WorldWideScience

Sample records for americium 246

  1. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-01

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  2. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  3. Americium recovery from reduction residues

    Science.gov (United States)

    Conner, W.V.; Proctor, S.G.

    1973-12-25

    A process for separation and recovery of americium values from container or bomb'' reduction residues comprising dissolving the residues in a suitable acid, adjusting the hydrogen ion concentration to a desired level by adding a base, precipitating the americium as americium oxalate by adding oxalic acid, digesting the solution, separating the precipitate, and thereafter calcining the americium oxalate precipitate to form americium oxide. (Official Gazette)

  4. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  5. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  6. Americium-241 - ED 4308

    International Nuclear Information System (INIS)

    This sheet presents the characteristics of Americium-241, its origin, and its radio-physical and biological properties. It briefly describes its use in nuclear medicine. It indicates its dosimetric parameters for external exposure, cutaneous contamination, and internal exposure due to acute contamination or to chronic contamination. It indicates and comments the various exposure control techniques: ambient dose rate measurement, surface contamination measurement, atmosphere contamination. It addresses the means of protection: premise design, protection against external exposure and against internal exposure. It describes how areas are delimited and controlled within the premises: regulatory areas, controls to be performed. It addresses the personnel classification, training and medical survey. It addresses the issue of wastes and effluents. It briefly recalls the administrative procedures related to the authorization and declaration of possession and use of sealed and unsealed sources. It indicates regulatory aspects related to the road transport of Americium-241, describes what is to be done in case of incident or accident (for the different types of contamination or exposure)

  7. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  8. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  9. Science and Technology for Americium Transmutation

    International Nuclear Information System (INIS)

    Americium could be seen as the most troublesome element that is present in nuclear fuel. This thesis offers different points of view on the possibility of americium transmutation. The first point of view elaborates simulations of americium-bearing facilities, namely nuclear data, a popular computational code and modeling techniques. The second point of view is focused on practical usage of the simulations to examine upper limit of americium in a specific reactor

  10. Transmutation of Americium in Fast Neutron Facilities

    OpenAIRE

    Zhang, Youpeng

    2011-01-01

    In this thesis, the feasibility to use a medium sized sodium cooled fast reactor fully loaded with MOX fuel for efficient transmutation of americium is investigated by simulating the safety performance of a BN600-type fast reactor loaded with different fractions of americium in the fuel, using the safety parameters obtained with the SERPENT Monte Carlo code. The focus is on americium mainly due to its long-term contribution to the radiotoxicity of spent nuclear fuel and its deterioration on c...

  11. Production of americium isotopes in France

    International Nuclear Information System (INIS)

    The program of productions of americium 241 and 243 isotopes is based respectively on the retreatment of aged plutonium alloys or plutonium dioxide and on the treatment of plutonium targets irradiated either in CELESTIN reactors for Pu-Al alloys or OSIRIS reactor for plutonium 242 dioxide. All the operations, including americium final purifications, are carried out in hot cells equipped with remote manipulators. The chemical processes are based on the use of extraction chromatography with hydrophobic SiO2 impregnated with extracting agents. Plutonium targets and aged plutonium alloys are dissolved in nitric acid using conventional techniques while plutonium dioxide dissolutions are performed routine at 300 grams scale with electrogenerated silver II in 4M HNO3 at room temperature. The separation between plutonium and americium is performed by extraction of Pu(IV) either on TBP/SiO2 or TOAHNO3/SiO2 column. Americium recovery from waste streams rid of plutonium is realized by chromatographic extraction of Am(III) using mainly TBP and episodically DHDECMP as extractant. The final purification of both americium isotopes uses the selective extraction of Am(VI) on HDDiBMP/SiO2 column at 60 grams scale. Using the overall process a total amount of 1000 grams of americium 241 and 100 grams of americium 243 has been produced nowadays and the AmO2 final product indicates a purity better than 98.5%

  12. Study of americium sorption by humic acids

    International Nuclear Information System (INIS)

    The results of investigation of influence of the cation content and acidity of soil solution on americium sorption by the humic acids have been shown. The most influence on the interphase distribution coefficient in the system 'humic acid - model soil solution' is caused by the presence of the iron (III), calcium ions and acidity of the solution. The increase of the sodium ions concentration in the solution makes an insignificant impact on the americium sorption. (Authors)

  13. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  14. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  15. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  16. Formation of americium and europium humate complexes

    International Nuclear Information System (INIS)

    Binding constants of americium and europium with a humic acid were determined to study if complex formation of trivalent actinide-humates affects dissolved species of the actinides in hydrosphere. The purified humic acid was characterized by means of UV-vis, IR, and pH titration, indicating high carboxylate capacity and low aromaticity. Binding constants of americium and europium humates were determined at pH 4.6 and 6.0 by solvent extraction using 241Am or 152Eu as a tracer. The binding constants for americium-humate obtained preliminarily suggest that complexes with humic acid are not negligible in speciation of trivalent actinides in hydrosphere. The obtained binding constants were nearly identical with those determined previously by the same procedures, but with humic acids of different origin and compositions. (author)

  17. Preparation of americium source for smoke detector

    International Nuclear Information System (INIS)

    This report describes the method developed for the preparation of 241Am source for smoke detector. Americium was electrodeposited from iso-propyl alcohol medium on silver backing. Thin layer of gold (few hundred micro gram thick) was plated on the americium source to make it safe for handling. The thickness of plated gold was such that the alpha radiations from the 241Am source could escape out of the gold layer and cause ionisation in the surrounding air. The performance of the prepared sources were checked in a smoke detector and was found to be satisfactory and comparable to the imported sources. (author). 1 refs., 2 figs., 1 tab

  18. Recovery of americium-241 from raffinates of plutonium purification columns

    International Nuclear Information System (INIS)

    Recovery and purification of americium from ion exchange raffinates generated during purification of aged plutonium is described. The method consists of the following stages: (i) co-precipitation of americium with kilogramme quantities of rare earth oxalates, (ii) destruction of oxalate and removal of residual plutonium from nitric acid medium using anion exchange process, (iii) preliminary separation of americium making use of its preferential uptake on an anion exchange column from thiocyanate medium and (iv) extraction of americium and remaining rare earths into di-(2-ethyl hexyl) phosphoric acid followed by preferential back washing of americium by lactic acid medium containing DTPA. (author)

  19. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  20. Americium separations from high salt solutions

    International Nuclear Information System (INIS)

    Americium (III) exhibits an unexpectedly high affinity for anion-exchange material from the high-salt evaporator bottoms solutions--an effect which has not been duplicated using simple salt solutions. Similar behavior is observed for its lanthanide homologue, Nd(III), in complex evaporator bottoms surrogate solutions. There appears to be no single controlling factor--acid concentration, total nitrate concentration or solution ionic strength--which accounts for the approximately 2-fold increase in retention of the trivalent ions from complex solutions relative to simple solutions. Calculation of species activities (i.e., water, proton and nitrate) in such concentrated mixed salt solutions is difficult and of questionable accuracy, but it is likely that the answer to forcing formation of anionic nitrate complexes of americium lies in the relative activities of water and nitrate. From a practical viewpoint, the modest americium removal needs (ca. 50--75%) from nitric acid evaporator bottoms allow sufficient latitude for the use of non-optimized conditions such as running existing columns filled with older, well-used Reillex HPQ. Newer materials, such as HPQ-100 and the experimental bifunctional resins, which exhibit higher distribution coefficients, would allow for either increased Am removal or the use of smaller columns. It is also of interest that one of the experimental neutral-donor solid-support extractants, DHDECMP, exhibits a similarly high level of americium (total alpha) removal from EV bottoms and is much less sensitive to total acid content than commercially-available material

  1. Decontaminaion of metals containing plutonium and americium

    International Nuclear Information System (INIS)

    Melt-slagging (melt-refining) techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7 x 106 were measured with boro-silicate slag and of 3 x 106 with calcium, magnesium silicate slag. Decontamination of metals containing as much as 14,000 ppM plutonium appears to be as efficient as for metals with plutonium levels of 400 ppM. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. The second extraction is effective with either resistance-furnace melting or electric-arc melting. Slag adhering to the metal ingots and in defects within the ingots is in the important contributors to plutonium retained in processed metals. If these sources of plutonium are controlled, the melt-refining process can be used on a large scale to convert highly contaminated metals to homogeneous and compact forms with very low concentrations of plutonium and americium. A conceptual design of a melt-refining process to decontaminate plutonium- and americium-contaminated metals is described. The process includes single-stage refining of contaminated metals to produce a metal product which would have less than 10 nCi/g of TRU-element contamination. Two plant sizes were considered. The smaller conceptual plant processes 77 kg of metal per 8-h period and may be portable.The larger one processes 140 kg of metal per 8-h period, is stationary, and may be near te maximum size that is practical for a metal decontamination process

  2. Status of Americium-241 recovery at Rocky Flats Plant

    International Nuclear Information System (INIS)

    This paper is presented in two parts: Part I, Molten Salt Extraction of Americium from Molten Plutonium Metal, and Part II, Aqueous Recovery of Americium from Extraction Salts. The Rocky Flats recovery process used for waste salts includes (1) dilute hydrochloric acid dissolution of residues; (2) cation exchange to convert from the chloride to the nitrate system and to remove gross amounts of monovalent impurities; (3) anion exchange separation of plutonium; (4) oxalate precipitation of americium; and (5) calcination of the oxalate at 6000C to yield americium oxide. The aqueous process portion describes attempts to improve the recovery of americium. The first part deals with modifications to the cation exchange step; the second describes development of a solvent extractions process that will recovery americium from residues containing aluminium as well as other common impurities. Results of laboratory work are described. 3 figures, 6 tables. (DP)

  3. Plutonium and americium in soil organic matter

    International Nuclear Information System (INIS)

    A gley soil from west Cumbria, with specific activities in its surface horizon of 5-10 kBq kg-1239,240Pu and comparable 241Am levels, has been used as a source of actinide-enriched organic fractions. Humic and fulvic acids were isolated by conventional alkali extraction and investigated by gel filtration, treatment with organic solvents and differential flocculation procedures. All these techniques are capable of resolving the organics into two or more fractions, with specific activities up to 80 kBq kg-239,240Pu. There is evidence for differentiation of plutonium and americium, with americium being concentrated, to some extent, in the lower molecular weight fractions from gel filtration. (author)

  4. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  5. Americium transfer studies using hollow fiber/extractant membranes

    International Nuclear Information System (INIS)

    Americium can be removed from low acid/high nitrate feeds using hollow fiber membrane modules. Americium can be concentrated in the stripping solution. (Maximum observed concentration was a factor of 3.1). Accurel hollow fibers are less prone to leakage problems

  6. Electronic structure of compressed americium metal

    Czech Academy of Sciences Publication Activity Database

    Kolorenč, Jindřich; Shick, Alexander; Caciuffo, R.

    Cambridge: Cambridge University Press,, 2012 - (Anderson, D.; Boot, C.; Burns, P.), s. 177-182. (Materials Research Society Symposium Proceedings. 1444). ISBN 978-1-60511-421-7. ISSN 0272-9172. [2012 MRS Spring Meeting. Sacramento (CA), 09.04.2012-13.04.2012] R&D Projects: GA ČR(CZ) GAP204/10/0330; GA AV ČR IAA100100912 Institutional research plan: CEZ:AV0Z10100520 Keywords : americium * X-ray spectroscopy * LDA+DMFT Subject RIV: BM - Solid Matter Physics ; Magnetism http://journals.cambridge.org/article_S1946427412009463

  7. 48 CFR 2453.246 - Quality Assurance.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Quality Assurance. 2453.246 Section 2453.246 Federal Acquisition Regulations System DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT CLAUSES AND FORMS FORMS Prescription of Forms 2453.246 Quality Assurance....

  8. 32 CFR 246.5 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 246.5 Section 246.5 National... STARS AND STRIPES (S&S) NEWSPAPER AND BUSINESS OPERATIONS § 246.5 Responsibilities. (a) The Assistant to the Secretary of Defense (Public Affairs), under 32 CFR part 375, as the principal staff assistant...

  9. 42 CFR 431.246 - Corrective action.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Corrective action. 431.246 Section 431.246 Public... Recipients Procedures § 431.246 Corrective action. The agency must promptly make corrective payments, retroactive to the date an incorrect action was taken, and, if appropriate, provide for admission...

  10. 7 CFR 246.11 - Nutrition education.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nutrition education. 246.11 Section 246.11 Agriculture... Participant Benefits § 246.11 Nutrition education. (a) General. (1) Nutrition education shall be considered a benefit of the Program, and shall be made available at no cost to the participant. Nutrition...

  11. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)

    2000-07-01

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  12. Modelling of americium stripping in the EXAm process

    International Nuclear Information System (INIS)

    The EXAm process aims at recovering americium alone contained in the PUREX raffinate. The americium stripping model has been revised to take into account a change of stripping aqueous phase and up-to-date experimental results conducted within DRCP to improve knowledge about complexes. This work represents a first approximation at modelling americium stripping. The modelling work has led to synthesize the knowledge on chemical phenomenology and adopt assumptions that best reflect experimental results. The modelling has been implemented in PAREX code in order to simulate this step to prepare and understand tests to be carried out in mixer settlers. (authors)

  13. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  14. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  15. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  16. Americium/Curium Disposition Life Cycle Planning Study

    International Nuclear Information System (INIS)

    At the request of the Department of Energy Savannah River Office (DOE- SR), Westinghouse Savannah River Company (WSRC) evaluated concepts to complete disposition of Americium and Curium (Am/Cm) bearing materials currently located at the Savannah River Site (SRS)

  17. Dicty_cDB: CHR246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR246 (Link to dictyBase) - - - Contig-U16475-1 CHR246P (Link to Original site) CHR...246F 145 CHR246Z 524 CHR246P 649 - - Show CHR246 Library CH (Link to library) Clone ID CHR... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR2-B/CHR246Q.Seq.d/ Representative seq. ID CHR...246P (Link to Original site) Representative DNA sequence >CHR246 (CHR246Q) /CSM/CH/CHR2-B/CHR2...equences producing significant alignments: (bits) Value N AC116957 |AC116957.2 Dictyostelium discoideum chro

  18. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  19. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  20. 1976 Hanford americium-exposure incident: external decontamination procedures

    International Nuclear Information System (INIS)

    An accident resulted in the deposition on an injured workman's skin surfaces, in acid-burned areas and in lacerations, of something in excess of 6 mCi americium-241. The external decontamination procedures used, the change in americium content of the skin during the course of treatment, and some of the unusual problems encountered from the extrusion of foreign material and flaking of skin and scar tissue are described

  1. The bone volume effect on the dosimetry of plutonium-239 and americium-241 in the skeleton of man and baboon

    International Nuclear Information System (INIS)

    Studies were undertaken using bone removed from young adult baboons, which had been contaminated with plutonium-239 at various times prior to sacrifice, and human bone from adult male (USTR Case 246), who had received an internal deposition of americium-241 as a result of a glove-box explosion 11 years prior to his death. The baboon bone was supplied by the CEA, France, and the human bone by the United States Transuranium registry. The bone samples, examined by qualitative and quantitative autoradiography with CR 39 detectors, demonstrated the rapid redistribution of bone surface-seeking radionuclides in younger primates due to growth and the slower, bone turnover driven redistribution in the adult human bone. In both species, primary and secondary surface deposits of radionuclide remained conspicious despite bone activity; true volumization of radionuclide was seldom seen. The dosimetric implications of these findings are discussed. (author) 21 refs.; 6 figs.; 4 tabs

  2. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  3. Complexation of americium with humic acid

    International Nuclear Information System (INIS)

    As a part of the interlaboratory comparison exercise for the complexation of humic acid and colloid generation (COCO-Club activities) in the CEC project MIRAGE-II, the complexation of americium with humic acid has been studied in our laboratory. Two humic acids were used for the study: Aldrich-HA(H+) which is a reference humic acid of the COCO-Club and Bradford-HA(H+) from Lake Bradford, Florida. A wide concentration range of humic acid and different ratios of Am to humic acid have been investigated between pH 5 and 6 with the ionic strength of 0.1 M and 1.0 M. The complexation has been studied by UV-spectroscopy, Laser-induced Photoacoustic Spectroscopy (LPAS) and ultrafiltration. LPAS is used for the submicromolar concentration range where the sensitivity of UV spectroscopy is not accessible. Ultrafiltration is used for low Am to humic acid ratios where both spectroscopic methods are not applicable. Varying the humic acid concentration over three orders of magnitude, only a 1:1 type of binding is observed. No significant variation of the stability constant is found in the investigated range of pH and ionic strength. However, the precipitation tendency and the loading capacity of humic acid are found to depend sensitively on pH and ionic strength. The complexation study provides a deep insight into the influence of humic acid on the migration behaviour of fission products and actinides in the geosphere. (orig.)

  4. Analysis of BWR lattices to recycle americium

    International Nuclear Information System (INIS)

    This study was carried out to assess the ability to eliminate meaningful quantities of americium in a primarily thermal neutron flux by 'spiking' modern BWR fuel with this minor actinide (MA). The studies carried out so far include the simulation of modern 10 x 10 BWR lattices employing the Westinghouse lattice physics code PHOENIX-4 alongside validation studies using MCNP5 models of the same lattices that were spatially depleted via the MONTEBURNS code coupling to ORIGEN. When considering the total inventory of minor actinides in Am-spiked pins, excluding isotopes of uranium and plutonium, the results indicate that a reduction of approximately 50% or more in the total mass inventory of these minor actinides is viable within the selected pins. Therefore, these preliminary results have encouraged the extension of this work to the development of improved lattice designs to help optimize the transmutation rates as well as absolute MA inventory reductions. The ultimate goal being to design batches of these advanced BWR bundles alongside multi-cycle core reload strategies. (authors)

  5. 50 CFR 665.246 - Gear identification.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Gear identification. 665.246 Section 665.246 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC... Gear identification. In Permit Area 1, the vessel's official number must be marked legibly on all...

  6. 7 CFR 246.21 - Investigations.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Investigations. 246.21 Section 246.21 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE..., where appropriate, a review of pertinent practices and policies of any State or local agency,...

  7. 7 CFR 246.8 - Nondiscrimination.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Nondiscrimination. 246.8 Section 246.8 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN Participant Eligibility §...

  8. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  9. 48 CFR 246.470 - Government contract quality assurance actions.

    Science.gov (United States)

    2010-10-01

    ... quality assurance actions. 246.470 Section 246.470 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Government Contract Quality Assurance 246.470 Government contract quality assurance actions....

  10. A TRUEX-based separation of americium from the lanthanides

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher; Nicholas C. Schmitt; Mary E. Case

    2011-03-01

    Abstract: The inextractability of the actinide AnO2+ ions in the TRUEX process suggests the possibility of a separation of americium from the lanthanides using oxidation to Am(V). The only current method for the direct oxidation of americium to Am(V) in strongly acidic media is with sodium bismuthate. We prepared Am(V) over a wide range of nitric acid concentrations and investigated its solvent extraction behavior for comparison to europium. While a separation is achievable in principal, the presence of macro amounts of cerium competes for the sparingly soluble oxidant and the oxidant itself competes for CMPO complexation. These factors conspire to reduce the Eu/Am separation factor from ~40 using tracer solutions to ~5 for extractions from first cycle raffinate simulant solution. To separate pentavalent americium directly from the lanthanides using the TRUEX process, an alternative oxidizing agent will be necessary.

  11. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  12. Dicty_cDB: AFM246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM246 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...246Z 559 - - - - Show AFM246 Library AF (Link to library) Clone ID AFM246 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM2-B/AFM...246Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...246 (AFM246Q) /CSM/AF/AFM2-B/AFM246Q.Seq.d/ XXXXXXXXXXAGATTAAACAATTCATTCTTGATGAATGTGATACC

  13. Uptake of americium-241 by algae and bacteria

    International Nuclear Information System (INIS)

    The uptake of americium by three algae, scenedesmus obliquus, selenastrum capricomutum and chlorella pyrenosdosa and a bacterium aeromonas hydrophila was studied. Live and fixed cells of each algal species and live bacterial cells were used. it is shown that algae and bacteria concentrate americium 241 to a high degree which makes them important links in the biomagnification phenomenon which may ultimately lead to a human hazard and be potentially important in recycling Am 241 in the water column and mobilization from sediments. Chemical fixation of algal cells caused increased uptake which indicated that uptake is by passive diffusion and probably due to chemical alteration of surface binding sites. (U.K.)

  14. Americium incineration by recycling in target rods using coated particles

    International Nuclear Information System (INIS)

    This paper proposes a type of target rod based on the use of coated particles, for an efficient incineration of americium in nuclear reactors. The analysis takes advantage of the experience gained in the past from long duration irradiation without damage of coated particles with plutonium oxide kernels. A conservative theoretical evaluation of the gas pressure inside the coated particles at the end of irradiation allows comparing the well known conditions of the plutonium oxide particles which were successfully irradiated to high burn-up, with a preliminary design of americium oxide particles. (authors)

  15. Mechanistic studies of APR-246 in leukemia

    OpenAIRE

    Ali, Dina Mahmoud

    2013-01-01

    PRIMA-1and its analog APR-246 are novel drugs that restore the active conformation of mutated and unfolded p53 protein and induce apoptosis and cell death in various tumors in pre-clinical models. We first aimed to explore the effects of APR-246 alone and in combination with other drugs in acute myeloid leukemia (AML) in vitro. APR-246 induced dose-dependent apoptosis and increased active caspase-3 and p53 protein levels as well as the Bax/Bcl-2 ratio independently of TP53...

  16. 40 CFR 246.202-1 - Requirement.

    Science.gov (United States)

    2010-07-01

    ...-1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE SEPARATION FOR MATERIALS RECOVERY GUIDELINES Requirements and Recommended Procedures § 246.202-1 Requirement. Any commercial establishment generating 10 or more tons of waste corrugated containers per month...

  17. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  18. Americium retention by the smectite hectorite

    International Nuclear Information System (INIS)

    Document available in extended abstract form only. Clay minerals may play an important role in a high level nuclear waste disposal site. Smectites may be major components of backfill material used to enhance the retention properties of engineered barriers. Furthermore, they have also been detected in the alteration layer of nuclear waste glass corroded in laboratory experiments. For example, the smectite hectorite (Na0.33[Mg2.67Li0.33Si4O10(OH)2]) was identified as phase forming upon waste matrix dissolution and subsequent reprecipitation. Smectites are known to be highly reactive with respect to cations in aqueous systems. Several distinct molecular scale binding mechanisms may operate, but the most effective retention may occur by incorporation in the bulk structure, especially if a (meta)stable solid solution forms. Investigations showed the possibility to incorporate Lu(III) in a clay-like octahedral site in hectorite by coprecipitation. Furthermore, luminescence studies on hectorite synthesized in the presence of Cm(III) or Eu(III) were consistent with an incorporation in the bulk structure. However, structural data such as coordination numbers and bond lengths are still missing for the actinides. In the present study, Am(III) was coprecipitated with and adsorbed on hectorite to decipher the actual retention mechanism(s). Hectorite was synthesized in the presence of Am(III) (sample AmCopHec) from an Am-containing brucite precursor phase. Briefly, brucite was freshly precipitated in the presence of Am(III) (Am:Mg molar ratio of 1:1175) and washed. The resulting sol was aged in a tightly closed vessel in the presence of LiF and silica sol for several days at 90 C. Separately, an Am-containing brucite phase (sample AmCopBru) was prepared under identical conditions as described above, and the americium aqua ions were adsorbed on hectorite (m/V = 2 g/L, [Am(III)]tot = 105 μmol/L, 0.5 mol/L NaClO4, pH = 6.4(1), sample AmSorbHec) and used as reference samples. X

  19. 48 CFR 252.246-7002 - Warranty of construction (Germany).

    Science.gov (United States)

    2010-10-01

    ... (Germany). 252.246-7002 Section 252.246-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.246-7002 Warranty of construction (Germany). As prescribed in 246.710(4), use the following clause: Warranty of Construction (Germany) (JUN 1997) (a) In addition to any...

  20. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  1. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  2. Liquid-liquid extraction separation and determination of plutonium and americium

    International Nuclear Information System (INIS)

    A procedure is described for the determination of plutonium and americium after their initial separation on barium sulfate. The barium sulfate is dissolved in perchloric acid and the antinides and lanthanides are extracted into bis(2-ethylhexyl)phosphoric acid (HDEHP). Americium along with other tervalent actinides and lanthanides is stripped from HDEHP with nitric acid. The lanthanides are removed on a column of HDEHP supported on Teflon powder, and the americium and other tervalent actinides are electrodeposited for their determination by α spectrometry. The plutonium is stripped with nitric acid after reduction to the tervalent state with 2,5-di-tert-butylhydroquinone and electrodeposited for α spectrometry. Decontamination factors for plutonium and americium from each other and from other α emitters are 104 to 105. Two hours are required for the liquid-liquid extraction separations of plutonium and americium from eight samples. Recoveries of americium and plutonium through the HDEHP separatons are 99% and 95%, respectively

  3. Calculational study on irradiation of americium fuel samples in the Petten High Flux Reactor

    International Nuclear Information System (INIS)

    A calculational study on the irradiation of americium samples in the Petten High Flux Reactor (HFR) has been performed. This has been done in the framework of the international EFTTRA cooperation. For several reasons the americium in the samples is supposed to be diluted with a neutron inert matrix, but the main reason is to limit the power density in the sample. The low americium nuclide density in the sample (10 weight % americium oxide) leads to a low radial dependence of the burnup. Three different calculational methods have been used to calculate the burnup in the americium sample: Two-dimensional calculations with WIMS-6, one-dimensional calculations with WIMS-6, and one-dimensional calculations with SCALE. The results of the different methods agree fairly well. It is concluded that the radiotoxicity of the americium sample can be reduced upon irradiation in our scenario. This is especially the case for the radiotoxicity between 100 and 1000 years after storage. (orig.)

  4. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  5. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  6. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  7. Recycling heterogeneous americium targets in a boiling water reactor

    International Nuclear Information System (INIS)

    One of the limiting contributors to the heat load constraint for a long term spent fuel repository is the decay of americium-241. A possible option to reduce the heat load produced by Am-241 is to eliminate it via transmutation in a light water reactor thermal neutron environment, in particular, by taking advantage of the large thermal fission cross section of Am-242 and Am-242m. In this study we employ lattice loading optimization techniques to define the loadings and arrangements of fuel pins with blended americium and uranium oxide in boiling water reactor bundles, specifically, by defining the incineration of pre-loaded americium as an objective function to maximize americium transmutation. Subsequently, the viability of these optimized lattices is tested by assembling them into bundles with Am-spiked fuel pins and by loading these bundles into realistic three-dimensional BWR core-wide simulations that model multiple reload cycles and observe standard operational constraints. These simulations are possible via our collaboration with the Westinghouse Electric Co. which facilitates the use of industrial-caliber design tools such as the PHOENIX-4/POLCA-7 sequence and the Core Master 2 GUI work environment for fuel management. The resulting analysis confirms the ability to axially uniformly eliminating roughly 90% of the pre-loaded inventory of recycled Am-241 in BWR bundles with heterogeneous target pins. This high level of incineration was achieved within three to four 18-month operational cycles, which is equivalent to a typical in-core residence time of a BWR bundle.

  8. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.

    1999-07-28

    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  9. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  10. 48 CFR 246.408-71 - Aircraft.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Aircraft. 246.408-71... Aircraft. (a) The Federal Aviation Administration (FAA) has certain responsibilities and prerogatives in connection with some commercial aircraft and of aircraft equipment and accessories (Pub. L. 85-726 (72...

  11. Dicty_cDB: AFG246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFG246 (Link to dictyBase) - - - Contig-U15510-1 AFG246P (Link to Original ... yhkllnmlkrlfqmd lhmnqmdqfiliq*hfqkhmimvn*--- ---lh*imc *tkdkskikfn*cnrrvyhlhflcfrfnrifnrlfndwfrfrw*r*yrrgd ...

  12. 40 CFR 246.200 - High-grade paper recovery.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false High-grade paper recovery. 246.200 Section 246.200 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE... paper recovery....

  13. 48 CFR 52.246-14 - Inspection of Transportation.

    Science.gov (United States)

    2010-10-01

    ... Transportation. 52.246-14 Section 52.246-14 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION....246-14 Inspection of Transportation. As prescribed in 46.314, insert the following clause in solicitations and contracts for freight transportation services (including local drayage) by rail,...

  14. 40 CFR 246.202-5 - Recommended procedures: Transportation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation. 246.202-5 Section 246.202-5 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.202-5 Recommended procedures: Transportation. Transportation to market may be supplied by...

  15. 40 CFR 246.200-7 - Recommended procedures: Transportation.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation. 246.200-7 Section 246.200-7 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.200-7 Recommended procedures: Transportation. Transportation to market may be supplied by...

  16. 40 CFR 246.201-4 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.201-4 Section 246.201-4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.201-4 Recommended procedures: Market study. An investigation of markets should be made for...

  17. 40 CFR 246.202-3 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.202-3 Section 246.202-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.202-3 Recommended procedures: Market study. An investigation of markets should be made by...

  18. 40 CFR 246.200-3 - Recommended procedures: Market study.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Market study. 246.200-3 Section 246.200-3 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... § 246.200-3 Recommended procedures: Market study. An investigation of markets should be made by...

  19. 48 CFR 552.246-71 - Source Inspection by Government.

    Science.gov (United States)

    2010-10-01

    ... Government. 552.246-71 Section 552.246-71 Federal Acquisition Regulations System GENERAL SERVICES....246-71 Source Inspection by Government. As prescribed in 546.302-71, insert the following clause: Source Inspection by Government (JUNE 1, 2009) (a) Inspection by Government personnel. (1) Supplies to...

  20. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  1. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  2. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  3. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  4. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  5. Placental transfer of americium and plutonium in mice

    International Nuclear Information System (INIS)

    Actinide element release to the environment and subsequent transfer through food chains to pregnant women may present a radiation hazard to fetuses in utero. To measure americium incorporation, four groups of pregnant mice were intravenously dosed with four concentrations of 243Am citrate in late pregnancy. Concentrations of 243Am in fetuses, placentas, and maternal femur, liver, carcass and pelt were determined 48 hr after injection. Doses were chosen so that the number of atoms of 243Am in each injected dose was equal to the number of atoms of 239Pu used in an earlier study of transplacental movement. Results indicate that, atom for atom, americium is incorporated into fetal tissue in lesser amounts (10-25 times) than is plutonium when intravenously administered to pregnant mice in equal atom amounts. Tissue analyses indicated that, at low dose levels, the average fraction of the dose incorporated into the fetuses decreased as the dose to the pregnant mouse was increased. A similar pattern was noted for placentas and maternal femurs. Data indicate that one must make extrapolations from low dose data only to make reasonable and realistic estimates of the transplacental movement and fetal incorporation of environmental levels of actinide elements in man and other species. (author)

  6. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  7. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Rudisill, T.S.

    1999-08-11

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  8. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    International Nuclear Information System (INIS)

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  9. Americium Transmutation Feasibility When Used as Burnable Absorbers - 12392

    International Nuclear Information System (INIS)

    The use of plutonium in Mixed Oxide (MOX) fuel in traditional Pressurized Water Reactor (PWR) assemblies leads to greater americium production which is not addressed in MOX recycling. The transuranic nuclides (TRU) contribute the most to the radiotoxicity of nuclear waste and a reduction of the TRU stockpile would greatly reduce the overall radiotoxicity of what must be managed. Am-241 is a TRU of particular concern because it is the dominant contributor of total radiotoxicity for the first 1000 years in a repository. This research explored the feasibility of transmuting Am-241 by using varying amounts in MOX rods being used in place of burnable absorbers and evaluated with respect to the impact on incineration and transmutation of transuranics in MOX fuel as well as the impact on safety. This research concludes that the addition of americium to a non-uniform fuel assembly is a viable method of transmuting Am-241, holding down excess reactivity in the core while serving as a burnable poison, as well as reducing the radiotoxicity of high level waste that must be managed. The use of Am/MOX hybrid fuel assemblies to transmute americium was researched using multiple computer codes. Am-241 was shown in this study to be able to hold down excess reactivity at the beginning of cycle and shape the power distribution in the core with assemblies of varying americium content loaded in a pattern similar to the traditional use of assemblies with varying amounts of burnable absorbers. The feasibility, safety, and utility of using americium to create an Am/MOX hybrid non-uniform core were also evaluated. The core remained critical to a burnup of 22,000 MWD/MTM. The power coefficient of reactivity as well as the temperature and power defects were sufficiently negative to provide a prompt feedback mechanism in case of a transient and prevent a power excursion, thus ensuring inherent safety and protection of the core. As shown here as well as many other studies, this non

  10. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Noronha, Donald M.; Pius, Illipparambil C.; Chaudhury, Satyajeet [Bhabha Atomic Research Centre, Mumbai (India). Fuel Chemistry Div.

    2015-07-01

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the K{sub d} value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  11. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    International Nuclear Information System (INIS)

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the Kd value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  12. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  13. Solubility of americium collected on an aerosol filter

    International Nuclear Information System (INIS)

    Kinetics of dissolution of undefined americium aerosol in simulated serum ultrafiltrate was studied. 241Am was present in aerosol collected at a workplace, where an intake of 241Am had occurred formerly. Dissolution experiments in four parts of an aerosol filter were carried out either in ambient air or under CO2 and pH was kept within physiological range. Two?phase kinetics was found in both cases with dissolution half?times for rapid and slow phases ranging from 0.16 to 0.23 d and from 150 to 500 d, respectively. Regardless data dispersion, found half?times justify use of class M model in intake assessment. (author)

  14. The 1976 Hanford Americium Accident: Then and Now

    Energy Technology Data Exchange (ETDEWEB)

    Carbaugh, Eugene H.

    2013-10-02

    The 1976 chemical explosion of an 241Am ion exchange column at a Hanford Site waste management facility resulted in the extreme contamination of a worker with 241Am, nitric acid and debris. The worker underwent medical treatment for acid burns, as well as wound debridement, extensive personal skin decontamination and long-term DTPA chelation therapy for decorporation of americium-241. Because of the contamination levels and prolonged decontamination efforts, care was provided for the first three months at the unique Emergency Decontamination Facility with gradual transition to the patient’s home occurring over another two months. The medical treatment, management, and dosimetry of the patient have been well documented in numerous reports and journal articles. The lessons learned with regard to patient treatment and effectiveness of therapy still form the underlying philosophy of treatment for contaminated injuries. Changes in infrastructure and facilities as well as societal expectations make for interesting speculation as to how responses might differ today.

  15. Separation of americium from curium by oxidation and ion exchange.

    Science.gov (United States)

    Burns, Jonathan D; Shehee, Thomas C; Clearfield, Abraham; Hobbs, David T

    2012-08-21

    Nuclear energy has the potential to be a clean alternative to fossil fuels, but in order for it to play a major role in the US, many questions about the back end of the fuel cycle must be addressed. One of these questions is the difficult separation of americium from curium. Here, we report the oxidation of Am in two systems, perchloric acid and nitric acid and the affect of changing the acid has on the oxidation. K(d) values were observed and a direct separation factor was calculated and was seen to be as high as 20 for four metal(IV) pillared phosphate phosphonate inorganic organic hybrid ion exchange materials. These ion exchangers are characterized by very low selectivity for cations with low charge but extremely high uptake of ions of high charge. PMID:22827724

  16. Monte Carlo modeling of spallation targets containing uranium and americium

    International Nuclear Information System (INIS)

    Neutron production and transport in spallation targets made of uranium and americium are studied with a Geant4-based code MCADS (Monte Carlo model for Accelerator Driven Systems). A good agreement of MCADS results with experimental data on neutron- and proton-induced reactions on 241Am and 243Am nuclei allows to use this model for simulations with extended Am targets. It was demonstrated that MCADS model can be used for calculating the values of critical mass for 233,235U, 237Np, 239Pu and 241Am. Several geometry options and material compositions (U, U + Am, Am, Am2O3) are considered for spallation targets to be used in Accelerator Driven Systems. All considered options operate as deep subcritical targets having neutron multiplication factor of k∼0.5. It is found that more than 4 kg of Am can be burned in one spallation target during the first year of operation

  17. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  18. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  19. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  20. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  1. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules

    Science.gov (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.

    2013-07-01

    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  2. Mesityl(2,4,6-trimethoxyphenylborinic acid

    Directory of Open Access Journals (Sweden)

    Sergiusz Luliński

    2010-07-01

    Full Text Available In the title molecule, C18H23BO4, the dihedral angle between the least-squares planes of the aromatic rings is 84.88 (3°. The B atom deviates by 0.202 (1 Å from the least-squares plane of the mesityl ring. All of the methoxy groups are approximately coplanar with the 2,4,6-trimethoxyphenyl ring, whereas the BOH group is twisted with respect to it by 19.5°. The borinic OH group is engaged in an intramolecular O—H...O hydrogen bond with one of ortho-methoxy groups. The molecular structure is stabilized by weak C—H...O contacts. In the crystal, molecules are linked by weak C—H...O and C—H...π interactions, generating a three-dimensional network.

  3. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)

    2010-07-01

    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  4. Dicty_cDB: SHA246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHA246 (Link to dictyBase) - - - Contig-U10899-1 | Contig-U12190-1 SHA246P ... 4-21.b_022.ab1 Whole-genome shotgun library of the elephant ... shark (aka elephant ... fish) Callorhinchus milii geno ...

  5. Dicty_cDB: AFJ246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFJ246 (Link to dictyBase) - - - Contig-U16240-1 AFJ246P (Link to Original ... il**mvq***slfklffklsirsrslg*f*ynrwwwtictn*wcwiw *p*sip *vck*siqsvslf*a--- ---TSVCFDGQCSVCXVDSSSVXISXTGIVTT ...

  6. 40 CFR 246.200-6 - Recommended procedures: Storage.

    Science.gov (United States)

    2010-07-01

    ....200-6 Section 246.200-6 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE SEPARATION FOR MATERIALS RECOVERY GUIDELINES Requirements and Recommended Procedures § 246..., the use of stationary compactors, or storage in corrugated boxes or normal waste containers....

  7. 21 CFR 520.246 - Butorphanol tartrate tablets.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Butorphanol tartrate tablets. 520.246 Section 520.246 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... tartrate tablets. (a) Specifications. Each tablet contains 1, 5, or 10 milligrams of butorphanol...

  8. 7 CFR 246.5 - Selection of local agencies.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Selection of local agencies. 246.5 Section 246.5 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF... cost efficiency and cost effectiveness of the local agency in terms of both food and nutrition...

  9. 7 CFR 246.13 - Financial management system.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Financial management system. 246.13 Section 246.13 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN State Agency Provisions §...

  10. 7 CFR 246.9 - Fair hearing procedures for participants.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Fair hearing procedures for participants. 246.9 Section 246.9 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN Participant...

  11. 7 CFR 246.15 - Program income other than grants.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Program income other than grants. 246.15 Section 246.15 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND CHILDREN State Agency Provisions §...

  12. Separation of curium and americium microquantities by chromatographic method with introduction of separating ions. 2. Effect of cadmium ion quantity and method of it introduction in the system on efficiency of curium and americium separation

    International Nuclear Information System (INIS)

    Effect of fractionating cadmium ion and a method of it introduction in the system on efficiency of separation of curium and americium with the use of NTA solutions as an eluent is investigated. It is established that in contrast to mutual sorption of curium, americium and cadmium their selective sorption contributes more complete separation of curium and americium. It is shown that growth of quantity of introduced cadmium increased efficiency of separation. Elution rate not products effect on separation process

  13. Americium(3) solvent extraction by oxides of dialkyl(diaryl)[dialkylcarbamoylmethyl]phosphines (CMPO) from perchloric acid solutions

    International Nuclear Information System (INIS)

    Extraction of americium(3) from perchloric acid solutions by CMPO was investigated. It is shown that americium(3) is much more effectively extracted from perchloric acid solutions, than from nitric acid ones, and increase in americium distribution coefficient depends considerably on reagent nature. As a consequence, anomalous aryl effect increases significantly in perchloric acid solutions. The value of anomalous aryl effect depends directly on stoichiometry of extracted complexes in nitric acid and perchloric acid media. Conditions for extractional concentration of americium up to the 100-fold one with small reagent consumption were suggested

  14. Extraction of Americium(III) by diglycolamides in ionic liquids

    International Nuclear Information System (INIS)

    In the present work, the extraction behavior of Am(lII) in the three isomeric DGAs, TODGA, DEHDODGA and TEHDGA in two ionic liquids, 1-butyl-3-methylimidazolium bis(triflouromethane sulphonyl)imide (C4mimNTf2) and 1-butyl-1-methylpyrrolidinium bis(triflouromethanesulphonyl)imide (C4mpyNTf2) is compared. The distribution ratio of americium was determined at various acidities ranging from 1M to 8M. The distribution values were found to decrease with increase in aqueous phase acidity upto 3M. The DAm values then marginally increased with increase of acidity from 3 to 4M followed by a decrease in distribution values. The distribution ratio obtained for various DGAs followed the order TEHDGA < TODGA < DEHDODGA at aqueous phase acidities ranging from 1-4 M. When the aqueous nitric acid concentration was higher than 4M, the distribution values followed the order DEHDODGA < TEHDGA < TODGA. The anomalous behaviour of unsymmetrical diglycolamide in ionic liquid medium was investigated by IR spectroscopy. The study revealed that the unprotonated fraction of DGA (i.e. the free DGA) increased in the order TEHDGA < TODGA < DEHDODGA, which seems to be responsible for the observed anomalous extraction trend in DEHDODGA in ionic liquid medium

  15. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    International Nuclear Information System (INIS)

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH2)n-NH-C(O)-CH2-P(O)Ph2] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO3 solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient DAm/DEu for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (DAm/DEu). (orig.)

  16. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  17. 48 CFR 246.704 - Authority for use of warranties.

    Science.gov (United States)

    2010-10-01

    ... acquisitions for— (i) Commercial items (see FAR 46.709); (ii) Technical data, unless the warranty provides for extended liability (see 246.708); (iii) Supplies and services in fixed-price type contracts...

  18. Dicty_cDB: VHP246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP246 (Link to dictyBase) - - - Contig-U16439-1 VHP246P (Link to Original ... (bits) Value (Q55C16) RecName: Full=Ubiquitin-like modi fier-activating enzyme... 375 e-102 EF468345_1( EF4 ... BC047256 |pid:none) Xenopus laevis ubiquitin-like modi ... 200 9e-50 AB040073_1( AB040073 |pid:none) Xenop ...

  19. Separation and determination of americium in low-level alkaline waste of NPP origin

    Science.gov (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.

    2006-01-01

    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  20. Americium 241 in vegetation of natural biocenoses and agrocenoses on Belarus territories contaminated with Chernobyl fall-out

    International Nuclear Information System (INIS)

    As a result of beta-decay of plutonium 241 the content of americium 241 increases progressively in soils, contaminated with Chernobyl trans uranium elements. Americium 241 displayed higher (0,5 - 1,5-fold) biological mobility than isotopes of plutonium 239, 240. Activity of americium 241 in surface phyto mass of wild and cultural plants varies from 0,04 to 5,9 Bq/kg of dry weight. Americium 241 contribution to the total trans uranium elements contamination of plants made up 60 - 80% in 1996 - 1998. Investigation of trials from the areas adjacent to the 30-km zone showed that mobility of americium 241 and plutonium was 5 - 15 times as high as in the zone

  1. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  2. Determination of trace concentration of uranium in americium oxide samples by ICP-AES

    International Nuclear Information System (INIS)

    A solvent extraction method has been developed for the determination of uranium (200-2000 ppm) in americium oxide samples. The method involves the quantitative separation of uranium from americium matrix using mixed solvent comprising 1.1M tri-n-butyl phosphate (TBP) +1% trialkyl phosphine oxide (TRPO) + 0.3 M tertiary butyl hydroquinone (TBHQ) in n-dodecane. Uranium from the organic is stripped into the aqueous phase with 0.8 M oxalic acid and determined by ICP-AES. The reliability of the method was ascertained by analytical recovery, which is found to be nearly 100%. (author)

  3. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  4. Extraction and chromatographic separation and concentration of plutonium and americium from natural matrices. Author-review of dissertation submitted for fulfillment of the scientific degree 'Philosophiae doctor' (PhD.)

    International Nuclear Information System (INIS)

    nitric acid and salty of aqueous phase, we can eliminate these undesirable effects. Optimal were the indicate of following composition of aqueous phase 4 M NaNO3 in 0.1 M HNO3; (c) ptimal was the adsorbent, which used in the extraction chromatography and was silanized Chromosorb a Kieselgel. Important factor is the granularity of using adsorbent and fixed of extraction reagent on surface adsorbent. Optimized methods were applied on separation 241Am from real samples of soil, which were sampling from contaminated surroundings of Dudvah. Values mass activity 241Am were in range (0,4 - 24.6) Bq · kg-1 , into sample surroundings of Dudvah. Results of these theses were application like base data for calculations of correlation factor of alpha radionuclide in the sample from surroundings nuclear power plant Jaslovske Bohunice. It showed, that exists certain correlation relationship between activities of plutonium and americium. We can assume on the certain accelerating, which presumed results even. Existing error is occurrence allowable, in this case. The results of thesis are suitable base for others theoretical works, however especially for practically applications at monitoring of eco-toxilic alpha radionuclide at environmental samples. In the time of realization we had minimal experience with separation of actinide. The work gives the first experimental data of range mass activity 241Am on the contaminated soils from surroundings of Dudvah. (author)

  5. Impact of ionic liquids on europium and americium extraction by an upper rim phosphorylated calixarene

    International Nuclear Information System (INIS)

    The solvent extraction of europium and americium using the calixarene 5,11,17,23-tetrakis[dipropylphosphinylmethyl] 25,26,27,28-tetrapropoxycalix[4]arene (conical conformation) in the presence of ionic liquids with different natures was studied. It was shown that upper rim phosphorylated calixarene is able to extract europium and americium from nitric acid to dichloroethane by forming a 1:1 complex without the addition of ionic liquids. The distribution coefficients of americium are higher than those of europium in this case, but the isolation degrees of both elements are insufficient for this system to be useful in extraction technologies. The addition of the ionic liquid trihexyl(tetradecyl)phosphonium hexafluorophosphate increases the europium distribution coefficient by values ranging from twofold to more than two orders of magnitude at ionic liquid concentrations of 1 and 50 %, respectively. The values of the distribution coefficients for americium are increased by approximately 25-fold after a 50 % addition of the ionic liquid. (author)

  6. Understanding the Chemistry of Uncommon Americium Oxidation States for Application to Actinide/Lanthanide Separations

    Energy Technology Data Exchange (ETDEWEB)

    Leigh Martin; Bruce J. Mincher; Nicholas C. Schmitt

    2007-09-01

    A spectroscopic study of the stability of Am(V) and Am(VI) produced by oxidizing Am(III) with sodium bismuthate is presented, varying the initial americium concentration, temperature and length of the oxidation was seen to have profound effects on the resultant solutions.

  7. Speciation and bioavailability of plutonium and americium in the Irish Sea and other marine ecosystems

    International Nuclear Information System (INIS)

    Since the late 1960s, the Irish Sea has become a repository for a variety of radio-elements originating mainly in discharges from the British Nuclear Fuels (BNF) plc. Sellafield reprocessing complex located on the Cumbrian coast. In particular, transuranium nuclides such as plutonium, americium and curium (the main constituents of the α-emitting discharges) have become incorporated into every marine compartment by a variety of mechanisms, many of which are not well understood. Although extensive studies have been carried out in the near-field (eastern Irish Sea, especially in the vicinity of the discharge point and collateral muddy sediments), comparatively little had been done to assess the long-term behaviour and bioavailability of plutonium and americium in the far-field, e.g., the western Irish Sea, prior to the present study. In this dissertation, the results of an extensive research programme, undertaken in order to improve and refine our understanding of the behaviour of plutonium and americium in the marine environment, are presented. Specifically, the thesis details the results of (and conclusions deduced from) a series of experiments in which the physical and chemical speciation, colloidal association, mobility and bioavailability of plutonium and americium were examined in diverse environments including the Irish Sea and the Mediterranean. (author)

  8. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  9. Extraction chromatographic recovery of americium from acidic raffinate solutions using CMPO adsorbed on Chromosorb-102

    International Nuclear Information System (INIS)

    Microgram amounts of americium have been separated and purified from large amounts of uranium present in effluent solutions resulting from the anion-exchange columns during the purification and recovery of plutonium by using TBP extraction followed by extraction chromatography using CMPO adsorbed on Chromosorb-102. (author). 4 refs., 1 tab

  10. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  11. Development of analytical methods for the separation of plutonium, americium, curium and neptunium from environmental samples

    OpenAIRE

    Salminen, Susanna

    2009-01-01

    In this work, separation methods have been developed for the analysis of anthropogenic transuranium elements plutonium, americium, curium and neptunium from environmental samples contaminated by global nuclear weapons testing and the Chernobyl accident. The analytical methods utilized in this study are based on extraction chromatography. Highly varying atmospheric plutonium isotope concentrations and activity ratios were found at both Kurchatov (Kazakhstan), near the former Semipalatinsk...

  12. Determination of specific activity of americium and plutonium in selected environmental samples

    International Nuclear Information System (INIS)

    The aim of this work was development of method for determination of americium and plutonium in environmental samples. Developed method was evaluated on soil samples and after they was applied on selected samples of fishes (smoked mackerel, herring and fillet from Alaska hake). The method for separation of americium is based on liquid separation with Aliquate-336, precipitation with oxalic acid and using of chromatographic material TRU-SpecTM.The intervals of radiochemical yields were from 13.0% to 80.9% for plutonium-236 and from 10.5% to 100% for americium-241. Determined specific activities of plutonium-239,240 were from (2.3 ± 1.4) mBq/kg to (82 ± 29) mBq/kg, the specific activities of plutonium-238 were from (14.2 ± 3.7) mBq/kg to (708 ± 86) mBq/kg. The specific activities of americium-241 were from (1.4 ± 0.9) mBq/kg to (3360 ± 210) mBq/kg. The fishes from Baltic Sea as well as from North Sea show highest specific activities then fresh-water fishes from Slovakia. Therefore the monitoring of alpha radionuclides in foods imported from territories with nuclear testing is recommended

  13. Application of hollow fiber supported liquid membrane for the separation of americium from the analytical waste

    International Nuclear Information System (INIS)

    Americium from analytical solid waste containing U and metallic impurities was separated using hollow fiber supported liquid membrane (HFSLM) technique impregnated with DHOA-TODGA from nitric acid medium. An aliquot of 5 g of the solid waste containing Am (19.95 mg) as minor actinide and of U (2,588 mg), Fe (1,360 mg), Ca (1,810 mg) and Na (3,130 mg) as major impurities was processed. The feed solution obtained after the dissolution of the residue in ∼4 M HNO3 was passed through HFSLM module. In the first stage using 1 M DHOA-dodecane was used for the separation of Am from other impurities. Though, majority of the elements were separated in this cycle, Ca was co extracted along with the americium. CMPO extraction chromatographic technique was used for further separation of americium from Ca. Significant decontamination factors were achieved in this three step separation process with respect to U, Fe, Na and Ca with ∼77 % recovery of americium. (author)

  14. Determination of α-emitters (plutonium, americium, curium ...) in feces and urine ashes

    International Nuclear Information System (INIS)

    A description is given of the methods used to determine a number of radionuclides to be found in feces and urine, and obtain samples thin enough for counting and α-spectrometry. These methods can be applied to plutonium, americium and curium especially

  15. Upper Limits to Americium Concentration in Medium Size Sodium Cooled Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.P.; Wallenius, J. [Royal Institute of Technology (KTH), AlbaNova University Centre, S-106 91, Stockholm (Sweden)

    2009-06-15

    The fastest way to realize transmutation of minor actinides would be using existing reactor types, adding some proper modifications to allow for insertion of MA in the fuel. According to calculations by Fazio and co-workers, the consumption rate of TRU in a low conversion ratio fast reactor may reach 70-75 % of that of an ADS with uranium free fuel [1]. However, americium introduction brings a negative influence on several safety parameters such as {beta}{sub eff}, Doppler coefficient, coolant temperature coefficient and void worth. Therefore the upper limit of americium that can be included into the fuel needs to be carefully evaluated. In this paper, fast reactor fuels with various minor actinide fractions are loaded into a SAS4A model of the semi-commercial BN600 reactor. Unprotected loss of flow (ULOF) and transient over power (UTOP) accidents are modelled using safety parameters obtained from Monte Carlo simulations as well as from the deterministic calculations published by Fazio et al. Applying the latter parameters (obtained with VARI3D), the upper limit to MA concentration in the fuel of a medium sized SFR of BN-600 type appears at 12%, corresponding to 8% of americium. We note however that the Doppler constants displayed by Fazio et al for MA concentrations above 10% have a considerably larger magnitude than those obtained with MCNP. Applying the safety parameters obtained with Monte Carlo simulations and updated nuclear data evaluations, we find that the upper limit to the americium concentration allowing to survive a ULOF is about half of that inferred by the use of parameters from VARI-3D. Since such a difference has a major impact on the predicted americium transmutation capability of SFR, it is of high priority to analyse the reasons for the apparent discrepancies. We note here that the major contribution to the Doppler feedback comes from capture resonance in U-238 and Pu-240 residing below the sodium scattering resonance located at 3 keV, and that

  16. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  17. Dicty_cDB: VHD246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHD246 (Link to dictyBase) - - - Contig-U11170-1 VHD246P (Link to Original ... ce. 38 0.28 5 CX072513 |CX072513.1 UCRCS08_28E10_g Parent ... Washington Navel Orange Callus cDNA Library UCRCS0 ... nce. 46 1.4 1 CX072512 |CX072512.1 UCRCS08_28E10_b Parent ... Washington Navel Orange Callus cDNA Library UCRCS0 ...

  18. Interaction and diffusion transport of americium in soils

    International Nuclear Information System (INIS)

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of 241Am in soils. The 241Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (Kd) and desorption percentage. Kd (Am) values ranged from 103 to 105 L kg-1 and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in 241Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between Kd (Am) values and a soil property was not found, the main properties affecting 241Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption capacity was observed in all soils due to the dissolution of soil

  19. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  20. 48 CFR 246.470-2 - Quality evaluation data.

    Science.gov (United States)

    2010-10-01

    ... SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Government Contract Quality Assurance 246.470-2 Quality evaluation data. The contract administration office shall establish a system for the... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Quality evaluation...

  1. 7 CFR 246.6 - Agreements with local agencies.

    Science.gov (United States)

    2010-01-01

    ... nutrition education services to participants, in compliance with § 246.11 and FNS guidelines and... Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS SPECIAL SUPPLEMENTAL NUTRITION PROGRAM FOR WOMEN, INFANTS AND...

  2. 40 CFR Appendix to Part 246 - Recommended Bibliography

    Science.gov (United States)

    2010-07-01

    ... Part 246 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES SOURCE... Belknap, M. Paper recycling: a business perspective. Subcommittee on Solid Waste, New York Chamber of... Publication SW-155. Washington, U.S. Government Printing Office, 1975. 26 p. Hansen, P. Solid waste...

  3. 48 CFR 1852.246-73 - Human space flight item.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Human space flight item... 1852.246-73 Human space flight item. As prescribed in 1845.370(b), insert the following clause: Human Space Flight Item (MAR 1997) The Contractor shall include the following statement in all...

  4. 40 CFR 86.246-94 - Intermediate temperature testing.

    Science.gov (United States)

    2010-07-01

    ...) contained in 40 CFR part 86, subpart C. (c) For testing at temperatures of 50 °F (10 °C) or higher, the FTP... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Intermediate temperature testing. 86... New Medium-Duty Passenger Vehicles; Cold Temperature Test Procedures § 86.246-94...

  5. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  6. Development of ST-246® for Treatment of Poxvirus Infections

    Directory of Open Access Journals (Sweden)

    Dennis E. Hruby

    2010-11-01

    Full Text Available ST-246 (Tecovirimat is a small synthetic antiviral compound being developed to treat pathogenic orthopoxvirus infections of humans. The compound was discovered as part of a high throughput screen designed to identify inhibitors of vaccinia virus-induced cytopathic effects. The antiviral activity is specific for orthopoxviruses and the compound does not inhibit the replication of other RNA- and DNA-containing viruses or inhibit cell proliferation at concentrations of compound that are antiviral. ST-246 targets vaccinia virus p37, a viral protein required for envelopment and secretion of extracellular forms of virus. The compound is orally bioavailable and protects multiple animal species from lethal orthopoxvirus challenge. Preclinical safety pharmacology studies in mice and non-human primates indicate that ST-246 is readily absorbed by the oral route and well tolerated with the no observable adverse effect level (NOAEL in mice measured at 2000 mg/kg and the no observable effect level (NOEL in non-human primates measured at 300 mg/kg. Drug substance and drug product processes have been developed and commercial scale batches have been produced using Good Manufacturing Processes (GMP. Human phase I clinical trials have shown that ST-246 is safe and well tolerated in healthy human volunteers. Based on the results of the clinical evaluation, once a day dosing should provide plasma drug exposure in the range predicted to be antiviral based on data from efficacy studies in animal models of orthopoxvirus disease. These data support the use of ST-246 as a therapeutic to treat pathogenic orthopoxvirus infections of humans.

  7. Metabolism of americium-241 in man: an unusual case of internal contamination of a child and his father

    International Nuclear Information System (INIS)

    The metabolism of americium-241 was studied during an 8-yr period of an adult male and his son who, at the ages of 50 and 4, respectively, were accidentally and unknowingly contaminated within their home by means of inhalation. Chelation therapy with Na3(Ca-DTPA) was more effective in enhancing the removal of americium-241 from the child than from his father

  8. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  9. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  10. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  11. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  12. Influence of some organic additives on the extractive separation of americium(III) by sulfoxides

    International Nuclear Information System (INIS)

    The solvent extraction behavior of americium(III) from aqueous nitrate media by two long-chain aliphatic sulfoxides has been examined systematically in the presence of several water-miscible organic solvents to study their possible synergistic effect on metal ion extraction. Methanol, ethanol, n- and isopropanol, n-butanol, dioxane, acetone, as well as acetonitrile, were employed as the organic component of the mixed (polar) phase. These additives affected the extraction to varying degrees. Extractability of Am increased 5 to 10-fold with increasing concentration of some of these additives, with the maximum enhancement being observed in the presence of acetone or acetonitrile. However, alcohols are generally very poor in this respect. Possible reasons for such behavior are briefly discussed. The distribution of several common contaminants was also investigated at the optimum condition for americium extraction

  13. Transmutation of americium and curium incorporated in zirconia-based host materials

    International Nuclear Information System (INIS)

    Presented are studies involving the incorporation of americium and curium in zirconia-based materials. First explored was the pseudo ternary system AmO2-ZrO2-Y2O3. It was determined that selected Y-CSZ materials can incorporate significant quantities of americium oxide and remain cubic single-phase. The cell parameters of these fluorite-type products were established to be linear with the AmO2 content. The Cm2O3-ZrO2 system was also investigated. It was found that at 25 mol% of CmO1.5, the Cm(III) stabilized zirconia in its cubic form (a = 5.21 ±0.01 Angstrom). At higher and lower concentrations, diphasic materials were encountered. At 50 mol% of CmO1.5, a pyrochlore oxide - Cm2Zr2O7 - is formed (a = 10.63 ±0.02 Angstrom). (author)

  14. Americium and samarium determination in aqueous solutions after separation by cation-exchange

    International Nuclear Information System (INIS)

    The concentration of trivalent americium and samarium in aqueous samples has been determined by means of alpha-radiometry and UV-Vis photometry, respectively, after chemical separation and pre-concentration of the elements by cation-exchange using Chelex-100 resin. Method calibration was performed using americium (241Am) and samarium standard solutions and resulted in a high chemical recovery for cation-exchange. Regarding, the effect of physicochemical parameters (e.g. pH, salinity, competitive cations and colloidal species) on the separation recovery of the trivalent elements from aqueous solutions by cation-exchange has also been investigated. The investigation was performed to evaluate the applicability of cation-exchange as separation and pre-concentration method prior to the quantitative analysis of trivalent f-elements in water samples, and has shown that the method could be successfully applied to waters with relatively low dissolved solid content. (author)

  15. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)

    2002-01-01

    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  16. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  17. Contemporary state of plutonium and americium in the soils of Palesse state radiation-ecological reserve

    International Nuclear Information System (INIS)

    Full text: At present, the most important alpha-emitting radionuclides of Chernobyl origin are Pu 238, Pu 239, Pu 240 and Am 241. They are classified as the most dangerous group of radionuclides in view of the long half-lives and high radiotoxicity. The main part of alpha-emitted radionuclides is located within the Palesse State Radiation-Ecological Reserve. One of the most important factors determining the radioecological situation in the contaminated ecosystems is the physicochemical forms of radionuclides in a soil medium. Radionuclide species determine the radionuclide entrance into the soil solutions, their redistribution in soil profiles and the 'soil - plant' and the 'soil - surface, ground or underground water' systems as well as spreading beyond the contaminated area. The present work is devoted to investigation of state and migration ability of plutonium and americium in soils of the Palesse state radiation-ecological reserve after more than 20 years from the Chernobyl accident. The objects of investigation were mineral and organic soils sampled in 2008 with the step of 5 cm to the depth of 25-30 cm. The forms of plutonium and americium distinguishing by association with the different components of soil and by potential for migration in the soil medium were studied using the method of sequential selective extraction according to the modified Tessier scheme. Activities of Pu 238, Pu 239, Pu 240 and Am 241 in the samples were determined by the method of radiochemical analysis with alpha-spectrometer radionuclide identification. The dominant part of plutonium and americium in the soils is in immobile forms. Nowadays, radionuclide portions in water soluble and reversibly bound forms do not exceed 9.4 % of radionuclide content in the soil. In mineral soil samples, the radionuclide portions in these fractions exceed the corresponding portions in organic ones. In both mineral and organic soils, the portions of mobile americium are higher than plutonium. The

  18. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  19. 48 CFR 52.246-17 - Warranty of Supplies of a Noncomplex Nature.

    Science.gov (United States)

    2010-10-01

    ... Noncomplex Nature. 52.246-17 Section 52.246-17 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.246-17 Warranty of Supplies of a Noncomplex Nature. As prescribed in 46.710(a)(1), insert a clause substantially as follows: Warranty of Supplies of a Noncomplex Nature (JUN 2003) (a)...

  20. 48 CFR 52.246-18 - Warranty of Supplies of a Complex Nature.

    Science.gov (United States)

    2010-10-01

    ... Complex Nature. 52.246-18 Section 52.246-18 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.246-18 Warranty of Supplies of a Complex Nature. As prescribed in 46.710(b)(1), insert a clause substantially as follows: Warranty of Supplies of a Complex Nature (MAY 2001) (a) Definitions. As used in...

  1. 48 CFR 552.246-77 - Additional Contract Warranty Provisions for Supplies of a Noncomplex Nature.

    Science.gov (United States)

    2010-10-01

    ... Warranty Provisions for Supplies of a Noncomplex Nature. 552.246-77 Section 552.246-77 Federal Acquisition... a Noncomplex Nature. As prescribed in 546.710(a), insert the following clause in solicitations and contracts that include FAR 52.246-17, Warranty of Supplies of a Noncomplex Nature. Additional...

  2. 10 CFR 431.246 - Energy conservation standards and their effective dates.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy conservation standards and their effective dates. 431.246 Section 431.246 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY EFFICIENCY PROGRAM FOR CERTAIN COMMERCIAL AND INDUSTRIAL EQUIPMENT Unit Heaters Energy Conservation Standards § 431.246...

  3. 48 CFR 246.402 - Government contract quality assurance at source.

    Science.gov (United States)

    2010-10-01

    ... quality assurance at source. 246.402 Section 246.402 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT QUALITY ASSURANCE Government Contract Quality Assurance 246.402 Government contract quality assurance at source. Do not...

  4. 40 CFR 246.201-6 - Recommended procedures: Transportation to market.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Recommended procedures: Transportation to market. 246.201-6 Section 246.201-6 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Procedures § 246.201-6 Recommended procedures: Transportation to market. Transportation to market may...

  5. Fabrication of neptunium, plutonium, americium and curium metals for fuel research

    International Nuclear Information System (INIS)

    The techniques for the fabrication of actinide metals; neptunium, americium and curium called as minor actinides, and plutonium, are surveied in a viewpoint of the preparation of starting materials for fuel property measurements. In this report, the processes of the conversion to metals, purification et al. are reviewed. The concept related to the apparatus design is also proposed and the considerable subjects are discussed. (author)

  6. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  7. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    International Nuclear Information System (INIS)

    Highlights: • Dust free process for (U,Am)O2 transmutation target fabrication. • Synthesis of U0.9Am0.1O2 mixed oxide microspheres from ion exchange resin. • Fabrication of dense U0.9Am0.1O2 pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U0.9Am0.1O2±δ is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U0.9Am0.1O2±δ. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials

  8. Influence of dissolved organic substances in groundwater on sorption behavior of americium and neptunium

    International Nuclear Information System (INIS)

    Groundwaters typically contain dissolved organic carbon consisting largely of high molecular weight compounds of humic and fulvic acids. To evaluate whether these dissolved organic substances can enhance the tranport of radionuclides through the groundwater system, experiments were conducted to examine the sorption of americium and neptunium onto crushed basalt in the presence of dissolved humic- and fulvic-acid organic carbon introduced into synthetic groundwater. The partitioning experiments with synthetic groundwater show that increasing the concentration of either humic or fulvic acid in the water has a significant inhibiting effect on sorption of both americium and neptunium. At 220C, adsorption of these radionuclides, as measured by distribution ratios (the ratio of nuclide sorbed onto the solid to nuclide in solution at the end of the experiment), decreased by 25% to 50% by addition of as little as 1 mg/L dissolved organic carbon and by one to two orders of magnitude by addition of 100 to 200 mg/L dissolved organic carbon. Distribution ratios measured in solutions reacted at 900C similarly decreased with the addition of dissolved organic carbon but generally ranged from one to two orders of magnitude higher than those determined in the 220C experiment. These results suggest that organic carbon dissolved in deep groundwaters may significantly enhance the mobility of radionuclides of americium and neptunium. 23 references, 5 figures, 11 tables

  9. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1974-09-01

    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  10. Selective recovery of americium alone from PUREX or COEXTM raffinate by the EXAm process

    International Nuclear Information System (INIS)

    Americium is the main contributor to the long-term radiotoxicity and to the heat generation of glasses used for the HLW conditioning. To decrease both impact on the ultimate waste and to avoid the difficult recycling of curium, the CEA has developed the EXAm process for the the separation and the recovery of the sole americium directly from PUREX or COEXTM raffinates. The principle of the EXAm process is to extract americium and light lanthanides from high nitric acid media, leaving curium and heavy lanthanides in the raffinate. A water-soluble amide molecule, TEDGA, is added in aqueous phase to increase Am/Cm and Am/heavy lanthanides selectivity, because of the preferential complexation of curium and heavy lanthanides by this diglycolamide. Many experimental data have been acquired mainly at the extraction-scrubbing step (Am/Cm separation) and were used for the development of a phenomenological model implemented in the PAREX process simulation code. The scientific feasibility demonstration of the EXAm process was then performed on a genuine PUREX raffinate in Atalante CBP hot cell in 2010. (author)

  11. Uptake and effects of americium-241 on a brackish-water amphipod

    International Nuclear Information System (INIS)

    The present paper reports the results of experimental work undertaken using the brackish-water amphipod Gammarus duebeni duebeni and the transuranium nuclide americium-241. Data on the accumulation of this actinide showed that the larger fraction of the total body burden is associated with the exoskeleton. It was found that the body burden remained constant in the range pH 8.0-6.5 even though the water concentration changed markedly. It would thus appear that the concept of a concentration factor should be re-examined and it is proposed that a factor should be defined in terms of environmental and chemical parameters which represent the bioavailable fraction of the actinide. The effect of americium on survival and moulting was studied at two activity concentrations; the dose rates and absorbed doses under the experimental conditions employed have been estimated. The differences in survival rates between the control and irradiated groups were statistically analyzed and the significant difference at the higher concentration is believed to be due to a synergism between physiological stress and radiotoxicity of americium rather than the chemical toxicity of the element. (orig.)

  12. Dicty_cDB: SHK246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CJ486536 |CJ486536.1 Macaca fascicularis mRNA, clone: QtsA-14165, 5' end, expressed in testis. 42 0.012 2 A...frontal lobe. 48 0.54 1 AM076235 |AM076235.1 Staphylococcus aureus partial sdrD gene for Ser-Asp rich fibrinogen-binding, bone si...l*tr*sttfksfh tfkynnlvtr*sngckcntq*scqrsiys*rtk*ryy*sdhlcnwr*gytrf*khni*g* wlrgwccyssiip...00686 |pid:none) Roseiflexus sp. RS-1, complete ... 75 5e-12 (Q7A780) RecName: Full=Serine-aspartate repeat-...SH (Link to library) SHK246 (Link to dictyBase) - - - Contig-U15700-1 SHK246P (Link to Original si

  13. Determination of 2,4,6-trichloroanisole by cyclic voltammetry

    OpenAIRE

    Freitas, Patrícia; Dias, L.G.; Peres, António M.; Luís M. de Castro; Veloso, Ana C. A.

    2012-01-01

    The electrochemical reduction of 2,4,6-trichloroanisole (TCA), which is a chlorinated arene with electron-donating substituents, was evaluated by cyclic voltammetry (CV). TCA is a major concern for the winery industry since it is related with “cork taint”, a wine defect. The results obtained in this work showed that CV could be used to detect and quantify TCA in preparative standard solutions. Linear relationships could be set between the current amplitude and TCA concentration (R...

  14. Solidification Effects in MAR-M246(Hf) Alloy

    Science.gov (United States)

    Johnston, M. H.; Parr, R. A.

    1987-01-01

    Fatigue properties degraded with crystallographic orientations greater than 10 degrees from {001} axis. Influence of solidification and heat-treatment parameters on structure and fatigue properties of nickel-based superalloy MAR-M246(Hf) described in 24-page report. Superalloys have high strength and corrosion resistance at temperatures up to 1,400 degrees C; their uses range from petrochemical equipment to marine, industrial, aircraft, and vehicular gas turbines.

  15. About the reaction between uranium-americium mixed oxides and sodium

    International Nuclear Information System (INIS)

    The recycling and fission of the highly toxic minor actinides neptunium and americium is only possible in a liquid metal cooled fast breeder reactor, for nuclear physical reasons. The present work is part of a research program dealing with the fuel-coolant interaction. Fuel pellets with equal parts of americium and uranium and varying oxygen-metal ratio were investigated. A behaviour comparable to that of uranium-plutonium mixed oxides was suggested as a first approach. The reaction of sodium with (U0.5Am0.5)O2-x results in a complete desintegration of the sintered pellet whereas (U, Pu)O2-x pellets show a small increase in volume. A first explanation of the strong reaction of uranium-americium mixed oxides compared to (U, Pu)O2-x or (U, Np)O2-x could be provided by the less negative oxygen potential of the former. Ternary and polynary oxides which are possible products of the fuel-coolant reaction were prepared and characterised by X-ray diffraction. Their oxygen potentials were measured using a solid state e.m.f. cell. Neither Na2AmO3 nor Na3AmO4 can coexist with sodium metal. The measured ΔGO2 values of the Am(IV) and Am (V)-compounds are much higher than those of the sodium uranates(VI) or sodium neptunates(VI). Only Na2O seems to be likely as product of the fuel-coolant interactions. It could be determined in reacted samples by X-ray diffraction. The relatively high oxygen potentials of (U0.5Am0.5)O2-x that are responsible for the reaction could be explained by a binding model which is based on an americium valency state of + 3 and U5+. The existence of both valency states could be proved by XPS measurements. Due to the similar behaviour of neptunium and uranium the problems that are expected for the recycling of Np are much smaller than for americium

  16. Photocatalytic degradation of 2,4,6-trinitrotoluene

    Institute of Scientific and Technical Information of China (English)

    LIU XiuHua; FU YiBei; WANG HeYi; ZHONG ZhiJing; XU YunShu

    2008-01-01

    A Pt/TiO2 photocatalyst was used in the photocatalytic degradation of 2,4,6-trinitrotoluene (TNT) under the irradiation of the simulated sunlight. The results show that the destruction of TNT is faster and more complete with the photocatalyst. The photocatalytic degradation of TNT follows first order kinetics. The transformation of nitryl groups of TNT molecules into nitrite and nitrate ions may be accelerated in the presence of the Pt/TiO2 photocatalyst. Compared with that without the catalyst, the concentration of nitrate ions was improved 32.3 times within 2.5 h.

  17. Dicty_cDB: SHJ246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHJ246 (Link to dictyBase) - - - Contig-U16427-1 - (Link to Original site) ... yfg*ytlyiyiiq*nviffrtdfrkdgfhr*ry*ihgns*sck*irkryf*ngs ... nl*k*ncykiisins*fsk*csrkcc*mfrfin*ks*rftsnrny*yiik ... f--- Homology vs CSM-cDNA Score E Sequences producing s ignificant alignments: (bits) Value VHP493 (VHP493 ... 003. 6. 8 Homology vs DNA Score E Sequences producing s ignificant alignments: (bits) Value N AC116956 |AC ... 5.10 Homology vs Protein Score E Sequences producing s ignificant alignments: (bits) Value (Q86KD1) RecNa ...

  18. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)

    2010-06-15

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  19. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  20. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  1. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: sebastien.picart@cea.fr [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)

    2014-10-15

    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  2. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  3. Recovery of Americium-241 from lightning rod by the method of chemical treatment

    International Nuclear Information System (INIS)

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 (241Am), fewer and Radium 226 (226Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of 241Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The 241Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel 241Am technique was used electrodeposition. (author)

  4. Report of scouting study on precipitation of strontium, plutonium, and americium from Hanford complexant concentrate waste

    International Nuclear Information System (INIS)

    A laboratory scouting test was conducted of precipitation methods for reducing the solubility of radionuclides in complexant concentrate (CC) waste solution. The results show that addition of strontium nitrate solution is effective in reducing the liquid phase activity of 90Sr (Strontium) in CC waste from tank 107-AN by 94% when the total strontium concentration is adjusted to 0.1 M. Addition of ferric nitrate solution effective in reducing the 241Am (Americium) activity in CC waste by 96% under the conditions described in the report. Ferric nitrate was also marginally effective in reducing the solubility of 239/240Pu (Plutonium) in CC waste

  5. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  6. Americium and curium heterogeneous transmutation in moderated S/ A in the framework of CNE scenarios studies

    International Nuclear Information System (INIS)

    This paper presents the transmutation of Americium and Curium in a heterogeneous mode in the framework of the 1991 French Law concerning waste management. Two scenarios with moderated targets are presented: a 100% frit reactor (EFR) scenario multi-recycling Pu+Np with targets of Am+Cm placed in core and a mixed PWR (UOX fuel) and fast reactor (50% of EFR) multi-recycling Pu+Np and containing targets in core and in the blanket region. The design of the target is based on classical fast fuel S/A technology (pins, spacer wires,...) and should reach the goal of 90% fission rate. (authors)

  7. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids.

    Science.gov (United States)

    Dittrich, Timothy Mark; Boukhalfa, Hakim; Ware, Stuart Douglas; Reimus, Paul William

    2015-10-01

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater-bentonite-fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L(-1)) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10(-10) M (241)Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (k(f)) of 0.01-0.02 h(-1). Am recoveries in each column were 55-60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h(-1) in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance scales because

  8. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  9. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  10. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning; Holm, E.; Boelskifte, S.; Duniec, S.; Persson, B.

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north of...

  11. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  12. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code is developed to predict the extraction behavior of americium and lanthanides in the TRUEX (TRansUranium EXtraction)process. This code gives the concentration profiles of the components at steady state. The stage efficiency is included in this code as a parameter in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated concentration profiles are compared with the experimental results. The efficiency value for the mixer-settlers, which gives good agreement between the calculated and the experimental profiles, is evaluated. (author)

  13. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code for the TRUEX (TRansUranium EXtraction) process is developed to predict the extraction behavior of americium and lanthanides. This code gives the concentrations of the components at the steady state of the TRUEX process. The stage efficiency is applied to this code in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated profiles are compared with the experimental ones. The efficiency value for the mixer-settlers, which gives the best agreement between the two profiles, is investigated

  14. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  15. Experimental and in situ investigations on americium, curium and plutonium behaviour in marine benthic species: transfer from water or sediments

    International Nuclear Information System (INIS)

    The tranfer of transuranic elements -americium, curium and plutonium- from the sediments containing them to some marine benthic species (endofauna and epifauna) was studied with a twofold approach - laboratory and in-situ investigation. The experimental investigations, divided into three parts, made it possible to specify concentration factors (F.C.), transfer factors (F.T.) and to understand the process involved for 5 benthic species. The result were refined by an in-situ study that brought new data on the marine distribution of the transuranic elements released by the La Hague plant. Finally, the localization of americium and plutonium in the tissues and cells of these species was determined by autoradiography

  16. Vitrification of F-area americium/curium: feasibility study and preliminary process recommendation

    International Nuclear Information System (INIS)

    Work was performed to identify a process to vitrify the contents of F- canyon Tank 17.1. Tank 17.1 contains the majority of americium (Am) and curium (Cm) contained in the DOE Complex. Oak Ridge National Laboratory (ORNL) has made a formal request for this material as fuel for production of Cf252 and other transplutonium actinides. The Am and Cm (and associated lanthanide fission products) are currently in nitric acid solution. Transportation of the intensely radioactive Am/Cm in liquid form is not considered possible. As a result, the material will either be solidified and shipped to ORNL or discarded to the Tank Farm. Nuclear Materials Processing Technology (NMPT), therefore, requested Defense Waste Processing Technology (DWPT) to determine if the Tank 17.1 material could be vitrified, and if it was vitrified could the americium and curium be successfully recovered. Research was performed to determine if the Tank 17.1 contents could indeed be mixed with glass formers and vitrified. Additional studies identified critical process parameters such as heat loading, melter requirements, off-gas evolution, etc. Discussions with NMPT personnel were initiated to determine existing facilities where this work could be accomplished safely. A process has been identified which will convert the Am/Cm material into approximately 300kg of glass

  17. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    International Nuclear Information System (INIS)

    A dual isotope method has been used to study the transfer of 137Cs, 239/240Pu and 241Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10-5 - 10-4, with mean values of 7 x 10-5 and 4 x 10-5 obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10-4 recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  18. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.I.; Weekes, T.E.C. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Biological and Nutritional Sciences; Rimmer, D.L. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Agricultural and Environmental Science; Green, N.; Wilkins, B.T. [National Radiological Protection Board, Chilton (United Kingdom)

    1997-12-31

    A dual isotope method has been used to study the transfer of {sup 137}Cs, {sup 239/240}Pu and {sup 241}Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10{sup -5} - 10{sup -4}, with mean values of 7 x 10{sup -5} and 4 x 10{sup -5} obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10{sup -4} recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  19. Americium and europium extraction from carbonate solutions by 1-phenyl-3-methyl-4-benzoylpyrazolone -5

    International Nuclear Information System (INIS)

    Trivalent TPEs and REEs are extractable from carbonate solutions by 1-pheny-3-methyl-4-benzoylpyrazolone-5 (PMBP). The effect of concentration of KHCO3 and K2CO3, extractant, metal, and other factors on the extent of extraction of the elements has been clarified. The kinetics of extraction of the elements from carbonate solutions has been studied. It has been shown that in the KHCO3 concentration range 0.2-2.0 M americium and europium are extracted by PMBP solutions in different diluents with distribution coefficients lying within n x 102-n x 103. From K2CO3 solutions the elements are extracted better by PMBP solutions in methyl isobutyl ketone (MIBK). It has been shown that metal concentration in the range 1x10-5. 5x10-3 g-ion x liter-1 does not affect extraction (log E = 3). Extracts based on PMBP with a metal content higher than 5x10-3g-ion x liter-1 were obtained by absolute concentrating method and were used for the study of 13C NMR spectra. The composition of thecompounds extracted by PMBP from carbonate solutions was determined by 13C NMR spectroscopy and extraction. The conditions of europium and americium reextraction from extracts based on PMBP by complexones, their mixtures with alkalis and other substances were studied. The scopes for using the system PMBP-carbonate solutions to separate and concentrate TPEs and REEs has been examined

  20. Evaluation of americium-241 toxicity influence on the microbial growth of organic wastes

    International Nuclear Information System (INIS)

    Available in abstract form only. Full text of publication follows: Since the licenses for using radioactive sources in radioactive lightning rods were lifted by the Brazilian national nuclear authority, in 1989, the radioactive devices have been replaced by Franklin type and collected as radioactive waste. However, only 20 percent of the estimated total number of installed rods was delivered to Brazilian Nuclear Commission. This situation causes concern, due to, first, the possibility of the rods being disposed as domestic waste, and second, the americium, the most commonly employed radionuclide, is classified as a high-toxicity element. In the present study, Am-241 migration experiments were performed by a lysimeter system, in order to evaluate the risk of contamination caused by radioactive lightning rods disposed as a common solid waste. Besides the risk evaluation, it is important to know the mechanism of the Am-241 release or retention in waste as well as its influence in the waste decomposition processes. Many factors are involved, but microorganisms present in the waste play an important role in its degradation, which control the physical and chemical processes. The objective of this work was to evaluate the Am-241 influence on the microbial population by counting number of cells in lysimeters leachate. Preliminary results suggest that americium may influence significantly the bacteria growth in organic waste, evidenced by culture under aerobiosis and an-aerobiosis and the antimicrobial resistance test. (authors)

  1. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  2. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  3. An economic analysis of a light and heavy water moderated reactor synergy: burning americium using recycled uranium

    International Nuclear Information System (INIS)

    An economic analysis is presented for a proposed synergistic system between 2 nuclear utilities, one operating light water reactors (LWR) and another running a fleet of heavy water moderated reactors (HWR). Americium is partitioned from LWR spent nuclear fuel (SNF) to be transmuted in HWRs, with a consequent averted disposal cost to the LWR operator. In return, reprocessed uranium (RU) is supplied to the HWRs in sufficient quantities to support their operation both as power generators and americium burners. Two simplifying assumptions have been made. First, the economic value of RU is a linear function of the cost of fresh natural uranium (NU), and secondly, plutonium recycling for a third utility running a mixed oxide (MOX) fuelled reactor fleet has been already taking place, so that the extra cost of americium recycling is manageable. We conclude that, in order for this scenario to be economically attractive to the LWR operator, the averted disposal cost due to partitioning americium from LWR spent fuel must exceed 214 dollars per kg, comparable to estimates of the permanent disposal cost of the high level waste (HLW) from reprocessing spent LWR fuel. (authors)

  4. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C H; Barney, G S

    1983-03-01

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO/sub 2/, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO/sub 2/ decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition.

  5. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    International Nuclear Information System (INIS)

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO2, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO2 decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition

  6. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  7. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  8. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  9. Application of ion-exchange chromatography to eliminate the curium from americium by his determination by the method of liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    The aim of this work is to eliminate curium in determining of americium by the method of liquid scintillation spectrometry. The paper introduces a method that has been done to eliminate curium from americium by determining of americium with liquid scintillation spectrometry method. In the research we used ion-exchange chromatography and ion-exchange sorbents DOWEX. We also observed the effect of geometry organization of column on the separation course. Resources for alpha spectrometry were prepared by micro-precipitation with neodymium chloride. High radiochemical yields were achieved, but separation did not take place according to a pre-separation scheme. (authors)

  10. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  11. Imitators of plutonium and americium in a mixed uranium- plutonium nitride fuel

    Science.gov (United States)

    Nikitin, S. N.; Shornikov, D. P.; Tarasov, B. A.; Baranov, V. G.; Burlakova, M. A.

    2016-04-01

    Uranium nitride and mix uranium nitride (U-Pu)N is most popular nuclear fuel for Russian Fast Breeder Reactor. The works in hot cells associated with the radiation exposure of personnel and methodological difficulties. To know the main physical-chemical properties of uranium-plutonium nitride it necessary research to hot cells. In this paper, based on an assessment of physicochemical and thermodynamic properties of selected simulators Pu and Am. Analogues of Pu is are Ce and Y, and analogues Am - Dy. The technique of obtaining a model nitride fuel based on lanthanides nitrides and UN. Hydrogenation-dehydrogenation- nitration method of derived powders nitrides uranium, cerium, yttrium and dysprosium, held their mixing, pressing and sintering, the samples obtained model nitride fuel with plutonium and americium imitation. According to the results of structural studies have shown that all the samples are solid solution nitrides rare earth (REE) elements in UN.

  12. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed. 16 refs., 6 figs

  13. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutyl-carbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed

  14. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  15. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    International Nuclear Information System (INIS)

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by 1H and 13C NMR, mass and IR spectroscopy. The extraction behaviour of (152+154)Eu(III) and 241Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for (152+154)Eu(III) and HDEHSDGA shows the superior selectivity for 241Am(III). (orig.)

  16. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids

    International Nuclear Information System (INIS)

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater–bentonite–fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L−1) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10−10 M 241Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (kf) of 0.01–0.02 h−1. Am recoveries in each column were 55–60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h−1 in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance

  17. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    International Nuclear Information System (INIS)

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and 241Am was low, with specific activity in the tissues 241Am occurred and 241Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author)

  18. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  19. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation

    International Nuclear Information System (INIS)

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  20. Ab initio modelling of the behaviour of helium in americium and plutonium oxides

    International Nuclear Information System (INIS)

    By means of an ab initio plane wave pseudo potential method, plutonium dioxide and americium dioxide are modelled, and the behaviour of helium in both these materials is studied. We first show that a pseudo potential approach in the Generalized Gradient Approximation (GGA) can satisfactorily describe the cohesive properties of PuO2 and AmO2. We then calculate the formation energies of point defects (vacancies and interstitials), as well as the incorporation and solution energies of helium in PuO2 and AmO2. The results are discussed according to the incorporation site of the gas atom in the lattice and to the stoichiometry of PuO2±x and AmO2±x. (authors)

  1. Removal of plutonium and americium from hydrochloric acid waste stream using extraction chromatography

    International Nuclear Information System (INIS)

    Extraction chromatography is under development as a method to lower actinide activity levels in hydrochloric acid (HCl) effluent streams. Successful application of this technique would allow recycle of the largest portion of HCl, while lowering the quantity and improving the form of solid waste generated. The extraction of plutonium and americium from HCl solutions was examined for several commercial and similar laboratory-produced resins coated with n-octyl(phenyl)-N,N-diisobutylcarbamoylmethyphosphine oxide (CMPO) and either tributyl phosphate (TBP), or diamyl amylphosphonate (DAAP). Distribution coefficients for Pu and Am were measured by contact studies in hydrochloric acid solutions over the range of 0.1 - 10.0 N HCl, whole varying REDOX conditions, actinide loading levels, and contact time intervals. Significant differences in the actinide distribution coefficients, and in the kinetics of actinide removal were observed as a function of resin formulation. The usefulness of these resins for actinide removal from HCl effluent streams is discussed

  2. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  3. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  4. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.

    2006-08-01

    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  5. Plutonium and americium concentrations and vertical profiles in some Italian mosses used as bioindicators

    International Nuclear Information System (INIS)

    We have examined the uptake of actinide elements Am and Pu by different species of lichen and moss collected in two locations (Urbino, Central Italy; Alps region, North-east Italy). Plutonium and americium were separated and determined by extraction chromatography, electrodeposition and alpha-spectrometry. This paper summarizes our results with a special emphasis on the vertical profiles of these actinides in two different species of mosses. Several 1-2 cm depth sections were obtained and dated by 210Pb method. A typical peak for 239,240Pu and 241Am was found in the very old moss species ('Sphagnum Compactum') at a depth corresponding to the period 1960-1970 which was the period characterized by the maximum nuclear weapon tests. In a younger moss species ('Neckeria Crispa') no peak was observed and the regression curves showed that Am is more mobile than 239,240Pu and 238Pu. (author)

  6. 25 CFR 1000.246 - Must an AFA that contains a construction project or activity incorporate provisions of Federal...

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 2 2010-04-01 2010-04-01 false Must an AFA that contains a construction project or activity incorporate provisions of Federal construction standards? 1000.246 Section 1000.246 Indians OFFICE... Construction § 1000.246 Must an AFA that contains a construction project or activity incorporate provisions...

  7. 33 CFR 148.246 - When is a document considered filed and where should I file it?

    Science.gov (United States)

    2010-07-01

    ... filed and where should I file it? 148.246 Section 148.246 Navigation and Navigable Waters COAST GUARD... Formal Hearings § 148.246 When is a document considered filed and where should I file it? (a) If a document to be filed is submitted by mail, it is considered filed on the date it is postmarked. If...

  8. Two new polytypes of 2,4,6-tribromobenzonitrile

    Directory of Open Access Journals (Sweden)

    Doyle Britton

    2016-02-01

    Full Text Available Three polymorphs of 2,4,6-tribromobenzonitrile (RCN, C7H2Br3N, two of which are novel and one of which is a redetermination of the original structure first determined by Carter & Britton [(1972. Acta Cryst. B28, 945–950] are found to be polytypic. Each has a layer structure which differs only in the stacking of the layers. Each layer is composed of molecules associated through C[triple-bond]N...Br contacts which form R22(10 rings. Two such rings are associated with each N atom; one with each ortho-Br atom. No new polytypes of 1,3,5-tribromo-2-isocyanobenzene (RNC were found but a re-determination of the original structure by Carter et al. [(1977. Cryst. Struct. Commun. 6, 543–548] is presented. RNC was found to be isostructural with one of the novel polytypes of RCN. Unit cells were determined for 23 RCN samples and 11 RNC samples. Polytypes could not be distinguished based on crystal habits. In all four structures, each molecule of the asymmetric unit lies across a mirror plane.

  9. An electrochemical oxidation process of Am (III) into Am (VI) used to separate the americium of spent fuels reprocessing solutions

    International Nuclear Information System (INIS)

    The aim of this invention is to oxidize by an electrochemical process Am (III) to Am (VI). This process can be used to separate the americium of spent fuels reprocessing solutions. The method consists to add to the aqueous nitric solution containing Am (III) an heteropolyanion able to complex the americium (as for instance the potassium tungstophosphate) and the Ag (II) ion. The Ag (II) ion oxidizes the Am (III) and is reduced into an Ag (I) ion. It is then regenerated by the electrolysis of the solution. After the oxidation of Am (III) into Am (VI), this last ion can be extracted by an adapted organic solvent. With this electrochemical method a yield of 100% Am (VI) is obtained in half a hour. (O.M.). 5 refs., 5 figs., 2 tabs

  10. Separation of oxidized americium from lanthanides by use of pillared metal(IV) phosphate-phosphonate hybrid materials

    International Nuclear Information System (INIS)

    Closing the nuclear fuel cycle in the US poses many challenges, one of which is found in the waste streams, which contain both trivalent lanthanides and actinides. The separation of americium from the raffinate will dramatically reduce the long-term radiotoxicity of the waste. The sorption of americium in both the tri- and pentavalent oxidation states was observed for four M(IV) phosphate-phosphonate ion exchange materials in nitric acid at pH 2. High selectivity was observed for reduced Am(III) with Kd values ca. 6 x 105 mL/g, while the Kd values for Am(V) were much lower. A new method of synthesizing and stabilizing AmO2+ to yield a lifetime of at least 24 h in acidic media using a combination of sodium persulfate and calcium hypochlorite will be described.

  11. Effects of impurities on the size and form of crystals of thorium and americium oxalates and oxides

    International Nuclear Information System (INIS)

    The influence of impurity salts and certain surfactants on the shape and size of thorium and americium oxalate crystals, as well as crystals of their dioxides, prepared at thermolysis of oxalate precipitates, has been investigated. It is shown that during thorium oxalate deposition from solutions, containing 0.8 mol/l thorium and 2 mol/l nitric acid at 96 deg C in the presence of ammonium salts or surfactants larger and monodisperse crystals are grown than in the absence of the above-mentioned substances. Addition of ammonium nitrate in the amount of 0.6 mol/l to solution containing 7.6x10-3 mol/l of americium dioxide particles coincides with the shape of oxalate crystals but their size is reduced by (20-25)% as compared with the initial ones

  12. Combined radiochemical procedure for determination of plutonium, americium and strontium-90 in the soil samples from SNTS

    International Nuclear Information System (INIS)

    The results of combined radiochemical procedure for the determination of plutonium, americium and 90Sr (via measurement of 90Y) in the soil samples from SNTS (Semipalatinsk Nuclear Test Site) are presented. The processes of co-precipitation of these nuclides with calcium fluoride in the strong acid solutions have been investigated. The conditions for simultaneous separation of americium and yttrium using extraction chromatography have been studied. It follows from analyses of real soil samples that the procedure developed provides the chemical recovery of plutonium and yttrium in the range of 50-95 % and 60-95 %, respectively. The execution of the procedure requires 3.5 working days including a sample decomposition study. (author)

  13. 10 CFR 72.246 - Issuance of amendment to a certificate of compliance.

    Science.gov (United States)

    2010-01-01

    ... INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.246 Issuance of amendment to a certificate...

  14. Extraction of americium(III) from nitric acid medium by CMPO-TBP extractants in ionic liquid diluent

    International Nuclear Information System (INIS)

    Extraction of americium(III) from nitric acid medium by a solution of tri-n-butylphosphate (TBP) and n-octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in room temperature ionic liquid, l-butyl-3-methyl-imidazolium bis(trifluoromethanesulfonyl)imide (bmimNTf2), was studied and the results were compared with that obtained with CMPO-TBP in n-doddecane (n-DD). The distribution ratio of 241Am(III) in TBP-CMPO/bmimNTf2 was measured as a function of various parameters such as concentrations of nitric acid, CMPO, bmimNO3, NaNO3 and TBP and temperature. Remarkably large distribution ratios were observed for the extraction of americium(III) when bmimNTf2 acted as diluent and the extraction was insignificant in the absence of CMPO. The stoichiometry of metal-solvate in organic phase was determined by the slope analysis of extraction data and it indicated the formation of 1:3 (Am: CMPO) complex in organic phase. Viscosity of TBP-CMPO/bmimNTf2 at various temperatures and enthalpy change accompanied by the extraction of americium(III) were determined and reported in this paper. (orig.)

  15. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  16. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  17. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  18. Bis(2,4,6-triaminopyrimidin-1-ium sulfate pentahydrate

    Directory of Open Access Journals (Sweden)

    Yupa Wattanakanjana

    2013-08-01

    Full Text Available The asymmetric unit of the title salt, 2C4H8N5+·SO42−·5H2O, contains four 2,4,6-triaminopyrimidinium (TAPH+ cations, two sulfate anions and ten lattice water molecules. Each two of the four TAPH+ cations form dimers via N—H...N hydrogen bonds between the amino groups and the unprotonated pyrimidine N atoms [graph-set motif R22(8]. The (TAPH+2 dimers, in turn, form slightly offset infinite π–π stacks parallel to [010], with centroid–centroid distances between pyrimidine rings of 3.5128 (15 and 3.6288 (16 Å. Other amino H atoms, as well as the pyrimidinium N—H groups, are hydrogen-bonded to sulfate and lattice water O atoms. The SO42− anions and water molecules are interconnected with each other via O—H...O hydrogen bonds. The combination of hydrogen-bonding interactions and π–π stacking leads to the formation of a three-dimensional network with alternating columns of TAPH+ cations and channels filled with sulfate anions and water molecules. One of the sulfate anions shows a minor disorder by a ca 37° rotation around one of the S—O bonds [occupancy ratio of the two sets of sites 0.927 (3:0.073 (3]. One water molecule is disordered over two mutually exclusive positions with an occupancy ratio of 0.64 (7:0.36 (7.

  19. Penta- and 2,4,6-tri-chlorophenol biodegradation during municipal solid waste anaerobic digestion.

    Science.gov (United States)

    Limam, Intissar; Limam, Rim Driss; Mezni, Mohamed; Guenne, Angéline; Madigou, Céline; Driss, Mohamed Ridha; Bouchez, Théodore; Mazeas, Laurent

    2016-08-01

    In this study isotopic tracing using (13)C labelled pentachlorophenol (PCP) and 2,4,6-trichlorophenol (2,4,6-TCP) is proposed as a tool to distinguish the loss of PCP and 2,4,6-TCP due to biodegradation from other physical processes. This isotopic approach was applied to accurately assess in situ PCP and 2,4,6-TCP degradation under methanogenic conditions in several microcosms made up of household waste. These microcosms were incubated in anaerobic conditions at 35°C (mesophilic) and 55°C (thermophilic) without agitation. The volume of biogas produced (CH4 and CO2), was followed for a period of 130 days. At this stage of stable methanogenesis, (13)C6-PCP and (13)C6-2,4,6-TCP were introduced anaerobically in microcosms and its monitoring at mesophilic and thermophilic conditions was performed in parallel by gas chromatography mass spectrometry (GC-MS) and gas chromatography isotope-ratio mass spectrometry (GC-IRMS). This study proved the almost total dechlorination of bioavailable PCP and 2,4,6-TCP into 4-CP at 35°C. Nevertheless, high rate adsorption in particular materials of the two compounds was observed. Furthermore, Carbon-13 Nuclear Magnetic Resonance ((13)C-NMR) Spectroscopy analysis of (13)C labelled 2,4,6-TCP mesophilic incubations showed the partial mineralization of 4-CP at 35°C to acetate and then to HCO(3-). Consequently, NMR results confirm the biogas isotopic results indicating the mineralization of (13)C labelled 2,4,6-TCP into (13)C (CH4 and CO2). Concerning (13)C labelled PCP mesophilic incubations, the isotopic composition of the biogas still natural until the day 262. In contrast, no dechlorination was observed at 55°C. Thus PCP and 2,4,6-TCP were persistent in thermophilic conditions. PMID:27151678

  20. Uptake of americium-241 by plants from contaminated Chernobyl exclusive zone test site soils

    International Nuclear Information System (INIS)

    Americium-241 was found to accumulate in soils and biological objects of the environment. Its concentration has increased many times after the Chernobyl disaster and can be expected to increase about 40 times in the future. This research concentrated on the contaminated exclusive Chernobyl zone polluted by trace radionuclides, their behavior and accumulation by various plant species. Special attention is devoted to the bioavailability of 241Am to the plants Galium rivale, G. tinctorium, G. aparine, G. intermedium, Berteroa incana, Artemisia absinthium, A. vulgaris, Centaurea borysthenica, C. arenaria, Cirsium arvense, Succissa pratensis, Solidago virgaurea, Linaria vulgaris, Lepidium ruderale, Stenactis annua, Veronica maxima, Verbascum lychnitis, Euphorbia cyparissias, Genista tinctoria, Erigeron canadensis, Oenothera biennis, Betula pendula and Quercus robur, which were collected from the Chernobyl, Kopachi, and Yanov districts. The plant samples of Oenothera biennis, Betula pendula and Quercus robur were collected from the Yanov district, where the soil contamination by 241Am and 137Cs was at the level of 660 and 27 MBq/m2, respectively. Gamma spectroscopy and radiochemical methods were used to estimate the activity concentration of 137Cs, 90Sr, 238Pu, 239+240Pu, 241Am. The radionuclides were measured in the dry green mass of the plant samples and in the dry soils. The contamination of the Oenothera biennis, Betula pendula and Quercus robur samples by 137Cs was (5.8±1,5)x106, (7.4±1.1)x105, and (2.6±0.2)x106 Bq/kg dry mass, respectively, and contamination by 241Am was 47±5, 45±3 and 3.2±0.2 Bq/kg, respectively. The soil-to-plant transfer ratio for 137Cs ranged lay within the interval of 0.2 to 0.03 Bq/kg : Bq/m2, the the transfer ratio for 241Am did not exceed 7x10-5 Bq/kg : Bq/m2. The coefficient of the relative contents of the 241Am/239+240Pu radionuclides in the various plant samples varied from 3.2 to 8.3, while for soil from the Yanov district this

  1. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  2. Inhibitory activities against rice pathogens of 8-hydroxy-2,4,6-octatriynamide from Agrocybe sp.

    Science.gov (United States)

    Zheng, Yongbiao; Xu, Xiaoping; Wu, Yabin

    2016-03-01

    8-Hydroxy-2,4,6-octatriynamide, a natural polyacetylene with inhibitory activities against rice pathogens, was isolated from the liquid fermentation broth of strain Agrocybe sp. YB2005 during screening for new natural chemical agents to control rice pathogens. 8-hydroxy-2,4,6-octatriynamide was purified by consecutive chromatography over a Cl8 reversed phase silica gel, sephadex LH-20 and silica gel. The chemical structure of 8-hydroxy-2,4,6-octatriynamide was elucidated through spectroscopic analyses, including 1D- and 2D-NMR, ESI mass spectrometry and X-ray single crystal diffraction. Bioassays showed that 8-hydroxy-2,4,6-octatriynamide could significantly inhibit growth of Xanthomonas oryzae with an MIC of 53.1 μM in a 96-well plate and the growth of Rhizoctonia solani at 1.02 mM in a 24-well plate. When rice leaves were inoculated with Magnaporthe grisea and cultured in artificial nutrition liquid containing 0.34 mM 8-hydroxy-2,4,6-octatriynamide, no rice blast was observed. The present study implied that 8-hydroxy-2,4,6-octatriynamide could be a candidate agent against rice pathogens. PMID:26861586

  3. Pathway of the ozonation of 2,4,6-trichlorophenol in aqueous solution

    Institute of Scientific and Technical Information of China (English)

    PI Yunzheng; WANG Jianlong

    2007-01-01

    The reaction mechanism and pathway of the ozonation of 2,4,6-trichlorophenol(2,4,6-TCP)in aqueous solution were investigated.The removal efficiency and the variation of H2O2,Cl-,formic acid,and oxalic acid were studied during the semi-batch ozonation experiments(continuous for ozone gas supply,fixed volume of water sample).The results showed that when there was no scavenger,the removal efficiency of 0.1 mmol/L 2,4,6-TCP could reach 99% within 6 min by adding 24 mg/L ozone.The reaction of molecular ozone with 1 2,4,6-TCP resulted in the formation of H2O2.The maximal concentration of H2O2 detected during the ozonation could reach 22.5% of the original concentration of 2,4,6-TCP.The reaction of ozone with H2O2 resulted in the molecule firstly degraded 2,4,6-TCP to form chlorinated quinone,which was subsequently oxidized to formic acid and oxalic acid.Two reaction pathways of the degradation of 2,4,6-TCP by ozone and O2/OH·were proposed in this study.

  4. Americium and plutonium in water, biota, and sediment from the central Oregon coast

    International Nuclear Information System (INIS)

    Plutonium-239, 240 and americium-241 were measured in the mussel Mytilus californianus from the region of Coos Bay, OR. The flesh of this species has a plutonium concentration of about 90 fCi/kg, and an Am-241/Pu-239, 240 ratio that is high relative to mixed fallout, ranging between two and three. Transuranic concentrations in sediment, unfiltered water, and filterable particulates were also measured; none of these materials has an Am/Pu ratio as greatly elevated as the mussels, and there is no apparent difference in the Am/Pu ratio of terrestrial runoff and coastal water. Sediment core profiles do not allow accumulation rates or depositional histories to be identified, but it does not appear that material characterized by a high Am/Pu ratio has ever been introduced to this estuary. Other bivalves (Tresus capax and Macoma nasuta) and a polychaete (Abarenicola sp.) do not have an elevated Am/Pu ratio, although the absolute activity of plutonium in the infaunal bivalves is roughly four times that in the mussels

  5. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  6. Influence of organic additives on the colour reaction between trivalent americium and arsenazo III

    International Nuclear Information System (INIS)

    The colour reaction of Am(III) with arsenazo III in several hydroorganic media has been examined systematically on the addition of certain polar water-miscible organic solvents in the course of a search for improved and simple spectrophotometric methods for the estimation of americium. Addition of these substances resulted in the stabilization of colour and brought about a drastic enhancement in the absorbance values. The organic additives studied include acetone, acetonitrile, dimethylformamide, dioxane and ethanol. Among the many solvents tested, alcohol and dioxane proved to be the most effective, the highest sensitivity is obtained by using a 60% dioxane-ethanol (1:1) mixture. The apparent molar absorptivity based on Am content is 184616+-9931 mol-1 cm-1 at 655 nm which is about 3 times higher than that attained for the reaction in aqueous medium (65178+-1243). Moreover, this is the highest value reported as yet for its determination. Beer's law is obeyed both in mixed and aqueous media. The effects of some experimental variables on colour development have also been studied to optimize the conditions for the assay of Am. (author)

  7. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  8. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  9. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  10. Assessment of radiation doses from residential smoke detectors that contain americium-241

    International Nuclear Information System (INIS)

    External dose equivalents and internal dose commitments were estimated for individuals and populations from annual distribution, use, and disposal of 10 million ionization chamber smoke detectors that contain 110 kBq (3 μCi) americium-241 each. Under exposure scenarios developed for normal distribution, use, and disposal using the best available information, annual external dose equivalents to average individuals were estimated to range from 4 fSv (0.4 prem) to 20 nSv (2 μrem) for total body and from 7 fSv to 40 nSv for bone. Internal dose commitments to individuals under post disposal scenarios were estimated to range from 0.006 to 80 μSv (0.0006 to 8 mrem) to total body and from 0.06 to 800 μSv to bone. The total collective dose (the sum of external dose equivalents and 50-year internal dose commitments) for all individuals involved with distribution, use, or disposal of 10 million smoke detectors was estimated

  11. NMR Evidence for the 8.5 K Phase Transition in Americium Dioxide

    Science.gov (United States)

    Tokunaga, Yo; Nishi, Tsuyoshi; Kambe, Shinsaku; Nakada, Masami; Itoh, Akinori; Homma, Yoshiya; Sakai, Hironori; Chudo, Hiroyuki

    2010-05-01

    We report here the first NMR study of americium dioxide (AmO2). More than 30 years ago, a phase transition was suggested to occur in this compound at 8.5 K based on magnetic susceptibility data, while no evidence had been obtained from microscopic measurements. We have prepared a powder sample of 243AmO2 containing 90 at. % 17O and have performed 17O NMR at temperatures ranging from 1.5 to 200 K. After a sudden drop of the 17O NMR signal intensity below 8.5 K, at 1.5 K we have observed an extremely broad spectrum covering a range of ˜14 kOe in applied field. These data provide the first microscopic evidence for a phase transition as a bulk property in this system. In addition, the 17O NMR spectrum has been found to split into two peaks in the paramagnetic state, an effect which has not been reported for actinide dioxides studied up to now. We suggest that the splitting is induced by self-radiation damage from the alpha decay of 243Am.

  12. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  13. In Vitro Dissolution Tests of Plutonium and Americium Containing Contamination Originating From ZPPR Fuel Plates

    Energy Technology Data Exchange (ETDEWEB)

    William F. Bauer; Brian K. Schuetz; Gary M. Huestis; Thomas B. Lints; Brian K. Harris; R. Duane Ball; Gracy Elias

    2012-09-01

    Assessing the extent of internal dose is of concern whenever workers are exposed to airborne radionuclides or other contaminants. Internal dose determinations depend upon a reasonable estimate of the expected biological half-life of the contaminants in the respiratory tract. One issue with refractory elements is determining the dissolution rate of the element. Actinides such as plutonium (Pu) and Americium (Am) tend to be very refractory and can have biological half-lives of tens of years. In the event of an exposure, the dissolution rates of the radionuclides of interest needs to be assessed in order to assign the proper internal dose estimates. During the November 2011 incident at the Idaho National Laboratory (INL) involving a ZPPR fuel plate, air filters in a constant air monitor (CAM) and a giraffe filter apparatus captured airborne particulate matter. These filters were used in dissolution rate experiments to determine the apparent dissolution half-life of Pu and Am in simulated biological fluids. This report describes these experiments and the results. The dissolution rates were found to follow a three term exponential decay equation. Differences were noted depending upon the nature of the biological fluid simulant. Overall, greater than 95% of the Pu and 93% of the Am were in a very slow dissolving component with dissolution half-lives of over 10 years.

  14. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  15. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T.F.; Smith, J.D. (Melbourne Univ., Parkville (Australia). Dept. of Inorganic Chemistry); Fowler, S.W.; LaRosa, J.; Holm, E. (International Atomic Energy Agency, Monaco-Ville (Monaco). Lab. of Marine Radioactivity); Aarkrog, A.; Dahlgaard, H. (Risoe National Lab., Roskilde (Denmark))

    1991-01-01

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and {sup 241}Am was low, with specific activity in the tissues <1% (dry wt) than in the sediments. Over the first three months, a slight preference in transfer of plutonium over {sup 241}Am occurred and {sup 241}Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author).

  16. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  17. Sorption of plutonium and americium on repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura

    International Nuclear Information System (INIS)

    An integrated program of batch sorption experiments and mathematical modeling has been carried out to study the sorption of plutonium and americium on a series of repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura. The sorption of plutonium and americium on samples of concrete, mortar, sand/bentonite, tuff, sandstone and cover soil has been investigated. In addition, specimens of bitumen, cation and anion exchange resins, and polyester were chemically degraded. The resulting degradation product solutions, alongside solutions of humic and isosaccharinic acids were used to study the effects on plutonium sorption onto concrete, sand/bentonite and sandstone. The sorption behavior of plutonium and americium has been modeled using the geochemical speciation program HARPHRQ in conjunction with the HATCHES database

  18. Isolation of Pseudomonas pickettii strains that degrade 2,4,6-trichlorophenol and their dechlorination of chlorophenols.

    OpenAIRE

    Kiyohara, H.; Hatta, T; Ogawa, Y.; T Kakuda; H. Yokoyama; Takizawa, N

    1992-01-01

    Three strains of Pseudomonas pickettii that can grow with 2,4,6-trichlorophenol (2,4,6-TCP) as the sole source of carbon and energy were isolated from different mixed cultures of soil bacterial populations that had been acclimatized to 2,4,6-TCP. These strains released 3 mol of chloride ion from 1 mol of 2,4,6-TCP during the complete degradation of the TCP. Of these strains, P. pickettii DTP0602 in high-cell-density suspension cultures dechlorinated various chlorophenols (CPs). Cells that wer...

  19. Functions of Flavin Reductase and Quinone Reductase in 2,4,6-Trichlorophenol Degradation by Cupriavidus necator JMP134▿

    OpenAIRE

    Belchik, Sara Mae; Xun, Luying

    2007-01-01

    The tcpRXABCYD operon of Cupriavidus necator JMP134 is involved in the degradation of 2,4,6-trichlorophenol (2,4,6-TCP), a toxic pollutant. TcpA is a reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenase that converts 2,4,6-TCP to 6-chlorohydroxyquinone. It has been implied via genetic analysis that TcpX acts as an FAD reductase to supply TcpA with FADH2, whereas the function of TcpB in 2,4,6-TCP degradation is still unclear. In order to provide direct biochemical evidence for t...

  20. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  1. Characterization of uranium, plutonium, neptunium, and americium in HLW supernate for LLW certification

    International Nuclear Information System (INIS)

    The 1S Manual requires that High Level Waste (HLW) implement a waste certification program prior to sending waste packages to the E-Area vaults. To support the waste certification plan, the HLW supernate inventory of uranium, plutonium, neptunium and americium have been characterized. This characterization is based on the chemical, isotopic and radiological properties of these elements in HLW supernate. This report uses process knowledge, solubility data, isotopic inventory data and sample data to determine if any isotopes of the aforementioned elements will exceed the minimum reportable quantity (MRQ) for waste packages contaminated with HLW supernate. If the MRQ can be exceeded for a particular nuclide, then a method for estimating the waste package content is provided. Waste packages contaminated from HLW supernate do not contain sufficient U-233, U-234, U-235, U-236, U-238, Pu-239, Pu-240, Pu-241, Pu-242 or Am-241 to warrant separate reporting on the shipping manifest. Calculations show that, on average, more than 100 gallons of supernate is required to exceed the PAC (package acceptance criteria) for each of these nuclides. Thus it is highly unlikely that the PAC would be exceeded for these nuclides and unlikely that the MRQ would be exceeded. These nuclides should be manifested as zero for waste packages contaminated with HLW supernate. The only actinide isotopes that may exceed the MRQ are Np-237 and Pu-238. The recommended method to calculate the amount of these two isotopes in waste packages contaminated with HLW supernate is to ratio them to the measured Cs-137 activity

  2. Some elements for a revision of the americium reference biokinetic model

    International Nuclear Information System (INIS)

    The interpretation of individual activity measurement after a contamination by 241Am or its parent nuclide 241Pu is based on the reference americium (Am) biokinetic model published by the International Commission on Radiological Protection in 1993 [International Commission on Radiological Protection. Age-dependent doses to members of the public from intake of radionuclides: Part 2 Ingestion dose coefficients. ICRP Publication 67. Ann. ICRP 23(3/4) (1993)]. The authors analysed the new data about Am biokinetics reported afterwards to propose an update of the current model. The most interesting results, from the United States Transuranium and Uranium Registries post-mortem measurement database [Filipy, R. E. and Russel, J. J. The United States Transuranium and Uranium Registries as sources for actinide dosimetry and bio-effects. Radiat. Prot. Dosim. 105(1-4), 185-187 (2003)] and the long-term follow-up of cases of inhalation intake [Malatova, I., Foltanova, S., Beckova, V., Filgas, R., Pospisilova, H. and Hoelgye, Z. Assessment of occupational doses from internal contamination with 241Am. Radiat. Prot. Dosim. 105(1-4), 325-328 (2003)], seemed to show that the current model underestimates the retention in the massive soft tissues and overestimates the retention in the skeleton and the late urinary excretion. However, a critical review of the data demonstrated that all were not equally reliable and suggested that only a slight revision of the model, possibly involving a change in the balance of activity between massive soft tissues, cortical and trabecular bone surfaces, may be required. (authors)

  3. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  4. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  5. Reduction of. systematic error of In-vivo measurement of americium 241 activity in the skull

    International Nuclear Information System (INIS)

    Excretion analysis and in vivo measuring methods are used for estimation of internal contamination by 241Am. In vivo measurements of the lung are suitable in short time after time of intake when the way of the intake is inhalation. In vivo measurements of the activity in the liver or in the skeleton could be performed at a later time. Detection of radionuclide activity in the liver is quite difficult because it is necessary to distinguish liver activity from the activity of surrounding tissues i.e. lung and skeleton. The skull or knees are the most suitable., for activity assessment in the skeleton. The skull is the most appropriate for measurements because it represents about 15% of total skeleton mass and contributions to measured activity of surrounding tissues are small. Americium activity in the skull could be measured with different instrumentation and in various geometries. Setting of two semiconductors detectors placed 3 cm over temporal region of the skull is used in NRPI. Calibration of the system was done by several head phantoms, in this process was observed that detection efficiencies depend on size of the phantoms. The aim of the paper is to express character of the efficiency as function of the size of skull in order to obtain more accurate value of the activity and decrees its uncertainty. Simulations of head by simplified geometric shapes, i.e. spheres and rotary ellipsoids, is in coherence with phantoms of big size (UCIN, BPAM-0001), but for small phantoms occurred quite serious discrepancy. Activity of real cases determined by calibration with phantom BPAM-0001 (reference phantom) is reduced from 9 to 44 %, when eq. 2 is used and relative uncertainty is reduced from 32% to maximum 12%. (authors)

  6. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  7. Inert matrices, uranium-free plutonium fuels and americium targets. Synthesis of CAPRA, SPIN and EFTTRA studies

    International Nuclear Information System (INIS)

    A first selection of inert-matrix materials, actinide support alone (Pu and Am based), and compound materials, U free plutonium burning fuels and heterogeneous americium targets are discussed. Basic properties, fabrication, and reprocessing studies, European in-pile and out-of-pile tests, performed recently in the framework of CAPRA, SPIN and EFTTRA programs, are reviewed here. Taking into account these studies and on the bases of the different requirements to be met in each of the fuels and targets, a number of materials have been selected as 'promising candidates'. Trends for further research on these materials are established. (author)

  8. Final Report on the Demonstration of Disposal of Americium and Curium Legacy Material Through the High Level Waste System

    International Nuclear Information System (INIS)

    This report provides the results of experimental demonstrations related to processing of a legacy solution containing americium and curium through the High Level Waste (HLW) system. The testing included eight experiments covering the baseline, mitigation, and enhanced nitrate processing studies. In general, each experiment studied the mixtures generated over a period of time to emulate the lifecycle of actual sludge in the High Level Waste system. While the data in previous reports remain valid, this report supercedes all the previous reports and provides a collective overview of the work

  9. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  10. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  11. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  12. Condensation monomers and polymers based on 2,4,6-trinitrotoluene

    International Nuclear Information System (INIS)

    The feasibility of conversion of 2,4,6-trinitrotoluene into condensation monomers (nitro compounds, diamines, etc.) and their applications in the synthesis of aromatic polymers has been analysed within the framework of a general problem of 2,4,6-trinitroluene conversion. The use of aromatic dinitro compounds and diamines for the preparation of oligomeric polyethers and polyamides (or polyimides), respectively, is considered. The possibility of the synthesis of polyamides and polyimides containing side aliphatic and aromatic groups and possessing better (in comparison with the corresponding unsubstituted polymers) characteristics is demonstrated.

  13. Coordination chemistry of 2,4,6-tri(pyridyl)-1,3,5-triazine ligands

    OpenAIRE

    Therrien, Bruno

    2012-01-01

    This review covers the rich coordination chemistry of 2,4,6-tri(pyridyl)-1,3,5-triazine ligands. These polypyridyl derivatives have been coupled to transition metals and lanthanides, and the complexes obtained have been used in various fields such as luminescent materials, for the preparation of coordination polymers and networks as well as for the synthesis of discrete metalla-assemblies. The synthetic and structural aspects of the different isomers of 2,4,6-tri(pyridyl)-1,3,5-triazine are p...

  14. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.

    1982-01-01

    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  15. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  16. Plutonium and americium in Arctic waters, the North Sea and Scottish and Irish coastal zones (in Fucus, Mytilus and Patella)

    International Nuclear Information System (INIS)

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were collected from the Irish coast in 1983. Fallout is found to dominate as a source of 239+240Pu north of latitude 650N, while for 238Pu a substantial fraction originates from European nuclear fuel reprocessing facilities. The 238Pu/239+240Pu isotope ratio provides clear evidence of the transport of effluent plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11-15 months in Scottish waters and, tentatively, 1.5-3 y during transport from the North Channel (north of the Irish Sea) to Spitsbergen. 241Am found in Arctic waters probably originates from the decay of fallout 241Pu and, like Pu, tentatively has a residence time of the order of several years. Americium from Sellafield has an estimated mean residence time of 4-6 months in Scottish waters. (author)

  17. A systematic study on the absorption and fluorescence properties of 2,4,6-triaryl and tripyridylpyridines

    OpenAIRE

    FINDIK, Esra; ARIK, Mustafa; Ceylan, Mustafa

    2009-01-01

    Eight different 2,4,6-triaryl, and tripyridylpridines compounds were synthesized and their fluorescent properties were studied by using steady-state and time-resolved fluorescence and UV-Vis absorption spectroscopy techniques in 6 different solvents. Especially, 2,4,6-triarylpyridines showed strong fluorescence properties with high fluorescence quantum yields but small Stokes shifts.

  18. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  19. 5 CFR 531.246 - Within-grade increases for GM employees.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Within-grade increases for GM employees... REGULATIONS PAY UNDER THE GENERAL SCHEDULE Determining Rate of Basic Pay Special Rules for Gm Employees § 531.246 Within-grade increases for GM employees. GM employees are entitled to within-grade increases...

  20. SAGE ANALYSIS OF TRANSCRIPTOME RESPONSES IN ARABIDOPSIS ROOTS EXPOSED TO 2,4,6-TRINITROTOLUENE

    Science.gov (United States)

    Serial Analysis of Gene Expression (SAGE) was used to profile transcript levels in Arabidopsis thaliana roots and assess their responses to 2,4,6-trinitrotoluene (TNT) exposure. SAGE libraries representing control and TNT-exposed seedling root transcripts were constructed, and ea...

  1. 8 CFR 246.4 - Immigration judge's authority; withdrawal and substitution.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Immigration judge's authority; withdrawal... IMMIGRATION REGULATIONS RESCISSION OF ADJUSTMENT OF STATUS § 246.4 Immigration judge's authority; withdrawal and substitution. In any proceeding conducted under this part, the immigration judge shall...

  2. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  3. Chemical behaviour of trivalent and pentavalent americium in saline NaCl-solutions. Studies of transferability of laboratory data to natural conditions. Interim report. Reported period: 1.2.1993-31.12.1993; Chemisches Verhalten von drei- und fuenfwertigem Americium in Salinen NaCl-Loesungen. Untersuchung der Uebertragbarkeit von Labordaten auf natuerliche Verhaeltnisse. Zwischenbericht. Berichtszeitraum 1.2.1993-31.12.1993

    Energy Technology Data Exchange (ETDEWEB)

    Runde, W.; Kim, J.I.

    1994-09-15

    In order to clarify the chemical behaviour of Americium in saline aqueous systems relevant for final storage this study deals with the chemical reactions of trivalent and pentavalent Americium in NaCl-solutions under the influence of radiolysis from its own alpha radiation. The focus of the study was on investigating the geologically relevant reactions, such as hydrolysis or carbonate- and chloride complexing in solid-liquid equilibriums. Comprehensive measurements on solubility and spectroscopic studies in NaCl-solutions were carried out in a CO{sub 2}-free atmosphere and 10{sup -2} atm CO{sub 2} partial pressure. Identification and characterisation of the AM (III) and AM(V) solid phases were supplemented by structural research with the chemically analogue EU (III) and Np(V) compounds. The alpha-radiation induced radiolysis in saline NaCl solutions and the redox behaviour of Americium which was influenced thereby were spectroscopically quantified. (orig.) [Deutsch] Zur Klaerung des chemischen Verhaltens von Americium in endlagerrelevanten salinen aquatischen Systemen befasst sich die vorliegende Arbeit mit den chemischen Reaktionen des drei- und fuenfwertigen Americiums in NaCl-Loesungen unter dem Einfluss der Radiolyse durch die eigene {alpha}-Strahlung. Der Schwerpunkt dieser Arbeit lag auf der Untersuchung der geologisch relevanten Reaktionen, wie Hydrolyse sowie Carbonat- und Chloridkomplexierung in fest-fluessig Gleichgewichtssystemen. Hierzu wurden umfassende Loeslichkeitsmessungen und spektroskopische Untersuchungen in NaCl-Loesungen, sowohl unter CO{sub 2}-freier Atmosphaere als auch unter 10{sup -2} atm CO{sub 2}-Partialdruck, durchgefuehrt. Die Identifizierung und Charakterisierung der Am(III)- und Am(V)-Festphasen wurde ergaenzt durch strukturelle Untersuchungen mit den chemisch analogen Eu(III)- und Np(V)-Verbindungen. Die von der {alpha}-Strahlung induzierte Radiolyse in salinen NaCl-Loesungen und das dadurch beeinflusste Redoxverhalten von Americium

  4. Levan-type fructooligosaccharide production using Bacillus licheniformis RN-01 levansucrase Y246S immobilized on chitosan beads

    Directory of Open Access Journals (Sweden)

    Surawut Sangmanee

    2016-06-01

    Full Text Available Bacillus licheniformis RN-01 levansucrase Y246S (LsRN-Y246S was immobilized by covalently linking onto chitosan, Sepabead EC-EP, and Sepabead EC-HFA, beads. The stability of immobilized LsRN-Y246S was found to be the highest with chitosan beads, retaining more than 70% activity after 13 weeks storage at 4 oC, and 68% activity after 12 hours incubation at 40°C. LsRN-Y246S immobilized on chitosan beads withstands sucrose concentrations up to 70% (w/v, retaining over 85% of its activity, significantly better than LsRN-Y246S immobilized on others supporting matrices. LsRN-Y246S immobilized on chitosan showed a 2.4 fold increase in activity in the presence of Mn2+, and gave slight protection against deactivation by of Cu2+, Zn2+, Fe3+, SDS and EDTA. A maximum of 8.36 g and an average of 7.35 g LFOS yield at least up to DP 11 can be produced from 25 g of sucrose, during five production cycles. We have demonstrated that LFOS can be effectively produced by chitosan immobilized LsRN-Y246S and purified.

  5. Influence of an alkoxy group on bis-triazinyl-pyridines for selective extraction of americium(III)

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and lanthanides(III) from nitric acid by 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin-3-yl)-pyridine and 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin- 3-yl)-4-methoxy-pyridine was studied. The physico-chemical properties of these ligands, such as the protonation and complexation constants, were also determined to describe the influence of different substituent groups. The selectivity of substituted-BTP was confirmed both in complexation and in solvent extraction experiments. The presence of an alkoxy-group in position 4 of the pyridine decreases the BTP selectivity. Influence of a long alkyl chain on protonation and complexation constants was also studied with 2,6-bis-(5,6-dimethyl-[1,2,4]- triazin-3-yl)-4-dodecyloxy-pyridine. (authors)

  6. Solvent extraction of europium and americium into phenyltrifluoromethyl sulfone by using synergistic mixture of hydrogen dicarbollylcobaltate and 'classical' CMPO

    International Nuclear Information System (INIS)

    Extraction of microamounts of europium and americium by a phenyltrifluoromethyl sulfone (FS 13) solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of octyl-phenyl-N,N-diisobutylcarbamoylmethyl phosphine oxide ('classical' CMPO, L) has been investigated. The equilibrium data have been explained assuming that the complexes HL+, HL2+, ML23+, ML33+ and ML43+ (M3+ Eu3+, Am3+) are extracted into the organic phase. The values of extraction and stability constants of the cationic complex species in FS 13 saturated with water have been determined. It was found that the stability constants of the corresponding complexes EuLn3+ and AmLn3+, where n 2, 3, 4 and L is 'classical' CMPO, in water-saturated FS 13 are comparable. (author)

  7. Recovery, purification and concentration of plutonium and americium from the aqueous wastes discharged in the reprocessing process studies

    International Nuclear Information System (INIS)

    For recovering and purifying plutonium and americium from the aqueous wastes occurring in the process studies on reprocessing, a standard procedure has been established for use in the laboratory works, through the preliminary tests of the precipitation as hydroxides and the anion exchange in nitrate media. The procedure was proven in the treatment of actual wastes, of which the results were contributed to determine the process conditions in the plutonium purification and product concentration of the JAERI Reprocessing Test Plant. The preliminary tests also include washing of U and Am recovery from the anion-exchanger in nitrate media, direct ion-exchange recovery of Pu from the TBP phase and elution of Am from the cation-exchanger. (auth.)

  8. Plutonium and americium in fish, shellfish and seaweed in the Irish environment and their contribution to dose

    International Nuclear Information System (INIS)

    Plutonium and americium activity concentrations in fish and shellfish landed in Ireland in the period 1988 to 1997 are presented. Activity concentrations in fish are low and often below detection limits, while those in mussels and oysters sampled on the northeast coast show no significant signs of decline. The estimated doses to hypothetical typical and heavy seafood consumers remain below 1 μSv yr-1 (committed effective dose).Plutonium activity concentrations measured in Fucus vesiculosus around the Irish coastline have not fallen appreciably in the ten year period between 1986 and 1996. Furthermore, the mean 238Pu/239,240Pu ratio of 0.17±0.05 in Fucus vesiculosus from the west coast of Ireland demonstrates the increasing significance of Sellafield-derived plutonium in those waters. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  9. White upconversion luminescence nanocrystals for the simultaneous and selective detection of 2,4,6-trinitrotoluene and 2,4,6-trinitrophenol.

    Science.gov (United States)

    Ma, Yingxin; Huang, Sheng; Deng, Mingliang; Wang, Leyu

    2014-05-28

    A highly water stable and strong upconversion (UC) luminescence NaYF4@PSI-NH nanosensor for the simultaneous and selective detection of 2,4,6-trinitrotoluene (TNT) and 2,4,6-trinitrophenol (TNP) was successfully developed. Via the 980 nm near-infrared (NIR) irradiation, these nanosensors emit strong white UC luminescence with five typical emission peaks centered at 363, 455, 475, 546, and 654 nm. The UC emission at both 363 and 546 nm was quenched by the addition of TNT; however, the ratio of luminescence intensity at 363 nm to 546 nm (I363/I546) had no change with the increase of TNT concentration. Meanwhile, only violet UC emission at 363 nm was dramatically quenched via the addition of TNP, and the I363/I546 ratio is negatively proportional to the TNP concentration in the range of 0.01-4.5 μg/mL of TNP. On the other hand, the green UC emission intensity at 546 nm is in negative proportion to the concentration of TNT. Moreover, cyclohexane, toluene, and other nitroaromatics (such as 2,4-dinitrotoluene (DNT) and nitrobenzene (NB)) have no influence on the detection. Therefore, we developed a facile method for the simultaneous and selective detection of TNT and TNP in the mixture solution of nitroaromatics independent of complicated instruments and sample pretreatment. PMID:24734988

  10. Vicarious nucleophilic substitution to prepare 1,3-diamino-2,4,6-trinitrobenzene or 1,3,5-triamino-2,4,6-trinitrobenzene

    Science.gov (United States)

    Mitchell, A.R.; Pagoria, P.F.; Schmidt, R.D.

    1996-10-29

    The present invention relates to a process to produce 1,3-diamino-2,4,6-trinitrobenzene (DATB) or 1,3,5-triamino-2,4,6,trinitrobenzene (TATB) by: (a) reacting at ambient pressure and a temperature of between about 0 and 50 C for between about 0.1 and 24 hr, a trinitroaromatic compound of the structure shown within where X, Y, and Z are each independently selected from --H, or --NH{sub 2}, with the proviso that at least 1 or 2 of X, Y, and Z are hydrogen, with an amount effective to produce DATB or TATB, or 1,1,1-trialkylhydrazinium halide wherein alkyl is selected from methyl, ethyl, propyl or butyl and halide is selected from chloride, bromide or iodide, in the presence of a strong base selected from sodium butoxide, potassium butoxide, potassium propoxide, sodium propoxide, sodium ethoxide, potassium ethoxide, sodium methoxide, potassium methoxide, and combinations thereof; in a solvent selected from the group consisting of methanol, ethanol, propanol, butanol, dimethylsulfoxide, N-methylpyrrolidone, hexamethylphosphoramide, dimethylformide, dimethylacetamide and mixtures thereof, provided that when alcohols are present primarily DATB and picramide is formed; and (b) isolating the DATB or TATB produced. DATB and TATB are useful specialty explosives. TATB is also used for the preparation of benzenehexamine, a starting material for the synthesis of novel materials (optical imaging devices, liquid crystals, ferromagnetic compounds).

  11. Theoretical design of energetic nitrogen-rich derivatives of 1,7-diamino-1,7-dinitrimino-2,4,6-trinitro-2,4,6-triazaheptane.

    Science.gov (United States)

    Wu, Qiong; Zhu, Weihua; Xiao, Heming

    2013-08-01

    The heats of formation (HOFs), energetic properties, and thermal stability of a series of 1,7-diamino-1,7-dinitrimino-2,4,6-trinitro-2,4,6-triazaheptane derivatives with different substituents, different numbers of substituents, and different original chains are found by using the DFT-B3LYP method. The results show that -NO2 or -NH2 is an effective substituent for increasing the gas-phase HOFs of the title compounds, especially -NO2 group. As the numbers of substitutents increase, their HOFs enhance obviously. Increasing the length of original chain is helpful for improving their HOFs. The substitution of -NO2 is useful for enhancing their detonation performances and the effects of the length of original chains on detonation properties are coupled with those of the substituents. An analysis of the BDE of the weakest bonds indicates that the substitution of the -NH2 groups and replacing the -NO2 groups of N-NO2 by the -NH2 groups are favorable for improving their thermal stability, while the substitution of -NO2 and increasing the length of original chain decrease their thermal stability. Considering the detonation performance and thermal stability, seven compounds may be considered as the potential candidates of high energy density compounds. PMID:23559097

  12. Synthesis and structure of diorganotin dibromides, R2SnBr2 (R = 2,4,6-trimethylphenyl or 2,4,6-trimethylbenzyl): Hydrolysis of (2,4,6-Me3C6H2)2SnBr2

    Indian Academy of Sciences (India)

    Vadapalli Chandrasekhar; Ramalingam Thirumoorthi

    2010-09-01

    The reaction of SnBr4 with in situ generated 2,4,6-trimethylphenylmagnesium bromide afforded a mixture of (2,4,6-Me3C6H2)2SnBr2 (1) and (2,4,6-Me3C6H2)3SnBr (2) which could be separated from each other by their solubility differences in diethyl ether. On the other hand, the reaction of tin metal with 2,4,6-Me3C6H2CH2Br afforded (2,4,6-Me3C6H2CH2)2SnBr2 (3). Hydrolysis of the latter using triethylamine as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(Br)(-OH)]2.2CH2Cl2 (4) while the use of NaOH as the base afforded [{(2,4,6-Me3C6H2CH2)2Sn}2(-O)(OH)(-OH)]2.2CH2Cl2 (5). Compounds 4 and 5 are dimeric tetraorganodistannoxanes consisting of a central distannoxane (Sn2O2) motif.

  13. 1,2-Bis(dimethylamino-1,2-bis(2,4,6-triisopropylphenyldiborane(4

    Directory of Open Access Journals (Sweden)

    Alexander Damme

    2010-12-01

    Full Text Available In the molecular structure of the title compound, C34H58B2N2, each B atom of the diborane(4 is connected to one dimethylamino group and one Tip ligand (Tip = 2,4,6-triisopropylphenyl. These findings indicate that the increased steric demand of the Tip groups exerts influence solely on the B—B separation but not on the overall geometry of the title compound.

  14. Development of the small-molecule antiviral ST-246® as a smallpox therapeutic

    OpenAIRE

    Grosenbach, Douglas W.; Jordan, Robert; Hruby, Dennis E

    2011-01-01

    Naturally occurring smallpox has been eradicated, yet it remains as one of the highest priority pathogens due to its potential as a biological weapon. The majority of the US population would be vulnerable in a smallpox outbreak. SIGA Technologies, Inc. has responded to the call of the US government to develop and supply to the Strategic National Stockpile a smallpox antiviral to be deployed in the event of a smallpox outbreak. ST-246® (tecovirimat) was initially identified via a high-throughp...

  15. 2,4,6-Trichloroanisole is a potent suppressor of olfactory signal transduction

    OpenAIRE

    Takeuchi, Hiroko; Kato, Hiroyuki; Kurahashi, Takashi

    2013-01-01

    Off-flavor substances generated naturally in foods/beverages deteriorate the quality of products considerably. Generally, it has been thought that off-flavor substances induce unpleasant smells exogenously. Here, however, we show that 2,4,6-trichroloanisole (TCA), known as one of the strongest off-flavors, inhibits ciliary transduction channels. Surprisingly, suppression was caused with 1-aM solution. The TCA effect showed slow kinetics, with an integration time of approximately 1 s, and posi...

  16. 2,4,6-Trinitrotoluene Reduction by Carbon Monoxide Dehydrogenase from Clostridium thermoaceticum

    OpenAIRE

    Huang, Shouqin; Lindahl, Paul A.; Wang, Chuanyue; Bennett, George N.; Rudolph, Frederick B.; Hughes, Joseph B.

    2000-01-01

    Purified CO dehydrogenase (CODH) from Clostridium thermoaceticum catalyzed the transformation of 2,4,6-trinitrotoluene (TNT). The intermediates and reduced products of TNT transformation were separated and appear to be identical to the compounds formed by C. acetobutylicum, namely, 2-hydroxylamino-4,6-dinitrotoluene (2HA46DNT), 4-hydroxylamino-2,6-dinitrotoluene (4HA26DNT), 2,4-dihydroxylamino-6-nitrotoluene (24DHANT), and the Bamberger rearrangement product of 2,4-dihydroxylamino-6-nitrotolu...

  17. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides

    Science.gov (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.

    2015-10-01

    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  18. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  19. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium

    OpenAIRE

    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray

    2009-01-01

    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  20. Distribution, retention and dosimetry of plutonium and americium in the rat, dog and monkey after inhalation of an industrial-mixed uranium and plutonium oxide aerosol

    International Nuclear Information System (INIS)

    This study provides information on patterns of radiation dose in laboratory animals after inhalation exposure to an aerosol of one form of mixed uranium and plutonium oxide. The aerosol contained a mixture of UO2 and 750 deg C heat-treated PuO2 obtained from the ball milling operation in a mixed-oxide fuel fabrication process. Americium-241 from the decay of 241Pu was also present in the PuO2 matrix. Fischer-344 rats, Beagle dogs, and Cynomolgus and Rhesus monkeys inhaled aerosols re-generated from dry mixed oxide powders with particle size distribution characteristics similar to those observed in samples collected at the industrial site. Clearance from the lung and distribution in other tissues of the plutonium from this UO2 + PuO2 admixture was similar to what has been observed for PuO2 from laboratory-produced aerosols. The UO2-PuO2 aerosol was relatively insoluble in the lungs of all species. Monkeys and rats cleared plutonium and americium from their lungs faster than dogs. Very little plutonium or americium translocated within the first 2 yr after exposure to tissues other than tracheobronchial lymph nodes. The greater accumulation of plutonium and americium in the tracheobronchial lymph nodes of dogs as compared to monkeys and rats combined with the more rapid initial clearance of these radionuclides from the lungs of rats and monkeys suggests that errors could result from using data from a single animal species to estimate risk to humans from inhalation of these industrial aerosols. (author)

  1. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  2. Structural Studies of N-(2,4,6-trisubstitutedphenyl)-Chloroacetamides, 2,4,6-X3C6 H2 -NHCO-CH3_y Cly, (X = CH3 or Cl and y = 1 -3)

    Science.gov (United States)

    Gowda, B. Thimme; Svoboda, I.; Fuess, Hartmut

    2000-10-01

    The effect of side chain and ring substitutions on the crystal structures of N-(2,4,6-substitutedpheny)- chloroacetamides of the type, 2,4,6-X3C6H2-NHCO-CH3_yCly (X = CH3 or Cl and 1 ⩽ y ⩽ 3), has been studied by determining the crystal structures of N-(2,4,6-trimethylphenyl)- 2-chloroacetamide, 2,4,6-(CH3)3C6H2-NHCO-CH2Cl (TMPMCA); N-(2,4,6-trichlorophenyl)-2- chloroacetamide, 2,4,6-Cl3C6H2-NHCO-CH2Cl (TCPMCA); N-(2,4,6-trichlorophenyl)-2,2-dichloroacetamide, 2,4,6-Cl3C6H2-NHCO-CHCl2 (TCPDCA) and N-(2,4,6-trichlorophenyl)-2,2,2- trichloroacetamide, 2,4,6-Cl3C6H2-NHCO-CCl3 (TCPTCA). The crystal type, space group, formula units and lattice constants in A are: (TMiPMCA); monoclinic, P21,/n, Z = 8, a = 9.029(5), b = 15.688(2), c = 16.150(3), ß = 96.77(2)°; (TCPMCA): orthorhombic, Pna21, Z = 8, a = 30.708(4), b = 4.685(1), c = 14.506(2); (TCPDCA) orthorhombic, P212121 Z = 4, a = 16.459(3), b = 15.240(3), c = 4.640(1) and (TCPTCA): triclinic, P Ī , Z = 4, a = 9.828(2), b = 11.953(2), c = 12.278(2), a = 71,05( 1)°, ß = 75.26(2)°, g = 83.29( 1)°. The results have been analysed along with the structures of the ring unsubstituted N-phenylacetamide (PA), N-phenyl-2,2,2-trichloro-acetamide, side chain unsubstituted N-(2,4,6-trichlorophenyl)-acetamide, 2,4,6-Cl3C6H2-NHCO-CH3 (TCPA) and the corresponding di-substituted phenyl acetamides and chloroacetamides. The compounds TMPMCA, TCPMCA and TCPTCA have 2 molecules each in their asymmetric units. This is in agreement with the multiple lines observed in the 35CI NQR spectra of TCPTCA. Further, this compound shows disorder as indicated by the multiplicity of the C(side chain) - Cl bonds. The compound TCPMCA does not show 35C1 NQR spectra, while the compound TMPMCA shows a single frequency which fades out above 200 K, indicating that it may undergo a phase transition well below room temperature. Conversion of 2,4,6-trichloroaniline into 2,4,6-trichlorophenyl acetamide and gradual replacement of H-atoms in the side chain

  3. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: dam.prieur@gmail.com [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)

    2015-10-15

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  4. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  5. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  6. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    International Nuclear Information System (INIS)

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1−xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1−xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions. - Graphical abstract: Formation of (UIV/V,AmIII)O2 solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • UV and AmIII are formed in equimolar proportions

  7. Preliminary results from uranium/americium affinity studies under experimental conditions for cesium removal from NPP ''Kozloduy'' simulated wastes solutions

    International Nuclear Information System (INIS)

    We use the approach described by Westinghouse Savannah River Company using ammonium molybdophosphate (AMP) to remove elevated concentrations of radioactive cesium to facilitate handling waste samples from NPP Kozloduy. Preliminary series of tests were carried out to determine the exact conditions for sufficient cesium removal from five simulated waste solutions with concentrations of compounds, whose complexing power complicates any subsequent processing. Simulated wastes solutions contain high concentrations of nitrates, borates, H2C2O4, ethylenediaminetetraacetate (EDTA) and Citric acid, according to the composition of the real waste from the NPP. On this basis a laboratory treatment protocol was created. This experiment is a preparation for the analysis of real waste samples. In this sense the results are preliminary. Unwanted removal of non-cesium radioactive species from simulated waste solutions was studied with gamma spectrometry with the aim to find a compromise between on the one hand the AMP effectiveness and on the other hand unwanted affinity to AMP of Uranium and Americium. Success for the treatment protocol is defined by proving minimal uptake of U and Am, while at the same time demonstrating good removal effectiveness through the use of AMP. Uptake of U and Am were determined as influenced by oxidizing agents at nitric acid concentrations, proposed by Savannah River National laboratory. It was found that AMP does not significantly remove U and Am when concentration of oxidizing agents is more than 0.1M for simulated waste solutions and for contact times inherent in laboratory treatment protocol. Uranium and Americium affinity under experimental conditions for cesium removal were evaluated from gamma spectrometric data. Results are given for the model experiment and an approach for the real waste analysis is chosen. Under our experimental conditions simulated wastes solutions showed minimal affinity to AMP when U and Am are most probably in the

  8. Monoklonale Antikörper zum Nachweis von 2,4,6-Trichloranisol in Kork

    OpenAIRE

    Lausterer, Ralph

    2005-01-01

    Die Verbindung 2,4,6-Trichloranisol (TCA) kann in Kork und Wein vorkommen. TCA entsteht durch mikrobielle Umsetzung von Chlorphenolen. In den betroffenen Industrien führt TCA zu jährlichen Verlusten von mehr als einer Milliarde €. Zur Bestimmung von TCA sollten enzymkoppelte Immunabsorptionstest (ELISAs) mit monoklonalen Antikörpern (mAk) entwickelt werden. Es wurden drei TCA-spezifische mAk-produzierende Zelllinien gewonnen. Mit diesen mAk wurden hochsensitive ELISAs hergstellt, die eine Nac...

  9. Synthesis of 2,4,6-triamino-1,3,5- trinitrobenzene

    Directory of Open Access Journals (Sweden)

    Gilson da Silva

    2011-01-01

    Full Text Available The 2,4,6-triamino-1,3,5-trinitrobenzene (TATB is perhaps the most thermostable and insensitive explosive known. Its low sensibility to shock makes it suitable for military and civil applications. TATB application is done either alone or in combination with another high energetic material. This study aimed at reporting the review about many processes to produce TATB and the problems associated with them, as well as suggest techniques like Fourier Transform Infrared Spectroscopy (FT-IR and Differential Scanning Calorimetry (DSC, which can be useful in the characterization of this energetic compound.

  10. Thermal Decomposition Kinetics of Lead 2,4,6-Trinitroresorcinate Monohydrate

    Institute of Scientific and Technical Information of China (English)

    HU Rong-zu; YAO Pu; LI Jing; CHEN San-ping; GAO Sheng-li; ZHAO Feng-qi; SONG Ji-rong; SHI Qi-zhen; CHEN Pei; LUO Yang; ZHAO Hong-an

    2004-01-01

    The non-isothermal decomposition of lead 2,4,6-trinitroresorcinate monohydrate, Pb (TNR) · H2O. was investigated by means of TG-DTA, DSC and IR. The thermal decomposition mechanism and the dissociated kinetics were also investigated. The kinetic parameters were obtained from the analysis of the DSC curves by integral and differential methods. The most probable kinetic model function of the dehydration reaction of Pb(TNR) · H2O was suggested by the comparison of the kinetic parameters.

  11. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    Energy Technology Data Exchange (ETDEWEB)

    Burns, P.A.; Cooper, M.B.; Lokan, K.H.; Wilks, M.J.; Williams, G.A. [Australian Radiation Lab., Melbourne, VIC (Australia)

    1995-11-01

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ``one point`` safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author).

  12. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  13. Characterization of a Sealed Americium-Beryllium (AmBe) Source by Inductively Coupled Plasma Mass Spectrometry

    International Nuclear Information System (INIS)

    Two Americium-Beryllium neutron sources were dismantled, sampled (sub-sampled) and analyzed via inductively coupled plasma mass spectrometry (ICP-MS). Characteristics such as 'age' since purification, actinide content, trace metal content and inter and intra source composition were determined. The 'age' since purification of the two sources was determined to be 25.0 and 25.4 years, respectively. The systematic errors in the 'age' determination were ± 4 % 2s. The amount and isotopic composition of U and Pu varied substantially between the sub-samples of Source 2 (n=8). This may be due to the physical means of sub-sampling or the way the source was manufactured. Source 1 was much more consistent in terms of content and isotopic composition (n=3 sub-samples). The Be-Am ratio varied greatly between the two sources. Source 1 had an Am-Be ratio of 6.3 ± 52 % (1s). Source 2 had an Am-Be ratio of 9.81 ± 3.5 % (1s). In addition, the trace element content between the samples varied greatly. Significant differences were determined between Source 1 and 2 for Sc, Sr, Y, Zr, Mo, Ba and W.

  14. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  15. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  16. Migration of the fission products strontium, technetium, iodine, cesium, and the actinides neptunium, plutonium, americium in granitic rock

    International Nuclear Information System (INIS)

    Rock samples were taken from drilling cores in granitic and granodioritic rock, and small (2x2x2 cm) rock tablets from the drilling cores were exposed to a groundwater solution containing one of the studied elements at race levels. The concentration of the element versus penetration depth in the rock tablet was measured radiometrically. The sorption on the mineral faces and the migration into the rock was studied, by an autoradiographic technique. The cationic fission products strontium and cesium had apparent diffusivities of 10-13-10-14 m2/s. They migrate mainly in fissures or filled fractures containing e.g., calcite, epidote or chlorite or in veins with hgih capacity minerals (e.g. biotite). The anionic fission products iodine and technetium had apparent diffusivities of about 10-14 m2/s. These species migrate along mineral boundaries and in open fractures and to a minor extent in high capacity mineral veins. The migration of the actinides neptunium, plutonium and americium is very slow (in the mm-range after 2-3 years contact time). The apparent diffusivities were about 10-15 m2/s. The actinide migration into the rock was largely confined to fissures. (orig./HP)

  17. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  18. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  19. Measured solubilities and speciations of neptunium, plutonium, and americium in a typical groundwater (J-13) from the Yucca Mountain region

    International Nuclear Information System (INIS)

    Solubility and speciation data are important in understanding aqueous radionuclide transport through the geosphere. They define the source term for transport retardation processes such as sorption and colloid formation. Solubility and speciation data are useful in verifying the validity of geochemical codes that are part of predictive transport models. Results are presented from solubility and speciation experiments of 237NpO2+, 239Pu4+, 241Am3+/Nd3+, and 243Am3+ in J-13 groundwater (from the Yucca Mountain region, Nevada, which is being investigated as a potential high-level nuclear waste disposal site) at three different temperatures (25 degree, 60 degree, and 90 degree C) and pH values (5.9, 7.0, and 8.5). The solubility-controlling steady-state solids were identified and the speciation and/or oxidation states present in the supernatant solutions were determined. The neptunium solubility decreased with increasing temperature and pH. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. The americium solutions showed no clear solubility trend with increasing temperature and increasing pH

  20. Synthesis of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide – a tailor-made photoinitiator for dental adhesives

    OpenAIRE

    Moszner, Norbert; Lamparth, Iris; Angermann, Jörg; Fischer, Urs Karl; Zeuner, Frank; Bock, Thorsten; Liska, Robert; Rheinberger, Volker

    2010-01-01

    Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide (WBAPO) was synthesized starting from 3-(chloromethyl)-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxy)ethanol. In the second step, 3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated...

  1. WE-A-18A-01: TG246 On Patient Dose From Diagnostic Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Supanich, M [Rush University Medical Center, Chicago, IL (United States); Dong, F [The Cleveland Clinic, Solon, OH (United States); Andersson, J [Umea University, Umea (Sweden); Pavlicek, W [Mayo Clinic Arizona, Scottsdale, AZ (United States); Bolch, W [University Florida, Gainesville, FL (United States); Fetterly, K [Mayo Clinic, Rochester, MN (United States)

    2014-06-15

    Radiation dose from diagnostic and interventional radiations continues to be a focus of the regulatory, accreditation and standards organizations in the US and Europe. A Joint AAPM/EFOMP effort has been underway in the past year — having the goal to assist the clinical medical physicist with communicating optional and varied approaches in estimating (and validating) patient dose. In particular, the tools provided by DICOM Radiation Dose Structured Reports, either by themselves or as part of a networked data repository of dose related information are a rich source of actionable information. The tools of the medical physicist have evolved to include using DICOM data in meaningful ways to look at patient dose with respect to imaging practices. In addition to how accurate or reproducible a dose value is (totally necessary and our traditional workspace) it is now being asked how reproducible (patient to patient, device to device) are the delivered doses (new tasking)? Clinical medical physicists are best equipped to assist our radiology and technologist colleagues with this effort. The purpose of this session is to review the efforts of TG246 - bringing forward a summary content of the TG246 Report including specific dose descriptors for CT and Fluoroscopy — particularly in a focus of leveraging the RDSR as a means for monitoring good practices ALARA. Additionally, rapidly evolving technologies for more refined dose estimates are now in use. These will be presented as they look to having highly patient specific dose estimates in automated use.

  2. Identification and responsibility of 2,4,6-tribromoanisole in musty, corked odors in wine.

    Science.gov (United States)

    Chatonnet, Pascal; Bonnet, Sandra; Boutou, Stéphane; Labadie, Marie-Dominique

    2004-03-10

    In this work, gas phase chromatography analysis coupled with selective selected ion monitoring (SIM) identified 2,4,6-tribromoanisole (TBA) in wines found on tasting to have significant "musty or corked" character, although they did not contain noteworthy quantities of chloroanisoles or chlorophenols, the contaminants generally reported to cause this type of defect. The perception thresholds were studied, together with contamination conditions during winemaking, storage, and bottle-aging. A "musty" off-odor was perceptible on smelling wine containing as little as 4 ng L(-)(1) TBA, and spoilage may be detected by retro-olfaction at even lower concentrations. TBA, produced by O-methylation of its direct precursor, 2,4,6-tribromophenol, generally comes from sources in the winery environment. This paper is the first to identify the sources of a large number of cases of wines polluted during storage in premises where the atmosphere was contaminated with TBA used recently to treat wood, or originating from much older structural elements of the winery, or from used wooden containers. In certain cases, although the initial source had been eliminated, residual pollution adsorbed on walls could be sufficient to make a building unsuitable for storing wooden barrels and plastics, as well as corks, which have been found to be particularly susceptible to contamination by the TBA in the winery atmosphere. PMID:14995130

  3. Ecotoxicological evaluation of wastewater from 2.4.6-TNT production.

    Science.gov (United States)

    Ribeiro, Elaine N; Da Silva, Flávio Teixeira; De Paiva, Teresa Cristina Brazil

    2012-01-01

    During the manufacture of explosives, large amounts of water are used to remove unwanted by-products generated. This water in turn, ends up in wastewater treatment plants or water bodies. The aim of this study was to evaluate the toxic potential of effluent generated by 2.4.6-Trinitrotoluene (TNT) production, yellow water, red water and mixture of yellow and red water, produced from a plant located in the Paraíba Valley, São Paolo state, Brazil. Daphnia similis, Danio rerio, Escherichia coli, Pseudomonas putida and Pseudokircheneriella subcaptata were used as test organisms. Physicochemical parameters such as color, pH, conductivity, total dissolved solids, dissolved oxygen, chemical oxygen demand (COD) and biochemical oxygen demand (BOD) were evaluated. Effluent from 2.4.6-TNT production was extremely toxic to all test organisms. The physicochemical parameters evaluated showed high levels of conductivity (from 41.533 to 42.344 μS /cm) and chemical oxygen demand (COD of 8471 to 27.364 mg/L) for the effluents analyzed. PMID:22242870

  4. WE-A-18A-01: TG246 On Patient Dose From Diagnostic Radiation

    International Nuclear Information System (INIS)

    Radiation dose from diagnostic and interventional radiations continues to be a focus of the regulatory, accreditation and standards organizations in the US and Europe. A Joint AAPM/EFOMP effort has been underway in the past year — having the goal to assist the clinical medical physicist with communicating optional and varied approaches in estimating (and validating) patient dose. In particular, the tools provided by DICOM Radiation Dose Structured Reports, either by themselves or as part of a networked data repository of dose related information are a rich source of actionable information. The tools of the medical physicist have evolved to include using DICOM data in meaningful ways to look at patient dose with respect to imaging practices. In addition to how accurate or reproducible a dose value is (totally necessary and our traditional workspace) it is now being asked how reproducible (patient to patient, device to device) are the delivered doses (new tasking)? Clinical medical physicists are best equipped to assist our radiology and technologist colleagues with this effort. The purpose of this session is to review the efforts of TG246 - bringing forward a summary content of the TG246 Report including specific dose descriptors for CT and Fluoroscopy — particularly in a focus of leveraging the RDSR as a means for monitoring good practices ALARA. Additionally, rapidly evolving technologies for more refined dose estimates are now in use. These will be presented as they look to having highly patient specific dose estimates in automated use

  5. Visual detection of 2,4,6-trinitrotolune by molecularly imprinted colloidal array photonic crystal.

    Science.gov (United States)

    Lu, Wei; Asher, Sanford A; Meng, Zihui; Yan, Zequn; Xue, Min; Qiu, Lili; Yi, Da

    2016-10-01

    We developed a photonic crystal (PhC) sensor for the quantification of 2,4,6-trinitrotoluene (TNT) in solution. Monodisperse (210nm in diameter) molecularly imprinted colloidal particles (MICs) for TNT were prepared by the emulsion polymerization of methyl methacrylate and acrylamide in the presence of TNT as a template. The MICs were then self-assembled into close-packed opal PhC films. The adsorption capacity of the MICs for TNT was 64mg TNT/g. The diffraction from the PhC depended on the TNT concentration in a methanol/water (3/2, v/v) potassium dihydrogen phosphate buffer solution (pH=7.0, 30mM). The limit of detection (LOD) of the sensor was 1.03μg. The color of the molecularly imprinted colloidal array (MICA) changed from green to red with an 84nm diffraction red shift when the TNT concentration increased to 20mM. The sensor response time was 3min. The PhC sensor was selective for TNT compared to similar compounds such as 2,4,6-trinitrophenol, 2,4-dinitrotoluene, 2,6-dinitrotoluene, 2-nitromesitylene, 4-nitrotoluene, 2-nitrotoluene, 1,3-dinitrobenzene, methylbenzene, 4-nitrophenol, 2-nitroaniline, 3-aminophenol and 3-nitroaniline. The sensor showed high stability with little response change after three years storage. This sensor technology might be useful for the visual determination of TNT. PMID:27214001

  6. 儿童支气管异物246例临床分析%Clinical analysis of bronchial foreign bodies in 246 children

    Institute of Scientific and Technical Information of China (English)

    马渝燕; 焦安夏; 江沁波; 饶小春; 潘跃娜; 刘玺诚

    2010-01-01

    目的 回顾性研究儿童支气管异物的临床特点以及电子支气管镜在诊断治疗儿童支气管异物中的作用.方法 2000年1月至2009年8月北京儿童医院经支气管镜诊断治疗的支气管异物患儿246例,应用Olympus电子支气管镜,在局部黏膜麻醉下经鼻插入支气管镜逐级观察支气管结构,使用篮状异物钳或齿状异物钳钳取异物.结果 246例患儿中,支气管异物以果仁或果壳类(230例,占93.5%)最为常见,异物嵌顿位置以右下叶支气管开口(98例,占39.8%)为最多.钳取异物手术次数平均为(1.9±1.3)次,一次取出率为58.5%(144例).阻塞于左右主支气管、右中叶和右下叶支气管的异物一次取出率较高,分别为91.1%、60.0%和55.1%.篮状异物钳钳取所需次数(1.4±0.9)明显低于齿状异物钳所需次数(2.1±1.4),差异有统计学意义(P=0.000).结论 儿童支气管异物种类以果仁或果壳类植物性异物为主,阻塞部位以右下支气管为多见.位于左右主支气管异物一次取出率明显高于其他部位.用篮状异物钳钳取异物所需手术次数明显少于使用齿状异物钳.%Objective To analyze the characters of bronchial foreign bodies in children and the utilization of bronchoscope in the treatment of bronchial foreign bodies. Methods A total of 246 children were diagnosed with bronchial foreign bodies at our hospital during January 2000 until August 2009. Under local mucosal anesthesia, a bronchoscope was inserted through nasal cavity into bronchi. After identifying the site of foreign body, grasping forceps was guided through bronchoscope to remove the foreign body from airway. Results Among 246 cases, hard nut and skin of melon seed were found ( n = 230, 93.5% ). The most common site of foreign body was in right lower lobe bronchi ( n =98, 38.9% ). The average operative frequency was 1.9 ± 1.3 and one-time extraction ratio 58.5% ( n = 144). The one-time extraction ratio of patients with foreign

  7. Timing analysis of the X-ray transient source XTE J1806--246 (2S1803--245)

    OpenAIRE

    Revnivtsev, M.; Borozdin, K.; A. Emelyanov

    1999-01-01

    An outburst of the X-ray transient source XTE J1806--246 (2S1803--245) has been observed by Rossi X-ray Timing Explorer in April-July 1998. Strong quasi-periodical oscillations (QPO) with a central peak frequency around 9 Hz was detected in one observation of the series performed by PCA/RXTE experiment. X-ray flux from the source during the observation with QPO was maximal. The energy spectrum of XTE J1806--246 at this time was softer than for other observations. A sufficient variability of t...

  8. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  9. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  10. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  11. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  12. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides.

    Science.gov (United States)

    Makris, Konstantinos C; Shakya, Kabindra M; Datta, Rupali; Sarkar, Dibyendu; Pachanoor, Devanand

    2007-07-01

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mgg(-1)), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (pvetiver grass. PMID:17240499

  13. The high-pressure phase behavior and compressibility of 2,4,6-trinitrotoluene

    Energy Technology Data Exchange (ETDEWEB)

    Stevens, Lewis L.; Velisavljevic, Nenad; Hooks, Daniel E.; Dattelbaum, Dana M. (LANL)

    2008-10-24

    The phase stability and isothermal compression behavior of 2,4,6-trinitrotoluene (TNT) have been established to 26.5 GPa using angle-dispersive x-ray diffraction. P-V isotherms derived from the high-pressure x-ray spectra displayed a slight density hysteresis around 4.0 GPa and a sharp discontinuity at - 20.0 GPa. The latter transition is ascribed to a monoclinic-to-orthorhombic first-order phase transition in TNT. The conversion of the isothermal P-V data to the shock velocity-particle velocity plane revealed a deviation from linearity at low u{sub p}, a cusp associated with the phase transition at high u{sub p}, and general agreement with the wealth of unreacted Hugoniot data on TNT.

  14. Crystal structure of [2-(triethylammonioethyl][(2,4,6-triisopropylphenylsulfonyl]amide tetrahydrate

    Directory of Open Access Journals (Sweden)

    C. Golz

    2015-05-01

    Full Text Available The zwitterionic title compound, C23H42N2O2S·4H2O, crystallized as a tetrahydrate from a solution of N-[(2,4,6-triisopropylphenylsulfonyl]aziridine in triethylamine, diethyl ether and pentane in the presence of moist air. It is formed by a nucleophillic ring-opening that is assumed to be reversible. The molecular structure shows a major disorder of the triisopropylphenyl group over two equally occupied locations. An interesting feature is the uncommon hydrate structure, exhibiting a tape-like motif which can be classified as a transition of the one-dimensional T4(26(2 motif into the two-dimensional L4(65(76(8 motif.

  15. The high-pressure phase stability of 2,4,6-trinitrotoluene (TNT)

    Science.gov (United States)

    Bowden, P. R.; Chellappa, R. S.; Dattelbaum, D. M.; Manner, V. W.; Mack, N. H.; Liu, Z.

    2014-05-01

    2,4,6-trinitrotoluene (TNT) is a widely used explosive that is relatively insensitive to initiation by shock loading. While the detonation properties of TNT have been extensively reported, the high pressure-temperature (P-T) stability of TNT has not been investigated in detail. At ambient conditions, TNT crystallizes in a monoclinic lattice (space group P21/a), and our previous X-ray diffraction (XRD) measurements at room temperature suggested a phase transition to orthorhombic (space group Pca21) at ~20 GPa. In this work, we have performed in-situ synchrotron XRD and vibrational spectroscopy measurements along the room temperature isotherm to investigate phase stabilities up to 18 GPa. While our Raman spectroscopy measurements indicate spectral changes at ~2 GPa, careful XRD measurements reveal that the monoclinic phase persists up to 10 GPa.

  16. The high-pressure phase stability of 2,4,6-trinitrotoluene (TNT)

    International Nuclear Information System (INIS)

    2,4,6-trinitrotoluene (TNT) is a widely used explosive that is relatively insensitive to initiation by shock loading. While the detonation properties of TNT have been extensively reported, the high pressure-temperature (P-T) stability of TNT has not been investigated in detail. At ambient conditions, TNT crystallizes in a monoclinic lattice (space group P21/a), and our previous X-ray diffraction (XRD) measurements at room temperature suggested a phase transition to orthorhombic (space group Pca21) at ∼20 GPa. In this work, we have performed in-situ synchrotron XRD and vibrational spectroscopy measurements along the room temperature isotherm to investigate phase stabilities up to 18 GPa. While our Raman spectroscopy measurements indicate spectral changes at ∼2 GPa, careful XRD measurements reveal that the monoclinic phase persists up to 10 GPa.

  17. Poly[[triaqua(μ3-pyridine-2,4,6-tricarboxylatoterbium(III] monohydrate

    Directory of Open Access Journals (Sweden)

    Hong-lin Zhu

    2012-07-01

    Full Text Available The asymmetric unit of the title compound, {[Tb(C8H2NO6(H2O3]·H2O}n, contains one TbIII ion, one pyridine-2,4,6-tricarboxylate (ptc anion, three aqua ligands and one lattice water molecule. The TbIII ion is nine coordinated by one N and five O atoms from three ptc ligands and by three O atoms from the three aqua ligands in a distorted bicapped trigonal–prismatic geometry. The ptc ligands bridge the TbIII ions into a two-dimensional polymeric framework parallel to (100. An extensive O—H...O hydrogen-bonding network consolidates the crystal packing.

  18. High uptake of 2,4,6-trinitrotoluene by vetiver grass--potential for phytoremediation?

    Science.gov (United States)

    Makris, Konstantinos C; Shakya, Kabindra M; Datta, Rupali; Sarkar, Dibyendu; Pachanoor, Devanand

    2007-03-01

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNTL(-1) for 8d. Aqueous concentrations of TNT reached the method detection limit ( approximately 1 microg L(-1)) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. PMID:16899329

  19. Reliability of optical fibres and components final report of COST 246

    CERN Document Server

    Griffioen, Willem; Gadonna, Michel; Limberger, Hans; Heens, Bernard; Knuuttila, Hanna; Kurkjian, Charles; Mirza, Shehzad; Opacic, Aleksandar; Regio, Paola; Semjonov, Sergei

    1999-01-01

    Reliability of Optical Fibres and Components reports the findings of COST 246 (1993-1998) - European research initiative in the field of optical telecommunications. Experts in the materials and reliability field of optical fibres and components have contributed to this unique study programme. The results, conclusions and achievements of their work have been obtained through joint experimentation and discussion with representatives from manufacturing and research groups. Topics covered include: Lifetime estimation; Failure mechanisms; Ageing test methods; Field data and service environments for components. For the first time the reader can explore the reliability of products and examine the results and conclusions in published form. This comprehensive volume is intended to provide a deeper understanding of the reliability of optical fibres and components. The book will be extremely useful to all scientists and practitioners involved in the industry.

  20. Oral exposure of adult zebrafish (Danio rerio) to 2,4,6-tribromophenol affects reproduction

    DEFF Research Database (Denmark)

    Halden, Anna Norman; Nyholm, Jenny Rattfelt; Andersson, Patrik L;

    2010-01-01

    not significantly affected, but yolk-sac oedema tended to increase in frequency in exposed groups with time. Our results show that dietary exposure to TBP, at concentrations found in marine organisms that are part of the natural diet of wild fish, can interfere with reproduction in zebrafish. We also......The bromophenol 2,4,6-tribromophenol (TBP) is widely used as an industrial chemical, formed by degradation of tetrabromobisphenol-A, and it occurs naturally in marine organisms. Concentrations of TBP in fish have been related to intake via feed, but little is known about effects on fish health...... after oral exposure. In this study, we exposed adult male and female zebrafish (Danio rerio) to TBP via feed in nominal concentrations of 33, 330, and 3300 mu g/g feed (or control feed) for 6 weeks to assess the effects of TBP on reproductive output, gonad morphology, circulatory vitellogenin levels...

  1. Recovery of plutonium and americium from laboratory acidic waste solutions using tri-n-octylamine and octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide.

    Science.gov (United States)

    Michael, K M; Rizvi, G H; Mathur, J N; Kapoor, S C; Ramanujam, A; Iyer, R H

    1997-11-01

    Plutonium from acidic waste solutions has been recovered quantitatively using tri-n-octylamine (TnOA) in xylene and americium using a mixture of octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide (CMPO) and TBP in dodecane by extraction and extraction chromatographic methods. The Pu ( IV ) TnOA species extracted into the organic phase from higher nitric acid concentrations has been confirmed as (R(3)NH)(2)Pu(NO(3))(6) (where R(3)N = TnOA by employing slope analysis as well as spectrophotometric studies. PMID:18966958

  2. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state properties...... phase in order to match the experimental data. Thus, neither the GGA+U nor the HYB-DFT methods are able to describe the energetics of Am metal properly in the entire pressure range from 0 GPa to 50 GPa with a single choice of their respectiveU and α parameters. Low binding-energy peaks in the...

  3. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  4. Uptake of curium (244Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    International Nuclear Information System (INIS)

    Curium (244Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium. (author)

  5. Uptake of curium (/sup 244/Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Miramand, P.; Germain, P.; Arzur, J.C.

    1987-01-01

    Curium (/sup 244/Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium.

  6. Towards the island of superheavy stability - Prompt spectroscopy of 246Fm and 256Rf nuclei

    International Nuclear Information System (INIS)

    The region of trans-fermium nuclei (Z = 100 to 104) is the last region of the nuclides chart to be accessible to spectroscopic measurements. It therefore provides the ultimate anchor points for nuclear models. This region also lies on the path of the alpha-decay chains of the super-heavy elements. This region represents the limit of today's spectroscopic capabilities. It therefore requires technological developments in order to overcome these limits. My thesis focuses on various aspects of the spectroscopy of trans-fermium nuclei. I took part in the development of the TNT2D digital acquisition cards for germanium detectors. I validated their use on the gamma-ray spectrometer JUROGAM during an in-beam experiment and demonstrated the gain compared to an analogue acquisition system. These tests were part of the developments needed to secure a study of the prompt spectroscopy of 256Rf. The preparation of this experiment also lead me to work on the development of a 50Ti beam. For that purpose, I studied and tested the use of titanium organo-metallic compounds compatible with the MIVOC technique. In parallel, I studied the use of metallic and oxide titanium pellets with an inductive oven newly developed at the University of Jyvaeskylae. In addition to these developments, I had the opportunity to study the in-beam prompt spectroscopy of 246Fm at the University of Jyvaeskylae. The measurements yielded a rotational band built on the ground state of 246Fm. This band has been observed up to the level 16+ and shows a behaviour quite similar to the neighbouring even-even isotopes, except for the top of the band for which a wider statistics is necessary in order to conclude. (author)

  7. Investigation of solubility of cesium, strontium, barium, rare-earth, uranium and americium fluorides in acid nitrosyl fluoride (NOFx3HF)

    International Nuclear Information System (INIS)

    Solubility of Am and other elements, which are fission products, in acid nitrosylfluoride has been studied. Cesium fluoride has maximum solubility; uranium tetrafluoride is also noticeably soluble; americium trifluoride is practically insoluble; fluorides of rare earth elements are slightly soluble in NOFx3HF. Analysis of the solid phase obtained after treating the mixture of the above fluorides with acid nitrosylfluoride has shown that cesium fluoride reacts with NOFx3HF with the formation of an acid salt (CsFxHF), whereas fluorides of alkaline and rare earth elements remain unchanged. The behaviour of a mixture of cesium, barium, and lanthanum fluorides in the process of three-multiple treating with acid nitrosylfluoride has been studied. It is shown that more than 98% of cesium fluoride and 5% of barium fluoride pass into the mother liquor while lanthanum fluoride remains completely in the solid phase. The data on americium fluoride solubility in acid nitrosylfluoride have indicated that it behaves in the same way as fluorides of rare earth elements; it is practically insoluble in HOFx3HF

  8. Determining the americium transmutation rate and fission rate by post-irradiation examination within the scope of the ECRIX-H experiment

    International Nuclear Information System (INIS)

    The ECRIX-H experiment aims to assess the feasibility of transmuting americium micro-dispersed in an inert magnesia matrix under a locally moderated neutron flux in the Phénix reactor. A first set of examinations demonstrated that pellet behaviour was satisfactory with moderate swelling at the end of the irradiation. Additional post-irradiation examinations needed to be conducted to confirm the high transmutation rate so as to definitively conclude on the success of the ECRIX-H experiment. This article presents and discusses the results of these new examinations. They confirm the satisfactory behaviour of the MgO matrix not only during the basic irradiation but also during post-irradiation thermal transients. These examinations also provide additional information on the behaviour of fission products both in the americium-based particles and in the MgO matrix. These results particularly validate the transmutation rate predicted by the calculation codes using several different analytical techniques. The fission rate is also determined

  9. Susceptibility of male and female Japanese medaka (Oryzias latipes) to 2,4,6-trichlorophenol-induced micronuclei in peripheral erythrocytes

    Institute of Scientific and Technical Information of China (English)

    Nannan LIU; Mei MA; Yiping XU; Jinmiao ZHA; Kaifeng RAO; Zijian WANG

    2013-01-01

    2,4,6-trichlorophenol (2,4,6-TCP) is a wide- spread probable human carcinogen and has been proven to have genotoxicity in in vitro assays. However, little genotoxicity information and no micronuclei induction data for 2,4,6-TCP is available from in vivo tests, especially for sex-specific differences. Following a preliminary test, a piscine peripheral erythrocyte micro- nucleus assay was conducted on medaka (Oryzias latipes) after a 28-day exposure to 2,4,6-TCE In the present study, the mean micronuclei (MNC) frequencies of all of the groups increased in a dose-dependent manner, which indicated the potential genotoxicity of 2,4,6-TCE More- over, males were found to be more susceptible compared with females after a 28-day exposure to 2,4,6-TCP in all of the dosed groups above 10 ~tg-L-1. This is the first report on the potential of micronuclei induction and a sex-susceptible effect in the peripheral erythrocytes of mature fish after 2,4,6-TCP in vivo exposure.

  10. Highly sensitive detection of 2,4,6-trichlorophenol based on HS-β-cyclodextrin/gold nanoparticles composites modified indium tin oxide electrode

    International Nuclear Information System (INIS)

    Graphical abstract: Display Omitted -- Highlights: •A novel electrochemical sensing platform by self-assembling of HS-β-cyclodextrin/gold nanoparticles onto indium tin oxide electrode (HS-β-CD/AuNPs/SAM/ITO electrode) surface was constructed. •The proposed electrochemical sensor exhibited high sensitivity for the determination 2,4,6-trichlorophenol which electrochemical activity is very weak. •The newly developed method was successfully applied to quantitatively determine 2,4,6-trichlorophenol in tap water samples. -- ABSTRACT: A new electrochemical sensor for determination of 2,4,6-trichlorophenol (2,4,6-TCP) was fabricated. The characterization of the sensor was studied by scanning electron microscopy, electrochemical impedance spectroscopy and cyclic voltammetry techniques. The electrochemical behavior of 2,4,6-TCP was investigated using cyclic voltammetry and differential pulse voltammetry at the HS-β-cyclodextrin (HS-β-CD)/gold nanoparticles (AuNPs) composite modified indium tin oxide (ITO) electrode. The results showed that the current responses of 2,4,6-TCP greatly enhanced due to the high catalytic activity and enrichment capability of composites. The peak current of 2,4,6-TCP increases linearly with the increase of the 2,4,6-TCP concentration from 3.0 × 10−9 to 2.8 × 10−8 M, with the limit of detection of 1.0 × 10−9. Further more, the modified electrode was successfully applied to detect the level of 2,4,6-TCP in tap water samples with excellent sensitivity

  11. PBCDD/F formation from radical/radical cross-condensation of 2-Chlorophenoxy with 2-Bromophenoxy, 2,4-Dichlorophenoxy with 2,4-Dibromophenoxy, and 2,4,6-Trichlorophenoxy with 2,4,6-Tribromophenoxy

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Xiangli [Environment Research Institute, Shandong University, Jinan 250100 (China); Yu, Wanni [Environment Research Institute, Shandong University, Jinan 250100 (China); College of Resources and Environment, Linyi University, Linyi 276000 (China); Xu, Fei [Environment Research Institute, Shandong University, Jinan 250100 (China); Zhang, Qingzhu, E-mail: zqz@sdu.edu.cn [Environment Research Institute, Shandong University, Jinan 250100 (China); Hu, Jingtian; Wang, Wenxing [Environment Research Institute, Shandong University, Jinan 250100 (China)

    2015-09-15

    Highlights: • We studied the formation of PBCDD/Fs from the reaction of three CPRs with BPRs. • The substitution pattern of halogenated phenols determines those of PBCDD/Fs. • The substitution of halogenated phenols influence the coupling of phenoxy radicals. • The rate constants of the crucial elementary steps were evaluated. - Abstract: Quantum chemical calculations were carried out to investigate the homogeneous gas-phase formation of mixed polybrominated/chlorinated dibenzo-p-dioxins/benzofurans (PBCDD/Fs) from the cross-condensation of 2-chlorophenoxy radical (2-CPR) with 2-bromophenoxy radical (2-BPR), 2,4-dichlorophenoxy radical (2,4-DCPR) with 2,4-dibromophenoxy radical (2,4-DBPR), and 2,4,6-trichlorophenoxy radical (2,4,6-TCPR) with 2,4,6-tribromophenoxy radical (2,4,6-TBPR). The geometrical parameters and vibrational frequencies were calculated at the MPWB1K/6-31+G(d,p) level, and single-point energy calculations were performed at the MPWB1K/6-311+G(3df,2p) level of theory. The rate constants of the crucial elementary reactions were evaluated by the canonical variational transition-state (CVT) theory with the small curvature tunneling (SCT) correction over a wide temperature range of 600–1200 K. Studies show that the substitution pattern of halogenated phenols not only determines the substitution pattern of the resulting PBCDD/Fs, but also has a significant influence on the formation mechanism of PBCDD/Fs, especially on the coupling of the halogenated phenoxy radicals.

  12. HIP 3678: a hierarchical triple stellar system in the centre of the planetary nebula NGC 246

    CERN Document Server

    Adam, C

    2014-01-01

    We report the detection of a new low-mass stellar companion to the white dwarf HIP 3678 A, the central star of the planetary nebula NGC 246. The newly found companion is located about 1 arcsec (at projected separation of about 500 au) north-east of HIP 3678 A, and shares a common proper motion with the white dwarf and its known comoving companion HIP 3678 B. The hypothesis that the newly detected companion is a non-moving background object can be rejected on a significance level of more than 8 $\\sigma$, by combining astrometric measurements from the literature with follow-up astrometry, obtained with Wild Field Planetary Camera 2/\\textit{Hubble Space Telescope} and NACO/Very Large Telescope. From our deep NACO imaging data, we can rule out additional stellar companions of the white dwarf with projected separations between 130 up to 5500 au. In the deepest high-contrast NACO observation, we achieve a detection limit in the \\textit{Ks} band of about 20 mag, which allows the detection of brown dwarf companions w...

  13. Degradation mechanism of 2,4,6-trinitrotoluene in supercritical water oxidation

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The 2,4,6-trinitrotoluene (TNT) is a potential carcinogens and TNT contaminated wastewater, which could not be effectively disposed with conventional treatments. The supercritical water oxidation (SCWO) to treat TNT contaminated wastewater was studied in this article. The TNT concentration in wastewater was measured by high-performance liquid chromatograph (HPLC) and the degraded intermediates were analyzed using GC-MS. The results showed that SCWO could degrade TNT efficiently with O2. The reaction temperature, pressure, residence time and oxygen excess were the main contributing factors in the process. The decomposition of TNT was accelerated as the temperature or residence time increases. At 550℃, 24 MPa, 120 s and oxygen excess 300%, TNT removal rate could exceed 99.9%. Partial oxidation occurs in SCWO without oxygen. It was concluded that supercritical water was a good solvent and had excellent oxidation capability in the existence of oxygen. The main intermediates of TNT during SCWO include toluene, 1,3,5-trinitrobenzene, nitrophenol, naphthalene, fluorenone, dibutyl phthalate, alkanes and several dimers based on the intermediate analysis. Some side reactions, such as coupled reaction, hydrolysis reaction and isomerization reaction may take place simultaneously as TNT is oxidized by SCWO.

  14. Molecularly Imprinted Nanofiber Film for Sensitive Sensing 2,4,6-Tribromophenol

    Directory of Open Access Journals (Sweden)

    Limei Huang

    2016-06-01

    Full Text Available The determination of brominated flame retardants is of great importance, but remains a challenge. Particularly, universal and facile approaches are limited. Here we report a new general approach, combining molecular imprinting and electrospinning, for the efficient and facile imprinting sensor of 2,4,6-tribromophenol (TBP, which was used as a “novel” brominated flame retardant. With TBP as the template molecular, β-cyclodextrin (β-CD as the functional monomer, and poly-vinylbutyral (PVB as the electro-spinning matrix, the nanofiber film was deposited on the glassy carbon electrode (GCE via electrospinning technique directly. The β-CD-PVB/GCE sensor system exhibited excellent TBP sensing performances, such as a low detection limit (6.29 × 10−10 mol·L−1 at room temperature, selective recognition to TBP/phenol/4-methyl-phenol, and good regeneration performance. The approach of fabricating a molecular imprinting nanofiber sensor may shed new light in the detection of other phenolic pollutants.

  15. Phototransformation of 2,4,6-trinitrotoluene: Sensitized by riboflavin under different irradiation spectral range

    Energy Technology Data Exchange (ETDEWEB)

    Yang Xin [Department of Biology, Jackson State University, Jackson, MS 39217 (United States); Beijing Institute of Pharmacology and Toxicology, Beijing 100850 (China); Zhao Xueheng [Department of Biology, Jackson State University, Jackson, MS 39217 (United States); Hwang, H.-M. [Department of Biology, Jackson State University, Jackson, MS 39217 (United States)]. E-mail: hwang@jsums.edu

    2007-05-08

    Riboflavin-sensitized phototransformation of 2,4,6-trinitrotoluene (TNT) under natural sunlight was investigated with reverse-phase high performance liquid chromatography/mass spectrometry (HPLC/MS) and gas chromatography/mass spectrometry (GC/MS). The effect of different spectral region of sunlight on TNT phototransformation in the absence or presence of riboflavin was also investigated by using optical filters with cut-off at 400 or 455 nm. The concentration of riboflavin in the phototransformation of TNT was optimized. Concentration of riboflavin and TNT was 1.0 and 50 {mu}M, respectively. The rates of phototransformation of TNT under natural sunlight in the presence or absence of riboflavin were conformed to initial pseudo-first-order rate equation. The photolysis half life of TNT in the presence of riboflavin was 21.87 min, compared to 39 min in the absence of riboflavin under natural sunlight. Two major phototransformation products of TNT, 3,5-dinitroaniline (3,5-DNA) and 1,3,5-trinitrobenzene (1,3,5-TNB), were detected in the samples in the presence of riboflavin receiving irradiation at full wavelength or wavelength >400 nm. The results indicate that riboflavin mediates TNT sensitized-phototransfomation under natural sunlight or near-UV-vis light.

  16. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides

    International Nuclear Information System (INIS)

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mg g-1), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (p<0.001) increased the 2nd-order reaction rate constant over that of the untreated (no urea) control. Three major TNT metabolites were detected in the roots, but not in the shoot, namely 1,3,5-trinitrobenzene, 4-amino 2,6-dinitrotoluene, and 2-amino 4,6-dinitrotoluene, indicating TNT degradation by vetiver grass. - A common agrochemical, urea catalyzes TNT removal by vetiver grass in aqueous media

  17. Degradation of 2,4,6-trinitrotoluene by P. aeruginosa and characterization of some metabolites

    Directory of Open Access Journals (Sweden)

    Hatice Aysun Mercimek

    2015-03-01

    Full Text Available Degradation of 2,4,6-trinitrotoluene (TNT, a nitroaromatic explosive found in the soil and ground water, was investigated using Pseudomonas aeruginosa in in vitroexperiments. Biodegradable abilitiy of this bacteria was performed with 50 and 75 mg L−1 TNT concentrations in a defined liquid medium for 96 h time period. Treatment of TNT in supernatant samples taken at 0, 6, 12, 24, 48, 72 and 96 h from agitated vessels was followed by reverse-phase high-performance liquid chromatography (HPLC. In cultures supplemented with 50 and 75 mgL−1 TNT, after 96 h of incubation 46% and 59% reduction were detected respectively. Two metabolites as degradation intermediates with nitrite release into the medium, 2,4-dinitrotoluene (2,4-DNT and 4-aminodinitrotoluene (4-ADNT, were elucidated by thin layer chromatography (TLC and gas chromatography-mass spectrometry (GC-MS. These findings clearly indicate that Pseudomonas aeruginosa can be used in bioremediation of TNT contaminated sites.

  18. The high pressure-temperature phase behavior of 2,4,6-trinitrotoluene (TNT)

    Science.gov (United States)

    Bowden, Patrick; Chellappa, Raja; Dattelbaum, Dana; Manner, Virginia; Mack, Nathan; Liu, Zhenxian

    2013-06-01

    2,4,6-trinitrotoluene (TNT) is a widely used explosive that is relatively insensitive to initiation by shock loading. While the detonation properties of TNT have been extensively reported, the high pressure-temperature (P - T) stability of TNT has not been investigated in detail. In addition, there are no studies that have determined the effects of pressure on the stability of the liquid phase. At ambient conditions, TNT crystallizes in a monoclinic lattice (space group P21 / a) , and our previous x-ray diffraction (XRD) measurements at room temperature suggested a phase transition to orthorhombic (space group Pca21) at ~20 GPa. In this work, we have performed in situ synchrotron XRD and vibrational spectroscopy measurements at various P - T conditions along isothermal and isobaric pathways to confirm previously reported phase transitions, and investigate phase stabilities up to 30 GPa and 500°C. Using all the available data, we have established the first comprehensive high P - T phase diagram of TNT, including the melting line as a function of pressure. While our synchrotron IR and Raman spectroscopy measurements indicate spectral changes at ~2 GPa, careful XRD measurements (hydrostatic, He medium and non-hydrostatic) reveal that the monoclinic phase is likely stable up to 20 GPa. We will present a self-consistent P - V - T equation of state derived from the reported structural and vibrational data.

  19. High uptake of 2,4,6-trinitrotoluene by vetiver grass - Potential for phytoremediation?

    International Nuclear Information System (INIS)

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNT L-1 for 8 d. Aqueous concentrations of TNT reached the method detection limit (∼1 μg L-1) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. - Vetiver grass demonstrates ability to absorb TNT in aqueous media

  20. The Value Of The Nonprofit Hospital Tax Exemption Was $24.6 Billion In 2011.

    Science.gov (United States)

    Rosenbaum, Sara; Kindig, David A; Bao, Jie; Byrnes, Maureen K; O'Laughlin, Colin

    2015-07-01

    The federal government encourages public support for charitable activities by allowing people to deduct donations to tax-exempt organizations on their income tax returns. Tax-exempt hospitals are major beneficiaries of this policy because it encourages donations to the hospitals while shielding them from federal and state tax liability. In exchange, these hospitals must engage in community benefit activities, such as providing care to indigent patients and participating in Medicaid. The congressional Joint Committee on Taxation estimated the value of the nonprofit hospital tax exemption at $12.6 billion in 2002--a number that included forgone taxes, public contributions, and the value of tax-exempt bond financing. In this article we estimate that the size of the exemption reached $24.6 billion in 2011. The Affordable Care Act (ACA) brings a new focus on community benefit activities by requiring tax-exempt hospitals to engage in communitywide planning efforts to improve community health. The magnitude of the tax exemption, coupled with ACA reforms, underscores the public's interest not only in community benefit spending generally but also in the extent to which nonprofit hospitals allocate funds for community benefit expenditures that improve the overall health of their communities. PMID:26085486

  1. High uptake of 2,4,6-trinitrotoluene by vetiver grass - Potential for phytoremediation?

    Energy Technology Data Exchange (ETDEWEB)

    Makris, Konstantinos C. [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Shakya, Kabindra M. [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Datta, Rupali [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States); Sarkar, Dibyendu [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States)]. E-mail: dibyendu.sarkar@utsa.edu; Pachanoor, Devanand [Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, 6900 North Loop 1604 West, One UTSA Circle, San Antonio, TX 78249-0663 (United States)

    2007-03-15

    2,4,6-Trinitrotoluene (TNT) is a potent mutagen, and a Group C human carcinogen that has been widely used to produce munitions and explosives. Vast areas that have been previously used as ranges, munition burning, and open detonation sites are heavily contaminated with TNT. Conventional remediation activities in such sites are expensive and damaging to the ecosystem. Phytoremediation offers a cost-effective, environment-friendly solution, utilizing plants to extract TNT from contaminated soil. We investigated the potential use of vetiver grass (Vetiveria zizanioides) to effectively remove TNT from contaminated solutions. Vetiver grass plants were grown in hydroponic systems containing 40 mg TNT L{sup -1} for 8 d. Aqueous concentrations of TNT reached the method detection limit ({approx}1 {mu}g L{sup -1}) within the 8-d period, demonstrating high affinity of vetiver for TNT, without any visible toxic effects. Results from this preliminary hydroponic study are encouraging, but in need of verification using TNT-contaminated soils. - Vetiver grass demonstrates ability to absorb TNT in aqueous media.

  2. Chemically catalyzed uptake of 2,4,6-trinitrotoluene by Vetiveria zizanioides

    Energy Technology Data Exchange (ETDEWEB)

    Makris, Konstantinos C. [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Shakya, Kabindra M. [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Datta, Rupali [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States); Sarkar, Dibyendu [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States)]. E-mail: dibyendu.sarkar@utsa.edu; Pachanoor, Devanand [Environmental Geochemistry Laboratory, Department of Earth and Environmental Science, College of Sciences, University of Texas at San Antonio, One UTSA Circle, San Antonio, TX 78249 (United States)

    2007-07-15

    The efficiency of vetiver grass (Vetiveria zizanioides) in removing 2,4,6-trinitrotoluene (TNT) from aqueous media was explored in the presence of a common agrochemical, urea, used as a chaotropic agent. Chaotropic agents disrupt water structure, increasing solubilization of hydrophobic compounds (TNT), thus, enhancing plant TNT uptake. The primary objectives of this study were to: (i) characterize TNT absorption by vetiver in hydroponic media, and (ii) determine the effect of urea on chemically catalyzing TNT uptake by vetiver grass in hydroponic media. Results showed that vetiver exhibited a high TNT uptake capacity (1.026 mg g{sup -1}), but kinetics were slow. Uptake was considerably enhanced in the presence of urea, which significantly (p<0.001) increased the 2nd-order reaction rate constant over that of the untreated (no urea) control. Three major TNT metabolites were detected in the roots, but not in the shoot, namely 1,3,5-trinitrobenzene, 4-amino 2,6-dinitrotoluene, and 2-amino 4,6-dinitrotoluene, indicating TNT degradation by vetiver grass. - A common agrochemical, urea catalyzes TNT removal by vetiver grass in aqueous media.

  3. Using corona discharge-ion mobility spectrometry for detection of 2,4,6-Trichloroanisole.

    Science.gov (United States)

    Lichvanová, Zuzana; Ilbeigi, Vahideh; Sabo, Martin; Tabrizchi, Mahmoud; Matejčík, Stefan

    2014-09-01

    In this work possible application of the corona discharge-ion mobility spectrometer (CD-IMS) for detection of 2,4,6-Trichloroanisole (TCA) has been investigated. We applied CD-IMS interfaced with orthogonal acceleration time of flight mass spectrometer (CD-IMS-oaTOF) to study the ion processes within the CD-IMS technique. The CD-IMS instrument was operated in two modes, (i) standard and (ii) reverse flow modes resulting in different chemical ionisation schemes by NO3(-)(HNO3)n (n=0,1,2) and O2(-)(H2O)n (n=0,1,2), respectively. The O2(-)(H2O)n ionisation was associated with formation of Cl(-) and (TCA-CH3)(-) ions from TCA. The NO3(-)(HNO3)n ionisation, resulted in formation of NO3(-)(HNO3)(TCA-Cl) adduct ions. Limit of detection (LOD) for TCA was determined in gas (100 ppb) and solid phases (150 ng). PMID:24913882

  4. Study on the Synthesis of Phenyl- thio- phosphine Acyl bis ( 2,4,6 - tribromophenyl) amine%苯基硫代膦酰二(2,4,6-三溴苯基)胺的合成研究

    Institute of Scientific and Technical Information of China (English)

    王彦林; 张艳丽; 陈小慧; 季勇

    2011-01-01

    文章以苯胺,溴素,苯基硫代膦酰二氯等为原料,合成了P,N,S,Br四元素协同阻燃的新型高效阻燃剂苯基硫代膦酰二(2,4,6-三溴苯基)胺,最佳工艺条件为以二甲苯做溶剂,吡啶做缚酸剂,低水合硼酸锌作催化剂,苯基硫代膦酰二氯与2,4,6-三溴苯胺的摩尔比为1:2.1,回流反应12 h,产率可达81.21%.并通过IR和NMR对产品的结构进行了表征.%In this paper, a novel high effective flame retardant which collaborated by P, N,S, Br was prepared via the reaction of aniline, bromide and phenylthiophosphonic dichloride. The optimum reaction conditions were: Xylene as the solvent , pyridine as aci - binding agent, low hydrated zinc borate as catalyst, while the molar ratio for the phenylthiophosphonic dichloride and 2,4,6 - tribromoaniline wasl: 2. 1, and the reaction time is 12 h, the yield was 81.21%. The structure of product were characterized by 1R and NMR.

  5. Selective detection of 2,4,6-trinitrophenol based on a fluorescent nanoscale bis(8-hydroxyquinoline) metal complex.

    Science.gov (United States)

    Lv, Xiao-Jun; Qi, Liang; Gao, Xiang-Yu; Wang, Huan; Huo, Yuan; Zhang, Zhi-Qi

    2016-04-01

    The reliable and accurate detection of explosives such as 2,4,6-trinitrophenol (TNP) and 2,4,6-trinitrotoluene (TNT) is in high demand for homeland security and public safety. Although extremely high sensitivity towards TNT has been demonstrated, detection of TNP remains a challenge. In this work, a fluorescent nanoscale complex composed of bis(8-hydroxyquinoline) and Al(3+) ions has been prepared, characterized and applied in detection of TNP. This complex exhibits the ability to sense the nitro explosive TNP via a fluorescence quenching mechanism with high selectivity. A simple paper test system for the rapid monitoring of TNP was also investigated. The results show that Bhq-Al is a quite ideal sensing material for trace-level detection of TNP. PMID:26838414

  6. The statistical model calculation of prompt neutron spectra from spontaneous fission of {sup 244}Cm and {sup 246}Cm

    Energy Technology Data Exchange (ETDEWEB)

    Gerasimenko, B.F. [V.G. Khlopin Radium Inst., Saint Peterburg (Russian Federation)

    1997-03-01

    The calculations of integral spectra of prompt neutrons of spontaneous fission of {sup 244}Cm and {sup 246}Cm were carried out. The calculations were done by the Statistical Computer Code Complex SCOFIN applying the Hauser-Feschbach method as applied to the description of the de-excitation of excited fission fragments by means of neutron emission. The emission of dipole gamma-quanta from these fragments was considered as a competing process. The average excitation energy of a fragment was calculated by two-spheroidal model of tangent fragments. The density of levels in an excited fragment was calculated by the Fermi-gas model. The quite satisfactory agreement was reached between theoretical and experimental results obtained in frames of Project measurements. The calculated values of average multiplicities of neutron number were 2,746 for {sup 244}Cm and 2,927 for {sup 246}Cm that was in a good accordance with published experimental figures. (author)

  7. (N,N,N′,N′-Tetramethylethylenediamine-κNbis(2,4,6-trimethylphenolato-κOgermanium(II

    Directory of Open Access Journals (Sweden)

    Eduard Rusanov

    2012-03-01

    Full Text Available In the title compound, [Ge(C9H11O2(C6H16N2], the GeII atom is coordinated in a distorted trigonal–pyramidal geometry by two O atoms belonging to two 2,4,6-trimethylphenolate ligands and one N atom of a tetramethylethylenediamine ligand. Comparing the structure with published data of similar compounds shows that the Ge—O bonds are covalent and the Ge—N bond is coordinated.

  8. Removal of 2,4,6-trichlorophenol from a solution by humic acids repeatedly extracted from a peat soil

    International Nuclear Information System (INIS)

    Humic acid (HA) is one of the major components of soil organic matter. It strongly affects the sorption behavior of organic and inorganic contaminants in soils. To obtain a better understanding of the interactions of contaminants with HA, a repeated extraction technique has been applied to a peat soil to obtain HA fractions with varying aliphaticity and aromaticity, which were subsequently correlated to the sorption properties of 2,4,6-trichlorophenol (TCP). HA fractions were extracted repeatedly using an alkaline solution and each HA fraction was separated into two portions with an air-drying or re-suspending (denoted as RSHAs) process. Solid-state 13C NMR and elemental analysis demonstrated that the aromaticity and polarity of HAs decreased with extractions. Kinetic results indicated that air-dried HAs exhibited two-step first order sorption behavior with a rapid stage followed by a slower stage. The slower sorption is attributed to the diffusion of 2,4,6-TCP in the condensed aromatic domains of HAs. Conversely, sorption of 2,4,6-TCP on RSHAs was extremely rapid and could not be fitted with any kinetic model. For air-dried HAs the sorption capacity (Koc) was weakly correlated with the chemical compositions of HAs. However, a positive trend between Koc and aromaticity was observed for RSHAs. Compared with the results of air-dried HAs with their counterparts of RSHAs, it is therefore concluded that air-drying may alter the structure of HAs through artificially creating a more condensed domain in HAs. The structural alternation may result in an incorrect interpretation of the relationship between sorption capacity and chemical composition of HAs and a misjudgment of the transport behavior of 2,4,6-TCP in soils and sediments

  9. Transformation of 2,4,6-trinitrotoluene (TNT) by actinomycetes isolated from TNT-contaminated and uncontaminated environments.

    OpenAIRE

    Pasti-Grigsby, M B; Lewis, T A; Crawford, D. L.; Crawford, R L

    1996-01-01

    Actinomycete strains isolated from 2,4,6-trinitrotoluene (TNT)-contaminated and uncontaminated environments were compared for TNT tolerance and abilities to transform TNT. Regardless of previous TNT exposure history, no significant differences in TNT tolerance were seen among strains. Selected strains did not significantly mineralize [14C]TNT. The actinomycetes did, however, transform TNT into reduced intermediates. The data indicate that, in actinomycete-rich aerobic environments like compos...

  10. Inhaled americium dioxide

    International Nuclear Information System (INIS)

    This project includes experiments to determine the effects of Zn-DTPA therapy on the retention, translocation and biological effects of inhaled 241AmO2. Beagle dogs that received inhalation exposure to 241AmO2 developed leukopenia, clincial chemistry changes associated with hepatocellular damage, and were euthanized due to respiratory insufficiency caused by radiation pneumonitis 120 to 131 days after pulmonary deposition of 22 to 65 μCi 241Am. Another group of dogs that received inhalation exposure to 241AmO2 and were treated daily with Zn-DTPA had initial pulmonary deposition of 19 to 26 μCi 241Am. These dogs did not develop respiratory insufficiency, and hematologic and clinical chemistry changes were less severe than in the non-DTPA-treated dogs

  11. Assessment of americium and curium transmutation in magnesia based targets in different spectral zones of an experimental accelerator driven system

    Science.gov (United States)

    Haeck, W.; Malambu, E.; Sobolev, V. P.; Aït Abderrahim, H.

    2006-06-01

    The potential to incinerate minor actinides (MA) in a sub-critical accelerator-driven system (ADS) is a subject of study in several countries where nuclear power plants are present. The performance of the MYRRHA experimental ADS, as to the transmutation of Am and Cm in the inert matrix fuel (IMF) samples consisting of 40 vol.% (Cm0.1Am0.5Pu0.4)O1.88 fuel and 60 vol.% MgO matrix with a density of 6.077 g cm-3 in three various spectrum regions, were analysed at the belgian nuclear research centre SCK · CEN. The irradiation period of 810 effective full power days (EFPD) followed by a storage period of 2 years was considered. The ALEPH code system currently under development at SCK · CEN was used to carry out this study. The total amount of MA is shown to decrease in all three considered cases. For Am, the decrease is the largest in the reflector (89% decrease) but at the cost of a net Cm production (92% increase). In the two other positions (inside the core region), 20-30% of Am has disappeared but with a lower production of Cm (between 7% and 11%). In the reflector, a significant build-up of long-lived 245Cm, 246Cm, 247Cm and 248Cm was also observed while the production of these isotopes is 10-1000 times smaller in the core. The reduction of the Pu content is also the highest in the reflector position (41%). In the other positions the incinerated amount of Pu is much smaller: 1-5%.

  12. Partitioning studies in China and the separation of americium and fission product rare earths with dialkyl phosphinic acid and its thio-substituted derivatives

    International Nuclear Information System (INIS)

    Studies on the TRPO extractions process for recovering actinides from highly active waste (HAW) and its application to the pretreatment of Chinese HAW are described. The removal of Sr by di-cyclohexyl 18 crown 6 and the removal of Cs by spherical titanium ferrous hexa-cyanate from acidic waste are also described. Results of the extraction of trivalent americium and fission product rare earths (FPREs) by dialkyl-phosphinic, dialkyl-mono-thio-phosphinic and dialkyl-di-thio-phosphinic acids are reported. Dialkyl-thio-phosphinic acid (commercial product Cyanex 301, alkyl =2, 4, 4-methyl-pentyl) shows very high selectivity towards Am. Using 1M Cyanex 301 -kerosene as extractant, 99.9 % Am can be separated from 0.5M(Pr+Nd)(NO3)3 solution with 3-4 extraction stages and 3-4 scrubbing stages. (authors)

  13. Theoretical and experimental study of the bio-geochemical behaviour of americium 241 in simplified rhizosphere conditions. Application to a calcareous agricultural soil

    International Nuclear Information System (INIS)

    Americium 241, is one of the most radio-toxic contaminant produced during the nuclear fuel cycle. It can be found in all environmental compartments, in particular the soils. The main goals of this study are to identify, quantify and model the effect of the main factors controlling the mobility of 241Am in the rhizosphere and the agricultural soils. The physico-chemical parameters of the soil and of the soil solution, the potential role of microorganisms on the sorption-desorption processes, and the speciation of americium in solution have been more particularly studied. 241Am remobilization has been studied at the laboratory using leaching experiments performed in controlled conditions on reworked calcareous soils artificially contaminated with 241Am. The soil samples have been washed out in different hydrodynamic conditions by solutions with various compositions. The eluted solution has been analyzed (pH, conductivity, ionic composition, Fetot, organic acids, 241Am) and its bacterial biomass content too. The overall results indicate that 241Am remobilization is contrasted and strongly linked with the condition under study (pH, ionic strength, glucose and/or citrate concentration). Therefore, a solution in equilibrium with the soil or containing small exudate concentrations (10-4 M) re-mobilizes only a very small part of the americium fixed on the solid phase. The desorption of 241Am corresponds to a solid/liquid coefficient of partition (Kd) of about 105 L.kg-1. A significant addition of glucose induces an important dissolution of soil carbonates by the indirect action of microorganisms, but does not significantly favor the 241Am remobilization. On the other hand, the presence of strong citrate concentrations (≥ 10-2 M) allows 300 to 10000 time greater re-mobilizations by the complexing of 241Am released after the dissolution of the carrying phases. Finally, the colloidal transport of 241Am has been systematically observed in a limited but significant extend and

  14. An evaluation of the VM/VF ratio to standard UO2 and MOX fuel with 4,5% enrichment and 1% of americium insertion

    International Nuclear Information System (INIS)

    A growing interest exists in the development of techniques for burning and transmuting minor actinides. Some indicate the possibility of differentiated burnup when studying different VM/VF. The VM/VF ratio, moderator volume/fuel volume, is directly related with the value obtained for the multiplication factor k. There is a VM/VF for which k is maximum, and this is directly related with the fuel composition. This work is a study to find a better value of VM/VF, using the WIMS-D5 code, considering a UO2 fuel and a MOX fuel, with 1% Americium insertion. The following parameters were appraised: spectrum hardening, boron worth, and reactivity temperature coefficients. (author)

  15. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: wcruz@ipen.gob.pe [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos

    2013-07-01

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  16. Dual role of endogenous serotonin in 2,4,6-trinitrobenzene sulfonic acid-induced colitis

    Directory of Open Access Journals (Sweden)

    Alberto eRapalli

    2016-03-01

    Full Text Available Background and Aims: Changes in gut serotonin content have been described in Inflammatory Bowel Disease and in different experimental models of colitis: the critical role of this monoamine in the pathogenesis of chronic gastrointestinal inflammation is gradually emerging. Aim of the present study was to evaluate the contribution of endogenous serotonin through the activation of its specific receptor subtypes to the local and systemic inflammatory responses in an experimental model of Inflammatory Bowel Disease. Methods: Colitis was induced by intrarectal 2,4,6-TriNitroBenzene Sulfonic acid in mice subacutely treated with selective antagonists of 5-HT1A (WAY100135, 5-HT2A (Ketanserin, 5-HT3 (Ondansetron, 5-HT4 (GR125487, 5-HT7 (SB269970 receptors and with 5-HT1A agonist 8-Hydroxy-2-(di-n-propylaminotetralin. Results: Blockade of 5-HT1A receptors worsened TNBS-induced local and systemic neutrophil recruitment while 5-HT1A agonist delayed and mitigated the severity of colitis, counteracting the increase in colonic 5-HT content. On the contrary, blockade of 5-HT2A receptors improved global health conditions, reduced colonic morphological alterations, down-regulated neutrophil recruitment, inflammatory cytokines levels and colonic apoptosis. Antagonism of 5-HT3, 5-HT4 and 5-HT7 receptor sites did not remarkably affect the progression and outcome of the pathology or only slightly improved it.Conclusions: The prevailing deleterious contribution given by endogenous serotonin to inflammation in TNBS-induced colitis is seemingly mediated by 5-HT2A and, to a lesser extent, by 5-HT4 receptors and coexists with the weak beneficial effect elicited by 5-HT1A stimulation. These findings suggest how only a selective interference with 5-HT pro-inflammatory actions may represent an additional potential therapeutic option for intestinal inflammatory disorders.

  17. Development of a cellular biosensor for the detection of 2,4,6-trichloroanisole (TCA).

    Science.gov (United States)

    Varelas, Vassileios; Sanvicens, Nuria; M-Pilar-Marco; Kintzios, Spiridon

    2011-05-15

    2,4,6-trichloroanisole (TCA) is a microbial metabolite formed from chlorophenols through the activity of several natural fungal strains present on the cork oak bark. TCA is the primary compound responsible for the mousty/mould off-odour known as "cork taint" present in cork stoppers, wine, water and alcoholic beverages. Chromatographic and electrochemical methods are currently used for the determination of TCA, however its detection at low concentrations remains a technical challenge. The aim of this study was the development of a rapid novel biosensor system based on the Bioelectric Recognition Assay (BERA). The sensor measured the electric response of cultured membrane-engineered fibroblast cells suspended in an alginate gel matrix due to the change of their membrane potential in the presence of the analyte. Membrane-engineered cells were prepared by osmotic insertion of 0.5 μg/l of specific TCA antibodies into the membrane of the cells. The BERA-based sensor was able to detect TCA in a few minutes (3-5 min) at extremely low concentrations (10(-1)ppt), thus demonstrating higher sensitivity than the human sensory threshold. In addition, the assay was quite selective against other haloanisoles and halophenols structurally related to or co-occurring with TCA. Finally the sensor was tested against real white wine samples from cork soaks. At this real test, the BERA sensor was able to detect TCA from cork soaks rapidly (3-5 min) at very low concentrations (1.02-12 ng/l), covering the whole range for the detection threshold for wines (1.4-10 ng/l). Therefore, this novel biosensor offers new perspectives for ultra-rapid, ultra-sensitive and low-cost monitoring of TCA presence in cork and wine and possibly also other food commodities. PMID:21482306

  18. Dual Role of Endogenous Serotonin in 2,4,6-Trinitrobenzene Sulfonic Acid-Induced Colitis

    Science.gov (United States)

    Rapalli, Alberto; Bertoni, Simona; Arcaro, Valentina; Saccani, Francesca; Grandi, Andrea; Vivo, Valentina; Cantoni, Anna M.; Barocelli, Elisabetta

    2016-01-01

    Background and Aims: Changes in gut serotonin (5-HT) content have been described in Inflammatory Bowel Disease (IBD) and in different experimental models of colitis: the critical role of this monoamine in the pathogenesis of chronic gastrointestinal inflammation is gradually emerging. Aim of the present study was to evaluate the contribution of endogenous 5-HT through the activation of its specific receptor subtypes to the local and systemic inflammatory responses in an experimental model of IBD. Materials and Methods: Colitis was induced by intrarectal 2,4,6-TriNitroBenzene Sulfonic acid in mice subacutely treated with selective antagonists of 5-HT1A (WAY100135), 5-HT2A (Ketanserin), 5-HT3 (Ondansetron), 5-HT4 (GR125487), 5-HT7 (SB269970) receptors and with 5-HT1A agonist 8-Hydroxy-2-(di-n-propylamino)tetralin. Results: Blockade of 5-HT1A receptors worsened TNBS-induced local and systemic neutrophil recruitment while 5-HT1A agonist delayed and mitigated the severity of colitis, counteracting the increase in colonic 5-HT content. On the contrary, blockade of 5-HT2A receptors improved global health conditions, reduced colonic morphological alterations, down-regulated neutrophil recruitment, inflammatory cytokines levels and colonic apoptosis. Antagonism of 5-HT3, 5-HT4, and 5-HT7 receptor sites did not remarkably affect the progression and outcome of the pathology or only slightly improved it. Conclusion: The prevailing deleterious contribution given by endogenous 5-HT to inflammation in TNBS-induced colitis is seemingly mediated by 5-HT2A and, to a lesser extent, by 5-HT4 receptors and coexists with the weak beneficial effect elicited by 5-HT1A stimulation. These findings suggest how only a selective interference with 5-HT pro-inflammatory actions may represent an additional potential therapeutic option for intestinal inflammatory disorders. PMID:27047383

  19. Bis(2,4,6-tri-amino-pyrimidin-1-ium) sulfate penta-hydrate.

    Science.gov (United States)

    Nimthong, Ruthairat; Chamchong, Siva; Pakawatchai, Chaveng; Mokhagul, Jedsada; Wattanakanjana, Yupa

    2013-01-01

    The asymmetric unit of the title salt, 2C4H8N5 (+)·SO4 (2-)·5H2O, contains four 2,4,6-tri-amino-pyrimidinium (TAPH(+)) cations, two sulfate anions and ten lattice water mol-ecules. Each two of the four TAPH(+) cations form dimers via N-H⋯N hydrogen bonds between the amino groups and the unprotonated pyrimidine N atoms [graph-set motif R 2 (2)(8)]. The (TAPH(+))2 dimers, in turn, form slightly offset infinite π-π stacks parallel to [010], with centroid-centroid distances between pyrimidine rings of 3.5128 (15) and 3.6288 (16) Å. Other amino H atoms, as well as the pyrimidinium N-H groups, are hydrogen-bonded to sulfate and lattice water O atoms. The SO4 (2-) anions and water mol-ecules are inter-connected with each other via O-H⋯O hydrogen bonds. The combination of hydrogen-bonding inter-actions and π-π stacking leads to the formation of a three-dimensional network with alternating columns of TAPH(+) cations and channels filled with sulfate anions and water mol-ecules. One of the sulfate anions shows a minor disorder by a ca 37° rotation around one of the S-O bonds [occupancy ratio of the two sets of sites 0.927 (3):0.073 (3)]. One water mol-ecule is disordered over two mutually exclusive positions with an occupancy ratio of 0.64 (7):0.36 (7). PMID:24109349

  20. Biodegradation of TNT (2,4,6-Trinitrotoluene) by Phanerochaete chrysosporium

    International Nuclear Information System (INIS)

    Extensive biodegradation of TNT (2,4,6-trinitrotoluene) by the white rot fungus Phanerochaete chrysosporium was observed. At an initial concentration of 1.3 mg/liter, 35.4 ± 3.6% of the [14C]TNT was degraded to 14CO2 in 18 days. The addition of glucose 12 days after the addition of TNT did not stimulate mineralization, and, after 18 days of incubation with TNT only, about 3.3% of the initial TNT could be recovered. Mineralization of [14C]TNT absorbed on soil was also examined. Ground corncobs served as the nutrient for slow but sustained degradation of [14C]TNT to 14CO2 such that 6.3 ± 0.6% of the [14C]TNT initially present was converted to 14CO2 during the 30-day incubation period. Mass balance analysis of liquid cultures and of soil-corncob cultures revealed that polar [14C]TNT metabolites are formed in both systems, and high-performance liquid chromatography analyses revealed that less then 5% of the radioactivity remained as undegraded [14C]TNT following incubation with the fungus in soil and liquid cultures. When the concentration of TNT in cultures (both liquid and soil) was adjusted to contamination levels that might be found in the environment, i.e., 10,000 mg/kg in soil and 100 mg/liter in water, mineralization studies showed that 18.4 ± 2.9% and 19.6 ± 3.5% of the initial TNT was converted to 14CO2 in 90 days in soil and liquid cultures, respectively. In both cases (90 days in water at 100 mg/liter and in soil at 10,000 mg/kg) approximately 85% of the TNT was degraded. These results suggest that this fungus may be useful for the decontamination of sites in the environment contaminated with TNT

  1. Preliminary application of 241-Americium calcaneus bone mineral density measurement in osteoporosis. Comparison with double X-ray densitometry of the lumber spine

    International Nuclear Information System (INIS)

    Bone mineral density (BMD) of calcaneus in 54 normals, 45 Osteoporosis, 25 suspected osteoporosis and 16 other non-osteoporosis patients, a total of 140 cases were measured by HUAKE (HK-1) 241-Americium BMD absorpmetry, among them 43 were compared with that of lumber spine (L2 - L4) measured by Lunar Corporation's Expert-XL absorpmeter. BMD of normal group of calcaneus was (409.8 +- 79.4) mg/cm2. The BMD were decreased slowly with the increasing age. The BMD of osteoporosis, suspected osteoporosis and non-osteoporosis group were 230.3 +- 62.3, 395.7 +- 57.4 and 363.3 +- 51.9 mg/cm2 respectively. The BMD of osteoporosis group was much lower than that of normal group, and also lower than that of the other two groups, among 26 patients (57.78%) had bone fracture, all was in accordance with the clinical diagnosis of osteoporosis. The BMD of suspected osteoporosis and non-osteoporosis had no significant difference with normal group. The coefficient variation (CV) of BMD in repeated measurement in calcaneus of 4 participants was less than 1.2%. The correlative coefficient (r) between BMD of calcaneus and lumber spine (L2 - L4) group was 0.6824. The correlative coefficient of normal young adult-matched percentage and T value in 2 groups were 0.6863 and 0.6755 respectively, whereas aged-matched percentage, Z value were 0.4614 and 0.5009 respectively. In conclusion 241-Americium calcaneus BMD absorpmetry has the advantage of low price, easy to operate, reliable and valuable in diagnosis osteoporosis. The correlations of calcaneus and lumber spine BMD, normal young adult-matched percentage and T value were rather good

  2. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  3. Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation

    International Nuclear Information System (INIS)

    For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high AD/AR ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values εG, and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies (∼95%), and by the stoichiometric release of chloride ions from the halogenated compound (∼80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions)

  4. 40 CFR 721.7280 - 1,3-Propanediamine, N,N′-1,2-ethanediylbis-, polymer with 2,4,6-trichloro-1,3,5-triazine...

    Science.gov (United States)

    2010-07-01

    ...-ethanediylbis-, polymer with 2,4,6-trichloro-1,3,5-triazine, reaction products with N-butyl-2,2,6,6-tetramethyl...-, polymer with 2,4,6-trichloro-1,3,5-triazine, reaction products with N-butyl-2,2,6,6-tetramethyl-4... identified as 1,3-propanediamine, N,N′-1,2-ethanediylbis-, polymer with...

  5. Biodegradation of 2,4,6-trichlorophenol in a packed-bed biofilm reactor equipped with an internal net draft tube riser for aeration and liquid circulation

    Energy Technology Data Exchange (ETDEWEB)

    Gomez-De Jesus, A.; Romano-Baez, F.J.; Leyva-Amezcua, L.; Juarez-Ramirez, C.; Ruiz-Ordaz, N. [Departamento de Ingenieria Bioquimica, Escuela Nacional de Ciencias Biologicas, IPN. Prol. Carpio y Plan de Ayala, Colonia Santo Tomas, s/n. CP 11340, Mexico, D.F. (Mexico); Galindez-Mayer, J. [Departamento de Ingenieria Bioquimica, Escuela Nacional de Ciencias Biologicas, IPN. Prol. Carpio y Plan de Ayala, Colonia Santo Tomas, s/n. CP 11340, Mexico, D.F. (Mexico)], E-mail: cmayer@encb.ipn.mx

    2009-01-30

    For the aerobic biodegradation of the fungicide and defoliant 2,4,6-trichlorophenol (2,4,6-TCP), a bench-scale packed-bed bioreactor equipped with a net draft tube riser for liquid circulation and oxygenation (PB-ALR) was constructed. To obtain a high packed-bed volume relative to the whole bioreactor volume, a high A{sub D}/A{sub R} ratio was used. Reactor's downcomer was packed with a porous support of volcanic stone fragments. PB-ALR hydrodynamics and oxygen mass transfer behavior was evaluated and compared to the observed behavior of the unpacked reactor operating as an internal airlift reactor (ALR). Overall gas holdup values {epsilon}{sub G}, and zonal oxygen mass transfer coefficients determined at various airflow rates in the PB-ALR, were higher than those obtained with the ALR. When comparing mixing time values obtained in both cases, a slight increment in mixing time was observed when reactor was operated as a PB-ALR. By using a mixed microbial community, the biofilm reactor was used to evaluate the aerobic biodegradation of 2,4,6-TCP. Three bacterial strains identified as Burkholderia sp., Burkholderia kururiensis and Stenotrophomonas sp. constituted the microbial consortium able to cometabolically degrade the 2,4,6-TCP, using phenol as primary substrate. This consortium removed 100% of phenol and near 99% of 2,4,6-TCP. Mineralization and dehalogenation of 2,4,6-TCP was evidenced by high COD removal efficiencies ({approx}95%), and by the stoichiometric release of chloride ions from the halogenated compound ({approx}80%). Finally, it was observed that the microbial consortium was also capable to metabolize 2,4,6-TCP without phenol as primary substrate, with high removal efficiencies (near 100% for 2,4,6-TCP, 92% for COD and 88% for chloride ions)

  6. Suppression of PCDD/Fs formation because of the presence of DEHP during the model slow combustion of 2,4,6-trichlorophenol.

    Science.gov (United States)

    Kishi, Tomohiro; Shinkura, Toshinori; Suzuki, Shota; Kawakami, Tsuyoshi; Takeda, Ken; Onodera, Sukeo

    2010-03-01

    The thermal reactions of 2,4,6-T(3)CP in the presence and absence of DEHP in a dry air stream was investigated using a silica flow reactor at a residence time of 10s and a temperature range from 450 degrees C to 850 degrees C. Two isomers of T(4)CDDs (1,3,6,8- and 1,3,7,9-T(4)CDDs) were the most abundant products during the combustion of 2,4,6-T(3)CP alone and were observed at temperatures ranging from 550 degrees C to 800 degrees C. In the presence of DEHP, we observed a remarkable decrease in the yields of T(4)CDDs during the combustion of 2,4,6-T(3)CP. The suppression ratio of the T(4)CDDs formation was more than 90% in the case of the co-combustion with 10% DEHP in molar ratio. Other PCDD/Fs except for 2,7-/2,8-DCDD and 2,8-DCDF also decreased upon the combustion of 2,4,6-T(3)CP in the presence of DEHP. During the co-combustion of 2,4,6-T(3)CP and DEHP, the residual ratio of 2,4,6-T(3)CP increased slightly and formations of lower chlorinated phenols were observed. The suppression of the T(4)CDDs was strongly dependent on the DEHP ratio in the starting material. The prospective pathways of the suppressions of the T(4)CDDs formations during the combustion of 2,4,6-T(3)CP in the presence of DEHP were proposed. PMID:20080281

  7. Anomalous temperature effect on the hydrogen bond strength and phase transition in 2,4,6-trimethylpyridinium pentachlorophenolate.

    Science.gov (United States)

    Majerz, Irena; Jakubas, Ryszard

    2004-06-01

    The phase transition in 2,4,6-trimethylpyridinium pentachlorophenolate has been studied by differential scanning calorimetry (DSC), thermogravimetric analysis (TGA) and dielectric method as well as theoretical calculations. The crystal undergoes a first order phase transition of order-disorder type at 376 K. The transition to the high temperature phase causes anomalous hydrogen-bond shortening. Experimental and theoretical results show that the change in the mutual orientation of the phenol and pyridine rings is connected with the change of the hydrogen bond. Such an effect, which appears in the present simple hydrogen-bond complex, may be common also for the other hydrogen-bond complexes.

  8. The effects of temperature gradient and growth rate on the morphology and fatigue properties of MAR-M246(Hf)

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, D.D.; Alter, W.S.; Hamilton, W.D.; Parr, R.A.

    1989-08-01

    MAR-M246(Hf) is a nickel based superalloy used in the turbopump blades of the Space Shuttle main engines. The effects are considered of temperature gradient (G) and growth rate (R) on the microstructure and fatigue properties of this superalloy. The primary dendrite arm spacings were found to be inversely proportional to both temperature gradient and growth rate. Carbide and gamma - gamma prime morphology trends were related to G/R ratios. Weibull analysis of fatigue results shows the characteristic life to be larger by a factor of 10 for the low gradient/fast rate pairing of G and R, while the reliability (beta) was lower.

  9. Poly[[triaqua­(μ3-pyridine-2,4,6-tricarboxyl­ato)terbium(III)] monohydrate

    OpenAIRE

    Hong-lin Zhu

    2012-01-01

    The asymmetric unit of the title compound, {[Tb(C8H2NO6)(H2O)3]·H2O}n, contains one TbIII ion, one pyridine-2,4,6-tricarboxylate (ptc) anion, three aqua ligands and one lattice water molecule. The TbIII ion is nine coordinated by one N and five O atoms from three ptc ligands and by three O atoms from the three aqua ligands in a distorted bicapped trigonal–prismatic geometry. The ptc ligands bridge the TbIII ions into a two-dimensional polymeric framework parallel to (100). ...

  10. Structural studies of the polysaccharides from the lipopolysaccharides of Azospirillum brasilense Sp246 and SpBr14.

    Science.gov (United States)

    Sigida, Elena N; Fedonenko, Yuliya P; Shashkov, Alexander S; Grinev, Vyacheslav S; Zdorovenko, Evelina L; Konnova, Svetlana A; Ignatov, Vladimir V; Knirel, Yuriy A

    2014-10-29

    Lipopolysaccharides from closely related Azospirillum brasilense strains, Sp246 and SpBr14, were obtained by phenol-water extraction. Mild acid hydrolysis of the lipopolysaccharides followed by GPC on Sephadex G-50 resulted in polysaccharide mixtures. On the basis of sugar and methylation analyses, Smith degradation and (1)H and (13)C NMR spectroscopy data, it was concluded that both bacteria possess the same two distinct polysaccharides having structures 1 and 2: [structure: see text]. Structure 1 has been reported earlier for a polysaccharide of A. brasilense 54 [Fedonenko et al., 2011] whereas to our knowledge structure 2 has not been hitherto found in bacterial polysaccharides. PMID:25240180

  11. Vicarious nucleophilic substitution using 4-amino-1,2,4-triazole, hydroxylamine or O-alkylhydroxylamine to prepare 1,3-diamino-2,4,6-trinitrobenzene or 1,3,5-triamino-2,4,6-trinitrobenzene

    Science.gov (United States)

    Mitchell, Alexander R.; Pagoria, Philip F.; Schmidt, Robert D.

    1997-01-01

    The present invention relates to a process to produce 1,3-diamino-2,4,6-trinitrobenzene (DATB) or 1,3,5-triamino-2,4,6,-trinitrobenzene (TATB) by: (a) reacting at ambient pressure and a temperature of between about 0.degree. and 50.degree. C. for between about 0.1 and 24 hr, a trinitroaromatic compound of structure V: ##STR1## wherein X, Y, and Z are each independently selected from the group consisting of --H and --NH.sub.2, with the proviso that at least 1 or 2 of X, Y, and Z are hydrogen; with an effective amount of 1-amino-1,2,4-triazole, hydroxylamine or O-alkylhydroxamine to produce DATB or TATB; in the presence of a strong base selected from sodium butoxide, potassium butoxide, potassium propoxide, sodium propoxide, sodium ethoxide, potassium ethoxide, sodium methoxide, potassium methoxide, and combinations thereof; in a solvent selected from the group consisting of methanol, ethanol, propanol, butanol, dimethylsulphoxide, N-methylpyrrolidone, hexamethylphosphoramide, dimethylformide, dimethylacetamide and mixtures thereof, provided that when alcohols are present or when hydroxylamine or its O-alkyl derivatives replace ATA primarily DATB is formed; and (b) isolating the DATB or TATB produced. DATB and TATB are important and useful specialty explosives and intermediates for other materials.

  12. Synthesis of bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine oxide – a tailor-made photoinitiator for dental adhesives

    Directory of Open Access Journals (Sweden)

    Norbert Moszner

    2010-03-01

    Full Text Available Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine oxide (WBAPO was synthesized starting from 3-(chloromethyl-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxyethanol. In the second step, 3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated. The formed acid chloride showed an unexpected low thermal stability. Its thermal rearrangement at 180 °C resulted in a fast formation of 3-(chloromethyl-2,4,6-trimethylbenzoic acid 2-(allyloxyethyl ester. In the third step, the acid chloride was reacted with phenylphosphine dilithium with the formation of bis(3-{[2-(allyloxyethoxy]methyl}-2,4,6-trimethylbenzoyl(phenylphosphine, which was oxidized to WBAPO. The structure of WBAPO was confirmed by 1H NMR, 13C NMR, 31P NMR, and IR spectroscopy, as well as elemental analysis. WBAPO, a yellow liquid, possesses improved solubility in polar solvents and shows UV–vis absorption, and a high photoreactivity comparable with the commercially available bisacylphosphine oxides. A sufficient storage stability was found in dental acidic aqueous primer formulations.

  13. Synthesis of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide - a tailor-made photoinitiator for dental adhesives.

    Science.gov (United States)

    Moszner, Norbert; Lamparth, Iris; Angermann, Jörg; Fischer, Urs Karl; Zeuner, Frank; Bock, Thorsten; Liska, Robert; Rheinberger, Volker

    2010-01-01

    Because of the poor solubility of the commercially available bisacylphosphine oxides in dental acidic aqueous primer formulations, bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine oxide (WBAPO) was synthesized starting from 3-(chloromethyl)-2,4,6-trimethylbenzoic acid by the dichlorophosphine route. The substituent was introduced by etherification with 2-(allyloxy)ethanol. In the second step, 3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoic acid was chlorinated. The formed acid chloride showed an unexpected low thermal stability. Its thermal rearrangement at 180 ° C resulted in a fast formation of 3-(chloromethyl)-2,4,6-trimethylbenzoic acid 2-(allyloxy)ethyl ester. In the third step, the acid chloride was reacted with phenylphosphine dilithium with the formation of bis(3-{[2-(allyloxy)ethoxy]methyl}-2,4,6-trimethylbenzoyl)(phenyl)phosphine, which was oxidized to WBAPO. The structure of WBAPO was confirmed by ¹H NMR, ¹³C NMR, ³¹P NMR, and IR spectroscopy, as well as elemental analysis. WBAPO, a yellow liquid, possesses improved solubility in polar solvents and shows UV-vis absorption, and a high photoreactivity comparable with the commercially available bisacylphosphine oxides. A sufficient storage stability was found in dental acidic aqueous primer formulations. PMID:20502649

  14. Preparation of oil palm empty fruit bunch-based activated carbon for removal of 2,4,6-trichlorophenol: Optimization using response surface methodology

    International Nuclear Information System (INIS)

    The effects of three preparation variables: CO2 activation temperature, CO2 activation time and KOH:char impregnation ratio (IR) on the 2,4,6-trichlorophenol (2,4,6-TCP) uptake and carbon yield of the activated carbon prepared from oil palm empty fruit bunch (EFB) were investigated. Based on the central composite design, two quadratic models were developed to correlate the three preparation variables to the two responses. The activated carbon preparation conditions were optimized using response surface methodology by maximizing both the 2,4,6-TCP uptake and activated carbon yield within the ranges studied. The optimum conditions for preparing activated carbon from EFB for adsorption of 2,4,6-TCP were found as follows: CO2 activation temperature of 814 deg. C, CO2 activation time of 1.9 h and IR of 2.8, which resulted in 168.89 mg/g of 2,4,6-TCP uptake and 17.96% of activated carbon yield. The experimental results obtained agreed satisfactorily with the model predictions. The activated carbon prepared under optimum conditions was mesoporous with BET surface area of 1141 m2/g, total pore volume of 0.6 cm3/g and average pore diameter of 2.5 nm. The surface morphology and functional groups of the activated carbon were respectively determined from the scanning electron microscopy and Fourier transform infrared analysis.

  15. Americium, plutonium and uranium contamination and speciation in well waters, streams and atomic lakes in the Sarzhal region of the Semipalatinsk Nuclear Test Site, Kazakhstan

    International Nuclear Information System (INIS)

    New data are reported on the concentrations, isotopic composition and speciation of americium, plutonium and uranium in surface and ground waters in the Sarzhal region of the Semipalatinsk Test Site, and an adjacent area including the settlement of Sarzhal. The data relate to filtered water and suspended particulate from (a) streams originating in the Degelen Mountains, (b) the Tel'kem 1 and Tel'kem 2 atomic craters, and (c) wells on farms located within the study area and at Sarzhal. The measurements show that 241Am, 239,240Pu and 238U concentrations in well waters within the study area are in the range 0.04-87 mBq dm-3, 0.7-99 mBq dm-3, and 74-213 mBq dm-3, respectively, and for 241Am and 239,240Pu are elevated above the levels expected solely on the basis of global fallout. Concentrations in streams sourced in the Degelen Mountains are similar, while concentrations in the two water-filled atomic craters are somewhat higher. Suspended particulate concentrations in well waters vary considerably, though median values are very low, at 0.01 mBq dm-3, 0.08 mBq dm-3 and 0.32 mBq dm-3 for 241Am, 239,240Pu and 238U, respectively. The 235U/238U isotopic ratio in almost all well and stream waters is slightly elevated above the 'best estimate' value for natural uranium worldwide, suggesting that some of the uranium in these waters is of test-site provenance. Redox analysis shows that on average most of the plutonium present in the microfiltered fraction of these waters is in a chemically reduced form (mean 69%; 95% confidence interval 53-85%). In the case of the atomic craters, the proportion is even higher. As expected, all of the americium present appears to be in a reduced form. Calculations suggest that annual committed effective doses to individual adults arising from the daily ingestion of these well waters are in the range 11-42 μSv (mean 21 μSv). Presently, the ground water feeding these wells would not appear to be contaminated with radioactivity from past

  16. Influence of a magnetic field during directional solidification of MAR-M 246 + Hf superalloy. Final Technical Report

    Energy Technology Data Exchange (ETDEWEB)

    Andrews, J.B.; Alter, W.; Schmidt, D.

    1991-01-01

    An area that has been almost totally overlooked in the optimization of properties in directionally solidified superalloys is the control of microstructural features through the application of a magnetic field during solidification. The influence of a magnetic field on the microstructural features of a nickel-base superalloys is investigated. Studies were performed on the dendritic MAR-M 246+Hf alloy, which was solidified under both a 5 K gauss magnetic field and under no-applied-field conditions. The possible influences of the magnetic field on the solidification process were observed by studying variations in microstructural features including volume fraction, surface area, number, and shape of the carbide particles. Stereological factors analyzed also included primary and secondary dendrite arm spacing and the volume fraction of the interdendritic eutectic constituent. Microprobe analysis was performed to determine the chemistry of the carbides, dendrites, and interdendritic constituents, and how it varied between field and no-field solidification samples. Experiments involving periodic application and removal of the magnetic field were also performed in order to permit a comparison with structural variations observed in a MAR-M 246+Hf alloy solidified during KC{sup {minus}135} high-g, low-g maneuvers.

  17. Separation of americium(III) and europium(III) from nitrate medium using a binary mixture of Cyanex-301 with neutral donor ligands

    International Nuclear Information System (INIS)

    Separation behaviour of Am3+ and Eu3+ was investigated from aqueous nitrate medium using a binary mixture of Cyanex-301 (bis(2,4,4- trimethylpentyl) dithiophosphinic acid) and several N, O or S donor ligands such as 1,10-phenanthroline (phen), TPTZ (2,4,6- tri(2-pyridyl)- 1,3,5- triazine), 2,2'-bipyridyl(bipy), hexa thia 18 crown 6 (S618C6), TBP (tri-n-butyl phosphate), TBTP (tri-n-butyl thiophosphate) in toluene. The S.F. values of >40,000 obtained with bipy and phen are the highest reported to date. (author)

  18. Sensitive determination of 2,4,6-trichloroanisole in water samples by ultrasound assisted emulsification microextraction prior to gas chromatography-tandem mass spectrometry analysis.

    Science.gov (United States)

    Fontana, Ariel R; Altamirano, Jorgelina C

    2010-06-15

    A novel application of an ultrasound assisted emulsification microextraction (USAEME) technique is proposed for the extraction and preconcentration of 2,4,6-trichloroanisole (2,4,6-TCA) from water samples prior to its determination by gas chromatography-tandem mass spectrometry (GC-MS/MS). USAEME employs a non-polar high-density solvent (extractant solvent), which forms an oil-in-water emulsion (O/W) in the aqueous sample bulk assisted by ultrasonic radiation. Several factors including, solvent type and volume, extraction time, extraction temperature, shaking mode and matrix modifiers were studied and optimized over the relative recovery of the target analyte. An aliquot of 5mL water sample was conditioned by adding 150microL 6.15molL(-1) sodium chloride and 300microL 0.05molL(-1) phosphate buffer (pH 6), and finally extracted with 40microL chloroform by using USAEME technique. Under the optimal experimental conditions 2,4,6-TCA was quantitatively extracted achieving an enrichment factor (EF) of 555. The detection limit (LOD), calculated as three times the signal-to-noise ratio (S/N), was 0.2ngL(-1) and the RSD was 6.3% (n=5) when 1ngL(-1) 2,4,6-TCA standard mixture was analyzed. The coefficients of estimation of the calibration curves obtained following the proposed methodology was >or=0.997 and the linear working range was 1-5000ngL(-1). Finally, the proposed technique was successfully applied for extraction and determination of the 2,4,6-TCA in water samples. Recovery studies lead values >or=94%, which showed a successfully robustness of the analytical methodology for determination of nanogram per liter of 2,4,6-TCA in water samples. PMID:20441935

  19. Simultaneous determination of 2,4,6-trichlorophenol and pentachlorophenol based on poly(Rhodamine B)/graphene oxide/multiwalled carbon nanotubes composite film modified electrode

    Science.gov (United States)

    Zhu, Xiaolin; Zhang, Kexin; Lu, Nan; Yuan, Xing

    2016-01-01

    In the present study, a poly(Rhodamine B)/graphene oxide/multiwalled carbon nanotubes nanocomposite modified glass carbon electrode (PRhB/GO/MWCNTs/GCE) was developed for the simultaneous determination of 2,4,6-trichlorophenol (2,4,6-TCP) and pentachlorophenol (PCP). The PRhB/GO/MWCNTs film was extensively characterized by emission scanning electron microscopy (SEM), X-ray diffraction (XRD), Raman spectroscopy and electrochemical impedance spectroscopy (EIS). The electrochemical behaviors of 2,4,6-TCP and PCP were investigated by cyclic voltammetry, linear sweep voltammetry and differential pulse voltammetry. Due to the synergistic effect, the PRhB/GO/MWCNTs/GCE significantly facilitated the simultaneous electro-oxidation of 2,4,6-TCP and PCP with peak potential difference of 160 mV and enhanced oxidation currents. Under optimum conditions, the oxidation current of 2,4,6-TCP was linear to its concentration in the ranges of 4.0 × 10-9 to 1.0 × 10-7 M and 1.0 × 10-7 to 1.0 × 10-4 M with the detection limit (S/N = 3) of 8.0 × 10-10 M. And the linear concentration ranges for PCP were 2.0 × 10-9 to 1.0 × 10-7 M and 1.0 × 10-7 to 9.0 × 10-5 M with the detection limit of 5.0 × 10-10 M. Moreover, the proposed PRhB/GO/MWCNTs/GCE was successfully applied to the simultaneous determination of 2,4,6-TCP and PCP in practical water samples.

  20. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  1. The estimation of reactions of hematopoietic systems of organisms to the effect, caused by americium and plutonium, of nuclear industry workers

    Energy Technology Data Exchange (ETDEWEB)

    Gasteva, G. N.; Ivanova, T. A.; Gordeeva, A. A.; Suvorova, L. A.; Molokanov, A. A.; Badine, I.

    2004-07-01

    Object of research are the workers having in an organism radioactive substance (Am-241 and Pu-239). The purpose of work was the estimation of reaction hemopoietic systems of an organism on influence of americium and plutonium at workers of the nuclear industry. At the surveyed contingent of persons the determined effects caused by total influence Am-241 and Pu-239 are ascertained; chronic radiation disease with development, besides diffusive a pneumoscleoris and a chronic toxic-chemical radiating bronchitis, reactions of system of blood, jet hepatopathy which frequency accrued with increase doses loadings and essentially did not depend on age. In peripheral blood on the foreground jet changes act: hyperglobulia, the tendency to neutrophilus leukocytosis, monocytosis, increase ESR, decrease (reduction ?/G of factor reflecting weight and processing of defeat bronchus and pulmonary of system. Stable downstroke in number thrombocytes and reticulocytes in peripheral blood, their direct dependence on a doze of an irradiation, reflect hypoplastic a background hemogenesis, caused by long influence incorporatedin a bone and a bone brain of radioactive substances. At cytologic research punctate a bone brain jet changes which are expressed in increase of functional activity erythro-and myelopoiesiscome to light and provide compensatory reaction of peripheral blood. At histologic research of a bone brain and a bone fabric attributes of development atrophic process which is expressed in reduction of volume parenchyma a bone brain (a fatty atrophy) and dysplasia to a bone fabric are observed.

  2. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  3. The recycling of the actinides neptunium, americium and curium in a fast power reactor to reduce the long term activity in a final store

    International Nuclear Information System (INIS)

    The starting point for the considerations and calculations given in this dissertation is the inevitable production of radioactive materials in the use of nuclear energy, which creates a considerable potential danger in a final store for a very long period. As one possibility of alleviating this problem, a concept for recycling the waste actinides neptunium, americium and curium was proposed. The waste actinides are separated in the reprocessing of burnt-up fuel elements and reach a further irradiation circuit. There they pass through the stages 'manufacture of irradiation elements', 'use in a fast power reactor' and reprocessing of irradiation elements' several times. In each irradiation and subsequent storage, about 17% of the waste actinides are removed by fission or by conversion into nuclides which can be reused as fuel, so that during the life of 40 years of the fast recycling reacor, the waste actinides can be reduced in mass by one half. In order to determine this mass reduction effect, a model calculation was developed, which includes the representation of the neutron physics and thermal properties of the reactor core and the storage and reprocessing of the irradiation elements. (orig./RB)

  4. Actinide and lanthanum accumulation by immobilized cells of a citrobacter sp. and application to the decontamination of solutions containing americium and plutonium

    International Nuclear Information System (INIS)

    Phosphatase-mediated metal bioaccumulation by a Citrobacter sp. underlies a bioprocess for the removal of heavy metals from solution, as cell-bound metal phosphate. Deposition of uranyl ion indicated a role in the biotechnological removal of americium and plutonium from wastes generated from the nuclear fuel cycle. Preliminary studies suggested a recalcitrance of tetravalent species of U(IV), Th(IV) and Zr(IV) and, by implication, Pu(IV), probably attributable to the stability of metal-ligand complexes in solution. Trials with the trivalent model, La(III), indicated probable bioaccumulation of Pu(III) and Am(III), which was confirmed by the removal of 241Am by cells immobilized in a cartridge incorporated into a flow supplemented with Am. Pu(V) and Pu(IV) wastes may be treatable via prior reduction to Pu(III), with simultaneous removal of the latter with the co-contaminant Am(III). An oxidative route, to Pu(VI), with desolubilization as HPuO2PO4 was also considered, but experiments using the analogous U(VI) (uranyl ion) demonstrated a greater efficiency of M(III) removal. Initial experiments utilized polyacrylamide gel-immobilized cells. 241Am removal also occurred with Citrobacter sp. immobilized as biofilm on reticulated foam supports, more amenable to large-scale processes

  5. Characterization of americium(III) and lanthanide(III) complexes in mixed solvent extraction systems containing a malonamide and a dialkyl-phosphoric acid

    International Nuclear Information System (INIS)

    In order to further reduce toxicity of nuclear waste, the French Commissariat a l'energie atomique et aux energies alternatives (CEA) is developing processes that allow separation of minor actinides from fission products. The DIAMEX (Diamide extraction) - SANEX (Selective actinide extraction) process is based on a mixture of two organic extractants: a malonamide, the N,N'-dimethyl-N,N'-dioctyl-hexyl-ethoxy-malonamide (DMDOHEMA) and a dialkyl-phosphoric acid, the di(2-ethylhexyl)phosphoric acid (HDEHP), dissolved in an alkane. The mechanisms of its extraction process are still not completely understood. Various complementary analytical techniques were used to identify and characterize americium(III) and lanthanide(III) metallic complexes formed in the organic phase after solvent extraction (UV-Visible, Infrared, NMR and Time Resolved Laser-Induced Fluorescence spectroscopy, as well as Electro-spray Ionization Mass Spectrometry). These speciation studies were performed under a variety of experimental conditions (influence of the extractants concentration, acidity of the aqueous phase..) and mixed species including the two extractants were observed. (authors)

  6. Strong synergy with APR-246 and DNA-damaging drugs in primary cancer cells from patients with TP53 mutant High-Grade Serous ovarian cancer

    OpenAIRE

    Fransson, Åsa; Glaessgen, Daria; Alfredsson, Jessica; Wiman, Klas G.; Bajalica-Lagercrantz, Svetlana; Mohell, Nina

    2016-01-01

    Background Mutation in the tumor suppressor gene TP53 is an early event in the development of high-grade serous (HGS) ovarian cancer and is identified in more than 96 % of HGS cancer patients. APR-246 (PRIMA-1MET) is the first clinical-stage compound that reactivates mutant p53 protein by refolding it to wild type conformation, thus inducing apoptosis. APR-246 has been tested as monotherapy in a Phase I/IIa clinical study in hematological malignancies and prostate cancer with promising result...

  7. N-(2-{[5-Bromo-2-(piperidin-1-ylpyrimidin-4-yl]sulfanyl}-4-methoxyphenyl-2,4,6-trimethylbenzenesulfonamide

    Directory of Open Access Journals (Sweden)

    Mohan Kumar

    2012-09-01

    Full Text Available In the title compound, C25H29BrN4O3S2, the benzene rings bridged by the sulfonamide group are tilted relative to each other by 63.9 (1° and the dihedral angle between the sulfur-bridged pyrimidine and benzene rings is 64.9 (1°. The molecular conformation is stabilized by a weak intramolecular π–π stacking interaction between the pyrimidine and the 2,4,6-trimethylbenzene rings [centroid–centroid distance = 3.766 (2 Å]. The piperidine ring adopts a chair conformation. In the crystal, molecules are linked into inversion dimers by pairs of N—H...O hydrogen bonds and these dimers are further linked by C—H...O hydrogen bonds into chains propagating along [010].

  8. Aquatrinitrato[2,4,6-tris(pyridin-2-yl-1,3,5-triazine]neodymium(III dihydrate

    Directory of Open Access Journals (Sweden)

    Jin Zhou

    2011-06-01

    Full Text Available In the title compound, [Nd(NO33(C18H12N6(H2O]·2H2O, the Nd3+ ion is in a distorted bicapped square-antiprismatic geometry formed by three N atoms from the 2,4,6-tris(pyridin-2-yl-1,3,5-triazine (TPTZ ligand, six O atoms from the three nitrate anions and one O atom from the aqua ligand. The molecules are linked by O—H...O and O—H...N hydrogen bonds. Two types of π–π stacking interactions occur between the TPTZ ligands of adjacent complexes [centroid-to-centroid distances = 3.760 (4 and 3.870 (3 Å].

  9. Grignard Reaktiflerinin Aseton O-(2,4,6-trimetilfenilsülfoniloksim ile Elektrofilik Aminasyonuyla Arilaminlerin Sentezi

    Directory of Open Access Journals (Sweden)

    Tahir DAŞKAPAN

    2009-04-01

    Full Text Available Arilaminler, birçok pratik ve yararlı uygulamalara imkan veren önemli bir organik bilesik sınıfıdır. Arilamino grubu dogada temel bir yapısal motiftir. Amin sentezi için gelistirilen modern yöntemler arasında kolay bulunabilen bir organometalik reaktifin elektrofilik aminasyonu yöntemi, organik sentezde önemli bir yöntem olarak ortaya çıkmıstır.Bu çalısmada, sentetik organik, ilaç ve tarım kimyasında kullanılan arilaminlerin, organomagnezyum reaktiflerinin aseton O-(2,4,6-trimetilfenilsülfoniloksim ile elektrofilik aminasyonuyla ılımlı reaksiyon sartları altında ve iyi verimle hazırlanması için kolay uygulanabilir bir yöntem gelistirilmistir.

  10. Ecotoxicological evaluation of in situ bioremediation of soils contaminated by the explosive 2,4,6-trinitrotoluene (TNT)

    International Nuclear Information System (INIS)

    The luminescent bacteria assay, using soil leachates, was the most sensitive toxicity indicator. - To evaluate the environmental relevance of in situ bioremediation of contaminated soils, effective and reliable monitoring approaches are of special importance. The presented study was conducted as part of a research project investigating in situ bioremediation of topsoils contaminated by the explosive 2,4,6-trinitrotoluene (TNT). Changes in soil toxicity within different experimental fields at a former ordnance factory were evaluated using a battery of five bioassays (plant growth, Collembola reproduction, soil respiration, luminescent bacteria acute toxicity and mutagenicity test) in combination to chemical contaminant analysis. Resulting data reveal clear differences in sensitivities between methods with the luminescent bacteria assay performed with soil leachates as most sensitive toxicity indicator. Complete test battery results are presented in so-called soil toxicity profiles to visualise and facilitate the interpretation of data. Both biological and chemical monitoring results indicate a reduction of soil toxicity within 17 months of remediation

  11. Green and solvent-free procedure for microwave-assisted synthesis of 2,4,6-triarylpyridines catalysed using MgAl2O4 nanocrystals

    Indian Academy of Sciences (India)

    Javad Safari; Soheila Gandomi-Ravandi; Mahmoud Borjian Borujeni

    2013-09-01

    Design and development of a heterogeneous nanocatalyst for condensation reaction of acetophenone derivatives, aromatic aldehydes, and ammonium acetate to yield 2,4,6-triarylpyridines followed by microwave irradiation is described. Nanocrystalline MgAl2O4 as a novel heterogeneous recyclable catalyst shows high activity for the above reaction. In addition, the easily recoverable nanosized catalysts showed good reusability.

  12. Critical and subcritical masses of curium-245, -246 and -247 calculated with a combination of MCNP4A code and JENDL-3.2 library

    International Nuclear Information System (INIS)

    Critical masses of three curium isotopes, 245Cm, 246Cm and 247Cm, were calculated with a combination of the current version of the Japanese Evaluated Nuclear Data Library, JENDL-3.2, and a continuous energy Monte Carlo neutron transport code, MCNP4A. The subcritical masses corresponding to the neutron multiplication factor keff=0.9 and 0.8 were also computed in the same way. The subcritical masses that correspond to keff=0.9 for 246Cm metal and 246CmO2 with a 30-cm-thick stainless steel reflector were computed as 25.2 kg and 41.8 kg, respectively. The minimum critical mass for 245Cm was obtained as 65.6 g in a sphere of a homogeneous mixture of granulated 245Cm metal and water surrounded by a fully thick water reflector. The corresponding quantity for 247Cm was found to be 2.19 kg. The critical masses of 245Cm, 246Cm and 247Cm metals were computed also for reference by replacing the JENDL-3.2 with the ENDF/B-VI; they were reduced by 23%, 45% and 2%, respectively, from each corresponding value, which revealed a large dependence of the results on the evaluated nuclear data libraries. The present report was prepared for revision of the ANSI/ANS-8.15, the American National Standard for Nuclear Criticality Control of Special Actinide Elements. (author)

  13. APR-246 (PRIMA-1(MET)) strongly synergizes with AZD2281 (olaparib) induced PARP inhibition to induce apoptosis in non-small cell lung cancer cell lines.

    Science.gov (United States)

    Deben, Christophe; Lardon, Filip; Wouters, An; Op de Beeck, Ken; Van den Bossche, Jolien; Jacobs, Julie; Van Der Steen, Nele; Peeters, Marc; Rolfo, Christian; Deschoolmeester, Vanessa; Pauwels, Patrick

    2016-06-01

    APR-246 (PRIMA-1(Met)) is able to bind mutant p53 and restore its normal conformation and function. The compound has also been shown to increase intracellular ROS levels. Importantly, the poly-[ADP-ribose] polymerase-1 (PARP-1) enzyme plays an important role in the repair of ROS-induced DNA damage. We hypothesize that by blocking this repair with the PARP-inhibitor AZD2281 (olaparib), DNA damage would accumulate in the cell leading to massive apoptosis. We observed that APR-246 synergistically enhanced the cytotoxic response of olaparib in TP53 mutant non-small cell lung cancer cell lines, resulting in a strong apoptotic response. In the presence of wild type p53 a G2/M cell cycle block was predominantly observed. NOXA expression levels were significantly increased in a TP53 mutant background, and remained unchanged in the wild type cell line. The combined treatment of APR-246 and olaparib induced cell death that was associated with increased ROS production, accumulation of DNA damage and translocation of p53 to the mitochondria. Out data suggest a promising targeted combination strategy in which the response to olaparib is synergistically enhanced by the addition of APR-246, especially in a TP53 mutant background. PMID:26975633

  14. Degradation of 2,4,6-Trichlorophenol Using Hydrogen Peroxide Catalyzed by Nanoscale Zero-Valent Iron Supported on Ion Exchange Resin.

    Science.gov (United States)

    Tai, Chao; She, Jiaping; Yin, Yongguang; Zhao, Tongqian; Wu, Li

    2016-06-01

    Nanoscale zero-valent iron (NZVI) supported on ion exchange resin was prepared and characterized by scanning electron microscope and energy dispersive spectroscopy, with a simple model developed for describing the catalyst. The degradation of 2,4,6-trichlorophenol (2,4,6-TCP) by hydrogen peroxide using NZVI supported on ion exchange resin as the catalyst, was studied. The results showed that 2,4,6-TCP with a concentration of 1 mmol L(-1) could be well degraded into low molecule weight organic acids in two hours. The optimized condition was as follows: pH, 3.0; temperature, 35 degrees C; catalyst dosage, 1.5 g; and hydrogen peroxide, 0.16 mmol L(-1). The catalyst has good reusability, with no catalytic efficiency decreasing even after ten times recycles. A possible mechanism of 2,4,6-TCP degradation was proposed, based on the products indentified by GC-MS after derived using trimethylsulfonium hydroxide. PMID:27427643

  15. 2,4,6-Trichloro-1,3,5-triazine/dimethylformamide as an efficient reagent for one-pot conversion of alcohols into N-alkylphthalimides

    Institute of Scientific and Technical Information of China (English)

    Babak; Mokhtari; Roya; Azadi; Aseieh; Azhdari

    2010-01-01

    An efficient and mild method for the direct conversion of alcohols into N-alkylphthalimides using 2,4,6-trichloro-1,3,5-triazine and dimethylformamide was described.The reaction was preceded via(alcoxymethylene) dimethylammonium chloride intermediate and produced corresponding N-alkylphthalimides in good-to-excellent yields.

  16. 1,1´,1´´-(2,4,6-Trihydroxybenzene-1,3,5-triyl)triethanone tautomerism revisited

    DEFF Research Database (Denmark)

    Hansen, Poul Erik; Kamounah, Fadhil S.; Zhiryakova, Diana;

    2014-01-01

    It has recently been suggested that 1,1′,1′′-(2,4,6-trihydroxybenzene-1,3,5-triyl)triethanone may be tautomeric. Using 13C NMR chemical shifts and deuterium isotope effects on 13C chemical shifts, it is demonstrated that this is not the case. This compound occurs as a strongly hydrogen bonded ben...

  17. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  18. 6,6 '-bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo 1,2,4 triazine-3-yl) 2,2 ' bipyridine, an effective extracting agent for the separation of americium(III) and curium(III) from the lanthanides

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and the lanthanides(III) from nitric acid by 6,6'- bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo[1,2,4]triazine-3-yl)-[2,2'] bipyridine (CyMe4-BTBP) has been studied. Since the extraction kinetics were slow, N,N'-dimethyl-N,N'-di-octyl-2-(2-hexyl-oxy-ethyl)malonamide (DMDOHEMA) was added as a phase transfer reagent. With a mixture of 0.01 M CyMe4-BTBP + 0.25 M DMDOHEMA in n -octanol, extraction equilibrium was reached within 5 min of mixing. At a nitric acid concentration of 1 M, an americium(III) distribution ratio of approx. 10 was achieved. Americium(III)/lanthanide(III) separation factors between 50 (dysprosium) and 1500 (lanthanum) were obtained. Whereas americium(III) and curium(III) were extracted as di-solvates, the stoichiometries of the lanthanide(III) complexes were not identified unambiguously, owing to the presence of DMDOHEMA. In the absence of DMDOHEMA, both americium(III) and europium(III) were extracted as di-solvates. Back-extraction with 0.1 M nitric acid was thermodynamically possible but rather slow. Using a buffered glycolate solution of pH=4, an americium(III) distribution ratio of 0.01 was obtained within 5 min of mixing. There was no evidence of degradation of the extractant, for example, the extraction performance of CyMe4-BTBP during hydrolysis with 1 M nitric acid did not change over a two month contact. (authors)

  19. Thermodynamic parameters of MeO2+ + H+ reversible MeO22+ + 1/2 H2 reaction for americium and neptunium ions in solution of potassium phosphotungstates

    International Nuclear Information System (INIS)

    Formal oxidation potentials of MeO22+-MeO2+ pair are measured for americium and neptunium ions in solutions of potassium phosphotungstates in 23-51 deg C temperature range at solution pH values equal to 1.0 and 4.0 by differential coulopotentiometric and potentiometric methods. Based on the data obtained Gibbs energy change values; enthalpies and enthropies for MeO2+ + H+ ↔ MeO22+ + 1/2H2 reaction are calculated

  20. Microwave assisted facile synthesis of {1/1,3-bis/1,3,5-tris-[(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene]} using bismuth nitrate pentahydrate as an eco-friendly nitrating agent

    International Nuclear Information System (INIS)

    1-(2-Nitroxyethylnitramino)-2,4,6-trinitrobenzene (3a), 1,3-bis(2-nitroxyethyl nitramino)-2,4,6-trinitrobenzene (3b) and 1,3,5-tris(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene (3c) were prepared by the nitration of 1-(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2a) 1,3-bis(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2b) and 1,3,5-tris(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2c) using bismuth nitrate pentahydrate (eco-friendly nitrating agent) in tetrahydrofuran adsorbed on silica gel under microwave irradiation, respectively. Key intermediate compounds viz., 2a, 2b and 2c were synthesized by condensing picryl chloride, styphnyl chloride and 1,3,5-trichloro-2,4,6-trinitrobenzene with ethanol amine, respectively, based on the lines of the reported method. The synthesized compounds were characterized based on their physical constant, infrared (IR) spectroscopy and 1H nuclear magnetic resonance (NMR) spectroscopy. The spectroscopic data obtained indicated the formation of nitrate esters (3a-3c). The nitration methodology adopted in the present study is of relevance in the context of green chemistry. The target compounds (3a-3c) synthesized using eco-friendly approach are of interest from the point of high energy materials (HEMs)

  1. Microwave assisted facile synthesis of {1/1,3-bis/1,3,5-tris-[(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene]} using bismuth nitrate pentahydrate as an eco-friendly nitrating agent.

    Science.gov (United States)

    Badgujar, D M; Talawar, M B; Asthana, S N; Venugopalan, S; Rao, A Subhananda; Mahulikar, P P

    2008-04-01

    1-(2-Nitroxyethylnitramino)-2,4,6-trinitrobenzene (3a), 1,3-bis(2-nitroxyethyl nitramino)-2,4,6-trinitrobenzene (3b) and 1,3,5-tris(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene (3c) were prepared by the nitration of 1-(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2a) 1,3-bis(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2b) and 1,3,5-tris(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2c) using bismuth nitrate pentahydrate (eco-friendly nitrating agent) in tetrahydrofuran adsorbed on silica gel under microwave irradiation, respectively. Key intermediate compounds viz., 2a, 2b and 2c were synthesized by condensing picryl chloride, styphnyl chloride and 1,3,5-trichloro-2,4,6-trinitrobenzene with ethanol amine, respectively, based on the lines of the reported method. The synthesized compounds were characterized based on their physical constant, infrared (IR) spectroscopy and (1)H nuclear magnetic resonance (NMR) spectroscopy. The spectroscopic data obtained indicated the formation of nitrate esters (3a-3c). The nitration methodology adopted in the present study is of relevance in the context of green chemistry. The target compounds (3a-3c) synthesized using eco-friendly approach are of interest from the point of high energy materials (HEMs). PMID:17723262

  2. Microwave assisted facile synthesis of {l_brace}1/1,3-bis/1,3,5-tris-[(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene]{r_brace} using bismuth nitrate pentahydrate as an eco-friendly nitrating agent

    Energy Technology Data Exchange (ETDEWEB)

    Badgujar, D.M. [School of Chemical Sciences, North Maharashtra University, Jalgaon, 425001 Maharashtra (India)], E-mail: dmbadgujar@rediffmail.com; Talawar, M.B. [High Energy Material Research Laboratory (HEMRL), Ministry of Defense (MOD), Defense Research and Development Organization - DRDO, Pune, 411021 Maharastra (India)], E-mail: mbtalawar@yahoo.com; Asthana, S.N.; Venugopalan, S.; Rao, A. Subhananda [High Energy Material Research Laboratory (HEMRL), Ministry of Defense (MOD), Defense Research and Development Organization - DRDO, Pune, 411021 Maharastra (India); Mahulikar, P.P. [School of Chemical Sciences, North Maharashtra University, Jalgaon, 425001 Maharashtra (India)], E-mail: mahulikarpp@rediffmail.com

    2008-04-01

    1-(2-Nitroxyethylnitramino)-2,4,6-trinitrobenzene (3a), 1,3-bis(2-nitroxyethyl nitramino)-2,4,6-trinitrobenzene (3b) and 1,3,5-tris(2-nitroxyethylnitramino)-2,4,6-trinitrobenzene (3c) were prepared by the nitration of 1-(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2a) 1,3-bis(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2b) and 1,3,5-tris(2-hydroxyethylamino)-2,4,6-trinitrobenzene (2c) using bismuth nitrate pentahydrate (eco-friendly nitrating agent) in tetrahydrofuran adsorbed on silica gel under microwave irradiation, respectively. Key intermediate compounds viz., 2a, 2b and 2c were synthesized by condensing picryl chloride, styphnyl chloride and 1,3,5-trichloro-2,4,6-trinitrobenzene with ethanol amine, respectively, based on the lines of the reported method. The synthesized compounds were characterized based on their physical constant, infrared (IR) spectroscopy and {sup 1}H nuclear magnetic resonance (NMR) spectroscopy. The spectroscopic data obtained indicated the formation of nitrate esters (3a-3c). The nitration methodology adopted in the present study is of relevance in the context of green chemistry. The target compounds (3a-3c) synthesized using eco-friendly approach are of interest from the point of high energy materials (HEMs)

  3. Update of JAEA-TDB. Additional selection of thermodynamic data for solid and gaseous phases on nickel, selenium, zirconium, technetium, thorium, uranium, neptunium plutonium and americium, update of thermodynamic data on iodine, and some modifications

    International Nuclear Information System (INIS)

    We additionally selected thermodynamic data for solid and gaseous phases of nickel, selenium, zirconium, technetium, thorium, uranium, neptunium, plutonium and americium to our thermodynamic database JAEA-TDB for geological disposal of radioactive waste of high-level and TRU wastes. We thermodynamically obtained equilibrium constant from addition and subtraction of Gibbs free energy of formation on nickel, selenium, zirconium, technetium, thorium, uranium, neptunium plutonium and americium, which were selected in the Thermochemical Database Project by the Nuclear Energy Agency in the Organisation for Economic Co-operation and Development. Furthermore, we collected and updated thermodynamic data on iodine, changed master species of technetium(IV), and added thermodynamic data on selenium due to improving reliability of the thermodynamic database. We prepared text files of the updated thermodynamic database (JAEA-TDB) for geochemical calculation programs of PHREEQC, EQ3/6 and Geochemist's Workbench. These text files are contained in the attached CD-ROM and will be available on our Website (http://migrationdb.jaea.go.jp/). (author)

  4. Impact of the cation distribution homogeneity on the americium oxidation state in the U{sub 0.54}Pu{sub 0.45}Am{sub 0.01}O{sub 2−x} mixed oxide

    Energy Technology Data Exchange (ETDEWEB)

    Vauchy, Romain [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Robisson, Anne-Charlotte, E-mail: anne-charlotte.robisson@cea.fr [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Scheinost, Andreas C. [Helmholtz Zentrum Dresden-Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 510119, 01314 Dresden, Germany and Rossendorf Beamline at ESRF, BP 220, F-38043 Grenoble (France); Hodaj, Fiqiri [Science et Ingénierie des Matériaux et Procédés (SIMaP, associé au CNRS UMR 5266 – UJF/INP-Grenoble), Domaine Universitaire, 1130 rue de la piscine, BP 75, 38402 Saint Martin d’Hères (France)

    2015-01-15

    The impact of the cation distribution homogeneity of the U{sub 0.54}Pu{sub 0.45}Am{sub 0.01}O{sub 2−x} mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium–plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β{sup −} decay of {sup 241}Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U–Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  5. Impact of the cation distribution homogeneity on the americium oxidation state in the U0.54Pu0.45Am0.01O2-x mixed oxide

    Science.gov (United States)

    Vauchy, Romain; Robisson, Anne-Charlotte; Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence; Scheinost, Andreas C.; Hodaj, Fiqiri

    2015-01-01

    The impact of the cation distribution homogeneity of the U0.54Pu0.45Am0.01O2-x mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium-plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β- decay of 241Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U-Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  6. APR-246/PRIMA-1(MET) rescues epidermal differentiation in skin keratinocytes derived from EEC syndrome patients with p63 mutations.

    Science.gov (United States)

    Shen, Jinfeng; van den Bogaard, Ellen H; Kouwenhoven, Evelyn N; Bykov, Vladimir J N; Rinne, Tuula; Zhang, Qiang; Tjabringa, Geuranne S; Gilissen, Christian; van Heeringen, Simon J; Schalkwijk, Joost; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing

    2013-02-01

    p53 and p63 share extensive sequence and structure homology. p53 is frequently mutated in cancer, whereas mutations in p63 cause developmental disorders manifested in ectodermal dysplasia, limb defects, and orofacial clefting. We have established primary adult skin keratinocytes from ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome patients with p63 mutations as an in vitro human model to study the disease mechanism in the skin of EEC patients. We show that these patient keratinocytes cultured either in submerged 2D cultures or in 3D skin equivalents have impaired epidermal differentiation and stratification. Treatment of these patient keratinocytes with the mutant p53-targeting compound APR-246/PRIMA-1(MET) (p53 reactivation and induction of massive apoptosis) that has been successfully tested in a phase I/II clinical trial in cancer patients partially but consistently rescued morphological features and gene expression during epidermal stratification in both 2D and 3D models. This rescue coincides with restoration of p63 target-gene expression. Our data show that EEC patient keratinocytes with p63 mutations can be used for characterization of the abnormal molecular circuitry in patient skin and may open possibilities for the design of novel pharmacological treatment strategies for patients with mutant p63-associated developmental abnormalities. PMID:23355676

  7. Aniline and 2,4,6-trinitrotoluene associate preferentially to low molecular weight fractions of dissolved soil organic matter

    International Nuclear Information System (INIS)

    Aniline and 2,4,6-trinitrotoluene (TNT) were equilibrated with particulate (POM) and dissolved organic matter (DOM) from an organic soil at different compositions of adsorbed major cations (Na, Al) and pH (aniline: 3.7-5.1, TNT: 4.8-5.0). After separation of POM, concentrations of 14C-labelled aniline and TNT* (including TNT degradation products) were determined in DOM size fractions using size-exclusion chromatography (SEC) and UV-detection. Concentrations in the 40 kDa fraction. Thus, both aniline and TNT* were preferentially associated to the smallest DOM size fraction. The significant binding to DOM (similar extent as to POM) and the fact that the <3.5 kDa DOM fraction was less susceptible to flocculation by major metals suggests that the mobility of aniline and TNT is highly affected by the solubility of soil organic matter. - Concentrations of aniline and TNT associated with dissolved organic matter (DOM) was shown to increase with decreasing apparent molecular mass of DOM.

  8. In vitro study to determine decontamination of 3,5-dichloro-2,4,6-trifluoropyridine (DCTFP) from human skin.

    Science.gov (United States)

    Hui, Xiaoying; Domoradzki, Jeanne Y; Maibach, Howard C

    2012-07-01

    This in vitro study determined the decontamination potential of soap and water, D-TAM skin cleanser, corn oil and the O'Dell reactive skin decontamination system to remove 3,5-dichloro-2,4,6-trifluoropyridine (DCTFP) from human skin after short exposure periods (10 and 30 min). The main result turned out to be the rapid volatility of DCTFP where half of the dose evaporated within 10 min and most of the dose was evaporated after 30 min. This rapid volatility was confirmed in an additional study where DCTFP rapidly evaporated from inert plastic disks (70% loss in 10 min). Despite rapid evaporation and short exposure periods, some DCTFP entered into the human skin epidermis, dermis and receptor fluid. Less DCTFP reached the receptor fluid with the 10 min decontamination (0.13%) than the 30 min decontamination (0.27%). Statistically, all tested decontamination systems performed the same (P>0.05). For human risk the volatility of DCTFP seems paramount. For skin decontamination any of the tested systems will work. An important point is that they should be used within minutes of skin exposure. This study exhibits the dynamics of evaporation, substantivity (skin binding), percutaneous absorption and decontamination of a volatile chemical. PMID:22504088

  9. Molecular and Crystal Structure of 1,3,5 Tris(benzimidazol-1-ylmethyl)-2,4,6-Trimethylbenzene

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The compound 1,3,5-tris(benzimidazol-l-ylmethyl)-2,4,6-trimethylbenzene, crystallizes in the monoclinic system, space group P2rC, with a = 17.571(4), b = 10.860(2), c = 14.126(3) A; β = 92.89(3)°, V= 2692(1)A3, De = 1.260 g/cm3, Z = 4, C33H30N6, Mr. = 510.63, μ(MoKα) = 0.077mm-1, F(000) = 1080. The structure was refined to R = 0.0592, wR = 0.1379 for 1492 (I>2σ(I)) reflections. The title molecule has cis, trans, trans-conformation about the central phenyl ring. The screw-related molecules are connected by hydrogen bonds C-H...N (x,-0.5-y, 0.5+z) and form the infinite helical chains. The polar molecular chains are antiparallelly stacked through edge-to-face C-H… π interactions.

  10. Highly selective detection of 2,4,6-trinitrophenol by using newly developed terbium-doped blue carbon dots.

    Science.gov (United States)

    Chen, Bin Bin; Liu, Ze Xi; Zou, Hong Yan; Huang, Cheng Zhi

    2016-04-25

    The detection of nitroaromatic explosives is of great importance owing to their strong explosive power and harmfulness in terms of the environment, homeland security and public safety. Herein, rare earth-doped carbon dots with multifunctional features were firstly prepared by simply keeping the mixture of terbium(iii) nitrate pentahydrate and citric acid at 190 °C for 30 min. The as-prepared terbium doped carbon dots (Tb-CDs), through a rapid and simple direct carbonization route, have a size of about 3 nm, and exhibit excitation wavelength dependent emission of blue fluorescence, are stable, and can be applied for the selective and colorimetric detection of 2,4,6-trinitrophenol (TNP) in the range of 500 nM-100 μM with a limit of detection of 200 nM based on the inner filtering effect (IFE) of the excitation and emission bands of Tb-CDs by TNP and the electron transfer (ET) from Tb-CDs to TNP, giving a precise and highly reproducible result for detecting complex water samples. PMID:27109163

  11. 2,4,6-Trinitrotoluene mineralization and bacterial production rates of natural microbial assemblages from coastal sediments

    International Nuclear Information System (INIS)

    The nitrogenous energetic constituent, 2,4,6-Trinitrotoluene (TNT), is widely reported to be resistant to bacterial mineralization (conversion to CO2); however, these studies primarily involve bacterial isolates from freshwater where bacterial production is typically limited by phosphorus. This study involved six surveys of coastal waters adjacent to three biome types: temperate broadleaf, northern coniferous, and tropical. Capacity to catabolize and mineralize TNT ring carbon to CO2 was a common feature of natural sediment assemblages from these coastal environments (ranging to 270+/-38 μg C kg-1 d-1). More importantly, these mineralization rates comprised a significant proportion of total heterotrophic production. The finding that most natural assemblages surveyed from these ecosystems can mineralize TNT ring carbon to CO2 is consistent with recent reports that assemblage components can incorporate TNT ring carbon into bacterial biomass. These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - Highlights: → TNT mineralization is a common feature of natural bacterial assemblages in coastal sediments. → TNT mineralization rates comprised a significant proportion of total heterotrophic production. → These data counter the widely held contention that TNT is recalcitrant to bacterial catabolism of the ring carbon in natural environments. - The capacity to mineralize TNT ring carbon to CO2 is a common feature of natural bacterial assemblages in coastal sediment.

  12. Highly Photoluminescent Molybdenum Oxide Quantum Dots: One-Pot Synthesis and Application in 2,4,6-Trinitrotoluene Determination.

    Science.gov (United States)

    Xiao, Sai Jin; Zhao, Xiao Jing; Hu, Ping Ping; Chu, Zhao Jun; Huang, Cheng Zhi; Zhang, Li

    2016-03-30

    As a well-studied transition-metal semiconductor material, MoOx has a wider band gap than molybdenum disulfide (MoS2), and its property varies dramatically for the existence of several different allotropes and suboxide phases of molybdenum oxides (MoOx, x synthesis of highly photoluminescent MoOx quantum dots (MoOx QDs), in which commercial molybdenum disulfide (MoS2) powder and hydrogen peroxide (H2O2) are employed as the precursor and oxidant, respectively. The obtained MoOx QDs can be further utilized as an efficient photoluminescent probe, and a new turn-off sensor is developed for 2,4,6-trinitrotoluene (TNT) determination based on the fact that the photoluminescence of MoOx QDs can be quenched by the Meisenheimer complexes formed in the strong alkali solution through the inner filter effect (IFE). Under the optimal conditions, the decreased photoluminescence of MoOx QDs shows a good linear relationship to the concentration of TNT ranging from 0.5 to 240.0 μM, and the limit of detection was 0.12 μM (3σ/k). With the present turn-off sensor, TNT in river water samples can be rapidly and selectively detected without tedious sample pretreatment processes. PMID:26954663

  13. Effectiveness of urea in enhancing the extractability of 2,4,6-trinitrotoluene from chemically variant soils.

    Science.gov (United States)

    Das, Padmini; Sarkar, Dibyendu; Makris, Konstantinos C; Punamiya, Pravin; Datta, Rupali

    2013-11-01

    One of the major challenges in developing an effective phytoremediation technology for 2,4,6-trinitrotoluene (TNT) contaminated soils is limited plant uptake resulting from low solubility of TNT. The effectiveness of urea as a solubilizing agent in increasing plant uptake of TNT in hydroponic systems has been documented. Our preliminary greenhouse experiments using urea were also very promising, but further characterization of the performance of urea in highly-complex soil-solution was necessary. The present study investigated the natural retention capacity of four chemically variant soils and optimized the factors influencing the effectiveness of urea in enhancing TNT solubility in the soil solutions. Results show that the extent of TNT sorption and desorption varies with the soil properties, and is mainly dependent on soil organic matter (SOM) content. Hysteretic desorption of TNT in all tested soils suggests irreversible sorption of TNT and indicates the need of using an extractant to increase the release of TNT in soil solutions. Urea significantly (porganic matter content and urea application rates showed significant effects, whereas pH did not exert any significant effect on urea catalysis of TNT extraction from soil. The optimum urea application rates (125 or 350 mg kg(-1)) for maximizing TNT extraction were within the limits set by the agronomic fertilizer-N rates used for major agricultural crops. The data obtained from this batch study will facilitate the optimization of a chemically-catalyzed phytoremediation model for cleaning up TNT-contaminated soils. PMID:23835412

  14. Ozonation catalyzed by the raw bauxite for the degradation of 2,4,6-trichloroanisole in drinking water

    International Nuclear Information System (INIS)

    A kind of inexpensive and environmental friendly mineral, the raw bauxite has been used successfully as a catalyst combined with ozonation in the degradation of 2,4,6-trichloroanisole (TCA). The catalyst was characterized by using various analytical techniques. X-ray powder diffraction (XRD) characterization showed that the raw bauxite containing boehmite (γ-AlOOH), kaolinite (Al2Si2O5(OH)4) and quartz (SiO2), and γ-AlOOH was the major composition. The catalytic ozonation removal effectiveness of TCA was investigated under various physicochemical conditions. Both the adsorption and the single ozonation were not effective for the degradation of TCA, and the presence of the raw bauxite in ozonation enhanced the TCA removal effectiveness. Both the hydroxyl radicals (·OH) scavenging experiment and Rct characterization confirmed that the generation of ·OH was accounted for the enhancement of the degradation of TCA. The generation of ·OH was inhibited faintly by the presence of both natural organic matters (NOMs) and alkalinity in the natural water during catalyzed ozonation with the raw bauxite. The increasing of both the bauxite dosage and the ozone dosage enhanced the removal effectiveness of TCA. The raw bauxite was an efficient green catalyst for TCA degradation in drinking water.

  15. Biotransformation of 2,4,6-trinitrotoluene (TNT) by enchytraeids (Enchytraeus albidus) in vivo and in vitro

    International Nuclear Information System (INIS)

    2,4,6-Trinitrotoluene (TNT) is toxic to soil invertebrates, but little is known about its toxicokinetic behavior in soil. Tissue residue analysis was used to evaluate whether the presence of TNT and its reduced metabolites in soil invertebrates was due to uptake of these compounds from the soil into the organism, or due to microbial transformation of TNT associated with the organism followed by uptake. Adult white potworms (Enchytraeus albidus) were exposed to non-lethal concentrations of TNT in amended artificial soil for 21 d, or to TNT in solution for 20 h. Soil exposure studies confirmed earlier reports that TNT was transformed in enchytraeids in vivo to 2- and 4-aminodinitrotoluenes. However, enchytraeid exposure to TNT in solution led to the additional presence of 2,4-diaminonitrotoluene as well as 2- and 4- hydroxyamino-dinitrotoluenes and azoxy-compounds, suggesting that TNT can be metabolized in vivo in the absence of soil. Incubation of unexposed enchytraeid homogenates with TNT led to a protein-dependent appearance of these metabolites in vitro after ≥16 h incubation. Cellular fractionation studies indicated that most of this activity resided in the 8000xg pellet, and was completely inhibited by broad-spectrum antibiotics. These studies demonstrate that enchytraeids can transform TNT in vivo and in vitro, at least in part, by bacteria associated with the host organism

  16. Effects of additives on 2,4,6-trinitrotoluene (TNT) removal and its mineralization in aqueous solution by gamma irradiation

    International Nuclear Information System (INIS)

    The effects of additives (i.e., methanol, EDTA, mannitol, thiourea, nitrous oxide, oxygen and ozone) on gamma irradiation of 2,4,6-trinitrotoluene (TNT) were investigated to elucidate the initial reaction mechanism of TNT degradation and suggest an practical method for complete by-product removal. All additives, except thiourea, significantly increased the TNT removal efficiency by gamma irradiation. The overall results of the additive experiments implied that the TNT decomposition would be initiated by ·OH, eaq-, and HO2·/O2·-, and also implied that ·H did not have any direct effect on the TNT decomposition. Additions of methanol and nitrous oxide were more effective in TNT removal than the other additives, achieving complete removal of TNT at doses below 20 kGy. Total organic carbon (TOC) of the irradiated solution was analyzed to evaluate the degree of TNT mineralization under the additive conditions. TOC under the nitrous oxide addition was removed rapidly, and complete TNT mineralization was thus achieved at 50 kGy. Methanol addition was very effective in the TNT removal, but it was not effective in reduction in TOC. Trinitrobenzene (TNB), oxalic acid and glyoxalic acid were detected as radiolytic organic by-products, while ammonia and nitrate were detected as radiolytic inorganic by-products. The most efficient TNT removal and its mineralization by gamma irradiation would be achieved by supersaturating the solution with nitrous oxide before irradiation.

  17. Synthesis and Docking Studies of 2,4,6-Trihydroxy-3-Geranylacetophenone Analogs as Potential Lipoxygenase Inhibitor

    Directory of Open Access Journals (Sweden)

    Chean Hui Ng

    2014-08-01

    Full Text Available The natural product molecule 2,4,6-trihydroxy-3-geranyl-acetophenone (tHGA isolated from the medicinal plant Melicope ptelefolia was shown to exhibit potent lipoxygenase (LOX inhibitory activity. It is known that LOX plays an important role in inflammatory response as it catalyzes the oxidation of unsaturated fatty acids, such as linoleic acid to form hydroperoxides. The search for selective LOX inhibitors may provide new therapeutic approach for inflammatory diseases. Herein, we report the synthesis of tHGA analogs using simple Friedel-Craft acylation and alkylation reactions with the aim of obtaining a better insight into the structure-activity relationships of the compounds. All the synthesized analogs showed potent soybean 15-LOX inhibitory activity in a dose-dependent manner (IC50 = 10.31–27.61 μM where compound 3e was two-fold more active than tHGA. Molecular docking was then applied to reveal the important binding interactions of compound 3e in soybean 15-LOX binding site. The findings suggest that the presence of longer acyl bearing aliphatic chain (5Cs and aromatic groups could significantly affect the enzymatic activity.

  18. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions

    International Nuclear Information System (INIS)

    addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  19. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 3

    International Nuclear Information System (INIS)

    This report summarizes the studies on sorption and diffusion of Cs, Sr, Co, Ni, Am and I in common rocks in Finnish bedrock carried out in laboratory experiments. Samples used in these studies were sections of drill cores containing filled and unfilled natural fracture surfaces and drill cores with a diamond drilled longitudinal cavity in the middle of the sample (drill core cups). Samples originated from the two nuclear power plant sites in Finland: tonalite and mica gneiss from Olkiluoto in Eurajoki and rapakivi granite from Haestholmen in Loviisa. The water used in the experiments was synthetic groundwater spiked at a time with one of the radionuclides: Cs-134, Sr-90, Co-60, Ni-63, Am-241 and I-125. Contact times from one week to one year were used to evaluate time dependence of diffusion. An autoradiographic method was used for determination of the penetration depths and diffusion pathways of elements. For determination of diffusion coefficients a quantitative computerized autoradiographic method was used to get the concentration profiles of the radionuclides in the drill cores. Sorption on natural fracture surfaces was more effective than on freshly drilled core samples. Filling materials on natural fracture surfaces, except calcite, increased sorption. The distribution coefficients for drill core cups were about the same as those for unfilled natural fracture surfaces after a contact time of one week and the sorption tendency of radionuclides was: Ka(Cs) > Ka(Co) > Ka(Am) > Ka(Ni) > Ka(Sr) > Ka(I). Radionuclides were observed to penetrate into fissures of the rock matrix and high-capacity minerals. Strontium was found as far as 35 mm in a filled natural fracture surface sample of rapakivi granite after a contact time of one year. The corresponding values were 3.0 mm for cesium, 2.1 mm for cobalt and 2.6 mm for nickel. For americium no diffusion could be observed (a-values for strontium was 6.6 x 10-16-1.1 x 10-13 m2/s, for cesium 4.7 x 10-16-7.2 x 10-15 m2/s

  20. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  1. Application of Novel Amino-Functionalized NZVI@SiO2 Nanoparticles to Enhance Anaerobic Granular Sludge Removal of 2,4,6-Trichlorophenol

    Directory of Open Access Journals (Sweden)

    Zeyu Guan

    2015-01-01

    Full Text Available A novel amino-functionalized silica-coated nanoscale zerovalent iron (NZVI@SiO2-NH2 was successfully synthesized by using one-step liquid-phase method with the surface functionalization of nanoscale zerovalent iron (NZVI to enhance degradation of chlorinated organic contaminants from anaerobic microbial system. NZVI@SiO2-NH2 nanoparticles were synthesized under optimal conditions with the uniform core-shell structure (80–100 nm, high loading of amino functionality (~0.9 wt%, and relatively large specific surface area (126.3 m2/g. The result demonstrated that well-dispersed NZVI@SiO2-NH2 nanoparticle with nFe0-core and amino-functional silicon shell can effectively remove 2,4,6-trichlorophenol (2,4,6-TCP in the neutral condition, much higher than that of NZVI. Besides, the surface-modified nanoparticles (NZVI@SiO2-NH2 in anaerobic granule sludge system also showed a positive effect to promote anaerobic biodechlorination system. More than 94.6% of 2,4,6-TCP was removed from the combined NZVI@SiO2-NH2-anaerobic granular sludge system during the anaerobic dechlorination processes. Moreover, adding the appropriate concentration of NZVI@SiO2-NH2 in anaerobic granular sludge treatment system can decrease the toxicity of 2,4,6-TCP to anaerobic microorganisms and improved the cumulative amount of methane production and electron transport system activity. The results from this study clearly demonstrated that the NZVI@SiO2-NH2/anaerobic granular sludge system could become an effective and promising technology for the removal of chlorophenols in industrial wastewater.

  2. Development of an analytical method to quantify PBDEs, OH-BDEs, HBCDs, 2,4,6-TBP, EH-TBB, and BEH-TEBP in human serum.

    Science.gov (United States)

    Butt, Craig M; Miranda, Marie Lynn; Stapleton, Heather M

    2016-04-01

    Polybrominated diphenyl ethers (PBDEs) flame retardants (FRs) were phased-out in the mid-2000s (penta- and octaBDE) and 2013 (decaBDE); however, their hydroxylated metabolites (OH-BDEs) are still commonly detected in human serum. Today, novel FRs such as Firemaster® 550, a mixture that contains two brominated compounds, EH-TBB and BEH-TEBP are used as replacements for PBDEs in some applications, and there is a need to develop a comprehensive analytical method to assess exposure to both legacy PBDEs and novel FRs. This study developed a solid-phase extraction (SPE)-based method to analyze PBDEs, OH-BDEs, 2,4,6-tribromophenol (TBP), hexabromocylcododecane isomers (HBCDs), EH-TBB, and BEH-TEBP in human serum. Briefly, serum proteins were first denatured with formic acid, and then the target analytes were isolated using a SPE column. Finally, the extract was cleaned and fractioned using a silica SPE column. Method performance was assessed by spiking fetal bovine serum with 1-2 ng of the target analytes, and method accuracy was quantified by comparison to a serum Standard Reference Material (SRM). The developed method showed good recovery and accuracy for all target analytes with the exception of the very low and very high molecular weight PBDE congeners. Using this method, 43 serum samples collected from the Healthy Pregnancy, Healthy Baby Study (HPHB) cohort in Durham, NC, USA were analyzed for FRs. A novel finding was the ubiquitous detection of 2,4,6-TBP, at levels greater than the individual PBDE congeners. Furthermore, 2,4,6-TBP was positively correlated with PBDEs, suggesting that they may have a similar source of exposure, or that 2,4,6-TBP may result from metabolism of PBDEs in vivo. PMID:26864867

  3. 40 CFR 721.5356 - Ethanol, 2,2′2″-nitrilotris-, compound with alpha-2,4,6-tris (1-phenylethyl)phenyl]-omega...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Ethanol, 2,2â²2â³-nitrilotris... Substances § 721.5356 Ethanol, 2,2′2″-nitrilotris-, compound with alpha-2,4,6-tris (1-phenylethyl)phenyl... subject to reporting. (1) The chemical substance identified as ethanol, 2,2′2″-nitrilotris-, compound...

  4. Dichlorido{(E-2,4,6-trimethyl-N-[phenyl(2-pyridylmethylidene]aniline-κ2N,N′}palladium(II

    Directory of Open Access Journals (Sweden)

    Cheng-Hsien Yang

    2010-06-01

    Full Text Available The title complex, [PdCl2(C21H20N2], contains a PdII atom in a slightly distorted square-planar coordination environment defined by two N atoms from one 2,4,6-trimethyl-N-[phenyl(2-pyridylmethylidene]aniline ligand and two Cl atoms, forming a five-membered ring (N—Pd—N—C—C.

  5. Draft Genome Sequence of Bacillus sp. GZT, a 2,4,6-Tribromophenol-Degrading Strain Isolated from the River Sludge of an Electronic Waste-Dismantling Region

    Science.gov (United States)

    Liang, Zhishu; Li, Guiying; Das, Ranjit

    2016-01-01

    Here, we report the draft genome sequence of Bacillus sp. strain GZT, a 2,4,6-tribromophenol (TBP)-degrading bacterium previously isolated from an electronic waste-dismantling region. The draft genome sequence is 5.18 Mb and has a G+C content of 35.1%. This is the first genome report of a brominated flame retardant-degrading strain. PMID:27257197

  6. Characterization of bacterial populations of 2,4,6-trinitrotoluene (TNT) contaminated soils and isolation of a Pseudomonas aeruginosa strain with TNT denitration activities

    OpenAIRE

    Eyers, Laurent

    2007-01-01

    2,4,6-trinitrotoluene (TNT) is a toxic and recalcitrant pollutant contaminating soils and groundwater. Therefore, characterization of microbial populations of TNT-contaminated soils and isolation of bacteria degrading this pollutant are of primordial importance. Comparison of hybridizations of 16S rRNA derived from uncontaminated and TNT-contaminated soil samples required the development of a functional ANOVA model. Specifically, a statistical tool was necessary to compare dissociation curves...

  7. Organic-inorganic compounds with strong nonlinear optical properties based on 2,4,6-trimethylpyridinium and tetrahedral BF4- networks

    Science.gov (United States)

    Wojtaś, Maciej; Bil, Andrzej; Jakubas, Ryszard; Gągor, Anna; Pietraszko, Adam; Czupiński, Olaf; Tylczyński, Zbigniew; Isakov, Dmitry

    2011-04-01

    A different organic-inorganic crystal—[2,4,6-trimethylpyridinium][BF4]—of nonlinear optical properties at room temperature was synthesized and characterized. The compound is built up of the organic [2,4,6-trimethylpyridinium] cations incorporated into inorganic, tetrahedral BF4 anions. It crystallizes at room temperature in the polar space group Pmn21, and undergoes three first-order phase transitions at [cooling (heating)] 241 (245) K, 297 (328) K, and 389 (406) K. The lowest temperature ferroic phase transition (ferroelastic; mm2→m type) is related to the significant pyroelectric effect. The compound was studied by single-crystal x-ray diffraction at several temperatures, using thermal (differential scanning calorimetry and thermogravimetric analysis) methods and dielectric spectroscopy. The piezoelectric, pyroelectric, and second-harmonic generation (SHG) properties were determined. Density-functional theory calculations in two stable phases are given. The [2,4,6-trimethylpyridinium][BF4] crystal exhibits a SHG efficiency of 1.7 times that of KDP. The mechanism of structural phase transitions in the title compound is discussed.

  8. Chemical and physical data collected aboard the THOMAS G. THOMPSON during cruise TN246 in the South Atlantic Ocean and South Pacific Ocean from 2010-01-15 to 2010-03-05 (NODC Accession 0117396)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0117396 includes chemical and physical data collected aboard the THOMAS G. THOMPSON during cruise TN246 in the South Atlantic Ocean and South Pacific...

  9. 2,4,6-Trimethylpyridinium perchlorate: Polar properties and correlations with molecular structure of organic-inorganic hybrid crystal

    International Nuclear Information System (INIS)

    [(CH3)3C5H2NH][ClO4] has been synthesized and characterized by X-ray (at 344, 245, 180 and 115 K), calorimetric, dilatometric, dielectric and pyroelectric measurements. At room temperature the crystal structure is polar, space group Pmn21. It consists of discrete disordered [ClO4]- anions and ordered trimethylpyridinium cations giving the 3D network of hydrogen bonds. The compound reveals a rich polymorphism in the solid state. It undergoes four solid-solid phase transitions: from phases I to II at 356/327 K (heating/cooling), II→III at 346/326, III→IV at 226 K and IV→V at 182/170 K. [(CH3)3C5H2NH][ClO4] reveals a strong pyroelectric response over a wide temperature region (phases III, IV and V) with the spontaneous polarization changes (ΔPs) of the order of 1.5-8x10-3C/m2. The spontaneous polarization is irreversible over all the polar phases, however, the magnitude of the ΔPs in the vicinity of the phase transitions is characteristic of compounds with the ferroelectric order. The molecular mechanism of the successive phases transitions in the studied crystal is proposed. - A novel organic-inorganic hybrid material, simple ionic salt: 2,4,6-trimethylpyridinium perchlorate, [(CH3)3C5H2NH][ClO4] has been synthesized. In this paper we report singlecrystal X-ray, powder X-ray, calorimetric, dilatometric, dielectric and pyroelectric studies of this compound over a wide temperature range. A possible mechanism of the structural phase transitions in [(CH3)3C5H2NH][ClO4] is discussed with particular attention focused on unusually strong pyroelectric properties.

  10. Degradation of 2,4,6-trinitrotoluene in water and soil slurry utilizing a calcium peroxide compound.

    Science.gov (United States)

    Arienzo, M

    2000-02-01

    The degradation of 2,4,6-trinitrotoluene was examined in pure water and contaminated soil slurry using calcium peroxide as a source of solid hydrogen peroxide and oxygen. The extent of TNT oxidation was compared with that obtained by using hydrated lime, which is normally generated by slurrying CaO2 in water and contained in CaO2 technical formulation (approximately 50%, w/w). Complete TNT degradation occurred between 280 min, 0.1% CaO2/Ca(OH)2 and 20 min, 1% CaO2/Ca(OH)2. A large part of the generated oxidation products, 80-90%, were absorbed on the solid calcium hydroxide, whereas the remaining 10-20% was detected in solution until 48 h. Removal of nitro groups was extremely effective in CaO2 slurry, where all the nitrogen (3 mol per mol of TNT) was removed from TNT within 240 min. Respect to calcium hydroxide, the peroxy compound liberated H2O2 in solution, 370 mg l-1 at 0.2% CaO2, w/v, which then decomposed within 480 min. Most of the 14C-TNT was retained more strongly on the calcium hydroxide generated by slurrying CaO2. This pool remained adsorbed on the solid until pH dropped below 5.8. The treatment of a contaminated soil slurry, 700 mg TNT kg-1, reduced CH3CN extractable TNT below 20 mg kg-1 at very low concentration of CaO2/Ca(OH)2, approximately 0.2%, w/w. Both oxidants do not lead to soil sterilization as the phosphorus added to neutralize the pH serves as a source of nutrient for the soil biomass. PMID:10665396

  11. Alkaline Hydrolysis/Polymerization of 2,4,6-Trinitrotoluene: Characterization of Products by 13C and 15N NMR

    Science.gov (United States)

    Thorn, K.A.; Thorne, P.G.; Cox, L.G.

    2004-01-01

    Alkaline hydrolysis has been investigated as a nonbiological procedure for the destruction of 2,4,6-trinitrotoluene (TNT) in explosives contaminated soils and munitions scrap. Nucleophilic substitutions of the nitro and methyl groups of TNT by hydroxide ion are the initial steps in the alkaline degradation of TNT. Potential applications of the technique include both in situ surface liming and ex situ alkaline treatment of contaminated soils. A number of laboratory studies have reported the formation of an uncharacterized polymeric material upon prolonged treatment of TNT in base. As part of an overall assessment of alkaline hydrolysis as a remediation technique, and to gain a better understanding of the chemical reactions underlying the hydrolysis/polymerization process, the soluble and precipitate fractions of polymeric material produced from the calcium hydroxide hydrolysis of unlabeled and 15N-labeled TNT were analyzed by elemental analysis and 13C and 15N nuclear magnetic resonance spectroscopy. Spectra indicated that reactions leading to polymerization included nucleophilic displacement of nitro groups by hydroxide ion, formation of ketone, carboxyl, alcohol, ether, and other aliphatic carbons, conversion of methyl groups to diphenyl methylene carbons, and recondensation of aromatic amines and reduced forms of nitrite, including ammonia and possibly hydroxylamine, into the polymer. Compared to the distribution of carbons in TNT as 14% sp 3- and 86% sp2-hybridized, the precipitate fraction from hydrolysis of unlabeled TNT contained 33% sp3- and 67% sp 2-hybridized carbons. The concentration of nitrogen in the precipitate was 64% of that in TNT. The 15N NMR spectra showed that, in addition to residual nitro groups, forms of nitrogen present in the filtrate and precipitate fractions include aminohydroquinone, primary amide, indole, imine, and azoxy, among others. Unreacted nitrite was recovered in the filtrate fraction. The toxicities and susceptibilities to

  12. Vibrational spectroscopic study of new promising materials for non-linear optics. Phosphates of 2,4,6-triaminopyrimidine

    International Nuclear Information System (INIS)

    Complete text of publication follows. The searching for new materials exhibiting nonlinear optical properties (e.g. second harmonic generation - SHG) in combination with other desirable properties (optical transparency, thermal, optical and mechanical stability) continues to be an important research goal in nonlinear optics (NLO). Essential applications of these materials lie in the areas of optical communications and optical signal processing, as well as storage and other information processing tasks. Interesting class of NLO compounds is based on salts combining a cation derived from a polarizable organic molecule with an inorganic anion capable of forming hydrogen-bonded crystal structures. The bonding energy present in the hydrogen bonds can counteract the tendencies of the organic dipoles to form centrosymmetric pairs. It is assumed that the acid part of such molecular complex is responsible for favourable chemical, mechanical and thermal properties, due to strong hydrogen bond interactions which stabilize the crystal lattice and also contributes to the second-order NLO coefficient of the crystal. The organic part is mainly responsible for the nonlinear optical properties of the crystal. Full assignment of vibrational spectra (employing quantum-chemical computational methods) of crystalline materials with promising SHG activity is very useful not only for their identification but also with respect to their nonlinear optical properties. In this contribution we are presenting results concerning three novel phosphates of 2,4,6-triaminopyrimidine. Assignment of vibrational spectra is based on results of X-ray structural analysis and quantum-chemical computations. Efficiency of SHG for polycrystalline samples is also presented and discussed. This work was supported by the Grant Agency of Czech Republic (grant No. 203/09/0878 and is part of the long term Research Plan of the Ministry of Education of the Czech Republic No. MSM0021620857.

  13. Spartathlon, a 246 kilometer foot race: effects of acute inflammation induced by prolonged exercise on circulating progenitor reparative cells.

    Science.gov (United States)

    Goussetis, Evgenios; Spiropoulos, Antonia; Tsironi, Maria; Skenderi, Katerina; Margeli, Alexandra; Graphakos, Stelios; Baltopoulos, Panayiotis; Papassotiriou, Ioannis

    2009-01-01

    Endothelial progenitor cells (EPCs) and the recently described circulating fibrocytes (CFs) are strongly associated with tissue repair. We investigated the kinetics of both "repair" progenitor cells in healthy athletes who participated in the "Spartahlon" ultradistance foot race (246 km continuous running exercise), which provides a unique model of inducing dramatic systemic inflammatory changes. Peripheral blood mononuclear cells (PBMCs) were isolated from 10 volunteer athletes, who completed successfully the race, before, at the end, and at 48 h post-race. EPCs and CFs were detected as endothelial colony-forming units (CFU-ECs) and as the number of adherent with a spindle-shaped morphology Collagen I(+) cells detected after 6-day culture of PBMCs, respectively. The marked increase of plasma levels of CRP, IL-6, SAA, MCP-1, IL-8, sVCAM-1, sICAM-1, thrombomodulin (sTM) and NT-pro-BNP at the end of race established acute inflammation and tissue injury. EPCs increased by nearly eleven-fold in peripheral blood at the end of the race from 44.5+/-2.5/ml to 494.6+/-27.9/ml and remained increased 428.5+/-31.5/ml at 48 h post-race (p<0.0001). The number of the fibrocytes cultured from PBMCs obtained before, at the end, and 48 h post-race did not reveal any significant difference. These findings indicate that bone marrow responses to acute inflammatory damage, induced by exhausting exercise, with a rapid release of EPCs but not CFs into circulation. Given the ability of EPCs to promote angiogenesis and vascular regeneration, we may suggest that this kind of cell mobilization may serve as a physiologic repair mechanism in acute inflammatory tissue injury. PMID:19233694

  14. Transformation of 2,4,6-trinitrotoluene in soil in the presence of the earthworm Eisenia andrei

    Energy Technology Data Exchange (ETDEWEB)

    Renoux, A.Y.; Sarrazin, M.; Hawari, J.; Sunahara, G.I.

    2000-06-01

    The ability of the earthworm Eisenia andrei to metabolize 2,4,6-trinitrotoluene (TNT) was studied in experiments with TNT-spiked soils, dermal contact tests, and with an in vitro assay. Lethality of TNT in a forest sandy soil was first determined. Then TNT at lethal and sublethal concentrations was applied to the same soil and was monitored along with its metabolites in extracts of soil and earthworm tissue for up to 14 d post application. High performance liquid chromatography-ultra violet analyses indicated that TNT was transformed in the presence of E. andrei by a reductive pathway to 2-amino-3,6-dinitrotoluene (2-ADNT), 4-amino-2,6-dinitrotoluene (4-ADNT), 2,4-diamino-6-nitrotoluene (2.4-DANT), and traces of 2,6-diamino-4-nitrotoluene (2,6-DANT) in earthworm tissues. This transformation could be explained by either a metabolic mechanism within the earthworm or by the enhancement of an earthworm-associated microbial activity or both. The TNT concentrations decreased from the spiked soils. However, the monoamino-dinitrotoluene (2-ADNT and 4-ADNT) concentrations increased with exposure duration and were dependent on the initial TNT soil concentrations. This was also observed to a lesser extent in the TNT-spiked soils with no earthworms present. The biotransformation of TNT into 2-ADNT, 4-ADNT, and 2,4-DANT and the presence of these metabolites in E. andrei after dermal contact on TNT-spiked filter paper showed that dermal uptake can be a significant exposure route for TNT. In vitro experiments showed that earthworm homogenate could metabolize TNT and form 2-ADNT and 4-ADNT at room temperature and at 37 C. This effect was inhibited by heat inactivation prior to incubation or by incubation at 4 C, suggesting that the biotransformation of TNT in the presence of E. andrei may be enzymatic in nature.

  15. Transplacental transport and fetal localization of bispehnol A, tetrabromobisphenol A and 2,4,6-tribromophenol in mice

    Energy Technology Data Exchange (ETDEWEB)

    Sundberg, A.; Brunstroem, B.; Brandt, I. [Uppsala Univ. (Sweden). Dept. of Environmental Toxicology; Cantillana, T.; Bergman, Aa. [Stockholm Univ. (Sweden). Dept. of Environmental Chemistry

    2004-09-15

    Bisphenol A (BPA) is an intermediate in the production of epoxy resins, while its brominated derivative tetrabromobishenol A (TBBPA) and its photolysis degradation product 2,4,6-tribromophenol (TBP) are widely used flame retardants. These brominated compounds have been identified in human blood. TBBPA, TBP and a number of 4-hydroxy-PCBs (e.g. 4-OH-CB107) are high affinity ligands for the thyroxin (T4) transporter transthyretin (TTR) in rodents and other species. Displacement of T4 from the TTR binding site has been proposed as an important mechanism of endocrine disruption by certain halogenated phenolic environmental pollutants. BPA is a fairly potent environmental estrogen receptor agonist that can induce an array of estrogenic effects in several species including mammals, birds and fish. Although the estrogenic activity of TBBPA is less obvious, this brominated BPA analog has been reported to interact with the estrogen receptor and induce estrogenic effects in some in vitro test systems. While the reproductive and developmental toxicity of BPA is well documented, there is evidence that also halogenated phenolic compounds can pass the placental barrier and induce such toxicity. Within the objectives of the COMPARE EU project we study the fetal and maternal kinetics and transplacental transport of phenolic environmental pollutants in pregnant mice. To explore the role of TTR in the placental and blood-brain barrier transport, we employ TTR-deficient mice. For comparative reasons, we also explore the transfer to bird embryos following injection into the yolk or administration to the egg-laying bird. In the present communication, we report on the disposition of BPA, TBBPA and TBP in the fetoplacental unit in pregnant wild-type mice.

  16. Americium behaviour in plastic vessels

    Energy Technology Data Exchange (ETDEWEB)

    Legarda, F.; Herranz, M. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Idoeta, R., E-mail: raquel.idoeta@ehu.e [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Abelairas, A. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain)

    2010-07-15

    The adsorption of {sup 241}Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of {sup 241}Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of {sup 241}Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  17. Americium behaviour in plastic vessels

    International Nuclear Information System (INIS)

    The adsorption of 241Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of 241Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of 241Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  18. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation; Accion EURADOS para la determinacion de americio en craneo mediante medidas in-vivo y simulacion Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ponte, M. A.; Navarro Amaro, J. F.; Perez Lopez, B.; Navarro Bravo, T.; Nogueira, P.; Vrba, T.

    2013-07-01

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  19. SEMI SINTESIS SENYAWA 2,4,6-TRINITROFENILHIDRAZON KALANON DAN UJI AKTIVITAS TERHADAP SEL LEUKIMIA L1210

    Directory of Open Access Journals (Sweden)

    Mochammad Chasani

    2011-11-01

    Full Text Available Kalanon adalah senyawa antikanker yang diisolasi dari Calophyllum biflorum Hends dan Ws. Aktivitas kalanon terhadap sel leukemia L1210 masih rendah yakni dengan niali IC50 = 59,4 ug/mL. Suatu senyawa dikatakan aktif sebagai antikanker jjika memiliki nilai IC50 di bawah 10 ug/mL. Penelitian ini ditujukan untuk mensintesis senyawa turunan kalanon dan diharapkan diperoleh senyawa baru yang mempunyai aktivitas lebih tinggi dibandingkan senyawa asal kalanon. Senyawa turunan kalanon diperoleh melalui reaksi antara kalanon dengan 2,4,6-trinitrofenilhidrazin. Reaksi dilakukan pada suhu 78 oC selama delapan jam. Analisis pendahuluan senyawa hasil sintesis dilakukan dengan metode kromatografi lapis tipis (KLT menggunakan eluen n-heksana dan etil asetat (2:1, v/v. Pemurnian senyawa hasil sintesis menggunakan teknik rekristalisasi dengan pelarut n-heksana dan diklorometan (3:1, v/v. Senyawa hasil sintesis diperoleh dengan Rf = 0,6609 dan rendemen 5,125 % ( b/b serta berupa kristal berwarna coklat. Identifikasi senyawa hasil sintesis dilakukan dengan spektrometer massa dan spektrofotometer IR. Hasil identifikasi menunjukkan bahwa senyawa hasil sintesis yang diharapkan telah terbentuk. Data spektrometer massa diperoleh ion molekul M+ = 647 dengan lepasnya molekul H2. Fragmen-fragmen yang terbentuk adalah pada m/e = 504, m/e = 479, m/e = 451, m/e = 429, m/e = 405, m/e = 377, m/e = 341, m/e = 316, m/e = 281, m/e = 253, m/e = 233, m/e = 207, m/e = 177, m/e = 156, m/e = 135, m/e = 96, m/e = 73, dan m/e = 41. Hasil spektrofotometer IR menunjukkan pita serapan pada 1654.8 cm-1 yang merupakan daerah regang ikatan rangkap C=N, pita serapan pada 3000 cm-1 – 3400 cm-1 adalah pita getaran OH fenol dan pita pada 1380 cm-1 menunjukkan rentangan simetri gugus nitro (NO2. Hasil uji sitotoksik terhadap sel leukemia L1210 menghasilkan nilai IC50 sebesr 47.69 μg/ml.

  20. Uptake of 2,4,6-Trinitrotoluene (TNT) by Vetiver grass (Vetiviera ziznoides L.) -- Preliminary results from a hydroponic study

    Science.gov (United States)

    Shakya, K. M.; Sarkar, D.; Datta, R.; Makris, K.; Pachanoor, D.

    2006-05-01

    2,4,6-Trinitrotoluene(TNT) is a potent mutagen and a Group C human carcinogen that has been widely used to produce munitions and explosives. As a result, vast areas that have been previously used as military ranges, munition burning and open detonation sites have been heavily contaminated with TNT. Conventional remedial activities in such contaminated sites commonly rely on methods such as incineration, land filling and soil composting. Phytoremediation offers a cost-effective solution, utilizing plants to phytoextract TNT from the contaminated soil. We propose the use of vetiver grass (Vetiveria zizanoides) to remove TNT from such contaminated soils. Vetiver is a fast-growing and adaptive grass, enabling its use in TNT-contaminated sites in a wide variety of soil types and climate. We also hypothesized that TNT removal by vetiver grass will be enhanced by utilizing a chaotropic agent (urea) to alter rhizosphere/root hair chemical environment. The objectives of this preliminary hydroponic study were: i) to investigate the effectiveness of vetiver grass in removing TNT from solution, and ii) to evaluate the use of a common agrochemical (urea) in enhancing TNT removal by vetiver grass. Vetiver plants were grown in a hydroponic system with five different TNT concentrations (0, 5, 10, 25, and 50 mg TNT L-1) and three urea concentrations (0, 0.01 and 0.1%). A plant density of 10 g L-1 and three replicate vessels per treatment were used. Aliquots were collected at several time intervals up to 192 hour, and were analyzed for TNT with HPLC. Results showed that vetiver was able to remove TNT from hydroponic solutions. The overall magnitude and kinetics of TNT removal by vetiver grass was enhanced in the presence of urea. TNT removal kinetics depended on TNT and urea initial concentrations, suggestive of second-order kinetic reactions. Preliminary results are encouraging, but in need for verification using more detailed studies involving TNT-contaminated soils. Ongoing

  1. Preliminary kinetics and metabolism of 2,4,6-trinitrotoluene and its reduced metabolites in an aquatic oligochaete

    Energy Technology Data Exchange (ETDEWEB)

    Conder, Jason M.; Point, Thomas W. La; Bowen, Alethea T

    2004-08-25

    We examined the toxicokinetics and metabolism of 2,4,6-trinitirotoluene (TNT) and four of its major reduced metabolites (2-amino-4,6-dinitrotoluene (2ADNT), 4-amino-2,6-dinitrotoluene (4ADNT), and 2,4-diamino-6-nitrotoluene (2,4DANT)) in the freshwater, aquatic oligochaete Tubifex tubifex exposed to spiked, reconstituted water. In uptake experiments with each compound, steady state concentrations were reached within 1 h, and all absorbed compounds were completely eliminated in 0-3 h. The appearance of 2ADNT and 4ADNT (from metabolism of absorbed TNT) was five times slower, reaching 95% of steady state in 14.2-16.1 h. Approximately, 82% of absorbed TNT was metabolized to ADNTs; metabolism to 4ADNT was favored over 2ADNT by a factor of 3. No further metabolism of ADNTs to DANTs was detected. After a loss of 29-50% of metabolically-generated ADNTs during the first hour of the TNT depuration experiment, Tubifex ADNT concentrations remained constant throughout the 53 h depuration period. This suggests differences between the toxicokinetics of absorbed ADNTs and the toxicokinetics of metabolically-generated ADNTs. Experiments using radiolabeled ({sup 14}C) TNT revealed that only 15-47% of {sup 14}C-TNT equivalents were identified as TNT, 2ADNT, or 4ADNT, indicating significant metabolism and/or binding to biomolecules. Of unidentified {sup 14}C-TNT equivalents, 28-38% remained unextractable. Both unextractable and extractable unidentified substances increased throughout the 54 h {sup 14}C-TNT uptake experiment. The unidentified portions of the radiolabel were not eliminated during a 53-h depuration experiment. Bioconcentration factors (BCFs) for HPLC-detectable compounds were found to be linearly related to log K{sub OW} (r{sup 2} = 0.9963). BCFs for 2ADNT, 4ADNT, and 2,4DANT were 10.22, 12.41, and 2.75, respectively. The BCF for TNT was 12.25, based on a molar sum of total TNT and its metabolites ({sigma}TNT + 2ADNT + 4ADNT), and 2.53 based on TNT only. Compound

  2. Preliminary kinetics and metabolism of 2,4,6-trinitrotoluene and its reduced metabolites in an aquatic oligochaete

    International Nuclear Information System (INIS)

    We examined the toxicokinetics and metabolism of 2,4,6-trinitirotoluene (TNT) and four of its major reduced metabolites (2-amino-4,6-dinitrotoluene (2ADNT), 4-amino-2,6-dinitrotoluene (4ADNT), and 2,4-diamino-6-nitrotoluene (2,4DANT)) in the freshwater, aquatic oligochaete Tubifex tubifex exposed to spiked, reconstituted water. In uptake experiments with each compound, steady state concentrations were reached within 1 h, and all absorbed compounds were completely eliminated in 0-3 h. The appearance of 2ADNT and 4ADNT (from metabolism of absorbed TNT) was five times slower, reaching 95% of steady state in 14.2-16.1 h. Approximately, 82% of absorbed TNT was metabolized to ADNTs; metabolism to 4ADNT was favored over 2ADNT by a factor of 3. No further metabolism of ADNTs to DANTs was detected. After a loss of 29-50% of metabolically-generated ADNTs during the first hour of the TNT depuration experiment, Tubifex ADNT concentrations remained constant throughout the 53 h depuration period. This suggests differences between the toxicokinetics of absorbed ADNTs and the toxicokinetics of metabolically-generated ADNTs. Experiments using radiolabeled (14C) TNT revealed that only 15-47% of 14C-TNT equivalents were identified as TNT, 2ADNT, or 4ADNT, indicating significant metabolism and/or binding to biomolecules. Of unidentified 14C-TNT equivalents, 28-38% remained unextractable. Both unextractable and extractable unidentified substances increased throughout the 54 h 14C-TNT uptake experiment. The unidentified portions of the radiolabel were not eliminated during a 53-h depuration experiment. Bioconcentration factors (BCFs) for HPLC-detectable compounds were found to be linearly related to log KOW (r2 = 0.9963). BCFs for 2ADNT, 4ADNT, and 2,4DANT were 10.22, 12.41, and 2.75, respectively. The BCF for TNT was 12.25, based on a molar sum of total TNT and its metabolites (ΣTNT + 2ADNT + 4ADNT), and 2.53 based on TNT only. Compound hydrophobicity predicted the toxicokinetics and

  3. Critical and shielding parametric studies with the Monte Carlo code TRIPOLI to identify the key points to take into account during the transportation of blanket assemblies with high ratio of americium

    International Nuclear Information System (INIS)

    In the framework of French research program on Generation IV sodium cooled fast reactor, one possible option consists in burning minor actinides in this kind of Advanced Sodium Technological Reactor. Two types of transmutation mode are studied in the world : the homogeneous mode of transmutation where actinides are scattered with very low enrichment ratio in fissile assemblies and the heterogeneous mode where fissile core is surrounded by blanket assemblies filled with minor actinides with ratio of incorporated actinides up to 20%. Depending on which element is considered to be burnt and on its content, these minor actinides contents imply constraints on assemblies' transportation between Nuclear Power Plants and fuel cycle facilities. In this study, we present some academic studies in order to identify some key constraints linked to the residual power and neutron/gamma load of such kind of blanket assemblies. To simplify the approach, we considered a modeling of a 'model cask' dedicated to the transportation of a unique irradiated blanket assembly loaded with 20% of Americium and basically inspired from an existent cask designed initially for the damaged fissile Superphenix assembly transport. Thermal calculations performed with EDF-SYRTHES code have shown that due to thermal limitations on cladding temperature, the decay time to be considered before transportation is 20 years. This study is based on explicit 3D representations of the cask and the contained blanket assembly with the Monte Carlo code TRIPOLI/JEFF3.1.1 library and concludes that after such a decay time, the transportation of a unique Americium radial blanket is feasible only if the design of our model cask is modified in order to comply with the dose limitation criterion. (author)

  4. Wet oxidative method for removal of 2,4,6-trichlorophenol in water using Fe(III), Co(II), Ni(II) supported MCM41 catalysts

    Energy Technology Data Exchange (ETDEWEB)

    Chaliha, Suranjana [Department of Chemistry, Gauhati University, Guwahati 781014, Assam (India); Bhattacharyya, Krishna Gopal [Department of Chemistry, Gauhati University, Guwahati 781014, Assam (India)], E-mail: krishna2604@sify.com

    2008-02-11

    Chlorophenols in water are resistant to biological oxidation and they have to be destroyed by chemical oxidation. In the present work, Fe(III), Co(II) and Ni(II) incorporated MCM41 mesoporous solids were used as catalysts for oxidation of 2,4,6-trichlorophenol in water with or without the oxidant, H{sub 2}O{sub 2}. The catalysts were prepared by impregnation and were characterized by XRD and FTIR measurements. The parent MCM41, Fe(III), Co(II) and Ni(II) impregnated MCM41 had cation exchange capacity of 20.5, 25.5, 24.2, 26.0 mequiv./100 g, respectively. The catalysts were used after calcination at 773-873 K for 5 h. The reactions were carried out in a high pressure stirred reactor at 0.2 MPa (autogenous) and 353 K under various reaction conditions. The conversion achieved with Fe(III), Co(II) and Ni(II) incorporated MCM41 in 5 h is respectively 59.4, 50.0 and 65.6% with 2,4,6-TCP:H{sub 2}O{sub 2} molar ratio of 1:1, and 60.2, 60.9 and 68.8% in absence of H{sub 2}O{sub 2}. The oxidation has a first order rate coefficient of (1.2-4.8) x 10{sup -3} min{sup -1}. The results show that introduction of Fe(III), Co(II) and Ni(II) into MCM-41 through impregnation produces very effective catalysts for wet oxidation of 2,4,6-trichlorophenol.

  5. Detecció de compostos volàtils, clorofenols, cloroanisoles i 2,4,6-tribromoanisole, relacionats amb el "gust del suro"

    OpenAIRE

    Insa Aguilar, Sara

    2006-01-01

    D'entre els defectes organolèptics associats al vi, en destaca l'anomenat "gust de suro" habitualment vinculat a la presència de cloroanisoles, els quals són productes de l'activitat microbiana formats a partir dels corresponents clorofenols. La present tesi doctoral recull, en primer lloc, metodologies analítiques adreçades principalment a la determinació dels compostos clorofenòlics (2,4,6-triclorofenol, 2,3,4,6-tetraclorofenol i pentaclorofenol) en el control de qualitat dels taps suro, em...

  6. PRIMA-1Met/APR-246 induces apoptosis and tumor growth delay in small cell lung cancer expressing mutant p53

    DEFF Research Database (Denmark)

    Zandi, Roza; Selivanova, Galina; Christensen, Camilla Laulund;

    2011-01-01

    Small cell lung cancer (SCLC) is a highly malignant disease with poor prognosis, necessitating the need to develop new and efficient treatment modalities. PRIMA-1(Met) (p53-dependent reactivation of massive apoptosis), also known as APR-246, is a small molecule, which restores tumor suppressor...... function to mutant p53 and induces cancer cell death in various cancer types. Since p53 is mutated in more than 90% of SCLC, we investigated the ability of PRIMA-1(Met) to induce apoptosis and inhibit tumor growth in SCLC with different p53 mutations....

  7. Synthesis and characterization of 2,3-dibromopropyl-2,4,6-tribromophenyl ether (DPTE) and structurally related compounds evidenced in seal blubber and brain.

    Science.gov (United States)

    von der Recke, Roland; Vetter, Walter

    2007-03-01

    The unknown compound UBC-1 previously described as the major organobromine contamination in the blubber extract of a hooded seal (Cystophora cristata) from the Barents Sea was identified as 2,3-dibromopropyl-2,4,6-tribromophenyl ether (DPTE). DPTE, which is the main component of the brominated flame retardant (BFR) Bromkal 73-5 PE, was synthesized by electrophilic addition of bromine to allyl-2,4,6-tribromophenyl ether (ATE). The chirality of DPTE was proven by gas chromatographic enantioseparation of the synthesized racemate. On the basis of GC/ECNI-MS ion chromatograms (m/z79 and 81), DPTE was the dominating organobromine compound in blubber and brain samples of hooded seals and harp seals (Phoca groenlandica) from the Barents and Greenland Seas. The concentrations of DPTE in blubber and brain were up to 470 and 340 microg/kg wet weight. Next to DPTE, the natural dibromo-trichloromonoterpene (MHC-1), the anthropogenic BDE 47 and BDE 99, as well as ATE, 3,5-dibromo-2-(2',4'-dibromo)-phenoxyanisole (6-MeO-BDE 47), 2-bromoallyl-2,4,6-tribromophenyl ether (BATE), and 4,6-dibromo-2-(2',4'-dibromo)-phenoxyanisole (2'-MeO-BDE 68) were present with decreasing relevance. BATE, which was detected for the first time in environmental samples, was synthesized from DPTE by E2 elimination. In brain samples of the harp seals, DPTE, ATE, and BATE were the most abundant organobromine compounds, whereas polybrominated diphenyl ethers (PBDEs) and MHC-1 were virtually absent. This indicated that DPTE, ATE, and BATE were able to penetrate the blood-brain barrier. The general co-occurrence of ATE and BATE in samples contaminated with DPTE support the hypothesis that these compounds are biotransformation products of DPTE. Anaerobic transformation studies of DPTE with super-reduced corrinoids resulted in the formation of ATE. Furthermore, 2,4,6-tribromophenol (TBP) and two other unknown minor transformation products were detected. PMID:17396646

  8. catena-Poly[[diaquabis(formato-κOnickel(II]-μ-2,4,6-tris(4-pyridyl-1,3,5-triazine-κ2N2:N4

    Directory of Open Access Journals (Sweden)

    Miao Feng

    2011-05-01

    Full Text Available In the title compound, [Ni(CHO22(C18H12N6(H2O2]n, the NiII ion, lying on a crystallographic inversion center, has a distorted octahedral coordination comprising two water ligands, two O-atom donors from formate ligands and two N-atom donors from the 2,4,6-tris(4-pyridyl-1,3,5-triazine ligands. These ligands bridge the NiII complex units, forming zigzag chains along the c axis. Adjacent chains are linked by O—H...O hydrogen bonds, forming a three-dimensional supramolecular network.

  9. Fe(III) mineral reduction followed by partial dissolution and reactive oxygen species generation during 2,4,6-trinitrotoluene transformation by the aerobic yeast Yarrowia lipolytica

    OpenAIRE

    Ziganshin, Ayrat M; Ziganshina, Elvira E; Byrne, James; Gerlach, Robin; Struve, Ellen; Biktagirov, Timur; Rodionov, Alexander; Kappler, Andreas

    2015-01-01

    Understanding the factors that influence pollutant transformation in the presence of ferric (oxyhydr)oxides is crucial to the efficient application of different remediation strategies. In this study we determined the effect of goethite, hematite, magnetite and ferrihydrite on the transformation of 2,4,6-trinitrotoluene (TNT) by Yarrowia lipolytica AN-L15. The presence of ferric (oxyhydr)oxides led to a small decrease in the rate of TNT removal. In all cases, a significant release of NO2 − fro...

  10. Theoretical Study on the Structures and Electronic Spectra of the Derivatives of C60-P-2,4,6-Triphenyl Borazinc

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    The structures and electronic spectra of the derivatives of C6o-P-2,4,6-triphenyl borazinc have been studied by using AM1 method. The calculated results indicate that this kind of compounds has a lower energy difference between HOMO and LUMO. It is found that the electron cloud on unoccupied frontier orbital mainly comes from the contribution of C6o, while that on occupied frontier orbital mainly concentrates on the side chain. A long-lived charge-separated state may occur in the objective compounds.

  11. Template synthesis, characterization and antimicrobial activity of the complex combinations of some transitional metals with isonicotinoylhydrazone -2,4,6- trimethylbenzaldehyde

    International Nuclear Information System (INIS)

    The complexes of Cu(II), Ni(II), Co(II), Mn(II), and Zn(II) with isonicotinoyl-hydrazone -2,4,6-trimethylbenzaldehyde (INHTB) are reported. The complexes have been characterized by analytical data, IR, UV-Vis, NMR spectra, magnetic susceptibility, thermal analysis and for the Cu(II) complex the ESR spectrum has been recorded. The anti-bacterial activity of these complexes were investigated against Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Salmonella enteritidis, Shigella flexneri bacteria. The INHTB ligand is coordinated at the metallic ions by oxygen amide (O=C) and the azomethine nitrogen. (author)

  12. Highly efficient and easy synthesis of 2,4,6-triarylpyridines catalyzed by pentafluorophenylammonium triflate (PFPAT) as a new recyclable solid acid catalyst in solvent-free conditions

    Institute of Scientific and Technical Information of China (English)

    Naser Montazeri; Saber Mahjoob

    2012-01-01

    Pentafluorophenylammonium triflate (PFPAT) was found to be a highly efficient catalyst for the preparation of 2,4,6-triarylpyridines from the reaction of acetophenone derivatives,aromatic aldehydes and ammonium acetate.Present methodology offers several advantages,such as short reaction time,high yields,simple procedure with an easy work-up and the absence of any volatile and hazardous organic solvent.In addition,this catalytic system can act as an active,inexpensive,metal-free,recoverable and recyclable catalyst.

  13. Hexaaquabis[3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanido-κ2N3,O4]barium tetrahydrate

    Directory of Open Access Journals (Sweden)

    Nguyen Dinh Do

    2013-11-01

    Full Text Available In the title compound, [Ba(C7H5N2O52(H2O6]·4H2O, the Ba2+ cation lies on a twofold rotation axis and is ten-coordinated by two 3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanide oxo O atoms [Ba—O = 2.8715 (17 Å], two hydroxyimino N atoms [Ba—N = 3.036 (2 Å], and six water molecules [Ba—O = 2.847 (2, 2.848 (2, and 2.880 (2 Å]. The 3,5-bis(hydroxyimino-1-methyl-2,4,6-trioxocyclohexanide monoanions act in a bidentate chelating manner, coordinating through an N atom of the non-deprotonated hydroxyimino group and an O atom of the neighboring oxo group. Two lattice water molecules are located in the cavities of the framework and are involved in hydrogen bonding to O atoms of one of the coordinating water molecules and the O atom of a keto group of the ligand. As a result, a three-dimensional network is formed.

  14. Thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine – Synthesis, structure and luminescence properties

    International Nuclear Information System (INIS)

    Two new thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized and characterized. The resulted complexes [Cd(SCN)(NO3)(tptz)(H2O)] (1) and [Cd(SCN)2(tptz)(MeOH)] (2) were studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. The luminescent properties of 1 and 2 were studied in solution and solid state and compared with the free ligand. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(SCN)(NO3)(tptz)(H2O)] and [Cd(SCN)2(tptz)(MeOH)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. - Highlights: • Two novel thiocyanate cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TD-DFT level employing B3LYP/LANL2DZ

  15. Thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine – Synthesis, structure and luminescence properties

    Energy Technology Data Exchange (ETDEWEB)

    Nawrot, I. [Department of Crystallography, Institute of Chemistry, University of Silesia, ul. Szkolna 9, 40-006 Katowice (Poland); Machura, B., E-mail: basia@ich.us.edu.pl [Department of Crystallography, Institute of Chemistry, University of Silesia, ul. Szkolna 9, 40-006 Katowice (Poland); Kruszynski, R., E-mail: rafal.kruszynski@p.lodz.pl [Department of X-ray Crystallography and Crystal Chemistry, Institute of General and Ecological Chemistry, Lodz University of Technology, ul. Żeromskiego 116, 90-924 Łódź (Poland)

    2014-12-15

    Two new thiocyanate cadmium(II) complexes of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized and characterized. The resulted complexes [Cd(SCN)(NO{sub 3})(tptz)(H{sub 2}O)] (1) and [Cd(SCN){sub 2}(tptz)(MeOH)] (2) were studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. The luminescent properties of 1 and 2 were studied in solution and solid state and compared with the free ligand. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(SCN)(NO{sub 3})(tptz)(H{sub 2}O)] and [Cd(SCN){sub 2}(tptz)(MeOH)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. - Highlights: • Two novel thiocyanate cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TD-DFT level employing B3LYP/LANL2DZ.

  16. Structural and Catalytic Differences between Two FADH2-Dependent Monooxygenases: 2,4,5-TCP 4-Monooxygenase (TftD) from Burkholderia cepacia AC1100 and 2,4,6-TCP 4-Monooxygenase (TcpA) from Cupriavidus necator JMP134

    OpenAIRE

    ChulHee Kang; Luying Xun; Andrew Popchock; Arun Kumar Subramanian; Webb, Brian N.; Robert P. Hayes; Mark Nissen

    2012-01-01

    2,4,5-TCP 4-monooxygenase (TftD) and 2,4,6-TCP 4-monooxygenase (TcpA) have been discovered in the biodegradation of 2,4,5-trichlorophenol (2,4,5-TCP) and 2,4,6-trichlorophenol (2,4,6-TCP). TcpA and TftD belong to the reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenases and both use 2,4,6-TCP as a substrate; however, the two enzymes produce different end products. TftD catalyzes a typical monooxygenase reaction, while TcpA catalyzes a typical monooxygenas...

  17. Bis(2,4,6-triamino-1,3,5-triazin-1-ium) tris(pyridine-2,6-dicarboxylato)zirconate(IV) tetrahydrate

    OpenAIRE

    Faranak Manteghi; Hossein Aghabozorg; Shirin Daneshvar

    2008-01-01

    The title compound, (C3H7N6)2[Zr(C7H3NO4)3]·4H2O or (tataH)2[Zr(pydc)3]·4H2O (tata is 2,4,6-triamino-1,3,5-triazine and pydcH2 is pyridine-2,6-dicarboxylic acid), was obtained by reaction between pydcH2, tata and zirconyl chloride octahydrate in aqueous solution. In the structure, the ZrIV atom is nine-coordinated by three (pydc)2− groups, resulting in an anionic complex which is balanced by two (tataH)+ cations. One of the NH2 groups shows positional disorder, with site occup...

  18. Adhesive properties of some fluoropolymer binders with the insensitive explosive 1,3,5-triamino-2,4,6-trinitrobenzene (TATB).

    Science.gov (United States)

    Yeager, J D; Dattelbaum, A M; Orler, E B; Bahr, D F; Dattelbaum, D M

    2010-12-15

    Adhesion between binders and explosive crystals is of critical importance for the mechanical performance of plastic-bonded explosives (PBXs). The surface properties of several prospective binders have been determined from static advancing contact angle measurements. The surface energies have been used to calculate theoretical work of adhesion to 1,3,5-triamino-2,4,6-trinitrobenzene (TATB), a common insensitive high explosive. The fluorinated terpolymer Oxy-461™, and Kel-F™ chlorotrifluoroethylene-vinylidene fluoride copolymers show the greatest potential for wetting TATB surfaces, and should promote the best adhesion to TATB in PBX formulations. In general, none of the fluoropolymer binders investigated here exhibit markedly superior adhesion to TATB. Thus, bulk physical properties are likely to be more important when choosing a binder. PMID:20875644

  19. Synthesis of novel tripodal-benzimidazole from 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine: Structural, electrochemical and antimicrobial studies

    Energy Technology Data Exchange (ETDEWEB)

    Koc, Ziya Erdem, E-mail: zerdemkoc@gmail.com [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey); Bingol, Haluk; Saf, Ahmet O. [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey); Torlak, Emrah [Provincial Control Laboratory, Konya (Turkey); Coskun, Ahmet [Department of Chemistry, Faculty of Science, Selcuk University, 42031 Konya (Turkey)

    2010-11-15

    Four new tripodal-benzimidazole derivatives were synthesized by Schiff base reaction between 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine (TRIPOD) and different diamine derivatives. The structures of the obtained compounds were identified by FT-IR, {sup 1}H NMR, {sup 13}C NMR and UV-vis spectral data, thermal analysis and elemental analysis. Electrochemical behaviors of the compounds were studied by cyclic voltammetry in DMF including 0.1 M [NBu{sub 4}] [PF{sub 6}]. The voltammograms showed peaks having similar characteristics except tripodal-benzimidazole including -NO{sub 2} derivative. In addition, their antimicrobial activities were evaluated by using the standard disk diffusion method in dimethylformamide media. The activities were determined against 4 bacteria cultures by comparing to those of gentamycin.

  20. Fluorescence-based Sensing of 2,4,6-Trinitrotoluene (TNT Using a Multi-channeled Poly(methyl methacrylate (PMMA Microimmunosensor

    Directory of Open Access Journals (Sweden)

    Anne W. Kusterbeck

    2010-01-01

    Full Text Available Fluorescence immunoassays employing monoclonal antibodies directed against the explosive 2,4,6-trinitrotoluene (TNT were conducted in a multi-channel microimmunosensor. The multi-channel microimmunosensor was prepared in poly (methyl methacrylate (PMMA via hot embossing from a brass molding tool. The multi-channeled microfluidic device was sol-gel coated to generate a siloxane surface that provided a scaffold for antibody immobilization. AlexaFluor-cadaverine-trinitrobenzene (AlexaFluor-Cad-TNB was used as the reporter molecule in a displacement immunoassay. The limit of detection was 1-10 ng/mL (ppb with a linear dynamic range that covered three orders of magnitude. In addition, antibody crossreactivity was investigated using hexahydro-1,3,5-triazine (RDX, HMX, 2,4-dinitrotoluene (DNT, 4-nitrotoluene (4-NT and 2-amino-4,6-DNT.

  1. Synthesis, characterization and evaluation of 1,2-bis(2,4,6-trinitrophenyl) hydrazine: a key precursor for the synthesis of high performance energetic materials.

    Science.gov (United States)

    Badgujar, D M; Talawar, M B; Harlapur, Sujata F; Asthana, S N; Mahulikar, P P

    2009-12-15

    1,2-Bis(2,4,6-trinitrophenyl) hydrazine (3) is one of the precursors in the synthesis of an important energetic material viz., hexanitrazobenzene. The simple and convenient lab scale synthesis of title compound (3) was carried out by the condensation of picryl chloride (2) with hydrazine hydrate at 30-50 degrees C in methanol based on the lines of scanty literature reports. Picryl chloride was synthesized by the reaction of picric acid (1) with phosphorous oxychloride based on the lines of reported method. The synthesized compound (3) was characterized by IR and 1H NMR spectral data. Some of the energetic properties of the synthesized compound have also been studied. The theoretically computed energetic properties of the title compound (3) indicated the superior performance in comparison to tetranitrodibenzo tetraazapentalene (TACOT) and hexanitrostilbene (HNS) in terms of velocity of detonation. PMID:19665292

  2. Fabrication of surface plasmon resonance sensor surface with control of the nonspecific adsorption and affinity for the detection of 2,4,6-trinitrotoluene using an antifouling copolymer

    Directory of Open Access Journals (Sweden)

    RuiYatabe

    2014-04-01

    Full Text Available We fabricated a surface plasmon resonance (SPR sensor using a hydrophilic polymer for the highly sensitive detection of 2,4,6-trinitrotoluene (TNT. The hydrophilic polymer was made from mono-2-(methacryloyloxyethylsuccinate (MES and 2-hydroxyethylmethacrylate (HEMA by surface-initiated atom transfer radical polymerization (SI-ATRP. The detection of TNT was carried out by displacement assay with the SPR measurement. In displacement assay, the affinity between anti-TNT antibody and the sensor surface, affects to the sensitivity. In the SPR measurement, nonspecific adsorption should be controlled because SPR sensor cannot discriminate between specific and nonspecific adsorption. Therefore, the affinity and nonspecific adsorption were controlled by changing the ratio of HEMA to MES. A detection limit of 0.4 ng/ml (ppb for TNT was achieved using a sensor surface with the lowest affinity without nonspecific adsorption.

  3. Magnetism of 1,3,5-trithia-2,4,6-triazapentalenyl (TTTA) and bis(hexafluoroacetylacetonato)copper(II) (Cu(hfac)2)

    International Nuclear Information System (INIS)

    An accurate full-potential density-functional method is used to study the mechanism of the origin of magnetism and the magnetic interactions in 1,3,5-Trithia-2,4,6-triazapentalenyl (TTTA) and Bis(hexafluoroacetylacetonato)copper(II) (Cu(hfac)2). The results revealed that the spontaneous magnetic moments for the TTTA.Cu(hfac)2 mainly come from Cu and N1 atoms, and the O1, O2, O3, O4 and N2, N3, S1, S2 atoms also contribute to the magnetism. In TTTA.Cu(hfac)2, there would be ferromagnetic interaction between the Cu(II) ion and the N1atom of TTTAA, and there exists antiferromagnetic interaction between the intramolecular organic ligands

  4. Synthesis of novel tripodal-benzimidazole from 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine: Structural, electrochemical and antimicrobial studies

    International Nuclear Information System (INIS)

    Four new tripodal-benzimidazole derivatives were synthesized by Schiff base reaction between 2,4,6-tris(p-formylphenoxy)-1,3,5-triazine (TRIPOD) and different diamine derivatives. The structures of the obtained compounds were identified by FT-IR, 1H NMR, 13C NMR and UV-vis spectral data, thermal analysis and elemental analysis. Electrochemical behaviors of the compounds were studied by cyclic voltammetry in DMF including 0.1 M [NBu4] [PF6]. The voltammograms showed peaks having similar characteristics except tripodal-benzimidazole including -NO2 derivative. In addition, their antimicrobial activities were evaluated by using the standard disk diffusion method in dimethylformamide media. The activities were determined against 4 bacteria cultures by comparing to those of gentamycin.

  5. Crystal structure of 4,4′,4′′-(1,3,5-triazine-2,4,6-triyltripyridinium trichloride 2.5-hydrate

    Directory of Open Access Journals (Sweden)

    Bo-Kai Ling

    2015-11-01

    Full Text Available The asymmetric unit of the title compound, C18H15N63+·3Cl−·2.5H2O, contains two independent (1,3,5-triazine-2,4,6-triyltripyridinium cations. Both cations are approximately planar, the r.m.s. deviations of fitted non-H atoms being 0.045 and 0.051 Å. In the crystal, extensive O—H...Cl, O—H...O, N—H...Cl and N—H...O hydrogen bonds and weak C—H...Cl and C—H...O interactions link the organic cations, Cl− anions and water molecules into a three-dimensional supramolecular architecture. π–π stacking between the pyridine rings of adjacent cations is also observed, the centroid-to-centroid distance being 3.7578 (8 Å.

  6. Elimination Reactions of (E)-2,4,6-Trinitrobenzaldehyde O-benzoyloximes Promoted by R2NH in MeCN. Change of Reaction Mechanism

    International Nuclear Information System (INIS)

    We have studied the nitrile-forming elimination reactions from 1 promoted by R2NH in MeCN. The reaction proceeded by (E1cb)irr mechanism. Change of the β-aryl group from 2,4-dinitrophenyl to a more strongly electron-withdrawing 2,4,6-trinitrophenyl increased the reaction rate by 470-fold, shifted the transition state toward more reactant-like, and changed the reaction mechanism from E2 to (E1cb)irr. To the best of our knowledge, this is the first example of nitrile-forming elimination reaction that proceeds by the (E1cb)irr mechanism in MeCN. Noteworthy is the carbanion stabilizing ability of the 2,4,6-trinitrophenyl group in aprotic solvent. Nitrile-forming elimination reactions of (E)-benzaldoxime derivatives have been extensively investigated under various conditions. The reactions proceeded by the E2 mechanism in MeCN despite the fact that the reactants have syn stereochemistry, poor leaving, and sp2 hybridized β-carbon atom, all of which favor E1cb- or E1cb-like transition state. Moreover, the transition state structures were relatively insensitive to the variation of the reactant structures. The results have been attributed to the poor anion solvating ability of MeCN, which favors E2 transition state with maximum charge dispersal. For eliminations from strongly activated (E)-2,4-(NO2)2C6H3CH=NOC(O)C6H4X, a change in the reaction mechanism from E2 to (E1cb)irr was observed as the base-solvent was changed from R2NH in MeCN to R2NH/R2NH2+ in 70 mol % MeCN(aq). A combination of a strong electron-withdrawing β-aryl group and anion-solvating protic solvent was required for the mechanistic change

  7. Preparation, Crystal Structure and Thermal Analyses of 1,5-Diamino-4-hydro-1,2,3,4-tetrazolium 3,5-Dihydroxy-2,4,6-trinitrophenolate

    Institute of Scientific and Technical Information of China (English)

    CUI Yan; ZHANG Tong-Lai; ZHANG Jian-Guo; HU Xiao-Chun; ZHANG Jin; HUANG Hui-Sheng

    2008-01-01

    A novel energetic salt 1,5-diamino-4-hydro-1,2,3,4-tetrazolium 3,5-dihydroxy-2,4,6-trinitrophenolate was synthesized by the reaction of 1,5-diamino-1,2,3,4-tetrazole (DAT) with 2,4,6-trinitro-1,3,5-trihydroxybenzene (trinitrophloroglucinol, TNPG). It was characterized by X-ray single crystal diffraction, elemental analysis, FT-IR spectroscopy and 1H NMR. The title compound crystallizes in monoclinic system, P2(1)/c space group with crystal parameters of a=1.3399(3) nm, b=0.47088(9) nm, c=2.0127(4) nm, β=92.83(3)°, V= 1.2684(4) nm3, Z=4. Hydrogen bonds, electrostatic interactions, and weak van der Waals' forces make the molecules form a stable threedimensional net structure. Mulliken charge distribution and overlap population of DAT and DATH+TNPG- in bulk state have been obtained from the density functional theory (DFT) with the B3LYP method employing the 6-31G**basis sets to interpret the reason why the protonation site of DAT is N(4) atom of the tetrazole ring. Thermal decomposition of the title compound was studied by using differential scanning calorimetry (DSC) and thermogravimetric analysis (TG) techniques. The high enthalpy change and leaving no solid residue after thermal decomposition indicate that the title compound can be used as a promising energetic material or gas-generating composition.The kinetic parameters of the exothermic process of DATH+TNPG- were studied by using Kissinger's and Ozawa-Doyle's methods and the Arrhenius equation of this process was obtained.

  8. Synthesis, structure and luminescence properties of cadmium(II) complexes with 2,4,6-tri(2-pyridyl)-1,3,5-triazine

    International Nuclear Information System (INIS)

    The paper presents a combined experimental and computational study for two cadmium(II) complexes [Cd(dca)(NO3)(tptz)(H2O)]·2H2O (1) and [Cd(dca)(OAc) (tptz)(H2O)]·2H2O (2) (tptz=2,4,6-tri(2-pyridyl)-1,3,5-triazine and dca=dicyanamide anion). The compounds have been studied by IR, UV–vis spectroscopy and single crystal X-ray analysis. Due to the presence of multidentate N-donor ligand, coordinated water molecule and nitrate or acetate groups together with the lattice water molecules their crystal structures are dominated by the hydrogen-bonding interactions that give rise to the supramolecular architectures. The luminescent properties of compounds 1 and 2 have been studied in solution and solid state and compared with the free ligand. The studies revealed that the fluorescence of tptz ligand and complexes 1 and 2 was concentration and solvent dependent. To get detailed insight into the electronic structure and spectroscopic properties of [Cd(dca)(NO3)(tptz)(H2O)] and [Cd(dca)(OAc) (tptz)(H2O)], the density functional theory (DFT) and time-dependent DFT (TD-DFT) calculations were performed. -- Highlights: • Two novel dicyanamide cadmium(II) compounds of 2,4,6-tri(2-pyridyl)-1,3,5-triazine were synthesized. • The compounds were identified by IR, UV–vis spectroscopy and X-ray analysis. • The fluorescence properties of the complexes were examined and compared with the free ligand. • The electronic spectra were investigated at the TDDFT level employing B3LYP/LANL2DZ

  9. Thermodynamics of extraction of plutonium(IV) and americium(III) in polyethylene glycol (PEG) and (NH4)2SO4 based aqueous biphasic system (ABS) using 18-crown-6

    International Nuclear Information System (INIS)

    Extraction of plutonium(IV) and americium(III) using PEG-2000/(NH4)2SO4 (40% w/w of each) aqueous biphasic system (ABS) with 18-crown-6 (18-C-6) was studied at four different temperatures in the range of 288 to 318 K. The species extracted are identified to be [Pu.2(18-C-6)](SO4)2 and [Am.2(18-C-6)](SO4)1.5 for Pu(IV) and Am(III), respectively, by the slope ratio method. The thermodynamic parameters evaluated at 298 K by the temperature coefficient approach show that the reaction is favoured by decrease of enthalpy and counteracted by decrease in entropy in the case of Pu(IV) as well as Am(III). The large decrease in the enthalpy observed indicates that there is direct bonding of crown ether to the central metal atom i.e. the formation of inner sphere complex for both Pu(IV) and Am(III) and is similar to that reported previously for Pu(VI). The order of equilibrium constant K and ΔG value is Pu(IV) > Pu(VI) > Am(III) and this is in accordance with the axial charge experienced by the incoming ligand. (orig.)

  10. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive; Utilizacao de metodos radioanaliticos para determinacao de isotopos de uranio, netunio, plutonio, americio e curio em rejeitos radioativos

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca

    2012-07-01

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  11. 1,3,5-Triazine-2,4,6-triyltrisulfamic acid (TTSA): A new organic solid acid for the nitrosation of secondary amines and oxidation of urazoles in the presence of NaNO2 under mild and heterogeneous conditions

    Indian Academy of Sciences (India)

    Gholamabbas Chehardoli; Mohammad Ali Zolfigol; Toktam Faal-Rastegar; Shadpour Mallakpour; Arash Ghorbani-Choghamarani

    2009-07-01

    Melamine reacted with chlorosufonic acid (ClSO3H) to form a new sulfamic-type acid, 1,3,5-triazine-2,4,6-triyltrisulfamic acid (TTSA). Both nitrosation of secondary amines and oxidation of urazoles were accomplished by using TTSA/NaNO2 system under mild and heterogeneous conditions with good to excellent yields.

  12. Molecular dynamics and first-principles studies of structural change in 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) in crystalline state under high pressure: Comparison of hydrogen bond systems of TATB versus 1,3-diamino-2,4,6-trinitrobenzene (DATB)

    Science.gov (United States)

    Kohno, Yuji; Mori, Kazuki; Hiyoshi, Reiko I.; Takahashi, Osamu; Ueda, Kazuyoshi

    2016-06-01

    Classical molecular dynamics (MD) calculations were performed to reveal the effect of high pressure on the crystal structure of 1,3,5-triamino-2,4,6-trinitrobenzene (TATB), an insensitive energetic material. The primary simulation cell consisted of 54 molecules in a triclinic cell, corresponding to 27 unit cells obtained by replicating the experimentally determined unit cell. Inter- and intra-molecular hydrogen bonds were maintained in the range of 1.0 atm to 20.0 GPa as pressure was incremented by 0.5 GPa. The pressure dependence of the interlayer distances (h1) and farthest intermolecular distance (d1) between nitro groups in the TATB crystal's unit cell was investigated in the same range. h1 decreased monotonously from 3.50 to 2.90 Å as pressure increased to 20.0 GPa. However, d1 increased considerably with pressure up to 4.0 GPa, most remarkably between 2.0 and 4.0 GPa. Thus, a unique structural change occurred in TATB crystal in this range. On the other hand, 1,3-diamino-2,4,6-trinitrobenzene (DATB) crystal showed a unique structural change between 7.0 and 8.0 GPa. These discrepancies are attributed to the different network systems of hydrogen bonding of these two molecules. To validate the MD calculation results, we conducted first-principles calculations. MD and first-principles calculations showed good agreement with previous experimental results.

  13. A facile synthesis of highly luminescent nitrogen-doped graphene quantum dots for the detection of 2,4,6-trinitrophenol in aqueous solution

    Science.gov (United States)

    Lin, Liping; Rong, Mingcong; Lu, Sisi; Song, Xinhong; Zhong, Yunxin; Yan, Jiawei; Wang, Yiru; Chen, Xi

    2015-01-01

    A facile bottom-up method for the synthesis of highly fluorescent nitrogen-doped graphene quantum dots (N-GQDs) has been developed via a one-step pyrolysis of citric acid and tris(hydroxymethyl)aminomethane. The obtained N-GQDs emitted strong blue fluorescence under 365 nm UV light excitation with a high quantum yield of 59.2%. They displayed excitation-independent behavior, high resistance to photobleaching and high ionic strength. In addition to the good linear relationship between the fluorescence intensity of the N-GQDs and pH in the range 2-7, the fluorescence intensity of the N-GQDs could be greatly quenched by the addition of a small amount of 2,4,6-trinitrophenol (TNP). A sensitive approach has been developed for the detection of TNP with a detection limit of 0.30 μM, and a linearity ranging from 1 to 60 μM TNP could be obtained. The approach was highly selective and suitable for TNP analysis in natural water samples.A facile bottom-up method for the synthesis of highly fluorescent nitrogen-doped graphene quantum dots (N-GQDs) has been developed via a one-step pyrolysis of citric acid and tris(hydroxymethyl)aminomethane. The obtained N-GQDs emitted strong blue fluorescence under 365 nm UV light excitation with a high quantum yield of 59.2%. They displayed excitation-independent behavior, high resistance to photobleaching and high ionic strength. In addition to the good linear relationship between the fluorescence intensity of the N-GQDs and pH in the range 2-7, the fluorescence intensity of the N-GQDs could be greatly quenched by the addition of a small amount of 2,4,6-trinitrophenol (TNP). A sensitive approach has been developed for the detection of TNP with a detection limit of 0.30 μM, and a linearity ranging from 1 to 60 μM TNP could be obtained. The approach was highly selective and suitable for TNP analysis in natural water samples. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06365a

  14. Solubility and speciation studies of waste radionuclides pertinent to geologic disposal at Yucca Mountain: Results on neptunium, plutonium and americium in J-13 groundwater; Letter report (R707): Reporting period, October 1, 1985--September 30, 1987

    Energy Technology Data Exchange (ETDEWEB)

    Nitsche, H.; Standifer, E.M.; Lee, S.C.; Gatti, R.C.; Tucker, D.B.

    1988-01-01

    We have studied the solubilities of neptunium, plutonium, and americium in J-13 groundwater from Yucca Mountain (Nevada) at three temperatures and hydrogen ion concentrations. They are 25{degree}, 60{degree}C, and 90{degree}C and pH 5.9, 7.0, and 8.5. The results for 25{degree}C are from a study which we did during FY 1984. We included these previous results in the tables to give more information on the solubility temperature dependence; they were, however, done at only one pH (7.0). The solubilities were studied from oversaturation. The nuclides were added at the beginning of each experiment as NpO{sub 2}{sup +}, Pu{sup 4+}, and Am{sup 3+}. The neptunium solubility decreased with increasing temperature and with increasing pH. The soluble neptunium did not change oxidation state at steady state. The pentavalent neptunium was increasingly complexed by carbonate with increasing pH. All solids were crystalline and contained carbonate, except the solid formed at 90{degree}C and pH 5.9. We identified this solid as crystalline Np{sub 2}P{sub 5}. The 25{degree}C, pH 7 solid was Na{sub 3}NpO{sub 2}(CO{sub 3}){sub 2} {center_dot} nH{sub 2}O. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. Pu(V) and Pu(VI) were the dominant oxidation states in the supernatant solution; as the amount of Pu(V) increased with pH, Pu(VI) decreed. The steady-state solids were mostly amorphous, although some contained a crystalline component. They contained Pu(IV) polymer and unknown carbonates.

  15. Anti-leukaemic effects induced by APR-246 are dependent on induction of oxidative stress and the NFE2L2/HMOX1 axis that can be targeted by PI3K and mTOR inhibitors in acute myeloid leukaemia cells.

    Science.gov (United States)

    Ali, Dina; Mohammad, Dara K; Mujahed, Huthayfa; Jonson-Videsäter, Kerstin; Nore, Beston; Paul, Christer; Lehmann, Sören

    2016-07-01

    The small molecule APR-246 (PRIMA-1(MET) ) is a novel drug that restores the activity of mutated and unfolded TP53 protein. However, the mechanisms of action and potential off-target effects are not fully understood. Gene expression profiling in TP53 mutant KMB3 acute myeloid leukaemia (AML) cells showed that genes which protected cells from oxidative stress to be the most up-regulated. APR-246 exposure also induced reactive oxygen species (ROS) formation and depleted glutathione in AML cells. The genes most up-regulated by APR-246, confirmed by quantitative real time polymerase chain reaction, were heme oxygenase-1 (HMOX1, also termed HO-1), SLC7A11 and RIT1. Up-regulation of HMOX1, a key regulator of cellular response to ROS, was independent of TP53 mutational status. NFE2L2 (also termed Nrf2), a master regulator of HMOX1 expression, showed transcriptional up-regulation and nuclear translocation by APR-246. Down-regulation of NFE2L2 by siRNA in AML cells significantly increased the antitumoural effects of APR-246. The PI3K inhibitor wortmannin and the mTOR inhibitor rapamycin inhibited APR-246-induced nuclear translocation of NFE2L2 and counteracted the protective cellular responses to APR-246, resulting in synergistic cell killing together with APR-246. In conclusion, ROS induction is important for antileukaemic activities of APR-246 and inhibiting the protective response of the Nrf-2/HMOX1 axis using PI3K inhibitors, enhances the antileukaemic effects. PMID:26991755

  16. Stand-off imaging Raman spectroscopy for forensic analysis of post-blast scenes: trace detection of ammonium nitrate and 2,4,6-trinitrotoluene

    Science.gov (United States)

    Ceco, Ema; Önnerud, Hans; Menning, Dennis; Gilljam, John L.; Bââth, Petra; Östmark, Henric

    2014-05-01

    The following paper presents a realistic forensic capability test of an imaging Raman spectroscopy based demonstrator system, developed at FOI, the Swedish Defence Research Agency. The system uses a 532 nm laser to irradiate a surface of 25×25mm. The backscattered radiation from the surface is collected by an 8" telescope with subsequent optical system, and is finally imaged onto an ICCD camera. We present here an explosives trace analysis study of samples collected from a realistic scenario after a detonation. A left-behind 5 kg IED, based on ammonium nitrate with a TNT (2,4,6-trinitrotoluene) booster, was detonated in a plastic garbage bin. Aluminum sample plates were mounted vertically on a holder approximately 6 m from the point of detonation. Minutes after the detonation, the samples were analyzed with stand-off imaging Raman spectroscopy from a distance of 10 m. Trace amounts could be detected from the secondary explosive (ammonium nitrate with an analysis time of 1 min. Measurement results also indicated detection of residues from the booster (TNT). The sample plates were subsequently swabbed and analyzed with HPLC and GC-MS analyses to confirm the results from the stand-off imaging Raman system. The presented findings indicate that it is possible to determine the type of explosive used in an IED from a distance, within minutes after the attack, and without tampering with physical evidence at the crime scene.

  17. Impaired epithelial differentiation of induced pluripotent stem cells from ectodermal dysplasia-related patients is rescued by the small compound APR-246/PRIMA-1MET.

    Science.gov (United States)

    Shalom-Feuerstein, Ruby; Serror, Laura; Aberdam, Edith; Müller, Franz-Josef; van Bokhoven, Hans; Wiman, Klas G; Zhou, Huiqing; Aberdam, Daniel; Petit, Isabelle

    2013-02-01

    Ectodermal dysplasia is a group of congenital syndromes affecting a variety of ectodermal derivatives. Among them, ectrodactyly, ectodermal dysplasia, and cleft lip/palate (EEC) syndrome is caused by single point mutations in the p63 gene, which controls epidermal development and homeostasis. Phenotypic defects of the EEC syndrome include skin defects and limbal stem-cell deficiency. In this study, we designed a unique cellular model that recapitulated major embryonic defects related to EEC. Fibroblasts from healthy donors and EEC patients carrying two different point mutations in the DNA binding domain of p63 were reprogrammed into induced pluripotent stem cell (iPSC) lines. EEC-iPSC from both patients showed early ectodermal commitment into K18(+) cells but failed to further differentiate into K14(+) cells (epidermis/limbus) or K3/K12(+) cells (corneal epithelium). APR-246 (PRIMA-1(MET)), a small compound that restores functionality of mutant p53 in human tumor cells, could revert corneal epithelial lineage commitment and reinstate a normal p63-related signaling pathway. This study illustrates the relevance of iPSC for p63 related disorders and paves the way for future therapy of EEC. PMID:23355677

  18. Fluorescent Detection of 2,4-DNT and 2,4,6-TNT in Aqueous Media by Using Simple Water-Soluble Pyrene Derivatives.

    Science.gov (United States)

    Kovalev, Igor S; Taniya, Olga S; Slovesnova, Nataliya V; Kim, Grigory A; Santra, Sougata; Zyryanov, Grigory V; Kopchuk, Dmitry S; Majee, Adinath; Charushin, Valery N; Chupakhin, Oleg N

    2016-03-01

    Pyrene-containing water-soluble probes for the fluorescent detection of nitroaromatic compounds (NACs), such as explosive components (2,4-DNT and 2,4,6-TNT) and herbicides (2,4-dinitrocresol, 2,4-DNOC), in aqueous media are reported. In the probes, the introduction of surface-active hydrophilic "heads" at the periphery of lipophilic (i.e., hydrophobic) pyrene "tails" resulted in the formation of highly fluorescent micelle-like aggregates/pre-associates in aqueous solutions at concentrations of ≤10(-5)  m. The enhanced fluorescence quenching of the herein reported architectures is achieved in the presence of ultra-trace amounts of TNT or 2,4-DNT with values of Stern-Volmer quenching constant close to 1×10(5)  m(-1) and a detection limit as low as 182 ppb. The most hydrophilic probes demonstrated higher response to 2,4-DNT over TNT. Filter paper test strips impregnated with 1×10(-5)  m solutions of the probes were able to detect TNT, 2,4-DNT, and other NACs at levels as low as 50 ppb in water. PMID:26757403

  19. Bis[1,3-bis(2,4,6-trimethylphenyl-2,3-dihydro-1H-imidazol-2-ylidene]dichloridodinitrosyltungsten(II tetrahydrofuran-d8 monosolvate

    Directory of Open Access Journals (Sweden)

    Heinz Berke

    2011-01-01

    Full Text Available The molecular structure of the title compound, [WCl2(NO2(C21H24N22]·C4D8O, displays a distorted octahedral arrangement around the W atom with two trans 1,3-bis(2,4,6-trimethylphenylimidazol-2-ylidene (IMes carbene ligands in axial positions. The four equatorial positions are occupied by nitrosyl and chloride ligands, which are trans to each other. The Ccarbene—W—Ccarbene bond angle of 173.44 (18° and the Cl—W—Nnitrosyl bond angles of 171.34 (11 and 171.32 (13° deviate only slightly from linearity. The distortion comes from the nitrosyl and chloride ligands which are not fully coplanar since the two N atoms deviate from the WCl2 plane by −0.279 (4 and 0.272 (4 Å, respectively. An intermolecular C—H...O interaction connects the organometallic molecule and the tetrahydrofuran-d8 solvent molecule.

  20. Tracing the Cycling and Fate of the Explosive 2,4,6-Trinitrotoluene in Coastal Marine Systems with a Stable Isotopic Tracer, (15)N-[TNT].

    Science.gov (United States)

    Smith, Richard W; Vlahos, Penny; Böhlke, J K; Ariyarathna, Thivanka; Ballentine, Mark; Cooper, Christopher; Fallis, Stephen; Groshens, Thomas J; Tobias, Craig

    2015-10-20

    2,4,6-Trinitrotoluene (TNT) has been used as a military explosive for over a hundred years. Contamination concerns have arisen as a result of manufacturing and use on a large scale; however, despite decades of work addressing TNT contamination in the environment, its fate in marine ecosystems is not fully resolved. Here we examine the cycling and fate of TNT in the coastal marine systems by spiking a marine mesocosm containing seawater, sediments, and macrobiota with isotopically labeled TNT ((15)N-[TNT]), simultaneously monitoring removal, transformation, mineralization, sorption, and biological uptake over a period of 16 days. TNT degradation was rapid, and we observed accumulation of reduced transformation products dissolved in the water column and in pore waters, sorbed to sediments and suspended particulate matter (SPM), and in the tissues of macrobiota. Bulk δ(15)N analysis of sediments, SPM, and tissues revealed large quantities of (15)N beyond that accounted for in identifiable derivatives. TNT-derived N was also found in the dissolved inorganic N (DIN) pool. Using multivariate statistical analysis and a (15)N mass balance approach, we identify the major transformation pathways of TNT, including the deamination of reduced TNT derivatives, potentially promoted by sorption to SPM and oxic surface sediments. PMID:26375037