated that the increase in plant growth was directly influenced by an increase in root colonisation by AMF when

  19. Effect of fermented soya beans on diarrhoea and feed efficiency in weaned piglets

    NARCIS (Netherlands)

    Kiers, J.L.; Meijer, J.C.; Nout, M.J.R.; Rombouts, F.M.; Nabuurs, M.J.A.; Meulen, van der J.

    2003-01-01

    Aims: To evaluate anti-diarrhoeal and growth enhancing properties of fermented soya beans in weaned piglets. Methods and Results: In a first phase piglet diet, toasted full-fat soya beans (20%) were replaced with either cooked soya beans or Rhizopus microsporus or Bacillus subtilis fermented soya be

  20. Extraction and characterization of polysaccharides from green and roasted Coffea arabica beans.

    NARCIS (Netherlands)

    Oosterveld, A.; Harmsen, H.; Voragen, A.G.J.; Schols, H.A.

    2003-01-01

    Polysaccharides were sequentially extracted from green and roasted Coffea arabica beans with water (90 °C), EDTA, 0.05, 1, and 4 M NaOH and characterized chemically. Additionally, the beans were subjected to a single extraction with water at 170 °C. Green arabica coffee beans contained large proport

  1. Physicochemical characteristics of green coffee: comparison of graded and defective beans.

    Science.gov (United States)

    Ramalakshmi, K; Kubra, I R; Rao, L J M

    2007-06-01

    Defective (triage) coffee beans are beans rejected after separating the graded ones according to the size and color. These coffee beans represent about 15% to 20% of coffee production in India but are not utilized for beverages since these affect the quality of coffee brew. In the present study, physical characteristics such as bean density, brightness, titratable acidity, pH, moisture, and total soluble solids and also chemical composition, namely, caffeine, chlorogenic acids, lipids, sucrose, total polyphenols, and proteins, were evaluated in defective as well as in graded green coffee beans. The physical parameters such as weight, density, and brightness of defective coffee beans were low compared to the graded beans, which is due to the presence of immature, broken, bleached, and black beans. Caffeine content was low in triage beans compared to graded beans. Chlorogenic acids, one of the composition in coffee responsible for antioxidant activity, was found to be intact (marginally high in some cases) in defective coffee beans. Hence, triage coffee beans can be evaluated as a source of antioxidant or radical scavenging conserve for food systems.

  2. The Effect of Cd, Zn and Fe on Seed Germination and Early Seedling Growth of Wheat and Bean

    Directory of Open Access Journals (Sweden)

    El Rasafi Taoufik

    2016-09-01

    Full Text Available This study was conducted to evaluate the effect of metals on wheat and bean species. The method uses seed germination and early seedling growth of these plants in the presence of various levels (10, 50, 100, 250, 500, 750 and 1000 mg/L of Cadmium (Cd, Iron (Fe and Zinc (Zn. The inhibition caused by these metals was depending on the concentration used, the metal itself and the plant species. The species had reduced seed germination, root and shoot lengths, tolerance index and percentphyto-toxicity with increasing concentrations of metals. Cadmium was determined to be the most inhibitory metal on these parameters. This metal affected significantly the germination, root and shoot length of the species tested, as well as the tolerance index and percentphytotoxicity starting from 50 mg Cd/l. Under the Iron stress, in general, the inhibition of germination and root length of wheat was reduced from 500 mg Fe/l. The results showed also that the inhibitory effect of increase of Zn levels was seen in root, shoot and tolerance indices. The findings also revealed that the metal toxicity was as follow: Cd > Fe > Zn. Regarding species, the results showed that bean seemed to be more tolerant to the increase of the three metals than wheat.

  3. Apis mellifera pollination improves agronomic productivity of anemophilous castor bean (Ricinus communis

    Directory of Open Access Journals (Sweden)

    Rômulo A.G. Rizzardo

    2012-12-01

    Full Text Available Castor bean (Ricinus communis L. is cultivated mainly for biodiesel production because of its oil-rich seeds; it is assumed to be an anemophylous species. But pollination deficit can lead to low productivity often attributed to other reasons. In this paper, we investigated pollination requirements, pollination mechanism, occurrence of pollination deficit, and the role of biotic pollinators in a large commercial plantation of castor bean. Our results show that R. communis bears a mixed breeding system favoring selfing by geitonogamy, although the wind promotes mostly outcrossing. We also found that the honey bee (Apis mellifera L. foraging on castor bean can both transfer pollen from male to female flowers within the same raceme and boost the release of airborne pollen by male flowers. Both situations increase geitonogamy rates, raising significantly fruit set and seed yield. This is the first report of an animal foraging activity increasing seed yield in an anemophilous and geitonogamous crop and elucidates the role of biotic pollinators in castor bean reproduction.A mamoneira (Ricinus communis L. é cultivada principalmente para produção de biodiesel devido ao alto teor de óleo de suas sementes e considerada como sendo de polinização anemófila. Mas déficits de polinização podem levar a baixos índices de produtividade geralmente atribuídos a outros fatores. Neste trabalho foram investigados os requerimentos, mecanismos e déficit de polinização e o papel dos polinizadores bióticos em um monocultivo comercial de mamona. Os resultados mostram que R. communis possui um sistema de polinização misto, favorecendo a autopolinização por geitonogamia, embora o vento normalmente promova polinização cruzada. Observou-se também que a abelha melífera (Apis mellifera L. forrageando na mamoneira pode tanto transferir pólen das flores estaminadas para as pistiladas do mesmo racemo, quanto aumentar consideravelmente a liberação de p

  4. Comparison of antioxidant activity between green and roasted coffee beans using molecular methods.

    Science.gov (United States)

    Priftis, Alexandros; Stagos, Dimitrios; Konstantinopoulos, Konstantinos; Tsitsimpikou, Christina; Spandidos, Demetrios A; Tsatsakis, Aristides M; Tzatzarakis, Manolis N; Kouretas, Demetrios

    2015-11-01

    Coffee is one of the most popular and widely consumed beverages worldwide due to its pleasant taste and aroma. A number of studies have been performed to elucidate the possible beneficial effects of coffee consumption on human health and have shown that coffee exhibits potent antioxidant activity, which may be attributed mainly to its polyphenolic content. However, there is also evidence to suggest that coffee roasting (the procedure which turns green coffee beans to the dark, roasted ones from which the beverage derives) may alter the polyphenolic profile of the beans (e.g., via the Maillard reaction) and, concomitantly, their antioxidant activity. In the present study, the antioxidant activity of 13 coffee varieties was examined in both green and roasted coffee bean extracts using 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS•+)- radical scavenging assays. In addition, 5 selected varieties were also examined for their protective effects against peroxyl and hydroxyl radical‑induced DNA strand cleavage. Finally, C2C12 murine myoblasts were treated with non‑cytotoxic concentrations of the most potent extract in order to examine its effects on the cellular redox status by measuring the glutathione (GSH) and reactive oxygen species (ROS) levels by flow cytometry. Our results revealed that, in 8 out of the 13 coffee varieties, roasting increased free radical scavenging activity as shown by DPPH and ABTS•+ assays. Moreover, we found that when one coffee variety was roasted for different amounts of time, the increase in the antioxidant activity depended on the roasting time. By contrast, in 5 varieties, roasting reduced the antioxidant activity. Similar differences between the roasted and green beans were also observed in the free radical‑induced DNA strand cleavage assay. The observed differences in the antioxidant activity between the different coffee varieties may be attributed to their varying

  5. Genetic Diversity and Symbiotic Efficiency of Indigenous Common Bean Rhizobia in Croatia.

    Science.gov (United States)

    Pohajda, Ines; Babić, Katarina Huić; Rajnović, Ivana; Kajić, Sanja; Sikora, Sanja

    2016-12-01

    Nodule bacteria (rhizobia) in symbiotic associations with legumes enable considerable entries of biologically fixed nitrogen into soil. Efforts are therefore made to intensify the natural process of symbiotic nitrogen fixation by legume inoculation. Studies of field populations of rhizobia open up the possibility to preserve and probably exploit some indigenous strains with hidden symbiotic or ecological potentials. The main aim of the present study is to determine genetic diversity of common bean rhizobia isolated from different field sites in central Croatia and to evaluate their symbiotic efficiency and compatibility with host plants. The isolation procedure revealed that most soil samples contained no indigenous common bean rhizobia. The results indicate that the cropping history had a significant impact on the presence of indigenous strains. Although all isolates were found to belong to species Rhizobium leguminosarum, significant genetic diversity at the strain level was determined. Application of both random amplification of polymorphic DNA (RAPD) and enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC- -PCR) methods resulted in similar grouping of strains. Symbiotic efficiency of indigenous rhizobia as well as their compatibility with two commonly grown bean varieties were tested in field experiments. Application of indigenous rhizobial strains as inoculants resulted in significantly different values of nodulation, seed yield as well as plant nitrogen and seed protein contents. The most abundant nodulation and the highest plant nitrogen and protein contents were determined in plants inoculated with R. leguminosarum strains S17/2 and S21/6. Although, in general, the inoculation had a positive impact on seed yield, differences depending on the applied strain were not determined. The overall results show the high degree of symbiotic efficiency of the specific indigenous strain S21/6. These results indicate different symbiotic

  6. Volatile compounds of dry beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Oomah, B Dave; Liang, Lisa S Y; Balasubramanian, Parthiba

    2007-12-01

    Volatile compounds of uncooked dry bean (Phaseolus vulgaris L.) cultivars representing three market classes (black, dark red kidney and pinto) grown in 2005 were isolated with headspace solid phase microextraction (HS-SPME), and analyzed with gas chromatography mass spectrometry (GC-MS). A total of 62 volatiles consisting of aromatic hydrocarbons, aldehydes, alkanes, alcohols and ketones represented on average 62, 38, 21, 12, and 9 x 10(6) total area counts, respectively. Bean cultivars differed in abundance and profile of volatiles. The combination of 18 compounds comprising a common profile explained 79% of the variance among cultivars based on principal component analysis (PCA). The SPME technique proved to be a rapid and effective method for routine evaluation of dry bean volatile profile.

  7. Changes of physical properties of coffee beans during roasting

    Directory of Open Access Journals (Sweden)

    Jokanović Marija R.

    2012-01-01

    Full Text Available The effects of heating time on physical changes (weight, volume, texture and colour of coffee beans (Outspan and Guaxupe coffee were investigated. The roasting temperature of both samples was 170°C and samples for analysis were taken at the intervals of 7 minutes during 40 minutes of roasting. Total weight loss at the end of the roasting process was 14.43 % (light roasted and 17.15 % (medium to dark roasted for Outspan and Guaxupe coffee beans, respectively. Significant (P < 0.05 changes in the coffee bean breaking force values were noted between the 7th and 14th minutes, and statistically not significant (P > 0.05 between the 35th and 40th minutes of the roasting. According to the L* colour parameter as a criterion for the classification of roasted coffee colour (light, medium, dark, the Outspan sample was medium and Guaxupe sample was dark roasted.

  8. The Influence of AMF on the Locust Nutrient Absorption under Different Levels of Calcium Application%不同施钙水平下AMF对刺槐养分吸收的影响

    Institute of Scientific and Technical Information of China (English)

    封晔

    2015-01-01

    This paper studied the influence of different levels of calcium application and inoculation of different AMF on locust growth and mineral nutrient absorption through pot experiment. The results show that: the right amount of Ca application can promote the absorption of nitrogen and phosphorus for locust, and when the volume of Ca application remains at 0.1~0.2g·L-1, the total nitrogen and total phosphorus content of locust are peak in the joint action AMF and Ca, but the Ca application inhibits the absorption of potassium.%采用盆栽实验研究不同施钙水平和接种不同丛枝菌根真菌(arbuscular mycorrhizal fungi,AMF)对刺槐生长状况及矿质养分吸收的影响。结果表明:适量施Ca能促进刺槐对氮和磷的吸收,当施Ca量保持在0.1~0.2g·L-1时,刺槐全氮和全磷含量在AMF、Ca的共同作用下达到峰值,但施Ca抑制了刺槐对钾的吸收。

  9. Low-Income US Women Under-informed of the Specific Health Benefits of Consuming Beans.

    Directory of Open Access Journals (Sweden)

    Donna M Winham

    Full Text Available Bean consumption can reduce chronic disease risk and improve nutrition status. Consumer knowledge of bean health benefits could lead to increased intakes. Low-income women have poorer health and nutrition, but their level of knowledge about bean health benefits is unknown. Beans are a familiar food of reasonable cost in most settings and are cultural staples for Hispanics and other ethnicities. Study objectives were to assess awareness of bean health benefits among low-income women, and to evaluate any differences by acculturation status for Hispanic women in the Southwestern United States.A convenience sample of 406 primarily Mexican-origin (70% low-income women completed a survey on knowledge of bean health benefits and general food behaviors. Principal components analysis of responses identified two summary scale constructs representing "bean health benefits" and "food behaviors." Acculturation level was the main independent variable in chi-square or ANOVA.The survey completion rate was 86% (406/471. Most women agreed or strongly agreed that beans improved nutrition (65% and were satiating (62%. Over 50% answered 'neutral' to statements that beans could lower LDL cholesterol (52%, control blood glucose (56% or reduce cancer risk (56%, indicating indifference or possible lack of knowledge about bean health benefits. There were significant differences by acculturation for beliefs that beans aid weight loss and intestinal health. Scores on the bean health benefits scale, but not the food behavior scale, also differed by acculturation.Limited resource women have a favorable view of the nutrition value of beans, but the majority did not agree or disagreed with statements about bean health benefits. Greater efforts to educate low-income women about bean health benefits may increase consumption and improve nutrition.

  10. 76 FR 33334 - Endangered and Threatened Wildlife and Plants; Initiation of 5-Year Reviews of Nine Species...

    Science.gov (United States)

    2011-06-08

    ... species means any species that is in danger of extinction throughout all or a significant portion of its...) Population size or trends; (B) Species biology or ecology; (C) The effects of current land management on... of Nine Species: Purple Bean, Clubshell, Roanoke Logperch, Swamp Pink, Northern Riffleshell,...

  11. Environmental Effects of Nanoceria on Seed Production of Common Bean (Phaseolus vulgaris): A Proteomic Analysis.

    Science.gov (United States)

    Majumdar, Sanghamitra; Almeida, Igor C; Arigi, Emma A; Choi, Hyungwon; VerBerkmoes, Nathan C; Trujillo-Reyes, Jesica; Flores-Margez, Juan P; White, Jason C; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge L

    2015-11-17

    The rapidly growing literature on the response of edible plants to nanoceria has provided evidence of its uptake and bioaccumulation, which delineates a possible route of entry into the food chain. However, little is known about how the residing organic matter in soil may affect the bioavailability and resulting impacts of nanoceria on plants. Here, we examined the effect of nanoceria exposure (62.5-500 mg/kg) on kidney bean (Phaseolus vulgaris) productivity and seed quality as a function of soil organic matter content. Cerium accumulation in the seeds produced from plants in organic matter enriched soil showed a dose-dependent increase, unlike in low organic matter soil treatments. Seeds obtained upon nanoceria exposure in soils with higher organic matter were more susceptible to changes in nutrient quality. A quantitative proteomic analysis of the seeds produced upon nanoceria exposure provided evidence for upregulation of stress-related proteins at 62.5 and 125 mg/kg nanoceria treatments. Although the plants did not exhibit overt toxicity, the major seed proteins primarily associated with nutrient storage (phaseolin) and carbohydrate metabolism (lectins) were significantly down-regulated in a dose dependent manner upon nanoceria exposure. This study thus suggests that nanoceria exposures may negatively affect the nutritional quality of kidney beans at the cellular and molecular level. More confirmatory studies with nanoceria along different species using alternative and orthogonal "omic" tools are currently under active investigation, which will enable the identification of biomarkers of exposure and susceptibility.

  12. Influence of fermentation and drying materials on the contamination of cocoa beans by ochratoxin A.

    Science.gov (United States)

    Dano, Sébastien Djédjé; Manda, Pierre; Dembélé, Ardjourma; Kouassi Abla, Ange Marie-Joseph; Bibaud, Joel Henri; Gouet, Julien Zroh; Ze Maria Sika, Charles Bruno

    2013-11-28

    Ochratoxin A (OTA) is a mycotoxin produced mainly by species of Aspergillus and Penicillium. Contamination of food with OTA is a major consumer health hazard. In Cote D'Ivoire, preventing OTA contamination has been the subject of extensive study. The current study was conducted to evaluate the influence of fermentation and drying materials on the OTA content in cocoa. For each test, 7000 intact cocoa pods were collected, split open to remove the beans, fermented using 1 of 3 different materials, sun-dried on 1 of 3 different platform types and stored for 30 days. A total of 22 samples were collected at each stage of post-harvesting operations. The OTA content in the extracted samples was then quantified by high-performance liquid chromatography. OTA was detected in beans at all stages of post-harvesting operations at varying levels: pod-opening (0.025 ± 0.02 mg/kg), fermentation (0.275 ± 0.2 mg/kg), drying (0.569 ± 0.015 mg/kg), and storage (0.558 ± 0.04 mg/kg). No significant relationships between the detected OTA level and the materials used in the fermentation and drying of cocoa were observed.

  13. Fungal and mycotoxin contamination of coffee beans in Benguet province, Philippines.

    Science.gov (United States)

    Culliao, Audrey Glenn L; Barcelo, Jonathan M

    2015-01-01

    Coffee remains an important agricultural product in Benguet province, Philippines, but is highly susceptible to fungal and mycotoxin contamination in various stages of growth and processing and in different local climates. In this study, pre- and post-harvest coffee bean samples from temperate and warm farming areas were assessed for their fungal and mycotoxin contaminants. One hundred eighty-five fungal isolates belonging to six genera were isolated representing 88.1% of mycotoxigenic fungi. The predominant species belonged to the genus Aspergillus, which are known producers of mycotoxins. Coffee beans from the post-harvest temperate group were found to have the highest percentage mycotoxigenic contamination of 98.4%, suggesting that the risk for fungal contamination is high after drying. Determination of the mycotoxins indicated 28.6% contamination. Ochratoxin A was found to be highest in dried whole cherries which contained 97.3 μg kg(-1), whilst sterigmatocystin was also highest in dried whole cherries at 193.7 μg kg(-1). These results indicate that there are risks of fungal and mycotoxin contamination of Benguet coffee at the post-harvest stage.

  14. Antioxidant Activities of Phenolic Compounds in Green and White Faba Bean (Vicia faba L.

    Directory of Open Access Journals (Sweden)

    Yu-wei Luo

    2014-12-01

    Full Text Available Polyphenols and tannins have implications for health and nutrition because of their antioxidant activities. Foods with high content of phenolics, such as fruits, vegetables, grains and legumes, show decreasing incidence of several diseases upon their consumption. However, there are limited reports on ant oxidative properties of tannins present in legumes. Faba bean seed has been known for high content of condensed tannin which is attributed as one of the ant nutritional factors in this highly proteinaceous pulse crop. Therefore, the objective of this study was to estimate and characterize the phenolic compounds in different tissues of this pulse and their ant oxidative activities. Fairly good amount of phenolics were observed in all tissues extract which was quite evident from their high FRAP (Ferric reducing antioxidant power value. It was further, observed that the extract prepared from its seeds presented a potent radical scavenger activity as indicated by its high capacity to reduce the free radical diphenylpicrylhydrazyl, whereas the tannin-free extract indicated loss of ant oxidative activities. The seed extract also interacted with superoxide anions, hydroxyl radicals as well as the oxidant species, hydrogen peroxide. Thus, our results provide evidence that the extract prepared from different tissues of faba bean shows antioxidant and radical scavenging activities largely because of its condensed tannins (proanthocyanidins.

  15. Virus-induced gene silencing in soybean and common bean.

    Science.gov (United States)

    Zhang, Chunquan; Whitham, Steven A; Hill, John H

    2013-01-01

    Plant viral vectors are useful for transient gene expression as well as for downregulation of gene expression via virus-induced gene silencing (VIGS). When used in reverse genetics approaches, VIGS offers a convenient way of transforming genomic information into knowledge of gene function. Efforts to develop and improve plant viral vectors have expanded their applications and have led to substantial advances needed to facilitate gene function studies in major row crops. Here, we describe a DNA-based Bean pod mottle virus (BPMV) vector system for both gene expression and VIGS in soybean and common bean.

  16. Locust bean gum: Exploring its potential for biopharmaceutical applications.

    Science.gov (United States)

    Dionísio, Marita; Grenha, Ana

    2012-07-01

    Polysaccharides have been finding, in the last decades, very interesting and useful applications in the biomedical and, specifically, in the biopharmaceutical field. Locust bean gum is a polysaccharide belonging to the group of galactomannans, being extracted from the seeds of the carob tree (Ceratonia siliqua). This polymer displays a number of appealing characteristics for biopharmaceutical applications, among which its high gelling capacity should be highlighted. In this review, we describe critical aspects of locust bean gum, contributing for its role in biopharmaceutical applications. Physicochemical properties, as well as strong and effective synergies with other biomaterials are described. The potential for in vivo biodegradation is explored and the specific biopharmaceutical applications are discussed.

  17. Computational identification and phylogenetic analysis of the oil-body structural proteins, oleosin and caleosin, in castor bean and flax.

    Science.gov (United States)

    Hyun, Tae Kyung; Kumar, Dhinesh; Cho, Young-Yeol; Hyun, Hae-Nam; Kim, Ju-Sung

    2013-02-25

    Oil bodies (OBs) are the intracellular particles derived from oilseeds. These OBs store lipids as a carbon resource, and have been exploited for a variety of industrial applications including biofuels. Oleosin and caleosin are the common OB structural proteins which are enabling biotechnological enhancement of oil content and OB-based pharmaceutical formations via stabilizing OBs. Although the draft whole genome sequence information for Ricinus communis L. (castor bean) and Linum usitatissimum L. (flax), important oil seed plants, is available in public database, OB-structural proteins in these plants are poorly indentified. Therefore, in this study, we performed a comprehensive bioinformatic analysis including analysis of the genome sequence, conserved domains and phylogenetic relationships to identify OB structural proteins in castor bean and flax genomes. Using comprehensive analysis, we have identified 6 and 15 OB-structural proteins from castor bean and flax, respectively. A complete overview of this gene family in castor bean and flax is presented, including the gene structures, phylogeny and conserved motifs, resulting in the presence of central hydrophobic regions with proline knot motif, providing an evolutionary proof that this central hydrophobic region had evolved from duplications in the primitive eukaryotes. In addition, expression analysis of L-oleosin and caleosin genes using quantitative real-time PCR demonstrated that seed contained their maximum expression, except that RcCLO-1 expressed maximum in cotyledon. Thus, our comparative genomics analysis of oleosin and caleosin genes and their putatively encoded proteins in two non-model plant species provides insights into the prospective usage of gene resources for improving OB-stability.

  18. Differences in the Responses to Iron Deficiency Stress between Bean and Maize

    OpenAIRE

    米谷, 力; 森次, 益三; 河﨑, 利夫

    1995-01-01

    The responses to iron deficiency stress in bean and maize were compared. The susceptibility to iron deficiency stress was smaller in bean than in maize;i.e., the tolerance to iron deficiency was greater in bean than in maize. The roots of the bean plants exposed to iron deficiency stress, developed iron reducing capacity and medium-pH lowering capacity,but not the roots of maize. The iron reducing capacity and medium-pH lowering capacity of the bean roots were inhibited by a shadowing, detopp...

  19. Rhizobium paranaense sp. nov., an effective N2-fixing symbiont of common bean (Phaseolus vulgaris L.) with broad geographical distribution in Brazil.

    Science.gov (United States)

    Dall'Agnol, Rebeca Fuzinatto; Ribeiro, Renan Augusto; Delamuta, Jakeline Renata Marçon; Ormeño-Orrillo, Ernesto; Rogel, Marco Antonio; Andrade, Diva Souza; Martínez-Romero, Esperanza; Hungria, Mariangela

    2014-09-01

    Nitrogen (N), the nutrient most required for plant growth, is key for good yield of agriculturally important crops. Common bean (Phaseolus vulgaris L.) can benefit from bacteria collectively called rhizobia, which are capable of fixing atmospheric nitrogen (N2) in root nodules and supplying it to the plant. Common bean is amongst the most promiscuous legume hosts; several described species, in addition to putative novel ones have been reported as able to nodulate this legume, although not always effectively in terms of fixing N2. In this study, we present data indicating that Brazilian strains PRF 35(T), PRF 54, CPAO 1135 and H 52, currently classified as Rhizobium tropici, represent a novel species symbiont of common bean. Morphological, physiological and biochemical properties differentiate these strains from other species of the genus Rhizobium, as do BOX-PCR profiles (less than 60 % similarity), multilocus sequence analysis with recA, gyrB and rpoA (less than 96.4 % sequence similarity), DNA-DNA hybridization (less than 50 % DNA-DNA relatedness), and average nucleotide identity of whole genomes (less than 92.8.%). The novel species is effective in nodulating and fixing N2 with P. vulgaris, Leucaena leucocephala and Leucaena esculenta. We propose the name Rhizobium paranaense sp. nov. for this novel taxon, with strain PRF 35(T) ( = CNPSo 120(T) = LMG 27577(T) = IPR-Pv 1249(T)) as the type strain.

  20. Mining whole genomes and transcriptomes of Jatropha (Jatropha curcas) and Castor bean (Ricinus communis) for NBS-LRR genes and defense response associated transcription factors.

    Science.gov (United States)

    Sood, Archit; Jaiswal, Varun; Chanumolu, Sree Krishna; Malhotra, Nikhil; Pal, Tarun; Chauhan, Rajinder Singh

    2014-11-01

    Jatropha (Jatropha curcas L.) and Castor bean (Ricinus communis) are oilseed crops of family Euphorbiaceae with the potential of producing high quality biodiesel and having industrial value. Both the bioenergy plants are becoming susceptible to various biotic stresses directly affecting the oil quality and content. No report exists as of today on analysis of Nucleotide Binding Site-Leucine Rich Repeat (NBS-LRR) gene repertoire and defense response transcription factors in both the plant species. In silico analysis of whole genomes and transcriptomes identified 47 new NBS-LRR genes in both the species and 122 and 318 defense response related transcription factors in Jatropha and Castor bean, respectively. The identified NBS-LRR genes and defense response transcription factors were mapped onto the respective genomes. Common and unique NBS-LRR genes and defense related transcription factors were identified in both the plant species. All NBS-LRR genes in both the species were characterized into Toll/interleukin-1 receptor NBS-LRRs (TNLs) and coiled-coil NBS-LRRs (CNLs), position on contigs, gene clusters and motifs and domains distribution. Transcript abundance or expression values were measured for all NBS-LRR genes and defense response transcription factors, suggesting their functional role. The current study provides a repertoire of NBS-LRR genes and transcription factors which can be used in not only dissecting the molecular basis of disease resistance phenotype but also in developing disease resistant genotypes in Jatropha and Castor bean through transgenic or molecular breeding approaches.

  1. Biofortified red mottled beans (Phaseolus vulgaris L. in a maize and bean diet provide more bioavailable iron than standard red mottled beans: Studies in poultry (Gallus gallus and an in vitro digestion/Caco-2 model

    Directory of Open Access Journals (Sweden)

    Glahn Raymond P

    2011-10-01

    Full Text Available Abstract Background Our objective was to compare the capacities of biofortified and standard colored beans to deliver iron (Fe for hemoglobin synthesis. Two isolines of large-seeded, red mottled Andean beans (Phaseolus vulgaris L., one standard ("Low Fe" and the other biofortified ("High Fe" in Fe (49 and 71 μg Fe/g, respectively were used. This commercial class of red mottled beans is the preferred varietal type for most of the Caribbean and Eastern and Southern Africa where almost three quarters of a million hectares are grown. Therefore it is important to know the affect of biofortification of these beans on diets that simulate human feeding studies. Methods Maize-based diets containing the beans were formulated to meet the nutrient requirements for broiler except for Fe (Fe concentrations in the 2 diets were 42.9 ± 1.2 and 54.6 ± 0.9 mg/kg. One day old chicks (Gallus gallus were allocated to the experimental diets (n = 12. For 4 wk, hemoglobin, feed-consumption and body-weights were measured. Results Hemoglobin maintenance efficiencies (HME (means ± SEM were different between groups on days 14 and 21 of the experiment (P In-vitro analysis showed lower iron bioavailability in cells exposed to standard ("Low Fe" bean based diet. Conclusions We conclude that the in-vivo results support the in-vitro observations; biofortified colored beans contain more bioavailable-iron than standard colored beans. In addition, biofortified beans seems to be a promising vehicle for increasing intakes of bioavailable Fe in human populations that consume these beans as a dietary staple. This justifies further work on the large-seeded Andean beans which are the staple of a large-region of Africa where iron-deficiency anemia is a primary cause of infant death and poor health status.

  2. Pinto Beans (Phaseolus vulgaris L. as a Functional Food: Implications on Human Health

    Directory of Open Access Journals (Sweden)

    Vicki Schlegel

    2013-02-01

    Full Text Available Most foods are considered functional in terms of providing nutrients and energy to sustain daily life, but dietary systems that are capable of preventing or remediating a stressed or diseased state are classified as functional foods. Dry beans (Phaseolus vulgaris L. contain high levels of chemically diverse components (phenols, resistance starch, vitamins, fructooligosaccharides that have shown to protect against such conditions as oxidative stress, cardiovascular disease, diabetes, metabolic syndrome, and many types of cancer, thereby positioning this legume as an excellent functional food. Moreover, the United States has a rich dry bean history and is currently a top producer of dry beans in the world with pinto beans accounting for the vast majority. Despite these attributes, dry bean consumption in the US remains relatively low. Therefore, the objective of this manuscript is to review dry beans as an important US agricultural crop and as functional food for the present age with an emphasis on pinto beans.

  3. Physicochemical properties and antioxidant capacity of raw, roasted and puffed cacao beans.

    Science.gov (United States)

    Hu, SuJung; Kim, Byung-Yong; Baik, Moo-Yeol

    2016-03-01

    The antioxidant capacity and attributable bioactive compounds of puffed cacao beans were investigated. Roasting was carried out at 190°C for 15min and puffing was performed at 4-7kgf/cm(2). Cacao beans puffed at 4kgf/cm(2) showed the highest total polyphenols (23.16mgGAE/gsample) and total flavonoids (10.65mgCE/gsample) (pcacao beans reflected the total polyphenols and flavonoids measured. The quantities of theobromine, catechin, epicatechin, and procyanidin B2 were higher in cacao beans puffed at 4kgf/cm(2) than in roasted cacao beans. Puffed cacao beans received a good sensory score in flavor, but sourness increased as puffing pressure increased. Thus, these results suggest that, in cacao bean processing, puffing could be an alternative to roasting, which provide a rich taste and high antioxidant capacity.

  4. Endomycorrhizal Inoculation Effect On Beans (Phaseolus vulgaris L., OAT (Avena sativa L., And Wheat (Triticum aestivum L. Growth Cultivated In Two Soil Types Under Greenhouse Conditions

    Directory of Open Access Journals (Sweden)

    Abdul Khalil Gardezi

    2012-10-01

    Full Text Available The objective of this research was to evaluate the effect of inoculation with Glomus intraradices on oat, beans, and wheat. The study was done under greenhouse conditions at the Montecillo Campus of the Postgraduate College, Mexico. Two soil types from San Luis Potosí State were used, one was red (Xerosol, and the other one was grey (Litosol. With and without Glomus intraradices inoculation. Three bean cultivars: Pinto Saltillo, Bayo comercial and Flor de Mayo; Chihuahua (oat variety; and Tlaxcala wheat genotype were planted. The experimental design was factorial complete randomized block and three replications. The result showed that bean yield (average 3.7 g plant-1, pod number and dry weight, leaf area, plant height, stem diameter, and aerial part dry weight were positively affected by the inoculation with Glomus intraradices, but not by soil type. A similar trend was observed in root length, volume and dry weight, and in the nodule number. In relation with the species studied, Phaseolus vulgaris varieties had higher values than wheat and oats in growth and yield variables evaluated. It is concluded that endomycorrhiza inoculation (Glomus intraradices gave better growth and yield, especially in beans. The soil types studied did not affect significantly plant responses in this study.

  5. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    Science.gov (United States)

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  6. Adaptive Potential for the Invasion of Novel Host Plants in the Bean Weevil: Patterns of the Reproductive Behavior in Populations That Used Different Host Plants

    Directory of Open Access Journals (Sweden)

    Dragana Milanović

    2007-01-01

    Full Text Available The goal of this work was to examine interpopulation patterns in the reproductive behavior of populations of bean weevil (Acanthoscelides obtectus Say; Coleoptera: Bruchidae that had different levels of specialization on their native host plant – the bean (Phaseolus vulgaris L., as well as on a novel host plant – the chickpea (Cicer arietinum Thorn. The obtained pattern of interpopulation mating behavior seemed exactly as if the males on chickpea had evolved a specific odor and/or a courtship ritual that females of populationson bean found repulsive. Unlike females, the males of bean populations seemed to be willing to mate with females from the population on chickpea equally as with their own females. Such an asymmetric pattern of reproductive isolation between populations ofa species has been often considered an initial phase of a process of speciation. Thus, our results could be a good starting point for further, thorough examination of both the role of the level of host specialization in females and the role of biochemical characteristics of male pheromone (and/or their cuticular hydrocarbones in the evolution of pre-reproductive isolation between insect populations.As the results of this study, together those of previous studies on A. obtectus, suggest great evolutionary potential for invasions of and fast specialization on novel host plants, they could provide valuable information for the development of long-term strategiesunder the programmes of Integrated Pest Management.

  7. ADMINISTRATION OF CACAO BEANS (Theobroma cacao L. EXTRACTS DECREASE MALONDIALDEHYDE CONCENTRATION AND INCREASE BLOOD NOx CONCENTRATION IN WHITE RAT (Ra"us norvegicus INDUCED BY PSYCHOSOCIAL STRESS

    Directory of Open Access Journals (Sweden)

    Dewi Wiryanthini IA

    2013-04-01

    Full Text Available Increased production of reactive oxygen species (ROS causing accumulation of oxidative damage caused by exceeding anti oxidant capacity in the body. Psychological stress as psychosocial stress can induce oxidative stress which subsequently cause increase blood malondialdehyde (MDA and decrease blood nitrate and nitrite (NOx concentration as intermediate product of nitric oxide (NO. Cacao beans extracts contained anti oxidant flavanols consist of catechin, epicatechin and procyanidin. The aims of this study is to investigate the effect of cacao beans (Theobroma cacao L. extracts for decreasing MDA and increasing NOx concentration in white rat (Ra$us norvegicus blood in stress oxidative state induced by psychosocial stress. It is an experimental study with Pretest-Postest Control Group Design. This study revealed decrease MDA concentration in group P1 (11.47 vs 8.04, P2 (11.92 vs 5.44 and P3 (11.69 vs 2.87 with P = 0.000 and increase NOx concentration in oxidative stress white rat induced by psychosocial stress a[er administration of cacao beans extract in group P1 (1909.83 vs 2085.16, P2 (1912.5 vs 2231.83 and P3 (1871.5 vs 2339.83 with P = 0.005. This study showed that cacao beans extract can inhibit oxidative stress caused by psychosocial stress.

  8. History of the common bean crop: its evolution beyond its areas of origin and domestication

    Directory of Open Access Journals (Sweden)

    De Ron, Antonio M.

    2016-06-01

    Full Text Available The common bean (Phaseolus vulgaris L. is the most important grain legume for direct human consumption on a global scale. Current bean germplasm collections show a wide variation of phenotypes, although genetic erosion is gradually affecting this species as in many countries local traditional varieties are being replaced by elite cultivars. This crop has spread to every continent over the past few centuries, which has resulted in a complex genetic structure of bean germplasm outside its areas of origin and domestication (South and Central America. Some evidence indicates that this germplasm is more complex than previously thought and contains additional, as yet unexplored, diversity. This is especially the case in southern Europe, particularly in the Iberian Peninsula, where it was introduced in the early sixteenth century and has been documented as a secondary focus of domestication of the species. The integration of omic data into bean germplasm documentation databases and its combination with genotypic, phenotypic and agro-ecological data is opening a new era for the enhancement and efficient use of common bean genetic resources as the main grain legume in Europe and worldwide.La judía común (Phaseolus vulgaris L. es la leguminosa de grano más relevante para el consumo humano directo en escala global. Las colecciones de germoplasma de judía actuales muestran una amplia variación de fenotipos, aunque en muchos países las variedades locales están siendo reemplazados por cultivares de élite, concentrando la producción agraria en un número cada vez más reducido de cultivares con la consecuente erosión genética o pérdida de biodiversidad. Este cultivo se ha extendido por todos los continentes durante los últimos siglos, lo que ha dado lugar a una compleja estructura genética fuera de sus áreas de origen y domesticación (Mesoamérica y Sudamérica. Diversas evidencias indican que el germoplasma europeo contiene una diversidad

  9. Utilization of half-embryo test to identify irradiated beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil); Mancini-Filho, Jorge [Sao Paulo Univ., SP (Brazil). Faculdade de Ciencias Farmaceuticas; Delincee, Henry [Federal Research Centre for Nutrition - BFE, Karlsruhe (Germany)

    1996-07-01

    Germination tests were carried out in irradiated and non-irradiated bean seeds which allow to observe characteristically variations on the shoots and roots. The methodology used in this work, is based upon biological changes which occur in two Brazilian beans, Phaseolus vulgaris L., var. carioca and Vigna unguiculata (L.) Walp, var. macacar, irradiated in a {sup 60} Co source, with doses of 0,0.5, 1.0, 2.5, 5.0 and 10.0 kGy. The shoots and roots were observed during 3 days of culturing period under specified conditions. The differences observed in these two varieties were analysed immediately after irradiation and after 6 months of storage period at room temperature. Irradiated half-embryos showed markedly reduced root grow and almost totally retarded shoot elongation. Differences between irradiated and nonirradiated half-embryo could be observed after irradiation when different beans and storage time were varied. The shoots of half-embryos irradiated with more than 2.5 kGy did not undergo any elongation, whereas, the shoots of non-irradiated or those beans irradiated under 1.0 kGy elongated significantly within the 3 day test period. (author)

  10. Structural features of acelated galactomannans from green Coffea arabica Beans

    NARCIS (Netherlands)

    Oosterveld, A.; Coenen, G.J.; Vermeulen, N.C.B.; Voragen, A.G.J.; Schols, H.A.

    2004-01-01

    Polysaccharides were extracted from green Coffea arabica beans with water (90 °C, 1 h). Galactomannans were isolated from the water extract using preparative anion-exchange chromatography. Almost all of the galactomannans eluted in two neutral populations, while almost all of the arabinogalactans bo

  11. Microbiological safety of kinema: a fermented soya bean food.

    NARCIS (Netherlands)

    Nout, M.J.R.; Bakshi, D.; Sarkar, P.K.

    1998-01-01

    Kinema is a fermented soya bean food of Nepal and the hilly regions of Northeastern States of India. Generally, the fermentation is dominated by Bacillus spp. that often cause alkalinity and desirable stickiness in the product. The present study was undertaken in a limited number of commercial (mark

  12. Studies on interference between newly defined bean-infecting potyviruses.

    NARCIS (Netherlands)

    Khan, J.A.

    1993-01-01

    Bean common mosaic virus (BCMV) and blackeye cowpea mosaic virus (BICMV) belonging to the genus Potyvirus of the plant virus family Potyviridae (Barnett, 1991, 1992) are of great economic importance. A large number of strains of BCMV and BlCMV are found to occur in nature, either in single or in mix

  13. Detection of radiation treatment of beans using DNA comet assay

    Science.gov (United States)

    Khan, Ashfaq A.; Khan, Hasan M.; Delincée, Henry

    2002-03-01

    A simple technique of microgel electrophoresis of single cells (DNA Comet Assay) enabled a quick detection of radiation treatment of several kinds of leguminous beans (azuki, black, black eye, mung, pinto, red kidney and white beans). Each variety was exposed to radiation doses of 0.5, 1 and 5kGy covering the permissible limits for insect disinfestation. The cells or nuclei from beans were extracted in cold PBS, embedded in agarose on microscope slides, lysed between 15 and 60min in 2.5% SDS and electrophoresis was carried out at a voltage of 2V/cm for 2-2.5min. After silver staining, the slides were evaluated through an ordinary transmission microscope. In irradiated samples, fragmented DNA stretched towards the anode and the damaged cells appeared as a comet. The density of DNA in the tails increased with increasing radiation dose. However, in non-irradiated samples, the large molecules of DNA remained relatively intact and there was only minor or no migration of DNA; the cells were round or had very short tails only. Hence, the DNA comet assay provides an inexpensive, rapid and relatively simple screening method for the detection of irradiated beans.

  14. Performance Evaluation of Rotating Cylinder Type Coffee Bean Roaster

    Directory of Open Access Journals (Sweden)

    Sutarsi

    2010-04-01

    Full Text Available One strategy attempts to reduce dependence on primary commodity markets are overseas market expansion and development of secondary products. In the secondary product processing coffee beans is required of supporting equipment to facilitate these efforts. Research Center for Indonesian Coffee and Cocoa has developed coffee bean roaster. However, there are still many people who do not know about the technical aspects of roaster machine type of rotating cylinder so that more people use traditional ways to roast coffee beans. In order for the benefits of this machine is better known society it is necessary to study on the technical aspects. The purpose of this research is to evaluate the technical performance of the coffee beans roaster machine type of rotating cylinder. These include the technical aspects of work capacity of the machine, roasting technical efficiency, fuel requirements, and power requirements of using roaster machine. Research methods are including data collection, calculation and analysis. The results showed that the roaster machine type of a rotating cylinder has capacity of 12.3 kg/hour. Roasting efficiency is 80%. Fuel consumption is 0.6 kg. The calculated amount of the used power of current measurement is the average of 0.616 kW.

  15. A Nomadic Subtelomeric Disease Resistance Gene Cluster in Common Bean

    Science.gov (United States)

    The B4 resistance (R)-gene cluster, located in subtelomeric region of chromosome 4, is one of the largest clusters known in common bean (Phaseolus vulgaris, Pv). We sequenced 650 kb spanning this locus and annotated 97 genes, 26 of which correspond to Coiled-coil-Nucleotide-Binding-Site-Leucine-Rich...

  16. Texturized pinto bean protein fortification in straight dough bread formulation

    Science.gov (United States)

    Pinto beans were milled and then air-classified to obtain a raw high protein fraction (RHPF) followed by extrusion to texturize the protein fraction. The texturized high protein fraction (THPF) was then milled to obtain flour, and combined with wheat flour at 5%, 10%, and 15% levels to make bread. A...

  17. The cholesterol-raising factor from coffee beans.

    NARCIS (Netherlands)

    Urgert, R.; Katan, M.B.

    1996-01-01

    Coffee beans and some types of coffee brew - not the regular types of coffee prepared with a paper filter or with soluble coffee granules - contain the diterpenes cafestol and kahweol. Cafestol and kahweol raise the serum concentration of cholesterol and triglycerides in humans, and they also appear

  18. Evaluation of some bean lines tolerance to alkaline soil

    Directory of Open Access Journals (Sweden)

    Abeer A. Radi

    2012-01-01

    Full Text Available Introduction: In less arid climates, salts are less concentrated and sodium dominates in carbonate and bicarbonate forms, which enhance the formation of alkaline soils. The development and identification of salt-tolerant crop cultivars or lines would complement salt management programs to improve the productivity and yields of salt stressed plants.Materials and methods: This work was to study the evaluation of alkalinity tolerance of some bean lines grown under different levels of sodium carbonate (Na2CO3 to select the most alkalinity tolerant lines versus the most-sensitive ones out of 6 lines of the test plants.Results: The symptoms induced by alkalinity included reduction in root, shoot growth, and leaf area which were more severe in some bean lines. Potassium leakage was severely affected by alkalinity in some lines at all tested levels, while in some others a moderate damage was manifested only at the higher levels. The increase in Na2CO3 level was associated with a gradual fall in chlorophyll a and b biosynthesis of all the test bean lines. However, alkalinity at low and moderate levels had a favorable effect on the biosynthesis of carotenoids in all the test bean lines. The increase in Na2CO3 supply had a considerable stimulatory effect on sodium accumulation, while potassium accumulation fluctuated in organs of bean lines.Conclusion: Assiut 1104 out of all the different lines investigated was found to display the lowest sensitivity to alkalinity stress, while Assiut 12/104 was the most sensitive one.

  19. Limenin, a defensin-like peptide with multiple exploitable activities from shelf beans.

    Science.gov (United States)

    Wong, Jack H; Ng, T B

    2006-05-01

    From the seeds of the shelf bean, an antifungal peptide with a molecular mass of 6.5 kDa was isolated. The isolation procedure comprised affinity chromatography on Affi-gel blue gel, ion exchange chromatography on Mono S, and gel filtration on Superdex 75. The peptide was adsorbed on Affi-gel blue gel and Mono S. It potently suppressed mycelial growth in Botrytis cinerea, Fusarium oxysporum, and Mycosphaerella arachidicola with an IC(50) of 2.9, 2.1, and 0.34 microM, respectively. It exerted antibacterial activity toward several bacterial species with an IC(50) approximating 100 microM. [Methyl-(3)H]-thymidine incorporation into isolated mouse splenocytes was stimulated. [Methyl-(3)H]-thymidine incorporation into M1 (myeloma) and L1210 (leukemia) cells was inhibited. The peptide reduced the activity of HIV-1 reverse transcriptase and also inhibited translation in a cell-free rabbit reticulocyte lysate system.

  20. The Effect of Orobanche crenata Infection Severity in Faba Bean, Field Pea, and Grass Pea Productivity

    Science.gov (United States)

    Fernández-Aparicio, Mónica; Flores, Fernando; Rubiales, Diego

    2016-01-01

    Broomrape weeds (Orobanche and Phelipanche spp.) are root holoparasites that feed off a wide range of important crops. Among them, Orobanche crenata attacks legumes complicating their inclusion in cropping systems along the Mediterranean area and West Asia. The detrimental effect of broomrape parasitism in crop yield can reach up to 100% depending on infection severity and the broomrape-crop association. This work provides field data of the consequences of O. crenata infection severity in three legume crops, i.e., faba bean, field pea, and grass pea. Regression functions modeled productivity losses and revealed trends in dry matter allocation in relation to infection severity. The host species differentially limits parasitic sink strength indicating different levels of broomrape tolerance at equivalent infection severities. Reductions in host aboveground biomass were observed starting at low infection severity and half maximal inhibitory performance was predicted as 4.5, 8.2, and 1.5 parasites per faba bean, field pea, and grass pea plant, respectively. Reductions in host biomass occurred in both vegetative and reproductive organs, the latter resulting more affected. The increase of resources allocated within the parasite was concomitant to reduction of host seed yield indicating that parasite growth and host reproduction compete directly for resources within a host plant. However, the parasitic sink activity does not fully explain the total host biomass reduction because combined biomass of host–parasite complex was lower than the biomass of uninfected plants. In grass pea, the seed yield was negligible at severities higher than four parasites per plant. In contrast, faba bean and field pea sustained low but significant seed production at the highest infection severity. Data on seed yield and seed number indicated that the sensitivity of field pea to O. crenata limited the production of grain yield by reducing seed number but maintaining seed size. In contrast

  1. Glycemic index of split peas, rice (Binam, kidney beans, green peas, "Lavash" bread and broad bean kernels in NIDDM subjects

    Directory of Open Access Journals (Sweden)

    Darabi A

    2000-09-01

    Full Text Available Equal amounts of carbohydrates from various foodstuffs do not increase blood glucose to the same extent. This study was carried out, therefore, in 1996 at the National Nutrition and Food Technology Research institute in Tehran to determine the glycemic index of split pease, rice (Binam, kidney beans, green peas, “Lavash” bread and broad bean kernels. Diabetic subjects were studied in a clinical trial. The exact amount of cabohydrate in foodstuffs was determined using AOAC. Methods. White bread was used as the reference food. After a 12-hour overnight fast on seven separate days each subject was given the test food in an amount to provide 25 g of carbohydrate. Blood glucose was determined after 0, 60, 120 minutes using orthotouidine method. Glycemi response in each individual was calculated as the area under the 2- hour glucose individual was calculated as the area under the test food glucose curve as a percentage of the mean area under the whith bread glucose curve. Glycemic indices of the test foods were 31± 8.5 for split peas, 42.9±3 for rice, 44±9 for kidney beans, 57±7 for green peas, 69±8.5 for “Lavash” bread, and 96±14 for broad bean kernels .Legumes and rice (Binam can be used efficiently in meal planning for the diabetic subjects.

  2. Beans, Boats and Archaeobotany : A New Translation of Phasolus, or why the Romans ate neither Kidney beans nor Cow peas

    NARCIS (Netherlands)

    Heinrich, Frits; Wilkins, D.A.

    2014-01-01

    Among classicists, archaeobotanists and agricultural historians, the meaning of the word phasolus (ϕασηλος in Greek) is ambiguous. While Latin scholars have agreed that the word refers to a type of pulse or bean, there are various interpretations and subsequent identifications as to which botanical

  3. Export and Competitiveness of Indonesian Coffee Bean in International Market: Strategic Implication for the Development of Organic Coffee Bean

    Directory of Open Access Journals (Sweden)

    Bambang Drajat

    2007-07-01

    Full Text Available The performance of Indonesian coffee bean export from 1995 to 2004was not satisfactory. This implied that there were problems of the competitiveness of Indonesian coffee bean export. This study was expected to come up withsome views related with the problem. This study was aimed to analyze the competitiveness of Indonesian coffee bean export in international markets. Somepolicy implication would be derived following the conclusions. In addition,this study was aimed to deliver some arguments referring to organic coffee development as an alternative export development. Data used in this study wastime series data ranging from 1995 to 2004 supported with some primary data.The export data were analyzed descriptively and the Revealed ComparativeAdvantage (RCA Index employed to analyze the competitiveness of Indonesian coffee bean export. The results of the analysis gave some conclusions, asfollows : (1 The export of Indonesian coffee bean was product oriented notmarket oriented. (2 The Indonesian coffee bean export was characterized withlow quality with no premium price, different from that of Vietnam coffee export. (3 Besides quality, the uncompetitive Indonesian coffee export was related to market hegemony by buyers, emerging issue of Ochratoxin A. contamination and high cost economy in export. (4 The competitiveness of Indonesian coffee export was lower than those other countries, such as Columbia,Honduras, Peru, Brazil, and Vietnam. (5 Indonesia still held opportunity todevelop organic coffee for export. Some policy implications emerged from thediscussion were as follows : (1 The Government should facilitate market development through the provisions of market information and export incentives.(2 The Government should develop and applied national standard of coffeebean referring to that of international, as well as, improve processing technology equipments in the farm level for both wet and dry process. (3 Besides improving quality, the improvement

  4. Bean yellow disorder virus: Parameters of transmission by Bemisia tabaci and host plant range

    Institute of Scientific and Technical Information of China (English)

    German Martín; Isabel Maria Cuadrado; Dirk Janssen

    2011-01-01

    Bean yellow disorder virus(BnYDV)was recently identified as the first crinivirus(family Closteroviridae)that infects members of the family Leguminosae.It was first observed during the autumn of 2003,causing heavy losses in French bean (Phaseolus vulgaris L.)grown commercially in Spain.The virus is transmitted by the sweetpotato whitefly,Bemisia tabaci(Hemiptera:Aleyrodidae)Q-biotype,and disease symptoms resemble nutritional disorders consisting of interveinal mottling and yellowing in leaves,combined with stiffness or brittleness,and are typically produced on the middle to lower parts of the plant.Transmission experiments showed that 50% and 100% of B.tabaci adults acquired the virus after a feeding period of 3 and 7 h,respectively.Viruliferous whiteflies infected 66% and 100% of P.vulgaris plants after a feeding period of 12 and 24 h,respectively.The transmission efficiency of single whiteflies was 37% and persistence of BnYDV in the vector lasted up to 2 weeks with a half-life of 9 days.BnYDV was transmitted to P.vulgaris,Pisum sativum L.,Lens culinaris Medik.,and Vicia faba L.,but not to Vigna unguiculata L.,Glycine max(L.) Merr.,Cicer arietum L.,and to crop species belonging to families of the Solanaceae and Cucurbitaceae.No virus was detected in field samples collected from 30 different species from Boraginaceae,Asteraceae,Geraniaceae,Lamiaceae,Leguminosae,Malvaceae,Scrophulariaceae,Thymelaeaceae and Verbenaceae.The restricted host range and efficient management of crops regarding whitefly infestation may be key elements in the control of BnYDV.

  5. Phenotypic Variability and Diversity Analysis of Bean Traits of Some Cocoa Hybrids in Nigeria

    Directory of Open Access Journals (Sweden)

    A.V. Oyedokun

    2011-03-01

    Full Text Available It is essential to understand the economic potential and superiority among cocoa hybrids. Therefore, the present study aims at detecting variability among cocoa hybrids for bean index in Nigeria. Dried bean of fourteen genotypes of cocoa were evaluated for their bean values. Analysis of variance (ANOVA was used to understand the variability among the fourteen genotypes and Principal Component Analysis (PCA was employed to identify distinguishing traits and the grouping of the genotypes based on similarities. The fourteen cocoa genotypes were significantly (p≤0.05 different from each other with respect to weight of one bean, bean length, width, thickness, 100 bean weight, bean length to width, length to thickness and width to thickness ratio. All the studied morphometric characters exhibited high (>70% broad sense heritability. G8, the hybrid between T53/5 and N38 was the most superior genotype for bean weight and some other bean characteristics. The mass of seventy-four dried cocoa bean of G8 approximated 100 g. The first three Principal Component axes explained 91% of the total variation and the PCA grouped the fourteen genotypes into four distinct clusters. Genotypes could be selected for specific traits and improvement of traits seemed to be genetically reliable.

  6. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    of a transcript map and given their high conservation between species allowed synteny comparisons to be made to sequenced genomes. This synteny analysis may support positional cloning of target genes in common bean through the use of genomic information from these other legumes.

  7. High-throughput metabolic profiling of diverse green Coffea arabica beans identified tryptophan as a universal discrimination factor for immature beans.

    Directory of Open Access Journals (Sweden)

    Daiki Setoyama

    Full Text Available The maturity of green coffee beans is the most influential determinant of the quality and flavor of the resultant coffee beverage. However, the chemical compounds that can be used to discriminate the maturity of the beans remain uncharacterized. We herein analyzed four distinct stages of maturity (immature, semi-mature, mature and overripe of nine different varieties of green Coffea arabica beans hand-harvested from a single experimental field in Hawaii. After developing a high-throughput experimental system for sample preparation and liquid chromatography-mass spectrometry (LC-MS measurement, we applied metabolic profiling, integrated with chemometric techniques, to explore the relationship between the metabolome and maturity of the sample in a non-biased way. For the multivariate statistical analyses, a partial least square (PLS regression model was successfully created, which allowed us to accurately predict the maturity of the beans based on the metabolomic information. As a result, tryptophan was identified to be the best contributor to the regression model; the relative MS intensity of tryptophan was higher in immature beans than in those after the semi-mature stages in all arabica varieties investigated, demonstrating a universal discrimination factor for diverse arabica beans. Therefore, typtophan, either alone or together with other metabolites, may be utilized for traders as an assessment standard when purchasing qualified trading green arabica bean products. Furthermore, our results suggest that the tryptophan metabolism may be tightly linked to the development of coffee cherries and/or beans.

  8. Molecular tools for utilization of mitochondrial diversity in faba bean (Vicia faba

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2014-01-01

    Full Text Available We performed in silico PCR analyses utilizing complete mitochondrial (mtDNA genome sequences of faba bean (Vicia faba and two related species, Vigna angularis and Vigna radiata, currently available in GenBank, to infer whether 15 published universal primer pairs for amplification of all 14 cis-spliced introns in genes of NADH subunits (nad genes are suitable for V. faba and related species. Then, we tested via PCR reactions whether seven out of 15 primer pairs would generate PCR products suitable for further manipulation in 16 genotypes of V. faba representing all botanical varieties of this species (major, minor, equina and subsp. paucijuga of various levels of improvement (traditional and improved cultivars originating from Europe, Africa, Asia and south America. We provide new PCR primers for amplification of nad1 intron 2/3 in V. faba, and demonstrate intraspecific variability in primary nucleotide sequences at this locus. Based on outcomes of both in silico predictions and PCR amplification, we report a set of PCR primers for amplification of five introns in nad genes that are promising molecular tools for future phylogeographic and other studies in this species for which unambiguous data on wild ancestors, centre of origin and domestication are lacking. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  9. Draft genome sequence of the oilseed species Ricinus communis.

    Science.gov (United States)

    Chan, Agnes P; Crabtree, Jonathan; Zhao, Qi; Lorenzi, Hernan; Orvis, Joshua; Puiu, Daniela; Melake-Berhan, Admasu; Jones, Kristine M; Redman, Julia; Chen, Grace; Cahoon, Edgar B; Gedil, Melaku; Stanke, Mario; Haas, Brian J; Wortman, Jennifer R; Fraser-Liggett, Claire M; Ravel, Jacques; Rabinowicz, Pablo D

    2010-09-01

    Castor bean (Ricinus communis) is an oilseed crop that belongs to the spurge (Euphorbiaceae) family, which comprises approximately 6,300 species that include cassava (Manihot esculenta), rubber tree (Hevea brasiliensis) and physic nut (Jatropha curcas). It is primarily of economic interest as a source of castor oil, used for the production of high-quality lubricants because of its high proportion of the unusual fatty acid ricinoleic acid. However, castor bean genomics is also relevant to biosecurity as the seeds contain high levels of ricin, a highly toxic, ribosome-inactivating protein. Here we report the draft genome sequence of castor bean (4.6-fold coverage), the first for a member of the Euphorbiaceae. Whereas most of the key genes involved in oil synthesis and turnover are single copy, the number of members of the ricin gene family is larger than previously thought. Comparative genomics analysis suggests the presence of an ancient hexaploidization event that is conserved across the dicotyledonous lineage.

  10. Development of a black gram [Vigna mungo (L.) Hepper] linkage map and its comparison with an azuki bean [Vigna angularis (Willd.) Ohwi and Ohashi] linkage map.

    Science.gov (United States)

    Chaitieng, B; Kaga, A; Tomooka, N; Isemura, T; Kuroda, Y; Vaughan, D A

    2006-11-01

    The Asian Vigna group of grain legumes consists of six domesticated species, among them black gram is widely grown in South Asia and to a lesser extent in Southeast Asia. We report the first genetic linkage map of black gram [Vigna mungo (L.) Hepper], constructed using a BC(1)F(1) population consisting of 180 individuals. The BC(1)F(1) population was analyzed in 61 SSR primer pairs, 56 RFLP probes, 27 AFLP loci and 1 morphological marker. About 148 marker loci could be assigned to the 11 linkage groups, which correspond to the haploid chromosome number of black gram. The linkage groups cover a total of 783 cM of the black gram genome. The number of markers per linkage group ranges from 6 to 23. The average distance between adjacent markers varied from 3.5 to 9.3 cM. The results of comparative genome mapping between black gram and azuki bean show that the linkage order of markers is highly conserved. However, inversions, insertions, deletions/duplications and a translocation were detected between the black gram and azuki bean linkage maps. The marker order on parts of linkage groups 1, 2 and 5 is reversed between the two species. One region on black gram linkage group 10 appears to correspond to part of azuki bean linkage group 1. The present study suggests that the azuki bean SSR markers can be widely used for Asian Vigna species and the black gram genetic linkage map will assist in improvement of this crop.

  11. The influence of strip cropping on the state and degree of weed infestation in dent maize (Zea mays L., common bean (Phaseolus vulgaris L., and spring barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Aleksandra Głowacka

    2013-04-01

    Full Text Available The experiment was conducted in the years 2008–2010 at the Experimental Station of the Faculty of Agricultural Sciences in Zamość, University of Life Sciences in Lublin. The following factors were analysed in the experiment: I. Cultivation method – sole cropping and strip cropping, which consisted in the cultivation of three plants: dent maize, common bean, and spring barley, in adjacent strips with a width of 3.3 m; II. Weed control methods – mechanical and chemical. The subject of the research was weed infestation of the 'Celio' variety of dent maize, the 'Aura' variety of common bean, and the 'Start' variety of spring barley. Weed infestation of the crops was assessed two weeks before harvesting by determining the species composi- tion as well as the number and dry weight of weeds. The dominant weed species in maize, common bean and spring barley were Echinochloa crus-galli, Chenopodium album and Galinsoga parviflora, constituting from 58% to 70% of the total number of weeds. Strip cropping clearly reduced the number of weeds per unit area in all the cultivated species and dry weight of aboveground parts produced by them in common bean and maize crops. The limiting effect of strip cropping on the weed infestation parameters was particularly clear in combination with the mechanical weed control method.

  12. Developing a prebiotic yogurt enriched by red bean powder: Microbiological, physi-cochemical and sensory aspect

    Science.gov (United States)

    Setiyoningrum, Fitri; Priadi, Gunawan; Afiati, Fifi

    2017-01-01

    Red bean is widely known as a prebiotic, but addition of it into yogurt is rare. The aim of this study was to evaluate the effect of red bean powder addition on microbiological, physicochemical, and sensory of yogurt. Skim milk also added into yogurt formula to optimize the quality of yogurt. The treatment of concentrations, either red bean and skim milk, did not effect on the viability of lactic acid bacteria of yogurt (8.35 - 9.03 log cfu/ml) and the crude fiber content (0.04 - 0.08%). The increasing of red bean concentration induced the increase of protein content significantly. The increasing of level concentration, either red bean or skim milk, induced the increasing of carbohydrate content. Opposite phenomenon was occurred on the moisture content. Based on the sensory test result, the addition of 3% of skim milk and 2%of red bean into yogurt still accepted by panelist.

  13. Distinction of Ecuadorian varieties of fermented cocoa beans using Raman spectroscopy.

    Science.gov (United States)

    Vargas Jentzsch, Paul; Ciobotă, Valerian; Salinas, Wilson; Kampe, Bernd; Aponte, Pedro M; Rösch, Petra; Popp, Jürgen; Ramos, Luis A

    2016-11-15

    Cocoa (Theobroma cacao) is a crop of economic importance. In Ecuador, there are two predominant cocoa varieties: National and CCN-51. The National variety is the most demanded, since its cocoa beans are used to produce the finest chocolates. Raman measurements of fermented, dried and unpeeled cocoa beans were performed using a handheld spectrometer. Samples of the National and CCN-51 varieties were collected from different provinces and studied in this work. For each sample, 25 cocoa beans were considered and each bean was measured at 4 different spots. The most important Raman features of the spectra were assigned and discussed. The spectroscopic data were processed using chemometrics, resulting in a distinction of varieties with 91.8% of total accuracy. Differences in the average Raman spectra of cocoa beans from different sites but within the same variety can be attributed to environmental factors affecting the cocoa beans during the fermentation and drying processes.

  14. Study on Drying Edible Soya-bean Oil Using Solar Energy

    Institute of Scientific and Technical Information of China (English)

    LIU Shengyong; LIU Peng; SHEN Xiaozhen; XU Guizhuan; SU Chaojie; CAI Xianjie

    2010-01-01

    Soya-bean oil(bean dregs)was dried in a solar energy drying system.Characteristics of the process were measured and the corresponding curves were done.The practicability of this process has been discussed.The results showed that the solar drying system could completely meet technological requirements of drying soy-bean oil,and it was feasible in technology to use the solar drying system to dry the vegetable oil.

  15. CULTIVAR RELEASE-IAC-Galante and IAC-Centauro: special common bean types

    Directory of Open Access Journals (Sweden)

    Sérgio Augusto Morais Carbonell

    2008-01-01

    Full Text Available Common bean types with pinkish and light brown teguments were predominant in Brazil before 1970, until therelease of the Carioca common bean. To avoid that these common bean types sink into oblivion, the Instituto AgronômicoCampinas applied for the registration of two cultivars by the MAPA/RNC: IAC-Galante (pinkish and IAC-Centauro (lightbrown, with high yield and resistance to anthracnose and common mosaic.

  16. The Effect of Cocoa Beans Heavy and Trace Elements on Safety and Stability of Confectionery Products

    Directory of Open Access Journals (Sweden)

    Vītola Vineta

    2016-06-01

    Full Text Available The aim of the study was to evaluate cocoa beans quality produced in Cameroon, Ecuador, Nigeria and Ghana from safety position determining heavy and trace metals concentration and evaluating the oxidative stability of confectionery products prototypes (trials with analysing cocoa beans. For evaluation of oxidative stability of confectionery products, the main ingredients - butter and cocoa beans kernels were tested making trials as milk chocolate prototype.

  17. Performance of Rotary Cutter Type Breaking Machine for Breakingand Deshelling Cocoa Roasted Beans

    OpenAIRE

    2005-01-01

    Conversion of cocoa beans to chocolate product is, therefore, one of the promising alternatives to increase the value added of dried cocoa beans. On the other hand, the development of chocolate industry requires an appropriate technology that is not available yet for small or medium scale of business. Breaking and deshelling cocoa roasted beans is one important steps in cocoa processing to ascertain good chocolate quality. The aim of this research is to study performance of rotary cutter type...

  18. BEANS - a software package for distributed Big Data analysis

    CERN Document Server

    Hypki, Arkadiusz

    2016-01-01

    BEANS software is a web based, easy to install and maintain, new tool to store and analyse data in a distributed way for a massive amount of data. It provides a clear interface for querying, filtering, aggregating, and plotting data from an arbitrary number of datasets. Its main purpose is to simplify the process of storing, examining and finding new relations in the so-called Big Data. Creation of BEANS software is an answer to the growing needs of the astronomical community to have a versatile tool to store, analyse and compare the complex astrophysical numerical simulations with observations (e.g. simulations of the Galaxy or star clusters with the Gaia archive). However, this software was built in a general form and it is ready to use in any other research field or open source software.

  19. Italian Common Bean Landraces: History, Genetic Diversity and Seed Quality

    Directory of Open Access Journals (Sweden)

    Angela R. Piergiovanni

    2010-05-01

    Full Text Available The long tradition of common bean cultivation in Italy has allowed the evolution of many landraces adapted to restricted areas. Nowadays, in response to market demands, old landraces are gradually being replaced by improved cultivars. However, landraces still survive in marginal areas of several Italian regions. Most of them appear severely endangered with risk of extinction due to the advanced age of the farmers and the socio-cultural context where they are cultivated. The present contribution is an overview of the state of the art about the knowledge of Italian common bean germplasm, describing the most important and recent progresses made in its characterization, including genetic diversity and nutritional aspects.

  20. Locust bean gum: Exploring its potential for biopharmaceutical applications

    Directory of Open Access Journals (Sweden)

    Marita Dionísio

    2012-01-01

    Full Text Available Polysaccharides have been finding, in the last decades, very interesting and useful applications in the biomedical and, specifically, in the biopharmaceutical field. Locust bean gum is a polysaccharide belonging to the group of galactomannans, being extracted from the seeds of the carob tree (Ceratonia siliqua. This polymer displays a number of appealing characteristics for biopharmaceutical applications, among which its high gelling capacity should be highlighted. In this review, we describe critical aspects of locust bean gum, contributing for its role in biopharmaceutical applications. Physicochemical properties, as well as strong and effective synergies with other biomaterials are described. The potential for in vivo biodegradation is explored and the specific biopharmaceutical applications are discussed.

  1. Trichoderma spp. decrease Fusarium root rot in common bean

    Directory of Open Access Journals (Sweden)

    Hudson Teixeira

    2012-12-01

    Full Text Available The effectiveness of six Trichoderma-based commercial products (TCP in controlling Fusarium root rot (FRR in common bean was assessed under field conditions. Three TCP, used for seed treatment or applied in the furrow, increased seedling emergence as much as the fungicide fludioxonil. FRR incidence was not affected, but all TCP and fludioxonil reduced the disease severity, compared to control. Application of Trichoderma-based products was as effective as that of fludioxonil in FRR management.

  2. Efficacy of Locust Beans Husk Char in Heavy Metal Sequestration

    OpenAIRE

    Ademola Ayodeji Ajayi-Banji; Temitayo Ewemoje; Adeniyi Ajimo

    2016-01-01

    Most solid waste management schemes minimally consider low concentration biodegradable agricultural waste management, though the environmental impact of this waste category is significant over a time frame. The column-mode study seeks to address the issue by suggesting potential utilisation of post-harvest waste for heavy metal sequestering. Locust beans husk char of 100 and 200 g was employed to inspect removal efficiency, isotherm and kinetic models of some heavy metals at 30, 60, 90, 120 a...

  3. Nodule senescence and biomass components in common bean cultivars

    OpenAIRE

    Fabián Fernández Luqueño; David Espinosa Victoria; Antonio Munive; Langen Corlay Chee; Luis M. Serrano Covarrubias

    2008-01-01

    Most legumes establish mutualistic symbiotic relationships with atmospheric nitrogen-fixing bacteria (rhizobia), giving origin to nodules. Nodules exhibit natural or induced aging which coincides with the drop in nitrogenase activity at the flowering period or at the pod filling stage. In this research, the onset of nodule senescence (NS) was evaluated under greenhouse conditions in five common bean (Phaseolus vulgaris L.) cultivars of two growth habits, determined (Type I) and indeterminate ...

  4. 力争第二的Coffee Bean

    Institute of Scientific and Technical Information of China (English)

    蔡正蓁

    2003-01-01

    一个小雨的午后,在新加坡繁华的Orchard大街上的连锁咖啡店“Coffee Bean & Tea Leaf”里,维克多·沙宣从他的座位上一跃而起,脱口而出:“下雨了,我得把屋顶打开。”短短几秒钟之内,在天井上方。

  5. A better bean. Reports from the field -- Latin America.

    Science.gov (United States)

    Powell, D

    1997-01-01

    Researchers from the Colegio de Postgraduados, in partnership with the University of Guelph in Canada, have used horizontal resistance breeding, without the aid of pesticides, to more than triple the yield of locally grown black beans. J.E. Vanderplank, a South African plant pathologist, coined the terms "vertical" and "horizontal" for the types of crop plant resistance in 1963. The former involves a single gene and breaks down when new pathogens appear; the latter involves several genes and is a more durable form of resistance to disease or to insects. Enhancing vertical resistance, which is based on classical Mendelian breeding techniques, requires crossing a wild plant that possesses the desired gene with a cultivar to create a hybrid; the hybrid offspring are then backcrossed with the cultivar parent for several generations until a hybrid is created that is identical to the cultivar, except for the wild parent's resistance gene. In horizontal resistance breeding, the best individuals from each generation are selected and bred with each other. According to Raoul Robinson, a Canadian crop scientist and member of the plant breeding team supported by IDRC, breeding to enhance vertical resistance, or under the protection of insecticides and fungicides, has caused the level of horizontal resistance to decline and plant susceptibility to parasites to increase. Dr. Robinson and Dr. Roberto Garcia Espinosa (the Mexican project manager) began their work using horizontal resistance breeding in black beans in 1991. Yields of 1500 kg/hectare were achieved in two breeding cycles (two years) without the use of pesticides. The average bean yield in the Mixteca region of Mexico is 400 kg/hectare with the use of pesticides. The 200,000 small farmers in the area cultivate over 300,000 hectares, 40,000 of which are beans. The breeding techniques used in this project can be applied to other crops and in other countries.

  6. Morphology and viability of castor bean genotypes pollen grains

    OpenAIRE

    Maria Selma Alves Silva Diamantino; Maria Angélica Pereira de Carvalho Costa; Taliane Leila Soares; Daniel Vieira Morais; Simone Alves Silva; Everton Hilo Souza

    2016-01-01

    The objective of this work was to characterize the morphology and viability of the pollen of 15 genotypes of castor bean (Ricinus communis L.) and to generate information that can assist in the selection of highly promising male parents for future use in genetic improvement programs aimed at producing seeds for oil extraction. Acetolysis and scanning electron microscopy was used to characterize the morphology of the pollen. The viability of the pollen grains was estimated by in vitro germinat...

  7. Morphology and viability of castor bean genotypes pollen grains

    OpenAIRE

    Diamantino,Maria Selma Alves Silva; Costa,Maria Angélica Pereira de Carvalho; Soares,Taliane Leila; Morais,Daniel Vieira; Silva,Simone Alves; Souza,Everton Hilo de

    2016-01-01

    ABSTRACT. The objective of this work was to characterize the morphology and viability of the pollen of 15 genotypes of castor bean (Ricinus communis L.) and to generate information that can assist in the selection of highly promising male parents for future use in genetic improvement programs aimed at producing seeds for oil extraction. Acetolysis and scanning electron microscopy was used to characterize the morphology of the pollen. The viability of the pollen grains was estimated by in vitr...

  8. Genetic diversity and population structure of an Italian landrace of runner bean (Phaseolus coccineus L.): inferences for its safeguard and on-farm conservation.

    Science.gov (United States)

    Mercati, F; Catarcione, G; Paolacci, A R; Abenavoli, M R; Sunseri, F; Ciaffi, M

    2015-08-01

    The landraces are considered important sources of valuable germplasm for breeding activities to face climatic changes as well as to satisfy the requirement of new varieties for marginal areas. Runner bean (Phaseolus coccineus L.) is one of the most cultivated Phaseolus species worldwide, but few studies have been addressed to assess the genetic diversity and structure within and among landrace populations. In the present study, 20 different populations of a runner bean landrace from Central Italy named "Fagiolone," together with 41 accessions from Italy and Mesoamerica, were evaluated by using 14 nuclear SSRs to establish its genetic structure and distinctiveness. Results indicated that "Fagiolone" landrace can be considered as a dynamic evolving open-pollinated population that shows a significant level of genetic variation, mostly detected within populations, and the presence of two main genetic groups, of which one distinguished from other Italian runner bean landraces. Results highlighted also a relevant importance of farmers' management practices able to influence the genetic structure of this landrace, in particular the seed exchanges and selection, and the past introduction in cultivation of landraces/cultivars similar to seed morphology, but genetically rather far from "Fagiolone." The most suitable on-farm strategies for seed collection, conservation and multiplication will be defined based on our results, as a model for threatened populations of other allogamous crop species. STRUCTURE and phylogenetic analyses indicated that Mesoamerican accessions and Italian landraces belong to two distinct gene pools confirming the hypothesis that Europe could be considered a secondary diversification center for P. coccineus.

  9. Evaluation of suitability of common sunflower (Helianthus annuus L. and Castor bean (Ricinus communis L. in phytoextraction of nickel from contaminated soil

    Directory of Open Access Journals (Sweden)

    Maciej Bosiacki

    2013-09-01

    Full Text Available The main objective of this study was to determine the suitability of sunflower (He­lianthus annuus L. ‘Choco Sun’ and castor bean (Ricinus communis L. ‘Sanguineus Apache’ to phytoextraction of nickel from the soil, as well as evaluation of the tolerance of these species to the increasing concentration of the metal. Potential for phytoextraction of ornamental plants has been studied in two years, pot experiment in the plastic greenhouse when they were grown in mineral soil (which was slightly loamy sand with four levels of nickel: control (native nickel content, 50 mg·dm-3 – increased content, 75 mg·dm-3 – low contamination, and 150 mg·dm-3 – medium contamination. Both species of ornamental plants were tolerant to applied concentrations of nickel, with the exception of sunflower grown in medium contaminated soil by this metal. Sunflower and castor bean are not nickel hyperaccumulators. Assessing their potential for nickel phytoextraction from the soil, it was found that it is not significant. Castor bean produces a greater aboveground mass and as a result uptake of nickel is greater compared to sunflower.

  10. Susceptibility of leguminous green manure species to Rhizoctonia solani and Sclerotium rolfsii

    Directory of Open Access Journals (Sweden)

    Trazilbo José de Paula Júnior

    2011-12-01

    Full Text Available We studied the susceptibility of species used as green manure in common bean fields to root rot (Rhizoctonia solani and southern blight (Sclerotium rolfsii. Seeds of Crotalaria breviflora, Canavalia ensiformis, Cajanus cajan, Dolichos lablab, Stizolobium cinereum, S. aterrimum, and the bean cvs. "Pérola", "Valente" and "Carnaval" were sown in soil infested by either R. solani AG-4 or S. rolfsii in greenhouse. The emergence of D. lablab seedlings in soil infested by R. solani dropped to 62%. C. breviflora, C. ensiformis and cv. "Valente" presented the lowest root rot severity. The pathogen S. rolfsii drastically reduced seedling emergence in all species; no C. cajan and S. cinereum seedling emerged. All plant species presented high southern blight severity. We conclude that leguminous crops are not suitable as green manure for areas of bean cultivation with high R. solani and S. rolfsii populations.

  11. Mung bean decreases plasma cholesterol by up-regulation of CYP7A1.

    Science.gov (United States)

    Yao, Yang; Hao, Liu; Shi, Zhenxing; Wang, Lixia; Cheng, Xuzhen; Wang, Suhua; Ren, Guixing

    2014-06-01

    Our results affirmed that supplementation of 1 or 2% mung bean could decrease plasma total cholesterol and triacylglycerol level. Mung bean increased mRNA 3-hydroxy-3-methyl-glutaryl-coenzyme A reductase. Most importantly, mung bean increased not only the protein level of cholesterol-7α-hydroxylase (CYP7A1) but also mRNA CYP7A1. It was concluded that the hypocholesterolemic activity of mung bean was most probable mediated by enhancement of bile acid excretion and up-regulation of CYP7A1.

  12. Navy Bean Flour Particle Size and Protein Content Affect Cake Baking and Batter Quality(1).

    Science.gov (United States)

    Singh, Mukti; Byars, Jeffrey A; Liu, Sean X

    2015-06-01

    Whole navy bean flour and its fine and coarse particle size fractions were used to completely replace wheat flour in cakes. Replacement of wheat flour with whole bean flour significantly increased the protein content. The protein content was adjusted to 3 levels with navy bean starch. The effect of navy bean flour and its fractions at 3 levels of protein on cake batter rheology and cake quality was studied and compared with wheat flour samples. Batters prepared from navy bean flour and its fractions had higher viscosity than the cake flour. Reducing the protein content by addition of starch significantly lowered the viscosity of cake batters. The whole navy bean flour and coarse bean fraction cakes were softer than cakes made with wheat flour but had reduced springiness. Principal component analysis showed a clear discrimination of cakes according to protein. It also showed that low protein navy bean flour cakes were similar to wheat flour cakes. Navy bean flour with protein content adjusted to the level of cake (wheat) flour has potential as a healthy alternative in gluten-free cakes.

  13. 1H NMR study of fermented cocoa (Theobroma cacao L.) beans.

    Science.gov (United States)

    Caligiani, Augusta; Acquotti, Domenico; Cirlini, Martina; Palla, Gerardo

    2010-12-08

    This study reports for the first time the metabolic profile of cocoa (Theobroma cacao L.) beans using the (1)H NMR technique applied to polar extracts of fermented cocoa beans. The simultaneous detection and quantification of amino acids, polyalcohols, organic acids, sugars, methylxanthines, catechins, and phenols were obtained by assigning the major signals of the spectra for different varieties of cocoa beans (Forastero, Criollo, and Trinitario) from different countries (Ecuador, Ghana, Grenada, and Trinidad). The data set obtained, representative of all classes of soluble compounds of cocoa, was useful to characterize the fermented cocoa beans as a function of the variety and geographic origin.

  14. COMPETITIVE ABILITY OF MAIZE IN MIXTURE WITH CLIMBING BEAN IN ORGANIC FARMING

    OpenAIRE

    Bavec, Franc; Živec, Urška; Grobelnik Mlakar, Silva; Bavec , Martina; Radics , Laszlo

    2005-01-01

    Intercropped crops represent an important production system in organic farming, especially maize/climbing bean mixture due to its high content of protein in bean seeds for human diet, and producing silage for ruminants. To test this hypothesis, the effects of maize (Zea mays L.) sown as a sole crop and maize/climbing bean (Phaseolus vulgaris L. cv. Cipro) mixtures on maize plant height, maize leaf area index, bean leaf area index and grain yield were investigated in field experiments on an o...

  15. Impact of Molecular Technologies on Faba Bean (Vicia faba L. Breeding Strategies

    Directory of Open Access Journals (Sweden)

    Tao Yang

    2012-07-01

    Full Text Available Faba bean (Vicia faba L. is a major food and feed legume because of the high nutritional value of its seeds. The main objectives of faba bean breeding are to improve yield, disease resistance, abiotic stress tolerance, seed quality and other agronomic traits. The partial cross-pollinated nature of faba bean introduces both challenges and opportunities for population development and breeding. Breeding methods that are applicable to self-pollinated crops or open-pollinated crops are not highly suitable for faba bean. However, traditional breeding methods such as recurrent mass selection have been established in faba bean and used successfully in breeding for resistance to diseases. Molecular breeding strategies that integrate the latest innovations in genetics and genomics with traditional breeding strategies have many potential applications for future faba bean cultivar development. Hence, considerable efforts have been undertaken in identifying molecular markers, enriching genetic and genomic resources using high-throughput sequencing technologies and improving genetic transformation techniques in faba bean. However, the impact of research on practical faba bean breeding and cultivar release to farmers has been limited due to disconnects between research and breeding objectives and the high costs of research and implementation. The situation with faba bean is similar to other small crops and highlights the need for coordinated, collaborative research programs that interact closely with commercially focused breeding programs to ensure that technologies are implemented effectively.

  16. [Broad beans (Vicia fava, L.) as an alternative source of protein in chick diets].

    Science.gov (United States)

    Bezares, A; Cuca, M; Avila, E; Velásquez, C

    1980-03-01

    Three experiments were conducted to study the possibility of improving the nutritive value of broad beans (Vicia faba, L.) in poultry diets. In the first experiment, raw and autoclaved (1.0 kg/cm2/15 min) beans, with and without antibiotic supplementation, were studied. The results after 21 days showed no significant differences among treatments in regard to body weight. In feed conversion, however, a significant difference was observed when diets prepared with raw beans were supplemented with 20 ppm of flavomycin. In the second experiment raw and autoclaved beans were supplemented with 0, 10, and 20 ppm of virginiamycin and 200 and 400 ppm of flavomycin to study the effect of these two antibiotics. After 28 days, the results indicated no significant differences with antibiotic supplementation in either raw or autoclaved beans. However, a significant difference (P < 0.05) in body weight was found when beans were autoclaved. In the third experiment, two levels, 31 and 76% of raw and autoclaved beans, were included in the chick diets. The results in body weight, after 28 days, did not show any significant differences between raw and autoclaved beans fed at a 31% level. With the 76% level the autoclaved treatment, however, induced a significantly higher body weight than the diets containing raw beans.

  17. Changes in weed infestation of common bean (Phaseolus vulgaris L. under conditions of strip intercropping and different weed control methods

    Directory of Open Access Journals (Sweden)

    Aleksandra Głowacka

    2012-12-01

    Full Text Available The experiment was conducted in the years 2004-2006 in a private farm in the village of Frankamionka in Zamość district. There were two experimental factors: I. Cultivation methods - sole cropping and strip intercropping; and II. Tending methods - mechanical, mechanical-chemical, and chemical weed control. The subject of the study was weed infestation of the Mela variety of common bean. Beans were sown between 30 April and 5 May. Weed infestation was assessed in the last week before harvesting by determining its floristic composition and the frequency of occurrence of particular weed species, as well as the air-dry weight of weeds. The dominant weed species were Galinsoga parviflora, Echinochloa crus-galli, Chenopodium album, and Amaranthus retroflexus, which comprised 84.7% of the total number of weeds. Strip intercropping markedly reduced the number of weeds per unit area (by 50%, as well as the dry weight of their aerial parts. The most effective method of weed control was the mechanical-chemical method, which resulted in the lowest occurrence of weeds. It also significantly reduced the weight of weeds.

  18. Rhizobium ecuadorense sp. nov., an indigenous N2-fixing symbiont of the Ecuadorian common bean (Phaseolus vulgaris L.) genetic pool.

    Science.gov (United States)

    Ribeiro, Renan Augusto; Martins, Talita Busulini; Ormeño-Orrillo, Ernesto; Marçon Delamuta, Jakeline Renata; Rogel, Marco Antonio; Martínez-Romero, Esperanza; Hungria, Mariangela

    2015-09-01

    There are two major centres of genetic diversification of common bean (Phaseolus vilgaris L.), the Mesoamerican and the Andean, and the legume is capable of establishing nitrogen-fixing symbioses with several rhizobia; Rhizobium etli seems to be the dominant species in both centres. Another genetic pool of common bean, in Peru and Ecuador, is receiving increasing attention, and studies of microsymbionts from the region can help to increase our knowledge about coevolution of this symbiosis. We have previously reported several putative new lineages from this region and here present data indicating that strains belonging to one of them, PEL4, represent a novel species. Based on 16S rRNA gene sequence phylogeny, PEL4 strains are positioned in the Rhizobium phaseoli/R. etli/Rhizobium leguminosarum clade, but show unique properties in several morphological, physiological and biochemical analyses, as well as in BOX-PCR profiles ( Rhizobium fabae. DNA-DNA hybridization ( Rhizobium ecuadorense sp. nov. The type strain is CNPSo 671(T) ( = UMR 1450(T) = PIMAMPIRS I 5(T) = LMG 27578(T)).

  19. Isolation and Purification of Thiamine Binding Protein from Mung Bean

    Directory of Open Access Journals (Sweden)

    MOHAMAD SADIKIN

    2013-03-01

    Full Text Available Thiamine has fundamental role in energy metabolism. The organs mostly sensitive to the lack of thiamine levels in the body are the nervous system and the heart. Thiamine deficiency causes symptoms of polyneuritis and cardiovascular diseases. Because of its importance in the metabolism of carbohydrates, we need to measure the levels of thiamine in the body fluids by using an easy and inexpensive way without compromising the sensitivity and selectivity. An option to it is thiamine measurement based on the principle of which is analogous to ELISA, in which a thiamine binding protein (TBP act by replacing antibodies. The presence of TBP in several seeds have been reported by previous researchers, but the presence of TBP in mung beans has not been studied. This study was aimed to isolate and purify TBP from mung bean. The protein was isolated from mung bean through salting out by ammonium sulphate of 40, 70, and 90% (w/v. TBP has a negative charge as shown by cellulose acetate electrophoresis. The result obtained after salting out by ammonium sulphate was further purified bymeans of DEAE-cellulose chromatography and affinity chromatography. In precipitation of 90% of salting out method, one peak protein was obtained by using affinity chromatography. The protein was analyzed by SDS PAGE electrophoresis. The result of SDS PAGE electrophoresis showed that TBP has a molecular weight of 72.63 kDa.

  20. Specific pretreatments reduce curing period of vanilla (Vanilla planifolia) beans.

    Science.gov (United States)

    Sreedhar, R V; Roohie, K; Venkatachalam, L; Narayan, M S; Bhagyalakshmi, N

    2007-04-18

    With the aiming of reducing the curing period, effects of pretreatments on flavor formation in vanilla beans during accelerated curing at 38 degrees C for 40 days were studied. Moisture loss, change in texture, levels of flavoring compounds, and activities of relevant enzymes were compared among various pretreatments as well as the commercial sample. Use of naphthalene acetic acid (NAA; 5 mg/L) or Ethrel (1%) with blanching pretreatment resulted in 3-fold higher vanillin on the 10th day. Other flavoring compounds-vanillic acid, p-hydroxybenzoic acid, and p-hydroxybenzaldehyde-fluctuated greatly, showing no correlation with the pretreatments. Scarification of beans resulted in nearly 4- and 3.6-fold higher vanillin formations on the 10th day in NAA- and Ethrel-treated beans, respectively, as compared to control with a significant change in texture. When activities of major relevant enzymes were followed, addition of NAA or Ethrel helped to retain higher levels of cellulase throughout the curing period and higher levels of beta-glucosidase on the 20th day that correlated with higher vanillin content during curing and subsequent periods. Peroxidase, being highest throughout, did not correlate with the change in levels of major flavoring compounds. The pretreatment methods of the present study may find importance for realizing higher flavor formation in a shorter period because the major quality parameters were found to be comparable to those of a commercial sample.

  1. Effect of toasting field beans and of grass-clover

    DEFF Research Database (Denmark)

    Mogensen, Lisbeth; Vestergaard, Jannie Steensig; Fretté, Xavier

    2010-01-01

    The effect of toasting field beans and of grass-clover: maize silage ratio on milk production, milk composition and the sensory quality of the milk was investigated in a 2   2 factorial experiment. Toasting of field beans resulted in lower milk contents of both fat (44.2 versus 46.1 g/kg, P = 0.......02) and protein (33.5 versus 34.2 g/kg, P = 0.008), whereas milk production, urea and somatic cell contents were unaffected compared with the untreated field beans. Increasing the proportion of maize silage (from 9 to 21% of DM) in the ration decreased the content of urea in milk (P = 0.002), whereas milk...... production and milk content of fat and protein were unaffected. Milk from cows fed the high proportion of maize silage had a lower (P = 0.04) long-chain fatty acid content (≥ C18). Furthermore, milk from cows fed the high proportion of maize silage had a lower (13-26%) content of luteine (P = 0.03), 13-cis...

  2. The water budget of rainfed maize and bean intercrop

    Science.gov (United States)

    Walker, S.; Ogindo, H. O.

    Food production in the South African Development Community (SADC) region is predominantly under rainfed conditions and therefore experiences annual fluctuations due to the rainfall variability. Although the staple food of maize ( Zea mays) is commonly grown in the same field as dry beans ( Phaseolus vulgaris) little work has been done to characterize the soil water budget of this intercropping system. The evapotranspiration can theoretically be divided into transpiration from the leaves and evaporation from the soil surface. However, it is difficult to separate the components in field studies. In this paper the Ritchie model is used to estimate the soil surface evaporation using the fractional radiation interception which depends on the crop leaf area. The intercropping system has higher leaf area than the sole crops of both maize and beans in all seasons. Therefore, the soil surface is shaded and the canopy is more dense resulting in a lower soil surface evaporation. The water budget thus gives a higher value of transpiration for the intercrop during each of the four growing seasons. This appears to be due to the complimentary use of the water resources by the maize and bean plants in the intercropping system. This illustrates the ability of the intercrop to use the available soil water in a semi-arid environment more productively. Thus the experience of the small-holder farmers in the SADC region is based on sound physical principles of water use by the two crops.

  3. FTIR Spectroscopic Study of Broad Bean 3iseased Leaves

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    [Objective] The aim was to indentify diseased leaves of broad bean by vibra- tional spectroscopy. [Method] In this paper, broad bean rust, fusarium rhizome rot, broad bean zonate spot, yellow leaf curl virus and normal leaves were studied using Fourier transform infrared spectroscopy combined with chemometrics. [Result] The spectra of the samples were similar, only with minor differences in absorption inten- sity of several peaks. Second derivative analyses show that the significant difference of all samples was in the range of 1 200-700 cm2. The data in the range of 1 200- 700 cm' were selected to evaluate correlation coefficients, hierarchical cluster analy- sis (HCA) and principal component analysis (PCA). Results showed that the correla- tion coefficients are larger than 0.928 not only between the healthy leaves, but also between the same diseased leaves. The values between healthy and diseased leaves, and among diseased leaves, are all declined. HCA and PCA yielded about 73.3% and 82.2% accuracy, respectively. [Conclusion] This study demonstrated that FTIR techniques might be used to detect crop diseases.

  4. Castor bean (Ricinus communis L.) as a potential environmental bioindicator.

    Science.gov (United States)

    Mendes, M G; Santos Junior, C D; Dias, A C C; Bonetti, A M

    2015-10-21

    Biomonitoring of air quality using living organisms is a very interesting approach to environmental impact assessment. Organisms with a vast distribution, such as plants, are widely used for these purposes. The castor bean (Ricinus communis L.) is an oleaginous plant that can potentially be used as a bioindicator plant owing to its rapid growth and large leaves, which have a wide surface area of contact with the air and the pollutants therein. This study investigated the the bioindicator potential of the castor bean by performing several tests. We observed statistically significant differences in the concentrations of chlorophyll a and b in the leaves of plants in polluted areas compared to that in the control group plants, which were located in a pollution-free area. Leaves of plants in the former group had higher peroxidase activity and showed a greater buffering ability than those of plants in the control group. The pKa values obtained via buffering capacity tests, revealed the presence of aminoazobenzene (an industrial dye) in leaves of R. communis. Genotoxicity was evaluated through the comet assay technique and revealed that other than some differences in DNA fragmentation, there is no statistically significant difference in this parameter between places analyzed. Our data indicate that R. communis can be a highly useful biological indicator. Further, we hypothesized that the castor bean can be a potential candidate for phytoremediation owing its physiological buffering capacity when exposed to substantial pollution.

  5. Adzuki beans (Vigna angularis seed quality under several drying conditions

    Directory of Open Access Journals (Sweden)

    Osvaldo Resende

    2012-03-01

    Full Text Available This study analyzed the drying process and the seed quality of adzuki beans (Vigna angularis. Grains of adzuki beans, with moisture content of 1.14 (decimal dry basis at harvest and dried until the moisture content of 0.11 (decimal dry basis. were used. Drying was done in an experimental drier maintened at controlled temperatures of 30, 40, 50, 60, and 70 ºC and relative humidity of 52.0, 28.0, 19.1, 13.1, and 6.8%, respectively. Physiological and technological seed quality was evaluated using the germination test, Index of Germination Velocity (IGV, electrical conductivity, and water absorption, respectively. Under the conditions tested in the present study, it can be concluded that drying time for adzuki beans decreases with the higher air temperatures of 60 and 70 ºC, and it affected the physiological and technological seed quality. Thus, to avoid compromising adzuki seeds quality, it is recommended to promote its drying up to 50 ºC.

  6. Evaluation of tolerance to water stress in beans

    Directory of Open Access Journals (Sweden)

    Mauricio Marini Köop

    2012-09-01

    Full Text Available The goal of this study was to evaluate the genotypes of beans, and to sort them into groups that are tolerant and sensitive to water stress, by assessing their morphological characteristics for use in blocks of crosses and the study of gene expression. We evaluated nine bean genotypes: IAPAR 14, IAPAR 81, Pérola, IPR Colibri, IPR Juriti, IPR Chopim, IPR Gralha, and IPR Tiziu IPR Uirapuru. The genotypes were subjected to two irrigation conditions: i irrigation water as needed throughout the culture cycle and ii irrigation water as needed until the appearance of the first bud, followed by no irrigation water for 15 days. The experimental design was in randomized blocks with three replications. The characteristics evaluated were: i plant height; ii stem diameter, iii number of pods per plant, iv number of grains per pod, v root length and vi root dry mass. Stem diameter should not be used to determine if bean genotypes are tolerant or susceptible to water shortages. The results for the Pérola genotype were the highest for most of the characteristics evaluated, and, for this reason, it was classified as tolerant to water stress during flowering. The genotypes IAPAR and 81 IPR Juriti had the lowest results for the most features and were classified as susceptible to water stress during flowering.

  7. Drying of green bean and okra under solar energy

    Directory of Open Access Journals (Sweden)

    İBRAHİM DOYMAZ

    2011-06-01

    Full Text Available In this study, sun drying characteristics of green bean and okra were investigated. Drying experiments were conducted in Iskenderun-Hatay, Turkey. The drying study showed that the times taken for drying of green bean and okra from the initial moisture contents of 89.5% and 88.7% (w.b. to final moisture content of around 15±0.5% (w.b. were 60 and 100 h in open sun drying, respectively. The constant rate period is absent in drying curves. The drying process took place in the falling rate period. The drying data were fitted to thirteen thin-layer drying models. The performance of these models was investigated by comparing the determination of coefficient (R2, reduced chi-square (2 and root mean square error (RMSE between the observed and predicted moisture ratios. Estimations by Approximation of diffusion (for green bean and Midilli et al. models (for okra were in good agreement with the experimental data obtained.

  8. Foliar injury and leaf diffusive resistance of rice and white bean in response to SO2 and O3, singly and in combination.

    Science.gov (United States)

    Tripathi, B D; Tripathi, A

    1992-01-01

    Plants of rice (Oryza sativa) and white bean (Phaseolus vulgaris) were exposed to 524 microg m(-3) SO2, 392 microg m(-3) O3 and a mixture of both gases, i.e. 524 microg m(-3) SO2 and 392 microg m(-3) O3 to determine the visible foliar injury and leaf diffusive resistance. Response of leaf diffusive resistance was measured on upper and lower surfaces of leaves, i.e. the two unifoliate leaves of bean and the first, second and third primary leaves of rice. The difference in the response may be due to sensitive guard cells causing stomatal closure in the presence of O3, whilst a low concentration of SO2 caused the stomata to open. Thus, SO2 alone is known to decrease, and O3 tends to increase leaf diffusive resistance. However, exposure to both gases increases or decreases the resistance, depending on the species response.

  9. Reduction of antiproliferative capacities, cell-based antioxidant capacities and phytochemical contents of common beans and soybeans upon thermal processing.

    Science.gov (United States)

    Xu, Baojun; Chang, Sam K C

    2011-12-01

    The effects of boiling and steaming processes on the antiproliferative and cellular antioxidant properties, as well as phytochemicals, of two types of common beans (pinto and black beans) and two types of soybeans (yellow and black) were investigated. All thermal-processing methods caused significant (pphytic acid content (PAC) values in all bean types (except for TPC values in pressure-steamed yellow soybeans) as compared to those of the raw beans. All types of uncooked raw beans exhibited cellular antioxidant activities (CAA) in dose-dependent manners. Black soybeans exhibited the greatest CAA, followed by black beans, pinto beans and yellow soybeans. The CAA of cooked beans were generally diminished or eliminated by thermal processing. The hydrophilic extracts from raw pinto beans, black beans and black soybeans exhibited antiproliferation capacities against human gastric (AGS) and colorectal (SW480) cancer cells in dose-dependent manners. The raw yellow soybeans exhibited dose-dependent antiproliferation activities against the SW480 cells. Most of the cooked beans lost their antiproliferation capacities as observed in the raw beans. These results indicate that different processing methods may have various effects on phytochemical profiles and bioactivities. Overall, thermal processing caused a significant reduction of the health-promotion effects of beans.

  10. Impact of fermentation, drying, roasting, and Dutch processing on epicatechin and catechin content of cacao beans and cocoa ingredients.

    Science.gov (United States)

    Payne, Mark J; Hurst, W Jeffrey; Miller, Kenneth B; Rank, Craig; Stuart, David A

    2010-10-13

    Low molecular weight flavan-3-ols are thought to be responsible, in part, for the cardiovascular benefits associated with cocoa powder and dark chocolate. The levels of epicatechin and catechin were determined in raw and conventionally fermented cacao beans and during conventional processing, which included drying, roasting, and Dutch (alkali) processing. Unripe cacao beans had 29% higher levels of epicatechin and the same level of catechin compared to fully ripe beans. Drying had minimal effect on the epicatechin and catechin levels. Substantial decreases (>80%) in catechin and epicatechin levels were observed in fermented versus unfermented beans. When both Ivory Coast and Papua New Guinea beans were subjected to roasting under controlled conditions, there was a distinct loss of epicatechin when bean temperatures exceeded 70 °C. When cacao beans were roasted to 120 °C, the catechin level in beans increased by 696% in unfermented beans, by 650% in Ivory Coast beans, and by 640% in Papua New Guinea fermented beans compared to the same unroasted beans. These results suggest that roasting in excess of 70 °C generates significant amounts of (-)-catechin, probably due to epimerization of (-)-epicatechin. Compared to natural cocoa powders, Dutch processing caused a loss in both epicatechin (up to 98%) and catechin (up to 80%). The epicatechin/catechin ratio is proposed as a useful and sensitive indicator for the processing history of cacao beans.

  11. Effect of Salt Stress on Three Green Bean (Phaseolus vulgaris L. Cultivars

    Directory of Open Access Journals (Sweden)

    Anna ASSIMAKOPOULOU

    2015-04-01

    Full Text Available Agriculture is increasingly forced to utilize marginal waters to meet its increasing demands, which in turn increases the risks of soil salinization and yield reduction in the arid and semi-arid areas of the Mediterranean basin. Given that the bean is an extremely salt sensitive species, the purpose of the present work was to study the effect of 0 and 75 mM sodium chloride (NaCl on leaf characteristics, growth, pod yield and ion accumulation of three green bean (Phaseolus vulgaris L. cultivars (‘Corallo Nano’, ‘Romano Bush Plaja’ and ‘Starazagorski’, widely used in Greece. Plants were grown in a greenhouse of Technological Educational Institute of Peloponnese in Messinia, Southern Greece, from April to June 2014, in hydroponics. The experimental design was the factorial completely randomized one with five replications; each replication consisted of the three plants grown on the same rockwool slab. The results of the majority of growth and yield parameters determined showed the superiority of ‘Corallo’ over ‘Romano’ whereas ‘Starazagorski’ tolerance was found to be intermediate. ‘Corallo’ tolerated NaCl salinity better due to its capacity for Na retention in the roots and maintaining appropriate K/Na and Ca/Na ratios, limiting the accumulation of toxic ions into actively growing shoots. The salt sensitivity of ‘Romano’ was related to its higher concentration of Na in the leaves and lower in the roots, to the greater decrease of the leaf number and leaf water content, as well as to the specific leaf area increase compared to the other two cultivars under saline conditions.

  12. Solar-Terrestrial Effects on Bean Seed Imbibition

    Science.gov (United States)

    Minorsky, P. V.

    2012-12-01

    Forty years ago, a lively debate ensued amongst biologists concerning the nature of biological rhythms. The "endogenous" school argued that biological rhythms that occur in the absence of any obvious environmental oscillation arise endogenously from within the organism itself. The "exogenous" school on the other hand proposed that subtle and pervasive exogenous factors (e.g., geomagnetic variations or cosmic radiation) underlie most biological rhythms. Much of the debate between the endogenous vs. exogenous schools focused on circadian (circa-24 h) rhythms in particular. The demonstration that circadian rhythms continue in orbiting spacecraft was widely regarded as the final nail in the coffin of the "exogenous" school, and the entire school sank into obscurity. Regrettably, the demise of the "exogenous" school also caused some interesting findings concerning non-circadian rhythms to fall into oblivion as well. Three different research groups, for example, reported that bean (Phaseolus vulgaris) seeds display rhythms in imbibition that have ~7- or ~14-day periodicities. Consistent with the idea of an exogenous synchronizer, these rhythms often occurred synchronously in bean seed populations located 1500 km apart. The present experiment was initiated with the intention of examining whether these ~7 and ~14 d oscillations in imbibition corresponded to oscillations in solar-terrestrial parameters. Three replicates of ~25 g of bean seeds (Phaseolus vulgaris cv. Provider) were weighed daily and placed into beakers containing 200 ml of distilled water at 25° C. This temperature was maintained by nesting the beakers inside larger, temperature-jacketed beakers through which water from a temperature-regulated water bath was circulated. Four hours later the experiments were terminated: the bean seeds were blotted and weighed. Experiments were conducted almost every day between 3 and 7 AM UT from Jan 18, 2007 to Feb 26, 2008. A major difference between the present study and

  13. Effect of raw soya bean particle size on productive performance and digestion of dairy cows.

    Science.gov (United States)

    Naves, A B; Freitas Júnior, J E; Barletta, R V; Gandra, J R; Calomeni, G D; Gardinal, R; Takiya, C S; Vendramini, T H A; Mingoti, R D; Rennó, F P

    2016-08-01

    Differing soya bean particle sizes may affect productive performance and ruminal fermentation due to the level of fatty acid (FA) exposure of the cotyledon in soya bean grain and because the protein in small particles is more rapidly degraded than the protein in large particles, which influence ruminal fibre digestion and the amounts of ruminally undegradable nutrients. The objective of this experiment was to investigate the effects of raw soya bean particle size on productive performance, digestion and milk FA profile of dairy cows. Twelve Holstein cows were assigned to three 4 × 4 Latin squares with 21-day periods. At the start of the experiment, cows were 121 days in milk (DIM) and yielded 30.2 kg/day of milk. Cows were fed 4 diets: (i) control diet (CO), without raw soya bean; (ii) whole raw soya bean (WRS); (iii) cracked raw soya bean in Wiley mill 4-mm screen (CS4); and (iv) cracked raw soya bean in Wiley mill 2-mm screen (CS2). The inclusion of soya beans (whole or cracked) was 200 g/kg on dry matter (DM) basis and partially replaced ground corn and soya bean meal. Uncorrected milk yield and composition were not influenced by experimental diets; however, fat-corrected milk (FCM) decreased when cows were fed soya bean treatments. Soya bean diets increased the intake of ether extract (EE) and net energy of lactation (NEL ), and decreased the intake of DM and non-fibre carbohydrate (NFC). Ruminal propionate concentration was lower in cows fed WRS than cows fed CS2 or CS4. Cows fed cracked raw soya bean presented lower nitrogen in faeces than cows fed WRS. The milk of cows fed WRS, CS2 and CS4 presented higher unsaturated FA than cows fed CO. The addition of raw soya bean in cow diets, regardless of the particle size, did not impair uncorrected milk yield and nutrient digestion, and increased the concentration of unsaturated FA in milk. Cows fed cracked raw soya bean presented similar productive performance to cows fed whole raw soya bean.

  14. Effects of dietary cooked navy bean on the fecal microbiome of healthy companion dogs.

    Directory of Open Access Journals (Sweden)

    Katherine R Kerr

    Full Text Available BACKGROUND: Cooked bean powders are a promising novel protein and fiber source for dogs, which have demonstrated potential to alter microbial composition and function for chronic disease control and prevention. This study aimed to determine the impact of cooked navy bean powder fed as a staple food ingredient on the fecal microbiome of healthy adult pet dogs. METHODOLOGY/PRINCIPAL FINDINGS: Fecal samples from healthy dogs prior to dietary control and after 4 wk of dietary treatment with macro- and micronutrient matched diets containing either 0 or 25% cooked navy beans (n = 11 and n = 10, respectively were analyzed by 454-pyrosequencing of the 16S rRNA gene. There were few differences between dogs fed the control and navy bean diets after 4 wk of treatment. These data indicate that there were no major effects of navy bean inclusion on microbial populations. However, significant differences due to dietary intervention onto both research diets were observed (i.e., microbial populations at baseline versus 4 wk of intervention with 0 or 25% navy bean diets. After 4 wk of dietary intervention on either control or navy bean diet, the Phylum Firmicutes was increased and the Phyla Actinobacteria and Fusobacteria were decreased compared to baseline. CONCLUSIONS: No negative alterations of microbial populations occurred following cooked navy bean intake in dogs, indicating that bean powders may be a viable protein and fiber source for commercial pet foods. The highly variable microbial populations observed in these healthy adult pet dogs at baseline is one potential reason for the difficulty to detect alterations in microbial populations following dietary changes. Given the potential physiological benefits of bean intake in humans and dogs, further evaluation of the impacts of cooked navy bean intake on fecal microbial populations with higher power or more sensitive methods are warranted.

  15. Evaluation of Maize (Zea mays L. and Bean (Phaseolus vulgaris L. Growth Indices in Strip Intercropping

    Directory of Open Access Journals (Sweden)

    M Nasiri Mahallati

    2015-07-01

    Full Text Available Intercropping systems are one of the best approaches in development of sustainable agriculture. Based on this purpose, the present study was conducted to evaluate effect of strip intercropping on maize and bean growth analysis and their yield during 2009. The experiment was set up in a completely randomized block with 3 replications and 6 treatments based on replacement design. The treatments were strip width, which included 2 rows bean plus 2 rows maize, 3 rows bean plus 3 rows maize, 4 rows bean plus 4 rows maize, 5 rows bean plus 5 rows maize, maize monoculture, and bean monoculture. Crop growth ratio, relative growth ratio, biological yield, economic yield, harvest index and land equivalent ratio were measured. Our results indicated that all of the measured traits were increased in the strip intercropping treatments compare to the monoculture treatments. Increasing of strip width in the central row of intercropping treatments in comparison with the two rows bean plus two rows maize treatment led to decrease crop growth rate (15.3% and 28.7%, relative growth rate (17.5% and 19.2%, biological yield (30.9% and 14%, economic yield (52.9% and 20.2%, harvest index (31.9% and 7.3% in maize and bean, respectively. With increasing of strip width, all of the measured traits decreased more in the central rows than the side rows. The highest (1.45 and the lowest (1.22 land equivalent ratio were found in the two rows bean plus two rows maize treatment and five rows bean plus five rows maize treatment, respectively. Partial of maize had more role compare to bean in terms of enhance land equivalent ratio.

  16. Effect of processing methods on nutritional, sensory, and physicochemical characteristics of biofortified bean flour.

    Science.gov (United States)

    Nkundabombi, Marie Grace; Nakimbugwe, Dorothy; Muyonga, John H

    2016-05-01

    Common beans (Phaseolus vulgaris L.) are rich nutritious and affordable by vulnerable groups, thus a good choice for biofortification to address malnutrition. However, increasing micronutrients content of beans, without improving micronutrients bioavailability will not improve the micronutrients status of consumers. Effect of different processing methods on the physicochemical characteristics of biofortified bean flour was determined. Processing methods used in this study were malting (48 h), roasting (170°C/45 min), and extrusion cooking using a twin screw extruder with three heating sections, the first set at 60°C, the second at 130°C, and the last one at 150°C. The screw was set at a speed of 35 Hz (123g) and bean flour moisture content was 15%. Mineral extractability, in vitro protein digestibility, pasting properties, and sensory acceptability of porridge and sauce from processed flour were determined. All processing methods significantly increased (P porridge or sauce from extruded biofortified bean flour and malted/roasted biofortified bean flour. Acceptability was also not affected by the bean variety used. Mineral bioavailability and in vitro protein digestibility increased more for extruded flour than for malted/roasted flours. Sauce and porridge prepared from processed biofortified bean flour had lower viscosity (extruded flour had the lowest viscosity), thus higher nutrient and energy density than those prepared from unprocessed biofortified bean flour. Estimated nutritional contribution of sauce and porridge made from processed ROBA1 flour to daily requirement of children below 5 years and women of reproductive age found to be high. These results show that processing methods enhanced nutritional value of biofortified bean flour and that processed biofortified bean flour can be used to prepare nutrient and energy-dense gruel to improve on nutritional status of children under 5 years and women of reproductive age.

  17. Mechanical weed control on small-size dry bean and its response to cross-flaming

    Energy Technology Data Exchange (ETDEWEB)

    Martelloni, L.; Frasconi, C.; Fontanelli, M.; Raffaelli, M.; Peruzzi, A.

    2016-11-01

    Dry bean (Phaseolus vulgaris L.) can be a profitable crop for farmers; however controlling weeds effectively without a decrease in yield remains a problem. An example where mechanical weed control is difficult to conduct is dry bean ‘Toscanello’, which is a small sized high-income niche product growing low to the ground. Concerning intra-row weed control, also flame weeding could be an opportunity but the dry bean heat tolerance needs to be studied. The aims of this research were to study the weed control efficacy of a spring-tine harrow and an inter-row cultivator in this bean variety, and to test the tolerance of dry bean cultivated under weed-free conditions to cross-flaming applied with different liquefied petroleum gas (LPG) doses. Flame weeding was applied at BBCH 13 and BBCH 14 bean growth stages by pairs of burners producing direct double flame acting into the intra-row space, with bean plants placed in the middle. The results suggest that the spring-tine harrow used two times at BBCH 13 and 14, respectively, lead to a yield similar to that of the weedy control. The inter-row cultivator could be an opportunity for small-sized dry bean crops producers, enabling them to obtain a similar yield compared to the hand-weeded control. Concerning the bean tolerance to cross-flaming the results showed that bean flamed at BBCH 13 stage had little tolerance to cross-flaming. Bean flamed at BBCH 14 stage was tolerant until an LPG dose of 39 kg/ha, giving yield responses similar to those observed in the non-flamed control. (Author)

  18. Phylogenetic analysis of a spontaneous cocoa bean fermentation metagenome reveals new insights into its bacterial and fungal community diversity.

    Directory of Open Access Journals (Sweden)

    Koen Illeghems

    Full Text Available This is the first report on the phylogenetic analysis of the community diversity of a single spontaneous cocoa bean box fermentation sample through a metagenomic approach involving 454 pyrosequencing. Several sequence-based and composition-based taxonomic profiling tools were used and evaluated to avoid software-dependent results and their outcome was validated by comparison with previously obtained culture-dependent and culture-independent data. Overall, this approach revealed a wider bacterial (mainly γ-Proteobacteria and fungal diversity than previously found. Further, the use of a combination of different classification methods, in a software-independent way, helped to understand the actual composition of the microbial ecosystem under study. In addition, bacteriophage-related sequences were found. The bacterial diversity depended partially on the methods used, as composition-based methods predicted a wider diversity than sequence-based methods, and as classification methods based solely on phylogenetic marker genes predicted a more restricted diversity compared with methods that took all reads into account. The metagenomic sequencing analysis identified Hanseniaspora uvarum, Hanseniaspora opuntiae, Saccharomyces cerevisiae, Lactobacillus fermentum, and Acetobacter pasteurianus as the prevailing species. Also, the presence of occasional members of the cocoa bean fermentation process was revealed (such as Erwinia tasmaniensis, Lactobacillus brevis, Lactobacillus casei, Lactobacillus rhamnosus, Lactococcus lactis, Leuconostoc mesenteroides, and Oenococcus oeni. Furthermore, the sequence reads associated with viral communities were of a restricted diversity, dominated by Myoviridae and Siphoviridae, and reflecting Lactobacillus as the dominant host. To conclude, an accurate overview of all members of a cocoa bean fermentation process sample was revealed, indicating the superiority of metagenomic sequencing over previously used techniques.

  19. The Magic Velvet Bean of Mucuna pruriens.

    Science.gov (United States)

    Lampariello, Lucia Raffaella; Cortelazzo, Alessio; Guerranti, Roberto; Sticozzi, Claudia; Valacchi, Giuseppe

    2012-10-01

    Mucuna pruriens (Fabaceae) is an established herbal drug used for the management of male infertility, nervous disorders, and also as an aphrodisiac. It has been shown that its seeds are potentially of substantial medicinal importance. The ancient Indian medical system, Ayurveda, traditionally used M. pruriens, even to treat such things as Parkinson's disease. M. pruriens has been shown to have anti-parkinson and neuroprotective effects, which may be related to its anti-oxidant activity. In addition, anti-oxidant activity of M. pruriens has been also demonstrated in vitro by its ability to scavenge DPPH radicals and reactive oxygen species. In this review the medicinal properties of M. pruriens are summarized, taking in consideration the studies that have used the seeds extracts and the leaves extracts.

  20. Hydrology and cycling of nitrogen and phosphorus in Little Bean Marsh : a remnant riparian wetland along the Missouri River in Platte County, Missouri, 1996-97

    Science.gov (United States)

    Blevins, Dale W.

    2004-01-01

    accounted for only 5 percent of the losses. Large residence times allows the marsh to greatly affect water quality before water escapes as ground-water recharge or surface outflow. The shallowness of Little Bean Marsh and ion exclusion during ice formation caused the highest specific conductances of 1,100 to 1,300 microsiemens per centimeter at 25 degrees Celsius to occur during the winter. This concentration of dissolved solutes under ice can make wetlands more vulnerable to toxic contaminants than deeper surface-water bodies. Dissolved oxygen was less than 5 mg/L (milligrams per liter) for 3 to 4 months and near 0 mg/L for about 1 month in summer. Despite depths of less than 1 meter, temperature stratification persisted more than 3 months during the summers of 1996 and 1997, preventing mixing and contributing to periods of anoxia. Shallow depths and extended periods of anoxia in the marsh limit the ability of some organisms to escape high-temperature stress. Turbidity in Little Bean Marsh usually was low for several reasons: sediment loadings from the largely flood-plain drainage were low, emergent vegetation shade out algae and shield the water from wind, and high concentrations of bivalent cations increase flocculation rates of inorganic suspended material. The high concentrations of bivalent cations was largely because of a substantial amount of ground-water seepage into the marsh. Dissolved organic nitrogen was the dominant nitrogen species in Little Bean Marsh. Denitrification and biotic uptake kept more than 62 percent of nitrate (NO3) and 43 percent of ammonium (NH4) concentrations in marsh samples less than a detection limit of 0.005 mg/L. This contrasts with the Missouri River where inorganic NO3 dominates. Consequently, artificial flood-plain drainage that bypasses riparian wetlands likely deliver substantially more biotically available inorganic nitrogen to receiving waters than surface water that has been routed through a remnant wetland. Aver

  1. A new method to select the drought resistance azuki bean germplasm

    Institute of Scientific and Technical Information of China (English)

    Chen Xin; Peerasak Srinives

    2006-01-01

    120 azuki bean germplasms from different regions of China were selected for drought-resistance. Results showed that there is a significant positive correlation between drought-resistance and photooxidation-resistance. So, the detecting technique for photooxidation-resistance should be suggested as a reference method to select the drought-resistance germplasms in azuki bean.

  2. Evaluation of tolerance to Bacillus thuringiensis toxins among laboratory-reared western bean cutworm (Lepidoptera: Noctuidae)

    Science.gov (United States)

    The Western bean cutworm (WBC), Striacosta albicosta, is a destructive insect pest of dry beans within its native range of western Nebraska and eastern Colorado. However, starting in the early 1990s, a range expansion of S. albicosta has resulted in damage to corn crops through the Midwest and more...

  3. Iron and zinc bioavailabilities to pigs from red and white beans (Phaseolus vulgaris L.) are similar

    Science.gov (United States)

    Common beans contain relatively high concentrations of iron (Fe) and zinc (Zn) but are also high in polyphenols and phytates, factors that may inhibit Fe and Zn absorption. In vitro (Caco-2 cells) and in vivo (pigs) models were used to compare Fe and Zn bioavailabilities between red and white beans,...

  4. Evaluation of common bean (Phaseolus vulgaris L.) collection for agromorphological and seed mineral concentration

    Science.gov (United States)

    A collection of common bean comprising totally 223 genotypes of which 176 genotypes from the USDA, 37 common bean landraces and 10 commercial cultivars from Turkey, evaluated for several agromorphological plant characters and mineral concentrations in seeds. There were wide range of variations for t...

  5. Phenotype and seed production among hyacinth bean (Lablab purpureus L. Sweet) accessions rescued using hydroponic techniques

    Science.gov (United States)

    Hyacinth bean, Lablab purpureus L. (Sweet) is a legume used as a vegetable, forage, and in home gardens as an ornamental plant. Many accessions do not flower during their juvenile period in Byron, GA. Other hyacinth bean accessions produce few seed when regenerated in the field. This study was condu...

  6. Resistance of common bean breeding lines to Phaeoisariopsis griseola isolates from Honduras

    Science.gov (United States)

    Angular leaf spot (ALS) disease caused by Phaeoisariopsis griseola Sacc. Ferraris, is currently one of the most important factors limiting bean productivity in Central America. The development of breeding lines which combine resistance to ALS and Bean Golden Yellow Mosaic Virus (BGYMV) and tolerance...

  7. Characterization of a Panela cheese with added probiotics and fava bean starch

    Science.gov (United States)

    Twenty Lactobacillus spp. and eight Bifidobacterium spp. were screened for their ability to ferment fava bean starch. B. breve ATCC 15700 and L. rhamnosus GG ATCC 53103 were selected as probiotics for use in fresh style Panela cheese. Two types of fresh cheese (with and without 3% fava bean starch) ...

  8. Common bean-Rhizobium symbiosis: functional genomics of legume response to abiotic stresses

    Science.gov (United States)

    Common bean (Phaseolus vulgaris) is the world's most important grain legume for direct human consumption and a main source of proteins in Latin America and Africa. Environmental factors such as nutrient deficiency, soil acidity, and metal toxicity are important constraints for bean symbiotic nitroge...

  9. Response of Andean and Mesoamerican common bean genotypes to inoculation with rhizobium strains.

    Science.gov (United States)

    In most common bean (Phaseolus vulgaris L.) production regions of Latin America, inoculants are rarely used by farmers in spite of several studies that demonstrate the importance of Rhizobium inoculation on commercial production of legume crops. This study investigated specific bean host plant-Rhizo...

  10. Evaluation of Organic Pest Management Treatments for Bean Leaf Beetle in Soybean in Iowa

    Science.gov (United States)

    Many organic soybean producers face the challenge of bean leaf beetle (Ceratoma trifurcata), which harbors bean mottle pod virus and opens infection sites for Fusarium spp., Cercospora kikuchii, and Phomopsis spp., which cause discoloration in soybeans. Stained soybean seed is less acceptable for fo...

  11. Inquiry-based Investigation in Biology Laboratories: Does Neem Provide Bioprotection against Bean Beetles?

    Science.gov (United States)

    Pearce, Amy R.; Sale, Amanda Lovelace; Srivatsan, Malathi; Beck, Christopher W.; Blumer, Lawrence S.; Grippo, Anne A.

    2013-01-01

    We developed an inquiry-based biology laboratory exercise in which undergraduate students designed experiments addressing whether material from the neem tree ("Azadirachta indica") altered bean beetle ("Callosobruchus maculatus") movements and oviposition. Students were introduced to the bean beetle life cycle, experimental…

  12. Recognition of Roasted Coffee Bean Levels using Image Processing and Neural Network

    Science.gov (United States)

    Nasution, T. H.; Andayani, U.

    2017-03-01

    The coffee beans roast levels have some characteristics. However, some people cannot recognize the coffee beans roast level. In this research, we propose to design a method to recognize the coffee beans roast level of images digital by processing the image and classifying with backpropagation neural network. The steps consist of how to collect the images data with image acquisition, pre-processing, feature extraction using Gray Level Co-occurrence Matrix (GLCM) method and finally normalization of data extraction using decimal scaling features. The values of decimal scaling features become an input of classifying in backpropagation neural network. We use the method of backpropagation to recognize the coffee beans roast levels. The results showed that the proposed method is able to identify the coffee roasts beans level with an accuracy of 97.5%.

  13. Uncertainty measurement in the homogenization and sample reduction in the physical classification of rice and beans

    Directory of Open Access Journals (Sweden)

    Dieisson Pivoto

    2016-04-01

    Full Text Available ABSTRACT: The study aimed to i quantify the measurement uncertainty in the physical tests of rice and beans for a hypothetical defect, ii verify whether homogenization and sample reduction in the physical classification tests of rice and beans is effective to reduce the measurement uncertainty of the process and iii determine whether the increase in size of beans sample increases accuracy and reduces measurement uncertainty in a significant way. Hypothetical defects in rice and beans with different damage levels were simulated according to the testing methodology determined by the Normative Ruling of each product. The homogenization and sample reduction in the physical classification of rice and beans are not effective, transferring to the final test result a high measurement uncertainty. The sample size indicated by the Normative Ruling did not allow an appropriate homogenization and should be increased.

  14. Evaluation of green coffee beans quality using near infrared spectroscopy: a quantitative approach.

    Science.gov (United States)

    Santos, João Rodrigo; Sarraguça, Mafalda C; Rangel, António O S S; Lopes, João A

    2012-12-01

    Characterisation of coffee quality based on bean quality assessment is associated with the relative amount of defective beans among non-defective beans. It is therefore important to develop a methodology capable of identifying the presence of defective beans that enables a fast assessment of coffee grade and that can become an analytical tool to standardise coffee quality. In this work, a methodology for quality assessment of green coffee based on near infrared spectroscopy (NIRS) is proposed. NIRS is a green chemistry, low cost, fast response technique without the need of sample processing. The applicability of NIRS was evaluated for Arabica and Robusta varieties from different geographical locations. Partial least squares regression was used to relate the NIR spectrum to the mass fraction of defective and non-defective beans. Relative errors around 5% show that NIRS can be a valuable analytical tool to be used by coffee roasters, enabling a simple and quantitative evaluation of green coffee quality in a fast way.

  15. Effect of acetylation, oxidation and annealing on physicochemical properties of bean starch.

    Science.gov (United States)

    Simsek, Senay; Ovando-Martínez, Maribel; Whitney, Kristin; Bello-Pérez, Luis A

    2012-10-15

    Black and Pinto bean starches were physically and chemically modified to investigate the effect of modification on digestibility and physicochemical properties of bean starch. The impact of acetylation, oxidation (ozonation) and annealing on the chemical composition, syneresis, swelling volume, pasting, thermal properties and digestibility of starches was evaluated. The physicochemical and estimated glycemic index (eGI) of the Black and Pinto bean starches treated with ozone were not significantly (P>0.05) different than that of their respective control starches. Annealed starches had improved thermal and pasting properties compared to native starches. Acetylated starches presented reduced syneresis, good pasting properties and lower eGI. Also, all modified starches had increased levels of resistant starch (RS). Therefore, the digestibility and physicochemical properties of bean starch were affected by the type of modification but there were no significant (P>0.05) differences between the Black and Pinto bean starches.

  16. Variability of root traits in common bean genotypes at different levels of phosphorus supply and ontogenetic stages

    Directory of Open Access Journals (Sweden)

    Roberto dos Santos Trindade

    2014-08-01

    Full Text Available Selection of common bean (Phaseolus vulgaris L. cultivars with enhanced root growth would be a strategy for increasing P uptake and grain yield in tropical soils, but the strong plasticity of root traits may compromise their inclusion in breeding programs. The aim of this study was to evaluate the magnitude of the genotypic variability of root traits in common bean plants at two ontogenetic stages and two soil P levels. Twenty-four common bean genotypes, comprising the four growth habits that exist in the species and two wild genotypes, were grown in 4 kg pots at two levels of applied P (20 and 80 mg kg-1 and harvested at the stages of pod setting and early pod filling. Root area and root length were measured by digital image analysis. Significant genotype × P level and genotype × harvest interactions in analysis of variance indicate that the genotypic variation of root traits depended on soil nutrient availability and the stage at which evaluation was made. Genotypes differed for taproot mass, basal and lateral root mass, root area and root length at both P levels and growth stages; differences in specific root area and length were small. Genotypes with growth habits II (upright indeterminate and III (prostrate indeterminate showed better adaptation to limited P supply than genotypes of groups I (determinate and IV (indeterminate climbing. Between the two harvests, genotypes of groups II and III increased the mass of basal and lateral roots by 40 and 50 %, respectively, whereas genotypes of groups I and IV by only 7 and 19 %. Values of the genotypic coefficient of determination, which estimates the proportion of phenotypic variance resulting from genetic effects, were higher at early pod filling than at pod setting. Correlations between shoot mass and root mass, which could indicate indirect selection of root systems via aboveground biomass, were higher at early pod filling than at pod setting. The results indicate that selection for root

  17. Effect of several germination treatments on phosphatases activities and degradation of phytate in faba bean (Vicia faba L.) and azuki bean (Vigna angularis L.).

    Science.gov (United States)

    Luo, Yuwei; Xie, Weihua; Luo, Fengxia

    2012-10-01

    Two assays were conducted to investigate the changes of faba bean (Vicia faba L.) and azuki bean (Vigna angularis L.) phosphatases (phytase [Phy] and acid phosphatase [AcPh]) and the degradation of its substrates (inositol phosphate esters) during seed germination. The 1st assay was to establish the optimal germination conditions of faba bean and azuki bean to improve the endogenous phosphatases and increase the hydrolysis of phytate and, in the second assay, to determine the different lower phosphate esters of myo-inositol produced during the germination process. In the 1st assay, seeds were soaked for 12 and 24 h and germinated for 3 and 5 d with and without the addition of gibberellic acid (GA(3) ). In the second assay, seeds were soaked for 12 h and germinated for 1, 3, and 5 d with GA(3) . Phy (up to 3625 and 1340 U/kg) and AcPh (up to 9456 and 2740 U/g) activities, and inositol hexaphosphate (IP6) (8.23 and 7.46 mg/g), inositol pentaphosphate (IP5) (0.55 and 0.82 mg/g), and inositol tetraphosphate (IP4) (0.26 and 0.01 mg/g) were detected in ungerminated faba bean and azuki bean, respectively. The germination process caused a significant increase of Phy and AcPh activities in faba bean (up to 147% and 210%) and azuki bean (up to 211% and 596%) and a reduction in the phytate phosphorus content (up to 81% and 63%, respectively). Phytate phosphorus content was affected only by soaking time in the case of faba bean. Finally, during the course of germination, IP6 and IP5 were rapidly degraded in faba bean (88% and 39%) and azuki bean (55% and 56%), and IP4 was only a short-living intermediate, which was increased during hydrolysis and degraded to inositol triphosphate. In this manner we could obtain a low-phytate, endogenous phosphatase-rich ingredient for enhancing human nutrition.

  18. Reduction of viral load in whitefly (Bemisia tabaci Gen.) feeding on RNAi-mediated bean golden mosaic virus resistant transgenic bean plants.

    Science.gov (United States)

    de Paula, Nayhanne T; de Faria, Josias C; Aragão, Francisco J L

    2015-12-02

    The RNAi concept was explored to silence the rep gene from the bean golden mosaic virus (BGMV) and a genetically modified (GM) bean immune to the virus was previously generated. We investigated if BGMV-viruliferous whiteflies would reduce viral amount after feeding on GM plants. BGMV DNA amount was significantly reduced in whiteflies feeding in GM-plants (compared with insects feeding on non-GM plants) for a period of 4 and 8 days in 52% and 84% respectively.

  19. A study of arsenic speciation in soil, irrigation water and plant tissue: A case study of the broad bean plant, Vicia faba.

    Science.gov (United States)

    Sadee, Bashdar A; Foulkes, Mike E; Hill, Steve J

    2016-11-01

    Samples of soil, the broad bean plant, Vicia faba and irrigation water were collected from the same agricultural site in Dokan, in the Kurdistan region of Iraq. Total arsenic and arsenic speciation were determined in all materials by ICP-MS and HPLC-ICP-MS, respectively. Available arsenic (11%) was also determined within the soil, together with Cd, Cr, Cu, Ni, Zn, Fe and Mn. The concentrations of total arsenic were: soil (5.32μgg(-1)), irrigation water (1.06μgL(-1)), roots (2.065μgg(-1)) and bean (0.133μgg(-1)). Stems, leaves and pods were also measured. Inorganic As(V) dominated soil (90%) and root (78%) samples. However, organo-arsenic (MMA, 48% and DMA, 19%) was the more dominant species in the edible bean. The study provides an insight into the uptake, preferred disposal route, speciation changes and loss mechanism involved for arsenic with this food source.

  20. Elucidating the Potential of Native Rhizobial Isolates to Improve Biological Nitrogen Fixation and Growth of Common Bean and Soybean in Smallholder Farming Systems of Kenya

    Directory of Open Access Journals (Sweden)

    Ernest Wandera Ouma

    2016-01-01

    Full Text Available Identification of effective indigenous rhizobia isolates would lead to development of efficient and affordable rhizobia inoculants. These can promote nitrogen fixation in smallholder farming systems of Kenya. To realize this purpose, two experiments were conducted under greenhouse conditions using two common bean cultivars; Mwezi moja (bush type and Mwitemania (climbing type along with soybean cultivar SB 8. In the first experiment, the common bean cultivars were treated with rhizobia inoculants including a consortium of native isolates, commercial isolate (CIAT 899, a mixture of native isolates and CIAT 899, and a control with no inoculation. After 30 days, the crop was assessed for nodulation, shoot and root dry weights, and morphological features. In the second experiment, soybean was inoculated with a consortium of native isolates, commercial inoculant (USDA 110, and a mixture of commercial and native isolates. Remarkably, the native isolates significantly (p<0.001 increased nodulation and shoot dry weight across the two common bean varieties compared to the commercial inoculant, CIAT 899. Mixing of the native rhizobia species and commercial inoculant did not show any further increase in nodulation and shoot performance in both crops. Further field studies will ascertain the effectiveness and efficiency of the tested indigenous isolates.

  1. Occurrence of ochratoxin A in cocoa beans: effect of shelling.

    Science.gov (United States)

    Amézqueta, S; González-Peñas, E; Murillo, M; de Cerain, A López

    2005-06-01

    The aim of this study was to investigate the influence of the shelling process on the presence of ochratoxin A (OTA) in cocoa samples. Twenty-two cocoa samples were analysed for the determination of OTA before (cocoa bean) and after undergoing manual shelling process (cocoa nib). In order to determine OTA contamination in cocoa samples, a validated high-performance liquid chromatography (HPLC) method with fluorescence detection was used for the quantitative analysis of ochratoxin A (OTA). In both types of samples, OTA was extracted with methanol-3% sodium hydrogen carbonate solution and then purified using immunoaffinity columns prior to HPLC analysis. Due to the fact that different recovery values were obtained for OTA from both types of samples, a revalidation of the method in the case of cocoa nibs was needed. Revalidation was based on the following criteria: Selectivity, limits of detection and quantification (0.03 and 0.1 microg kg(-1), respectively), precision (within-day and between-day variability) and recovery 84.2% (RSD = 7.1%), and uncertainty (30%). Fourteen of the twenty-two cocoa bean samples (64%) suffered a loss of OTA of more than 95% due to shelling, six samples suffered a loss of OTA in the range 65-95%, and only one sample presented a reduction of less than 50%. The principal conclusion derived from this study is that OTA contamination in cocoa beans is concentrated in the shell; therefore, improvements of the industrial shelling process could prevent OTA occurrence in cocoa final products.

  2. Ingestive behavior of finishing sheep fed detoxified castor bean meal

    Directory of Open Access Journals (Sweden)

    Daniel Cézar da Silva

    2016-06-01

    Full Text Available ABSTRACT Castor bean crops stand out in the Northeastern Brazil for oil production, producing coproducts with potential for animal diets. Thus, this work evaluated the effect on ingestive behavior when 0, 33, 67 and 100% of detoxified castor bean meal (DCBM were included to substitute soy bean meal in diets for sheep. The randomized blocks design was used with five sheep in each treatment. Dry matter intake and neutral detergent fiber intake were not affected (P > .05 by the inclusion of DCBM in the diet, with means of 1362.6 and 582.98 g/animal/day, respectively. Substitution of soybean meal by DCBM did not affect (P > .05 times of rumination, idle and total chewing, with averages of 181.33, 347.04 and 366.24 minute/12 h, respectively. A quadratic effect (P < .05 was found for feeding time, with minimum of 164.56 min/12 h, when 60% of DCBM was included in the diet. A quadratic effect (P < .05 was verified for eating efficiency with maximum of 4.43 g DM/minute and 2.08 g NDF/minute. Rumination efficiency in g DM and NDF/minute were not affected (P < .05, with means of 4.31 and 1.84, respectively. The substitution of soybean meal by DCBM decreases feeding time when 60% of it was used but does not influence the intake of DM and NDF, time spent in ruminating and idle, and total chewing time. The use of 60% of DCBM increases feeding efficiency of DM and NDF, and does not compromise the efficiency of rumination.

  3. Agronomic performance of velvet bean at different spatial arrangement; Desempenho agronomico de mucuna-verde em diferentes arranjos espaciais

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Aijanio Gomes de Brito; Goncalves Junior, Murilo [Universidade Federal Rural do Rio de Janeiro (UFRRJ), Seropedica, RJ (Brazil); Guerra, Jose Guilherme Marinho; Costa, Janaina Ribeiro; Espindola, Jose Antonio Azevedo; Araujo, Ednaldo da Silva, E-mail: gmguerra@cnpab.embrapa.b, E-mail: janaina@cnpab.embrapa.b, E-mail: jose@cnpab.embrapa.b, E-mail: ednaldo@cnpab.EMBRAP [EMBRAPA Agrobiologia, Seropedica, RJ (Brazil)

    2011-06-15

    The objective of this work was to evaluate the effect of different plant spatial arrangements on agronomic performance of velvet-bean (Mucuna pruriens var. utilis). The experiment was performed with eight treatments, distributed in a randomized complete block design in a 2x4 factorial arrangement, with four replicates. The treatments were velvet bean sowing at two spacings between furrows (0.5 and 1.0 m) and four plant densities (2, 4, 8 and 16 plants m{sup -1}). Determinations were made for the soil covering and biological nitrogen fixation (BNF) rates, and for the dry matter yield and N accumulation in the plant shoots. Total soil cover was accomplished at 50 days after sowing at 16 plants m{sup -1} density and 0.5 m spacing between furrows. The combination of 16 plants m{sup -1}1density with the 1.0 m spacing between furrows provided the greatest dry matter yield and accumulated most N in the plant shoots. Irrespective of the plant spatial arrangement, the estimation of BNF in this species shows that about 70% N present in the shoot is derived from the atmosphere. (author)

  4. Characterization of bean (Phaseolus vulgaris L.) ecotype "Fagiolo occhio nero di Oliveto Citra" using agronomic, biochemical and molecular approaches.

    Science.gov (United States)

    Zaccardelli, Massimo; Pentangelo, Alfonso; Tripodi, Pasquale

    2013-09-15

    Common bean (Phaseolus vulgaris) is the most important grain legume and plays a significant role in human nutrition being a major source of dietary protein and representing a rich source of minerals and certain vitamins. Several large germplasm collections have been established, which contain large amounts of genetic diversity, including wild and domesticated species. In this study agronomic, biochemical and molecular characterization of landrace bean named "Fagiolo occhio nero di Oliveto Citra" (Phaseolus vulgaris L.), is described. Seeds were obtained by local farmers and field trials were carried out during years 2009-2010, in the typical cultivation site (Oliveto Citra, Salerno Province), using two different densities of investment. During 2011, in order to evaluate the performance in different environments, field trials were conducted in three localities (Battipaglia, Oliveto Citra and Controne). Data analysis shows good adaptability across locations and similar grain yield using two spacing's of seeds. Morphological characterization and molecular analysis, using AFLP and Minisatellite molecular markers, were performed on ten "biotypes" collected from local farmers. Seeds characterization showed variability on the violet area surrounding the hilum (named as eye) while markers have provided useful information on relationships between biotypes. Biochemical analysis, which includes the contents of protein, minerals and antioxidants, shows how the composition is consistent with respect to other landraces and commercial cultivars. The landrace under study revealed genetic stability and good adaptation to cultivated environment with best performance in the native area. In addition, the bio-agronomic characteristics are in accord with studies reported in literature.

  5. 蚕豆赤斑病病原菌鉴定%Identification of the pathogens causing chocolate spot on the broad bean

    Institute of Scientific and Technical Information of China (English)

    黄燕; 段灿星; 陆鸣; 东方阳; 朱振东

    2012-01-01

    Abstract Chocolate spot is one of the most important diseases on broad bean, causing severe yield loss in China. In this study, the pathogens for chocolate spot of broad bean were isolated from Gansu, Qinghai, Jiangsu, Sichuan, Hebei and Chongqing provinces and were identified on the basis of the morphological and molecular characteristics. Three Botrytis species, namely B. fabae, B. cinerea and B. fabiopsis, were found in all of the surveyed provinces. The isolates of each species differed greatly in pathogenicity. However, most isolates of each species showed strong pathogenicity on broad bean. To our knowledge, this is the first report of B. fabiopsis in other provinces of our country since the nomenclature of this species in Hubei Province.%蚕豆赤斑病是蚕豆的重要病害之一,严重影响蚕豆生产.本研究通过形态学和分子特征,对采自甘肃、青海、江苏、四川、河北、重庆等6个省市的蚕豆赤斑病病原菌进行鉴定.结果表明,在6个省市均鉴定到蚕豆葡萄孢(Botrytis abae)、灰葡萄孢(B.cinerea)和拟蚕豆葡萄孢(B.fabiopsis)3种病原菌.致病力测定表明:不同地理来源的3种病原菌分离物都存在致病力差异,但均以强致病力分离物为主.本研究是继湖北省之后在其他省市首次发现拟蚕豆葡萄孢.

  6. Rheological properties of gelatin, carrageenan and locust bean gum mixtures

    OpenAIRE

    Jones, Guy Matthew John

    2004-01-01

    This thesis reports data on blends of carrageenan (0.3%w/w) and locust bean gum (0.3%w/w) in the presence of biopolymers, particularly gelatin of varying concentration. Particular attention is given to their behaviour on autoclaving since this is relevant to one of the most important applications of these materials as gelling agents in canned meat products. It was shown there is such 3% gelatin could be found in the gelling system as a result of from collagen in the meat. Gelatin at this ...

  7. 广州地区7种菊科入侵植物丛枝菌根侵染和根际土壤孢子密度的生境差异性分析%Habitat Difference Analysis of Arbuscular Mycorrhizal Colonization and Spore Density for Seven Compositae Invasive Species in Guangzhou

    Institute of Scientific and Technical Information of China (English)

    胡文武; 辛国荣; 郭健桦; 彭雪

    2015-01-01

    为了解广州地区7种菊科(Compositae)入侵植物与丛枝菌根真菌(Arbuscular mycorrhizal fungi, AMF)的互作共生关系,调查了这7种菊科入侵植物在4种生境中的AMF侵染和根际土壤孢子密度,并分析土壤因子对AMF的影响。结果表明,7种入侵植物根内均受到AMF侵染,根际土壤中均检测到AMF孢子;AMF侵染在宿主间差异显著,生境间的差异不显著;孢子密度在生境和宿主间的差异均显著,人工绿地、农田果园的AMF孢子密度均显著高于森林周边和滨海地带。相关性分析表明,农田果园生境的根际土壤孢子密度与土壤有机质含量呈显著负相关关系;森林周边生境的AMF总侵染率与土壤全氮呈极显著正相关关系;人工绿地的AMF总侵染率与土壤速效氮含量呈显著负相关关系;滨海地带的AMF总侵染率与土壤有效磷含量呈显著负相关关系。这些对理解菊科植物入侵机理具有非常重要的作用。%In order to understand the symbiosis of arbuscular mycorrhizal fungi (AMF) with Compositae invasive plants in Guangzhou, the AMF colonization rate and spore density of 7 Compositae invasive plant species in four habitats were studied, and the effect of soil factors on AMF was also analyzed. The results showed that all the investigated plants were colonized by AMF, AMF spores were detected from all soil samples. AMF colonization rate showed significant difference among hosts, but not among habitats. AMF spore density was significantly different both among hosts and habitats, among which, spore density was signiifcantly higher in artiifcial green land, farmland and orchard than that in forest surround and coastal area. Correlation analysis showed that spore density was negatively correlated with soil organic matter content in farmland and orchard, AMF colonization rate was positively correlated with total N content in forest surround, AMF colonization rate was negatively

  8. Application of 1H NMR for the characterisation of cocoa beans of different geographical origins and fermentation levels.

    Science.gov (United States)

    Caligiani, Augusta; Palla, Luigi; Acquotti, Domenico; Marseglia, Angela; Palla, Gerardo

    2014-08-15

    This study reports for the first time the use of (1)H NMR technique combined with chemometrics to study the metabolic profile of cocoa (Theobroma cacao L.) beans of different varieties, origin and fermentation levels. Results of PCA applied to cocoa bean (1)H NMR dataset showed that the main factor influencing the cocoa bean metabolic profile is the fermentation level. In fact well fermented brown beans form a group clearly separated from unfermented, slaty, and underfermented, violet, beans, independently of the variety or geographical origin. Considering only well fermented beans, the metabolic profile obtained by (1)H NMR permitted to discriminate between some classes of samples. The National cocoa of Ecuador, known as Arriba, showed the most peculiar characteristics, while the samples coming from the African region showed some similar traits. The dataset obtained, representative of all the classes of soluble compounds of cocoa, was therefore useful to characterise fermented cocoa beans as a function of their origin and fermentation level.

  9. Molecular assessment of genetic diversity in mung bean germplasm

    Indian Academy of Sciences (India)

    G. Roopa Lavanya; Jyoti Srivastava; Shirish A. Ranade

    2008-04-01

    RAPD profiles were used to identify the extent of diversity among 54 accessions of mung bean that included both improved and local land races. Out of the 40 primers screened, seven primers generated 174 amplification products with an average of 24.85 bands per primer. The RAPD profiles were analysed for Jaccard’s similarity coefficients that was found to be in the range from 0 to 0.48, indicating the presence of wide range of genetic diversity at molecular level. Cluster analysis was carried out based on distances (1-similarity coefficient) using neighbour-joining method in Free Tree package. The dendrogram resolved all the accessions into two major clusters, I (with 11 accessions) and II (with 43 accessions). However, the cluster was further divided into four subclusters (II A with six, II B with nine, II C with 15 and II D with 13 accessions). The distribution of the accessions in different clusters and subclusters appeares to be related to their performance in field conditions for 10 morphological traits that were scored. This study indicated that the RAPD profiles provide an easy and simple technique for preliminary genetic diversity assessment of mung bean accessions that may reflect morphological trait differences among them.

  10. Biological treatment to bean seeds before sowing them.

    Directory of Open Access Journals (Sweden)

    Silvano Edel Castro Mayo

    2013-09-01

    Full Text Available Even in some bibliography about the bean cultivation is recommended the use of Rhizobium which association with the cultivation is very advantageous for the fixation of the atmospheric nitrogen, as well as the employment of the antagonistic mushroom Trichoderma spp., for the control of fungous illnesses of the floor and knowing that the cultivation has its fertilization demands and of the plagues control and illnesses that are in definitive the causes that limit the yields of the cultivation, these practices are not used. We proceeded to the disinfection of bean seeds with the resulting solution of the laundry of 1Kg of Trichoderma harzianum of the stock A-34 with 2 liters of water and the mixture of this fluid with 1 Kg of Rhizobium, more a package (134 grams of Gaucho PS 70 for 45.35 kg (100 pounds of t seed. The disinfection of the seed was made by hand, 12 hour before sowing them and the results were very encouraging, so much in the delay of days in appearing the illnesses and the plagues and its low attack intensity as the increase of the yields with relationship to the not treated seed.

  11. Infrared thermometry to schedule irrigation of common bean

    Directory of Open Access Journals (Sweden)

    Lobo Francisco de Almeida

    2004-01-01

    Full Text Available The objective of this work was to determine the critical irrigation time for common bean (Phaseolus vulgaris L. cv. Carioca using infrared thermometry. Five treatments were analyzed. Canopy temperature differences between plants and a well-watered control about 1, 2, 3, 4, and 5±0.5ºC were tested. Physiological variables and plant growth were analyzed to establish the best time to irrigate. There was a significant linear correlation between the index and stomatal resistance, transpiration rate, and leaf water potential. Although significant linear correlation between the index and mean values of total dry matter, absolute growth rate, and leaf area index was found, no correlation was found with other growth index like relative growth rate, net assimilation rate, and leaf area ratio. Plants irrigated when their canopy temperature was 3±0.5ºC above the control had their relative growth rate mean value increased up to 59.7%, yielding 2,260.2 kg ha-1, with a reduction of 38.0% in the amount of water used. Plants irrigated when their canopy temperature was 4±0.5ºC yielded 1,907.6 kg ha-1, although their relative growth rate mean value was 4.0% below the control. These results show that the best moment to irrigate common bean is when their canopy temperature is between 3ºC and 4±0.5ºC above the control.

  12. Effect of copper on castor bean (Ricinus communis L.) growth

    Energy Technology Data Exchange (ETDEWEB)

    Chaves, Lucia Helena Garofalo; Cunha, Tassio Cavalcanti da Silva; Lima, Vinicius Mota; Cabral, Paulo Cesar Pinto; Barros Junior, Genival; Lacerda, Rogerio Dantas de [Universidade Federal de Campina Grande (UAEAg/UFCG), PB (Brazil). Unidade Academica de Engenharia Agricola

    2008-07-01

    Castor beans crop (Ricinus communis L.) is raising attention as an alternative crop for oil and biodiesel production. Despite the mineral fertilization is an important factor for increasing castor yield, few research has been made on this issue, mainly on the use de copper. In order to evaluate the effects of copper on growth of this plant an experiment was carried out in a greenhouse, in Campina Grande, Paraiba State, Brazil, from July to December 2007. The substrate for the pot plants was a 6 mm-sieved surface soil (Neossolo Quartzarenico). The experimental design was a completely randomized with three replications. The treatments were composed of five levels of Cu (0; 1; 2; 3 and 4 mg dm{sup -3}), which were applied at the time of planting. One plant of castor bean, cultivar BRS 188 - Paraguacu, was grown per pot after thinning and was irrigated whenever necessary. Data on plant height, number and length of leaves and stem diameter were measured at 21, 34, 77 and 103 days after planting. Copper levels used, in general, did not affect the plant height, stem diameter and leaf area, however they influenced the leaves and shoot biomass dry mass and the quadratic trend was the best to show the behavior of these. (author)

  13. Efficacy of Locust Beans Husk Char in Heavy Metal Sequestration

    Directory of Open Access Journals (Sweden)

    Ademola Ayodeji Ajayi-Banji

    2016-03-01

    Full Text Available Most solid waste management schemes minimally consider low concentration biodegradable agricultural waste management, though the environmental impact of this waste category is significant over a time frame. The column-mode study seeks to address the issue by suggesting potential utilisation of post-harvest waste for heavy metal sequestering. Locust beans husk char of 100 and 200 g was employed to inspect removal efficiency, isotherm and kinetic models of some heavy metals at 30, 60, 90, 120 and 150 min contact time. Elemental composition of the biosorbent was investigated using the SEM-EDX machine. The results obtained depict that over 85% aluminium and nickel removal was achieved at 150 min detention time. The Freundlich isotherm well described most of the sorbates sorption (R2 ≥ 0.91. The sorption rate equally fitted into the second-order pseudo kinetic model (R2 ≥ 0.88. Ion exchange took place during the sorption. Locust beans husk has promising adsorption potential in heavy metal ions removal from fouled surface water. DOI: http://dx.doi.org/10.5755/j01.erem.71.4.13081

  14. Faba bean hulls as a potential source of pectin.

    Science.gov (United States)

    Korish, Mohamed

    2015-09-01

    This study aimed for the first time to assess the potential use of faba bean hulls as a source of pectin. The study involved extracting pectin under various conditions of pH, temperature and extraction time and determining how these conditions affected pectin yield and its characteristics. The maximum yield of extracted pectin did not coincide with the highest degree of esterification since the maximum yield (15.75 %) was recorded at pH 1.5 and at a temperature of 85 °C for an 80-min extraction period and solid to liquid (1: 25) ratio, while the highest degree of esterification (54.62 %) occurred at pH 2.5 and at temperature of 90 °C for a 60-min extraction period. The composition of the pectin varied according to the extraction conditions: the neutral sugars galactose, arabinose and rhamnose increased under milder extraction conditions while glucose, mannose and xylose sugars predominated under harsher extraction conditions. The results indicated that faba bean hulls contains adequate amount of pectin, suitable for commercial utilization.

  15. Effect of gamma irradiation on antinutritional factors in broad bean

    Energy Technology Data Exchange (ETDEWEB)

    Al-Kaisey, M.T. E-mail: istd@uruklink.net; Alwan, A.-K.H.; Mohammad, M.H.; Saeed, A.H

    2003-06-01

    The effect of gamma irradiation on the level of antinutritional factors (trypsin inhibitor (TI), phytic acid and oligosaccharides) of broad bean was investigated. The seeds were subjected to gamma irradiation at 0, 2.5, 5, 7.5 and 10 kGy, respectively using cobalt-60 gamma radiation with a dose rate 2.37 kGy/h. TI activity was reduced by 4.5%, 6.7%, 8.5% and 9.2% at 2.5, 5, 7.5 and 10 kGy, respectively. Meanwhile, irradiation at 10.2, 12.3, 15.4 and 18.2 kGy reduced the phytic acid content. The flatulence causing oligosaccharides were decreased as the radiation dose increased. The chemical composition (protein, oil, ash and total carbohydrates) of the tested seeds was determined. Gamma radiation seems to be a good procedure to improve the quality of broad bean from the nutritional point of view.

  16. Breeding common bean populations for traits using selection index

    Directory of Open Access Journals (Sweden)

    Dayane Cristina Lima

    2015-02-01

    Full Text Available A common bean (Phaseolus vulgarisL. cultivar must combine desirable genotypes for several traits in order to be accepted by producers and consumers. This study aimed to evaluate selection efficiency when segregating bean populations for traits, by means of a selection index, in order to obtain superior progenies for traits considered. A total of 16 populations from the F4 and F5generations were evaluated in 2011 and 2012, respectively. The traits evaluated were plant architecture, plant disease, grain type and yield. Using standard scores (Z, the sum of the four traits (∑Z was obtained and, based on this information, the best populations were identified. The evaluation of selection effectiveness was performed on 31 progenies from each population. The 496 progenies plus eight controls were evaluated in the F5:6and F5:7 generations for the same traits in July and November 2012, respectively. The selection, using the index based on the sum of standardized variables (∑Z, was efficient for identifying populations with superior progenies for all the traits considered.

  17. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean

    Institute of Scientific and Technical Information of China (English)

    Yau Sang Chan; Jack Ho Wong; Evandro Fei Fang; Wen Liang Pan; Tzi Bun Ng

    2012-01-01

    A 5.4-kDa antifungal peptide,with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC5o=3 μM),Setospaeria turcica and Bipolaris maydis,was isolated from the seeds of Phaseolus vulgaris cv.brown kidney bean.The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75.The antifungal activity of the peptide against M.arachidicola was stable in the pH range 3-12 and in the temperature range 0℃ to 80℃.There was a slight reduction of the antifungal activity at pH 2 and 13,and the activity was indiscernible at pH 0,1,and 14.The activity at 90℃ and 100℃ was slightly diminished.Deposition of Congo red at the hyphal tips of M.arachidicola was induced by the peptide indicating inhibition of hyphal growth.The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells,in contrast to the presence of such activity of other antifungal peptides,indicates that different domains are responsible for the antifungal and antiproliferative activities.

  18. An antifungal peptide from Phaseolus vulgaris cv. brown kidney bean.

    Science.gov (United States)

    Chan, Yau Sang; Wong, Jack Ho; Fang, Evandro Fei; Pan, Wen Liang; Ng, Tzi Bun

    2012-04-01

    A 5.4-kDa antifungal peptide, with an N-terminal sequence highly homologous to defensins and inhibitory activity against Mycosphaerella arachidicola (IC(50)= 3 μM), Setospaeria turcica and Bipolaris maydis, was isolated from the seeds of Phaseolus vulgaris cv. brown kidney bean. The peptide was purified by employing a protocol that entailed adsorption on Affi-gel blue gel and Mono S and finally gel filtration on Superdex 75. The antifungal activity of the peptide against M. arachidicola was stable in the pH range 3-12 and in the temperature range 0°C to 80°C. There was a slight reduction of the antifungal activity at pH 2 and 13, and the activity was indiscernible at pH 0, 1, and 14. The activity at 90°C and 100°C was slightly diminished. Deposition of Congo red at the hyphal tips of M. arachidicola was induced by the peptide indicating inhibition of hyphal growth. The lack of antiproliferative activity of brown kidney bean antifungal peptide toward tumor cells, in contrast to the presence of such activity of other antifungal peptides, indicates that different domains are responsible for the antifungal and antiproliferative activities.

  19. Prosopis pubescens (screw bean mesquite) seedlings are hyperaccumulators of copper.

    Science.gov (United States)

    Zappala, Marian N; Ellzey, Joanne T; Bader, Julia; Peralta-Videa, Jose R; Gardea-Torresdey, Jorge

    2013-08-01

    Due to health reasons, toxic metals must be removed from soils contaminated by mine tailings and smelter activities. The phytoremediation potential of Prosopis pubescens (screw bean mesquite) was examined by use of inductively-coupled plasma optical emission spectroscopy. Transmission electron microscopy was used to observe ultrastructural changes of parenchymal cells of leaves in the presence of copper. Elemental analysis was used to localize copper within leaves. A 600-ppm copper sulfate exposure to seedlings for 24 days resulted in 31,000 ppm copper in roots, 17,000 ppm in stems, 11,000 in cotyledons and 20 ppm in the true leaves. For a plant to be considered a hyperaccumulator, the plant must accumulate a leaf-to-root ratio <1. Screw bean mesquite exposed to copper had a leaf-to-root ratio of 0.355 when cotyledons were included. We showed that P. pubescens grown in soil is a hyperaccumulator of copper. We recommend that this plant should be field tested.

  20. Economic viability of common bean variety BRS Estilo

    Directory of Open Access Journals (Sweden)

    Osmira Fatima da Silva

    2015-11-01

    Full Text Available This study aims to evaluate financially BRS Estilo, a variety of common bean (Phaseolus vulgaris L., the carioca group, developed by “Embrapa Rice and Beans” and partners, estimating the regional economic benefit from the knowledge of the costs generation and transfer of technology and production system. The BRS Estilo variety was evaluated in four successive seasons: 2010/2011, 2011/2012, 2012/2013 and 2013/2014. The BRS Estilo technology contribution to the bean agribusiness in Brazil was R$ 239.431.760,83, about US$ 106 million during the period. The transfer process of the BRS Estilo to the productive sector represents 7,5% of the total cost on developing technology, which began in 2000. In addition to the economic benefit provided by the adoption of this technology, there has also been generating more jobs in its supply chain and also increasing the product offered in the market. JEL-Code | O13; Q16; R32.

  1. Influence of Bacterial Quantitiy in Mycorrhizosphere on Species Diversity of Arbuscular Mycorrhizal Fungi in an Alpine Grassland on the Tibetan Plateau%高寒草原菌根围细菌数量对丛枝茵根真菌物种多样性的影响

    Institute of Scientific and Technical Information of China (English)

    蔡晓布; 彭岳林

    2011-01-01

    Based on spore identification, the influence of bacterial quantity in mycorrhizosphere of dominant grasses on species diversity of arbuscular mycorrhizal fungi (AMF) was investigated in an alpine grassland on North Tibetan Plateau. The results indicated that: 1) When the bacterial number was in the range of 1.02×106 to 2.96 × 106 and 3.01 × 106 to 6.06 × 106 g-1, Glomus and Acaulospora were the dominant genera and Scutellospora was the common genera. The spore density, isolation frequency, relative abundance, importance value and species richness (SN, SR) of AMF showed the similar trend of Glomus > Acaulospora > Scutellospora. 2) When the bacterial number was below 3.0 × 106 g-1, spore density of each AMF genus and species richness (SR) were relatively high. The Shannon-Weiner index and species evenness index were 1.774 and 0.127, respectively. 3) The spore density of AMF declined slightly with the increase of bacterial number, whereas the root infection rate, infection intensity and arbuscule richness of AMF tended to increase. The effect was remarkable when the bacterial number was over 3.0 × 106 g-1.4) Regardless of bacterial number, the species of AMF was mainly composed of common species and dominant species (Glomus was the main genus), and rare species and unique species were less reported. Spore density, relative abundance and importance value differed greatly among different genera of AMF. Fig 6, Tab 3, Ref 25%基于从枝菌根真菌(Arbuscular mycorrhizas fungi,AMF)孢子形态学鉴定,研究了藏北高寒草原主要建群植物菌根围细菌数量对AMF物种多样性的影响.结果表明:1)细菌数量1.02×106~2.96×106、3.01×106~6.06×106个/g范围内,Glomus、Acaulospor均为优势属,Scutellospora则均为最常见属;AMF孢子密度、分离频度、相对多度、重要值和种的丰度(SN、SR)均呈Glomus>Acaulospora> Scutellospora属的趋势.2)细菌数量较低时(<3.0×106个/g),AMF各属孢子密度、种的丰

  2. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Energy Technology Data Exchange (ETDEWEB)

    Villavicencio, Anna Lucia C.H. E-mail: villavic@net.ipen.br; Mancini-Filho, Jorge E-mail: jmancini@usp.br; Delincee, Henry; Greiner, Ralf E-mail: ralf.greiner@bfe.uni-karlsruhe.de

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macacar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g{sup -1} dry basis, 1.8 mg g{sup -1} dry basis and 13.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Carioca beans and 0.30 mg g{sup -1} dry basis, 0.42 mg g{sup -1} dry basis and 7.5 {mu}mol g{sup -1} dry basis in the raw non-irradiated Macacar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macacar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  3. Intake of Mung Bean Protein Isolate Reduces Plasma Triglyceride Level in Rats

    Directory of Open Access Journals (Sweden)

    Nobuhiko Tachibana

    2013-09-01

    Full Text Available ABSTRACTBackground: Mung bean is well known as a starch source, but the physiological effects of mung bean protein have received little attention. In this study, we isolated mung bean protein from de-starched mung bean solutions, and investigated its influence on lipid metabolism. Objective: The aim of this study is to clarify the influence of the lipid metabolism by consumption of mung bean protein isolate (MPIMethods: Diets containing either mung bean protein isolate (MPI or casein were fed to normal rats for 28 days.Results: Both groups ate the same amount of food, but the plasma triglyceride level, relative liver weight and liver lipid contents (cholesterol and triglyceride pool in the MPI group were significantly lower than in the casein group. In the MPI group, the expression of sterol regulatory-element binding factor 1 (SREBF1 mRNA in the liver was significantly different when compared with the casein group. The significantly lower levels of insulin and free fatty acids in the MPI-fed rats may be due to the regulation of genes related to lipid metabolism in the liver.Conclusions: These results suggest that MPI may improve the plasma lipid profile by normalizing insulin sensitivity.Keywords: mung bean, Vigna radiata L., 8S globulin, triglyceride, β-conglycinin, 7S globulin, insulin sensitivity, SREBF1

  4. Effect of irradiation on anti-nutrients (total phenolics, tannins and phytate) in Brazilian beans

    Science.gov (United States)

    Villavicencio, Anna Lucia C. H.; Mancini-Filho, Jorge; Delincée, Henry; Greiner, Ralf

    2000-03-01

    The Brazilian bean varieties Phaseolus vulgaris L. var. Carioca and Vigna unguiculata (L.) Walp var. Macaçar were irradiated with doses of 0.5, 1.0, 2.5, 5.0 and 10 kGy and subsequently stored at ambient temperature for 6 months. The anti-nutrients phenolic compounds, tannins and phytate were determined to be 0.48 mg g -1 dry basis, 1.8 mg g -1 dry basis and 13.5 μmol g -1 dry basis in the raw non-irradiated Carioca beans and 0.30 mg g -1 dry basis, 0.42 mg g -1 dry basis and 7.5 μmol g -1 dry basis in the raw non-irradiated Macaçar beans. After soaking and cooking a higher content of phenolic compounds and a lower phytate content was observed in both bean varieties. Tannin content was not affected by soaking and cooking of Carioca beans, but higher after soaking and cooking of Macaçar beans. Using radiation doses relevant for food did not effect the content of the anti-nutrients under investigation in both bean varieties.

  5. Cotyledon thermal behavior and pectic solubility as related to cooking quality in common beans.

    Science.gov (United States)

    Bernal-Lugo, I; Parra, C; Portilla, M; Peña-Valdivia, C B; Moreno, E

    1997-01-01

    The characteristic of proteins, starch and pectic substances in cotyledons of two bean cultivars varying in cooking time were determined to investigate their possible contribution to bean cooking quality. Both cultivars showed the same enthalpies of starch gelatinization but different protein denaturation enthalpies. The proportion of hot water soluble pectins was higher in Michigan, the cultivar with the lower cooking time, than in Ojo de Cabra, the cultivar with the higher cooking time. These results were not due to differences in pectin methylation or in the ratio of monovalent to divalent cations in the tissue, suggesting that in fresh beans the beta-elimination reaction is not the sole or predominant route of thermal pectin degradation. Overall, this study indicates that varietal differences in bean cooking quality may be reflections of the rate of pectin loss during soaking/heating and that the thermal properties of starch and protein fractions seem to have a minor contribution. Researchers involved in this study propose that in fresh beans, the thermal pectin loss results from a two step mechanism: pectin enzymic breakdown during the bean soaking followed by thermal solubilization rather than beta-elimination during the bean heating.

  6. Molecular structure and physicochemical properties of potato and bean starches as affected by gamma-irradiation.

    Science.gov (United States)

    Chung, Hyun-Jung; Liu, Qiang

    2010-08-01

    In this study, potato and bean starches were treated by gamma-irradiation up to 50kGy. Molecular structure and physicochemical properties of irradiated potato and bean starches were investigated. Microscopic observation under scanning electron microscope (SEM) and polarized microscope showed that some of potato and bean starch granules were destroyed by gamma-irradiation and the breakage was much greater at a higher dose (50 kGy). Carboxyl content and amylose leaching increased, whereas the swelling factor and apparent amylose content decreased after irradiation in both potato and bean starches. The proportions of short (DP 6-12) and long (DP > or = 37) amylopectin chains as well as average chain length increased with increasing irradiation dose. However, the proportion of DP 13-24 decreased by irradiation. The relative crystallinity, the degree of granule surface order, and gelatinization enthalpy decreased with an increase in irradiation dose. The extent of decrease in potato starch was greater than that in bean starch. The exothermic peak around 90-110 degrees C was observed in DSC thermogram when the potato starch was irradiated at 50 kGy. The pasting viscosity significantly decreased with an increase in irradiation dose. The proportion of slowly digestible starch (SDS) decreased and resistant starch (RS) content increased by irradiation in both potato and bean starches. However, the rapidly digestible starch (RDS) of potato starch increased with increasing irradiation dose, whereas the bean starch showed the opposite trend to potato starch in RDS content.

  7. Effect of edible coating on the aromatic attributes of roasted coffee beans.

    Science.gov (United States)

    Rattan, Supriya; Parande, A K; Ramalakshmi, K; Nagaraju, V D

    2015-09-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was made to minimise the loss of volatile from roasted coffee beans by coating with Carboxymethyl cellulose (CMC), Hydroxypropylmethyl cellulose (HPMC) and Whey protein concentrate. Coffee volatiles were analysed by Gas chromatography and 14 major compounds were identified and compared in this study. Results showed an increase in the relative area of major volatile compounds in coated roasted coffee beans when compared with unroasted coffee beans for consecutive two months. Moreover, effect of coating on textural properties and non-volatiles were also analysed. The results have indicated that edible coatings preserve the sensory properties of roasted coffee beans for a longer shelf life and cellulose derivatives, as an edible coating, exhibited the best protecting effect on roasted coffee beans.

  8. Relative planting times on the production components in sesame/cowpea bean intercropping in organic system

    Directory of Open Access Journals (Sweden)

    Afrânio César de Araújo

    2013-12-01

    Full Text Available Aiming at better land use, small farmers usually plant sesame and cowpea bean intercropped with other crops. The aim of this work was to analyze and quantify the influence of four relative planting times of the cowpea bean in intercropping with sesame from the standpoint of their production components, plant productivity and the index of land equivalent ratio (LER. The field experiment was conducted in a randomized blocks with four treatments and four replicates. The treatments were the sesame and the cowpea bean in intercropping with the cowpea bean planted at the same time, 7, 14 and 21days after than the sesame. A greater part of the production components of both the sesame as well the cowpea bean was affected by the intercropping and significant differences were noted among the treatments in a larger part of the parameters. As the planting of the cowpea bean became more distant from that of the sesame, the yield of the Pedaliaceae increased and the yield of the Fabaceae decreased. The results for LER findings on the other hand suggest that in the sesame/cowpea bean intercropping, when the Fabaceae is planted seven days after the sesame, there is better use of the land and a largest possibility to the producer earning a profit.

  9. The effects of nitrogen form on root morphological and physiological adaptations of maize, white lupin and faba bean under phosphorus deficiency

    Science.gov (United States)

    Liu, Haitao; Tang, Caixian; Li, Chunjian

    2016-01-01

    Root morphological/physiological modifications are important for phosphorus (P) acquisition of plants under P deficiency, but strategies differ among plant species. Detailed studies on the response of maize roots to P deficiency are limited. Nitrogen (N) form influences root morphology/physiology, and thus may influence root responses to P deficiency. This work investigated adaptive mechanisms of maize roots to low P by comparison with white lupin and faba bean supplied with two N forms. Plants were grown for 7–16 days in hydroponics with sufficient (250 µmol L−1) and deficient P supply (1 µmol L−1) under supply of NH4NO3 or Ca(NO3)2. Plant growth and P uptake were measured, and release of protons and organic acid anions, and acid phosphatase activity in the root were monitored. The results showed that P deficiency significantly decreased shoot growth while increased root growth and total root length of maize and faba bean, but not white lupin. It enhanced the release of protons and organic acid anions, and acid phosphatase activity, from the roots of both legumes but not maize. Compared with Ca(NO3)2, NH4NO3 dramatically increased proton release by roots but did not alter root morphology or physiology of the three species in response to low P. It is concluded that the N form did not fundamentally change root morphological/physiological responses of the three species to P deficiency. Morphological variation in maize and morpho-physiological modifications in white lupin and faba bean were the main adaptive strategies to P deficiency. PMID:27519912

  10. Ghanaian cocoa bean fermentation characterized by spectroscopic and chromatographic methods and chemometrics.

    Science.gov (United States)

    Aculey, Patrick C; Snitkjaer, Pia; Owusu, Margaret; Bassompiere, Marc; Takrama, Jemmy; Nørgaard, Lars; Petersen, Mikael A; Nielsen, Dennis S

    2010-08-01

    Export of cocoa beans is of great economic importance in Ghana and several other tropical countries. Raw cocoa has an astringent, unpleasant taste, and flavor, and has to be fermented, dried, and roasted to obtain the characteristic cocoa flavor and taste. In an attempt to obtain a deeper understanding of the changes in the cocoa beans during fermentation and investigate the possibility of future development of objective methods for assessing the degree of fermentation, a novel combination of methods including cut test, colorimetry, fluorescence spectroscopy, NIR spectroscopy, and GC-MS evaluated by chemometric methods was used to examine cocoa beans sampled at different durations of fermentation and samples representing fully fermented and dried beans from all cocoa growing regions of Ghana. Using colorimetry it was found that samples moved towards higher a* and b* values as fermentation progressed. Furthermore, the degree of fermentation could, in general, be well described by the spectroscopic methods used. In addition, it was possible to link analysis of volatile compounds with predictions of fermentation time. Fermented and dried cocoa beans from the Volta and the Western regions clustered separately in the score plots based on colorimetric, fluorescence, NIR, and GC-MS indicating regional differences in the composition of Ghanaian cocoa beans. The study demonstrates the potential of colorimetry and spectroscopic methods as valuable tools for determining the fermentation degree of cocoa beans. Using GC-MS it was possible to demonstrate the formation of several important aroma compounds such 2-phenylethyl acetate, propionic acid, and acetoin and the breakdown of others like diacetyl during fermentation. Practical Application: The present study demonstrates the potential of using colorimetry and spectroscopic methods as objective methods for determining cocoa bean quality along the processing chain. Development of objective methods for determining cocoa bean

  11. Investigation of optimum roasting conditions to obtain possible health benefit supplement, antioxidants from coffee beans.

    Science.gov (United States)

    Sulaiman, Shaida Fariza; Moon, Joon-Kwan; Shibamoto, Takayuki

    2011-09-01

    In order to investigate the role of roasting conditions in antioxidant formation, methanol and hot water extracts from Robusta coffee beans roasted for various lengths of time and at various temperatures were analyzed for total phenolic acid, chlorogenic acid, and caffeine content, as well as for their antioxidant activities using 1,1-diphenyl-2-picryhydrazyl (DPPH), thiobarbituric acid (TBA), and malonaldehyde/gas chromatography (MA/GC) assays. The amount of total phenolics in methanol extracts decreased linearly over the roasting temperature from 63.51 ± 0.77 mg chlorogenic acid equivalent (CAE)/g coffee beans (roasted at 200°C) to 42.56 ± 0.33 mg CAE/g coffee beans (roasted at 240°C). The total chlorogenic acid content decreased when the roasting time was increased from 78.33 ± 1.41 mg/g (green coffee beans) to 4.31 ± 0.23 mg/g (roasted for 16 min at 250°C). All methanol extracts from roasted coffee beans possessed over 90% antioxidant activities in the DPPH assay. The antioxidant activity of methanol extracts ranged from 41.38 ± 1.77% (roasted at 250°C for 10 min) to 98.20 ± 1.49% (roasted at 230°C for 16 min) as tested by the TBA assay. The antioxidant activity of methanol extracts of green coffee beans and roasted coffee beans ranged from 93.01% (green coffee beans) to 98.62 ± 1.32% (roasted at 250°C for 14 min) in the MA/GC assays. All hot water extracts exhibited moderate pro-oxidant activities in TBA and MA/GC assays. The results indicated that roasting conditions of coffee beans play an important role in the formation of antioxidants in brewed coffee, which can be dietary supplements having beneficial effect to human health.

  12. Principal Component Analysis of Chlorophyll Content in Tobacco, Bean and Petunia Plants Exposed to Different Tropospheric Ozone Concentrations

    Directory of Open Access Journals (Sweden)

    Borowiak Klaudia

    2014-06-01

    Full Text Available Three plant species were assessed in this study - ozone-sensitive and -resistant tobacco, ozone-sensitive petunia and bean. Plants were exposed to ambient air conditions for several weeks in two sites differing in tropospheric ozone concentrations in the growing season of 2009. Every week chlorophyll contents were analysed. Cumulative ozone effects on the chlorophyll content in relation to other meteorological parameters were evaluated using principal component analysis, while the relation between certain days of measurements of the plants were analysed using multivariate analysis of variance. Results revealed variability between plant species response. However, some similarities were noted. Positive relations of all chlorophyll forms to cumulative ozone concentration (AOT 40 were found for all the plant species that were examined. The chlorophyll b/a ratio revealed an opposite position to ozone concentration only in the ozone-resistant tobacco cultivar. In all the plant species the highest average chlorophyll content was noted after the 7th day of the experiment. Afterwards, the plants usually revealed various responses. Ozone-sensitive tobacco revealed decrease of chlorophyll content, and after few weeks of decline again an increase was observed. Probably, due to the accommodation for the stress factor. While during first three weeks relatively high levels of chlorophyll contents were noted in ozone-resistant tobacco. Petunia revealed a slow decrease of chlorophyll content and the lowest values at the end of the experiment. A comparison between the plant species revealed the highest level of chlorophyll contents in ozone-resistant tobacco.

  13. Isolation and Characterization of 13 New Polymorphic Microsatellite Markers in the Phaseolus vulgaris L. (Common Bean Genome

    Directory of Open Access Journals (Sweden)

    Aihua Wang

    2012-09-01

    Full Text Available In this study, 13 polymorphic microsatellite markers were isolated from the Phaseolus vulgaris L. (common bean by using the Fast Isolation by AFLP of Sequence COntaining Repeats (FIASCO protocol. These markers revealed two to seven alleles, with an average of 3.64 alleles per locus. The polymorphic information content (PIC values ranged from 0.055 to 0.721 over 13 loci, with a mean value of 0.492, and 7 loci having PIC greater than 0.5. The expected heterozygosity (HE and observed heterozygosity (HO levels ranged from 0.057 to 0.814 and from 0.026 to 0.531, respectively. Cross-species amplification of the 13 prime pairs was performed in its related specie of Vigna unguiculata L. Seven out of all these markers showed cross-species transferability. These markers will be useful for future genetic diversity and population genetics studies for this agricultural specie and its related species.

  14. In vitro starch digestibility and predicted glycemic index of corn tortilla, black beans, and tortilla-bean mixture: effect of cold storage.

    Science.gov (United States)

    Sáyago-Ayerdi, S G; Tovar, Juscelino; Osorio-Díaz, P; Paredes-López, Octavio; Bello-Pérez, Luis A

    2005-02-23

    People in the rural areas of Mexico consume corn tortillas and beans as basic components of their diet. However, little is known about the nutritionally relevant features of starch present in such combined meals. The objective of the present study was to evaluate the in vitro bioavailability of starch in tortilla-bean mixtures stored at 4 degrees C for different times, as compared to that of corn tortilla and boiled black beans kept separately under the same conditions. Available starch (AS), resistant starch (RS), and retrograded resistant starch (RRS) contents were measured. The in vitro starch hydrolysis indices (HI) of freshly cooked and cold-stored samples were evaluated using a chewing/dialysis digestion protocol. HIs were used to predict glycemic indices (pGI) of the samples. AS in tortilla and beans decreased between 3 and 6% after 48-72 h, whereas values in the mixture fell by 3% after 48 h, with no further change by 72 h. Only minor rises in RS contents (1.5-1.6%) were recorded for tortilla and beans after 72 h of storage, and a lower increase (0.4%) was recorded in the mixture. Judging from RRS values, an important proportion of RS is due to starch retrogradation. The HI and pGI were higher in tortilla than in bean and the mixture. Hydrolysis rate values decreased in the stored samples, a pattern that corresponded with RS and RRS changes. The slow digestion features of common beans are largely retained by the legume-tortilla combination. Data support the perceived health beneficial properties of starch in this traditional cereal-legume food.

  15. Effects of sulphur dioxide on southern bean mosaic and maize dwarf mosaic

    Energy Technology Data Exchange (ETDEWEB)

    Laurence, J.A.; Aluisio, A.L.; Weinstein, L.H.; McCune, D.C.

    1981-01-01

    Sub-acute doses of sulphur dioxide (SO/sub 2/) (either 262 or 524 ..mu..g m/sup -3/) for 5-10 days caused small but consistent increases in the titre of southern bean mosaic virus (SBMV) in Bountiful bean and maize dwarf mosaic virus (MDMV) in maize. Exposure to SO/sub 2/ also increased infection and intensified symptoms caused by MDMV. Sulphur uptake by the host plant was not affected by either virus; however, pre- and post-inoculation exposures of bean plants to SO/sub 2/ resulted in greater than additive effects on sulphur uptake.

  16. Palm olein oil produces less lipid peroxidation products than soya bean oil.

    Science.gov (United States)

    Zaiton, Z; Merican, Z; Khalid, B A; Mohamed, J B; Baharom, S

    1997-06-01

    The soleus muscles of hyperthyroid rats were used to investigate the effect of palm olein oil and soya bean oil on the production of lipid peroxidation products. It was found that palm olein oil but not soya bean oil significantly decreased malonaldehyde and conjugated diene levels of the soleus muscles of hyperthyroid rats. These findings suggest that palm olein per se produces less lipid peroxidation products than soya bean oil. Such an assay method gives a composite net picture of the propensity of an oil to produce lipid peroxidation products.

  17. Cooking quality and starch digestibility of gluten free pasta using new bean flour.

    Science.gov (United States)

    Giuberti, Gianluca; Gallo, Antonio; Cerioli, Carla; Fortunati, Paola; Masoero, Francesco

    2015-05-15

    The use of rice/leguminous blend may be nutritionally convenient in gluten free product manufacturing. Gluten free spaghetti was prepared with rice flour and different concentrations of bean flour (included at levels of 0%, 20% and 40%, w/w) derived from a new developed white-seeded low phytic acid and lectin free (ws+lpa+lf) bean cultivar. Protein, ash and dietary fibre contents increased linearly (Presistant starch content, while decreasing quadratically (Pglycemic index. The partial replacement of rice flour with bean flour can favourably be used in gluten free spaghetti formulation.

  18. NOTE-Management system of an active genebank of common bean

    Directory of Open Access Journals (Sweden)

    Marlon Mathias Dacal Coan

    2010-01-01

    Full Text Available Genetic resources are conserved ex situ in genebanks, which are used as a source of useful alleles. Theinformation generated by the Active Common Bean Genebank (ACBG is stored in a Database Management system whichensures a quick and safe data recovery. Using Microsoft Access, a database system was developed to store and search basesof accession combinations or directly among morphological, physiological and yield descriptors of common bean. The systemcalled Common Bean Genebank (CBGB provides a graphical interface for the operation in the database, facilitating andoptimizing the search time in germplasm catalogues.

  19. Locust bean gum: processing, properties and food applications--a review.

    Science.gov (United States)

    Barak, Sheweta; Mudgil, Deepak

    2014-05-01

    Locust bean gum or carob gum is a galactomannan obtained from seed endosperm of carob tree i.e. Ceratonia siliqua. It is widely utilized as an additive in various industries such as food, pharmaceuticals, paper, textile, oil well drilling and cosmetics. Industrial applications of locust bean gum are due to its ability to form hydrogen bonding with water molecule. It is also beneficial in the control of many health problems like diabetes, bowel movements, heart disease and colon cancer due to its dietary fiber action. This article focuses on production, processing, composition, properties, food applications and health benefits of locust bean gum.

  20. MONTHLY PRICE ANALYSIS OF COWPEA (BEANS AND MAIZE IN AKWA IBOM STATE, SOUTHERN NIGERIA

    Directory of Open Access Journals (Sweden)

    Sunday Brownson Akpan

    2014-04-01

    Full Text Available The study examined the price transmission and market integration of Maize and Beans in the rural and urban markets of Akwa Ibom State, Nigeria. Average monthly prices (measured in naira per kilogram of Maize and Cowpea in rural and urban markets were used in the analysis. The data was obtained from the quarterly publications of the Akwa Ibom State Agricultural Development Programme (AKADEP. The data covered the period; January 2005 to June 2013. The trend analysis showed that, prices of Maize and Beans in the rural and urban markets had exponential growth rates that were less than unity, which suggested a possible co-movement of these prices in the study area. Also, the Pearson correlation coefficient generated for the pair of rural and urban prices of Maize and Beans revealed significant linear symmetric relationships. The result implies the existence of symmetric market information flows between the rural and urban markets for Maize and Beans in the state. The Granger causality test revealed bi-directional relationships between the rural and urban price of Maize and Beans in the study area. The co-integration test revealed the presence of co-integration between the rural and urban prices of Maize and Beans. The coefficients of the price variables in the co-integration equations for Maize and Beans markets converged to unity or law of one price which implied perfect market integration in the long run. The results of the error correction model (ECM also confirm the existence of the short run market integration between the rural and urban prices of Maize and Beans in the study area. In addition, it was discovered that, the rural price of Maize adjusted faster to the stable state in the long run than the urban price. Likewise, the urban price of Beans adjusted faster than its corresponding rural price. The index of market connection (IMC supported the high short run market integration for prices of Maize and Beans in rural and urban markets. Based

  1. Changes in differently processed soya bean (Glycine max.) and lima bean (Phaseolus lunatus) with particular reference to their chemical composition and their mineral and some inherent anti-nutritional constituents.

    Science.gov (United States)

    Aletor, V A; Ojo, O I

    1989-01-01

    The effects of 3 processing techniques: cooking, roasting and autoclaving on the proximate chemical composition, the mineral content and some inherent toxic factors of soya and lima beans were investigated. The processing techniques generally reduced the crude fibre levels and enhanced the extractable fat in the soya and lima beans. The coefficients of variability for crude fibre and ether extract due to the processing techniques of soya and lima beans were 20.9%, 16.0% and 22.3%, 38.1%, respectively. In parallel with decreased ash content in the cooked bean samples, there was a decrease in the K, Mg, Na and P levels relative to the raw bean and also relative to the other processing techniques. Mineral contents of the autoclaved bean samples were generally similar to those of the raw (unprocessed) samples. Under the processing conditions, roasting caused the highest reduction in thioglucoside content (59%) in soya bean while cooking caused the highest reduction in lima bean (78%). Trypsin inhibitor activity (TIA) ranged between 0.59 mg/g sample in the cooked soya bean and 11.6 mg/g sample in the raw bean while the corresponding values for lima bean ranged between 0.59 and 6.3 mg/g sample. Cooking and roasting caused over 90% reduction of TIA, while autoclaving caused 64-69% reduction in both bean samples. Under the assay conditions, haemagglutinating activity was not detected in the cooked and autoclaved soya and lima beans. The need to prevent both functional and nutritional damage to food proteins and other nutrients, resulting from excessive heating, was discussed.

  2. Natural selection and family X location interaction in the common (dry bean plant

    Directory of Open Access Journals (Sweden)

    Luís Henrique Pirola

    2002-01-01

    Full Text Available Natural selection takes place while advancing generations of segregant populations of self pollinating species by the population (bulk method. There is evidence that it maintains the individuals with greater grain yield. The question arises whether natural selection preserves the individuals which are more adapted only to the environment where the generation advance occurred, that is, if it contributes to increasing the genotype x environment interaction in the family assessment. This study was carried out to check this hypothesis in the common bean plant using families derived from a segregating population from a cross between the Carioca MG x ESAL 686 cultivars. The segregating populations increase in homozygosity was obtained by the population (bulk method until the F14 generation, in three distinct locations in Minas Gerais state: Lavras, Lambari and Patos de Minas. Forty-seven F14:15 families were randomly taken from the population in each location and later multiplied to obtain F14:16 families. These families were jointly assessed with three controls using a triple 12 x 12 lattice design in the three locations of generation advance in the wet season of 1998/1999. All the estimated parameters showed that while advancing segregant populations by the population (bulk method, natural selection acted to preserve the individuals which are more adapted to the environment in which they were advanced.

  3. Proteinases involved in the degradation of trypsin inhibitor in germinating mung beans.

    Science.gov (United States)

    Wilson, K A; Tan-Wilson, A L

    1983-01-01

    The mung bean (Vigna radiata (L.) Wilczek) trypsin inhibitor (MBTI) is rapidly modified by limited proteolysis during the early stages of seedling growth. Using an electrophoretic assay that separates the unmodified inhibitor (MBTI-F) and the first two modified species (MBTI-E and -C), a pH optimum of approximately 4 was found for the modification reaction. The inhibitor modifying activity is initially low in ungerminated seeds, with the reaction F leads to E being the primary reaction catalyzed. Activity catalyzing the production of MBTI-C appears on the first day of germination. This activity (F leads to E leads to C) increases up to 6 days after inhibition, at which time the cotyledons begin to abscise. The activity converting MBTI-F and -E to MBTI-C was strongly inhibited by phenylmethylsulfonyl fluoride (3.3 mM) but only weakly by iodoacetate (9 mM) and not at all by pepstatin A (9 microM), leupeptin (18 microM), or EDTA (5 mM). These results suggest the involvement of proteinases other than the major endopeptidase of the germinating seed, vicilin peptidohydrolase. This conclusion is further supported by gel filtration of the extracts of cotyledons on Sephacryl S-200. At least three proteinases are present in germinated cotyledons capable of modifying MBTI-F to MBTI-C and/or -E. All are distinguishable from vicilin peptidohydrolase on the basis of their molecular weight and inhibition by low molecular weight organic reagents.

  4. Short-Term Local Adaptation of Historical Common Bean (Phaseolus vulgaris L. Varieties and Implications for In Situ Management of Bean Diversity

    Directory of Open Access Journals (Sweden)

    Stephanie M. Klaedtke

    2017-02-01

    Full Text Available Recognizing both the stakes of traditional European common bean diversity and the role farmers’ and gardeners’ networks play in maintaining this diversity, the present study examines the role that local adaptation plays for the management of common bean diversity in situ. To the purpose, four historical bean varieties and one modern control were multiplied on two organic farms for three growing seasons. The fifteen resulting populations, the initial ones and two populations of each variety obtained after the three years of multiplication, were then grown in a common garden. Twenty-two Simple Sequence Repeat (SSR markers and 13 phenotypic traits were assessed. In total, 68.2% of tested markers were polymorphic and a total of 66 different alleles were identified. FST analysis showed that the genetic composition of two varieties multiplied in different environments changed. At the phenotypic level, differences were observed in flowering date and leaf length. Results indicate that three years of multiplication suffice for local adaptation to occur. The spatial dynamics of genetic and phenotypic bean diversity imply that the maintenance of diversity should be considered at the scale of the network, rather than individual farms and gardens. The microevolution of bean populations within networks of gardens and farms emerges as a research perspective.

  5. Review: The Potential of the Common Bean (Phaseolus vulgaris as a Vehicle for Iron Biofortification

    Directory of Open Access Journals (Sweden)

    Nicolai Petry

    2015-02-01

    Full Text Available Common beans are a staple food and the major source of iron for populations in Eastern Africa and Latin America. Bean iron concentration is high and can be further increased by biofortification. A major constraint to bean iron biofortification is low iron absorption, attributed to inhibitory compounds such as phytic acid (PA and polyphenol(s (PP. We have evaluated the usefulness of the common bean as a vehicle for iron biofortification. High iron concentrations and wide genetic variability have enabled plant breeders to develop high iron bean varieties (up to 10 mg/100 g. PA concentrations in beans are high and tend to increase with iron biofortification. Short-term human isotope studies indicate that iron absorption from beans is low, PA is the major inhibitor, and bean PP play a minor role. Multiple composite meal studies indicate that decreasing the PA level in the biofortified varieties substantially increases iron absorption. Fractional iron absorption from composite meals was 4%–7% in iron deficient women; thus the consumption of 100 g biofortified beans/day would provide about 30%–50% of their daily iron requirement. Beans are a good vehicle for iron biofortification, and regular high consumption would be expected to help combat iron deficiency (ID.

  6. Effect of several strains of rizobium in soybean and dry bean Efecto de varios inoculos de leguminosas sobre soya y fríjol

    Directory of Open Access Journals (Sweden)

    Prieto Hennio

    1990-12-01

    Full Text Available A study was carried out of the Instituto Colombiano Agropecuario-ICA of Palmira between the second semester of 1987 and second of 1989 with the objetive to see of nodulation form and the response of soybean and beans to seven strains of Rizobium of soybean, beans, mungobean, caupí, peanuts, crotalaria and Desmodium. All of especies nodulated after 15 days of emergence also, the nodules lasted in all of especies up to 60 days after emergence except in beans which deteriorated nodules were evident after flowering. The position of nodules were in the main root and secundaries except for beans that only presented nodules in secundary roots; besides, all species presented global shapes nodules except for Crotalaria which showed oval, astragal and baton shape. The size was small in all especies, however, soybean presented big nodules so as 5 mm of diameter. The soybean nodulated specifically with its strain; however, beans presented effective nodulation with other strains suggesting gesting a wide types strains for this legume and permitting more studies about it.El estudio se realizó en el Instituto Colombiano Agropecuario-ICA en Palmira, durante los semestres 87B y 89B. Todas las especies nodularon a partir de los primeros 15 días después de emergencia, exceptuando Cassia tora. El resto de materiales presentaron nódulos efectivos. La posición de los nódulos fue en toda la raíz menos en las variedades de fríjol que sólo los presentaron en las raíces secundarias. La forma fue globosa excepto en Crotalaria (ovales, astragaloides yen forma de bastón y el tamaño fue pequeño (hasta 2.5 mm de diámetro excepto en soya (5 mm. En otro ensayo se probaron en soya y fríjol las cepas aisladas de Rizobios de soya, frijol, maní, frijolillo, Desmodium, Crotalaria y mungo. La soya únicamente noduló con su cepa especifica, mientras que el fríjol hizo con todas las cepas, por lo cual se recomienda que se hagan evaluaciones de fijación de nitr

  7. Isolation and characterization of a proteinase inhibitor from marama beans.

    Science.gov (United States)

    Elfant, M; Bryant, L; Starcher, B

    1985-11-01

    A protease inhibitor was purified from the African marama bean (Tylosema esculenturm). The inhibitor is present in large amounts, representing about 10.5% of the total protein. The molecular weight is slightly larger than soybean trypsin inhibitor and was estimated at 23,000 by SDS-gel electrophoresis or 24,500 by amino acid analysis. The amino acid composition was atypical of most other plant inhibitors with a cysteine content of only one or possibly two residues/mole and a blocked amino terminus. Inhibition studies indicated virtually no inhibition of chymotrypsin activity. Elastase, however, was inhibited to the same extent as trypsin, requiring about 2 moles of inhibitor for complete inhibition of the enzyme.

  8. Copper excess impairs mobilization of storage proteins in bean cotyledons.

    Science.gov (United States)

    Karmous, Inès; El Ferjani, Ezzedine; Chaoui, Abdelilah

    2011-12-01

    Germination represents a limiting stage of plant life cycle. One of the underlying metabolic activities following imbibition of seed is the reserve mobilization. Seeds of bean (Phaseolus vulgaris L. var. soisson nain hatif) were germinated by soaking in distilled water or 200 μM CuCl(2). Storage proteins breakdown and amino acids freeing from reserve tissues were investigated. Compared to the control, Cu caused a reduction in germination rate, embryo growth, and in mobilization of cotyledonary biomass. The failure in albumin and globulin hydrolysis after the exposure to the pollutant was argued by (1) higher contents of remaining proteins than control ones, (2) persistence of some polypeptide bands resolved by polyacrylamide gel electrophoresis of albumin and globulin-rich fractions, and (3) decrease in the availability of amino acids. Nitrogen starvation in embryonic axis should be associated with the Cu-imposed delay in growth.

  9. Moisture sorption isotherms of castor beans. Part 2: Thermodynamic properties

    Directory of Open Access Journals (Sweden)

    André L. D. Goneli

    Full Text Available ABSTRACT Knowledge on the water sorption within agricultural products is extremely important for decision making during post-harvest procedures. In order to improve this knowledge, thermodynamic properties regarding water sorption provide useful data. Thermodynamic properties of castor beans, related to sorption, were determined. Static gravimetric technique under different conditions of temperature (25, 35, 45 and 55 ± 1 °C was used. Saturated salt solutions in the range of 37-87% ± 2% were utilized to create the required controlled humidity environment. After the sorption procedure, differential enthalpy, differential entropy and Gibbs free energy of this process were calculated and decreased with increased values of equilibrium moisture content.

  10. ARTICLE - Inbreeding depression in castor bean (Ricinus communis L. progenies

    Directory of Open Access Journals (Sweden)

    Milton Krieger

    2012-12-01

    Full Text Available The purpose of this study was to investigate inbreeding depression (DE in castor bean. From a population derived from the Guarani cultivar, 60 mother plants were sampled. Three types of progenies were obtained from each one: from self-pollination (AU, from crosses (CR and from open pollination (PL. Grain yield of the progenies was evaluated in two locations. There was a strong interaction of progenies x locations, which led to obtaining estimates within each location. Broad variation was observed in inbreeding depression, with mean values of 6.7% and 13.4%, comparing AU progenies with PL progenies. It was observed that the population has high potential for selecting promising inbred lines. The frequency of mother plants generating progenies with simultaneous high general combination capacity and low inbreeding depression was low. Recurrent selection will increase the occurrence of parent plants associating these two properties, which is necessary for obtaining superior synthetic varieties.

  11. Confirmation of bean leaf beetle, Cerotoma trifurcata, feeding on cucurbits

    Directory of Open Access Journals (Sweden)

    R.L. Koch

    2004-02-01

    Full Text Available The objective of these studies was to assess the degree to which bean leaf beetle, Cerotoma trifurcata (Forster, will feed on cucurbits. In 2003, we documented an infestation of C. trifurcata in a commercial pumpkin field near Rosemount, MN, USA. To evaluate C. trifurcata feeding on cucurbits, we conducted laboratory no-choice and choice test feeding studies. In the laboratory, C. trifurcata fed most heavily on cotyledon-stage cucumber plants, followed by pumpkin and squash. With soybean plants present, C. trifurcata still fed on cucumber plants. However, C. trifurcata appeared to prefer soybeans until the quality of the soybean plants was diminished through feeding damage. This is the first known report of C. trifurcata feeding on cucurbits. The pest potential of C. trifurcata in cucurbit cropping systems should be further evaluated.

  12. BEAN PRODUCERS’ PERSPECTIVES OF DEVELOPMENT IN SOMBRERETE, ZACATECAS

    Directory of Open Access Journals (Sweden)

    Octaviano Ceceñas-Jacquez

    2015-07-01

    Full Text Available In this investigation production strategies, marketing, food security and development possibilities for bean producers in the municipality of Sombrerete, Zacatecas are identified. The study is approached from the perspective of the theory of rural territorial development, and surveys producers were conducted. It is concluded that the region is moving smallholdings and decrease in family income, so that agriculture becomes increasingly a subsistence activity where diversification becomes more important. Productive transformation has its limitations due to factors such as the arid climate, the largest division of the land, the high cost of credit, low level of technology and knowledge producers. Additionally, much of small producers is outside the new models of organization and government support, so cannot be considered solved the institutional framework to promote equitable development of producers.

  13. Role of xyloglucan in gravitropic bending of azuki bean epicotyl.

    Science.gov (United States)

    Ikushima, Toshimitsu; Soga, Kouichi; Hoson, Takayuki; Shimmen, Teruo

    2008-04-01

    The mechanism of the gravitropic bending was studied in azuki bean epicotyls. The cell wall extensibility of the lower side became higher than that of the upper side in the epicotyl bending upward. The contents of matrix polysaccharides of the cell wall (pectin and xyloglucan in hemicellulose-II) in the lower side became smaller than those in the upper side. The molecular mass of xyloglucans in the lower side decreased. After an epicotyl was fixed to a metal rod to prevent the bending, gravistimulation was applied. Fundamentally the same results were obtained with respect to rheological and chemical characteristics of the cell wall as those of epicotyls showing gravitropic bending. The present results suggested that the initial gravitropic bending was caused by the increase in extensibility of the lower side and the decrease in extensibility of the upper side via the change of the cell wall matrix, especially xyloglucans.

  14. The Sequence Variations of Intron-3 of the α-Amylase Gene in Adzuki Bean

    Institute of Scientific and Technical Information of China (English)

    JIN Wen-lin; Yamaguchi Hirofumi; Isigami Matiko; Yasuda Kentaro

    2003-01-01

    This study describes variation of intron-3 of a-amylase gene from 156 breeds of adzuki beansusing SSCP(single-strand conformation polymorphism)analysis. Based on a-amylase gene structure and se-quence, A pair of PCR primers, F (CCTACATTCTAACACACCCT) and R (GCATATTGTGCCAGTACAAT)were designed to amplify intron-3 fragments of a-amylase gene. 14 variant types were detected, including 13,9, 10, 4 variant types in the wild, weed, locally cultivated and modern brought-up adzuki beans respectively,9, 8, 7 variant types of the wild adzuki beans from Japan, China and Korea respectively, and some other va-riant types in the local adzuki beans from China and Bhutan. 60 % of subjects of cultivated races were found tobe EE type in the experiment. In addition, sequence analysis of intron-3 of α-amylase gene from 8 varianttypes reveals the evolution process of various variant types in adzuki beans.

  15. Research on Development Strategy of Industry of Edible Beans in West China

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The West China is main producing region and advantageous producing region of edible beans. Developing industry of edible beans in West China has prominent regional advantage, production advantage, quality advantage, market advantage, and price advantage. We analyze the problems existing in the process of development of industry of edible beans in West China as follows: the cognition is insufficient; fund for scientific research is short; the basic research is weak; the planting is sparse; the industrialization is not sound; the information is restricted. Corresponding suggestions are put forward in this paper as follows, in order to ensure the healthy development of industry of edible beans in China: formulate preferential policies; establish high-quality edible producing bases; promote the brand effect; pay attention to post-production development; develop the idea of new agricultural planting and cultivation.

  16. 豆渣调味酱的研制%Study on Bean Dregs Tartare Sauce

    Institute of Scientific and Technical Information of China (English)

    何欢; 黄宇; 黄莉萍; 林琳

    2009-01-01

    利用豆渣为主要原料,加入白砂糖、食盐、豆油、豆酱、酱油、白酒、味精、食品添加荆等辅料,开发出风味较好、酱香味浓郁的豆渣调味酱.研究了去除豆渣油腻味最佳的方法,通过正交试验确定了豆渣调味酱的最佳配方.%Bean dregs tartare sauce regard fresh bean dregs as main raw materials,adding such batching as sugar,sah,oil,sauce,soy sauce,liquor,MSG,food additives,etc.,to make delicious food.This experiment studied the best way of Ilemoving the bean dregs'greasy taste,and determined the best formula of bean dregs tartare sauce through orthogonal test.

  17. [Comparison of green coffee beans volatiles chemical composition of Hainan main area].

    Science.gov (United States)

    Hu, Rong-Suo; Chu, Zhong; Gu, Feng-Lin; Lu, Min-Quan; Lu, Shao-Fang; Wu, Gui-Ping; Tan, Le-He

    2013-02-01

    Chemical component of Hainan green coffee beans was analyzed with solid phase microextraction-gas chromatography-mass spectrometry, and the discrepancy between two green coffee beans was differentiated through the spectrum database retrieval and retention index of compound characterization. The experimental results show that: the chemical composition of Wanning coffee beans and Chengmai coffee beans is basically the same. The quantity of analyzed compound in Wanning area coffee is 91, and in Chengmai area coffee is 106, the quantity of the same compound is 66, and the percent of the same component is 75.52%. The same compounds accounted for 89.86% of the total content of Wanning area coffee, and accounted for 85.70% of the total content of Chengmai area coffee.

  18. The effect of bean origin and temperature on grinding roasted coffee

    Science.gov (United States)

    Uman, Erol; Colonna-Dashwood, Maxwell; Colonna-Dashwood, Lesley; Perger, Matthew; Klatt, Christian; Leighton, Stephen; Miller, Brian; Butler, Keith T.; Melot, Brent C.; Speirs, Rory W.; Hendon, Christopher H.

    2016-04-01

    Coffee is prepared by the extraction of a complex array of organic molecules from the roasted bean, which has been ground into fine particulates. The extraction depends on temperature, water chemistry and also the accessible surface area of the coffee. Here we investigate whether variations in the production processes of single origin coffee beans affects the particle size distribution upon grinding. We find that the particle size distribution is independent of the bean origin and processing method. Furthermore, we elucidate the influence of bean temperature on particle size distribution, concluding that grinding cold results in a narrower particle size distribution, and reduced mean particle size. We anticipate these results will influence the production of coffee industrially, as well as contribute to how we store and use coffee daily.

  19. Proposal: Conservation of Price's Potato Bean on Sauta Cave National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Proposal is to conduct monitoring response of Price's potato bean to overstory tree removal and understory grass control at Sauta Cave NWR.

  20. Draft genome sequence of the ricin-producing oilseed castor bean

    Science.gov (United States)

    Chan, Agnes P.; Crabtree, Jonathan; Zhao, Qi; Lorenzi, Hernan; Orvis, Joshua; Puiu, Daniela; Melake-Berhan, Admasu; Jones, Kristine M.; Redman, Julia; Chen, Grace; Cahoon, Edgar B.; Gedil, Melaku; Stanke, Mario; Haas, Brian J.; Wortman, Jennifer R.; Fraser-Liggett, Claire M.; Ravel, Jacques; Rabinowicz, Pablo D.

    2010-01-01

    Castor bean (Ricinus communis) is an oil crop that belongs to the spurge (Euphorbiaceae) family. Its seeds are the source of castor oil, used for the production of high-quality lubricants due to its high proportion of the unusual fatty acid ricinoleic acid. Castor bean seeds also produce ricin, a highly toxic ribosome inactivating protein, making castor bean relevant for biosafety. We report here the 4.6X draft genome sequence of castor bean, representing the first reported Euphorbiaceae genome sequence. Our analysis shows that most key castor oil metabolism genes are single-copy while the ricin gene family is larger than previously thought. Comparative genomics analysis suggests the presence of an ancient hexaploidization event that is conserved across the dicotyledonous lineage. PMID:20729833

  1. Genetic diversity analysis of common beans based on molecular markers.

    Science.gov (United States)

    Gill-Langarica, Homar R; Muruaga-Martínez, José S; Vargas-Vázquez, M L Patricia; Rosales-Serna, Rigoberto; Mayek-Pérez, Netzahualcoyotl

    2011-10-01

    A core collection of the common bean (Phaseolus vulgaris L.), representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico) Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions) was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each), as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP) +3/+3 primer combinations and seven simple sequence repeats (SSR) loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA) and molecular variance (AMOVA) analyses. AFLP analysis produced 530 bands (88.5% polymorphic) while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus). AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  2. Genetic diversity analysis of common beans based on molecular markers

    Directory of Open Access Journals (Sweden)

    Homar R. Gill-Langarica

    2011-01-01

    Full Text Available A core collection of the common bean (Phaseolus vulgaris L., representing genetic diversity in the entire Mexican holding, is kept at the INIFAP (Instituto Nacional de Investigaciones Forestales, Agricolas y Pecuarias, Mexico Germplasm Bank. After evaluation, the genetic structure of this collection (200 accessions was compared with that of landraces from the states of Oaxaca, Chiapas and Veracruz (10 genotypes from each, as well as a further 10 cultivars, by means of four amplified fragment length polymorphisms (AFLP +3/+3 primer combinations and seven simple sequence repeats (SSR loci, in order to define genetic diversity, variability and mutual relationships. Data underwent cluster (UPGMA and molecular variance (AMOVA analyses. AFLP analysis produced 530 bands (88.5% polymorphic while SSR primers amplified 174 alleles, all polymorphic (8.2 alleles per locus. AFLP indicated that the highest genetic diversity was to be found in ten commercial-seed classes from two major groups of accessions from Central Mexico and Chiapas, which seems to be an important center of diversity in the south. A third group included genotypes from Nueva Granada, Mesoamerica, Jalisco and Durango races. Here, SSR analysis indicated a reduced number of shared haplotypes among accessions, whereas the highest genetic components of AMOVA variation were found within accessions. Genetic diversity observed in the common-bean core collection represents an important sample of the total Phaseolus genetic variability at the main Germplasm Bank of INIFAP. Molecular marker strategies could contribute to a better understanding of the genetic structure of the core collection as well as to its improvement and validation.

  3. Faba bean drought responsive gene identification and validation

    Directory of Open Access Journals (Sweden)

    Megahed H. Ammar

    2017-01-01

    Full Text Available This study was carried out to identify drought-responsive genes in a drought tolerant faba bean variety (Hassawi 2 using a suppressive subtraction hybridization approach (SSH. A total of 913 differentially expressed clones were sequenced from a differential cDNA library that resulted in a total of 225 differentially expressed ESTs. The genes of mitochondrial and chloroplast origin were removed, and the remaining 137 EST sequences were submitted to the gene bank EST database (LIBEST_028448. A sequence analysis identified 35 potentially drought stress-related ESTs that regulate ion channels, kinases, and energy production and utilization and transcription factors. Quantitative PCR on Hassawi 2 genotype confirmed that more than 65% of selected drought-responsive genes were drought-related. Among these induced genes, the expression levels of eight highly up-regulated unigenes were further analyzed across 38 selected faba bean genotypes that differ in their drought tolerance levels. These unigenes included ribulose 1,5-bisphosphate carboxylase (rbcL gene, non-LTR retroelement reverse related, probable cyclic nucleotide-gated ion channel, polyubiquitin, potassium channel, calcium-dependent protein kinase and putative respiratory burst oxidase-like protein C and a novel unigene. The expression patterns of these unigenes were variable across 38 genotypes however, it was found to be very high in tolerant genotype. The up-regulation of these unigenes in majority of tolerant genotypes suggests their possible role in drought tolerance. The identification of possible drought responsive candidate genes in Vicia faba reported here is an important step toward the development of drought-tolerant genotypes that can cope with arid environments.

  4. Common bean cultivars and lines interactions with environments

    Directory of Open Access Journals (Sweden)

    Carbonell Sérgio Augusto Morais

    2004-01-01

    Full Text Available The performance of bean lines brought forth in breeding programs or of cultivars in use can be affected by environmental variability. The adaptability and stability of grain yield of 18 common bean cultivars and lines in 23 environments (combinations of seasons, years and locations were evaluated in the State of São Paulo, Brazil. 'IAC-Carioca' and 'IAC-Carioca Eté' were used as standard cultivars for the carioca grain type, while 'FT-Nobre' and 'IAC-Una' represented the standard for black grains. The experiment was set up in a randomized complete block design with four replications and plots consisting of two, two central five meters rows flanked by border rows. Stability parameters were estimated by the methods Maximum Yield Deviations (MYD and by the Additive Main Effects and Multiplicative Interaction Analysis (AMMI. For the identification of the most stable cultivars, the two methods led to consistent results, although by MYD the highest stability was always associated to the highest yield. 'MAC-733327' and 'LP 9637' were the most suitable cultivars and lines for the joint seasons, while 'LP 9637' and 'FT-Nobre' were the most suitable for the dry season. The MYD method combined a simple procedure, easiness of result interpretation, uniqueness of parameters, and association between stability and yield. On the other hand, the AMMI method simplified the identification of stable cultivars by visual inspection, also providing information on the environments. However, the complex nature which combines uni-and multivariate techniques hampers its widespread use in breeding programs.

  5. Inheritance of resistance to the bean-pod weevil (Apion godmani Wagner) in common beans from Mexico.

    Science.gov (United States)

    Garza, R; Cardona, C; Singh, S P

    1996-03-01

    The bean-pod weevil (BPW), Apion godmani Wagner, often causes heavy losses in crops of common bean (Phaseolus vulgaris L.). Farmers need resistant bean cultivars to minimize losses, cut production costs, stabilize seed yield, and reduce pesticide use and consequent health hazards. To design effective breeding methods, breeders need new and better sources of resistance and increased knowledge of their modes of inheritance. We therefore: (1) compared sources of resistance to BPW, (2) studied the inheritance of resistance, and (3) determined whether the sources possess similar or different genes for BPW resistance. The following sources of resistance, originating from the Mexican highlands, were evaluated for 3 years at INIFAP-Santa Lucía de Prias, Texcoco, Mexico: 'Amarillo 153', 'Amarillo 169', 'Hidalgo 58', 'J 117', 'Pinto Texcoco', 'Pinto 168', and 'Puebla 36'. All except 'Puebla 36' were crossed with the susceptible cultivar 'Jamapa'. 'Amarillo 153' and 'Puebla 36' were crossed with another susceptible cultivar, 'Bayo Mex'. The parents, F1 hybrids, and F2 populations were evaluated for BPW damage in 1992. Backcrosses of the F1 of Jamapa/Pinto 168 to the respective susceptible and resistant parents were also evaluated in 1992. All seven resistant accessions were crossed in all possible combinations, excluding reciprocals. The resulting 21 F1 hybrids and 21 F2 populations were evaluated for BPW damage in 1994. 'J 117' had the highest level of resistance to BPW. 'Pinto Texcoco' and 'Puebla 36' had the highest mean damage score of all seven sources of resistance. The F1 hybrids between susceptible parents and resistant sources were generally intermediate. Two genes segregating independently controlled the BPW resistance in each accession. One gene, Agm, has no effect when present alone, whereas the other gene, Agr, alone conferred intermediate resistance. When both genes were present, resistance to BPW was higher. Based on mean BPW damage scores, all 21 F1 hybrids

  6. Tylosema esculentum (Marama) Tuber and Bean Extracts Are Strong Antiviral Agents against Rotavirus Infection

    OpenAIRE

    Walter Chingwaru; Runner T. Majinda; Sam O. Yeboah; Jackson, Jose C.; Petrina T. Kapewangolo; Martha Kandawa-Schulz; Avrelija Cencic

    2011-01-01

    Tylosema esculentum (marama) beans and tubers are used as food, and traditional medicine against diarrhoea in Southern Africa. Rotaviruses (RVs) are a major cause of diarrhoea among infants, young children, immunocompromised people, and domesticated animals. Our work is first to determine anti-RV activity of marama bean and tuber ethanol and water extracts; in this case on intestinal enterocyte cells of human infant (H4), adult pig (CLAB) and adult bovine (CIEB) origin. Marama cotyledon ethan...

  7. Physical Characteristics of Coffee Beans from Steaming Processin Single Column Reactor

    Directory of Open Access Journals (Sweden)

    Sukrisno Widyotomo

    2010-05-01

    Full Text Available One of important steps in decaffeination process is steaming. The aim of steaming is to expand coffee beans porosity in order to obtain optimal condition for decaffeination process. Steaming can be done in single column reactor using saturated water vapour as media. The objective of this research is to study physical characteristics of coffee beans after steaming process using single column reactor. Material tested was Robusta coffee with 13—14% moisture content after dry processing. Reactor capacity is 6 kg dried coffee beans and 30 l water to produce water vapour. Dried coffee beans classified in 4 grades, i.e. diameter size (d d>7,5 mm; 6,5beans expanded 8.6—9.5% in length, 12.2—13.3% in width, and 18.3—20.6% in thickness. Coffee bean volume increased 30—50%. Coffee bean moisture content increased f. Aritmatic diameter increased 8—13% while geometric diameter increased 9—18%. Sphericity not affected. Surface area increased 18—37%. True density increased 19—30% while bulk density was while. Porosity increased from 13—18% to 24—39% while coffee beans texture decreased from 323—384 g/1 mm to 212—225 g/1 mm. Color change increased from 14—20 to 38—40. The optimum steaming process was 3 hours.Key words : Coffee, steaming, single column reactor, decaffeination.

  8. Control of angular leaf spot on dry beans with fungicides and its effect on plant production

    OpenAIRE

    Deman, Luis Alfredo Raue; Maringoni, Antonio Carlos [UNESP

    2012-01-01

    The angular leaf spot of dry bean caused by the fungus Phaeoisairopsis griseola is a very important disease on dry bean crops in Brazil. In propitious weather conditions, susceptible cultivars have significant losses due to this disease. In these conditions, fungicide usage is an important step for angular leaf spot management. Since the effects of this method of control on plant physiology are not known, this study had the following objectives: a) Verify the action of fungicide in physiologi...

  9. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    Science.gov (United States)

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed.

  10. Beans (Phaseolus vulgaris) are an important part of the Costa Rican diet.

    OpenAIRE

    2004-01-01

    Nevertheless, the amount and the frequencyof its consumption has been decreasing over time, especiallyin the urban areas1 This tendency is a concern to thoseinvolved in health and nutrition since beans are a source ofprotein, non-heme iron, fiber, folic acid, thiamin, potassium,magnesium and zinc2. The nutritional contribution of beanslo the Costa Rican diet is important in spite of the reductionin consumption. Beans are important because of their nutrientcontent and the presence of phytochem...

  11. Physicochemical, morphological and rheological properties of canned bean pastes "negro Queretaro" variety (Phaseolus vulgaris L.).

    Science.gov (United States)

    Martínez-Preciado, A H; Estrada-Girón, Y; González-Álvarez, A; Fernández, V V A; Macías, E R; Soltero, J F A

    2014-09-01

    Proximate, thermal, morphological and rheological properties of canned "negro Querétaro" bean pastes, as a function of fat content (0, 2 and 3 %) and temperature (60, 70 and 85 °C), were evaluated. Raw and precooked bean pastes were characterized by scanning electron microscopy (SEM) and differential scanning calorimetry (DSC). Well-defined starch granules in the raw bean pastes were observed, whereas a gelatinized starch paste was observed for the canned bean pastes. The DSC analysis showed that the raw bean pastes had lower onset peak temperatures (79 °C, 79.1 °C) and gelatinization enthalpy (1.940 J/g), compared to that precooked bean pastes (70.4 °C, 75.7 °C and 1.314 J/g, respectively) thermal characteristics. Moreover, the dynamic rheological results showed a gel-like behavior for the canned bean pastes, where the storage modulus (G') was frequency independent and was higher than the loss modulus (G″). The non-linear rheological results exhibited a shear-thinning flow behavior, where the steady shear-viscosity was temperature and fat content dependent. For canned bean pastes, the shear-viscosity data followed a power law equation, where the power law index (n) decreased when the temperature and the fat content increased. The temperature effect on the shear-viscosity was described by an Arrhenius equation, where the activation energy (Ea) was in the range from 19.04 to 36.81 KJ/mol. This rheological behavior was caused by gelatinization of the starch during the cooking and sterilization processes, where starch-lipids and starch-proteins complex were formed.

  12. Effect of edible coating on the aromatic attributes of roasted coffee beans

    OpenAIRE

    Rattan, Supriya; Parande, A. K.; Ramalakshmi, K.; Nagaraju, V. D.

    2015-01-01

    Coffee is known throughout the world for its distinct aroma and flavour which results from a number of volatile compounds present in it. It is very difficult to arrest the aromatic compounds once the roasting process is complete and it becomes even more challenging to store the beans for a longer time with the retained volatiles as these compounds are easily lost during industrialized processing such as the grinding of roasted coffee beans and storage of ground coffee. Thus, an attempt was ma...

  13. Are Lotus species good models for studying iron accumulation in common beans?

    DEFF Research Database (Denmark)

    Orlowska, Elzbieta; Laszcyca, Katarzyna Malgorzata; Urbanski, Dorian Fabian

      Iron is an important micronutrient for all living organisms. Although iron is abundant in the Earth's crust, iron deficiency is a common problem throughout the food chain. Legume seeds have relatively high but also highly variable iron content. Little is known about the mechanisms controlling...

  14. Dynamics and biodiversity of populations of lactic acid bacteria and acetic acid bacteria involved in spontaneous heap fermentation of cocoa beans in Ghana.

    Science.gov (United States)

    Camu, Nicholas; De Winter, Tom; Verbrugghe, Kristof; Cleenwerck, Ilse; Vandamme, Peter; Takrama, Jemmy S; Vancanneyt, Marc; De Vuyst, Luc

    2007-03-01

    The Ghanaian cocoa bean heap fermentation process was studied through a multiphasic approach, encompassing both microbiological and metabolite target analyses. A culture-dependent (plating and incubation, followed by repetitive-sequence-based PCR analyses of picked-up colonies) and culture-independent (denaturing gradient gel electrophoresis [DGGE] of 16S rRNA gene amplicons, PCR-DGGE) approach revealed a limited biodiversity and targeted population dynamics of both lactic acid bacteria (LAB) and acetic acid bacteria (AAB) during fermentation. Four main clusters were identified among the LAB isolated: Lactobacillus plantarum, Lactobacillus fermentum, Leuconostoc pseudomesenteroides, and Enterococcus casseliflavus. Other taxa encompassed, for instance, Weissella. Only four clusters were found among the AAB identified: Acetobacter pasteurianus, Acetobacter syzygii-like bacteria, and two small clusters of Acetobacter tropicalis-like bacteria. Particular strains of L. plantarum, L. fermentum, and A. pasteurianus, originating from the environment, were well adapted to the environmental conditions prevailing during Ghanaian cocoa bean heap fermentation and apparently played a significant role in the cocoa bean fermentation process. Yeasts produced ethanol from sugars, and LAB produced lactic acid, acetic acid, ethanol, and mannitol from sugars and/or citrate. Whereas L. plantarum strains were abundant in the beginning of the fermentation, L. fermentum strains converted fructose into mannitol upon prolonged fermentation. A. pasteurianus grew on ethanol, mannitol, and lactate and converted ethanol into acetic acid. A newly proposed Weissella sp., referred to as "Weissella ghanaensis," was detected through PCR-DGGE analysis in some of the fermentations and was only occasionally picked up through culture-based isolation. Two new species of Acetobacter were found as well, namely, the species tentatively named "Acetobacter senegalensis" (A. tropicalis-like) and "Acetobacter

  15. Kinetic analysis of strains of lactic acid bacteria and acetic acid bacteria in cocoa pulp simulation media toward development of a starter culture for cocoa bean fermentation.

    Science.gov (United States)

    Lefeber, Timothy; Janssens, Maarten; Camu, Nicholas; De Vuyst, Luc

    2010-12-01

    The composition of cocoa pulp simulation media (PSM) was optimized with species-specific strains of lactic acid bacteria (PSM-LAB) and acetic acid bacteria (PSM-AAB). Also, laboratory fermentations were carried out in PSM to investigate growth and metabolite production of strains of Lactobacillus plantarum and Lactobacillus fermentum and of Acetobacter pasteurianus isolated from Ghanaian cocoa bean heap fermentations, in view of the development of a defined starter culture. In a first step, a selection of strains was made out of a pool of strains of these LAB and AAB species, obtained from previous studies, based on their fermentation kinetics in PSM. Also, various concentrations of citric acid in the presence of glucose and/or fructose (PSM-LAB) and of lactic acid in the presence of ethanol (PSM-AAB) were tested. These data could explain the competitiveness of particular cocoa-specific strains, namely, L. plantarum 80 (homolactic and acid tolerant), L. fermentum 222 (heterolactic, citric acid fermenting, mannitol producing, and less acid tolerant), and A. pasteurianus 386B (ethanol and lactic acid oxidizing, acetic acid overoxidizing, acid tolerant, and moderately heat tolerant), during the natural cocoa bean fermentation process. For instance, it turned out that the capacity to use citric acid, which was exhibited by L. fermentum 222, is of the utmost importance. Also, the formation of mannitol was dependent not only on the LAB strain but also on environmental conditions. A mixture of L. plantarum 80, L. fermentum 222, and A. pasteurianus 386B can now be considered a mixed-strain starter culture for better controlled and more reliable cocoa bean fermentation processes.

  16. Three Members of the Bemisia tabaci (Hemiptera: Aleyrodidae) Cryptic Species Complex Occur Sympatrically in Argentine Horticultural Crops.

    Science.gov (United States)

    Alemandri, V; Vaghi Medina, C G; Dumón, A D; Argüello Caro, E B; Mattio, M F; García Medina, S; López Lambertini, P M; Truol, G

    2015-04-01

    The whitefly, Bemisia tabaci (Gennadius), is a cryptic species complex that attacks >600 different species of plants and transmits several plant viruses causing severe economic losses. Until 2010, the B. tabaci complex comprised 24 distinct putative species. Recently, at least 15 new species have been reported. The objective of this study was to identify B. tabaci species present in bean, melon, and tomato crops in Argentina by applying phylogenetic analyses and pairwise comparison of genetic distances of mitochondrial cytochrome c oxidase subunit I (mtCOI) sequences. The 39 proposed whitefly species were identified with both analyses, and the presence in Argentina of one indigenous species, New World 2 (NW2), and two introduced species, Middle East-Asia Minor one (MEAM1) and Mediterranean, was confirmed. Common bean crop presented the three whitefly species detected, with NW2, MEAM1, and Mediterranean being present all together under field conditions. Also, Mediterranean was the only species identified in tomato, whereas MEAM1 was found in melon. To the best of our knowledge, Mediterranean is a recent invasive species in open-field agriculture in the American continent and in greenhouse tomato in Argentina. Additionally, we provide the first report of MEAM1 in common bean and melon. These findings raise several questions on the future scenario of B. tabaci and the viruses it transmits in Argentina.

  17. Identification of bean varieties according to color features using artificial neural network

    Directory of Open Access Journals (Sweden)

    A. Nasirahmadi

    2013-07-01

    Full Text Available A machine vision and a multilayer perceptron artificial neural network (MLP-ANN were applied to identify bean varieties, based on color features. Ten varieties of beans, which were grown in Iran (Khomein1, KS21108, Khomein2, Sarab1, Khomein3, KS21409, Akhtar2, Sarab2, KS21205, and G11870 were collected. Six color features of the bean and six color features of the spots were extracted and used as input for MLP-ANN classifier. In this study, 1000 data sets were used, 70% for training, 15% for validating and 15% for testing. The results showed that the applied machine vision and neural network were able to classify bean varieties with 100% sensibility and specificity, except with Sarab1 with sensibilities of 100%, 73.3%, 60% for the training, validation and testing processes, respectively and KS21108 with specificities of 100%, 79% and 71%, respectively for the aforementioned processes. Considering total sensibilities of 100%, 97.33%, 96% and also specificities of 100%, 97.9% and 97.1% for training, validation and testing of beans, respectively, the ANN could be used as a effective tool for classification of bean varieties.