
Sample records for americium 243 target

  1. Monte Carlo modeling of spallation targets containing uranium and americium

    International Nuclear Information System (INIS)

    Neutron production and transport in spallation targets made of uranium and americium are studied with a Geant4-based code MCADS (Monte Carlo model for Accelerator Driven Systems). A good agreement of MCADS results with experimental data on neutron- and proton-induced reactions on 241Am and 243Am nuclei allows to use this model for simulations with extended Am targets. It was demonstrated that MCADS model can be used for calculating the values of critical mass for 233,235U, 237Np, 239Pu and 241Am. Several geometry options and material compositions (U, U + Am, Am, Am2O3) are considered for spallation targets to be used in Accelerator Driven Systems. All considered options operate as deep subcritical targets having neutron multiplication factor of k∼0.5. It is found that more than 4 kg of Am can be burned in one spallation target during the first year of operation

  2. Americium incineration by recycling in target rods using coated particles

    International Nuclear Information System (INIS)

    This paper proposes a type of target rod based on the use of coated particles, for an efficient incineration of americium in nuclear reactors. The analysis takes advantage of the experience gained in the past from long duration irradiation without damage of coated particles with plutonium oxide kernels. A conservative theoretical evaluation of the gas pressure inside the coated particles at the end of irradiation allows comparing the well known conditions of the plutonium oxide particles which were successfully irradiated to high burn-up, with a preliminary design of americium oxide particles. (authors)

  3. Recycling heterogeneous americium targets in a boiling water reactor

    International Nuclear Information System (INIS)

    One of the limiting contributors to the heat load constraint for a long term spent fuel repository is the decay of americium-241. A possible option to reduce the heat load produced by Am-241 is to eliminate it via transmutation in a light water reactor thermal neutron environment, in particular, by taking advantage of the large thermal fission cross section of Am-242 and Am-242m. In this study we employ lattice loading optimization techniques to define the loadings and arrangements of fuel pins with blended americium and uranium oxide in boiling water reactor bundles, specifically, by defining the incineration of pre-loaded americium as an objective function to maximize americium transmutation. Subsequently, the viability of these optimized lattices is tested by assembling them into bundles with Am-spiked fuel pins and by loading these bundles into realistic three-dimensional BWR core-wide simulations that model multiple reload cycles and observe standard operational constraints. These simulations are possible via our collaboration with the Westinghouse Electric Co. which facilitates the use of industrial-caliber design tools such as the PHOENIX-4/POLCA-7 sequence and the Core Master 2 GUI work environment for fuel management. The resulting analysis confirms the ability to axially uniformly eliminating roughly 90% of the pre-loaded inventory of recycled Am-241 in BWR bundles with heterogeneous target pins. This high level of incineration was achieved within three to four 18-month operational cycles, which is equivalent to a typical in-core residence time of a BWR bundle.

  4. Preparation of americium targets for nuclear chemistry experiments at DANCE

    International Nuclear Information System (INIS)

    Using 1 gram of 241Am from LANL stocks, the purification steps required to obtain a solution of 241Am from the original material are described. Part of the purified solution was submitted for purity analysis by mass spectrometry, radiochemistry and trace metals analysis. The impurities were expected to be 239Pu and 237Np. A second fraction of this material was used for electroplating three samples onto titanium disks that were suitable for insertion into an instrument package to be placed into the DANCE detector. The purification methods used, the electroplating setup and the solutions to various problems that were encountered in making these targets are discussed. The analytical results are discussed as well as the yields from the electrodeposition process. Comparison of these yields with those from similar experiments utilizing 235U and 243Am are also discussed. (author)

  5. Production of americium isotopes in France

    International Nuclear Information System (INIS)

    The program of productions of americium 241 and 243 isotopes is based respectively on the retreatment of aged plutonium alloys or plutonium dioxide and on the treatment of plutonium targets irradiated either in CELESTIN reactors for Pu-Al alloys or OSIRIS reactor for plutonium 242 dioxide. All the operations, including americium final purifications, are carried out in hot cells equipped with remote manipulators. The chemical processes are based on the use of extraction chromatography with hydrophobic SiO2 impregnated with extracting agents. Plutonium targets and aged plutonium alloys are dissolved in nitric acid using conventional techniques while plutonium dioxide dissolutions are performed routine at 300 grams scale with electrogenerated silver II in 4M HNO3 at room temperature. The separation between plutonium and americium is performed by extraction of Pu(IV) either on TBP/SiO2 or TOAHNO3/SiO2 column. Americium recovery from waste streams rid of plutonium is realized by chromatographic extraction of Am(III) using mainly TBP and episodically DHDECMP as extractant. The final purification of both americium isotopes uses the selective extraction of Am(VI) on HDDiBMP/SiO2 column at 60 grams scale. Using the overall process a total amount of 1000 grams of americium 241 and 100 grams of americium 243 has been produced nowadays and the AmO2 final product indicates a purity better than 98.5%

  6. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  7. Preparation and high intensity heavy ion irradiation tests of intermetallic 243Am/Pd targets

    International Nuclear Information System (INIS)

    Previously reported preparation method for Pd-based intermetallic targets (Usoltsev, et al., 2012) [1] has been successfully applied for producing two stationary 243Am/Pd targets. Both targets have been irradiated at the U-400 cyclotron at Flerov Laboratory of Nuclear Reactions Dubna (Russian Federation) using high intensity beams (up to 0.83 μApart) of 48Ca18+. Alpha-particle spectroscopy and light microscopy allowed for a comprehensive characterization of the intermetallic targets before and after irradiation. A natNd/Pd intermetallic target and a solely electroplated 243Am/Ti target were similarly investigated for comparison

  8. Inert matrices, uranium-free plutonium fuels and americium targets. Synthesis of CAPRA, SPIN and EFTTRA studies

    International Nuclear Information System (INIS)

    A first selection of inert-matrix materials, actinide support alone (Pu and Am based), and compound materials, U free plutonium burning fuels and heterogeneous americium targets are discussed. Basic properties, fabrication, and reprocessing studies, European in-pile and out-of-pile tests, performed recently in the framework of CAPRA, SPIN and EFTTRA programs, are reviewed here. Taking into account these studies and on the bases of the different requirements to be met in each of the fuels and targets, a number of materials have been selected as 'promising candidates'. Trends for further research on these materials are established. (author)

  9. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  10. Transuranium element production. II. Chemical processing of targets

    International Nuclear Information System (INIS)

    The chemical processing described concerns small experimental targets irradiated in OSIRIS or EL-III and industrial targets irradiated in the CELESTIN reactors. In view of the difficulties encountered when processing highly irradiated targets ( by liquid-liquid extraction (interface sludges leading to stable emulsion) the new processes developed are based on inverse phase chromatography. This technique applied to targets of americium 241, plutonium 239 and a plutonium mixture rich in isotope 242 has given tens of milligrams of curium 242, grams of americium 243 and curium 244 and micrograms of californium 252

  11. Americium recovery from reduction residues (United States)

    Conner, W.V.; Proctor, S.G.


    A process for separation and recovery of americium values from container or bomb'' reduction residues comprising dissolving the residues in a suitable acid, adjusting the hydrogen ion concentration to a desired level by adding a base, precipitating the americium as americium oxalate by adding oxalic acid, digesting the solution, separating the precipitate, and thereafter calcining the americium oxalate precipitate to form americium oxide. (Official Gazette)

  12. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  13. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions

    International Nuclear Information System (INIS)

    Transmutation and incineration are innovative options in the management and disposal of fission products and actinides. nevertheless, the fabrication of targets for transmutation and incineration of actinides and fission products require a reconsideration of conventional processes (mechanical blending) and the development of new procedures compatible with the high activity of these materials. This work presents th R and D of a new fabrication method called INRAM (Infiltration of Radioactive Materials) based on the infiltration of an actinide solution in a porous non radiotoxic material in the form of a pellet (up to 12% An), or beads (up to 40% An) produced by sol-gel. The first method have been used for the fabrication of spinel (MgAl2O4) targets containing 11% Am, which have been irradiated in HFR-Petten (358.4 full power days). Post-test burn-up calculations showed that at the end of the irradiation the initial Am-241 concentration was reduced to 4%. The fraction of the initial americum atoms that have been fissioned is 28%. The main advantage of the INRAM method is that matrices with low or zero activity can be fabricated and formed into the required shape in an unshielded facility. This method offers other advantages over conventional ones, such as the active wastes are reduced, is easy to automate, adoptable to telemanipulation and dust free, which facilitate operator intervention and minimise radiation exposure to the personal. In addition, the infiltrant needs only be present in liquid form, i. e. it could be transferred directly from the reprocessing plant for fabrication into targets without conversion into-solid form. In order to optimise the infiltration process in depth investigations of all important process parameters, e. g. infiltration kinetics and metal (pu, Am) concentration in the feed solution, and also on extensive study or powder metallurgy parameters for the preparation of high quality fuel pellets with a high density, have been made. In

  14. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.


    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  15. Placental transfer of americium and plutonium in mice

    International Nuclear Information System (INIS)

    Actinide element release to the environment and subsequent transfer through food chains to pregnant women may present a radiation hazard to fetuses in utero. To measure americium incorporation, four groups of pregnant mice were intravenously dosed with four concentrations of 243Am citrate in late pregnancy. Concentrations of 243Am in fetuses, placentas, and maternal femur, liver, carcass and pelt were determined 48 hr after injection. Doses were chosen so that the number of atoms of 243Am in each injected dose was equal to the number of atoms of 239Pu used in an earlier study of transplacental movement. Results indicate that, atom for atom, americium is incorporated into fetal tissue in lesser amounts (10-25 times) than is plutonium when intravenously administered to pregnant mice in equal atom amounts. Tissue analyses indicated that, at low dose levels, the average fraction of the dose incorporated into the fetuses decreased as the dose to the pregnant mouse was increased. A similar pattern was noted for placentas and maternal femurs. Data indicate that one must make extrapolations from low dose data only to make reasonable and realistic estimates of the transplacental movement and fetal incorporation of environmental levels of actinide elements in man and other species. (author)

  16. Americium-241 - ED 4308

    International Nuclear Information System (INIS)

    This sheet presents the characteristics of Americium-241, its origin, and its radio-physical and biological properties. It briefly describes its use in nuclear medicine. It indicates its dosimetric parameters for external exposure, cutaneous contamination, and internal exposure due to acute contamination or to chronic contamination. It indicates and comments the various exposure control techniques: ambient dose rate measurement, surface contamination measurement, atmosphere contamination. It addresses the means of protection: premise design, protection against external exposure and against internal exposure. It describes how areas are delimited and controlled within the premises: regulatory areas, controls to be performed. It addresses the personnel classification, training and medical survey. It addresses the issue of wastes and effluents. It briefly recalls the administrative procedures related to the authorization and declaration of possession and use of sealed and unsealed sources. It indicates regulatory aspects related to the road transport of Americium-241, describes what is to be done in case of incident or accident (for the different types of contamination or exposure)

  17. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)


    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  18. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  19. Science and Technology for Americium Transmutation

    International Nuclear Information System (INIS)

    Americium could be seen as the most troublesome element that is present in nuclear fuel. This thesis offers different points of view on the possibility of americium transmutation. The first point of view elaborates simulations of americium-bearing facilities, namely nuclear data, a popular computational code and modeling techniques. The second point of view is focused on practical usage of the simulations to examine upper limit of americium in a specific reactor

  20. Transmutation of Americium in Fast Neutron Facilities


    Zhang, Youpeng


    In this thesis, the feasibility to use a medium sized sodium cooled fast reactor fully loaded with MOX fuel for efficient transmutation of americium is investigated by simulating the safety performance of a BN600-type fast reactor loaded with different fractions of americium in the fuel, using the safety parameters obtained with the SERPENT Monte Carlo code. The focus is on americium mainly due to its long-term contribution to the radiotoxicity of spent nuclear fuel and its deterioration on c...

  1. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  2. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)


    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  3. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  4. Study of americium sorption by humic acids

    International Nuclear Information System (INIS)

    The results of investigation of influence of the cation content and acidity of soil solution on americium sorption by the humic acids have been shown. The most influence on the interphase distribution coefficient in the system 'humic acid - model soil solution' is caused by the presence of the iron (III), calcium ions and acidity of the solution. The increase of the sodium ions concentration in the solution makes an insignificant impact on the americium sorption. (Authors)

  5. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  6. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  7. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  8. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  9. Formation of americium and europium humate complexes

    International Nuclear Information System (INIS)

    Binding constants of americium and europium with a humic acid were determined to study if complex formation of trivalent actinide-humates affects dissolved species of the actinides in hydrosphere. The purified humic acid was characterized by means of UV-vis, IR, and pH titration, indicating high carboxylate capacity and low aromaticity. Binding constants of americium and europium humates were determined at pH 4.6 and 6.0 by solvent extraction using 241Am or 152Eu as a tracer. The binding constants for americium-humate obtained preliminarily suggest that complexes with humic acid are not negligible in speciation of trivalent actinides in hydrosphere. The obtained binding constants were nearly identical with those determined previously by the same procedures, but with humic acids of different origin and compositions. (author)

  10. 48 CFR 243.204 - Administration. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Administration. 243.204... OF DEFENSE CONTRACT MANAGEMENT CONTRACT MODIFICATIONS Change Orders 243.204 Administration. Follow the procedures at PGI 243.204 for administration of change orders....

  11. 40 CFR 243.204 - Collection management. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Collection management. 243.204 Section 243.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES... and Recommended Procedures § 243.204 Collection management....

  12. 7 CFR 58.243 - Checking quality. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Checking quality. 58.243 Section 58.243 Agriculture... Procedures § 58.243 Checking quality. All milk, milk products and dry milk products shall be subject to inspection and analysis by the dairy plant for quality and condition throughout each processing...

  13. 40 CFR 243.201 - Safety. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Safety. 243.201 Section 243.201 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE STORAGE... Procedures § 243.201 Safety....

  14. 46 CFR 169.243 - Electrical. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Electrical. 169.243 Section 169.243 Shipping COAST GUARD... Certification Inspections § 169.243 Electrical. At each inspection for certification and periodic inspection... that they are in proper operating condition, in safe electrical condition, and fit for the service...

  15. 33 CFR 117.243 - Nanticoke River. (United States)


    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Nanticoke River. 117.243 Section 117.243 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Delaware § 117.243 Nanticoke River. (a) The draw...

  16. Preparation of americium source for smoke detector

    International Nuclear Information System (INIS)

    This report describes the method developed for the preparation of 241Am source for smoke detector. Americium was electrodeposited from iso-propyl alcohol medium on silver backing. Thin layer of gold (few hundred micro gram thick) was plated on the americium source to make it safe for handling. The thickness of plated gold was such that the alpha radiations from the 241Am source could escape out of the gold layer and cause ionisation in the surrounding air. The performance of the prepared sources were checked in a smoke detector and was found to be satisfactory and comparable to the imported sources. (author). 1 refs., 2 figs., 1 tab

  17. Recovery of americium-241 from raffinates of plutonium purification columns

    International Nuclear Information System (INIS)

    Recovery and purification of americium from ion exchange raffinates generated during purification of aged plutonium is described. The method consists of the following stages: (i) co-precipitation of americium with kilogramme quantities of rare earth oxalates, (ii) destruction of oxalate and removal of residual plutonium from nitric acid medium using anion exchange process, (iii) preliminary separation of americium making use of its preferential uptake on an anion exchange column from thiocyanate medium and (iv) extraction of americium and remaining rare earths into di-(2-ethyl hexyl) phosphoric acid followed by preferential back washing of americium by lactic acid medium containing DTPA. (author)

  18. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  19. Americium separations from high salt solutions

    International Nuclear Information System (INIS)

    Americium (III) exhibits an unexpectedly high affinity for anion-exchange material from the high-salt evaporator bottoms solutions--an effect which has not been duplicated using simple salt solutions. Similar behavior is observed for its lanthanide homologue, Nd(III), in complex evaporator bottoms surrogate solutions. There appears to be no single controlling factor--acid concentration, total nitrate concentration or solution ionic strength--which accounts for the approximately 2-fold increase in retention of the trivalent ions from complex solutions relative to simple solutions. Calculation of species activities (i.e., water, proton and nitrate) in such concentrated mixed salt solutions is difficult and of questionable accuracy, but it is likely that the answer to forcing formation of anionic nitrate complexes of americium lies in the relative activities of water and nitrate. From a practical viewpoint, the modest americium removal needs (ca. 50--75%) from nitric acid evaporator bottoms allow sufficient latitude for the use of non-optimized conditions such as running existing columns filled with older, well-used Reillex HPQ. Newer materials, such as HPQ-100 and the experimental bifunctional resins, which exhibit higher distribution coefficients, would allow for either increased Am removal or the use of smaller columns. It is also of interest that one of the experimental neutral-donor solid-support extractants, DHDECMP, exhibits a similarly high level of americium (total alpha) removal from EV bottoms and is much less sensitive to total acid content than commercially-available material

  20. Decontaminaion of metals containing plutonium and americium

    International Nuclear Information System (INIS)

    Melt-slagging (melt-refining) techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7 x 106 were measured with boro-silicate slag and of 3 x 106 with calcium, magnesium silicate slag. Decontamination of metals containing as much as 14,000 ppM plutonium appears to be as efficient as for metals with plutonium levels of 400 ppM. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. The second extraction is effective with either resistance-furnace melting or electric-arc melting. Slag adhering to the metal ingots and in defects within the ingots is in the important contributors to plutonium retained in processed metals. If these sources of plutonium are controlled, the melt-refining process can be used on a large scale to convert highly contaminated metals to homogeneous and compact forms with very low concentrations of plutonium and americium. A conceptual design of a melt-refining process to decontaminate plutonium- and americium-contaminated metals is described. The process includes single-stage refining of contaminated metals to produce a metal product which would have less than 10 nCi/g of TRU-element contamination. Two plant sizes were considered. The smaller conceptual plant processes 77 kg of metal per 8-h period and may be portable.The larger one processes 140 kg of metal per 8-h period, is stationary, and may be near te maximum size that is practical for a metal decontamination process

  1. Status of Americium-241 recovery at Rocky Flats Plant

    International Nuclear Information System (INIS)

    This paper is presented in two parts: Part I, Molten Salt Extraction of Americium from Molten Plutonium Metal, and Part II, Aqueous Recovery of Americium from Extraction Salts. The Rocky Flats recovery process used for waste salts includes (1) dilute hydrochloric acid dissolution of residues; (2) cation exchange to convert from the chloride to the nitrate system and to remove gross amounts of monovalent impurities; (3) anion exchange separation of plutonium; (4) oxalate precipitation of americium; and (5) calcination of the oxalate at 6000C to yield americium oxide. The aqueous process portion describes attempts to improve the recovery of americium. The first part deals with modifications to the cation exchange step; the second describes development of a solvent extractions process that will recovery americium from residues containing aluminium as well as other common impurities. Results of laboratory work are described. 3 figures, 6 tables. (DP)

  2. Plutonium and americium in soil organic matter

    International Nuclear Information System (INIS)

    A gley soil from west Cumbria, with specific activities in its surface horizon of 5-10 kBq kg-1239,240Pu and comparable 241Am levels, has been used as a source of actinide-enriched organic fractions. Humic and fulvic acids were isolated by conventional alkali extraction and investigated by gel filtration, treatment with organic solvents and differential flocculation procedures. All these techniques are capable of resolving the organics into two or more fractions, with specific activities up to 80 kBq kg-239,240Pu. There is evidence for differentiation of plutonium and americium, with americium being concentrated, to some extent, in the lower molecular weight fractions from gel filtration. (author)

  3. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  4. 27 CFR 24.243 - Filtering aids. (United States)


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Filtering aids. 24.243... OF THE TREASURY LIQUORS WINE Storage, Treatment and Finishing of Wine § 24.243 Filtering aids. Inert fibers, pulps, earths, or similar materials, may be used as filtering aids in the cellar treatment...

  5. 37 CFR 2.43 - Service mark. (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Service mark. 2.43 Section 2... COMMERCE RULES OF PRACTICE IN TRADEMARK CASES The Written Application § 2.43 Service mark. In an application to register a service mark, the application shall specify and contain all the elements required...

  6. 7 CFR 1220.243 - Confidential treatment. (United States)


    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Confidential treatment. 1220.243 Section 1220.243 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... Confidential treatment. Except as otherwise provided in the Act, financial or commercial information that...

  7. Americium and curium heterogeneous transmutation in moderated S/ A in the framework of CNE scenarios studies

    International Nuclear Information System (INIS)

    This paper presents the transmutation of Americium and Curium in a heterogeneous mode in the framework of the 1991 French Law concerning waste management. Two scenarios with moderated targets are presented: a 100% frit reactor (EFR) scenario multi-recycling Pu+Np with targets of Am+Cm placed in core and a mixed PWR (UOX fuel) and fast reactor (50% of EFR) multi-recycling Pu+Np and containing targets in core and in the blanket region. The design of the target is based on classical fast fuel S/A technology (pins, spacer wires,...) and should reach the goal of 90% fission rate. (authors)

  8. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  9. Americium transfer studies using hollow fiber/extractant membranes

    International Nuclear Information System (INIS)

    Americium can be removed from low acid/high nitrate feeds using hollow fiber membrane modules. Americium can be concentrated in the stripping solution. (Maximum observed concentration was a factor of 3.1). Accurel hollow fibers are less prone to leakage problems

  10. Electronic structure of compressed americium metal

    Czech Academy of Sciences Publication Activity Database

    Kolorenč, Jindřich; Shick, Alexander; Caciuffo, R.

    Cambridge: Cambridge University Press,, 2012 - (Anderson, D.; Boot, C.; Burns, P.), s. 177-182. (Materials Research Society Symposium Proceedings. 1444). ISBN 978-1-60511-421-7. ISSN 0272-9172. [2012 MRS Spring Meeting. Sacramento (CA), 09.04.2012-13.04.2012] R&D Projects: GA ČR(CZ) GAP204/10/0330; GA AV ČR IAA100100912 Institutional research plan: CEZ:AV0Z10100520 Keywords : americium * X-ray spectroscopy * LDA+DMFT Subject RIV: BM - Solid Matter Physics ; Magnetism

  11. NMR Evidence for the 8.5 K Phase Transition in Americium Dioxide (United States)

    Tokunaga, Yo; Nishi, Tsuyoshi; Kambe, Shinsaku; Nakada, Masami; Itoh, Akinori; Homma, Yoshiya; Sakai, Hironori; Chudo, Hiroyuki


    We report here the first NMR study of americium dioxide (AmO2). More than 30 years ago, a phase transition was suggested to occur in this compound at 8.5 K based on magnetic susceptibility data, while no evidence had been obtained from microscopic measurements. We have prepared a powder sample of 243AmO2 containing 90 at. % 17O and have performed 17O NMR at temperatures ranging from 1.5 to 200 K. After a sudden drop of the 17O NMR signal intensity below 8.5 K, at 1.5 K we have observed an extremely broad spectrum covering a range of ˜14 kOe in applied field. These data provide the first microscopic evidence for a phase transition as a bulk property in this system. In addition, the 17O NMR spectrum has been found to split into two peaks in the paramagnetic state, an effect which has not been reported for actinide dioxides studied up to now. We suggest that the splitting is induced by self-radiation damage from the alpha decay of 243Am.

  12. Dicty_cDB: SLA243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA243 (Link to dictyBase) - G22368 DDB0187482 Contig-U03776-1 SLA...243Z (Link to Original site) - - SLA243Z 336 - - - - Show SLA243 Library SL (Link to library) Clone ID SLA...riginal site URL ...Representative seq. ID SLA243Z (Link to Original site) Representative DNA sequence >SLA243 (SLA243Q) /CSM/SL/SLA2-B/SLA...AGTTATTGGTGATACTTATATTGAAATTAA TTAAAAATTAATAATAAAAAAAAAAAAAAAAATTTTGTACAAATAA sequence update 1997. 5. 7 Transla

  13. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)


    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  14. Modelling of americium stripping in the EXAm process

    International Nuclear Information System (INIS)

    The EXAm process aims at recovering americium alone contained in the PUREX raffinate. The americium stripping model has been revised to take into account a change of stripping aqueous phase and up-to-date experimental results conducted within DRCP to improve knowledge about complexes. This work represents a first approximation at modelling americium stripping. The modelling work has led to synthesize the knowledge on chemical phenomenology and adopt assumptions that best reflect experimental results. The modelling has been implemented in PAREX code in order to simulate this step to prepare and understand tests to be carried out in mixer settlers. (authors)

  15. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    International Nuclear Information System (INIS)

    Highlights: • Dust free process for (U,Am)O2 transmutation target fabrication. • Synthesis of U0.9Am0.1O2 mixed oxide microspheres from ion exchange resin. • Fabrication of dense U0.9Am0.1O2 pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U0.9Am0.1O2±δ is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U0.9Am0.1O2±δ. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials

  16. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)


    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  17. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions; Fabricacion de blancos para la transmutacion de americio: sintesis de matrices inertes por el metodo sol-gel. Estudio del procedimiento de infiltracion de disoluciones radiactivas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Carretero, A. [Universidad Complutense de Madrid (Spain)


    Transmutation and incineration are innovative options in the management and disposal of fission products and actinides. nevertheless, the fabrication of targets for transmutation and incineration of actinides and fission products require a reconsideration of conventional processes (mechanical blending) and the development of new procedures compatible with the high activity of these materials. This work presents th R and D of a new fabrication method called INRAM (Infiltration of Radioactive Materials) based on the infiltration of an actinide solution in a porous non radiotoxic material in the form of a pellet (up to 12% An), or beads (up to 40% An) produced by sol-gel. The first method have been used for the fabrication of spinel (MgAl{sub 2}O{sub 4}) targets containing 11% Am, which have been irradiated in HFR-Petten (358.4 full power days). Post-test burn-up calculations showed that at the end of the irradiation the initial Am-241 concentration was reduced to 4%. The fraction of the initial americum atoms that have been fissioned is 28%. The main advantage of the INRAM method is that matrices with low or zero activity can be fabricated and formed into the required shape in an unshielded facility. This method offers other advantages over conventional ones, such as the active wastes are reduced, is easy to automate, adoptable to telemanipulation and dust free, which facilitate operator intervention and minimise radiation exposure to the personal. In addition, the infiltrant needs only be present in liquid form, i. e. it could be transferred directly from the reprocessing plant for fabrication into targets without conversion into-solid form. In order to optimise the infiltration process in depth investigations of all important process parameters, e. g. infiltration kinetics and metal (pu, Am) concentration in the feed solution, and also on extensive study or powder metallurgy parameters for the preparation of high quality fuel pellets with a high density, have been

  18. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  19. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.


    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  20. Americium/Curium Disposition Life Cycle Planning Study

    International Nuclear Information System (INIS)

    At the request of the Department of Energy Savannah River Office (DOE- SR), Westinghouse Savannah River Company (WSRC) evaluated concepts to complete disposition of Americium and Curium (Am/Cm) bearing materials currently located at the Savannah River Site (SRS)

  1. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  2. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  3. 1976 Hanford americium-exposure incident: external decontamination procedures

    International Nuclear Information System (INIS)

    An accident resulted in the deposition on an injured workman's skin surfaces, in acid-burned areas and in lacerations, of something in excess of 6 mCi americium-241. The external decontamination procedures used, the change in americium content of the skin during the course of treatment, and some of the unusual problems encountered from the extrusion of foreign material and flaking of skin and scar tissue are described

  4. Gas Well Blowout Kills 243 People

    Institute of Scientific and Technical Information of China (English)


    @@ At least 243 people have been killed and scores of others poisoned in a devastating blowout at a natural gas field in Southwest China's Chongqing municipality on December 24. The accident happened at the Chuandongbei gas field in Kaixian county of Chongqing municipality.

  5. Käibemaksu maksmine maksab 243 miljonit

    Index Scriptorium Estoniae


    Poliitikauuringute keskuse PRAXIS uurimus näitas, et Eesti ettevõtetel kulub käibemaksu administreerimisele ja seadustega kursis hoidmisele aastas kokku 243 miljonit krooni, mis võrdub 0,25% SKP-st. Tabel: Suurim kulu ettevõtetele on enda kursishoidmine käibemaksuküsimustes. Vt. samas: Kuidas PRAXIS halduskoormust hindas

  6. 28 CFR 2.43 - Early termination. (United States)


    ..., YOUTH OFFENDERS, AND JUVENILE DELINQUENTS United States Code Prisoners and Parolees § 2.43 Early... score in the very good risk category and has completed two continuous years of supervision free from an incident of new criminal behavior or serious parole violation; or (ii) Has a salient factor score in a...

  7. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept) (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.


    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  8. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  9. Complexation of americium with humic acid

    International Nuclear Information System (INIS)

    As a part of the interlaboratory comparison exercise for the complexation of humic acid and colloid generation (COCO-Club activities) in the CEC project MIRAGE-II, the complexation of americium with humic acid has been studied in our laboratory. Two humic acids were used for the study: Aldrich-HA(H+) which is a reference humic acid of the COCO-Club and Bradford-HA(H+) from Lake Bradford, Florida. A wide concentration range of humic acid and different ratios of Am to humic acid have been investigated between pH 5 and 6 with the ionic strength of 0.1 M and 1.0 M. The complexation has been studied by UV-spectroscopy, Laser-induced Photoacoustic Spectroscopy (LPAS) and ultrafiltration. LPAS is used for the submicromolar concentration range where the sensitivity of UV spectroscopy is not accessible. Ultrafiltration is used for low Am to humic acid ratios where both spectroscopic methods are not applicable. Varying the humic acid concentration over three orders of magnitude, only a 1:1 type of binding is observed. No significant variation of the stability constant is found in the investigated range of pH and ionic strength. However, the precipitation tendency and the loading capacity of humic acid are found to depend sensitively on pH and ionic strength. The complexation study provides a deep insight into the influence of humic acid on the migration behaviour of fission products and actinides in the geosphere. (orig.)

  10. Analysis of BWR lattices to recycle americium

    International Nuclear Information System (INIS)

    This study was carried out to assess the ability to eliminate meaningful quantities of americium in a primarily thermal neutron flux by 'spiking' modern BWR fuel with this minor actinide (MA). The studies carried out so far include the simulation of modern 10 x 10 BWR lattices employing the Westinghouse lattice physics code PHOENIX-4 alongside validation studies using MCNP5 models of the same lattices that were spatially depleted via the MONTEBURNS code coupling to ORIGEN. When considering the total inventory of minor actinides in Am-spiked pins, excluding isotopes of uranium and plutonium, the results indicate that a reduction of approximately 50% or more in the total mass inventory of these minor actinides is viable within the selected pins. Therefore, these preliminary results have encouraged the extension of this work to the development of improved lattice designs to help optimize the transmutation rates as well as absolute MA inventory reductions. The ultimate goal being to design batches of these advanced BWR bundles alongside multi-cycle core reload strategies. (authors)

  11. Dicty_cDB: CFH243 [Dicty_cDB

    Lifescience Database Archive (English)


  12. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  13. 12 CFR 24.3 - Public welfare investments. (United States)


    ... investment would receive consideration under 12 CFR 25.23 as a “qualified investment.” ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Public welfare investments. 24.3 Section 24.3... DEVELOPMENT ENTITIES, COMMUNITY DEVELOPMENT PROJECTS, AND OTHER PUBLIC WELFARE INVESTMENTS § 24.3...

  14. 26 CFR 1.243-5 - Effect of election. (United States)


    ... 26 Internal Revenue 3 2010-04-01 2010-04-01 false Effect of election. 1.243-5 Section 1.243-5...) INCOME TAXES Special Deductions for Corporations § 1.243-5 Effect of election. (a) General—(1) Corporations subject to restrictions and limitations. If an election by an affiliated group under section...

  15. 20 CFR 243.4 - Taxation of benefits. (United States)


    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Taxation of benefits. 243.4 Section 243.4 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT TRANSFER, ASSIGNMENT, OR WAIVER OF PAYMENTS § 243.4 Taxation of benefits. (a) Annuities paid by the Board are...

  16. Evaluation of neutron data for curium-243

    International Nuclear Information System (INIS)

    The evaluation of neutron data for 243Cm is made in the energy region from 10-5 eV up to 20 MeV. The results of the evaluation are compiled in the ENDF/B-VI format. This work is performed under the Project Agreement CIS-03-95 with the International Science and Technology Center (Moscow). The Financing Party for the Project is Japan. The evaluation was requested by Y. Kikuchi (JAERI). (author). 36 refs, figs and tabs

  17. A TRUEX-based separation of americium from the lanthanides

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher; Nicholas C. Schmitt; Mary E. Case


    Abstract: The inextractability of the actinide AnO2+ ions in the TRUEX process suggests the possibility of a separation of americium from the lanthanides using oxidation to Am(V). The only current method for the direct oxidation of americium to Am(V) in strongly acidic media is with sodium bismuthate. We prepared Am(V) over a wide range of nitric acid concentrations and investigated its solvent extraction behavior for comparison to europium. While a separation is achievable in principal, the presence of macro amounts of cerium competes for the sparingly soluble oxidant and the oxidant itself competes for CMPO complexation. These factors conspire to reduce the Eu/Am separation factor from ~40 using tracer solutions to ~5 for extractions from first cycle raffinate simulant solution. To separate pentavalent americium directly from the lanthanides using the TRUEX process, an alternative oxidizing agent will be necessary.

  18. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  19. Measurements of neutron cross section of the {sup 243}Am(n,{gamma}){sup 244}Am reaction

    Energy Technology Data Exchange (ETDEWEB)

    Hatsukawa, Yuichi; Shinohara, Nobuo; Hata, Kentaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment


    The effective thermal neutron cross section of {sup 243}Am(n,{gamma}){sup 244}Am reaction was measured by the activation method. Highly-purified {sup 243}Am target was irradiated in an aluminum capsule by using a research reactor JRR-3M. The tentative effective thermal neutron cross sections are 3.92 b, and 84.44 b for the production of {sup 244g}Am and {sup 244m}Am, respectively. (author)

  20. Uptake of americium-241 by algae and bacteria

    International Nuclear Information System (INIS)

    The uptake of americium by three algae, scenedesmus obliquus, selenastrum capricomutum and chlorella pyrenosdosa and a bacterium aeromonas hydrophila was studied. Live and fixed cells of each algal species and live bacterial cells were used. it is shown that algae and bacteria concentrate americium 241 to a high degree which makes them important links in the biomagnification phenomenon which may ultimately lead to a human hazard and be potentially important in recycling Am 241 in the water column and mobilization from sediments. Chemical fixation of algal cells caused increased uptake which indicated that uptake is by passive diffusion and probably due to chemical alteration of surface binding sites. (U.K.)

  1. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)


    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  2. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  3. Americium retention by the smectite hectorite

    International Nuclear Information System (INIS)

    Document available in extended abstract form only. Clay minerals may play an important role in a high level nuclear waste disposal site. Smectites may be major components of backfill material used to enhance the retention properties of engineered barriers. Furthermore, they have also been detected in the alteration layer of nuclear waste glass corroded in laboratory experiments. For example, the smectite hectorite (Na0.33[Mg2.67Li0.33Si4O10(OH)2]) was identified as phase forming upon waste matrix dissolution and subsequent reprecipitation. Smectites are known to be highly reactive with respect to cations in aqueous systems. Several distinct molecular scale binding mechanisms may operate, but the most effective retention may occur by incorporation in the bulk structure, especially if a (meta)stable solid solution forms. Investigations showed the possibility to incorporate Lu(III) in a clay-like octahedral site in hectorite by coprecipitation. Furthermore, luminescence studies on hectorite synthesized in the presence of Cm(III) or Eu(III) were consistent with an incorporation in the bulk structure. However, structural data such as coordination numbers and bond lengths are still missing for the actinides. In the present study, Am(III) was coprecipitated with and adsorbed on hectorite to decipher the actual retention mechanism(s). Hectorite was synthesized in the presence of Am(III) (sample AmCopHec) from an Am-containing brucite precursor phase. Briefly, brucite was freshly precipitated in the presence of Am(III) (Am:Mg molar ratio of 1:1175) and washed. The resulting sol was aged in a tightly closed vessel in the presence of LiF and silica sol for several days at 90 C. Separately, an Am-containing brucite phase (sample AmCopBru) was prepared under identical conditions as described above, and the americium aqua ions were adsorbed on hectorite (m/V = 2 g/L, [Am(III)]tot = 105 μmol/L, 0.5 mol/L NaClO4, pH = 6.4(1), sample AmSorbHec) and used as reference samples. X

  4. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  5. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)


    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  6. Dicty_cDB: VHP243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP243 (Link to dictyBase) - - - Contig-U16236-1 - (Link to Or...iginal site) VHP243F 134 - - - - - - Show VHP243 Library VH (Link to library) Clone ID VHP243 (Link to dicty...Base) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16236-1 Original site URL http://dictycdb.b...AXXXXXXXXXX sequence update 2002.10.25 Translated Amino Acid sequence CWPTGIXKTTICT...kilsif*ynfkyyqqpkkk--- Frame B: llaywyxqnnnlyqyyyyfyl*kyflsfniilniinnpkk--- Frame C: CWPTGIXKTTICTNTTIISICKN

  7. Liquid-liquid extraction separation and determination of plutonium and americium

    International Nuclear Information System (INIS)

    A procedure is described for the determination of plutonium and americium after their initial separation on barium sulfate. The barium sulfate is dissolved in perchloric acid and the antinides and lanthanides are extracted into bis(2-ethylhexyl)phosphoric acid (HDEHP). Americium along with other tervalent actinides and lanthanides is stripped from HDEHP with nitric acid. The lanthanides are removed on a column of HDEHP supported on Teflon powder, and the americium and other tervalent actinides are electrodeposited for their determination by α spectrometry. The plutonium is stripped with nitric acid after reduction to the tervalent state with 2,5-di-tert-butylhydroquinone and electrodeposited for α spectrometry. Decontamination factors for plutonium and americium from each other and from other α emitters are 104 to 105. Two hours are required for the liquid-liquid extraction separations of plutonium and americium from eight samples. Recoveries of americium and plutonium through the HDEHP separatons are 99% and 95%, respectively

  8. Calculational study on irradiation of americium fuel samples in the Petten High Flux Reactor

    International Nuclear Information System (INIS)

    A calculational study on the irradiation of americium samples in the Petten High Flux Reactor (HFR) has been performed. This has been done in the framework of the international EFTTRA cooperation. For several reasons the americium in the samples is supposed to be diluted with a neutron inert matrix, but the main reason is to limit the power density in the sample. The low americium nuclide density in the sample (10 weight % americium oxide) leads to a low radial dependence of the burnup. Three different calculational methods have been used to calculate the burnup in the americium sample: Two-dimensional calculations with WIMS-6, one-dimensional calculations with WIMS-6, and one-dimensional calculations with SCALE. The results of the different methods agree fairly well. It is concluded that the radiotoxicity of the americium sample can be reduced upon irradiation in our scenario. This is especially the case for the radiotoxicity between 100 and 1000 years after storage. (orig.)

  9. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  10. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  11. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  12. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.


    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  13. 14 CFR 243.15 - Conflict with foreign laws. (United States)


    ... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Conflict with foreign laws. 243.15 Section... PROCEEDINGS) ECONOMIC REGULATIONS PASSENGER MANIFEST INFORMATION § 243.15 Conflict with foreign laws. (a) If a... portion of this part is not required because of a conflict with applicable foreign law....

  14. 5 CFR 531.243 - Promotion of a GM employee. (United States)


    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Promotion of a GM employee. 531.243... UNDER THE GENERAL SCHEDULE Determining Rate of Basic Pay Special Rules for Gm Employees § 531.243 Promotion of a GM employee. (a) Upon promotion, an employee's status as a GM employee ends, as provided...

  15. 47 CFR 24.243 - The cost-sharing formula. (United States)


    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false The cost-sharing formula. 24.243 Section 24.243... cost-sharing formula. A PCS relocator who relocates an interfering microwave link, i.e. one that is in... microwave incumbent, is entitled to pro rata reimbursement based on the following formula: er12jn96.001...

  16. Dicty_cDB: SFL243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFL243 (Link to dictyBase) - - - Contig-U08029-1 SFL243Z (Link to Original ... 152123_6( AC152123 |pid:none) Genomic sequence for broccoli ... [Bra... 136 4e-31 CR954204_278( CR954204 |pid:none ...

  17. 7 CFR 2.43 - Administrator, Foreign Agricultural Service. (United States)


    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Administrator, Foreign Agricultural Service. 2.43... for Farm and Foreign Agricultural Services § 2.43 Administrator, Foreign Agricultural Service. (a... Administrator, Foreign Agricultural Service: (1) Coordinate the carrying out by Department agencies of...

  18. Dicty_cDB: SHC243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHC243 (Link to dictyBase) - - - Contig-U16405-1 SHC243P (Link to Original ... ikyc*glyi*cfgfsilsksiqfei**ktkniw*ryshywl ifkiiwws*fpy *fh*ck*tfcc*r*fl*sif*l--- ---KEFKVNVKSNNKNTTVFAQDEK ...

  19. Dicty_cDB: SFD243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFD243 (Link to dictyBase) - - - Contig-U16243-1 SFD243P (Link to Original ... (bits) Value X75329_1( X75329 |pid:none) M.indica (Manila ) THMF5 mRNA for 3-ket... 237 e-115 AM474896_9( AM4 ...

  20. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  1. Dicty_cDB: SSB243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CTTTATTAAAACAAGCTGTTGAATTTAAAACAA TGGTTAGATATT Length of 3' end seq. 542 Connected seq. ID SSB243P Connect...PALLKQAVEFKTM VRY Frame C: *fffftsivkyfittiiiilfsennnyyinnnklsln*skik*ifxndctiistnnilcr vlcy*vlhl--- ---gspg...TTTAATAAGTCTTG GAAAATATTCTGCTATCTTTGTTTATAAAGATTACTCAATAACTGGTTTCTTACCAGCTT TATTAAAACAAGCTGTTGAATTTAAAACAATGGTTAGATATT Length of conn...SS (Link to library) SSB243 (Link to dictyBase) - G02063 DDB0186878 Contig-U16443-1... ID SSB243 (Link to dictyBase) Atlas ID - NBRP ID G02063 dictyBase ID DDB0186878 Link to Contig Conti

  2. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  3. Measured solubilities and speciations of neptunium, plutonium, and americium in a typical groundwater (J-13) from the Yucca Mountain region

    International Nuclear Information System (INIS)

    Solubility and speciation data are important in understanding aqueous radionuclide transport through the geosphere. They define the source term for transport retardation processes such as sorption and colloid formation. Solubility and speciation data are useful in verifying the validity of geochemical codes that are part of predictive transport models. Results are presented from solubility and speciation experiments of 237NpO2+, 239Pu4+, 241Am3+/Nd3+, and 243Am3+ in J-13 groundwater (from the Yucca Mountain region, Nevada, which is being investigated as a potential high-level nuclear waste disposal site) at three different temperatures (25 degree, 60 degree, and 90 degree C) and pH values (5.9, 7.0, and 8.5). The solubility-controlling steady-state solids were identified and the speciation and/or oxidation states present in the supernatant solutions were determined. The neptunium solubility decreased with increasing temperature and pH. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. The americium solutions showed no clear solubility trend with increasing temperature and increasing pH

  4. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  5. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  6. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  7. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Rudisill, T.S.


    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  8. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    International Nuclear Information System (INIS)

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  9. Americium Transmutation Feasibility When Used as Burnable Absorbers - 12392

    International Nuclear Information System (INIS)

    The use of plutonium in Mixed Oxide (MOX) fuel in traditional Pressurized Water Reactor (PWR) assemblies leads to greater americium production which is not addressed in MOX recycling. The transuranic nuclides (TRU) contribute the most to the radiotoxicity of nuclear waste and a reduction of the TRU stockpile would greatly reduce the overall radiotoxicity of what must be managed. Am-241 is a TRU of particular concern because it is the dominant contributor of total radiotoxicity for the first 1000 years in a repository. This research explored the feasibility of transmuting Am-241 by using varying amounts in MOX rods being used in place of burnable absorbers and evaluated with respect to the impact on incineration and transmutation of transuranics in MOX fuel as well as the impact on safety. This research concludes that the addition of americium to a non-uniform fuel assembly is a viable method of transmuting Am-241, holding down excess reactivity in the core while serving as a burnable poison, as well as reducing the radiotoxicity of high level waste that must be managed. The use of Am/MOX hybrid fuel assemblies to transmute americium was researched using multiple computer codes. Am-241 was shown in this study to be able to hold down excess reactivity at the beginning of cycle and shape the power distribution in the core with assemblies of varying americium content loaded in a pattern similar to the traditional use of assemblies with varying amounts of burnable absorbers. The feasibility, safety, and utility of using americium to create an Am/MOX hybrid non-uniform core were also evaluated. The core remained critical to a burnup of 22,000 MWD/MTM. The power coefficient of reactivity as well as the temperature and power defects were sufficiently negative to provide a prompt feedback mechanism in case of a transient and prevent a power excursion, thus ensuring inherent safety and protection of the core. As shown here as well as many other studies, this non

  10. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Noronha, Donald M.; Pius, Illipparambil C.; Chaudhury, Satyajeet [Bhabha Atomic Research Centre, Mumbai (India). Fuel Chemistry Div.


    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the K{sub d} value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  11. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    International Nuclear Information System (INIS)

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the Kd value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  12. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  13. Solubility of americium collected on an aerosol filter

    International Nuclear Information System (INIS)

    Kinetics of dissolution of undefined americium aerosol in simulated serum ultrafiltrate was studied. 241Am was present in aerosol collected at a workplace, where an intake of 241Am had occurred formerly. Dissolution experiments in four parts of an aerosol filter were carried out either in ambient air or under CO2 and pH was kept within physiological range. Two?phase kinetics was found in both cases with dissolution half?times for rapid and slow phases ranging from 0.16 to 0.23 d and from 150 to 500 d, respectively. Regardless data dispersion, found half?times justify use of class M model in intake assessment. (author)

  14. The 1976 Hanford Americium Accident: Then and Now

    Energy Technology Data Exchange (ETDEWEB)

    Carbaugh, Eugene H.


    The 1976 chemical explosion of an 241Am ion exchange column at a Hanford Site waste management facility resulted in the extreme contamination of a worker with 241Am, nitric acid and debris. The worker underwent medical treatment for acid burns, as well as wound debridement, extensive personal skin decontamination and long-term DTPA chelation therapy for decorporation of americium-241. Because of the contamination levels and prolonged decontamination efforts, care was provided for the first three months at the unique Emergency Decontamination Facility with gradual transition to the patient’s home occurring over another two months. The medical treatment, management, and dosimetry of the patient have been well documented in numerous reports and journal articles. The lessons learned with regard to patient treatment and effectiveness of therapy still form the underlying philosophy of treatment for contaminated injuries. Changes in infrastructure and facilities as well as societal expectations make for interesting speculation as to how responses might differ today.

  15. Separation of americium from curium by oxidation and ion exchange. (United States)

    Burns, Jonathan D; Shehee, Thomas C; Clearfield, Abraham; Hobbs, David T


    Nuclear energy has the potential to be a clean alternative to fossil fuels, but in order for it to play a major role in the US, many questions about the back end of the fuel cycle must be addressed. One of these questions is the difficult separation of americium from curium. Here, we report the oxidation of Am in two systems, perchloric acid and nitric acid and the affect of changing the acid has on the oxidation. K(d) values were observed and a direct separation factor was calculated and was seen to be as high as 20 for four metal(IV) pillared phosphate phosphonate inorganic organic hybrid ion exchange materials. These ion exchangers are characterized by very low selectivity for cations with low charge but extremely high uptake of ions of high charge. PMID:22827724

  16. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  17. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  18. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  19. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.


    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  20. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)


    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  1. Separation of curium and americium microquantities by chromatographic method with introduction of separating ions. 2. Effect of cadmium ion quantity and method of it introduction in the system on efficiency of curium and americium separation

    International Nuclear Information System (INIS)

    Effect of fractionating cadmium ion and a method of it introduction in the system on efficiency of separation of curium and americium with the use of NTA solutions as an eluent is investigated. It is established that in contrast to mutual sorption of curium, americium and cadmium their selective sorption contributes more complete separation of curium and americium. It is shown that growth of quantity of introduced cadmium increased efficiency of separation. Elution rate not products effect on separation process

  2. 48 CFR 3452.243-70 - Key personnel. (United States)


    ... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Key personnel. 3452.243-70... Key personnel. As prescribed in 3443.106(b), insert the following clause in all solicitations and resultant cost-reimbursement contracts: Key Personnel (AUG 1987) The personnel designated as key...

  3. Preparation of tracer 239Np from 243Am

    International Nuclear Information System (INIS)

    The aim of this work is the preparation of tracer 239Np from 243Am by extraction chromatography as a separation method that can be used as a tracer to determine the radiochemical yield of 237Np in the analysis of environmental samples. (authors)

  4. 48 CFR 52.243-6 - Change Order Accounting. (United States)


    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Change Order Accounting....243-6 Change Order Accounting. As prescribed in 43.205(f), the contracting officer may insert a clause, substantially the same as follows: Change Order Accounting (APR 1984) The Contracting Officer may require...

  5. 49 CFR 372.243 - Controlling distances and population data. (United States)


    ... 49 Transportation 5 2010-10-01 2010-10-01 false Controlling distances and population data. 372.243... population data. In the application of § 372.241: (a) Air-line distances or mileages about corporate limits of municipalities shall be used. (b) The population of any municipality shall be deemed to be...

  6. Dicty_cDB: VHL243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHL243 (Link to dictyBase) - - - Contig-U16441-1 - (Link to Original site) ... pic herpesvirus 2... 33 6.3 (Q8TS91) RecName: Full=Imidazole ... glycerol phosphate synthase sub... 33 6.3 CP000091 ...

  7. 40 CFR 180.243 - Propazine; tolerances for residues. (United States)


    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Propazine; tolerances for residues...) PESTICIDE PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances § 180.243 Propazine; tolerances for residues. Tolerances are established for negligible residues (N)...

  8. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)


    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  9. Reaction mechanisms in 24.3 MeV/nucleon 238U induced reactions through a comprehensive study of fission

    International Nuclear Information System (INIS)

    Nuclear reaction mechanisms for system characterized by very different asymmetries (U+C, Si, Ni, Au) have been investigated at 24.3 MeV/nucleon, using as observables both the fission products and the neutron multiplicity. It is clearly observed that the fusion process-whatever its completeness- can only occur with rather light target nuclei, indicating the persistence of potential energy effects much above the interaction barrier. (authors). 22 refs., 1 fig

  10. Americium(3) solvent extraction by oxides of dialkyl(diaryl)[dialkylcarbamoylmethyl]phosphines (CMPO) from perchloric acid solutions

    International Nuclear Information System (INIS)

    Extraction of americium(3) from perchloric acid solutions by CMPO was investigated. It is shown that americium(3) is much more effectively extracted from perchloric acid solutions, than from nitric acid ones, and increase in americium distribution coefficient depends considerably on reagent nature. As a consequence, anomalous aryl effect increases significantly in perchloric acid solutions. The value of anomalous aryl effect depends directly on stoichiometry of extracted complexes in nitric acid and perchloric acid media. Conditions for extractional concentration of americium up to the 100-fold one with small reagent consumption were suggested

  11. Phosphorylation of HPV-16 E2 at serine 243 enables binding to Brd4 and mitotic chromosomes.

    Directory of Open Access Journals (Sweden)

    Szu-Wei Chang

    Full Text Available The papillomavirus E2 protein is involved in the maintenance of persistent infection and known to bind either to cellular factors or directly to mitotic chromosomes in order to partition the viral genome into the daughter cells. However, how the HPV-16 E2 protein acts to facilitate partitioning of the viral genome remains unclear. In this study, we found that serine 243 of HPV-16 E2, located in the hinge region, is crucial for chromosome binding during mitosis. Bromodomain protein 4 (Brd4 has been identified as a cellular binding target through which the E2 protein of bovine papillomavirus type 1 (BPV-1 tethers the viral genome to mitotic chromosomes. Mutation analysis showed that, when the residue serine 243 was substituted by glutamic acid or aspartic acid, whose negative charges mimic the effect of constitutive phosphorylation, the protein still can interact with Brd4 and colocalize with Brd4 in condensed metaphase and anaphase chromosomes. However, substitution by the polar uncharged residues asparagine or glutamine abrogated Brd4 and mitotic chromosome binding. Moreover, following treatment with the inhibitor JQ1 to release Brd4 from the chromosomes, Brd4 and E2 formed punctate foci separate from the chromosomes, further supporting the hypothesis that the association of the HPV-16 E2 protein with the chromosomes is Brd4-dependent. In addition, the S243A E2 protein has a shorter half-life than the wild type, indicating that phosphorylation of the HPV-16 E2 protein at serine 243 also increases its half-life. Thus, phosphorylation of serine 243 in the hinge region of HPV-16 E2 is essential for interaction with Brd4 and required for host chromosome binding.

  12. Extraction of Americium(III) by diglycolamides in ionic liquids

    International Nuclear Information System (INIS)

    In the present work, the extraction behavior of Am(lII) in the three isomeric DGAs, TODGA, DEHDODGA and TEHDGA in two ionic liquids, 1-butyl-3-methylimidazolium bis(triflouromethane sulphonyl)imide (C4mimNTf2) and 1-butyl-1-methylpyrrolidinium bis(triflouromethanesulphonyl)imide (C4mpyNTf2) is compared. The distribution ratio of americium was determined at various acidities ranging from 1M to 8M. The distribution values were found to decrease with increase in aqueous phase acidity upto 3M. The DAm values then marginally increased with increase of acidity from 3 to 4M followed by a decrease in distribution values. The distribution ratio obtained for various DGAs followed the order TEHDGA < TODGA < DEHDODGA at aqueous phase acidities ranging from 1-4 M. When the aqueous nitric acid concentration was higher than 4M, the distribution values followed the order DEHDODGA < TEHDGA < TODGA. The anomalous behaviour of unsymmetrical diglycolamide in ionic liquid medium was investigated by IR spectroscopy. The study revealed that the unprotonated fraction of DGA (i.e. the free DGA) increased in the order TEHDGA < TODGA < DEHDODGA, which seems to be responsible for the observed anomalous extraction trend in DEHDODGA in ionic liquid medium

  13. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    International Nuclear Information System (INIS)

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH2)n-NH-C(O)-CH2-P(O)Ph2] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO3 solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient DAm/DEu for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (DAm/DEu). (orig.)

  14. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)


    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  15. 30 CFR 243.2 - What leases are subject to this part? (United States)


    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false What leases are subject to this part? 243.2 Section 243.2 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.2...

  16. Post irradiation examination of irradiated americium oxide and uranium dioxide in magnesium aluminate spinel

    International Nuclear Information System (INIS)

    To study MgAl2O4 spinel as inert matrix material for the transmutation of minor actinides, two capsules were irradiated at the high flux reactor in Petten, containing 12.5 wt% micro-dispersed 241AmOx in spinel and 25 wt% micro-dispersed enriched UO2 in spinel. During irradiation, the initially present 241Am was converted for 99.8% to fission products (50%), plutonium (30%), curium (16%) and 243Am (4%). The UO2 spinel target experienced a burn-up of 32% fission per initial metal atom. The post irradiation examination of the AmOx inert matrix target showed swelling of 27 vol.%, and a gas release of 48% for He and 16% for Xe and Kr. The UO2 inert matrix target also showed a large volumetric swelling of 11%, directed mainly radially. Ceramography on the UO2 inert matrix target revealed a complete restructuring of the spinel grains upon irradiation and the absence of porosity, suggesting that amorphisation is the main cause of the swelling

  17. Post irradiation examination of irradiated americium oxide and uranium dioxide in magnesium aluminate spinel (United States)

    Klaassen, F. C.; Bakker, K.; Schram, R. P. C.; Klein Meulekamp, R.; Conrad, R.; Somers, J.; Konings, R. J. M.


    To study MgAl 2O 4 spinel as inert matrix material for the transmutation of minor actinides, two capsules were irradiated at the high flux reactor in Petten, containing 12.5 wt% micro-dispersed 241AmO x in spinel and 25 wt% micro-dispersed enriched UO 2 in spinel. During irradiation, the initially present 241Am was converted for 99.8% to fission products (50%), plutonium (30%), curium (16%) and 243Am (4%). The UO 2 spinel target experienced a burn-up of 32% fission per initial metal atom. The post irradiation examination of the AmO x inert matrix target showed swelling of 27 vol.%, and a gas release of 48% for He and 16% for Xe and Kr. The UO 2 inert matrix target also showed a large volumetric swelling of 11%, directed mainly radially. Ceramography on the UO 2 inert matrix target revealed a complete restructuring of the spinel grains upon irradiation and the absence of porosity, suggesting that amorphisation is the main cause of the swelling.

  18. Post irradiation examination of irradiated americium oxide and uranium dioxide in magnesium aluminate spinel

    Energy Technology Data Exchange (ETDEWEB)

    Klaassen, F.C. E-mail:; Bakker, K.; Schram, R.P.C.; Klein Meulekamp, R.; Conrad, R.; Somers, J.; Konings, R.J.M


    To study MgAl{sub 2}O{sub 4} spinel as inert matrix material for the transmutation of minor actinides, two capsules were irradiated at the high flux reactor in Petten, containing 12.5 wt% micro-dispersed {sup 241}AmO{sub x} in spinel and 25 wt% micro-dispersed enriched UO{sub 2} in spinel. During irradiation, the initially present {sup 241}Am was converted for 99.8% to fission products (50%), plutonium (30%), curium (16%) and {sup 243}Am (4%). The UO{sub 2} spinel target experienced a burn-up of 32% fission per initial metal atom. The post irradiation examination of the AmO{sub x} inert matrix target showed swelling of 27 vol.%, and a gas release of 48% for He and 16% for Xe and Kr. The UO{sub 2} inert matrix target also showed a large volumetric swelling of 11%, directed mainly radially. Ceramography on the UO{sub 2} inert matrix target revealed a complete restructuring of the spinel grains upon irradiation and the absence of porosity, suggesting that amorphisation is the main cause of the swelling.

  19. Dicty_cDB: SHL243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHL243 (Link to dictyBase) - G23225 DDB0219989 Contig-U13301-1 | Contig-U16 ... .1 Influenza A virus (swine/Cotes d'Armor/1515/99 (H1N1 )) partial N1NA gene for Neuraminidase, genomic RNA ... .1 Influenza A virus (swine/Cotes d'Armor/1482/99 (H1N1 )) partial N1NA gene for Neuraminidase, genomic RNA ...

  20. Coulomb fission of 238U in the interaction of 24.3 MeV/nucleon 238U with 197Au

    International Nuclear Information System (INIS)

    Coulomb fission of 238U has been studied in the interaction of a 24.3 MeV/nucleon U beam with an Au target. A novel experimental approach is followed, allowing to isolate the Coulomb fission from the nuclear fission on an event by event basis. The Z distribution of the fragments is studied for both fission processes. (author)

  1. Separation and determination of americium in low-level alkaline waste of NPP origin (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.


    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  2. Americium 241 in vegetation of natural biocenoses and agrocenoses on Belarus territories contaminated with Chernobyl fall-out

    International Nuclear Information System (INIS)

    As a result of beta-decay of plutonium 241 the content of americium 241 increases progressively in soils, contaminated with Chernobyl trans uranium elements. Americium 241 displayed higher (0,5 - 1,5-fold) biological mobility than isotopes of plutonium 239, 240. Activity of americium 241 in surface phyto mass of wild and cultural plants varies from 0,04 to 5,9 Bq/kg of dry weight. Americium 241 contribution to the total trans uranium elements contamination of plants made up 60 - 80% in 1996 - 1998. Investigation of trials from the areas adjacent to the 30-km zone showed that mobility of americium 241 and plutonium was 5 - 15 times as high as in the zone

  3. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  4. Determination of trace concentration of uranium in americium oxide samples by ICP-AES

    International Nuclear Information System (INIS)

    A solvent extraction method has been developed for the determination of uranium (200-2000 ppm) in americium oxide samples. The method involves the quantitative separation of uranium from americium matrix using mixed solvent comprising 1.1M tri-n-butyl phosphate (TBP) +1% trialkyl phosphine oxide (TRPO) + 0.3 M tertiary butyl hydroquinone (TBHQ) in n-dodecane. Uranium from the organic is stripped into the aqueous phase with 0.8 M oxalic acid and determined by ICP-AES. The reliability of the method was ascertained by analytical recovery, which is found to be nearly 100%. (author)

  5. Review of fission product yields and delayed neutron data for the actinides NP-237, PU-242, AM-242M, AM-243, CM-243 and CM-245

    International Nuclear Information System (INIS)

    A review of fission product yields and delayed neutron data for Np-237, Pu-242, Am-242m, Am-243, Cm-243 and Cm-245 has been undertaken. Gaps in understanding and inconsistencies in existing data were identified and priority areas for further experimental, theoretical and evaluation investigation detailed

  6. Fission dynamics study in 243Am and 254Fm (United States)

    Banerjee, K.; Ghosh, T. K.; Roy, P.; Bhattacharya, S.; Chaudhuri, A.; Bhattacharya, C.; Pandey, R.; Kundu, S.; Mukherjee, G.; Rana, T. K.; Meena, J. K.; Mohanto, G.; Dubey, R.; Saneesh, N.; Sugathan, P.; Guin, R.; Das, S.; Bhattacharya, P.


    Fission fragment mass distributions in the reactions 11B + 232Th and 11B + 243Am were measured in an energy range around the barrier. No sudden change in the width of the mass distribution as a function of center-of-mass energy was observed at near-barrier energies, indicating no quasifission transition in the near-barrier energies. Interestingly, the previous measurements of fission fragment angular anisotropies for the same systems showed significant departure from the statistical saddle-point model predictions at near-barrier energies, indicating the presence of nonequilibrium fission processes.

  7. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  8. Impact of ionic liquids on europium and americium extraction by an upper rim phosphorylated calixarene

    International Nuclear Information System (INIS)

    The solvent extraction of europium and americium using the calixarene 5,11,17,23-tetrakis[dipropylphosphinylmethyl] 25,26,27,28-tetrapropoxycalix[4]arene (conical conformation) in the presence of ionic liquids with different natures was studied. It was shown that upper rim phosphorylated calixarene is able to extract europium and americium from nitric acid to dichloroethane by forming a 1:1 complex without the addition of ionic liquids. The distribution coefficients of americium are higher than those of europium in this case, but the isolation degrees of both elements are insufficient for this system to be useful in extraction technologies. The addition of the ionic liquid trihexyl(tetradecyl)phosphonium hexafluorophosphate increases the europium distribution coefficient by values ranging from twofold to more than two orders of magnitude at ionic liquid concentrations of 1 and 50 %, respectively. The values of the distribution coefficients for americium are increased by approximately 25-fold after a 50 % addition of the ionic liquid. (author)

  9. Understanding the Chemistry of Uncommon Americium Oxidation States for Application to Actinide/Lanthanide Separations

    Energy Technology Data Exchange (ETDEWEB)

    Leigh Martin; Bruce J. Mincher; Nicholas C. Schmitt


    A spectroscopic study of the stability of Am(V) and Am(VI) produced by oxidizing Am(III) with sodium bismuthate is presented, varying the initial americium concentration, temperature and length of the oxidation was seen to have profound effects on the resultant solutions.

  10. Speciation and bioavailability of plutonium and americium in the Irish Sea and other marine ecosystems

    International Nuclear Information System (INIS)

    Since the late 1960s, the Irish Sea has become a repository for a variety of radio-elements originating mainly in discharges from the British Nuclear Fuels (BNF) plc. Sellafield reprocessing complex located on the Cumbrian coast. In particular, transuranium nuclides such as plutonium, americium and curium (the main constituents of the α-emitting discharges) have become incorporated into every marine compartment by a variety of mechanisms, many of which are not well understood. Although extensive studies have been carried out in the near-field (eastern Irish Sea, especially in the vicinity of the discharge point and collateral muddy sediments), comparatively little had been done to assess the long-term behaviour and bioavailability of plutonium and americium in the far-field, e.g., the western Irish Sea, prior to the present study. In this dissertation, the results of an extensive research programme, undertaken in order to improve and refine our understanding of the behaviour of plutonium and americium in the marine environment, are presented. Specifically, the thesis details the results of (and conclusions deduced from) a series of experiments in which the physical and chemical speciation, colloidal association, mobility and bioavailability of plutonium and americium were examined in diverse environments including the Irish Sea and the Mediterranean. (author)

  11. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald


    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  12. Extraction chromatographic recovery of americium from acidic raffinate solutions using CMPO adsorbed on Chromosorb-102

    International Nuclear Information System (INIS)

    Microgram amounts of americium have been separated and purified from large amounts of uranium present in effluent solutions resulting from the anion-exchange columns during the purification and recovery of plutonium by using TBP extraction followed by extraction chromatography using CMPO adsorbed on Chromosorb-102. (author). 4 refs., 1 tab

  13. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  14. Development of analytical methods for the separation of plutonium, americium, curium and neptunium from environmental samples


    Salminen, Susanna


    In this work, separation methods have been developed for the analysis of anthropogenic transuranium elements plutonium, americium, curium and neptunium from environmental samples contaminated by global nuclear weapons testing and the Chernobyl accident. The analytical methods utilized in this study are based on extraction chromatography. Highly varying atmospheric plutonium isotope concentrations and activity ratios were found at both Kurchatov (Kazakhstan), near the former Semipalatinsk...

  15. Determination of specific activity of americium and plutonium in selected environmental samples

    International Nuclear Information System (INIS)

    The aim of this work was development of method for determination of americium and plutonium in environmental samples. Developed method was evaluated on soil samples and after they was applied on selected samples of fishes (smoked mackerel, herring and fillet from Alaska hake). The method for separation of americium is based on liquid separation with Aliquate-336, precipitation with oxalic acid and using of chromatographic material TRU-SpecTM.The intervals of radiochemical yields were from 13.0% to 80.9% for plutonium-236 and from 10.5% to 100% for americium-241. Determined specific activities of plutonium-239,240 were from (2.3 ± 1.4) mBq/kg to (82 ± 29) mBq/kg, the specific activities of plutonium-238 were from (14.2 ± 3.7) mBq/kg to (708 ± 86) mBq/kg. The specific activities of americium-241 were from (1.4 ± 0.9) mBq/kg to (3360 ± 210) mBq/kg. The fishes from Baltic Sea as well as from North Sea show highest specific activities then fresh-water fishes from Slovakia. Therefore the monitoring of alpha radionuclides in foods imported from territories with nuclear testing is recommended

  16. Application of hollow fiber supported liquid membrane for the separation of americium from the analytical waste

    International Nuclear Information System (INIS)

    Americium from analytical solid waste containing U and metallic impurities was separated using hollow fiber supported liquid membrane (HFSLM) technique impregnated with DHOA-TODGA from nitric acid medium. An aliquot of 5 g of the solid waste containing Am (19.95 mg) as minor actinide and of U (2,588 mg), Fe (1,360 mg), Ca (1,810 mg) and Na (3,130 mg) as major impurities was processed. The feed solution obtained after the dissolution of the residue in ∼4 M HNO3 was passed through HFSLM module. In the first stage using 1 M DHOA-dodecane was used for the separation of Am from other impurities. Though, majority of the elements were separated in this cycle, Ca was co extracted along with the americium. CMPO extraction chromatographic technique was used for further separation of americium from Ca. Significant decontamination factors were achieved in this three step separation process with respect to U, Fe, Na and Ca with ∼77 % recovery of americium. (author)

  17. Determination of α-emitters (plutonium, americium, curium ...) in feces and urine ashes

    International Nuclear Information System (INIS)

    A description is given of the methods used to determine a number of radionuclides to be found in feces and urine, and obtain samples thin enough for counting and α-spectrometry. These methods can be applied to plutonium, americium and curium especially

  18. Upper Limits to Americium Concentration in Medium Size Sodium Cooled Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.P.; Wallenius, J. [Royal Institute of Technology (KTH), AlbaNova University Centre, S-106 91, Stockholm (Sweden)


    The fastest way to realize transmutation of minor actinides would be using existing reactor types, adding some proper modifications to allow for insertion of MA in the fuel. According to calculations by Fazio and co-workers, the consumption rate of TRU in a low conversion ratio fast reactor may reach 70-75 % of that of an ADS with uranium free fuel [1]. However, americium introduction brings a negative influence on several safety parameters such as {beta}{sub eff}, Doppler coefficient, coolant temperature coefficient and void worth. Therefore the upper limit of americium that can be included into the fuel needs to be carefully evaluated. In this paper, fast reactor fuels with various minor actinide fractions are loaded into a SAS4A model of the semi-commercial BN600 reactor. Unprotected loss of flow (ULOF) and transient over power (UTOP) accidents are modelled using safety parameters obtained from Monte Carlo simulations as well as from the deterministic calculations published by Fazio et al. Applying the latter parameters (obtained with VARI3D), the upper limit to MA concentration in the fuel of a medium sized SFR of BN-600 type appears at 12%, corresponding to 8% of americium. We note however that the Doppler constants displayed by Fazio et al for MA concentrations above 10% have a considerably larger magnitude than those obtained with MCNP. Applying the safety parameters obtained with Monte Carlo simulations and updated nuclear data evaluations, we find that the upper limit to the americium concentration allowing to survive a ULOF is about half of that inferred by the use of parameters from VARI-3D. Since such a difference has a major impact on the predicted americium transmutation capability of SFR, it is of high priority to analyse the reasons for the apparent discrepancies. We note here that the major contribution to the Doppler feedback comes from capture resonance in U-238 and Pu-240 residing below the sodium scattering resonance located at 3 keV, and that

  19. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  20. Interaction and diffusion transport of americium in soils

    International Nuclear Information System (INIS)

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of 241Am in soils. The 241Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (Kd) and desorption percentage. Kd (Am) values ranged from 103 to 105 L kg-1 and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in 241Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between Kd (Am) values and a soil property was not found, the main properties affecting 241Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption capacity was observed in all soils due to the dissolution of soil

  1. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)


    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  2. Facilities for preparing actinide or fission product-based targets

    CERN Document Server

    Sors, M


    Research and development work is currently in progress in France on the feasibility of transmutation of very long-lived radionuclides such as americium, blended with an inert medium such as magnesium oxide and pelletized for irradiation in a fast neutron reactor. The process is primarily designed to produce ceramics for nuclear reactors, but could also be used to produce targets for accelerators. The Actinide Development Laboratory is part of the ATALANTE complex at Marcoule, where the CEA investigates reprocessing, liquid and solid waste treatment and vitrification processes. The laboratory produces radioactive sources; after use, their constituents are recycled, notably through R and D programs requiring such materials. Recovered americium is purified, characterized and transformed for an experiment known as ECRIX, designed to demonstrate the feasibility of fabricating americium-based ceramics and to determine the reactor transmutation coefficients.


    Directory of Open Access Journals (Sweden)

    E. B. Ershov


    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  4. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    International Nuclear Information System (INIS)

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for 241Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for 243Am for neutron energies between 35 eV and 200 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on 242mAm will be presented, where the fission events were actively triggered during the experiments. In these experiments, the Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,γ) from (n,f) events. The first evidence of neutron capture on 242mAm in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  5. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, Marian [Los Alamos National Laboratory


    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for {sup 241}Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for {sup 243}Am for neutron energies between 35 eV and 200 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on {sup 242m}Am will be presented, where the fission events were actively triggered during the experiments. In these experiments, the Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,{gamma}) from (n,f) events. The first evidence of neutron capture on {sup 242m}Am in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  6. Metabolism of americium-241 in man: an unusual case of internal contamination of a child and his father

    International Nuclear Information System (INIS)

    The metabolism of americium-241 was studied during an 8-yr period of an adult male and his son who, at the ages of 50 and 4, respectively, were accidentally and unknowingly contaminated within their home by means of inhalation. Chelation therapy with Na3(Ca-DTPA) was more effective in enhancing the removal of americium-241 from the child than from his father

  7. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro


    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  8. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  9. 30 CFR 243.8 - When will MMS suspend my obligation to comply with an order? (United States)


    ... with an order? 243.8 Section 243.8 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT... with the Bureau of Land Management for onshore leases, and MMS for OCS leases, as collateral for...

  10. 30 CFR 243.4 - How do I suspend compliance with an order? (United States)


    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I suspend compliance with an order? 243.4 Section 243.4 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General...

  11. 30 CFR 243.201 - How will MMS determine if I am financially solvent? (United States)


    ... solvent? 243.201 Section 243.201 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT Financial... making payments found in 30 CFR 218.51. You are not required to use Electronic Funds Transfer (EFT)...

  12. 30 CFR 243.200 - How do I demonstrate financial solvency? (United States)


    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I demonstrate financial solvency? 243.200 Section 243.200 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT Financial...

  13. 30 CFR 243.202 - When will MMS monitor my financial solvency? (United States)


    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false When will MMS monitor my financial solvency? 243.202 Section 243.202 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT...

  14. 30 CFR 243.1 - What is the purpose of this part? (United States)


    ... 243.1 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.1 What... are a lessee) have appealed under 30 CFR part 290 in effect prior to May 13, 1999 and contained in...

  15. 30 CFR 243.3 - What definitions apply to this part? (United States)


    ... Section 243.3 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.3 What... assigned. MMS bond-approving officer means the Associate Director for Minerals Revenue Management or...

  16. 14 CFR 243.11 - Transmission of information after an aviation disaster. (United States)


    ... aviation disaster. 243.11 Section 243.11 Aeronautics and Space OFFICE OF THE SECRETARY, DEPARTMENT OF... of information after an aviation disaster. (a) Each covered airline shall inform the Managing... upon learning of an aviation disaster involving a covered flight segment operated by that carrier....

  17. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  18. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  19. Influence of some organic additives on the extractive separation of americium(III) by sulfoxides

    International Nuclear Information System (INIS)

    The solvent extraction behavior of americium(III) from aqueous nitrate media by two long-chain aliphatic sulfoxides has been examined systematically in the presence of several water-miscible organic solvents to study their possible synergistic effect on metal ion extraction. Methanol, ethanol, n- and isopropanol, n-butanol, dioxane, acetone, as well as acetonitrile, were employed as the organic component of the mixed (polar) phase. These additives affected the extraction to varying degrees. Extractability of Am increased 5 to 10-fold with increasing concentration of some of these additives, with the maximum enhancement being observed in the presence of acetone or acetonitrile. However, alcohols are generally very poor in this respect. Possible reasons for such behavior are briefly discussed. The distribution of several common contaminants was also investigated at the optimum condition for americium extraction

  20. Transmutation of americium and curium incorporated in zirconia-based host materials

    International Nuclear Information System (INIS)

    Presented are studies involving the incorporation of americium and curium in zirconia-based materials. First explored was the pseudo ternary system AmO2-ZrO2-Y2O3. It was determined that selected Y-CSZ materials can incorporate significant quantities of americium oxide and remain cubic single-phase. The cell parameters of these fluorite-type products were established to be linear with the AmO2 content. The Cm2O3-ZrO2 system was also investigated. It was found that at 25 mol% of CmO1.5, the Cm(III) stabilized zirconia in its cubic form (a = 5.21 ±0.01 Angstrom). At higher and lower concentrations, diphasic materials were encountered. At 50 mol% of CmO1.5, a pyrochlore oxide - Cm2Zr2O7 - is formed (a = 10.63 ±0.02 Angstrom). (author)

  1. Americium and samarium determination in aqueous solutions after separation by cation-exchange

    International Nuclear Information System (INIS)

    The concentration of trivalent americium and samarium in aqueous samples has been determined by means of alpha-radiometry and UV-Vis photometry, respectively, after chemical separation and pre-concentration of the elements by cation-exchange using Chelex-100 resin. Method calibration was performed using americium (241Am) and samarium standard solutions and resulted in a high chemical recovery for cation-exchange. Regarding, the effect of physicochemical parameters (e.g. pH, salinity, competitive cations and colloidal species) on the separation recovery of the trivalent elements from aqueous solutions by cation-exchange has also been investigated. The investigation was performed to evaluate the applicability of cation-exchange as separation and pre-concentration method prior to the quantitative analysis of trivalent f-elements in water samples, and has shown that the method could be successfully applied to waters with relatively low dissolved solid content. (author)

  2. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  3. Contemporary state of plutonium and americium in the soils of Palesse state radiation-ecological reserve

    International Nuclear Information System (INIS)

    Full text: At present, the most important alpha-emitting radionuclides of Chernobyl origin are Pu 238, Pu 239, Pu 240 and Am 241. They are classified as the most dangerous group of radionuclides in view of the long half-lives and high radiotoxicity. The main part of alpha-emitted radionuclides is located within the Palesse State Radiation-Ecological Reserve. One of the most important factors determining the radioecological situation in the contaminated ecosystems is the physicochemical forms of radionuclides in a soil medium. Radionuclide species determine the radionuclide entrance into the soil solutions, their redistribution in soil profiles and the 'soil - plant' and the 'soil - surface, ground or underground water' systems as well as spreading beyond the contaminated area. The present work is devoted to investigation of state and migration ability of plutonium and americium in soils of the Palesse state radiation-ecological reserve after more than 20 years from the Chernobyl accident. The objects of investigation were mineral and organic soils sampled in 2008 with the step of 5 cm to the depth of 25-30 cm. The forms of plutonium and americium distinguishing by association with the different components of soil and by potential for migration in the soil medium were studied using the method of sequential selective extraction according to the modified Tessier scheme. Activities of Pu 238, Pu 239, Pu 240 and Am 241 in the samples were determined by the method of radiochemical analysis with alpha-spectrometer radionuclide identification. The dominant part of plutonium and americium in the soils is in immobile forms. Nowadays, radionuclide portions in water soluble and reversibly bound forms do not exceed 9.4 % of radionuclide content in the soil. In mineral soil samples, the radionuclide portions in these fractions exceed the corresponding portions in organic ones. In both mineral and organic soils, the portions of mobile americium are higher than plutonium. The

  4. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia


    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  5. Fabrication of neptunium, plutonium, americium and curium metals for fuel research

    International Nuclear Information System (INIS)

    The techniques for the fabrication of actinide metals; neptunium, americium and curium called as minor actinides, and plutonium, are surveied in a viewpoint of the preparation of starting materials for fuel property measurements. In this report, the processes of the conversion to metals, purification et al. are reviewed. The concept related to the apparatus design is also proposed and the considerable subjects are discussed. (author)

  6. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  7. Influence of dissolved organic substances in groundwater on sorption behavior of americium and neptunium

    International Nuclear Information System (INIS)

    Groundwaters typically contain dissolved organic carbon consisting largely of high molecular weight compounds of humic and fulvic acids. To evaluate whether these dissolved organic substances can enhance the tranport of radionuclides through the groundwater system, experiments were conducted to examine the sorption of americium and neptunium onto crushed basalt in the presence of dissolved humic- and fulvic-acid organic carbon introduced into synthetic groundwater. The partitioning experiments with synthetic groundwater show that increasing the concentration of either humic or fulvic acid in the water has a significant inhibiting effect on sorption of both americium and neptunium. At 220C, adsorption of these radionuclides, as measured by distribution ratios (the ratio of nuclide sorbed onto the solid to nuclide in solution at the end of the experiment), decreased by 25% to 50% by addition of as little as 1 mg/L dissolved organic carbon and by one to two orders of magnitude by addition of 100 to 200 mg/L dissolved organic carbon. Distribution ratios measured in solutions reacted at 900C similarly decreased with the addition of dissolved organic carbon but generally ranged from one to two orders of magnitude higher than those determined in the 220C experiment. These results suggest that organic carbon dissolved in deep groundwaters may significantly enhance the mobility of radionuclides of americium and neptunium. 23 references, 5 figures, 11 tables

  8. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.


    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  9. Selective recovery of americium alone from PUREX or COEXTM raffinate by the EXAm process

    International Nuclear Information System (INIS)

    Americium is the main contributor to the long-term radiotoxicity and to the heat generation of glasses used for the HLW conditioning. To decrease both impact on the ultimate waste and to avoid the difficult recycling of curium, the CEA has developed the EXAm process for the the separation and the recovery of the sole americium directly from PUREX or COEXTM raffinates. The principle of the EXAm process is to extract americium and light lanthanides from high nitric acid media, leaving curium and heavy lanthanides in the raffinate. A water-soluble amide molecule, TEDGA, is added in aqueous phase to increase Am/Cm and Am/heavy lanthanides selectivity, because of the preferential complexation of curium and heavy lanthanides by this diglycolamide. Many experimental data have been acquired mainly at the extraction-scrubbing step (Am/Cm separation) and were used for the development of a phenomenological model implemented in the PAREX process simulation code. The scientific feasibility demonstration of the EXAm process was then performed on a genuine PUREX raffinate in Atalante CBP hot cell in 2010. (author)

  10. Uptake and effects of americium-241 on a brackish-water amphipod

    International Nuclear Information System (INIS)

    The present paper reports the results of experimental work undertaken using the brackish-water amphipod Gammarus duebeni duebeni and the transuranium nuclide americium-241. Data on the accumulation of this actinide showed that the larger fraction of the total body burden is associated with the exoskeleton. It was found that the body burden remained constant in the range pH 8.0-6.5 even though the water concentration changed markedly. It would thus appear that the concept of a concentration factor should be re-examined and it is proposed that a factor should be defined in terms of environmental and chemical parameters which represent the bioavailable fraction of the actinide. The effect of americium on survival and moulting was studied at two activity concentrations; the dose rates and absorbed doses under the experimental conditions employed have been estimated. The differences in survival rates between the control and irradiated groups were statistically analyzed and the significant difference at the higher concentration is believed to be due to a synergism between physiological stress and radiotoxicity of americium rather than the chemical toxicity of the element. (orig.)

  11. About the reaction between uranium-americium mixed oxides and sodium

    International Nuclear Information System (INIS)

    The recycling and fission of the highly toxic minor actinides neptunium and americium is only possible in a liquid metal cooled fast breeder reactor, for nuclear physical reasons. The present work is part of a research program dealing with the fuel-coolant interaction. Fuel pellets with equal parts of americium and uranium and varying oxygen-metal ratio were investigated. A behaviour comparable to that of uranium-plutonium mixed oxides was suggested as a first approach. The reaction of sodium with (U0.5Am0.5)O2-x results in a complete desintegration of the sintered pellet whereas (U, Pu)O2-x pellets show a small increase in volume. A first explanation of the strong reaction of uranium-americium mixed oxides compared to (U, Pu)O2-x or (U, Np)O2-x could be provided by the less negative oxygen potential of the former. Ternary and polynary oxides which are possible products of the fuel-coolant reaction were prepared and characterised by X-ray diffraction. Their oxygen potentials were measured using a solid state e.m.f. cell. Neither Na2AmO3 nor Na3AmO4 can coexist with sodium metal. The measured ΔGO2 values of the Am(IV) and Am (V)-compounds are much higher than those of the sodium uranates(VI) or sodium neptunates(VI). Only Na2O seems to be likely as product of the fuel-coolant interactions. It could be determined in reacted samples by X-ray diffraction. The relatively high oxygen potentials of (U0.5Am0.5)O2-x that are responsible for the reaction could be explained by a binding model which is based on an americium valency state of + 3 and U5+. The existence of both valency states could be proved by XPS measurements. Due to the similar behaviour of neptunium and uranium the problems that are expected for the recycling of Np are much smaller than for americium

  12. 30 CFR 243.101 - How will MMS determine the amount of my bond or other surety instrument? (United States)


    ... other surety instrument? 243.101 Section 243.101 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT Bonding Requirements § 243.101 How will MMS determine the amount of my bond or...

  13. Dicty_cDB: SHB243 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available R103667 |CR103667.1 Forward strand read from insert in 3'HPRT insertion targeting and chromosome engineering... in 3'HPRT insertion targeting and chromosome engineering clone MHPP186g09. 50 0.13 1 dna update 2005.12.21

  14. Electrochemical oxidation of 243Am(III) in nitric acid by a terpyridyl-derivatized electrode

    Energy Technology Data Exchange (ETDEWEB)

    Dares, C. J.; Lapides, A. M.; Mincher, B. J.; Meyer, T. J.


    A high surface area, tin-doped indium oxide electrode surface-derivatized with a terpyridine ligand has been applied to the oxidation of trivalent americium to Am(V) and Am(VI) in nitric acid. Potentials as low as 1.8 V vs. the saturated calomel electrode are used, 0.7 V lower than the 2.6 V potential for one-electron oxidation of Am(III) to Am(IV) in 1 M acid. This simple electrochemical procedure provides, for the first time, a method for accessing the higher oxidation states of Am in non-complexing media for developing the coordination chemistries of Am(V) and Am(VI) and, more importantly, for separation of americium from nuclear waste streams.

  15. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)


    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  16. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  17. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola. (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe


    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  18. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  19. Recovery of Americium-241 from lightning rod by the method of chemical treatment

    International Nuclear Information System (INIS)

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 (241Am), fewer and Radium 226 (226Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of 241Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The 241Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel 241Am technique was used electrodeposition. (author)

  20. Report of scouting study on precipitation of strontium, plutonium, and americium from Hanford complexant concentrate waste

    International Nuclear Information System (INIS)

    A laboratory scouting test was conducted of precipitation methods for reducing the solubility of radionuclides in complexant concentrate (CC) waste solution. The results show that addition of strontium nitrate solution is effective in reducing the liquid phase activity of 90Sr (Strontium) in CC waste from tank 107-AN by 94% when the total strontium concentration is adjusted to 0.1 M. Addition of ferric nitrate solution effective in reducing the 241Am (Americium) activity in CC waste by 96% under the conditions described in the report. Ferric nitrate was also marginally effective in reducing the solubility of 239/240Pu (Plutonium) in CC waste

  1. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;


    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  2. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids. (United States)

    Dittrich, Timothy Mark; Boukhalfa, Hakim; Ware, Stuart Douglas; Reimus, Paul William


    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater-bentonite-fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L(-1)) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10(-10) M (241)Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (k(f)) of 0.01-0.02 h(-1). Am recoveries in each column were 55-60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h(-1) in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance scales because

  3. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  4. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  5. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning; Holm, E.; Boelskifte, S.; Duniec, S.; Persson, B.


    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north of...

  6. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  7. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code is developed to predict the extraction behavior of americium and lanthanides in the TRUEX (TRansUranium EXtraction)process. This code gives the concentration profiles of the components at steady state. The stage efficiency is included in this code as a parameter in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated concentration profiles are compared with the experimental results. The efficiency value for the mixer-settlers, which gives good agreement between the calculated and the experimental profiles, is evaluated. (author)

  8. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code for the TRUEX (TRansUranium EXtraction) process is developed to predict the extraction behavior of americium and lanthanides. This code gives the concentrations of the components at the steady state of the TRUEX process. The stage efficiency is applied to this code in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated profiles are compared with the experimental ones. The efficiency value for the mixer-settlers, which gives the best agreement between the two profiles, is investigated

  9. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  10. Experimental and in situ investigations on americium, curium and plutonium behaviour in marine benthic species: transfer from water or sediments

    International Nuclear Information System (INIS)

    The tranfer of transuranic elements -americium, curium and plutonium- from the sediments containing them to some marine benthic species (endofauna and epifauna) was studied with a twofold approach - laboratory and in-situ investigation. The experimental investigations, divided into three parts, made it possible to specify concentration factors (F.C.), transfer factors (F.T.) and to understand the process involved for 5 benthic species. The result were refined by an in-situ study that brought new data on the marine distribution of the transuranic elements released by the La Hague plant. Finally, the localization of americium and plutonium in the tissues and cells of these species was determined by autoradiography

  11. Vitrification of F-area americium/curium: feasibility study and preliminary process recommendation

    International Nuclear Information System (INIS)

    Work was performed to identify a process to vitrify the contents of F- canyon Tank 17.1. Tank 17.1 contains the majority of americium (Am) and curium (Cm) contained in the DOE Complex. Oak Ridge National Laboratory (ORNL) has made a formal request for this material as fuel for production of Cf252 and other transplutonium actinides. The Am and Cm (and associated lanthanide fission products) are currently in nitric acid solution. Transportation of the intensely radioactive Am/Cm in liquid form is not considered possible. As a result, the material will either be solidified and shipped to ORNL or discarded to the Tank Farm. Nuclear Materials Processing Technology (NMPT), therefore, requested Defense Waste Processing Technology (DWPT) to determine if the Tank 17.1 material could be vitrified, and if it was vitrified could the americium and curium be successfully recovered. Research was performed to determine if the Tank 17.1 contents could indeed be mixed with glass formers and vitrified. Additional studies identified critical process parameters such as heat loading, melter requirements, off-gas evolution, etc. Discussions with NMPT personnel were initiated to determine existing facilities where this work could be accomplished safely. A process has been identified which will convert the Am/Cm material into approximately 300kg of glass

  12. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    International Nuclear Information System (INIS)

    A dual isotope method has been used to study the transfer of 137Cs, 239/240Pu and 241Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10-5 - 10-4, with mean values of 7 x 10-5 and 4 x 10-5 obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10-4 recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  13. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.I.; Weekes, T.E.C. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Biological and Nutritional Sciences; Rimmer, D.L. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Agricultural and Environmental Science; Green, N.; Wilkins, B.T. [National Radiological Protection Board, Chilton (United Kingdom)


    A dual isotope method has been used to study the transfer of {sup 137}Cs, {sup 239/240}Pu and {sup 241}Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10{sup -5} - 10{sup -4}, with mean values of 7 x 10{sup -5} and 4 x 10{sup -5} obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10{sup -4} recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  14. Americium and europium extraction from carbonate solutions by 1-phenyl-3-methyl-4-benzoylpyrazolone -5

    International Nuclear Information System (INIS)

    Trivalent TPEs and REEs are extractable from carbonate solutions by 1-pheny-3-methyl-4-benzoylpyrazolone-5 (PMBP). The effect of concentration of KHCO3 and K2CO3, extractant, metal, and other factors on the extent of extraction of the elements has been clarified. The kinetics of extraction of the elements from carbonate solutions has been studied. It has been shown that in the KHCO3 concentration range 0.2-2.0 M americium and europium are extracted by PMBP solutions in different diluents with distribution coefficients lying within n x 102-n x 103. From K2CO3 solutions the elements are extracted better by PMBP solutions in methyl isobutyl ketone (MIBK). It has been shown that metal concentration in the range 1x10-5. 5x10-3 g-ion x liter-1 does not affect extraction (log E = 3). Extracts based on PMBP with a metal content higher than 5x10-3g-ion x liter-1 were obtained by absolute concentrating method and were used for the study of 13C NMR spectra. The composition of thecompounds extracted by PMBP from carbonate solutions was determined by 13C NMR spectroscopy and extraction. The conditions of europium and americium reextraction from extracts based on PMBP by complexones, their mixtures with alkalis and other substances were studied. The scopes for using the system PMBP-carbonate solutions to separate and concentrate TPEs and REEs has been examined

  15. Evaluation of americium-241 toxicity influence on the microbial growth of organic wastes

    International Nuclear Information System (INIS)

    Available in abstract form only. Full text of publication follows: Since the licenses for using radioactive sources in radioactive lightning rods were lifted by the Brazilian national nuclear authority, in 1989, the radioactive devices have been replaced by Franklin type and collected as radioactive waste. However, only 20 percent of the estimated total number of installed rods was delivered to Brazilian Nuclear Commission. This situation causes concern, due to, first, the possibility of the rods being disposed as domestic waste, and second, the americium, the most commonly employed radionuclide, is classified as a high-toxicity element. In the present study, Am-241 migration experiments were performed by a lysimeter system, in order to evaluate the risk of contamination caused by radioactive lightning rods disposed as a common solid waste. Besides the risk evaluation, it is important to know the mechanism of the Am-241 release or retention in waste as well as its influence in the waste decomposition processes. Many factors are involved, but microorganisms present in the waste play an important role in its degradation, which control the physical and chemical processes. The objective of this work was to evaluate the Am-241 influence on the microbial population by counting number of cells in lysimeters leachate. Preliminary results suggest that americium may influence significantly the bacteria growth in organic waste, evidenced by culture under aerobiosis and an-aerobiosis and the antimicrobial resistance test. (authors)

  16. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  17. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  18. An economic analysis of a light and heavy water moderated reactor synergy: burning americium using recycled uranium

    International Nuclear Information System (INIS)

    An economic analysis is presented for a proposed synergistic system between 2 nuclear utilities, one operating light water reactors (LWR) and another running a fleet of heavy water moderated reactors (HWR). Americium is partitioned from LWR spent nuclear fuel (SNF) to be transmuted in HWRs, with a consequent averted disposal cost to the LWR operator. In return, reprocessed uranium (RU) is supplied to the HWRs in sufficient quantities to support their operation both as power generators and americium burners. Two simplifying assumptions have been made. First, the economic value of RU is a linear function of the cost of fresh natural uranium (NU), and secondly, plutonium recycling for a third utility running a mixed oxide (MOX) fuelled reactor fleet has been already taking place, so that the extra cost of americium recycling is manageable. We conclude that, in order for this scenario to be economically attractive to the LWR operator, the averted disposal cost due to partitioning americium from LWR spent fuel must exceed 214 dollars per kg, comparable to estimates of the permanent disposal cost of the high level waste (HLW) from reprocessing spent LWR fuel. (authors)

  19. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C H; Barney, G S


    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO/sub 2/, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO/sub 2/ decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition.

  20. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    International Nuclear Information System (INIS)

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO2, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO2 decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition

  1. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  2. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  3. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  4. 30 CFR 243.12 - May I substitute a demonstration of financial solvency for a bond posted before the effective... (United States)



  5. Application of ion-exchange chromatography to eliminate the curium from americium by his determination by the method of liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    The aim of this work is to eliminate curium in determining of americium by the method of liquid scintillation spectrometry. The paper introduces a method that has been done to eliminate curium from americium by determining of americium with liquid scintillation spectrometry method. In the research we used ion-exchange chromatography and ion-exchange sorbents DOWEX. We also observed the effect of geometry organization of column on the separation course. Resources for alpha spectrometry were prepared by micro-precipitation with neodymium chloride. High radiochemical yields were achieved, but separation did not take place according to a pre-separation scheme. (authors)

  6. Molecular Cloning and Production of Recombinant Phytase from Bacillus subtilis ASUIA243 in Pichia pastoris

    Directory of Open Access Journals (Sweden)

    Nor Soleha Mohd Dali


    Full Text Available Phytase gene obtained from Bacillus subtilis ASUIA243 was cloned into a medium vector and transformed into E. coli. Restriction enzyme digestion was conducted to get blunt-ended phytase gene and ligated into the Pichia expression vector, pPICZαA. The recombinant vector, pPICZαA-243HPp was then linearized with PmeI and transformed into P. pastoris strain X33. Screening for multi copy gene number of transformants was done by re-plating the selected colonies on increasing concentration of zeocin. One positive clone, X243HPp#2 was then grown in BMGY media as the starting culture, followed by induction in BMMY media for protein expression study. The supernatant was then analysed by SDS-PAGE and Western blot method to check the protein expression.ABSTRAK: Gen fitase yang didapati daripada Bacillus subtilis ASUIA243 diklonkan sebagai vektor perantara dan berubah menjadi E. coli. Sekatan pencernaan enzim dijalankan untuk mendapatkan gen fitase berhujung tumpul dan diligatkan dengan vektor ekspresi Pichia, pPICZαA. Vektor rekombinan, pPICZαA-243HPp kemudian dilinearkan dengan PmeI dan berubah menjadi P. pastoris strain X33. Penyaringan untuk nombor gen berbilang salinan yang menjalani transformasi genetik dijalankan dengan menyalur semula koloni terpilih dengan penambahan kepekatan zeocin. Satu klon positif, X243HPp#2 kemudian dibiarkan hidup dalam perantara BMGY sebagai kultur permulaan, diikuti dengan aruhan dalam perantara BMMY untuk kajian penglahiran protein. Supernatan kemudian dikaji dengan SDS-PAGE dan kaedah sap Western untuk menyemak penglahiran protein.KEYWORDS:  phytase, Bacillus subtilis, Pichia pastoris, gene cloning.

  7. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  8. Molecular Cloning and Production of Recombinant Phytase from Bacillus subtilis ASUIA243 in Pichia pastoris


    Nor Soleha Mohd Dali; Tamrin Nuge; Mohd Hafidz Mahamad Maifiah; Faridah Yusof; Anis Shobirin Meor Hussin; Abd-Elaziem Farouk; and Hamzah Mohd. Salleh


    Phytase gene obtained from Bacillus subtilis ASUIA243 was cloned into a medium vector and transformed into E. coli. Restriction enzyme digestion was conducted to get blunt-ended phytase gene and ligated into the Pichia expression vector, pPICZαA. The recombinant vector, pPICZαA-243HPp was then linearized with PmeI and transformed into P. pastoris strain X33. Screening for multi copy gene number of transformants was done by re-plating the selected colonies on increasing concentrati...

  9. Spectroscopic monitoring of the luminous blue variable Westerlund1-243 from 2002 to 2009


    Ritchie, B.; Clark, J. S.; Negueruela,, I.; Najarro, F


    Context. The massive post-main sequence star W243 in the galactic starburst cluster Westerlund 1 has undergone a spectral transformation from a B2Ia supergiant devoid of emission features in 1981 to an A-type supergiant with a rich emission-line spectrum by 2002/03.Aims. We examine the continued evolution of W243 from 2002 to 2009 to understand its evolutionary state, current physical properties and the origin of its peculiar emission line spectrum.Methods. We used VLT/UVES and VLT/FLAMES to ...

  10. Imitators of plutonium and americium in a mixed uranium- plutonium nitride fuel (United States)

    Nikitin, S. N.; Shornikov, D. P.; Tarasov, B. A.; Baranov, V. G.; Burlakova, M. A.


    Uranium nitride and mix uranium nitride (U-Pu)N is most popular nuclear fuel for Russian Fast Breeder Reactor. The works in hot cells associated with the radiation exposure of personnel and methodological difficulties. To know the main physical-chemical properties of uranium-plutonium nitride it necessary research to hot cells. In this paper, based on an assessment of physicochemical and thermodynamic properties of selected simulators Pu and Am. Analogues of Pu is are Ce and Y, and analogues Am - Dy. The technique of obtaining a model nitride fuel based on lanthanides nitrides and UN. Hydrogenation-dehydrogenation- nitration method of derived powders nitrides uranium, cerium, yttrium and dysprosium, held their mixing, pressing and sintering, the samples obtained model nitride fuel with plutonium and americium imitation. According to the results of structural studies have shown that all the samples are solid solution nitrides rare earth (REE) elements in UN.

  11. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed. 16 refs., 6 figs

  12. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutyl-carbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed

  13. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  14. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    International Nuclear Information System (INIS)

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by 1H and 13C NMR, mass and IR spectroscopy. The extraction behaviour of (152+154)Eu(III) and 241Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for (152+154)Eu(III) and HDEHSDGA shows the superior selectivity for 241Am(III). (orig.)

  15. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids

    International Nuclear Information System (INIS)

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater–bentonite–fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L−1) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10−10 M 241Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (kf) of 0.01–0.02 h−1. Am recoveries in each column were 55–60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h−1 in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance

  16. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    International Nuclear Information System (INIS)

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and 241Am was low, with specific activity in the tissues 241Am occurred and 241Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author)

  17. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation

    International Nuclear Information System (INIS)

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  18. Ab initio modelling of the behaviour of helium in americium and plutonium oxides

    International Nuclear Information System (INIS)

    By means of an ab initio plane wave pseudo potential method, plutonium dioxide and americium dioxide are modelled, and the behaviour of helium in both these materials is studied. We first show that a pseudo potential approach in the Generalized Gradient Approximation (GGA) can satisfactorily describe the cohesive properties of PuO2 and AmO2. We then calculate the formation energies of point defects (vacancies and interstitials), as well as the incorporation and solution energies of helium in PuO2 and AmO2. The results are discussed according to the incorporation site of the gas atom in the lattice and to the stoichiometry of PuO2±x and AmO2±x. (authors)

  19. Removal of plutonium and americium from hydrochloric acid waste stream using extraction chromatography

    International Nuclear Information System (INIS)

    Extraction chromatography is under development as a method to lower actinide activity levels in hydrochloric acid (HCl) effluent streams. Successful application of this technique would allow recycle of the largest portion of HCl, while lowering the quantity and improving the form of solid waste generated. The extraction of plutonium and americium from HCl solutions was examined for several commercial and similar laboratory-produced resins coated with n-octyl(phenyl)-N,N-diisobutylcarbamoylmethyphosphine oxide (CMPO) and either tributyl phosphate (TBP), or diamyl amylphosphonate (DAAP). Distribution coefficients for Pu and Am were measured by contact studies in hydrochloric acid solutions over the range of 0.1 - 10.0 N HCl, whole varying REDOX conditions, actinide loading levels, and contact time intervals. Significant differences in the actinide distribution coefficients, and in the kinetics of actinide removal were observed as a function of resin formulation. The usefulness of these resins for actinide removal from HCl effluent streams is discussed

  20. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  1. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia


    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  2. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.


    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  3. Plutonium and americium concentrations and vertical profiles in some Italian mosses used as bioindicators

    International Nuclear Information System (INIS)

    We have examined the uptake of actinide elements Am and Pu by different species of lichen and moss collected in two locations (Urbino, Central Italy; Alps region, North-east Italy). Plutonium and americium were separated and determined by extraction chromatography, electrodeposition and alpha-spectrometry. This paper summarizes our results with a special emphasis on the vertical profiles of these actinides in two different species of mosses. Several 1-2 cm depth sections were obtained and dated by 210Pb method. A typical peak for 239,240Pu and 241Am was found in the very old moss species ('Sphagnum Compactum') at a depth corresponding to the period 1960-1970 which was the period characterized by the maximum nuclear weapon tests. In a younger moss species ('Neckeria Crispa') no peak was observed and the regression curves showed that Am is more mobile than 239,240Pu and 238Pu. (author)

  4. Concept and experimental studies on fuel and target for minor actinides and fission products transmutation

    International Nuclear Information System (INIS)

    High activity long-lived radionuclides in nuclear wastes, namely minor actinides (americium and neptunium) are in large amount generated by current nuclear reactive. The destruction of these radionuclides is a part of the French SPIN (Partitioning and Burning) program consistent with the determination to send a minimum amount of harmful products for final storage. Transmutation concepts are defined for neptunium and americium taking into account fuel cycle strategies. Neptunium destruction does not pose any major problems. It's a by-product of uranium consumption, as plutonium and in despite of a slight gamma activity due to the protactinium 233 it's quite easy to handle. Diluting neptunium in the mixed oxide fuels (MOX) should not be an obstacle for fabrication, in-pile behaviour and reprocessing either. Consequently we make the proposal of homogeneous mode of neptunium in MOX which should be soon explored in the experimental OSIRIS reactor and in the Phenix and Superphenix reactors. The analysis is more complex for the multi isotope americium. Its destruction is difficult because of gamma radioactivity which complicates fabrication. Experiments in Phenix and calculation showed that Phenix reactor offers a good potential for americium incineration, but similar data do not exist for PWR. It will remain a well known difficulty for fabrication and reprocessing. In this case we have to put a real new face to the fabrication flow-sheet of americium compounds and we propose to develop the heterogeneous mode. Targets choice are defined in term of: -safety, considering fuel reaction with cladding and water sodium, -transmutation rate, limited by target behaviour, in FR's (Phenix), PWR's (OSIRIS) and HFR (Petten), -reprocessing, checking the solubility of such targets by Purex process. So, at the beginning of our program the account has been on improving fuel and targets properties related to safety and fuel cycle. (authors). 4 figs

  5. 40 CFR 761.243 - Standard wipe sample method and size. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Standard wipe sample method and size... Natural Gas Pipeline: Selecting Sample Sites, Collecting Surface Samples, and Analyzing Standard PCB Wipe Samples § 761.243 Standard wipe sample method and size. (a) Collect a surface sample from a natural...

  6. Pesticides: Benefaction or Pandora's Box? A synopsis of the environmental aspects of 243 pesticides

    NARCIS (Netherlands)

    Linders JBHJ; Jansma JW; Mensink BJWG; Otermann K; ACT


    The report provides an overview of physical, chemical and environmental data of 243 pesticides. The data mentioned are based on confidential information supplied by the manufacturers of the pesticides. For all pesticides mentioned a Final Environmental File, which is public, is derived. Tables with

  7. 17 CFR 243.103 - No effect on Exchange Act reporting status. (United States)


    ... filings in a timely manner; or (b) There is adequate current public information about the issuer for... a public disclosure required solely by § 243.100 shall not affect whether: (a) For purposes of Forms S-2 (17 CFR 239.12), S-3 (17 CFR 239.13) and S-8 (17 CFR 239.16b) under the Securities Act,...

  8. 30 CFR 243.10 - When will MMS collect against a bond or other surety instrument or a person demonstrating... (United States)


    ... surety instrument or a person demonstrating financial solvency? 243.10 Section 243.10 Mineral Resources... a bond or other surety instrument or a person demonstrating financial solvency? (a) This section... surety instrument on your own behalf or for another person; or (2) Have demonstrated financial...

  9. 20 CFR 404.243 - Computation where you are eligible for a pension based on noncovered employment. (United States)


    ... pension based on noncovered employment. 404.243 Section 404.243 Employees' Benefits SOCIAL SECURITY... for a pension based on noncovered employment. The provisions of § 404.213 are applicable to... of living amount), minus one-half the portion of your monthly pension which is due to noncovered...

  10. An electrochemical oxidation process of Am (III) into Am (VI) used to separate the americium of spent fuels reprocessing solutions

    International Nuclear Information System (INIS)

    The aim of this invention is to oxidize by an electrochemical process Am (III) to Am (VI). This process can be used to separate the americium of spent fuels reprocessing solutions. The method consists to add to the aqueous nitric solution containing Am (III) an heteropolyanion able to complex the americium (as for instance the potassium tungstophosphate) and the Ag (II) ion. The Ag (II) ion oxidizes the Am (III) and is reduced into an Ag (I) ion. It is then regenerated by the electrolysis of the solution. After the oxidation of Am (III) into Am (VI), this last ion can be extracted by an adapted organic solvent. With this electrochemical method a yield of 100% Am (VI) is obtained in half a hour. (O.M.). 5 refs., 5 figs., 2 tabs

  11. Separation of oxidized americium from lanthanides by use of pillared metal(IV) phosphate-phosphonate hybrid materials

    International Nuclear Information System (INIS)

    Closing the nuclear fuel cycle in the US poses many challenges, one of which is found in the waste streams, which contain both trivalent lanthanides and actinides. The separation of americium from the raffinate will dramatically reduce the long-term radiotoxicity of the waste. The sorption of americium in both the tri- and pentavalent oxidation states was observed for four M(IV) phosphate-phosphonate ion exchange materials in nitric acid at pH 2. High selectivity was observed for reduced Am(III) with Kd values ca. 6 x 105 mL/g, while the Kd values for Am(V) were much lower. A new method of synthesizing and stabilizing AmO2+ to yield a lifetime of at least 24 h in acidic media using a combination of sodium persulfate and calcium hypochlorite will be described.

  12. Effects of impurities on the size and form of crystals of thorium and americium oxalates and oxides

    International Nuclear Information System (INIS)

    The influence of impurity salts and certain surfactants on the shape and size of thorium and americium oxalate crystals, as well as crystals of their dioxides, prepared at thermolysis of oxalate precipitates, has been investigated. It is shown that during thorium oxalate deposition from solutions, containing 0.8 mol/l thorium and 2 mol/l nitric acid at 96 deg C in the presence of ammonium salts or surfactants larger and monodisperse crystals are grown than in the absence of the above-mentioned substances. Addition of ammonium nitrate in the amount of 0.6 mol/l to solution containing 7.6x10-3 mol/l of americium dioxide particles coincides with the shape of oxalate crystals but their size is reduced by (20-25)% as compared with the initial ones

  13. Combined radiochemical procedure for determination of plutonium, americium and strontium-90 in the soil samples from SNTS

    International Nuclear Information System (INIS)

    The results of combined radiochemical procedure for the determination of plutonium, americium and 90Sr (via measurement of 90Y) in the soil samples from SNTS (Semipalatinsk Nuclear Test Site) are presented. The processes of co-precipitation of these nuclides with calcium fluoride in the strong acid solutions have been investigated. The conditions for simultaneous separation of americium and yttrium using extraction chromatography have been studied. It follows from analyses of real soil samples that the procedure developed provides the chemical recovery of plutonium and yttrium in the range of 50-95 % and 60-95 %, respectively. The execution of the procedure requires 3.5 working days including a sample decomposition study. (author)

  14. Extraction of americium(III) from nitric acid medium by CMPO-TBP extractants in ionic liquid diluent

    International Nuclear Information System (INIS)

    Extraction of americium(III) from nitric acid medium by a solution of tri-n-butylphosphate (TBP) and n-octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in room temperature ionic liquid, l-butyl-3-methyl-imidazolium bis(trifluoromethanesulfonyl)imide (bmimNTf2), was studied and the results were compared with that obtained with CMPO-TBP in n-doddecane (n-DD). The distribution ratio of 241Am(III) in TBP-CMPO/bmimNTf2 was measured as a function of various parameters such as concentrations of nitric acid, CMPO, bmimNO3, NaNO3 and TBP and temperature. Remarkably large distribution ratios were observed for the extraction of americium(III) when bmimNTf2 acted as diluent and the extraction was insignificant in the absence of CMPO. The stoichiometry of metal-solvate in organic phase was determined by the slope analysis of extraction data and it indicated the formation of 1:3 (Am: CMPO) complex in organic phase. Viscosity of TBP-CMPO/bmimNTf2 at various temperatures and enthalpy change accompanied by the extraction of americium(III) were determined and reported in this paper. (orig.)

  15. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  16. Uptake of americium-241 by plants from contaminated Chernobyl exclusive zone test site soils

    International Nuclear Information System (INIS)

    Americium-241 was found to accumulate in soils and biological objects of the environment. Its concentration has increased many times after the Chernobyl disaster and can be expected to increase about 40 times in the future. This research concentrated on the contaminated exclusive Chernobyl zone polluted by trace radionuclides, their behavior and accumulation by various plant species. Special attention is devoted to the bioavailability of 241Am to the plants Galium rivale, G. tinctorium, G. aparine, G. intermedium, Berteroa incana, Artemisia absinthium, A. vulgaris, Centaurea borysthenica, C. arenaria, Cirsium arvense, Succissa pratensis, Solidago virgaurea, Linaria vulgaris, Lepidium ruderale, Stenactis annua, Veronica maxima, Verbascum lychnitis, Euphorbia cyparissias, Genista tinctoria, Erigeron canadensis, Oenothera biennis, Betula pendula and Quercus robur, which were collected from the Chernobyl, Kopachi, and Yanov districts. The plant samples of Oenothera biennis, Betula pendula and Quercus robur were collected from the Yanov district, where the soil contamination by 241Am and 137Cs was at the level of 660 and 27 MBq/m2, respectively. Gamma spectroscopy and radiochemical methods were used to estimate the activity concentration of 137Cs, 90Sr, 238Pu, 239+240Pu, 241Am. The radionuclides were measured in the dry green mass of the plant samples and in the dry soils. The contamination of the Oenothera biennis, Betula pendula and Quercus robur samples by 137Cs was (5.8±1,5)x106, (7.4±1.1)x105, and (2.6±0.2)x106 Bq/kg dry mass, respectively, and contamination by 241Am was 47±5, 45±3 and 3.2±0.2 Bq/kg, respectively. The soil-to-plant transfer ratio for 137Cs ranged lay within the interval of 0.2 to 0.03 Bq/kg : Bq/m2, the the transfer ratio for 241Am did not exceed 7x10-5 Bq/kg : Bq/m2. The coefficient of the relative contents of the 241Am/239+240Pu radionuclides in the various plant samples varied from 3.2 to 8.3, while for soil from the Yanov district this

  17. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  18. Effect of arginine on stability of GST-ZNF191(243-368)

    Institute of Scientific and Technical Information of China (English)

    Dong Xin Zhao; Zhong Xian Huang


    For better understanding the chemical or biological information of ZNF191 (243-368), we expressed the fusion protein of GST and ZNF191(243-368), and used it to obtain the binding DNA sequence of this zinc finger protein. But in the process of expression and purification, we found this fusion protein slowly degradated. For resolving this problem, we simultaneously added charged amino acids L-Arg and L-Glu to the solution of fusion protein, and demonstrated that this method can dramatically increase the stability of this fusion protein. This method can make the fusion protein suitable for the continuous works, especially for situations where high protein concentration and long-term stability without precipitate and degradation of protein are required.

  19. Two photon dissociation of benzene, phenylacetylene, and benzaldehyde at 243 nm: translational energy releases in the H atom channel

    International Nuclear Information System (INIS)

    Hydrogen atom production channels from photodissociation of benzene, phenylacetylene, and benzaldehyde at 243 nm have been investigated by detecting H atoms using two photon absorption at 243.2 nm and induced fluorescence at 121.6 nm. Translational energies of the H atoms were measured by Doppler broadened H atom spectra. By absorption of two photons at 243 nm, the H atoms are statistically produced from benzene and phenylacetylene whereas the H atoms from the aldehyde group in benzaldehyde are produced from different pathways. The possible dissociation mechanisms are discussed from the measured translational energy releases

  20. 243例乳腺癌患者配偶照顾负担及影响因素研究%The level and influencing factors of caregiver burden among 243 spouses of women with breast cancer

    Institute of Scientific and Technical Information of China (English)

    邾萍; 付菊芳; 王波; 林静; 凌瑞; 郭丝锦; 房宁宁; 王丹丹


    Objective To investigate the level and influencing factors of spouse caregiver burden of women with breast cancer.Methods Totally 243 spouses of women with breast cancer were investigated with Zarit Burden Interview (ZBI)and Social Support Rating Scale (SSRS).The patients were investigated with M.D.Anderson Symptom Inventory(MDASI-C).Results The spouse caregiver burden was in the middle level with a total score of 33.99±14.28.The influencing factors were life stress events,subjective support,daily sleep time of spouses,the symptom severity and cancer stage of patients and monthly family income.Conclusion The spouse caregivers of women with breast cancer suffer from middle level of burden.Nurses should assess the caregiver burden and provide targeted interventions to relieve spouse caregiver burden and promote their quality of life.%目的 了解乳腺癌患者配偶照顾负担现状及影响因素.方法 对243例乳腺癌患者配偶照顾者采用照顾负担量表(ZBI)、社会支持量表(SSRS)进行调查,对患者采用安德森症状量表(MDSAI-C)进行调查.结果 配偶照顾负担总分为(33.99±14.28)分,为中度负担水平.影响因素为配偶生活应激事件、主观支持、睡眠时间、患者症状严重程度和肿瘤分期、家庭人均月收入.结论 乳腺癌患者配偶存在中度照顾负担,护理人员应通过同步评估患者与配偶,了解配偶的照顾负担,主动给予配偶照顾者针对性的护理服务,从而减轻其照顾负担,提高其生活质量.

  1. Yb fiber amplifier at 972.5 nm with frequency quadrupling to 243.1 nm

    CERN Document Server

    Burkley, Z; Cooper, S F; Brandt, A D; Yost, D C


    We demonstrate a continuous-wave ytterbium-doped fiber amplifier which produces 6.3 W at a wavelength of 972.5 nm. We frequency quadruple this source in two resonant doubling stages to produce 530 mW at 243.1 nm. Radiation at this wavelength is required to excite the 1S-2S transition in atomic hydrogen and could therefore find application in experimental studies of hydrogen and anti-hydrogen.

  2. Spectroscopic monitoring of the luminous blue variable Westerlund1-243 from 2002 to 2009

    CERN Document Server

    Ritchie, B W; Negueruela, I; Najarro, F


    The massive post-Main Sequence star W243 in the galactic starburst cluster Westerlund 1 has undergone a spectral transformation from a B2Ia supergiant devoid of emission features in 1981 to an A-type supergiant with a rich emission-line spectrum by 2002/03. We used VLT/UVES and VLT/FLAMES to obtain high-resolution spectra on six epochs in 2003/04 (UVES) and ten epochs in 2008/09 (FLAMES). These spectra are used alongside other VLT/FLAMES and NTT/EMMI spectra to follow the evolution of W243 from 2002 to 2009. W243 displays a complex, time-varying spectrum with emission lines of Hydrogen, Helium and Lyman-pumped metals, forbidden lines of Nitrogen and Iron, and a large number of absorption lines from neutral and singly-ionized metals. Many lines are complex emission/absorption blends. The LBV has a current temperature of ~8500K (spectral type A3Ia+), and displays signs of photospheric pulsations and weak episodic mass loss. Nitrogen is highly overabundant, with Carbon and Oxygen depleted, indicative of surface ...

  3. Americium and plutonium in water, biota, and sediment from the central Oregon coast

    International Nuclear Information System (INIS)

    Plutonium-239, 240 and americium-241 were measured in the mussel Mytilus californianus from the region of Coos Bay, OR. The flesh of this species has a plutonium concentration of about 90 fCi/kg, and an Am-241/Pu-239, 240 ratio that is high relative to mixed fallout, ranging between two and three. Transuranic concentrations in sediment, unfiltered water, and filterable particulates were also measured; none of these materials has an Am/Pu ratio as greatly elevated as the mussels, and there is no apparent difference in the Am/Pu ratio of terrestrial runoff and coastal water. Sediment core profiles do not allow accumulation rates or depositional histories to be identified, but it does not appear that material characterized by a high Am/Pu ratio has ever been introduced to this estuary. Other bivalves (Tresus capax and Macoma nasuta) and a polychaete (Abarenicola sp.) do not have an elevated Am/Pu ratio, although the absolute activity of plutonium in the infaunal bivalves is roughly four times that in the mussels

  4. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)


    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  5. Influence of organic additives on the colour reaction between trivalent americium and arsenazo III

    International Nuclear Information System (INIS)

    The colour reaction of Am(III) with arsenazo III in several hydroorganic media has been examined systematically on the addition of certain polar water-miscible organic solvents in the course of a search for improved and simple spectrophotometric methods for the estimation of americium. Addition of these substances resulted in the stabilization of colour and brought about a drastic enhancement in the absorbance values. The organic additives studied include acetone, acetonitrile, dimethylformamide, dioxane and ethanol. Among the many solvents tested, alcohol and dioxane proved to be the most effective, the highest sensitivity is obtained by using a 60% dioxane-ethanol (1:1) mixture. The apparent molar absorptivity based on Am content is 184616+-9931 mol-1 cm-1 at 655 nm which is about 3 times higher than that attained for the reaction in aqueous medium (65178+-1243). Moreover, this is the highest value reported as yet for its determination. Beer's law is obeyed both in mixed and aqueous media. The effects of some experimental variables on colour development have also been studied to optimize the conditions for the assay of Am. (author)

  6. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  7. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge


    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  8. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  9. Assessment of radiation doses from residential smoke detectors that contain americium-241

    International Nuclear Information System (INIS)

    External dose equivalents and internal dose commitments were estimated for individuals and populations from annual distribution, use, and disposal of 10 million ionization chamber smoke detectors that contain 110 kBq (3 μCi) americium-241 each. Under exposure scenarios developed for normal distribution, use, and disposal using the best available information, annual external dose equivalents to average individuals were estimated to range from 4 fSv (0.4 prem) to 20 nSv (2 μrem) for total body and from 7 fSv to 40 nSv for bone. Internal dose commitments to individuals under post disposal scenarios were estimated to range from 0.006 to 80 μSv (0.0006 to 8 mrem) to total body and from 0.06 to 800 μSv to bone. The total collective dose (the sum of external dose equivalents and 50-year internal dose commitments) for all individuals involved with distribution, use, or disposal of 10 million smoke detectors was estimated

  10. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  11. In Vitro Dissolution Tests of Plutonium and Americium Containing Contamination Originating From ZPPR Fuel Plates

    Energy Technology Data Exchange (ETDEWEB)

    William F. Bauer; Brian K. Schuetz; Gary M. Huestis; Thomas B. Lints; Brian K. Harris; R. Duane Ball; Gracy Elias


    Assessing the extent of internal dose is of concern whenever workers are exposed to airborne radionuclides or other contaminants. Internal dose determinations depend upon a reasonable estimate of the expected biological half-life of the contaminants in the respiratory tract. One issue with refractory elements is determining the dissolution rate of the element. Actinides such as plutonium (Pu) and Americium (Am) tend to be very refractory and can have biological half-lives of tens of years. In the event of an exposure, the dissolution rates of the radionuclides of interest needs to be assessed in order to assign the proper internal dose estimates. During the November 2011 incident at the Idaho National Laboratory (INL) involving a ZPPR fuel plate, air filters in a constant air monitor (CAM) and a giraffe filter apparatus captured airborne particulate matter. These filters were used in dissolution rate experiments to determine the apparent dissolution half-life of Pu and Am in simulated biological fluids. This report describes these experiments and the results. The dissolution rates were found to follow a three term exponential decay equation. Differences were noted depending upon the nature of the biological fluid simulant. Overall, greater than 95% of the Pu and 93% of the Am were in a very slow dissolving component with dissolution half-lives of over 10 years.

  12. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site. (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E


    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  13. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T.F.; Smith, J.D. (Melbourne Univ., Parkville (Australia). Dept. of Inorganic Chemistry); Fowler, S.W.; LaRosa, J.; Holm, E. (International Atomic Energy Agency, Monaco-Ville (Monaco). Lab. of Marine Radioactivity); Aarkrog, A.; Dahlgaard, H. (Risoe National Lab., Roskilde (Denmark))


    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and {sup 241}Am was low, with specific activity in the tissues <1% (dry wt) than in the sediments. Over the first three months, a slight preference in transfer of plutonium over {sup 241}Am occurred and {sup 241}Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author).

  14. ESO 243-49 HLX-1: scaling of X-ray spectral properties and black hole mass determination

    CERN Document Server

    Titarchuk, Lev


    We report the results of Swift/XRT observations (2008-2015) of a hyper-luminous X-ray source, ESO 243-49 HLX-1. We found a strong observational evidence that ESO 243-49 HLX-1 underwent spectral transitions from the low/hard state to the high/soft state during these observations. The spectra of ESO 243-49 HLX-1 are well fitted by the so-{called} bulk motion Comptonization model for all spectral states. We have established the photon index Gamma saturation level, Gamma_{sat}$=3.0+/-0.1, in the correlation of Gamma versus mass accretion rate dot M. This Gamma-dot M correlation allows us to estimate the black hole (BH) mass in ESO 243-49 HLX-1 to be M_{BH}~ 7x 10^4 solar masses, assuming the distance to ESO 243-49 of 95 Mpc. For the BH mass estimate we used the scaling method, taking Galactic BHs XTE~J1550-564, H~1743-322 and 4U~1630-472, and an extragalactic BH source, M101 ULX-1 as reference sources. The Gamma-dot M correlation revealed in ESO 243-49 HLX-1 is similar to those in a number of Galactic and extraga...

  15. Assessment of americium and curium transmutation in magnesia based targets in different spectral zones of an experimental accelerator driven system (United States)

    Haeck, W.; Malambu, E.; Sobolev, V. P.; Aït Abderrahim, H.


    The potential to incinerate minor actinides (MA) in a sub-critical accelerator-driven system (ADS) is a subject of study in several countries where nuclear power plants are present. The performance of the MYRRHA experimental ADS, as to the transmutation of Am and Cm in the inert matrix fuel (IMF) samples consisting of 40 vol.% (Cm0.1Am0.5Pu0.4)O1.88 fuel and 60 vol.% MgO matrix with a density of 6.077 g cm-3 in three various spectrum regions, were analysed at the belgian nuclear research centre SCK · CEN. The irradiation period of 810 effective full power days (EFPD) followed by a storage period of 2 years was considered. The ALEPH code system currently under development at SCK · CEN was used to carry out this study. The total amount of MA is shown to decrease in all three considered cases. For Am, the decrease is the largest in the reflector (89% decrease) but at the cost of a net Cm production (92% increase). In the two other positions (inside the core region), 20-30% of Am has disappeared but with a lower production of Cm (between 7% and 11%). In the reflector, a significant build-up of long-lived 245Cm, 246Cm, 247Cm and 248Cm was also observed while the production of these isotopes is 10-1000 times smaller in the core. The reduction of the Pu content is also the highest in the reflector position (41%). In the other positions the incinerated amount of Pu is much smaller: 1-5%.

  16. Combined procedure using radiochemical separation of plutonium, americium and uranium radionuclides for alpha-spectrometry

    International Nuclear Information System (INIS)

    Radiochemical separation of Pu, Am and U was tested from synthetic solutions and evaporator concentrate samples from nuclear power plants for isolation of each of them for alpha-spectrometry analysis. The separation was performed by anion-exchange chromatography, extraction chromatography, using TRU resin, and precipitation techniques. The aim of the study was to develop a sensitive analytical procedure for the sequential determination of 242Pu, 238Pu, 239+240Pu, 241Am and 235,238U in radioactive wastes. 238Pu, 242Pu, 243Am and 232U were used as tracers. The measurements of α emitting radionuclides were performed by semiconductor detector that is used especially when spectrometric information is needed. For synthetic solutions the chemical recovery was based on associated iron concentration and was about 93%. (author)

  17. Preparation of actinide targets by electrodeposition (United States)

    Trautmann, N.; Folger, H.


    Actinide targets with varying thicknesses on different substrates have been prepared by electrodeposition either from aqueous solutions or from solutions of their nitrates in isopropyl alcohol. With these techniques the actinides can be deposited almost quantitatively on various backing materials within 15 to 30 min. Targets of thorium, uranium, neptunium, plutonium, americium, curium and californium with areal densities from almost carrier-free up to 1.4 mg/cm 2 on thin beryllium, carbon, titanium, tantalum and platinum foils have been prepared. In most cases, prior to the deposition, the actinides had to be purified chemically and for some of them, due to the limited amount of material available, recycling procedures were required. Applications of actinide targets in heavy-ion reactions are briefly discussed.

  18. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  19. Sorption of plutonium and americium on repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura

    International Nuclear Information System (INIS)

    An integrated program of batch sorption experiments and mathematical modeling has been carried out to study the sorption of plutonium and americium on a series of repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura. The sorption of plutonium and americium on samples of concrete, mortar, sand/bentonite, tuff, sandstone and cover soil has been investigated. In addition, specimens of bitumen, cation and anion exchange resins, and polyester were chemically degraded. The resulting degradation product solutions, alongside solutions of humic and isosaccharinic acids were used to study the effects on plutonium sorption onto concrete, sand/bentonite and sandstone. The sorption behavior of plutonium and americium has been modeled using the geochemical speciation program HARPHRQ in conjunction with the HATCHES database

  20. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  1. Characterization of uranium, plutonium, neptunium, and americium in HLW supernate for LLW certification

    International Nuclear Information System (INIS)

    The 1S Manual requires that High Level Waste (HLW) implement a waste certification program prior to sending waste packages to the E-Area vaults. To support the waste certification plan, the HLW supernate inventory of uranium, plutonium, neptunium and americium have been characterized. This characterization is based on the chemical, isotopic and radiological properties of these elements in HLW supernate. This report uses process knowledge, solubility data, isotopic inventory data and sample data to determine if any isotopes of the aforementioned elements will exceed the minimum reportable quantity (MRQ) for waste packages contaminated with HLW supernate. If the MRQ can be exceeded for a particular nuclide, then a method for estimating the waste package content is provided. Waste packages contaminated from HLW supernate do not contain sufficient U-233, U-234, U-235, U-236, U-238, Pu-239, Pu-240, Pu-241, Pu-242 or Am-241 to warrant separate reporting on the shipping manifest. Calculations show that, on average, more than 100 gallons of supernate is required to exceed the PAC (package acceptance criteria) for each of these nuclides. Thus it is highly unlikely that the PAC would be exceeded for these nuclides and unlikely that the MRQ would be exceeded. These nuclides should be manifested as zero for waste packages contaminated with HLW supernate. The only actinide isotopes that may exceed the MRQ are Np-237 and Pu-238. The recommended method to calculate the amount of these two isotopes in waste packages contaminated with HLW supernate is to ratio them to the measured Cs-137 activity

  2. Some elements for a revision of the americium reference biokinetic model

    International Nuclear Information System (INIS)

    The interpretation of individual activity measurement after a contamination by 241Am or its parent nuclide 241Pu is based on the reference americium (Am) biokinetic model published by the International Commission on Radiological Protection in 1993 [International Commission on Radiological Protection. Age-dependent doses to members of the public from intake of radionuclides: Part 2 Ingestion dose coefficients. ICRP Publication 67. Ann. ICRP 23(3/4) (1993)]. The authors analysed the new data about Am biokinetics reported afterwards to propose an update of the current model. The most interesting results, from the United States Transuranium and Uranium Registries post-mortem measurement database [Filipy, R. E. and Russel, J. J. The United States Transuranium and Uranium Registries as sources for actinide dosimetry and bio-effects. Radiat. Prot. Dosim. 105(1-4), 185-187 (2003)] and the long-term follow-up of cases of inhalation intake [Malatova, I., Foltanova, S., Beckova, V., Filgas, R., Pospisilova, H. and Hoelgye, Z. Assessment of occupational doses from internal contamination with 241Am. Radiat. Prot. Dosim. 105(1-4), 325-328 (2003)], seemed to show that the current model underestimates the retention in the massive soft tissues and overestimates the retention in the skeleton and the late urinary excretion. However, a critical review of the data demonstrated that all were not equally reliable and suggested that only a slight revision of the model, possibly involving a change in the balance of activity between massive soft tissues, cortical and trabecular bone surfaces, may be required. (authors)

  3. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  4. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  5. Reduction of. systematic error of In-vivo measurement of americium 241 activity in the skull

    International Nuclear Information System (INIS)

    Excretion analysis and in vivo measuring methods are used for estimation of internal contamination by 241Am. In vivo measurements of the lung are suitable in short time after time of intake when the way of the intake is inhalation. In vivo measurements of the activity in the liver or in the skeleton could be performed at a later time. Detection of radionuclide activity in the liver is quite difficult because it is necessary to distinguish liver activity from the activity of surrounding tissues i.e. lung and skeleton. The skull or knees are the most suitable., for activity assessment in the skeleton. The skull is the most appropriate for measurements because it represents about 15% of total skeleton mass and contributions to measured activity of surrounding tissues are small. Americium activity in the skull could be measured with different instrumentation and in various geometries. Setting of two semiconductors detectors placed 3 cm over temporal region of the skull is used in NRPI. Calibration of the system was done by several head phantoms, in this process was observed that detection efficiencies depend on size of the phantoms. The aim of the paper is to express character of the efficiency as function of the size of skull in order to obtain more accurate value of the activity and decrees its uncertainty. Simulations of head by simplified geometric shapes, i.e. spheres and rotary ellipsoids, is in coherence with phantoms of big size (UCIN, BPAM-0001), but for small phantoms occurred quite serious discrepancy. Activity of real cases determined by calibration with phantom BPAM-0001 (reference phantom) is reduced from 9 to 44 %, when eq. 2 is used and relative uncertainty is reduced from 32% to maximum 12%. (authors)

  6. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  7. Final Report on the Demonstration of Disposal of Americium and Curium Legacy Material Through the High Level Waste System

    International Nuclear Information System (INIS)

    This report provides the results of experimental demonstrations related to processing of a legacy solution containing americium and curium through the High Level Waste (HLW) system. The testing included eight experiments covering the baseline, mitigation, and enhanced nitrate processing studies. In general, each experiment studied the mixtures generated over a period of time to emulate the lifecycle of actual sludge in the High Level Waste system. While the data in previous reports remain valid, this report supercedes all the previous reports and provides a collective overview of the work

  8. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  9. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  10. Quality control of the sheep bacterial artificial chromosome library, CHORI-243

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen F


    Full Text Available Abstract Background The sheep CHORI-243 bacterial artificial chromosome (BAC library is being used in the construction of the virtual sheep genome, the sequencing and construction of the actual sheep genome assembly and as a source of DNA for regions of the genome of biological interest. The objective of our study is to assess the integrity of the clones and plates which make up the CHORI-243 library using the virtual sheep genome. Findings A series of analyses were undertaken based on the mapping the sheep BAC-end sequences (BESs to the virtual sheep genome. Overall, very few plate specific biases were identified, with only three of the 528 plates in the library significantly affected. The analysis of the number of tail-to-tail (concordant BACs on the plates identified a number of plates with lower than average numbers of such BACs. For plates 198 and 213 a partial swap of the BESs determined with one of the two primers appear to have occurred. A third plate, 341, also with a significant deficit in tail-to-tail BACs, appeared to contain a substantial number of sequences determined from contaminating eubacterial 16 S rRNA DNA. Additionally a small number of eubacterial 16 S rRNA DNA sequences were present on two other plates, 111 and 338, in the library. Conclusions The comparative genomic approach can be used to assess BAC library integrity in the absence of fingerprinting. The sequences of the sheep CHORI-243 library BACs have high integrity, especially with the corrections detailed above. The library represents a high quality resource for use by the sheep genomics community.

  11. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  12. Measurements of energy dependence of average number of prompt neutrons from neutron-induced fission of 235U, 241Am and 243Am from 0.5 to 12 MeV

    International Nuclear Information System (INIS)

    The energy dependence measurements results of average number of prompt neutrons from neutron-induced fission of 235U, 241Am, 243Am and total gamma-rays energy for 235U and 243Am from 0.5 to 12 MeV are presented. The measurements were carried out with neutron beam from uranium target of electron linac of All-Union Scientific Research Institute of Experimental Physics using time-of-flight technique on 28.5 m flight-path. The neutrons and gamma-rays from fission were detected by a big liquid scintillator detector (BLSD) loaded with gadolinium, events of fission - by parallel plate avalanche detector for fission fragments. Measurement of energy dependence of anti νp, Eγtot and determination of BLSD efficiency (relative to anti νp and Eγtot for 252Cf) were carried out simultaneously. Least squares fitting results give anti νp=3.05+0.14degEn for 241Am and anti νp=3.20+.15degEn for 243Am. (orig.)

  13. A monolithic collapse origin for the thin/thick disc structure of ESO~243-49

    CERN Document Server

    Comerón, S; Peletier, R F; Mentz, J


    ESO 243-49 is a high-mass (circular velocity $v_{\\rm c}\\approx200\\,{\\rm km\\,s^{-1}}$) edge-on S0 galaxy in the Abell 2877 cluster at a distance of $\\sim95\\,{\\rm Mpc}$. To elucidate the origin of its thick disc, we use MUSE science verification data to study its kinematics and stellar populations. The thick disc emits $\\sim80\\%$ of the light at heights in excess of $3.5^{\\prime\\prime}$ ($1.6\\,{\\rm kpc}$). The rotation velocities of its stars lag by $30-40\\,{\\rm km\\,s^{-1}}$ compared to those in the thin disc, which is compatible with the asymmetric drift. The thick disc is found to be more metal-poor than the thin disc, but both discs have old ages. We suggest an internal origin for the thick disc stars in high-mass galaxies. We propose that the thick disc formed either ${\\rm a)}$ first in a turbulent phase with a high star formation rate and that a thin disc formed shortly afterwards, or ${\\rm b)}$ because of the dynamical heating of a thin pre-existing component. Either way, the star formation in ESO 243-49 ...

  14. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.


    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  15. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  16. Plutonium and americium in Arctic waters, the North Sea and Scottish and Irish coastal zones (in Fucus, Mytilus and Patella)

    International Nuclear Information System (INIS)

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were collected from the Irish coast in 1983. Fallout is found to dominate as a source of 239+240Pu north of latitude 650N, while for 238Pu a substantial fraction originates from European nuclear fuel reprocessing facilities. The 238Pu/239+240Pu isotope ratio provides clear evidence of the transport of effluent plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11-15 months in Scottish waters and, tentatively, 1.5-3 y during transport from the North Channel (north of the Irish Sea) to Spitsbergen. 241Am found in Arctic waters probably originates from the decay of fallout 241Pu and, like Pu, tentatively has a residence time of the order of several years. Americium from Sellafield has an estimated mean residence time of 4-6 months in Scottish waters. (author)

  17. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  18. Americium, curium and rare earths radionuclides in forest litter samples from Poland

    International Nuclear Information System (INIS)

    Twenty seven samples of forest litter or humus layers (A0 or A1) collected in 1991 in selected regions of Poland were analysed for the presence of 241Am, Cm isotopes and rare-earths alpha-emitters. Samples were originating from a large research project and were previously analysed for gamma-emitters and plutonium. The measurements were done using alpha spectrometry preceded by a radiochemical separation procedure. Additional low-level gamma spectrometric measurements were performed for the rare-earths fractions of samples with the aim to search for europium gamma-emitters. The applied radiochemical procedure, based on the IAEA recommendations, is described. The maximum observed specific activity of 241Am was found to be equal to (5.00 ± 0.19) Bq/kg, for 243+244Cm it was (0.25 ± 0.02) Bq/kg and for 147Sm it was (0.124 ± 0.009) Bq/kg. The possible origin of each isotope is discussed. The obtained results confirmed the presence of the non-volatile isotopes of the Chernobyl fallout in north-eastern Poland. (author)

  19. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  20. Partial monosomy 8q and partial trisomy 9q due to the maternal translocation t(8;9(q24.3;q34.1)

    DEFF Research Database (Denmark)

    Tos, T; Alp, M Y; Eker, H K;


    Partial trisomy 9q34-qter and partial monosomy 8q24.3-qter are very rare chromosomal abnormalities. Characteristic features of partial trisomy 9q34-qter are hypotonia, developmental delay, mild intellectual disability, dolichocephaly, distinct facial phenotype, long and thin fingers, and cardiac...... anomalies. Unlike the partial trisomy 9q34-qter, partial monosomy 8q24.3-qter has no distinct phenotype. Here we report a four years old female patient with partial trisomy 9q34-qter and partial monosomy 8q24.3-qter due to the maternal translocation t(8;9)(q24.3;q34. I). She has developmental delay...

  1. Function of conserved histidine-243 in phosphatase activity of EnvZ, the sensor for porin osmoregulation in Escherichia coli.


    Hsing, W; Silhavy, T J


    EnvZ and OmpR are the sensor and response regulator proteins of a two-component system that controls the porin regulon of Escherichia coli in response to osmolarity. Three enzymatic activities are associated with EnvZ: autokinase, OmpR kinase, and OmpR-phosphate (OmpR-P) phosphatase. Conserved histidine-243 is critical for both autokinase and OmpR kinase activities. To investigate its involvement in OmpR-P phosphatase activity, histidine-243 was mutated to several other amino acids and the ph...

  2. Efttra irradiation experiments for the development of fuels and targets for transmutation

    International Nuclear Information System (INIS)

    The EFTTRA collaboration (Experimental Feasibility of Targets for Transmutation) between CEA (France), ECN (The Netherlands), EDF (France), FZK (Germany), IAM and ITU (European Commission) was launched in 1992, with the aim of performing joint experiments for the study of materials for the transmutation. Irradiations have started in parallel in the Phenix fast reactor in France, and in the high flux thermal reactor HFR the Netherlands. One of these experiments, concerning technetium and iodine, has been completed; post-irradiation examinations of the Tc metallic samples are performed by ECN, CEA and ITU, and a summary of the last results is presented. The other on-going EFTTRA experiments are described, with a report on the application of fabrication methods for matrices with up to 10% americium content. Finally, some considerations on the strategies for americium are given. (authors)

  3. Measurement of fission cross section with pure Am-243 sample using lead slowing-down spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, Katsuhei; Yamamoto, Shuji; Kai, T.; Fujita, Yoshiaki; Yamamoto, Hideki; Kimura, Itsuro [Kyoto Univ. (Japan); Shinohara, Nobuo


    By making use of back-to-back type double fission chambers and a lead slowing-down spectrometer coupled to an electron linear accelerator, the fission cross section for the {sup 243}Am(n,f) reaction has been measured relative to that for the {sup 235}U(n,f) reaction in the energy range from 0.1 eV to 10 keV. The measured result was compared with the evaluated nuclear data appeared in ENDF/B-VI and JENDL-3.2, whose evaluated data were broadened by the energy resolution function of the spectrometer. General agreement was seen between the evaluated data and the measurement except that the ENDF/B-VI data were lower in the range from 15 to 60 eV and that the JENDL-3.2 data seemed to be lower above 100 eV. (author)

  4. Chemical behaviour of trivalent and pentavalent americium in saline NaCl-solutions. Studies of transferability of laboratory data to natural conditions. Interim report. Reported period: 1.2.1993-31.12.1993; Chemisches Verhalten von drei- und fuenfwertigem Americium in Salinen NaCl-Loesungen. Untersuchung der Uebertragbarkeit von Labordaten auf natuerliche Verhaeltnisse. Zwischenbericht. Berichtszeitraum 1.2.1993-31.12.1993

    Energy Technology Data Exchange (ETDEWEB)

    Runde, W.; Kim, J.I.


    In order to clarify the chemical behaviour of Americium in saline aqueous systems relevant for final storage this study deals with the chemical reactions of trivalent and pentavalent Americium in NaCl-solutions under the influence of radiolysis from its own alpha radiation. The focus of the study was on investigating the geologically relevant reactions, such as hydrolysis or carbonate- and chloride complexing in solid-liquid equilibriums. Comprehensive measurements on solubility and spectroscopic studies in NaCl-solutions were carried out in a CO{sub 2}-free atmosphere and 10{sup -2} atm CO{sub 2} partial pressure. Identification and characterisation of the AM (III) and AM(V) solid phases were supplemented by structural research with the chemically analogue EU (III) and Np(V) compounds. The alpha-radiation induced radiolysis in saline NaCl solutions and the redox behaviour of Americium which was influenced thereby were spectroscopically quantified. (orig.) [Deutsch] Zur Klaerung des chemischen Verhaltens von Americium in endlagerrelevanten salinen aquatischen Systemen befasst sich die vorliegende Arbeit mit den chemischen Reaktionen des drei- und fuenfwertigen Americiums in NaCl-Loesungen unter dem Einfluss der Radiolyse durch die eigene {alpha}-Strahlung. Der Schwerpunkt dieser Arbeit lag auf der Untersuchung der geologisch relevanten Reaktionen, wie Hydrolyse sowie Carbonat- und Chloridkomplexierung in fest-fluessig Gleichgewichtssystemen. Hierzu wurden umfassende Loeslichkeitsmessungen und spektroskopische Untersuchungen in NaCl-Loesungen, sowohl unter CO{sub 2}-freier Atmosphaere als auch unter 10{sup -2} atm CO{sub 2}-Partialdruck, durchgefuehrt. Die Identifizierung und Charakterisierung der Am(III)- und Am(V)-Festphasen wurde ergaenzt durch strukturelle Untersuchungen mit den chemisch analogen Eu(III)- und Np(V)-Verbindungen. Die von der {alpha}-Strahlung induzierte Radiolyse in salinen NaCl-Loesungen und das dadurch beeinflusste Redoxverhalten von Americium

  5. Influence of an alkoxy group on bis-triazinyl-pyridines for selective extraction of americium(III)

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and lanthanides(III) from nitric acid by 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin-3-yl)-pyridine and 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin- 3-yl)-4-methoxy-pyridine was studied. The physico-chemical properties of these ligands, such as the protonation and complexation constants, were also determined to describe the influence of different substituent groups. The selectivity of substituted-BTP was confirmed both in complexation and in solvent extraction experiments. The presence of an alkoxy-group in position 4 of the pyridine decreases the BTP selectivity. Influence of a long alkyl chain on protonation and complexation constants was also studied with 2,6-bis-(5,6-dimethyl-[1,2,4]- triazin-3-yl)-4-dodecyloxy-pyridine. (authors)

  6. Solvent extraction of europium and americium into phenyltrifluoromethyl sulfone by using synergistic mixture of hydrogen dicarbollylcobaltate and 'classical' CMPO

    International Nuclear Information System (INIS)

    Extraction of microamounts of europium and americium by a phenyltrifluoromethyl sulfone (FS 13) solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of octyl-phenyl-N,N-diisobutylcarbamoylmethyl phosphine oxide ('classical' CMPO, L) has been investigated. The equilibrium data have been explained assuming that the complexes HL+, HL2+, ML23+, ML33+ and ML43+ (M3+ Eu3+, Am3+) are extracted into the organic phase. The values of extraction and stability constants of the cationic complex species in FS 13 saturated with water have been determined. It was found that the stability constants of the corresponding complexes EuLn3+ and AmLn3+, where n 2, 3, 4 and L is 'classical' CMPO, in water-saturated FS 13 are comparable. (author)

  7. Recovery, purification and concentration of plutonium and americium from the aqueous wastes discharged in the reprocessing process studies

    International Nuclear Information System (INIS)

    For recovering and purifying plutonium and americium from the aqueous wastes occurring in the process studies on reprocessing, a standard procedure has been established for use in the laboratory works, through the preliminary tests of the precipitation as hydroxides and the anion exchange in nitrate media. The procedure was proven in the treatment of actual wastes, of which the results were contributed to determine the process conditions in the plutonium purification and product concentration of the JAERI Reprocessing Test Plant. The preliminary tests also include washing of U and Am recovery from the anion-exchanger in nitrate media, direct ion-exchange recovery of Pu from the TBP phase and elution of Am from the cation-exchanger. (auth.)

  8. Plutonium and americium in fish, shellfish and seaweed in the Irish environment and their contribution to dose

    International Nuclear Information System (INIS)

    Plutonium and americium activity concentrations in fish and shellfish landed in Ireland in the period 1988 to 1997 are presented. Activity concentrations in fish are low and often below detection limits, while those in mussels and oysters sampled on the northeast coast show no significant signs of decline. The estimated doses to hypothetical typical and heavy seafood consumers remain below 1 μSv yr-1 (committed effective dose).Plutonium activity concentrations measured in Fucus vesiculosus around the Irish coastline have not fallen appreciably in the ten year period between 1986 and 1996. Furthermore, the mean 238Pu/239,240Pu ratio of 0.17±0.05 in Fucus vesiculosus from the west coast of Ireland demonstrates the increasing significance of Sellafield-derived plutonium in those waters. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  9. The bone volume effect on the dosimetry of plutonium-239 and americium-241 in the skeleton of man and baboon

    International Nuclear Information System (INIS)

    Studies were undertaken using bone removed from young adult baboons, which had been contaminated with plutonium-239 at various times prior to sacrifice, and human bone from adult male (USTR Case 246), who had received an internal deposition of americium-241 as a result of a glove-box explosion 11 years prior to his death. The baboon bone was supplied by the CEA, France, and the human bone by the United States Transuranium registry. The bone samples, examined by qualitative and quantitative autoradiography with CR 39 detectors, demonstrated the rapid redistribution of bone surface-seeking radionuclides in younger primates due to growth and the slower, bone turnover driven redistribution in the adult human bone. In both species, primary and secondary surface deposits of radionuclide remained conspicious despite bone activity; true volumization of radionuclide was seldom seen. The dosimetric implications of these findings are discussed. (author) 21 refs.; 6 figs.; 4 tabs

  10. 49 CFR 173.243 - Bulk packaging for certain high hazard liquids and dual hazard materials which pose a moderate... (United States)


    ... conforming to 46 CFR part 64 with design pressure of at least 172.4 kPa (25 psig) are authorized. Unless... 49 Transportation 2 2010-10-01 2010-10-01 false Bulk packaging for certain high hazard liquids and... Packaging for Hazardous Materials Other Than Class 1 and Class 7 § 173.243 Bulk packaging for certain...

  11. Measurement and analysis of the $^{243}$Am neutron capture cross section at the n_TOF facility at CERN

    CERN Document Server

    Mendoza, E; Guerrero, C; Berthoumieux, E; Abbondanno, U; Aerts, G; Alvarez-Velarde, F; Andriamonje, S; Andrzejewski, J; Assimakopoulos, P; Audouin, L; Badurek, G; Balibrea, J; Baumann, P; Becvar, F; Belloni, F; Calvino, F; Calviani, M; Capote, R; Carrapico, C; Carrillo de Albornoz, A; Cennini, P; Chepel, V; Chiaveri, E; Colonna, N; Cortes, G; Couture, A; Cox, J; Dahlfors, M; David, S; Dillmann, I; Dolfini, R; Domingo-Pardo, C; Dridi, W; Duran, I; Eleftheriadis, C; Ferrant†, L; Ferrari, A; Ferreira-Marques, R; Fitzpatrick, L; Frais-Koelbl, H; Fujii, K; Furman, W; Goncalves, I; Gonz alez-Romero, E; Goverdovski, A; Gramegna, F; Griesmayer, E; Gunsing, F; Haas, B; Haight, R; Heil, M; Herrera-Martinez, A; Igashira, M; Isaev, S; Jericha, E; Kappeler, F; Kadi, Y; Karadimos, D; Karamanis, D; Ketlerov, V; Kerveno, M; Koehler, P; Konovalov, V; Kossionides, E; Krticka, M; Lampoudis, C; Leeb, H; Lindote, A; Lopes, I; Lossito, R; Lozano, M; Lukic, S; Marganiec, J; Marques, L; Marrone, S; Martınez, T; Massimi, C; Mastinu, P; Mengoni, A; Milazzo, P M; Moreau, C; Mosconi, M; Neves, F; Oberhummer, H; O’Brien, S; Oshima, M; Pancin, J; Papachristodoulou, C; Papadopoulos, C; Paradela, C; Patronis, N; Pavlik, A; Pavlopoulos, P; Perrot, L; Pigni, M T; Plag, R; Plompen, A; Plukis, A; Poch, A; Praena, J; Pretel, C; Quesada, J; Rauscher, T; Reifarth, R; Rosetti, M; Rubbia, C; Rudolf, G; Rullhusen, P; Salgado, J; Santos, C; Sarchiapone, L; Savvidis, I; Stephan, C; Tagliente, G; Tain, J L; Tassan-Got, L; Tavora, L; Terlizzi, R; Vannini, G; Vaz, P; Ventura, A; Villamarin, D; Vicente, M C; Vlachoudis, V; Vlastou, R; Voss, F; Walter, S; Wendler, H; Wiescher, M; Wisshak, K


    Background:The design of new nuclear reactors and transmutation devices requires to reduce the present neutron cross section uncertainties of minor actinides. Purpose: Reduce the $^{243}$Am(n,$\\gamma$) cross section uncertainty. Method: The $^{243}$Am(n,$\\gamma$) cross section has been measured at the n_TOF facility at CERN with a BaF$_{2}$ Total Absorption Calorimeter, in the energy range between 0.7 eV and 2.5 keV. Results: The $^{243}$Am(n,$\\gamma$) cross section has been successfully measured in the mentioned energy range. The resolved resonance region has been extended from 250 eV up to 400 eV. In the unresolved resonance region our results are compatible with one of the two incompatible capture data sets available below 2.5 keV. The data available in EXFOR and in the literature has been used to perform a simple analysis above 2.5 keV. Conclusions: The results of this measurement contribute to reduce the $^{243}$Am(n,$\\gamma$) cross section uncertainty and suggest that this cross section is underestimate...

  12. 30 CFR 243.5 - May another person post a bond or other surety instrument or demonstrate financial solvency on my... (United States)


    ... instrument or demonstrate financial solvency on my behalf? 243.5 Section 243.5 Mineral Resources MINERALS... surety instrument or demonstrate financial solvency on my behalf? Any other person, including a designee, payor, or affiliate, may post a bond or other surety instrument or demonstrate financial solvency...

  13. Neutron-induced fission cross section measurement of 233U, 241Am and 243Am in the energy range 0.5 MeV En 20 MeV at nTOF at CERN

    Energy Technology Data Exchange (ETDEWEB)

    Belloni, F. [Instituto Nazionale de Fisica Nucleare-Italy and CEA-France; Milazzo, P. M. [Instituto Nazionale de Fisica Nucleare, Trieste, Italy; Calviani, M. [Laboratori Nazionali di Legnaro, Italy and CERN, Geneva, Switzerland; Colonna, N. [Instituto Nazionale di Fisica Nucleare, Bari, Italy; Mastinu, P. F. [INFN, Laboratori Nazionali di Legnaro, Italy; Abbondanno, U. [Instituto Nazionale de Fisica Nucleare, Trieste, Italy; Aerts, G. [French Atomic Energy Commission (CEA), Centre de Saclay, Gif sur Yvette; Alvarez, H. [University of Santiago de Compostela, Spain; Alvarez-Velarde, F. [Centro de Investigaciones Energeticas Medioambientales y Technol., Madrid, Spain; Andriamonje, S. [French Atomic Energy Commission (CEA), Centre de Saclay, Gif sur Yvette; Andrzejewski, J. [University of Lodz, Lodz, Poland; Assimakopoulos, P. A. [University of Ioannina, Greece; Audouin, L. [Centre National de la Recherche Scidntifique/IN2P3-IPN, Orsay, France; Badurek, G. [Vienna University of Technology, Austria; Barbagallo, M. [Instituto Nazionale di Fisica Nucleare, Bari, Italy; Baumann, P. [CNRS, Strasbourg, France; Becvar, F. [Charles University, Prague, Czech Republic; Berthoumieux, E. [French Atomic Energy Commission (CEA), Centre de Saclay, Gif sur Yvette; Calvino, F. [Universidad Politecnica de Madrid, Spain; Cerutti, F. [CERN, Geneva, Switzerland; Cano-Ott, D. [CIEMAT, Spain; Capote, R. [IAEA-Vienna, Austria and Universidad de Sevilla, Spain; Carrapico, C. [Instituto Tecnológico e Nuclear (ITN), Lisbon, Portugal; Carrillo de Albornoz, A. [Instituto Tecnológico e Nuclear (ITN), Lisbon, Portugal; Cennini, P. [CERN, Geneva, Switzerland; Chepel, V. [University of Ciombra, Portugal; Chiaveri, E. [CERN, Geneva, Switzerland; Cortes, G. [Universitat Politecnica de Catalunya, Barcelona, Spain; Couture, A. [University of Notre Dame, IN; Cox, J. [University of Notre Dame, IN; Dahlfors, M. [CERN, Geneva, Switzerland; David, S. [CNRS, Orsay, France; Dillmann, I. [Institut fur Kernphysik, Karlsruhe, Germany; Dolfini, R. [Universita di Pavia, Italy; Domingo-Pardo, C. [CSIC-Universidad de Valencia; Koehler, Paul [ORNL; The n_TOF Collaboration, [CERN, Geneva, Switzerland


    Neutron-induced fission cross section measurements of 233U, 243Am and 241Am relative to 235U have been carried out at the neutron time-of-flight facility n TOF at CERN. A fast ionization chamber has been employed. All samples were located in the same detector; therefore the studied elements and the reference 235U target are subject to the same neutron beam.

  14. Haploinsufficiency of ANKRD11 (16q24.3) Is Not Obligatorily Associated with Cognitive Impairment but Shows a Clinical Overlap with Silver-Russell Syndrome (United States)

    Spengler, S.; Oehl-Jaschkowitz, B.; Begemann, M.; Hennes, P.; Zerres, K.; Eggermann, T.


    Microdeletions in 16q24.3 are associated with intellectual disability and a specific phenotype, e.g. short stature and a prominent forehead. The 16q24.3 microdeletion syndrome shows a broad phenotypic overlap with the KBG syndrome, which is caused by mutations within the ANKRD11 gene. Furthermore, both KBG and the 16q24.3 microdeletion syndromes show clinical findings reminiscent of Silver-Russell syndrome (SRS), an imprinting disorder characterized by severe primordial growth retardation. In a cohort of patients referred as SRS, we previously identified a 16q24.3 deletion, but at that time, only patients with larger imbalances in 16q24.3 and intellectual disability had been published. Considering the recent description of the ANKRD11 gene as the causative factor for the 2 16q24.3-associated disorders, we now classified our patient as a 16q24.3 microdeletion syndrome patient exhibiting some characteristic features but normal intelligence. Our case illustrates the broad clinical spectrum associated with microdeletions, and we confirm that the 16q24.3 microdeletion syndrome is a further microdeletion syndrome with very variable expressivity. Indeed, our case is the first 16q24.3 patient of normal intelligence, but we assume that this variant is present in further mentally healthy probands which have not yet been tested. In conclusion, the detection of the 16q24.3 deletion in a proband of unremarkable intellectual capacities once again illustrates the need to perform molecular karyotyping in dysmorphic patients with normal intelligence. PMID:23885231

  15. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.


    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  16. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  17. 243 244Cm studies in C57BL/Do mice

    International Nuclear Information System (INIS)

    Three groups of C57BL/Do mice were injected with different activities of 243244Cm so that the long-term biological effects could be evaluated. Effective skeletal retention equations were used to calculate the cumulative mean skeletal dose in rad at 140 days before death in each group of mice. The primary objective of this study was to determine the relative biological effectiveness (RBE) of 243244Cm compared to 226Ra, using bone sarcoma induction at the end point. Combined data for male and female mice permitted the RBE value +/- SD for 243244Cm to be calculated as 4.4 +/- 1.8 compared to 1.0 for 226Ra. A comparison of RBE values from a previous study in this mouse strain and the value for 243244Cm from this study suggest that the trivalent actinides 241Am, /sup 243,244/Cm, and 249Cf are about three times less effective for bone sarcoma induction than 239Pu

  18. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium


    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray


    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  19. Distribution, retention and dosimetry of plutonium and americium in the rat, dog and monkey after inhalation of an industrial-mixed uranium and plutonium oxide aerosol

    International Nuclear Information System (INIS)

    This study provides information on patterns of radiation dose in laboratory animals after inhalation exposure to an aerosol of one form of mixed uranium and plutonium oxide. The aerosol contained a mixture of UO2 and 750 deg C heat-treated PuO2 obtained from the ball milling operation in a mixed-oxide fuel fabrication process. Americium-241 from the decay of 241Pu was also present in the PuO2 matrix. Fischer-344 rats, Beagle dogs, and Cynomolgus and Rhesus monkeys inhaled aerosols re-generated from dry mixed oxide powders with particle size distribution characteristics similar to those observed in samples collected at the industrial site. Clearance from the lung and distribution in other tissues of the plutonium from this UO2 + PuO2 admixture was similar to what has been observed for PuO2 from laboratory-produced aerosols. The UO2-PuO2 aerosol was relatively insoluble in the lungs of all species. Monkeys and rats cleared plutonium and americium from their lungs faster than dogs. Very little plutonium or americium translocated within the first 2 yr after exposure to tissues other than tracheobronchial lymph nodes. The greater accumulation of plutonium and americium in the tracheobronchial lymph nodes of dogs as compared to monkeys and rats combined with the more rapid initial clearance of these radionuclides from the lungs of rats and monkeys suggests that errors could result from using data from a single animal species to estimate risk to humans from inhalation of these industrial aerosols. (author)

  20. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  1. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)


    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  2. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  3. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  4. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    International Nuclear Information System (INIS)

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1−xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1−xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions. - Graphical abstract: Formation of (UIV/V,AmIII)O2 solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • UV and AmIII are formed in equimolar proportions

  5. 优质花生新品种龙花243示范表现与高产栽培技术%Demonstration performance and high-yielding cultivation technique of high-quailty new variety Longhua243

    Institute of Scientific and Technical Information of China (English)



    New peanut variety Longhua243 was bred by Longyan Agricultural Science Institute,Fujian Province and demonstrated in Shishi City.This cultivar displayed traits of high yield,good quality,uniformity of population and strong vitality.This paper concluded high-yield cultivation techniques including selection of seeds,optimization of sowing technology,fertilizer and water management,disease and pest control,etc.%龙花243系龙岩市农业科学研究所育成的优质花生新品种,在石狮市引进龙花243进行示范种植,表现丰产性和稳产性较好,植株整齐、长势较好等特点。总结出精选种子、优化播种技术、科学施肥、科学管水、加强病虫害防治等高产配套技术。

  6. Competence of alpha spectrometry analysis algorithms used to resolve the 241Am and 243Am alpha peak overlap

    International Nuclear Information System (INIS)

    Five alpha spectrometry analysis algorithms were evaluated for their ability to resolve the 241Am and 243Am peak overlap present under typical low-level counting conditions. The major factors affecting the performance of the algorithms were identified using design-of-experiment combined with statistical analysis of the results. The study showed that the accuracy of the 241Am/243Am ratios calculated by the algorithms depends greatly on the degree of peak deformation and tailing. Despite the improved data quality obtained using an algorithm that may include peak addition and tail estimation, the accurate determination of 241Am by alpha spectrometry relies primarily on reduction of peak overlap rather than on algorithm selection

  7. Re-evaluation of neutron nuclear data for 242mAm, 243Am, 99Tc and140Ce

    International Nuclear Information System (INIS)

    The evaluated nuclear data given in JENDL-3.2 were compared with other evaluated data sets and available experimental data, for important minor actinides of 242mAm and 243Am, and fission product nuclides of 99Tc and 140Ce. Since problems were found as a result of the comparison, the data of JENDL-3.2 were improved for these nuclides. It was found that the evaluated data of Maslov et al. were superior to the others. They were adopted for 242mAm and 243Am after further improvements. For 99Tc and 140Ce, resonance parameters and optical model parameters were improved. The cross sections of these two nuclides in the smooth part were re-calculated. The present results were given in the neutron energy range from 10-5 eV to 20 MeV in the ENDF-6 format, and adopted to JENDL-3.3. (author)

  8. The influence of impurities for cross section measurement of {sup 241,243}Am(n,f) reactions

    Energy Technology Data Exchange (ETDEWEB)

    Kai, Tetsuya; Kobayashi, Katsuhei; Yamamoto, Shuji; Fujita, Yoshiaki; Kimura, Itsuro; Miyoshi, Mitsuharu; Yamamoto, Hideki [Kyoto Univ. (Japan); Shinohara, Nobuo


    The influence of the impurities on the fission cross section measurements for {sup 241}Am and {sup 243}Am has been investigated with the practical results. Following cases have been considered as the influence of impurities; (a) experiments with the {sup 241}Am sample that contains impurities originally, and (b) experiments with the {sup 243}Am sample that contains impurities produced by {alpha}, {beta} decays after the chemical purification. The present study has demonstrated the usefulness of pure samples by the comparison of the experiments using the sample on the market with those using the pure sample processed by the authors. Particularly on the case (b), the correction of the impurity through the periodical measurements was experimentally performed (about 18% around 0.3 eV in 4 weeks after the chemical purification). (author)

  9. Preliminary results from uranium/americium affinity studies under experimental conditions for cesium removal from NPP ''Kozloduy'' simulated wastes solutions

    International Nuclear Information System (INIS)

    We use the approach described by Westinghouse Savannah River Company using ammonium molybdophosphate (AMP) to remove elevated concentrations of radioactive cesium to facilitate handling waste samples from NPP Kozloduy. Preliminary series of tests were carried out to determine the exact conditions for sufficient cesium removal from five simulated waste solutions with concentrations of compounds, whose complexing power complicates any subsequent processing. Simulated wastes solutions contain high concentrations of nitrates, borates, H2C2O4, ethylenediaminetetraacetate (EDTA) and Citric acid, according to the composition of the real waste from the NPP. On this basis a laboratory treatment protocol was created. This experiment is a preparation for the analysis of real waste samples. In this sense the results are preliminary. Unwanted removal of non-cesium radioactive species from simulated waste solutions was studied with gamma spectrometry with the aim to find a compromise between on the one hand the AMP effectiveness and on the other hand unwanted affinity to AMP of Uranium and Americium. Success for the treatment protocol is defined by proving minimal uptake of U and Am, while at the same time demonstrating good removal effectiveness through the use of AMP. Uptake of U and Am were determined as influenced by oxidizing agents at nitric acid concentrations, proposed by Savannah River National laboratory. It was found that AMP does not significantly remove U and Am when concentration of oxidizing agents is more than 0.1M for simulated waste solutions and for contact times inherent in laboratory treatment protocol. Uranium and Americium affinity under experimental conditions for cesium removal were evaluated from gamma spectrometric data. Results are given for the model experiment and an approach for the real waste analysis is chosen. Under our experimental conditions simulated wastes solutions showed minimal affinity to AMP when U and Am are most probably in the

  10. Quantum Partial Searching Algorithm of a Database with Several Target Items

    Institute of Scientific and Technical Information of China (English)

    ZHONG Pu-Cha; BAO Wan-Su; WEI Yun


    Choi and Korepin [Quantum Information Processing 6(2007)243] presented a quantum partial search algorithm of a database with several target items which can find a target block quickly when each target block contains the same number of target items. Actually, the number of target items in each target block is arbitrary. Aiming at this case, we give a condition to guarantee performance of the partial search algorithm to be performed and the number of queries to oracle of the algorithm to be minimized. In addition, by further numerical computing we come to the conclusion that the more uniform the distribution of target items, the smaller the number of queries.

  11. The ancient mammalian KRAB zinc finger gene cluster on human chromosome 8q24.3 illustrates principles of C2H2 zinc finger evolution associated with unique expression profiles in human tissues (United States)


    explain the observed expression pattern similarities. Conclusions The ZNF genes at human 8q24.3 form a relatively old mammalian paralog group conserved in eutherian mammals for at least 130 million years. The members persisted after initial duplications by undergoing subfunctionalizations in their expression patterns and target site recognition. KRAB-ZNF mediated repression of transcription might have shaped organogenesis in mammalian ontogeny. PMID:20346131

  12. The ancient mammalian KRAB zinc finger gene cluster on human chromosome 8q24.3 illustrates principles of C2H2 zinc finger evolution associated with unique expression profiles in human tissues

    Directory of Open Access Journals (Sweden)

    Ding Guohui


    modules partly explain the observed expression pattern similarities. Conclusions The ZNF genes at human 8q24.3 form a relatively old mammalian paralog group conserved in eutherian mammals for at least 130 million years. The members persisted after initial duplications by undergoing subfunctionalizations in their expression patterns and target site recognition. KRAB-ZNF mediated repression of transcription might have shaped organogenesis in mammalian ontogeny.

  13. Overview of NATO/AC 243/Panel 3 activities concerning radiowave propagation in coastal environments (United States)

    Christophe, F.; Douchin, N.; Hurtaud, Y.; Dion, D.; Makaruschka, R.; Heemskerk, H.; Anderson, K.


    The performances of most systems operating at RF and millimeter waves can be seriously affected by propagation effects. That is the reason why NATO established the Research Study group No. 8 (RSG8) within Panel 3 (physics and electronics) of Defense Research Group (AC 243), with its Propagation Subgroup (PSG) responsible for the propagation aspects. Comparison of mm and other wavelengths was to be considered. In maritime and coastal environments, the use of such wavelengths for various military applications like anti-ship seekers, fire control radars, ship to ship communications or Electronic Support Measurements (ESM) led to the setting up of specific measurement campaigns; the last three are reported hereafter. The first two experiments used facilities close to Lorient, on the Atlantic coast, and Toulon, on the Mediterranean coast of France, with the purpose of documenting the refractive effects for medium range over the horizon paths. These experiments where are referred to as Lorient 89 and Toulon 90 campaigns, are described in this paper, and some typical results are presented. The latest cooperative work of RSG8/PSG took place recently (fall 1993) near Lorient, on a line-of-sight 10 km path over seawater. This experiment, referred to as Lorient 93 campaign, was devoted to the analysis of phase-front distortions due to multipath along with refractive effects, and to the assessment of performances for naval systems like short range tracking radars. Analysis of the data, either on a statistical base or as specific case studies, is being performed presently, but some early typical results will be given in this paper after a detailed description of the experiment.

  14. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    Energy Technology Data Exchange (ETDEWEB)

    Burns, P.A.; Cooper, M.B.; Lokan, K.H.; Wilks, M.J.; Williams, G.A. [Australian Radiation Lab., Melbourne, VIC (Australia)


    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ``one point`` safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author).

  15. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  16. Characterization of a Sealed Americium-Beryllium (AmBe) Source by Inductively Coupled Plasma Mass Spectrometry

    International Nuclear Information System (INIS)

    Two Americium-Beryllium neutron sources were dismantled, sampled (sub-sampled) and analyzed via inductively coupled plasma mass spectrometry (ICP-MS). Characteristics such as 'age' since purification, actinide content, trace metal content and inter and intra source composition were determined. The 'age' since purification of the two sources was determined to be 25.0 and 25.4 years, respectively. The systematic errors in the 'age' determination were ± 4 % 2s. The amount and isotopic composition of U and Pu varied substantially between the sub-samples of Source 2 (n=8). This may be due to the physical means of sub-sampling or the way the source was manufactured. Source 1 was much more consistent in terms of content and isotopic composition (n=3 sub-samples). The Be-Am ratio varied greatly between the two sources. Source 1 had an Am-Be ratio of 6.3 ± 52 % (1s). Source 2 had an Am-Be ratio of 9.81 ± 3.5 % (1s). In addition, the trace element content between the samples varied greatly. Significant differences were determined between Source 1 and 2 for Sc, Sr, Y, Zr, Mo, Ba and W.

  17. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  18. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  19. Migration of the fission products strontium, technetium, iodine, cesium, and the actinides neptunium, plutonium, americium in granitic rock

    International Nuclear Information System (INIS)

    Rock samples were taken from drilling cores in granitic and granodioritic rock, and small (2x2x2 cm) rock tablets from the drilling cores were exposed to a groundwater solution containing one of the studied elements at race levels. The concentration of the element versus penetration depth in the rock tablet was measured radiometrically. The sorption on the mineral faces and the migration into the rock was studied, by an autoradiographic technique. The cationic fission products strontium and cesium had apparent diffusivities of 10-13-10-14 m2/s. They migrate mainly in fissures or filled fractures containing e.g., calcite, epidote or chlorite or in veins with hgih capacity minerals (e.g. biotite). The anionic fission products iodine and technetium had apparent diffusivities of about 10-14 m2/s. These species migrate along mineral boundaries and in open fractures and to a minor extent in high capacity mineral veins. The migration of the actinides neptunium, plutonium and americium is very slow (in the mm-range after 2-3 years contact time). The apparent diffusivities were about 10-15 m2/s. The actinide migration into the rock was largely confined to fissures. (orig./HP)

  20. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  1. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  2. 30 CFR 243.6 - When must I or another person meet the bonding or financial solvency requirements under this part? (United States)



  3. 30 CFR 243.9 - Will MMS continue to suspend my obligation to comply with an order if I seek judicial review in a... (United States)



  4. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  5. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  6. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  7. The chiral transition on a 243 x 10 lattice with Nf = 2 clover sea quarks studied by overlap valence quarks

    International Nuclear Information System (INIS)

    Overlap fermions are particularly well suited to study the finite temperature dynamics of the chiral symmetry restoration transition of QCD, which might be just an analytic crossover. Using gauge field configurations on a 243 x 10 lattice with Nf=2 flavours of dynamical Wilson-clover quarks generated by the DIK collaboration, we compute the lowest 50 eigenmodes of the overlap Dirac operator and try to locate the transition by fermionic means. We analyse the spectral density, local chirality and localisation properties of the low-lying modes and illustrate the changing topological and (anti-) selfdual structure of the underlying gauge fields across the transition. (orig.)

  8. On the radio properties of the intermediate-mass black hole candidate ESO 243-49 HLX-1


    Cseh, D.; Webb, N. A.; Godet, O.; D. Barret(IRAP, Toulouse, France); Corbel, S.; Coriat, M.; Falcke, H.; Farrell, S. A.; Körding, E.; Lenc, E.; Wrobel, J. M.


    We present follow-up radio observations of ESO 243-49 HLX-1 from 2012 using the Australia Telescope Compact Array (ATCA) and the Karl G. Jansky Very Large Array (VLA). We report the detection of radio emission at the location of HLX-1 during its hard X-ray state using the ATCA. Assuming that the `Fundamental Plane' of accreting black holes is applicable, we provide an independent estimate of the black hole mass of $M_{\\rm{BH}}\\leq2.8^{+7.5}_{-2.1} \\times 10^{6}$ M$_{\\odot}$ at 90% confidence....

  9. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)


    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  10. Recovery of plutonium and americium from laboratory acidic waste solutions using tri-n-octylamine and octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide. (United States)

    Michael, K M; Rizvi, G H; Mathur, J N; Kapoor, S C; Ramanujam, A; Iyer, R H


    Plutonium from acidic waste solutions has been recovered quantitatively using tri-n-octylamine (TnOA) in xylene and americium using a mixture of octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide (CMPO) and TBP in dodecane by extraction and extraction chromatographic methods. The Pu ( IV ) TnOA species extracted into the organic phase from higher nitric acid concentrations has been confirmed as (R(3)NH)(2)Pu(NO(3))(6) (where R(3)N = TnOA by employing slope analysis as well as spectrophotometric studies. PMID:18966958

  11. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;


    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state properties...... phase in order to match the experimental data. Thus, neither the GGA+U nor the HYB-DFT methods are able to describe the energetics of Am metal properly in the entire pressure range from 0 GPa to 50 GPa with a single choice of their respectiveU and α parameters. Low binding-energy peaks in the...

  12. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  13. Uptake of curium (244Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    International Nuclear Information System (INIS)

    Curium (244Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium. (author)

  14. Uptake of curium (/sup 244/Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Miramand, P.; Germain, P.; Arzur, J.C.


    Curium (/sup 244/Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium.

  15. Discovery of an optical counterpart to the hyperluminous X-ray source in ESO 243-49

    CERN Document Server

    Soria, Roberto; Graham, Alister W; Kong, Albert K H; Kuin, N Paul M; Li, I-Hui; Liu, Ji-Feng; Wu, Kinwah


    The existence of black holes of masses ~ 10^3-10^4 Msun has important implications for the formation and evolution of star clusters and galaxies. The strongest candidate so far is the hyperluminous X-ray source HLX1, apparently located in the S0-a galaxy ESO 243-49, but the lack of an identifiable optical counterpart had hampered its interpretation. Using the Magellan telescope, we discovered an unresolved optical source with R = (24.6 +/- 0.2) mag and V = (25.4 +/- 0.3) mag within the X-ray error circle. This implies an X-ray/optical flux ratio ~ 1000. Taking the same distance as ESO 243-49, we obtain an intrinsic brightness M_R = (-10.2 +/- 0.3) mag. With the combined optical and X-ray measurements, we put constraints on the nature of HLX1. We rule out a foreground star and a background AGN. A foreground accreting neutron star is unlikely but cannot be completely ruled out. We also examined the properties of the host galaxy by combining Swift/UVOT observations with stellar population modelling. We found tha...

  16. Investigation of solubility of cesium, strontium, barium, rare-earth, uranium and americium fluorides in acid nitrosyl fluoride (NOFx3HF)

    International Nuclear Information System (INIS)

    Solubility of Am and other elements, which are fission products, in acid nitrosylfluoride has been studied. Cesium fluoride has maximum solubility; uranium tetrafluoride is also noticeably soluble; americium trifluoride is practically insoluble; fluorides of rare earth elements are slightly soluble in NOFx3HF. Analysis of the solid phase obtained after treating the mixture of the above fluorides with acid nitrosylfluoride has shown that cesium fluoride reacts with NOFx3HF with the formation of an acid salt (CsFxHF), whereas fluorides of alkaline and rare earth elements remain unchanged. The behaviour of a mixture of cesium, barium, and lanthanum fluorides in the process of three-multiple treating with acid nitrosylfluoride has been studied. It is shown that more than 98% of cesium fluoride and 5% of barium fluoride pass into the mother liquor while lanthanum fluoride remains completely in the solid phase. The data on americium fluoride solubility in acid nitrosylfluoride have indicated that it behaves in the same way as fluorides of rare earth elements; it is practically insoluble in HOFx3HF

  17. Determining the americium transmutation rate and fission rate by post-irradiation examination within the scope of the ECRIX-H experiment

    International Nuclear Information System (INIS)

    The ECRIX-H experiment aims to assess the feasibility of transmuting americium micro-dispersed in an inert magnesia matrix under a locally moderated neutron flux in the Phénix reactor. A first set of examinations demonstrated that pellet behaviour was satisfactory with moderate swelling at the end of the irradiation. Additional post-irradiation examinations needed to be conducted to confirm the high transmutation rate so as to definitively conclude on the success of the ECRIX-H experiment. This article presents and discusses the results of these new examinations. They confirm the satisfactory behaviour of the MgO matrix not only during the basic irradiation but also during post-irradiation thermal transients. These examinations also provide additional information on the behaviour of fission products both in the americium-based particles and in the MgO matrix. These results particularly validate the transmutation rate predicted by the calculation codes using several different analytical techniques. The fission rate is also determined

  18. Recoil-alpha-fission and recoil-alpha-alpha-fission events observed in the reaction Ca-48 + Am-243

    CERN Document Server

    Forsberg, U; Andersson, L -L; Di Nitto, A; Düllmann, Ch E; Gates, J M; Golubev, P; Gregorich, K E; Gross, C J; Herzberg, R -D; Hessberger, F P; Khuyagbaatar, J; Kratz, J V; Rykaczewski, K; Sarmiento, L G; Schädel, M; Yakushev, A; Åberg, S; Ackermann, D; Block, M; Brand, H; Carlsson, B G; Cox, D; Derkx, X; Dobaczewski, J; Eberhardt, K; Even, J; Fahlander, C; Gerl, J; Jäger, E; Kindler, B; Krier, J; Kojouharov, I; Kurz, N; Lommel, B; Mistry, A; Mokry, C; Nazarewicz, W; Nitsche, H; Omtvedt, J P; Papadakis, P; Ragnarsson, I; Runke, J; Schaffner, H; Schausten, B; Shi, Y; Thörle-Pospiech, P; Torres, T; Traut, T; Trautmann, N; Türler, A; Ward, A; Ward, D E; Wiehl, N


    Products of the fusion-evaporation reaction Ca-48 + Am-243 were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum f\\"ur Schwerionenforschung. Amongst the detected thirty correlated alpha-decay chains associated with the production of element Z=115, two recoil-alpha-fission and five recoil-alpha-alpha-fission events were observed. The latter are similar to four such events reported from experiments performed at the Dubna gas-filled separator. Contrary to their interpretation, we propose an alternative view, namely to assign eight of these eleven decay chains of recoil-alpha(-alpha)-fission type to start from the 3n-evaporation channel 115-288. The other three decay chains remain viable candidates for the 2n-evaporation channel 115-289.

  19. New data from the 243Am + 48Ca reaction give cross-bombardment verification of elements 113, 115 and 117

    International Nuclear Information System (INIS)

    The reaction 243Am + 48Ca has been reinvestigated to provide new evidence for the discovery of elements 113, 115. Twenty eight new 288115 decay chains were detected in this reaction to increase from three to 31 the number of 288115 atoms observed. In addition, four new decay chains were observed for the first time and assigned to the decay of 289115. These new 289115 events have the same properties for their decay chains as those observed for 289115 populated in the alpha decay of 293117 produced in the 249Bk + 48Ca reaction to provide cross-bombardment evidence. These new high statistics data sets and the cross-bombardment agreement provide definitive evidence for the discoveries of the new elements with Z = 113, 115, 117.

  20. Viscosity Measurements of Ethyl Fluoride (R161) from 243 K to 363 K at Pressures up to 30 MPa (United States)

    Meng, Xianyang; Gu, Xiaoyun; Wu, Jiangtao; Bi, Shengshan


    The Montreal Protocol and its subsequent amendments have created a schedule to replace ozone depletion substances, such as chlorofluorocarbons and hydrochlorofluorocarbons, with chlorine-free molecules in several industrial applications. Ethyl fluoride (R161, C2H5F, 353-36-6) was found to be a potential alternative refrigerant for the replacement of controlled substances, such as R22 with excellent cycle performance. In this work, the viscosity of ethyl fluoride is reported at temperatures from 243 K to 363 K and at pressures from saturation pressure to 30 MPa. The experiment was performed with a calibrated vibrating-wire viscometer, which exhibited a combined expanded uncertainty of 2.5 % with a level of confidence of 0.95 (k = 2) for such a fluid. A scheme based on a hard-spheres model was used to correlate the experimental results. The average absolute deviation of the experimental results from the correlations for R161 is 0.88 %.

  1. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  2. Sputter target (United States)

    Gates, Willard G.; Hale, Gerald J.


    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  3. Inhaled americium dioxide

    International Nuclear Information System (INIS)

    This project includes experiments to determine the effects of Zn-DTPA therapy on the retention, translocation and biological effects of inhaled 241AmO2. Beagle dogs that received inhalation exposure to 241AmO2 developed leukopenia, clincial chemistry changes associated with hepatocellular damage, and were euthanized due to respiratory insufficiency caused by radiation pneumonitis 120 to 131 days after pulmonary deposition of 22 to 65 μCi 241Am. Another group of dogs that received inhalation exposure to 241AmO2 and were treated daily with Zn-DTPA had initial pulmonary deposition of 19 to 26 μCi 241Am. These dogs did not develop respiratory insufficiency, and hematologic and clinical chemistry changes were less severe than in the non-DTPA-treated dogs

  4. 30 CFR 243.7 - What must a person do when posting a bond or other surety instrument or demonstrating financial... (United States)


    ....7 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT SUSPENSIONS PENDING APPEAL AND BONDING-MINERALS REVENUE MANAGEMENT General Provisions § 243.7 What...(a), or any other theory, as a defense if MMS calls your bond or requires you to pay based on...

  5. Synthesis of 24S and 24R-hydroxy-[24-3H] vitamin D3 and their metabolism in rachitic rats

    International Nuclear Information System (INIS)

    An epimeric mixture of 24-hydroxy-[24-3H] vitamin D3 was synthesized by the reduction of 24-ketovitamin D3 by sodium borotritide. The epimeric mixture was converted to the trimethylsilylether derivatives and subjected to high-pressure liquid chromatography using silica gel columns to separate the 24-hydroxy-[24-3H] vitamin D3 isomers. The 24R-hydroxy-[24-3H]vitamin D3 induced calcification in rachitic rats while the 24S-hydroxy-[24-3H]vitamin D3 had little or no such activity. As both isomers of 24-hydroxy-vitamin D3 are metabolized to 24,25-dihydroxyvitamin D3, it appears that the 24-hydroxyvitamin D3-25-hydroxylase does not discriminate between the isomers. Only the R-isomer of 24-hydroxyvitamin D3 is metabolized to 1,24-dihydroxyvitamin D3, although only trace amounts of this compound were found 2 days after the administration of 24-hydroxyvitamin D3. The striking difference in the metabolism of the isomers is the high selectivity of the 1-hydroxylase for the R-isomer. It is suggested that the high specificity of biological activity for the R-isomer of 24-hydroxyvitamin D3 is because of the specificity of the 1-hydroxylation of 24,25-dihydroxyvitamin D3 for the R configuration

  6. Partitioning studies in China and the separation of americium and fission product rare earths with dialkyl phosphinic acid and its thio-substituted derivatives

    International Nuclear Information System (INIS)

    Studies on the TRPO extractions process for recovering actinides from highly active waste (HAW) and its application to the pretreatment of Chinese HAW are described. The removal of Sr by di-cyclohexyl 18 crown 6 and the removal of Cs by spherical titanium ferrous hexa-cyanate from acidic waste are also described. Results of the extraction of trivalent americium and fission product rare earths (FPREs) by dialkyl-phosphinic, dialkyl-mono-thio-phosphinic and dialkyl-di-thio-phosphinic acids are reported. Dialkyl-thio-phosphinic acid (commercial product Cyanex 301, alkyl =2, 4, 4-methyl-pentyl) shows very high selectivity towards Am. Using 1M Cyanex 301 -kerosene as extractant, 99.9 % Am can be separated from 0.5M(Pr+Nd)(NO3)3 solution with 3-4 extraction stages and 3-4 scrubbing stages. (authors)

  7. Theoretical and experimental study of the bio-geochemical behaviour of americium 241 in simplified rhizosphere conditions. Application to a calcareous agricultural soil

    International Nuclear Information System (INIS)

    Americium 241, is one of the most radio-toxic contaminant produced during the nuclear fuel cycle. It can be found in all environmental compartments, in particular the soils. The main goals of this study are to identify, quantify and model the effect of the main factors controlling the mobility of 241Am in the rhizosphere and the agricultural soils. The physico-chemical parameters of the soil and of the soil solution, the potential role of microorganisms on the sorption-desorption processes, and the speciation of americium in solution have been more particularly studied. 241Am remobilization has been studied at the laboratory using leaching experiments performed in controlled conditions on reworked calcareous soils artificially contaminated with 241Am. The soil samples have been washed out in different hydrodynamic conditions by solutions with various compositions. The eluted solution has been analyzed (pH, conductivity, ionic composition, Fetot, organic acids, 241Am) and its bacterial biomass content too. The overall results indicate that 241Am remobilization is contrasted and strongly linked with the condition under study (pH, ionic strength, glucose and/or citrate concentration). Therefore, a solution in equilibrium with the soil or containing small exudate concentrations (10-4 M) re-mobilizes only a very small part of the americium fixed on the solid phase. The desorption of 241Am corresponds to a solid/liquid coefficient of partition (Kd) of about 105 A significant addition of glucose induces an important dissolution of soil carbonates by the indirect action of microorganisms, but does not significantly favor the 241Am remobilization. On the other hand, the presence of strong citrate concentrations (≥ 10-2 M) allows 300 to 10000 time greater re-mobilizations by the complexing of 241Am released after the dissolution of the carrying phases. Finally, the colloidal transport of 241Am has been systematically observed in a limited but significant extend and

  8. An evaluation of the VM/VF ratio to standard UO2 and MOX fuel with 4,5% enrichment and 1% of americium insertion

    International Nuclear Information System (INIS)

    A growing interest exists in the development of techniques for burning and transmuting minor actinides. Some indicate the possibility of differentiated burnup when studying different VM/VF. The VM/VF ratio, moderator volume/fuel volume, is directly related with the value obtained for the multiplication factor k. There is a VM/VF for which k is maximum, and this is directly related with the fuel composition. This work is a study to find a better value of VM/VF, using the WIMS-D5 code, considering a UO2 fuel and a MOX fuel, with 1% Americium insertion. The following parameters were appraised: spectrum hardening, boron worth, and reactivity temperature coefficients. (author)

  9. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos


    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  10. Preliminary application of 241-Americium calcaneus bone mineral density measurement in osteoporosis. Comparison with double X-ray densitometry of the lumber spine

    International Nuclear Information System (INIS)

    Bone mineral density (BMD) of calcaneus in 54 normals, 45 Osteoporosis, 25 suspected osteoporosis and 16 other non-osteoporosis patients, a total of 140 cases were measured by HUAKE (HK-1) 241-Americium BMD absorpmetry, among them 43 were compared with that of lumber spine (L2 - L4) measured by Lunar Corporation's Expert-XL absorpmeter. BMD of normal group of calcaneus was (409.8 +- 79.4) mg/cm2. The BMD were decreased slowly with the increasing age. The BMD of osteoporosis, suspected osteoporosis and non-osteoporosis group were 230.3 +- 62.3, 395.7 +- 57.4 and 363.3 +- 51.9 mg/cm2 respectively. The BMD of osteoporosis group was much lower than that of normal group, and also lower than that of the other two groups, among 26 patients (57.78%) had bone fracture, all was in accordance with the clinical diagnosis of osteoporosis. The BMD of suspected osteoporosis and non-osteoporosis had no significant difference with normal group. The coefficient variation (CV) of BMD in repeated measurement in calcaneus of 4 participants was less than 1.2%. The correlative coefficient (r) between BMD of calcaneus and lumber spine (L2 - L4) group was 0.6824. The correlative coefficient of normal young adult-matched percentage and T value in 2 groups were 0.6863 and 0.6755 respectively, whereas aged-matched percentage, Z value were 0.4614 and 0.5009 respectively. In conclusion 241-Americium calcaneus BMD absorpmetry has the advantage of low price, easy to operate, reliable and valuable in diagnosis osteoporosis. The correlations of calcaneus and lumber spine BMD, normal young adult-matched percentage and T value were rather good

  11. 243例双J管内引流的并发症和处置%Complications and treatment for internal drainage with double-J tube in 243 cases

    Institute of Scientific and Technical Information of China (English)

    鄢俊安; 杨超; 张恒; 沈文浩; 李龙坤; 陈志文; 周占松; 李为兵


    Objective To anatyze the comptications of internat drainage with doubte-J tube and to discuss ihe disposat programs. Methods The comptications of 243 patients who underwent internat drainage with doubte-J tube from 2008 to 2010 in our institute were ret-rospectivety anatyzed and the disposat programs were discussed. Resutts There were seven kinds of comptications inctuding discomfort of tocation (72 cases,29. 6% ) , bteeding (34 cases, 14. 0% ) , catcutus in tube watt( 19 cases,7. 8% ) , reftux ( 32 cases, 13. 2% ) , infection (47 cases,19. 3% ) ,painfutness (36 cases, 14. 8% ) ,doubte-J tube rupture (3 cases, 1. 2% ) , etc. Att of them were given symptomatic treatment. Conctusion The tocations shoutd be adjusted according to the conditions in the ptacement of doubte-J tube. The doubte-J tube shoutd be removed immediatety if comptications of severe infection,urinary reftux and hematuria occurred.%目的 分析双J管内引流的并发症,探讨其处置方案.方法 对2008年至2010年在我院诊治置入双J管的部分病例所发的并发症进行回顾性分析,探讨和总结处置方式.结果 243例双J管内引流所致的并发症主要有7种,包括位置不适(72例,29.6%)、出血(34例,14.0%)、管壁伴发结石(19例,7.8%)、返流(32例,13.2%)、感染(47例,19.3%)、疼痛(36例,14.8%)、双J管断裂(3例,1.2%)等,分别给予了对症处理.结论 在双J管留置体内过程中根据情况调整双J管的位置,若产生严重的感染、尿液返流、血尿等并发症时,宜尽早拔除双J管.

  12. Hidrocefalia derivada na infância: um estudo clínico-epidemiológico de 243 observações consecutivas Shunted hydrocephalus in childhood: an epidemiological study of 243 consecutive observations

    Directory of Open Access Journals (Sweden)

    Susana Ely Kliemann


    Full Text Available Os objetivos deste estudo foram analisar as características epidemiológicas e clínicas de 243 crianças com hidrocefalia derivada, acompanhadas durante 1 a 27 anos, assim como identificar os fatores relacionados aos distúrbios psicomotores, epilepsia e ao óbito. A meningite pós-derivação e os distúrbios mecânicos do sistema foram as complicações mais freqüentes (22,3% e 30,7%, respectivamente. A média de derivação por paciente foi 1,47. Distúrbios motores graves ocorreram em 34,3%, déficit cognitivo em 58,5% e epilepsia em 43,6% dos pacientes. Os distúrbios motores correlacionaram-se positivamente com o grau da hidrocefalia. Houve maior incidência de déficit cognitivo e epilepsia nos casos de hidrocefalia pós-meningite. O óbito ocorreu em 52 pacientes e estes apresentaram um percentual maior de neoplasia do sistema nervoso central e de distúrbios motores na última avaliação, assim como de retirada da primeira derivação por meningite precoce, ocorrida até 2 meses após a derivação.This study aimed to evaluate the epidemiological and clinical data of 243 children with shunted hydrocephalus, followed-up during 1 to 27 years, as well as to identify the risk factors for psychomotor disturbances, epilepsy and death. Postoperative meningitis and mechanical problems were the most frequent complications (22.3% and 30.7%, respectively. There was an average of 1.47 shunt per patient. Severe motor disturbances occurred in 34.3%, cognitive deficits in 58.5% and epilepsy in 43.6%. Motor disturbances correlated positively with the degree of hydrocephalus. The majority of patients with hydrocephalus due to meningitis presented cognitive deficits and a significant incidence of epilepsy. Death occurred in 52 patients and there was a higher percentage of brain tumours in this group, as well as the replacement of the first shunt device due to precocious postoperative meningitis.

  13. Target capture and target ghosts (United States)

    Auerbach, Steven P.


    Optimal detection methods for small targets rely on whitened matched filters, which convolve the measured data with the signal model, and whiten the result with the noise covariance. In real-world implementations of such filters, the noise covariance must be estimated from the data, and the resulting covariance estimate may be corrupted by presence of the target. The resulting loss in SNR is called 'target capture'. Target capture is often thought to be a problem only for bright targets. This presentation shows that target capture also arises for dim targets, leading to an SNR loss which is independent of target strength and depends on the averaging method used to estimate the noise covariance. This loss is due to a 'coherent beat' between the true noise and that portion of the estimated noise covariance due to the target. This beat leads to 'ghost targets', which diminish the target SNR by producing a negative target ghost at the target's position. A quantitative estimate of this effect will be given, and shown to agree with numerical results. The effect of averaging on SNR is also discussed for data scenes with synthetic injected targets, in cases where the noise covariance is estimated using 'no target' data. For these cases, it is shown that the so-called 'optimal' filter, which uses the true noise covariance, is actually worse than a 'sub-optimal' filter which estimates the noise from scene. This apparent contradiction is resolved by showing that the optimal filter is best if the same filter is used for many scenes, but is outperformed by a filter adapted to a specific scene.

  14. Experimental and theoretical study of the photodissociation reaction of thiophenol at 243 nm: Intramolecular orbital alignment of the phenylthiyl radical (United States)

    Lim, Ivan S.; Lim, Jeong Sik; Lee, Yoon Sup; Kim, Sang Kyu


    The photoinduced hydrogen (or deuterium) detachment reaction of thiophenol (C6H5SH) or thiophenol-d1 (C6H5SD) pumped at 243nm has been investigated using the H (D) ion velocity map imaging technique. Photodissociation products, corresponding to the two distinct and anisotropic rings observed in the H (or D) ion images, are identified as the two lowest electronic states of phenylthiyl radical (C6H5S•). Ab initio calculations show that the singly occupied molecular orbital of the phenylthiyl radical is localized on the sulfur atom and it is oriented either perpendicular or parallel to the molecular plane for the ground (B1) and the first excited state (B2) species, respectively. The experimental energy separation between these two states is 2600±200cm-1 in excellent agreement with the authors' theoretical prediction of 2674cm-1 at the CASPT2 level. The experimental anisotropy parameter (β) of -1.0±0.05 at the large translational energy of D from the C6H5SD dissociation indicates that the transition dipole moment associated with this optical transition at 243nm is perpendicular to the dissociating S-D bond, which in turn suggests an ultrafast D +C6H5S•(B1) dissociation channel on a repulsive potential energy surface. The reduced anisotropy parameter of -0.76±0.04 observed at the smaller translational energy of D suggests that the D +C6H5S•(B2) channel may proceed on adiabatic reaction paths resulting from the coupling of the initially excited state to other low-lying electronic states encountered along the reaction coordinate. Detailed high level ab initio calculations adopting multireference wave functions reveal that the C6H5S•(B1) channel may be directly accessed via a (nπ,σ*)1 photoexcitation at 243nm while the key feature of the photodissociation dynamics of the C6H5S•(B2) channel is the involvement of the (nπ,π*)3→(nσ,σ*)3 profile as well as the spin-orbit induced avoided crossing between the ground and the (nπ,σ*)3 state. The S-D bond

  15. Experimental and theoretical study of the photodissociation reaction of thiophenol at 243 nm: Intramolecular orbital alignment of the phenylthiyl radical

    International Nuclear Information System (INIS)

    The photoinduced hydrogen (or deuterium) detachment reaction of thiophenol (C6H5SH) or thiophenol-d1 (C6H5SD) pumped at 243 nm has been investigated using the H (D) ion velocity map imaging technique. Photodissociation products, corresponding to the two distinct and anisotropic rings observed in the H (or D) ion images, are identified as the two lowest electronic states of phenylthiyl radical (C6H5S·). Ab initio calculations show that the singly occupied molecular orbital of the phenylthiyl radical is localized on the sulfur atom and it is oriented either perpendicular or parallel to the molecular plane for the ground (B1) and the first excited state (B2) species, respectively. The experimental energy separation between these two states is 2600±200 cm-1 in excellent agreement with the authors' theoretical prediction of 2674 cm-1 at the CASPT2 level. The experimental anisotropy parameter (β) of -1.0±0.05 at the large translational energy of D from the C6H5SD dissociation indicates that the transition dipole moment associated with this optical transition at 243 nm is perpendicular to the dissociating S-D bond, which in turn suggests an ultrafast D+C6H5S·(B1) dissociation channel on a repulsive potential energy surface. The reduced anisotropy parameter of -0.76±0.04 observed at the smaller translational energy of D suggests that the D+C6H5S·(B2) channel may proceed on adiabatic reaction paths resulting from the coupling of the initially excited state to other low-lying electronic states encountered along the reaction coordinate. Detailed high level ab initio calculations adopting multireference wave functions reveal that the C6H5S·(B1) channel may be directly accessed via a 1(nπ,σ*) photoexcitation at 243 nm while the key feature of the photodissociation dynamics of the C6H5S·(B2) channel is the involvement of the 3(nπ,π*)→3(nσ,σ*) profile as well as the spin-orbit induced avoided crossing between the ground and the 3(nπ,σ*) state. The S-D bond

  16. Concentration and speciation of plutonium, americium, uranium, thorium, potassium and 137Cs in a venice canal sediment sample (United States)

    Testa, C.; Desideri, D.; Guerra, F.; Meli, M. A.; Roselli, C.; Degetto, S.


    A sequential extraction method consisting of six operationally-defined fractions has been developed for determining the geochemical partitioning of natural (U, Th, 40K) and antropogenic (Pu, Am, 137Cs) radionuclides in a 40-50 cm deep sediment sample collected in a Venice canal. Extraction chromatography with Microthene-TOPO (U, Th), Microthene-TNOA (Pu) and Microthene-HDEHP (Am) column was used for the chemical separation of a single radionuclide; the final recoveries were calculated by adding 236U, 229Th, 242Pu and 243Am as the yield tracers. After electrodeposition the alpha spectrometry was carried out. 137Cs and 40K were measured by gamma spectrometry. The total concentrations in the wet sample (Bq/kgd), obtained by a complete disgregation of the matrix by wet and dry treatment, were the following: 239+240Pu=1.03±0.07, 238Pu=0.022±0.005, 241Am=0.337±0.027, 137Cs=9.78±0.78, 238U=28.84±1.62, 232Th=21.42±1.93, 40K=376.05±12.78. The mean ratio 238Pu/239+240Pu (0.02) shows a contamination due essentially to fall-out and U and Th alpha spectra indicate the natural origin of two elements. The absence of 134Cs in the sample proves that at 40-50 cm depth the sediment was not affected by the Chernobyl fall-out. As far as the speciation is concerned the following fractions were considered: water soluble, carbonates, Fe-Mn oxides, organic matter, acid soluble, residue. Pu (˜67%) an Am (˜95%) were present principally in the carbonate fraction; U was more distributed and about 30% and 45% appeared in the carbonate fraction and in the residue respectively; the majority of Th was present in the residue (˜60%); 40K was totally present in the residue; finally 137Cs was found mostly in the acid soluble fraction (˜53%) and in the residue (˜47%). Some stable elements (Fe, Mn, Al, Ti, Ca, Pb, Ba) were also determined in the different fractions to get more information about the chemical association of the single radionuclides.

  17. On the radio properties of the intermediate-mass black hole candidate ESO 243-49 HLX-1

    CERN Document Server

    Cseh, D; Godet, O; Barret, D; Corbel, S; Coriat, M; Falcke, H; Farrell, S A; Koerding, E; Lenc, E; Wrobel, J M


    We present follow-up radio observations of ESO 243-49 HLX-1 from 2012 using the Australia Telescope Compact Array (ATCA) and the Karl G. Jansky Very Large Array (VLA). We report the detection of radio emission at the location of HLX-1 during its hard X-ray state using the ATCA. Assuming that the `Fundamental Plane' of accreting black holes is applicable, we provide an independent estimate of the black hole mass of $M_{\\rm{BH}}\\leq2.8^{+7.5}_{-2.1} \\times 10^{6}$ M$_{\\odot}$ at 90% confidence. However, we argue that the detected radio emission is likely to be Doppler-boosted and our mass estimate is an upper limit. We discuss other possible origins of the radio emission such as being due to a radio nebula, star formation, or later interaction of the flares with the large-scale environment. None of these were found adequate. The VLA observations were carried out during the X-ray outburst. However, no new radio flare was detected, possibly due to a sparse time sampling. The deepest, combined VLA data suggests a ...

  18. Neutron capture cross section measurements of $^{238}$U, $^{241}$Am and $^{243}$Am at n_TOF

    CERN Document Server

    Koehler, P E; Plag, R

    The increase of the world energy demand and the need of low carbon energy sources have triggered the renaissance and/or enhancement of nuclear energy in many countries. Fundamental nuclear physics can contribute in a practical way to the sustainability and safety of the nuclear energy production and the management of the nuclear waste. There exists a series of recent studies which address the most relevant isotopes, decay data, nuclear reaction channels and energy ranges which have to be investigated in more detail for improving the design of different advanced nuclear systems [1] and nuclear fuel cycles [2]. In this proposal, we aim at the measurement of the neutron capture cross sections of $^{238}$U, $^{241}$Am and $^{243}$Am. All three isotopes are listed in the NEA High Priority Request List [37], are recommended for measurements [1] and play an important role in the nuclear energy production and fuel cycle scenarios. The measurements will provide as well valuable nuclear structure data necessary for the...

  19. A large early-onset Alzheimer`s disease pedigree linked to chromosome 14q24.3

    Energy Technology Data Exchange (ETDEWEB)

    Hannequin, D. [CHU de Rouen (France); Campion, D. [INSERM, U155 Paris (France); Brice, A. [INSERM U289, Paris (France)] [and others


    A large French pedigree including 34 subjects with early-onset progressive dementia was identified. In patients, the mean age-at-onset was 46 {plus_minus} 3.5 (SD) years and the mean age at death 52.6 {plus_minus} 5.7 (SD) years. No evidence for anticipation or genetic imprinting was found. Twelve patients were clinically diagnosed as probable Alzheimer`s disease (AD) according to the NINCDS-ADRDA criteria. Myoclonus and extrapyramidal signs were common and seizures were found in all affected subjects. At autopsy, neuropathological changes typical of AD were present in two brains. A significant lod score of 5.38 was observed at a recombination fraction of {theta} = 0.0 with the genetic marker D14S43, thereby establishing that the responsible gene was located on chromosome 14q24.3. Furthermore, no obligate recombinant was observed with markers D14S77 and D14S71. Typing other genetic markers in this region will allow us to localize more precisely the pathological gene.

  20. Gender Difference in Prevalence of Signs and Symptoms of Temporomandibular Joint Disorders: A Retrospective Study on 243 Consecutive Patients

    Directory of Open Access Journals (Sweden)

    Bora Bagis, Elif Aydogan Ayaz, Sedanur Turgut, Rukiye Durkan, Mutlu Özcan


    Full Text Available Background: This study evaluated the prevalence of the signs and symptoms of temporomandibular joint disorder (TMD among patients with TMD symptoms. Methods: Between September 2011 and December 2011, 243 consecutive patients (171 females, 72 males, mean age 41 years who were referred to the Department of Prosthodontics, Faculty of Dentistry, Karadeniz Technical University, Trabzon were examined physically and completed a questionnaire regarding age, gender, social status, general health, antidepressant drug usage, dental status, limited mouth opening, temporomandibular joint (TMJ sounds, and parafunctions (bruxism, clenching. The data were analyzed using the chi-square test and binary logistic regression model (alpha = 0.05. Results: With a frequency of 92%, pain in the temporal muscle was the most common symptom, followed by pain during mouth opening (89% in both genders. TMJ pain at rest, pain in the masseter muscle, clicking, grinding, and anti-depressant use were significantly more frequent in females than males. Age (p=0.006; odds ratio 0.954; 95% CI 0.922-0.987 and missing teeth (p=0.003; odds ratio 3.753; 95% CI 1.589-8.863 had significant effects on the prevalence of TMD. Conclusion: Females had TMD signs and symptoms more frequently than males in the study population. The most common problem in both genders was pain.

  1. A comprehensive study of fission in 24.3 MeV/nucleon U reactions induced on C, Si, Ni, Au targets

    International Nuclear Information System (INIS)

    Fission is a powerful tool for studying the primary reaction mechanisms in nucleus-nucleus collisions involving at least one fissionable nucleus. This is well shown when an additional information on the violence of the collision is provided by a totally independent observable such as the neutron multiplicity. The mass asymmetry in the entrance channel and the impact parameter are shown to have a decisive influence on the fate of the collision leading to either fusion or a two-body deeply inelastic reaction, analogous to what is known at lower bombarding energies. The experimental approach allows also to single out electromagnetic fission of U after interaction with Au and to provide some characteristics of such a process. (author)

  2. Preparation of targets for nuclear chemistry experiments at DANCE

    International Nuclear Information System (INIS)

    In this paper, we describe the separation chemistry and electrodepositions conducted for the preparation of 241Am, 243Am and 233U targets used for cross-section measurements at DANCE. Thick, adherent deposits were prepared using molecular plating from isopropyl alcohol solutions. Improved yields and thicknesses were observed for 241Am electrodeposition after the material was purified using TRU resin from Eichrom. Similarly, 233U deposits were improved after purification with an anion exchange column in 9 M HBr followed by purification using UTEVA resin from Eichrom. (author)

  3. Antiproton Target

    CERN Multimedia


    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  4. Fission-product yields for thermal-neutron fission of 243Cm determined from measurements with a high-resolution low-energy germanium gamma-ray detector

    International Nuclear Information System (INIS)

    Cumulative fission-product yields have been determined for 13 gamma rays emitted during the decay of 12 fission products created by thermal-neutron fission of 243Cm. A high-resolution low-energy germanium detector was used to measure the pulse-height spectra of gamma rays emitted from a 77-nanogram sample of 243Cm after the sample had been irradiated by thermal neutrons. Analysis of the data resulted in the identification and matching of gamma-ray energies and half-lives to individual radioisotopes. From these results, 12 cumulative fission product yields were deduced for radionuclides with half-lives between 4.2 min and 84.2 min. 7 references

  5. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides. (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M


    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  6. Novel heterozygous C243Y A20/TNFAIP3 gene mutation is responsible for chronic inflammation in autosomal-dominant Behçet's disease (United States)

    Shigemura, Tomonari; Kaneko, Naoe; Kobayashi, Norimoto; Kobayashi, Keiko; Takeuchi, Yusuke; Nakano, Naoko; Masumoto, Junya; Agematsu, Kazunaga


    Objective Although Behçet's disease (BD) is a chronic inflammatory disorder of uncertain aetiology, the existence of familial BD with autosomal-dominant traits suggests that a responsibility gene (or genes) exists. We investigated a Japanese family with a history of BD to search for pathogenic mutations underlying the biological mechanisms of BD. Methods 6 patients over 4 generations who had suffered from frequent oral ulcers, genital ulcers and erythaema nodosum-like lesions in the skin were assessed. Whole-exome sequencing was performed on genomic DNA, and cytokine production was determined from stimulated mononuclear cells. Inflammatory cytokine secretion and Nod2-mediated NF-κB activation were analysed using the transfected cells. Results By whole-exome sequencing, we identified a common heterozygous missense mutation in A20/TNFAIP3, a gene known to regulate NF-κB signalling, for which all affected family members carried a heterozygous C243Y mutation in the ovarian tumour domain. Mononuclear cells obtained from the proband and his mother produced large amounts of interleukin 1β, IL-6 and tumour necrosis factor α (TNF-a) on stimulation as compared with those from normal controls. Although inflammatory cytokine secretion was suppressed by wild-type transfected cells, it was suppressed to a much lesser extent by mutated C243Y A20/TNFAIP3-transfected cells. In addition, impaired suppression of Nod2-mediated NF-κB activation by C243Y A20/TNFAIP3 was observed. Conclusions A C243Y mutation in A20/TNFAIP3 was likely responsible for increased production of human inflammatory cytokines by reduced suppression of NF-κB activation, and may have accounted for the autosomal-dominant Mendelian mode of BD transmission in this family. PMID:27175295

  7. Molecular cloning of t(2;7)(p24.3;p14.2), a novel chromosomal translocation in myelodysplastic syndrome-derived acute myeloid leukemia. (United States)

    Fujita, Kazuhiro; Sanada, Masashi; Harada, Hiroshi; Mori, Hiraku; Niikura, Haruo; Omine, Mitsuhiro; Inazawa, Johji; Imoto, Issei


    In this study, we report the molecular structure of the breakpoint region in a new chromosomal translocation, t(2;7)(p24.3;p14.2), in a case of acute myeloid leukemia transformed from myelodysplastic syndrome (MDS). An extensive fluorescence in situ hybridization (FISH) analysis showed that NAG (2p24.3) and ELMO1 (7p14.2) were involved at the breakpoints of t(2;7)(p24.3;p14.2). Furthermore, we detected a novel chimeric transcript consisting of NAG and ELMO1. Interestingly, this transcript encoded a truncated molecular form of 3'ELMO1 as the result of a frameshift caused by the chromosomal translocation. Although this study does not provide direct evidence that a defect in NAG-ELMO1 plays a role in the pathogenesis or the leukemic change in MDS, it does suggest that defects in NAG-ELMO1 potentially contributed to the leukemic progression in this case. PMID:19407829

  8. Americium, plutonium and uranium contamination and speciation in well waters, streams and atomic lakes in the Sarzhal region of the Semipalatinsk Nuclear Test Site, Kazakhstan

    International Nuclear Information System (INIS)

    New data are reported on the concentrations, isotopic composition and speciation of americium, plutonium and uranium in surface and ground waters in the Sarzhal region of the Semipalatinsk Test Site, and an adjacent area including the settlement of Sarzhal. The data relate to filtered water and suspended particulate from (a) streams originating in the Degelen Mountains, (b) the Tel'kem 1 and Tel'kem 2 atomic craters, and (c) wells on farms located within the study area and at Sarzhal. The measurements show that 241Am, 239,240Pu and 238U concentrations in well waters within the study area are in the range 0.04-87 mBq dm-3, 0.7-99 mBq dm-3, and 74-213 mBq dm-3, respectively, and for 241Am and 239,240Pu are elevated above the levels expected solely on the basis of global fallout. Concentrations in streams sourced in the Degelen Mountains are similar, while concentrations in the two water-filled atomic craters are somewhat higher. Suspended particulate concentrations in well waters vary considerably, though median values are very low, at 0.01 mBq dm-3, 0.08 mBq dm-3 and 0.32 mBq dm-3 for 241Am, 239,240Pu and 238U, respectively. The 235U/238U isotopic ratio in almost all well and stream waters is slightly elevated above the 'best estimate' value for natural uranium worldwide, suggesting that some of the uranium in these waters is of test-site provenance. Redox analysis shows that on average most of the plutonium present in the microfiltered fraction of these waters is in a chemically reduced form (mean 69%; 95% confidence interval 53-85%). In the case of the atomic craters, the proportion is even higher. As expected, all of the americium present appears to be in a reduced form. Calculations suggest that annual committed effective doses to individual adults arising from the daily ingestion of these well waters are in the range 11-42 μSv (mean 21 μSv). Presently, the ground water feeding these wells would not appear to be contaminated with radioactivity from past

  9. Ceftaroline versus isolates from animal bite wounds: comparative in vitro activities against 243 isolates, including 156 Pasteurella species isolates. (United States)

    Goldstein, Ellie J C; Citron, Diane M; Merriam, C Vreni; Tyrrell, Kerin L


    More than 5 million Americans are bitten by animals, usually dogs, annually. Bite patients comprise ∼1% of all patients who visit emergency departments (300,000/year), and approximately 10,000 require hospitalization and intravenous antibiotics. Ceftaroline is the bioactive component of the prodrug ceftaroline fosamil, which is FDA approved for the treatment of acute bacterial skin and skin structure infections (ABSSSIs), including those containing methicillin-resistant Staphylococcus aureus (MRSA). There are no in vitro data about the activity of ceftaroline against Pasteurella multocida subsp. multocida and Pasteurella multocida subsp. septica, other Pasteurella spp., or other bite wound isolates. We therefore studied the in vitro activity of ceftaroline against 243 animal bite isolates. MICs were determined using the broth microdilution method according to CLSI guidelines. Comparator drugs included cefazolin, ceftriaxone, ertapenem, ampicillin-sulbactam, azithromycin, doxycycline, and sulfamethoxazole-trimethoprim (SMX-TMP). Ceftaroline was the most active agent against all 5 Pasteurella species, including P. multocida subsp. multocida and P. multocida subsp. septica, with a maximum MIC of ≤0.008 μg/ml; more active than ceftriaxone and ertapenem (MIC(90)s, ≤0.015 μg/ml); and more active than cefazolin (MIC(90), 0.5 μg/ml) doxycycline (MIC(90), 0.125 μg/ml), azithromycin (MIC(90), 0.5 μg/ml), ampicillin-sulbactam (MIC(90), 0.125 μg/ml), and SMX-TMP (MIC(90), 0.125 μg/ml). Ceftaroline was also very active against all S. aureus isolates (MIC(90), 0.125 μg/ml) and other Staphylococcus and Streptococcus species, with a maximum MIC of 0.125 μg/ml against all bite isolates tested. Ceftaroline has potential clinical utility against infections involving P. multocida, other Pasteurella species, and aerobic Gram-positive isolates, including S. aureus. PMID:23027193

  10. Application of the TRUEX process to highly irradiated targets

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory processes highly irradiated targets for the Mark 42 program to separate americium, curium, and plutonium. Argonne National Laboratory (ANL) has developed the TRUEX process for the removal of transuranic elements from aqueous waste streams and a computer model that aids in the design of potential flowsheets. Because the TRUEX process is attractive for application to the large volumes of high-activity tank wastes stored at various Department of Energy sites, a test of the process on the highly irradiated Mark 42 target material would yield useful information on the performance of the process under open-quotes realclose quotes conditions. Researchers at ANL used the Generic TRUEX Model (GTM) to design a TRUEX flowsheet to process Mark 42 target material. Researchers at the REDC refurbished the Solvent Extraction Test Facility mixer-settler contactors and conducted three test runs using the TRUEX process. The results from the three demonstration tests are presented along with the predicted results from the GTM

  11. Embedded target toolbox for DSP control applications of BLDC motor

    Directory of Open Access Journals (Sweden)

    Benk Enikö


    Full Text Available This paper presents a Matlab embedded target toolbox used for the DC brushless (BLDC motor applications. The synthesis, code generation, and the implementation of the control program, and also the control task itself are carried out on the host PC, under the Simulink. The target system is a brushless DC motor control kit – MSK243, connected on serial port COM to the host computer. With this real time library, it is possible to develop a Rapid Control Prototyping and Hardware-in-the-Loop Simulations. During the running control task on the target, the full functionality of Matlab/Simulink can be used for parameter’s visualization without interrupting or impeding the control process on the MSK240 board.

  12. Actinide targets for the synthesis of super-heavy elements (United States)

    Roberto, J. B.; Alexander, C. W.; Boll, R. A.; Burns, J. D.; Ezold, J. G.; Felker, L. K.; Hogle, S. L.; Rykaczewski, K. P.


    Since 2000, six new super-heavy elements with atomic numbers 113 through 118 have been synthesized in hot fusion reactions of 48Ca beams on actinide targets. These target materials, including 242Pu, 244Pu, 243Am, 245Cm, 248Cm, 249Cf, and 249Bk, are available in very limited quantities and require specialized production and processing facilities resident in only a few research centers worldwide. This report describes the production and chemical processing of heavy actinide materials for super-heavy element research, current availabilities of these materials, and related target fabrication techniques. The impact of actinide materials in super-heavy element discovery is reviewed, and strategies for enhancing the production of rare actinides including 249Bk, 251Cf, and 254Es are described.

  13. Targeted Learning

    CERN Document Server

    van der Laan, Mark J


    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  14. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  15. The estimation of reactions of hematopoietic systems of organisms to the effect, caused by americium and plutonium, of nuclear industry workers

    Energy Technology Data Exchange (ETDEWEB)

    Gasteva, G. N.; Ivanova, T. A.; Gordeeva, A. A.; Suvorova, L. A.; Molokanov, A. A.; Badine, I.


    Object of research are the workers having in an organism radioactive substance (Am-241 and Pu-239). The purpose of work was the estimation of reaction hemopoietic systems of an organism on influence of americium and plutonium at workers of the nuclear industry. At the surveyed contingent of persons the determined effects caused by total influence Am-241 and Pu-239 are ascertained; chronic radiation disease with development, besides diffusive a pneumoscleoris and a chronic toxic-chemical radiating bronchitis, reactions of system of blood, jet hepatopathy which frequency accrued with increase doses loadings and essentially did not depend on age. In peripheral blood on the foreground jet changes act: hyperglobulia, the tendency to neutrophilus leukocytosis, monocytosis, increase ESR, decrease (reduction ?/G of factor reflecting weight and processing of defeat bronchus and pulmonary of system. Stable downstroke in number thrombocytes and reticulocytes in peripheral blood, their direct dependence on a doze of an irradiation, reflect hypoplastic a background hemogenesis, caused by long influence incorporatedin a bone and a bone brain of radioactive substances. At cytologic research punctate a bone brain jet changes which are expressed in increase of functional activity erythro-and myelopoiesiscome to light and provide compensatory reaction of peripheral blood. At histologic research of a bone brain and a bone fabric attributes of development atrophic process which is expressed in reduction of volume parenchyma a bone brain (a fatty atrophy) and dysplasia to a bone fabric are observed.

  16. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)


    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  17. The recycling of the actinides neptunium, americium and curium in a fast power reactor to reduce the long term activity in a final store

    International Nuclear Information System (INIS)

    The starting point for the considerations and calculations given in this dissertation is the inevitable production of radioactive materials in the use of nuclear energy, which creates a considerable potential danger in a final store for a very long period. As one possibility of alleviating this problem, a concept for recycling the waste actinides neptunium, americium and curium was proposed. The waste actinides are separated in the reprocessing of burnt-up fuel elements and reach a further irradiation circuit. There they pass through the stages 'manufacture of irradiation elements', 'use in a fast power reactor' and reprocessing of irradiation elements' several times. In each irradiation and subsequent storage, about 17% of the waste actinides are removed by fission or by conversion into nuclides which can be reused as fuel, so that during the life of 40 years of the fast recycling reacor, the waste actinides can be reduced in mass by one half. In order to determine this mass reduction effect, a model calculation was developed, which includes the representation of the neutron physics and thermal properties of the reactor core and the storage and reprocessing of the irradiation elements. (orig./RB)

  18. Actinide and lanthanum accumulation by immobilized cells of a citrobacter sp. and application to the decontamination of solutions containing americium and plutonium

    International Nuclear Information System (INIS)

    Phosphatase-mediated metal bioaccumulation by a Citrobacter sp. underlies a bioprocess for the removal of heavy metals from solution, as cell-bound metal phosphate. Deposition of uranyl ion indicated a role in the biotechnological removal of americium and plutonium from wastes generated from the nuclear fuel cycle. Preliminary studies suggested a recalcitrance of tetravalent species of U(IV), Th(IV) and Zr(IV) and, by implication, Pu(IV), probably attributable to the stability of metal-ligand complexes in solution. Trials with the trivalent model, La(III), indicated probable bioaccumulation of Pu(III) and Am(III), which was confirmed by the removal of 241Am by cells immobilized in a cartridge incorporated into a flow supplemented with Am. Pu(V) and Pu(IV) wastes may be treatable via prior reduction to Pu(III), with simultaneous removal of the latter with the co-contaminant Am(III). An oxidative route, to Pu(VI), with desolubilization as HPuO2PO4 was also considered, but experiments using the analogous U(VI) (uranyl ion) demonstrated a greater efficiency of M(III) removal. Initial experiments utilized polyacrylamide gel-immobilized cells. 241Am removal also occurred with Citrobacter sp. immobilized as biofilm on reticulated foam supports, more amenable to large-scale processes

  19. Characterization of americium(III) and lanthanide(III) complexes in mixed solvent extraction systems containing a malonamide and a dialkyl-phosphoric acid

    International Nuclear Information System (INIS)

    In order to further reduce toxicity of nuclear waste, the French Commissariat a l'energie atomique et aux energies alternatives (CEA) is developing processes that allow separation of minor actinides from fission products. The DIAMEX (Diamide extraction) - SANEX (Selective actinide extraction) process is based on a mixture of two organic extractants: a malonamide, the N,N'-dimethyl-N,N'-dioctyl-hexyl-ethoxy-malonamide (DMDOHEMA) and a dialkyl-phosphoric acid, the di(2-ethylhexyl)phosphoric acid (HDEHP), dissolved in an alkane. The mechanisms of its extraction process are still not completely understood. Various complementary analytical techniques were used to identify and characterize americium(III) and lanthanide(III) metallic complexes formed in the organic phase after solvent extraction (UV-Visible, Infrared, NMR and Time Resolved Laser-Induced Fluorescence spectroscopy, as well as Electro-spray Ionization Mass Spectrometry). These speciation studies were performed under a variety of experimental conditions (influence of the extractants concentration, acidity of the aqueous phase..) and mixed species including the two extractants were observed. (authors)

  20. Measurement of the neutron-induced fission cross-section of 243Am relative to 235U from 0.5 to 20 MeV

    International Nuclear Information System (INIS)

    The ratio of the neutron-induced fission cross-sections of 243Am and 235U was measured in the energy range from 0.5 to 20 MeV with uncertainties of ∼ 4%. The experiment was performed at the CERN nTOF facility using a fast ionization chamber. With the good counting statistics that could be achieved thanks to the high instantaneous flux and the low backgrounds, the present results are useful for resolving discrepancies in previous data sets and are important for future reactors with improved fuel burn-up. (orig.)

  1. Measurement of the neutron-induced fission cross-section of {sup 243}Am relative to {sup 235}U from 0.5 to 20 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Belloni, F.; Milazzo, P.M.; Abbondanno, U.; Fujii, K.; Moreau, C. [Istituto Nazionale di Fisica Nucleare, Trieste (Italy); Calviani, M. [Laboratori Nazionali di Legnaro, Istituto Nazionale di Fisica Nucleare, Legnaro (Italy); CERN, Geneva (Switzerland); Colonna, N.; Barbagallo, M.; Marrone, S.; Meaze, M.H.; Tagliente, G.; Terlizzi, R. [Istituto Nazionale di Fisica Nucleare, Bari (Italy); Mastinu, P.; Gramegna, F. [Lab. Nazionali di Legnaro, Istituto Nazionale di Fisica Nucleare, Legnaro (Italy); Aerts, G.; Andriamonje, S.; Berthoumieux, E.; Dridi, W.; Gunsing, F.; Pancin, J.; Perrot, L.; Plukis, A. [Irfu, CEA, Gif-sur-Yvette (France); Alvarez, H.; Cano-Ott, D.; Duran, I.; Embid-Segura, M.; Gonzalez-Romero, E.; Paradela, C.; Tarrio, D. [Univ. de Santiago de Compostela, Galicia (Spain); Alvarez-Velarde, F.; Guerrero, C.; Martinez, T.; Villamarin, D.; Vincente, M.C. [Centro de Investigaciones Energeticas Medioambientales y Technologicas, Madrid (Spain); Andrzejewski, J.; Marganiec, J. [Univ. of Lodz (Poland); Audouin, L.; Dillmann, I.; Heil, M.; Kaeppeler, F.; Mosconi, M.; Plag, R.; Voss, F.; Walter, S.; Wisshak, K. [Karlsruhe Inst. of Technology, Eggenstein-Leopoldshafen (Germany). Inst. fuer Kernphysik; Badurek, G.; Jericha, E.; Leeb, H.; Oberhummer, H. [Technische Univ. Wien, Atominstitut der Oesterreichischen Universitaeten, Wien (Austria); Baumann, P.; David, S.; Kerveno, M.; Lukic, S.; Rudolf, G. [IReS, Centre National de la Recherche Scientifique/IN2P3, Strasbourg (France); Becvar, F.; Krticka, M. [Charles Univ., Faculty of Mathematics and Physics, Prague (Czech Republic); Calvino, F.; Cortes, G.; Poch, A.; Pretel, C. [Univ. Politecnica de Catalunya, Barcelona (Spain); Capote, R. [NAPC/Nuclear Data Section, International Atomic Energy Agency, Vienna (Austria); Univ. de Sevilla (Spain); Carrapico, C.; Goncalves, I.; Salgado, J.; Santos, C.; Tavora, L.; Vaz, P. [Inst. Tecnologico e Nuclear, Lisbon (Portugal)] [and others


    The ratio of the neutron-induced fission cross-sections of {sup 243}Am and {sup 235}U was measured in the energy range from 0.5 to 20 MeV with uncertainties of {approx} 4%. The experiment was performed at the CERN n{sub T}OF facility using a fast ionization chamber. With the good counting statistics that could be achieved thanks to the high instantaneous flux and the low backgrounds, the present results are useful for resolving discrepancies in previous data sets and are important for future reactors with improved fuel burn-up. (orig.)

  2. Neutron-induced fission cross sections of 233U and 243Am in the energy range 0.5 Mev En 20 MeV @ n_TOF

    CERN Document Server

    Belloni, F; Milazzo, P M; Calviani, M; Colonna, N; Mastinu, P; Abbondanno, U; Aerts, G; Álvarez, H; Álvarez-Velarde, F; Andriamonje, S; Andrzejewski, J; Assimakopoulos, P; Audouin, L; Badurek, G; Baumann, P; Becvár, F; Berthoumieux, E; Calviño, F; Cano-Ott, D; Capote, R; Carrapiço, C; Cennini, P; Chepel, V; Chiaveri, E; Cortes, G; Couture, A; Cox, J; Dahlfors, M; David, S; Dillmann, I; Domingo-Pardo, C; Dridi, W; Duran, I; Eleftheriadis, C; Embid-Segura, M; Ferrant, L; Ferrari, A; Ferreira-Marques, R; Fujii, K; Furman, W; Goncalves, I; González-Romero, E; Gramegna, F; Guerrero, C; Gunsing, F; Haas, B; Haight, R; Heil, M; Herrera-Martinez, A; Igashira, M; Jericha, E; Käppeler, F; Kadi, Y; Karadimos, D; Karamanis, D; Kerveno, M; Koehler, P; Kossionides, E; Krticka, M; Lampoudis, C; Leeb, H; Lindote, A; Lopes, I; Lozano, M; Lukic, S; Marganiec, J; Marrone, S; Martínez, T; Massimi, C; Mengoni, A; Moreau, C; Mosconi, M; Neves, F; Oberhummer, H; O'Brien, S; Pancin, J; Papachristodoulou, C; Papadopoulos, C; Paradela, C; Patronis, N; Pavlik, A; Pavlopoulos, P; Perrot, L; Pigni, M T; Plag, R; Plompen, A; Plukis, A; Poch, A; Praena, J; Pretel, C; Quesada, J; Rauscher, T; Reifarth, R; Rubbia, C; Rudolf, G; Rullhusen, P; Salgado, J; Santos, C; Sarchiapone, L; Savvidis, I; Stephan, C; Tagliente, G; Tain, J L; Tassan-Got, L; Tavora, L; Terlizzi, R; Vannini, G; Vazl, P; Ventura, A; Villamarin, D; Vincente, M C; Vlachoudis, V; Vlastou, R; Voss, F; Walter, S; Wiescher, M; Wisshak, K


    Neutron-induced fission cross-sections of actinides have been recently measured at the neutron time of flight facility n_TOF at CERN in the frame of a research project involving isotopes relevant for nuclear astrophysics and nuclear technologies. Fission fragments are detected by a gas counter with good discrimination between nuclear fission products and background events. Neutron-induced fission cross-sections of 233U and 243Am were determined relative to 235U. The present paper reports the results obtained at neutron energies between 0.5 and 20 MeV.

  3. Extraction and chromatographic separation and concentration of plutonium and americium from natural matrices. Author-review of dissertation submitted for fulfillment of the scientific degree 'Philosophiae doctor' (PhD.)

    International Nuclear Information System (INIS)

    We followed the optimization of separation progress of americium (241Am) from environmental samples - soil from surroundings nuclear power plant Jaslovske Bohunice, in our work. Selection and optimization of separation progresses had to verify the condition for preparation of samples on spectral measurement with coprecipitation of americium or plutonium with NdF3 (undesirable presence of calcium, magnesium, lanthanides) and condition of spectral purity (spectral overlapping 228Th, 238Pu, 241Am and 222Rn of energy). Very important step was the realization of existing goal and learn suitable isolation techniques of plutonium. We are choosing technique separation of plutonium base upon amine liquid extraction, for a digest consider qualitative quantitative factor of separation. Extraction reagent has been Aliquat-336, which extracts nitric complex of plutonium [Pu(NO3)62-] from 7-8 M solution HNO3. Use method separate off quantitative the plutonium, thorium and uranium from americium. Background sample formed the sample of soil from surroundings Velke Kostolany. Real samples were sampling from surroundings of pollute river Dudvah. Average value mass activities of 239,240Pu in the background sample had value 0.28 ± 0.10 Bq · kg-1. Value mass activities of 239,240Pu in sample from surroundings river Dudvah were in the range (0,6 - 39.4) Bq · kg-1. Methodical side separation of americium we step by step by using ion exchange methods, liquid extraction with extraction reagent TOPO, or combination of them and extraction chromatography with TOPO. We find out: (a) on exchange procedure are suitable on obtainable basis extract tracer of radionuclide, also is very up to time. Optimal method was indicate techniques using the formation of rhodanide complex of americium, with following adsorption on stark acidity anionic exchanger (lanthanides were non-absorbing); (b) t liquid extraction formed emulsion, the third phase on the interface of phases. If we treat the molar of

  4. Accelerator target

    Energy Technology Data Exchange (ETDEWEB)

    Schlyer, David J. (Bellport, NY); Ferrieri, Richard A. (Patchogue, NY); Koehler, Conrad (Miller Place, NY)


    A target includes a body having a depression in a front side for holding a sample for irradiation by a particle beam to produce a radioisotope. Cooling fins are disposed on a backside of the body opposite the depression. A foil is joined to the body front side to cover the depression and sample therein. A perforate grid is joined to the body atop the foil for supporting the foil and for transmitting the particle beam therethrough. A coolant is circulated over the fins to cool the body during the particle beam irradiation of the sample in the depression.

  5. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens


    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  6. 6,6 '-bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo 1,2,4 triazine-3-yl) 2,2 ' bipyridine, an effective extracting agent for the separation of americium(III) and curium(III) from the lanthanides

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and the lanthanides(III) from nitric acid by 6,6'- bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo[1,2,4]triazine-3-yl)-[2,2'] bipyridine (CyMe4-BTBP) has been studied. Since the extraction kinetics were slow, N,N'-dimethyl-N,N'-di-octyl-2-(2-hexyl-oxy-ethyl)malonamide (DMDOHEMA) was added as a phase transfer reagent. With a mixture of 0.01 M CyMe4-BTBP + 0.25 M DMDOHEMA in n -octanol, extraction equilibrium was reached within 5 min of mixing. At a nitric acid concentration of 1 M, an americium(III) distribution ratio of approx. 10 was achieved. Americium(III)/lanthanide(III) separation factors between 50 (dysprosium) and 1500 (lanthanum) were obtained. Whereas americium(III) and curium(III) were extracted as di-solvates, the stoichiometries of the lanthanide(III) complexes were not identified unambiguously, owing to the presence of DMDOHEMA. In the absence of DMDOHEMA, both americium(III) and europium(III) were extracted as di-solvates. Back-extraction with 0.1 M nitric acid was thermodynamically possible but rather slow. Using a buffered glycolate solution of pH=4, an americium(III) distribution ratio of 0.01 was obtained within 5 min of mixing. There was no evidence of degradation of the extractant, for example, the extraction performance of CyMe4-BTBP during hydrolysis with 1 M nitric acid did not change over a two month contact. (authors)

  7. Thermodynamic parameters of MeO2+ + H+ reversible MeO22+ + 1/2 H2 reaction for americium and neptunium ions in solution of potassium phosphotungstates

    International Nuclear Information System (INIS)

    Formal oxidation potentials of MeO22+-MeO2+ pair are measured for americium and neptunium ions in solutions of potassium phosphotungstates in 23-51 deg C temperature range at solution pH values equal to 1.0 and 4.0 by differential coulopotentiometric and potentiometric methods. Based on the data obtained Gibbs energy change values; enthalpies and enthropies for MeO2+ + H+ ↔ MeO22+ + 1/2H2 reaction are calculated

  8. The use of isotopic correlation technique for determination of sup(241)Am and sup(243)Am concentration in nuclear irradiated fuels

    International Nuclear Information System (INIS)

    In the last years the isotopic correlation technique is emerging as a powerful tool for the determination of concentration and isotopic composition of heavy nuclides in the nuclear fuel cycle. Accordingly, this technique has gained significant importance for the safeguard of the nuclear materials as well as for the accounting and build up of actinides elements in the irradiated nuclear fuels. In this work 42 isotopic correlations between the nuclides sup(241)Am and sup(243)Am and post irradiation isotopic data of 7 samples from fuel element BE-124 and 1 sample from fuel element BE-120 from the Obrigheim pressurized water nuclear power reactor, Federal Republic of Germany, were proposed. These isotopic correlations allowed to estimate the isotopic concentrations of sup(241)Am and sup(243)Am with an average deviation, relative to the experimental data obtained from isotopic dilution mass spectrometry technique, of 10%. These results are more precise than those found using the computer code ORIGEN 2 demonstrating the great potential of this technique for the determination of isotopic concentration and build up of those nuclides in irradiated nuclear fuels. The analytical and other experimental aspects of the post irradiation isotopic analysis of nuclear fuels are also discussed. (author)

  9. De novo 14q24.2q24.3 microdeletion including IFT43 is associated with intellectual disability, skeletal anomalies, cardiac anomalies, and myopia. (United States)

    Stokman, Marijn F; Oud, Machteld M; van Binsbergen, Ellen; Slaats, Gisela G; Nicolaou, Nayia; Renkema, Kirsten Y; Nijman, Isaac J; Roepman, Ronald; Giles, Rachel H; Arts, Heleen H; Knoers, Nine V A M; van Haelst, Mieke M


    We report an 11-year-old girl with mild intellectual disability, skeletal anomalies, congenital heart defect, myopia, and facial dysmorphisms including an extra incisor, cup-shaped ears, and a preauricular skin tag. Array comparative genomic hybridization analysis identified a de novo 4.5-Mb microdeletion on chromosome 14q24.2q24.3. The deleted region and phenotype partially overlap with previously reported patients. Here, we provide an overview of the literature on 14q24 microdeletions and further delineate the associated phenotype. We performed exome sequencing to examine other causes for the phenotype and queried genes present in the 14q24.2q24.3 microdeletion that are associated with recessive disease for variants in the non-deleted allele. The deleted region contains 65 protein-coding genes, including the ciliary gene IFT43. Although Sanger and exome sequencing did not identify variants in the second IFT43 allele or in other IFT complex A-protein-encoding genes, immunocytochemistry showed increased accumulation of IFT-B proteins at the ciliary tip in patient-derived fibroblasts compared to control cells, demonstrating defective retrograde ciliary transport. This could suggest a ciliary defect in the pathogenesis of this disorder. © 2016 Wiley Periodicals, Inc. PMID:26892345

  10. Thermal neutron capture cross-section measurements of 243Am and 242Pu using the new mini-INCA α- and γ-spectroscopy station

    International Nuclear Information System (INIS)

    In the framework of the Mini-INCA project, dedicated to the study of Minor Actinide transmutation process in high neutron fluxes, an α- and γ-spectroscopy station has been developed and installed at the High Flux Reactor of the Laue-Langevin Institut. This set-up allows short irradiations as well as long irradiations in a high quasi-thermal neutron flux and post-irradiation spectroscopy analysis. It is well suited to measure precisely, in reference to 59Co cross-section, neutron capture cross-sections, for all the actinides, in the thermal energy region. The first measurements using this set-up were done on 243Am and 242Pu isotopes. Cross-section values, at En=0.025eV, were found to be (81.8+/-3.6)b for 243Am and (22.5+/-1.1)b for 242Pu. These values differ from evaluated data libraries by a factor of 9% and 17%, respectively, but are compatible with the most recent measurements, validating by the way the experimental apparatus

  11. NIRATAM-NATO infrared air target model (United States)

    Noah, Meg A.; Kristl, Joseph; Schroeder, John W.; Sandford, B. P.


    NIRATAM (the NATO Infrared Air Target Model) was developed by the NATO AC 243, Panel IV, Research Study Group 6 (RSG-6). RSG-6 is composed of representatives from Denmark, France, Germany, Italy, the Netherlands, the United Kingdom, the United States of America, and Canada (as an observer). NIRATAM is based on theoretical studies, field measurements, and infrared data analysis performed over many years. The model encompasses all the major signature components required to simulate the infrared signature of an aircraft and the atmosphere. The vehicle fuselage, facet, model includes radiation due to aerodynamic heating, internal heat sources, reflected sky, earth, and solar radiation. Plume combustion gas emissions are calculated for H(subscript 2)O, CO(subscript 2), CO, and other gases as well as solid particles. Lowtran 7 is used for the atmospheric transmission and radiance. The software generates graphical outputs of the target wireframe, plume flowfield, atmospheric transmission, total signature, and plume signature. Imagery data can be used for system development and evaluation. NIRATAM can be used for many applications such as measurement planning, data analysis, systems design, and aircraft development. Ontar has agreed to assist the RSG-6 by being the NIRATAM distribution center in the United States for users approved by the national representatives. Arrangements have also been made to distribute a user-friendly NIRATAM interface. This paper describes the model, presents results, makes comparisons with measured field data, and describes the availability and procedure for obtaining the software.

  12. Update of JAEA-TDB. Additional selection of thermodynamic data for solid and gaseous phases on nickel, selenium, zirconium, technetium, thorium, uranium, neptunium plutonium and americium, update of thermodynamic data on iodine, and some modifications

    International Nuclear Information System (INIS)

    We additionally selected thermodynamic data for solid and gaseous phases of nickel, selenium, zirconium, technetium, thorium, uranium, neptunium, plutonium and americium to our thermodynamic database JAEA-TDB for geological disposal of radioactive waste of high-level and TRU wastes. We thermodynamically obtained equilibrium constant from addition and subtraction of Gibbs free energy of formation on nickel, selenium, zirconium, technetium, thorium, uranium, neptunium plutonium and americium, which were selected in the Thermochemical Database Project by the Nuclear Energy Agency in the Organisation for Economic Co-operation and Development. Furthermore, we collected and updated thermodynamic data on iodine, changed master species of technetium(IV), and added thermodynamic data on selenium due to improving reliability of the thermodynamic database. We prepared text files of the updated thermodynamic database (JAEA-TDB) for geochemical calculation programs of PHREEQC, EQ3/6 and Geochemist's Workbench. These text files are contained in the attached CD-ROM and will be available on our Website ( (author)

  13. Impact of the cation distribution homogeneity on the americium oxidation state in the U{sub 0.54}Pu{sub 0.45}Am{sub 0.01}O{sub 2−x} mixed oxide

    Energy Technology Data Exchange (ETDEWEB)

    Vauchy, Romain [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Robisson, Anne-Charlotte, E-mail: [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence [CEA, DEN, DEC, Centre d’études nucléaires de Cadarache, Saint Paul Lez Durance 13108 (France); Scheinost, Andreas C. [Helmholtz Zentrum Dresden-Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 510119, 01314 Dresden, Germany and Rossendorf Beamline at ESRF, BP 220, F-38043 Grenoble (France); Hodaj, Fiqiri [Science et Ingénierie des Matériaux et Procédés (SIMaP, associé au CNRS UMR 5266 – UJF/INP-Grenoble), Domaine Universitaire, 1130 rue de la piscine, BP 75, 38402 Saint Martin d’Hères (France)


    The impact of the cation distribution homogeneity of the U{sub 0.54}Pu{sub 0.45}Am{sub 0.01}O{sub 2−x} mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium–plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β{sup −} decay of {sup 241}Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U–Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  14. Impact of the cation distribution homogeneity on the americium oxidation state in the U0.54Pu0.45Am0.01O2-x mixed oxide (United States)

    Vauchy, Romain; Robisson, Anne-Charlotte; Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence; Scheinost, Andreas C.; Hodaj, Fiqiri


    The impact of the cation distribution homogeneity of the U0.54Pu0.45Am0.01O2-x mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium-plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β- decay of 241Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U-Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  15. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 3

    International Nuclear Information System (INIS)

    This report summarizes the studies on sorption and diffusion of Cs, Sr, Co, Ni, Am and I in common rocks in Finnish bedrock carried out in laboratory experiments. Samples used in these studies were sections of drill cores containing filled and unfilled natural fracture surfaces and drill cores with a diamond drilled longitudinal cavity in the middle of the sample (drill core cups). Samples originated from the two nuclear power plant sites in Finland: tonalite and mica gneiss from Olkiluoto in Eurajoki and rapakivi granite from Haestholmen in Loviisa. The water used in the experiments was synthetic groundwater spiked at a time with one of the radionuclides: Cs-134, Sr-90, Co-60, Ni-63, Am-241 and I-125. Contact times from one week to one year were used to evaluate time dependence of diffusion. An autoradiographic method was used for determination of the penetration depths and diffusion pathways of elements. For determination of diffusion coefficients a quantitative computerized autoradiographic method was used to get the concentration profiles of the radionuclides in the drill cores. Sorption on natural fracture surfaces was more effective than on freshly drilled core samples. Filling materials on natural fracture surfaces, except calcite, increased sorption. The distribution coefficients for drill core cups were about the same as those for unfilled natural fracture surfaces after a contact time of one week and the sorption tendency of radionuclides was: Ka(Cs) > Ka(Co) > Ka(Am) > Ka(Ni) > Ka(Sr) > Ka(I). Radionuclides were observed to penetrate into fissures of the rock matrix and high-capacity minerals. Strontium was found as far as 35 mm in a filled natural fracture surface sample of rapakivi granite after a contact time of one year. The corresponding values were 3.0 mm for cesium, 2.1 mm for cobalt and 2.6 mm for nickel. For americium no diffusion could be observed (a-values for strontium was 6.6 x 10-16-1.1 x 10-13 m2/s, for cesium 4.7 x 10-16-7.2 x 10-15 m2/s

  16. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  17. Sequential isotopic determination of plutonium, thorium, americium and uranium in the air filter and drinking water samples around the WIPP site

    International Nuclear Information System (INIS)

    The simultaneous determination of actinides in air filter and water samples around the WIPP site have been demonstrated. The analytical method is based on the selective separation and purification by anion exchange and Eichrome-TEVA, TRU and DGA-resin followed by determination of actinides by alpha spectrometry. Counting sources for alpha spectrometric measurements were prepared by microcoprecipitation on neodymium fluoride (NdF3). Radiochemical yields were determined using 242Pu, 229Th, 243Am and 232U as tracers. The validation of the method is performed through the analysis of reference materials or participating in laboratory intercomparison programs. The plutonium concentrations in aerosols varied seasonally, being highest in spring and summer due to the spring-time enhanced wind-storm transportation of radioactive aerosols from the stratosphere to the troposphere. The 238Pu/239+240Pu activity ratio in the aerosol samples is typically close to that of global fallout from historic above-ground nuclear weapons testing. The results presented here indicate that the source of plutonium in the WIPP environment results mainly from global nuclear fallout and there is no evidence of increases in radiological contaminants in the region that could be attributed to releases from the WIPP. (author)

  18. Fission Cross-section Measurements of (233)U, (245)Cm and (241,243)Am at CERN n_TOF Facility

    CERN Document Server

    Calviani, M; Andriamonje, S; Chiaveri, E; Vlachoudis, V; Colonna, N; Meaze, M H; Marrone, S; Tagliente, G; Terlizzi, R; Belloni, F; Abbondanno, U; Fujii, K; Milazzo, P M; Moreau, C; Aerts, G; Berthoumieux, E; Dridi, W; Gunsing, F; Pancin, J; Perrot, L; Plukis, A; Alvarez, H; Duran, I; Paradela, C; Alvarez-Velarde, F; Cano-Ott, D; Gonzalez-Romero, E; Guerrero, C; Martinez, T; Villamarin, D; Vicente, M C; Andrzejewski, J; Marganiec, J; Assimakopoulos, P; Karadimos, D; Karamanis, D; Papachristodoulou, C; Patronis, N; Audouin, L; David, S; Ferrant, L; Isaev, S; Stephan, C; Tassan-Got, L; Badurek, G; Jericha, E; Leeb, H; Oberhummer, H; Pigni, M T; Baumann, P; Kerveno, M; Lukic, S; Rudolf, G; Becvar, F; Krticka, M; Calvino, F; Capote, R; Carrillo De Albornoz, A; Marques, L; Salgado, J; Tavora, L; Vaz, P; Cennini, P; Dahlfors, M; Ferrari, A; Gramegna, F; Herrera-Martinez, A; Kadi, Y; Mastinu, P; Praena, J; Sarchiapone, L; Wendler, H; Chepel, V; Ferreira-Marques, R; Goncalves, I; Lindote, A; Lopes, I; Neves, F; Cortes, G; Poch, A; Pretel, C; Couture, A; Cox, J; O'brien, S; Wiescher, M; Dillman, I; Heil, M; Kappeler, F; Mosconi, M; Plag, R; Voss, F; Walter, S; Wisshak, K; Dolfini, R; Rubbia, C; Domingo-Pardo, C; Tain, J L; Eleftheriadis, C; Savvidis, I; Frais-Koelbl, H; Griesmayer, E; Furman, W; Konovalov, V; Goverdovski, A; Ketlerov, V; Haas, B; Haight, R; Reifarth, R; Igashira, M; Koehler, P; Kossionides, E; Lampoudis, C; Lozano, M; Quesada, J; Massimi, C; Vannini, G; Mengoni, A; Oshima, M; Papadopoulos, C; Vlastou, R; Pavlik, A; Pavlopoulos, P; Plompen, A; Rullhusen, P; Rauscher, T; Rosetti, M; Ventura, A


    Neutron-induced fission cross-sections of minor actinides have been measured using the n_TOF white neutron source at CERN, Geneva, as part of a large experimental program aiming at collecting new data relevant for nuclear astrophysics and for the design of advanced reactor systems. The measurements at n_TOF take advantage of the innovative features of the n_TOF facility, namely the wide energy range, high instantaneous neutron flux and good energy resolution. Final results on the fission cross-section of 233U, 245Cm and 243Am from thermal to 20 MeV are here reported, together with preliminary results for 241Am. The measurement have been performed with a dedicated Fast Ionization Chamber (FIC), a fission fragment detector with a very high efficiency, relative to the very well known cross-section of 235U, measured simultaneously with the same detector.

  19. Synthesis, characterization and biological activity of new cyclization products of 3-(4-substituted benzylidene)-2-pyrido[1,2-]pyrimidine 2,4-(3)-diones

    Indian Academy of Sciences (India)

    Abha Bishnoi; Suruchi Singh; Anil K Tiwari; Krishna Srivastava; Ram Raghuvir; Chandrakant M Tripathi


    A method is presented for the synthesis of 4-(substituted phenyl)-3-(3-substituted phenyl)4-spiro[isoxazole-5,3'-pyrido[1,2-]pyrimidine]-2',4'-dione (3), 3-(4-substituted phenyl)-3-isoxazole[3, 4-]pyrido[1,2-]pyrimidin-4-(3a)-one (4) and 3-(4-substituted phenyl) 3,3a-dihydropyrazolo[3,4-]pyrido[1,2-]pyrimidin-4-(2)-one (5) which consists of the conversion of 2-pyrido[1,2-]pyrimidine-2,4(3)-dione (1) to chalcones (2) and their 1,3-dipolar cycloaddition with appropriate aldoximes to give spiro compounds and heterocyclization using amines to yield isoxazolines and pyrazolines. All the compounds were screened for their antimicrobial and antitubercular activity.

  20. Study of the Beta-delayed multiple particle break-up of the 2.43 MeV state in Be-9 (United States)

    Madurga Flores, Miguel; Borge, M. J. G.; Fynbo, H. O. U.; Jonson, B.; Nyman, G.; Prezado, Y.; Riisager, K.

    The aim of this work is to study the β -delayed multiparticle break-up of the 5/2- state in 9 Be at 2.43 MeV excitation energy. This process is relevant as it has been proposed recently that this level plays a role in the α(αn,γ)9 Be reaction. This state breaks-up in 2α+n, and sequential as well as direct ("democratic") decay have previously been considered. In our work energy and direction of the two emitted α particles has been measured, while those of the neutron have been reconstructed. The sequential decay is considered using the R-matrix formalism. For the democratic decay the hyper-spherical harmonics functions are used. The different decay processes are compared with the data using the Monte-Carlo method. Our preliminary results indicate that the data is better described when democratic decay is assumed.

  1. Transmutation of 129I, 237Np, 238Pu, 239Pu, and 241Am using neutrons produced in target-blanket system `Energy plus Transmutation' by relativistic protons

    Indian Academy of Sciences (India)

    J Adam; K Katovsky; A Balabekyan; V G Kalinnikov; M I Krivopustov; H Kumawat; A A Solnyshkin; V I Stegailov; S G Stetsenko; V M Tsoupko-Sitnikov; W Westmeier


    Target-blanket facility `Energy + Transmutation' was irradiated by proton beam extracted from the Nuclotron Accelerator in Laboratory of High Energies of Joint Institute for Nuclear Research in Dubna, Russia. Neutrons generated by the spallation reactions of 0.7, 1.0, 1.5 and 2 GeV protons and lead target interact with subcritical uranium blanket. In the neutron field outside the blanket, radioactive iodine, neptunium, plutonium and americium samples were irradiated and transmutation reaction yields (residual nuclei production yields) have been determined using -spectroscopy. Neutron field's energy distribution has also been studied using a set of threshold detectors. Results of transmutation studies of 129I, 237Np, 238Pu, 239Pu and 241Am are presented.

  2. Monozygotic twins with a de novo 0.32 Mb 16q24.3 deletion, including TUBB3 presenting with developmental delay and mild facial dysmorphism but without overt brain malformation

    DEFF Research Database (Denmark)

    Grønborg, Sabine; Kjaergaard, Susanne; Hove, Hanne;


    been associated with missense mutations in this group of genes. Here, we report two patients, monozygotic twins, carrying a de novo 0.32 Mb deletion of chromosome 16q24.3 including the TUBB3 gene. The patients presented with global developmental delay, mild facial dysmorphism, secondary microcephaly...

  3. Americium behaviour in plastic vessels

    Energy Technology Data Exchange (ETDEWEB)

    Legarda, F.; Herranz, M. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Idoeta, R., E-mail: raquel.idoeta@ehu.e [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Abelairas, A. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain)


    The adsorption of {sup 241}Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of {sup 241}Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of {sup 241}Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  4. Americium behaviour in plastic vessels

    International Nuclear Information System (INIS)

    The adsorption of 241Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of 241Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of 241Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  5. Neutronic Assessment of Transmutation Target Compositions in Heterogeneous Sodium Fast Reactor Geometries

    Energy Technology Data Exchange (ETDEWEB)

    Samuel E. Bays; Rodolfo M. Ferrer; Michael A. Pope; Benoit Forget; Mehdi Asgari


    The sodium fast reactor is under consideration for consuming the transuranic waste in the spent nuclear fuel generated by light water reactors. This work is concerned with specialized target assemblies for an oxide-fueled sodium fast reactor that are designed exclusively for burning the americium and higher mass actinide component of light water reactor spent nuclear fuel (SNF). The associated gamma and neutron radioactivity, as well as thermal heat, associated with decay of these actinides may significantly complicate fuel handling and fabrication of recycled fast reactor fuel. The objective of using targets is to isolate in a smaller number of assemblies these concentrations of higher actinides, thus reducing the volume of fuel having more rigorous handling requirements or a more complicated fabrication process. This is in contrast to homogeneous recycle where all recycled actinides are distributed among all fuel assemblies. Several heterogeneous core geometries were evaluated to determine the fewest target assemblies required to burn these actinides without violating a set of established fuel performance criteria. The DIF3D/REBUS code from Argonne National Laboratory was used to perform the core physics and accompanying fuel cycle calculations in support of this work. Using the REBUS code, each core design was evaluated at the equilibrium cycle condition.

  6. Neutronic Assessment of Transmutation Target Compositions in Heterogeneous Sodium Fast Reactor Geometries

    International Nuclear Information System (INIS)

    The sodium fast reactor is under consideration for consuming the transuranic waste in the spent nuclear fuel generated by light water reactors. This work is concerned with specialized target assemblies for an oxide-fueled sodium fast reactor that are designed exclusively for burning the americium and higher mass actinide component of light water reactor spent nuclear fuel (SNF). The associated gamma and neutron radioactivity, as well as thermal heat, associated with decay of these actinides may significantly complicate fuel handling and fabrication of recycled fast reactor fuel. The objective of using targets is to isolate in a smaller number of assemblies these concentrations of higher actinides, thus reducing the volume of fuel having more rigorous handling requirements or a more complicated fabrication process. This is in contrast to homogeneous recycle where all recycled actinides are distributed among all fuel assemblies. Several heterogeneous core geometries were evaluated to determine the fewest target assemblies required to burn these actinides without violating a set of established fuel performance criteria. The DIF3D/REBUS code from Argonne National Laboratory was used to perform the core physics and accompanying fuel cycle calculations in support of this work. Using the REBUS code, each core design was evaluated at the equilibrium cycle condition

  7. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation; Accion EURADOS para la determinacion de americio en craneo mediante medidas in-vivo y simulacion Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ponte, M. A.; Navarro Amaro, J. F.; Perez Lopez, B.; Navarro Bravo, T.; Nogueira, P.; Vrba, T.


    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  8. Critical and shielding parametric studies with the Monte Carlo code TRIPOLI to identify the key points to take into account during the transportation of blanket assemblies with high ratio of americium

    International Nuclear Information System (INIS)

    In the framework of French research program on Generation IV sodium cooled fast reactor, one possible option consists in burning minor actinides in this kind of Advanced Sodium Technological Reactor. Two types of transmutation mode are studied in the world : the homogeneous mode of transmutation where actinides are scattered with very low enrichment ratio in fissile assemblies and the heterogeneous mode where fissile core is surrounded by blanket assemblies filled with minor actinides with ratio of incorporated actinides up to 20%. Depending on which element is considered to be burnt and on its content, these minor actinides contents imply constraints on assemblies' transportation between Nuclear Power Plants and fuel cycle facilities. In this study, we present some academic studies in order to identify some key constraints linked to the residual power and neutron/gamma load of such kind of blanket assemblies. To simplify the approach, we considered a modeling of a 'model cask' dedicated to the transportation of a unique irradiated blanket assembly loaded with 20% of Americium and basically inspired from an existent cask designed initially for the damaged fissile Superphenix assembly transport. Thermal calculations performed with EDF-SYRTHES code have shown that due to thermal limitations on cladding temperature, the decay time to be considered before transportation is 20 years. This study is based on explicit 3D representations of the cask and the contained blanket assembly with the Monte Carlo code TRIPOLI/JEFF3.1.1 library and concludes that after such a decay time, the transportation of a unique Americium radial blanket is feasible only if the design of our model cask is modified in order to comply with the dose limitation criterion. (author)

  9. Human glutamate pyruvate transaminase (GPT): Localization to 8q24.3, cDNA and genomic sequences, and polymorphic sites

    Energy Technology Data Exchange (ETDEWEB)

    Sohocki, M.M.; Sullivan, L.S.; Daiger, S.P. [Univ. of Texas Health Science Center, Houston, TX (United States)] [and others


    Two frequent protein variants of glutamate pyruvate transaminase (GPT) (E.C. have been used as genetic markers in humans for more than two decades, although chromosomal mapping of the GPT locus in the 1980s produced conflicting results. To resolve this conflict and develop useful DNA markers for this gene, we isolated and characterized cDNA and genomic clones of GPT. We have definitively mapped human GPT to the terminus of 8q using several methods. First, two cosmids shown to contain the GPT sequence were derived from a chromosome 8-specific library. Second, by fluorescence in situ hybridization, we mapped the cosmid containing the human GPT gene to chromosome band 8q24.3. Third, we mapped the rat gpt cDNA to the syntenic region of rat chromosome 7. Finally, PCR primers specific to human GPT amplify sequences contained within a {open_quotes}half-YAC{close_quotes} from the long arm of chromosome 8, that is, a YAC containing the 8q telomere. The human GPT genomic sequence spans 2.7 kb and consists of 11 exons, ranging in size from 79 to 243 bp. The exonic sequence encodes a protein of 495 amino acids that is nearly identical to the previously reported protein sequence of human GPT-1. The two polymorphic GPT isozymes are the result of a nucleotide substitution in codon 14. In addition, a cosmid containing the GPT sequence also contains a previously unmapped, polymorphic microsatellite sequence, D8S421. The cloned GPT gene and associated polymorphisms will be useful for linkage and physical mapping of disease loci that map to the terminus of 8q, including atypical vitelliform macular dystrophy (VMD1) and epidermolysis bullosa simplex, type Ogna (EBS1). In addition, this will be a useful system for characterizing the telomeric region of 8q. Finally, determination of the molecular basis of the GPT isozyme variants will permit PCR-based detection of this world-wide polymorphism. 22 refs., 3 figs.

  10. Target Awareness: Lupus (United States)

    ... Target Awareness: Lupus Jan. 15, 2009 Target Awareness: Lupus Target Awareness: Lupus provides a brief overview of ... Email Print Tags for this Story treatments symptoms Lupus FAQ What is lupus? What are the common ...

  11. Target Awareness: Lupus

    Medline Plus

    Full Text Available ... Target Awareness: Lupus Jan. 15, 2009 Target Awareness: Lupus Target Awareness: Lupus provides a brief overview of ... Email Print Tags for this Story treatments symptoms Lupus FAQ What is lupus? What are the common ...

  12. Target factory in perspective

    International Nuclear Information System (INIS)

    A target factory diagram has been constructed for an analysis of the shell coating process system in relation to target production. The number of deposition units needed to achieve the coating requirements will be a major target production operating cost

  13. Deletions in 14q24.1q24.3 are associated with congenital heart defects, brachydactyly, and mild intellectual disability. (United States)

    Oehl-Jaschkowitz, Barbara; Vanakker, Olivier M; De Paepe, Anne; Menten, Björn; Martin, Thomas; Weber, Georg; Christmann, Alexander; Krier, Romain; Scheid, Simone; McNerlan, Susan E; McKee, Shane; Tzschach, Andreas


    Interstitial deletions of chromosome band 14q24.1q24.3 are apparently very rare. We report on three unrelated patients with overlapping de novo deletions of sizes 5.4, 2.8, and 2.3 Mb in this region. While some clinical problems such as intestinal malrotation, cryptorchidism, and ectopic kidney were only observed in single patients, all three patients had mild intellectual disability, congenital heart defects (truncus arteriosus, pulmonary atresia, atrial septal defect, and/or ventricular septal defect), brachydactyly, hypertelorism, broad nasal bridge, and thin upper lips. Likely haploinsufficiency of one or several of the 19 genes in the common deleted interval (ACTN1, DCAF5, EXD2, GALNTL1, ERH, SLC39A9, PLEKHD1, CCDC177, KIAA0247, LOC100289511, SRSF5, SLC10A1, SMOC1, SLC8A3, ADAM21P1, COX16, SYNJ2BP, SYNJ2BP-COX16, ADAM21) was responsible for these manifestations, but apart from SMOC1, mutations in which cause autosomal recessive Waardenburg anophthalmia syndrome, and ACTN1, mutations in which are associated with congenital macrothrombocytopenia, no disease associations have so far been reported for the other genes. Functional studies and a systematic search for mutations or chromosome aberrations in this region will elucidate the role of individual genes in the clinical manifestations and will provide insight into the underlying biological mechanisms. PMID:24357125

  14. Low-Redshift Damped Lyman Alpha Galaxies Towards the Quasars B2 0827+243, PKS 0952+179, PKS 1127-145, and PKS 1629+120

    CERN Document Server

    Rao, S M; Turnshek, D A; Lane, W M; Monier, E M; Bergeron, J; Rao, Sandhya M.; Nestor, Daniel B.; Turnshek, David A.; Lane, Wendy M.; Monier, Eric M.; Bergeron, Jacqueline


    We present optical and near-infrared ground-based imaging results on four low-redshift damped Lyman alpha (DLA) galaxies. The corresponding DLA systems were discovered in our Hubble Space Telescope spectroscopic surveys for DLAs in known strong MgII absorption-line systems towards the quasars B2 0827+243 (z{DLA}=0.525), PKS 0952+179 (z{DLA}=0.239), PKS 1127-145 (z_{DLA}=0.313), and PKS 1629+120 (z{DLA}=0.532). The DLA galaxies span a mixture of morphological types from patchy, irregular, and low-surface-brightness to spiral galaxies. The luminosities range from 0.02L_K^* to 1.2L_K^*. We also discovered several extremely red objects (EROs) in two of these fields and discuss the possibility that they are associated with the DLA galaxies. These observations add to the small but growing list of DLA galaxies at low redshift. At the present time, 14 DLA galaxies in the redshift range $0.05 \\lesssim z \\lesssim 1$ have been studied. The distributions of DLA galaxy properties for these 14 cases are discussed and some ...

  15. Susceptibility to insulin-dependent diabetes mellitus maps to a locus (IDDM11) on human chromosome 14q24.3-q31

    Energy Technology Data Exchange (ETDEWEB)

    Field, L.L.; Tobias, R. [Univ. of Calgary, Alberta (Canada); Thomson, G. [Univ. of California, Berkeley, CA (United States)] [and others


    To locate genes predisposing to insulin-dependent diabetes mellitus (IDDM), an autoimmune disorder resulting from destruction of the insulin-producing pancreatic cells, we are testing linkage of IDDM susceptibility to polymorphic markers across the genome using families with two or more IDDM children. A new susceptibility locus (IDDM11) has been localized to chromosome 14q24.3-q31 by detection of significant linkage to microsatellite D14S67, using both maximum likelihood methods D14S67, using both maximum likelihood methods (LOD{sub max} = 4.0 at {theta} = 0.20) and affected sib pair (ASP) methods (P = 1 x 10{sup -5}). This represents the strongest reported evidence for linkage to any IDDM locus outside the HLA region. The subset of families in which affected children did not show increased sharing of HLA genes (HLA sharing {le}50%) provided most of the support for D14S67 linkage (LOD{sub max}4.6 at {theta} = 0.12;ASP P < 5 x 10{sup -6}). There was significant linkage heterogeneity between the HLA-defined subsets of families (P = 0.009), suggesting that IDDM11 may be an important susceptibility locus in families lacking strong HLA region predisposition. 52 refs., 2 figs., 3 tabs.

  16. Expression and purification of a novel ZNF191 zinc finger protein——ZNF191 protein and its truncated zinc finger region ZNF191 (243—368)

    Institute of Scientific and Technical Information of China (English)

    刘玉奇; 余龙; 余文浩; 施少林; 孙炳耘; 吴国俊; 黄仲贤


    ZNF191 is a new zine finger gene whieh has a 1107 bp open reading frame (ORF) and eneodes a 368 amino avid protein including a putative DNA-binding domain of four Cys2 His2 zine finger motifs at its C-terminal region. The ZNF191 cDNA is loeated in the chromosome 18q12.1 region where it is known that a variety of hereditary diseases are related to. Probably, this protein has potential function of stimulating the gene franscription. In order to examine the function and structure of ZNF191 protein, the ORF of ZNF191 and its zine finger region ZNF191(243--368) genes were inserted into PTSA-18 expression vector by PCR amplification, then the constructed genes were expressed in the PTSA-18/B121 (DE3) system. The two proteins were purified by DEAE-52, CM-23 and Heparin-Sepharose 4B columns. The pooled proteins showed a single band as assayed by Coomasie Brillian Blue Staining of an SDS/polyacryamide gel.

  17. Discovery of very high energy gamma-ray emission from the BL Lac object PKS 0301-243 with H.E.S.S

    CERN Document Server

    Abramowski, A; Aharonian, F; Ait, F; Akhperjanian, A G; Angüner, E; Anton, G; Balenderan, S; Balzer, A; Barnacka, A; Becherini, Y; Becker, J; Bernlöhr, K; Birsin, E; Bissaldi, E; Biteau, J; Böttcher, M; Boisson, C; Bolmont, J; Bordas, P; Brucker, J; Brun, F; Brun, P; Bulik, T; Carrigan, S; Casanova, S; Cerruti, M; Chadwick, P M; Chalme-Calvet, R; Chaves, R C G; Cheesebrough, A; Chrétien, M; Colafrancesco, S; Cologna, G; Conrad, J; Couturier, C; Dalton, M; Daniel, M K; Davids, I D; Degrange, B; Deil, C; deWilt, P; Dickinson, H J; Djannati-Ataï, A; Domainko, W; Drury, L O'C; Dubus, G; Dutson, K; Dyks, J; Dyrda, M; Edwards, T; Egberts, K; Eger, P; Espigat, P; Farnier, C; Fegan, S; Feinstein, F; Fernandes, M V; Fernandez, D; Fiasson, A; Fontaine, G; Förster, A; Füssling, M; Gajdus, M; Gallant, Y A; Garrigoux, T; Giebels, B; Glicenstein, J F; Grondin, M -H; Grudzìnska, M; Häffner, S; Hague, J D; Hahn, J; Harris, J; Heinzelmann, G; Henri, G; Hermann, G; Hervet, O; Hillert, A; Hinton, J A; Hofmann, W; Hofverberg, P; Holler, M; Horns, D; Jacholkowska, A; Jahn, C; Jamrozy, M; Janiak, M; Jankowsky, F; Jung, I; Kastendieck, M A; Katarzyński, K; Katz, U; Kaufmann, S; Khélifi, B; Kieffer, M; Klepser, S; Klochkov, D; Kluźniak, W; Kneiske, T; Kolitzus, D; Komin, Nu; Kosack, K; Krakau, S; Krayzel, F; Krüger, P P; Laffon, H; Lamanna, G; Lefaucheur, J; Lemoine-Goumard, M; Lenain, J -P; Lennarz, D; Lohse, T; Lopatin, A; Lu, C -C; Marandon, V; Marcowith, A; Marx, R; Maurin, G; Maxted, N; Mayer, M; McComb, T J L; Medina, M C; Méhault, J; Menzler, U; Meyer, M; Moderski, R; Mohamed, M; Moulin, E; Murach, T; Naumann, C L; de Naurois, M; Nedbal, D; Niemiec, J; Nolan, S J; Oakes, L; Ohm, S; Wilhelmi, E de Oña; Opitz, B; Ostrowski, M; Oya, I; Panter, M; Parsons, R D; Arribas, M Paz; Pekeur, N W; Pelletier, G; Perez, J; Petrucci, P -O; Peyaud, B; Pita, S; Poon, H; Pühlhofer, G; Punch, M; Quirrenbach, A; Raab, S; Raue, M; Reimer, A; Reimer, O; Renaud, M; Reyes, R de los; Rieger, F; Rob, L; Rosier-Lees, S; Rowell, G; Rudak, B; Rulten, C B; Sahakian, V; Sanchez, D A; Santangelo, A; Schlickeiser, R; Schüssler, F; Schulz, A; Schwanke, U; Schwarzburg, S; Schwemmer, S; Sol, H; Spengler, G; Spies, F; Stawarz, L; Steenkamp, R; Stegmann, C; Stinzing, F; Stycz, K; Sushch, I; Szostek, A; Tavernet, J -P; Terrier, R; Tluczykont, M; Trichard, C; Valerius, K; van Eldik, C; Vasileiadis, G; Venter, C; Viana, A; Vincent, P; Völk, H J; Volpe, F; Vorster, M; Wagner, S J; Wagner, P; Ward, M; Weidinger, M; Weitzel, Q; White, R; Wierzcholska, A; Willmann, P; Wörnlein, A; Wouters, D; Zacharias, M; Zajczyk, A; Zdziarski, A A; Zech, A; Zechlin, H -S


    The active galactic nucleus PKS 0301-243 (z=0.266) is a high-synchrotron-peaked BL Lac object that is detected at high energies (HE, 100 MeV 100 GeV) by the High Energy Stereoscopic System (H.E.S.S.) from observations between September 2009 and December 2011 for a total live time of 34.9 hours. Gamma rays above 200 GeV are detected at a significance of 9.4{\\sigma}. A hint of variability at the 2.5{\\sigma} level is found. An integral flux I(E > 200 GeV) = (3.3 +/- 1.1_stat +/- 0.7_syst)e-12 ph cm^-2s^-1 and a photon index {\\Gamma} = 4.6 +/- 0.7_stat +/- 0.2_syst are measured. Multi-wavelength light curves in HE, X-ray and optical bands show strong variability, and a minimal variability timescale of eight days is estimated from the optical light curve. A single-zone leptonic synchrotron self-Compton scenario satisfactorily reproduces the multi-wavelength data. In this model, the emitting region is out of equipartition and the jet is particle dominated. Because of its high redshift compared to other sources obse...

  18. A unique de novo interstitial deletion of chromosome 17, del(17)(q23.2q24.3) in a female newborn with multiple congenital anomalies

    Energy Technology Data Exchange (ETDEWEB)

    Levin, M.L.; Shaffer, L.G.; Lewis, R.A. [Baylor College of Medicine, Houston, TX (United States)] [and others


    Contiguous gene or microdeletion syndromes occurring on chromosome 17p include the Smith-Magenis and Miller-Dieker syndromes associated with interstitial deletions of 17p11.2 and 17p13.3, respectively. Other cytogenetically visible interstitial deletions on chromosome 17 are quite rare or unique. We describe a newborn with a novel interstitial deletion of the long arm of chromosome 17 [del(17)(q23.2q24.3)] who died on day of life 17 during a recurrent apneic episode. We have compared our patient`s phenotype and karyotype to two reported patients with deletion 17q with minor clinical overlap. The most striking clinical features of this patient were severe intrauterine growth retardation, widespread skeletal malformations (split sutures, hypoplastic acetabulae and scapulae, vertebral anomalies, and digital hypoplasia), cutis verticis gyrata, dysmorphic facial features, and oropharyngeal malformations (absent uvula and submucous cleft palate). Mild congenital heart disease and anomalous optic nerves were also present. Parental karyotyps were normal. DNA from parents and patient has been collected and cell lines established on both parents. Genes which have been previously mapped to the region that is apparently deleted in this patient include: chorionic somatomammotropin A, growth hormone (normal), acid alpha-glucosidase, apolipoprotein H, and the alpha peptide of type 4 voltage gated sodium channel. As in other clinical cytogenetic syndromes, further descriptions of patients with similar or overlapping rearrangements in this region will be necessary to delineate genotype/phenotype correlations for chromosome 17.

  19. Experimental study of the neutron induced fission cross-section of 234U, 237Np and 243Am with time-of-flight spectrometry technics

    International Nuclear Information System (INIS)

    The current work concentrates on the measurements of the nuclear data needed for solving the problem of transmutation of radiotoxic waste. It includes fission cross-section of 234U in the energy range from thermal to 1 MeV, 237Np and 243Am in the resonance region and average group capture cross-section of 234U and 236U. Almost all of these data are recommended by IAEA as a first priority needs for transmutation problem. Another objective is to obtain the high resolution data of the fission cross-section of the 234U on the fission barrier to confirm the existence of the fine structure, attributed to the vibrational resonances in the third well of the fission barrier. The Dissertation summarizes more, than 10 years of the experiments, performed on the pulsed neutron sources IBR-2 and IBR-30 of Frank Laboratory of Neutron Physics of the Joint Institute for Nuclear Research (FLNP JINR) in Dubna, Russia; 'Fakel' of Russian Scientific Center 'Kurchatov's Institute' and n-TOF of CERN. The TOF technique was used for neutron energy spectrometry and various kinds of detectors to mark the fission events. The independent measurements of the same isotopes done on different neutron sources and sometimes with different techniques gives strong, self-consistent set of data. (author)

  20. X-ray outbursts of ESO 243-49 HLX-1: comparison with Galactic low-mass X-ray binary transients

    CERN Document Server

    Yan, Zhen; Soria, Roberto; Altamirano, Diego; Yu, Wenfei


    We studied the outburst properties of the hyper-luminous X-ray source ESO 243-49 HLX-1, using the full set of Swift monitoring observations. We quantified the increase in the waiting time, recurrence time and e-folding rise timescale along the outburst sequence, and the corresponding decrease in outburst duration, total radiated energy, and e-folding decay timescale, which confirms previous findings. HLX-1 spends less and less time in outburst and more and more time in quiescence, but its peak luminosity remains approximately constant. We compared the HLX-1 outburst properties with those of bright Galactic low-mass X-ray binary transients (LMXBTs). Our spectral analysis strengthens the similarity between state transitions in HLX-1 and those in Galactic LMXBTs. We also found that HLX-1 follows the nearly linear correlations between the hard-to-soft state transition luminosity and the peak luminosity, and between the rate of change of X-ray luminosity during the rise phase and the peak luminosity, which indicat...

  1. A novel autosomal recessive non-syndromic hearing impairment locus (DFNB47) maps to chromosome 2p25.1-p24.3. (United States)

    Hassan, Muhammad Jawad; Santos, Regie Lyn P; Rafiq, Muhammad Arshad; Chahrour, Maria H; Pham, Thanh L; Wajid, Muhammad; Hijab, Nadine; Wambangco, Michael; Lee, Kwanghyuk; Ansar, Muhammad; Yan, Kai; Ahmad, Wasim; Leal, Suzanne M


    Hereditary hearing impairment (HI) displays extensive genetic heterogeneity. Autosomal recessive (AR) forms of prelingual HI account for approximately 75% of cases with a genetic etiology. A novel AR non-syndromic HI locus (DFNB47) was mapped to chromosome 2p25.1-p24.3, in two distantly related Pakistani kindreds. Genome scan and fine mapping were carried out using microsatellite markers. Multipoint linkage analysis resulted in a maximum LOD score of 4.7 at markers D2S1400 and D2S262. The three-unit support interval was bounded by D2S330 and D2S131. The region of homozygosity was found within the three-unit support interval and flanked by markers D2S2952 and D2S131, which corresponds to 13.2 cM according to the Rutgers combined linkage-physical map. This region contains 5.3 Mb according to the sequence-based physical map. Three candidate genes, KCNF1, ID2 and ATP6V1C2 were sequenced, and were found to be negative for functional sequence variants. PMID:16261342

  2. The orbits of subdwarf B + main-sequence binaries. I: The sdB+G0 system PG 1104+243

    CERN Document Server

    Vos, J; Degroote, P; De Smedt, K; Green, E M; Heber, U; Van Winckel, H; Acke, B; Bloemen, S; De Cat, P; Exter, K; Lampens, P; Lombaert, R; Masseron, T; Menu, J; Neyskens, P; Raskin, G; Smolders, K; Tkachenko, A; Ringat, E; Rauch, T


    The predicted orbital period histogram of an sdB population is bimodal with a peak at short ( 250 days) periods. Observationally, there are many short-period sdB systems known, but only very few long-period sdB binaries are identified. As these predictions are based on poorly understood binary interaction processes, it is of prime importance to confront the predictions to observational data. In this contribution we aim to determine the absolute dimensions of the long-period sdB+MS binary system PG1104+243. High-resolution spectroscopy time-series were obtained with HERMES at the Mercator telescope at La Palma, and analyzed to obtain radial velocities of both components. Photometry from the literature was used to construct the spectral energy distribution (SED) of the binary. Atmosphere models were used to fit this SED and determine the surface gravity and temperature of both components. The gravitational redshift provided an independent confirmation of the surface gravity of the sdB component. An orbital peri...

  3. Association of the −243A>G, +61450C>A Polymorphisms of the Glutamate Decarboxylase 2 (GAD2) Gene with Obesity and Insulin Level in North Indian Population (United States)

    PRAKASH, Jai; MITTAL, Balraj; AWASTHI, Shally; SRIVASTAVA, Neena


    Background: Obesity associated with type 2 diabetes, and hypertension increased mortality and morbidity. Glutamate decarboxylase 2 (GAD2) gene is associated with obesity and it regulate food intake and insulin level. We investigated the association of GAD-2gene −243A>G (rs2236418) and +61450C>A (rs992990) polymorphisms with obesity and related phenotypes. Methods: Insulin, glucose and lipid levels were estimated using standard protocols. All subjects were genotyped (PCR-RFLP) method. Results: The −243A>G polymorphism of the GAD-2 gene was significantly associated with higher risk of obesity (Pobesity and related phenotype in complex manner, probably by regulating the food intake, insulin and body weight.

  4. Discovery of a Neuroprotective Chemical, (S)-N-(3-(3,6-Dibromo-9H-carbazol-9-yl)-2-fluoropropyl)-6-methoxypyridin-2-amine [(−)-P7C3-S243], with Improved Druglike Properties


    Naidoo, Jacinth; De Jesus-Cortes, Hector; Huntington, Paula; Estill, Sandi; Morlock, Lorraine K.; Starwalt, Ruth; Mangano, Thomas J.; Williams, Noelle S.; Pieper, Andrew A.; Ready, Joseph M.


    (−)-P7C3-S243 is a neuroprotective aminopropyl carbazole with improved druglike properties compared with previously reported compounds in the P7C3 class. It protects developing neurons in a mouse model of hippocampal neurogenesis and protects mature neurons within the substantia nigra in a mouse model of Parkinson’s disease. A short, enantioselective synthesis provides the neuroprotective agent in optically pure form. It is nontoxic, orally bioavailable, metabolically stable, and able to cros...

  5. Comment on "John's stone: A possible fragment of the 1908 Tunguska meteorite" (Anfinogenov et al., 2014, Icarus 243, 139-147) (United States)

    Haack, Henning; Greenwood, Richard C.; Busemann, Henner


    Anfinogenov et al. (Anfinogenov et al. [2014]. Icarus 243, 139-147) argue that a highly silicified gravelite sandstone referred to as "John's stone" could be a fragment of the long-sought-after impactor from the 1908 Tunguska event. We have analyzed the oxygen isotopic composition of two distinct samples of John's stone both kindly provided by Dr Yana Anfingenova. Both samples had very similar isotopic compositions, such that the average of the two was as follows: δ17O = 6.67 ± 0.15‰; δ18O = 12.78 ± 0.28‰; Δ17O = -0.01 ± 0.01 (errors 1SD). This value is well within the range for samples of terrestrial quartz-bearing sedimentary and metamorphic rocks. John's stone has an oxygen isotope composition and mineralogy that is unlike any known group of meteorites. If John's stone is extraterrestrial this would imply that it represents a previously unknown type of meteorite, as suggested by Anfinogenov et al. However, since sandstones can only form on a parent body with liquid water and by inference, also an atmosphere, we argue that there are only two possible parent bodies in the Solar System: the Earth and Mars. Mars can be ruled out for several reasons, including the oxygen isotopic and noble gas composition of John's stone, which is clearly distinct from martian meteorites. Consistent with the O study, the noble gases do not provide any evidence for an extraterrestrial origin of the samples. The lack of any cosmogenic noble gases (particularly striking in 3He, 21Ne, 38Ar) is consistent with a terrestrial origin or an extraterrestrial origin under large shielding. Based on the combined evidence obtained in this study we infer that John's stone is a terrestrial rock unrelated to the Tunguska impactor.

  6. Effective neutron targets

    International Nuclear Information System (INIS)

    Because of the lack of a free neutron target, deuterium targets have been used extensively in studying the neutron structure. The unique spin structure of the 3He ground state wave function and the recent developments in laser technologies made polarized 3He targets widely used in many experiments from neutron electromagnetic form factor studies to nucleon spin structure function measurements at all major electron accelerator facilities. In this talk, the current status of the polarized 3He targets will be reviewed. The author will focus on neutron electromagnetic form factor studies using polarized 3He targets. The polarized nucleon spin structure function measurements using polarized 3He targets will also be discussed

  7. Molecular Targets for Targeted Radionuclide Therapy

    International Nuclear Information System (INIS)

    Molecular targeted radionuclide cancer therapy is becoming of increasing importance, especially for disseminated diseases. Systemic chemotherapies often lack selectivity while targeted radionuclide therapy has important advantages as the radioactive cytotoxic unit of the targeting vector is specifically directed to the cancer, sparing normal tissues. The principle strategy to improve cancer selectivity is to couple therapeutic agents to tumour-targeting vectors. In targeted radionuclide therapy (TRT), the cytotoxic portion of the conjugates normally contains a therapeutic radiometal immobilised by a bifunctional chelator. The aim is therefore to use as ligand-targeted therapeutics vectors coupled to Auger-, alpha- and/or beta-emitting radionuclides. An advantage of using radiation instead of chemotherapeutics as the cytotoxic agent is the so called 'crossfire effect'. This allows sterilisation of tumour cells that are not directly targeted due to heterogeneity in target molecule expression or inhomogeneous vector delivery. However, before the targeting ligands can be selected, the target molecule on the tumour has to be selected. It should be uniquely expressed, or at least highly overexpressed, on or in the target cells relative to normal tissues. The target should be easily accessible for ligand delivery and should not be shed or down- regulated after ligand binding. An important property of a receptor (or antigen) is its potential to be internalized upon binding of the ligand. This provides an active uptake mechanism and allows the therapeutic agent to be trapped within the tumour cells. Molecular targets of current interest include: Receptors: G-protein coupled receptors are overexpressed on many major human tumours. The prototype of these receptors are somatostatin receptors which show very high density in neuroendocrine tumours, but there are many other most interesting receptors to be applied for TRT. The targeting ligands for these receptors are

  8. Price level targeting


    Shukayev, Malik; Ueberfeldt, Alexander


    Various papers have suggested that Price-Level targeting is a welfare improving policy relative to Inflation targeting. From a practical standpoint, this raises an important yet unanswered question: What is the optimal price index to target? This paper derives the optimal price level targeting index defined over the eight main components of the Consumer Price Index. It finds that such an index places a heavier weight, relative to the expenditure weight, on sectors with slow price adjustments....

  9. Multilayer polymer microspot targets

    International Nuclear Information System (INIS)

    Last year the authors reported on the development of a seeded microspot x-ray diagnostic target. This target consisted of a 300-μm-diam, 2-μm-thick disk of silicon or sulfur-seeded hydrocarbon polymer nested tightly in a hole in a 2-μm-thick film of pure hydrocarbon polymer. This year they extended our work on the microspot target, fully encapsulating the microspot in what they call the multilayer polymer microspot target

  10. Target Price Accuracy


    Alexander G. Kerl


    This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown) 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio). However, target price accuracy is positive...

  11. The Targeting of Advertising


    Ganesh Iyer; David Soberman; J. Miguel Villas-Boas


    An important question that firms face in advertising is developing effective media strategy. Major improvements in the quality of consumer information and the growth of targeted media vehicles allow firms to precisely target advertising to consumer segments within a market. This paper examines advertising strategy when competing firms can target advertising to different groups of consumers within a market. With targeted advertising, we find that firms advertise more to consumers who have a st...





    This article aims to highlight the concept of Target Costing. Based on the characteristics of Target Costing, identified in specialized literature, the article presents its main advantages and disadvantages. Also, a comparison is being made between Target Cost and Traditional Cost (in its traditional form, the cost represents an independent variable on the basis of which the sell price is established; and in the Target Cost form the cost represents a dependent variable which is determined on ...

  13. An actionable climate target (United States)

    Geden, Oliver


    The Paris Agreement introduced three mitigation targets. In the future, the main focus should not be on temperature targets such as 2 or 1.5 °C, but on the target with the greatest potential to effectively guide policy: net zero emissions.

  14. Thermodynamics of extraction of plutonium(IV) and americium(III) in polyethylene glycol (PEG) and (NH4)2SO4 based aqueous biphasic system (ABS) using 18-crown-6

    International Nuclear Information System (INIS)

    Extraction of plutonium(IV) and americium(III) using PEG-2000/(NH4)2SO4 (40% w/w of each) aqueous biphasic system (ABS) with 18-crown-6 (18-C-6) was studied at four different temperatures in the range of 288 to 318 K. The species extracted are identified to be [Pu.2(18-C-6)](SO4)2 and [Am.2(18-C-6)](SO4)1.5 for Pu(IV) and Am(III), respectively, by the slope ratio method. The thermodynamic parameters evaluated at 298 K by the temperature coefficient approach show that the reaction is favoured by decrease of enthalpy and counteracted by decrease in entropy in the case of Pu(IV) as well as Am(III). The large decrease in the enthalpy observed indicates that there is direct bonding of crown ether to the central metal atom i.e. the formation of inner sphere complex for both Pu(IV) and Am(III) and is similar to that reported previously for Pu(VI). The order of equilibrium constant K and ΔG value is Pu(IV) > Pu(VI) > Am(III) and this is in accordance with the axial charge experienced by the incoming ligand. (orig.)

  15. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive; Utilizacao de metodos radioanaliticos para determinacao de isotopos de uranio, netunio, plutonio, americio e curio em rejeitos radioativos

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca


    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  16. Viscosity of n-hexadecane, n-octadecane and n-eicosane at pressures up to 243 MPa and temperatures up to 534 K

    International Nuclear Information System (INIS)

    Highlights: • A novel windowed Inconel rolling-ball viscometer is designed and used by our team. • Viscosity data are reported for n-hexadecane, n-octadecane, and n-eicosane at high temperatures and pressures. • The viscosity results are compared with the available literature data. • The viscosity results are modeled with the free volume theory model. - Abstract: Viscosity data are reported for n-hexadecane (C16), n-octadecane (C18), and n-eicosane (C20) at pressures between (3 and 243) MPa and temperatures between (304 and 534) K. These extreme conditions are representative of those encountered in ultra-deep petroleum formations beneath the deepwaters of the Gulf of Mexico. The measurements are taken with a novel windowed Inconel rolling-ball viscometer designed by our team that is calibrated with n-decane. A comparison of the reported viscosity values with the available literature data that cover limited pressure and temperature ranges, shows that the mean absolute percentage deviation, δ, ranges between 1.1% and 4.8%. The reported data extend the database of viscosity to the high-temperature, high-pressure region where most gaps occur in the literature data for n-hexadecane and n-octadecane. To the best of our knowledge, the results for n-eicosane are the first reported viscosity values at pressures above 2 MPa over the entire temperature range. The viscosity results are modeled with the free volume theory model in conjunction with density values obtained using the Peng–Robinson equation of state (EoS) and the PC-SAFT EoS. The δ values obtained with this model range from 2.0% to 3.5%. The data are also correlated by a non-linear surface fit as a simultaneous function of temperature and pressure that yields δ values of 0.40%, 0.43%, and 0.38% for C16, C18, and C20, respectively


    Energy Technology Data Exchange (ETDEWEB)

    Bussmann, R. S.; Gurwell, M. A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Fu Hai; Cooray, A. [Department of Physics and Astronomy, University of California, Irvine, CA 92697 (United States); Smith, D. J. B.; Bonfield, D.; Dunne, L. [Centre for Astrophysics, Science and Technology Research Institute, University of Hertfordshire, Hatfield, Herts AL10 9AB (United Kingdom); Dye, S.; Eales, S. [School of Physics and Astronomy, University of Nottingham, University Park, Nottingham NG7 2RD (United Kingdom); Auld, R. [Cardiff University, School of Physics and Astronomy, Queens Buildings, The Parade, Cardiff CF24 3AA (United Kingdom); Baes, M.; Fritz, J. [Sterrenkundig Observatorium, Universiteit Gent, Krijgslaan 281 S9, B-9000 Gent (Belgium); Baker, A. J. [Department of Physics and Astronomy, Rutgers, the State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854-8019 (United States); Cava, A. [Departamento de Astrofisica, Facultad de CC. Fisicas, Universidad Complutense de Madrid, E-28040 Madrid (Spain); Clements, D. L.; Dariush, A. [Imperial College London, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom); Coppin, K. [Department of Physics, McGill University, Ernest Rutherford Building, 3600 Rue University, Montreal, Quebec, H3A 2T8 (Canada); Dannerbauer, H. [Universitaet Wien, Institut fuer Astronomie, Tuerkenschanzstrasse 17, 1180 Wien, Oesterreich (Austria); De Zotti, G. [Universita di Padova, Dipto di Astronomia, Vicolo dell' Osservatorio 2, IT 35122, Padova (Italy); Hopwood, R., E-mail: [Department of Physics and Astronomy, Open University, Walton Hall, Milton Keynes, MK7 6AA (United Kingdom); and others


    We present high-spatial resolution imaging obtained with the Submillimeter Array (SMA) at 880 {mu}m and the Keck adaptive optics (AO) system at the K{sub S}-band of a gravitationally lensed submillimeter galaxy (SMG) at z = 4.243 discovered in the Herschel Astrophysical Terahertz Large Area Survey. The SMA data (angular resolution Almost-Equal-To 0.''6) resolve the dust emission into multiple lensed images, while the Keck AO K{sub S}-band data (angular resolution Almost-Equal-To 0.''1) resolve the lens into a pair of galaxies separated by 0.''3. We present an optical spectrum of the foreground lens obtained with the Gemini-South telescope that provides a lens redshift of z{sub lens} = 0.595 {+-} 0.005. We develop and apply a new lens modeling technique in the visibility plane that shows that the SMG is magnified by a factor of {mu} = 4.1 {+-} 0.2 and has an intrinsic infrared (IR) luminosity of L{sub IR} = (2.1 {+-} 0.2) Multiplication-Sign 10{sup 13} L{sub Sun }. We measure a half-light radius of the background source of r{sub s} = 4.4 {+-} 0.5 kpc which implies an IR luminosity surface density of {Sigma}{sub IR} (3.4 {+-} 0.9) Multiplication-Sign 10{sup 11} L{sub Sun} kpc{sup -2}, a value that is typical of z > 2 SMGs but significantly lower than IR luminous galaxies at z {approx} 0. The two lens galaxies are compact (r{sub lens} Almost-Equal-To 0.9 kpc) early-types with Einstein radii of {theta}{sub E1} 0.57 {+-} 0.01 and {theta}{sub E2} = 0.40 {+-} 0.01 that imply masses of M{sub lens1} = (7.4 {+-} 0.5) Multiplication-Sign 10{sup 10} M{sub Sun} and M{sub lens2} = (3.7 {+-} 0.3) Multiplication-Sign 10{sup 10} M{sub Sun }. The two lensing galaxies are likely about to undergo a dissipationless merger, and the mass and size of the resultant system should be similar to other early-type galaxies at z {approx} 0.6. This work highlights the importance of high spatial resolution imaging in developing models of strongly lensed galaxies

  18. Targeted cancer therapies

    Institute of Scientific and Technical Information of China (English)

    Li Yan; Neal Rosen; Carlos Arteaga


    With unprecedented understanding of molecular events underlying human cancer in this genomic era, a large number of drugs specifically targeting hypothesized oncogenic drivers to which tumors are potentially addicted to have been developed and continue to be developed. These targeted cancer therapies are being actively tested in clinical trials with mixed successes. This editorial provides an overview on successful targeted cancer drugs on the market and those drugs that are in late clinical development stages. Importantly, the article lays out main challenges in developing molecular targeted therapies and potential path forward to overcome these challenges, as well as opportunities for China in this new era of targeted agents. The editorial serves as an introduction to the Targeted Cancer Therapies serias that will review in depth of major pathways and drugs targeting these pathways to be published in the coming issues of the Chinese Journal of Cancer.

  19. Polarized targets and beams

    International Nuclear Information System (INIS)

    First the experimental situation of the single-pion photoproduction and the photodisintegration of the deuteron is briefly discussed. Then a description of the Bonn polarization facilities is given. The point of main effort is put on the polarized target which plays a vital role in the program. A facility for photon induced double polarization experiments at ELSA will be presented in section 4. Properties of a tensor polarized deuteron target are discussed in section 5. The development in the field of polarized targets, especially on new target materials, enables a new generation of polarized target experiments with (polarized) electrons. Some comments on the use of a polarized target in combination with electron beams will be discussed in section 6. Electron deuteron scattering from a tensor polarized deuteron target is considered and compared with other experimental possibilities. (orig./HSI)

  20. I. Nuclear Production Reaction and Chemical Isolation Procedure for Americium-240 II. New Superheavy Element Isotopes: Plutonium-242(Calcium-48,5n)(285)114 (United States)

    Ellison, Paul Andrew


    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242 Pu(p, 3n)240Am nuclear reaction was measured to be lower than theoretical predictions, but high enough to be the most viable nuclear reaction for the large-scale production of 240 Am. Details of the development of a chemical separation procedure for isolating 240Am from proton-irradiated 242Pu are discussed. The separation procedure, which includes two anion exchange columns and two extraction chromatography columns, was experimentally investi- gated using tracer-level 241Am, 239Pu, and model proton-induced fission products 95Zr, 95Nb, 125Sb, and 152Eu. The separation procedure was shown to have an Am/Pu separation factor of >2x10 7 and an Am yield of ˜70%. The separation procedure was found to purify the Am sample from >99.9% of Eu, Zr, Nb, and Sb. The procedure is well suited for the processing of ˜1 gram of proton-irradiated 242Pu to produce a neutron-induced fission target consisting of tens of nanograms of 240Am. Part II describes the use of the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron for the study of the 242Pu(48Ca,5n)285114 nuclear re- action. The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV ( E* = 50 MeV). The alpha decay of 285114 was followed by the sequential alpha decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269 Sg. 265Rf was observed to decay by spontaneous fission. The measured alpha-decay Q-values were compared with those from a macroscopic

  1. GWAS and drug targets


    Cao, Chen; Moult, John


    Background Genome wide association studies (GWAS) have revealed a large number of links between genome variation and complex disease. Among other benefits, it is expected that these insights will lead to new therapeutic strategies, particularly the identification of new drug targets. In this paper, we evaluate the power of GWAS studies to find drug targets by examining how many existing drug targets have been directly 'rediscovered' by this technique, and the extent to which GWAS results may ...

  2. Deuterium high pressure target

    International Nuclear Information System (INIS)

    The design of the deuterium high-pressure target is presented. The target having volume of 76 cm3 serves to provide the experimental research of muon catalyzed fusion reactions in ultra-pure deuterium in the temperature range 80-800 K under pressures of up to 150 MPa. The operation of the main systems of the target is described: generation and purification of deuterium gas, refrigeration, heating, evacuation, automated control system and data collection system

  3. Inertial Confinement fusion targets (United States)

    Hendricks, C. D.


    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques were devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems, and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented.

  4. Deuterium High Pressure Target

    CERN Document Server

    Perevozchikov, V; Vinogradov, Yu I; Vikharev, M D; Ganchuk, N S; Golubkov, A N; Grishenchkin, S K; Demin, A M; Demin, D L; Zinov, V G; Kononenko, A A; Lobanov, V N; Malkov, I L; Yukhimchuk, S A


    The design of the deuterium high-pressure target is presented. The target having volume of 76 cm^3 serves to provide the experimental research of muon catalyzed fusion reactions in ultra-pure deuterium in the temperature range 80-800 K under pressures of up to 150 MPa. The operation of the main systems of the target is described: generation and purification of deuterium gas, refrigeration, heating, evacuation, automated control system and data collection system.

  5. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice


    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  6. Moving Target Defense

    CERN Document Server

    Jajodia, Sushil; Swarup, Vipin; Wang, Cliff; Wang, X Sean


    Moving Target Defense: Creating Asymmetric Uncertainty for Cyber Threats was developed by a group of leading researchers. It describes the fundamental challenges facing the research community and identifies new promising solution paths. Moving Target Defense which is motivated by the asymmetric costs borne by cyber defenders takes an advantage afforded to attackers and reverses it to advantage defenders. Moving Target Defense is enabled by technical trends in recent years, including virtualization and workload migration on commodity systems, widespread and redundant network connectivity, instr

  7. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  8. Target Assembly Facility (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  9. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.


    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  10. Bayesian multiple target tracking

    CERN Document Server

    Streit, Roy L


    This second edition has undergone substantial revision from the 1999 first edition, recognizing that a lot has changed in the multiple target tracking field. One of the most dramatic changes is in the widespread use of particle filters to implement nonlinear, non-Gaussian Bayesian trackers. This book views multiple target tracking as a Bayesian inference problem. Within this framework it develops the theory of single target tracking, multiple target tracking, and likelihood ratio detection and tracking. In addition to providing a detailed description of a basic particle filter that implements

  11. The Target Visitation Problem


    Hildenbrandt, Achim


    The thesis considers the target visitation problem, a combinatorial optimization problem, which merges the classical traveling salesman problem with the linear ordering problem. In more detail, we are looking for a tour which visits a set of targets and which is optimal with respect to two different aspects: On the one hand, we have given a travel cost from each target to every other. On the other hand, we have preference values which tell us how much we would like to visit one target before ...

  12. The real part of the forward elastic scattering amplitude for pp and /ovr/p//p at √s = 24.3 GeV from experiment UA6

    International Nuclear Information System (INIS)

    Preliminary results for the ratio of the real part to the imaginary part of the forward elastic scattering amplitude are presented for both pp and /ovr/p/p scattering at √s = 24.3 GeVc. The elastic differential cross section was measured in the four-momentum transfer range 0.001 2 using a position sensitive silicon detector to detect the recoil proton. The values found are /rho/(pp) = 0.014 +- 0.007 +- 0.007 and /rho/(/ovr/p//p) = 0.045 +- 0.007 +- 0.007

  13. Impaction grafting in the femur in cementless modular revision total hip arthroplasty: a descriptive outcome analysis of 243 cases with the MRP-TITAN revision implant

    Directory of Open Access Journals (Sweden)

    Wimmer Matthias D


    Full Text Available Abstract Background We present a descriptive and retrospective analysis of revision total hip arthroplasties (THA using the MRP-TITAN stem (Peter Brehm, Weisendorf, GER with distal diaphyseal fixation and metaphyseal defect augmentation. Our hypothesis was that the metaphyseal defect augmentation (Impaction Bone Grafting improves the stem survival. Methods We retrospectively analyzed the aggregated and anonymized data of 243 femoral stem revisions. 68 patients with 70 implants (28.8% received an allograft augmentation for metaphyseal defects; 165 patients with 173 implants (71.2% did not, and served as controls. The mean follow-up was 4.4 ± 1.8 years (range, 2.1–9.6 years. There were no significant differences (p > 0.05 between the study and control group regarding age, body mass index (BMI, femoral defects (types I-III as described by Paprosky, and preoperative Harris Hip Score (HHS. Postoperative clinical function was evaluated using the HHS. Postoperative radiologic examination evaluated implant stability, axial implant migration, signs of implant loosening, periprosthetic radiolucencies, as well as bone regeneration and resorption. Results There were comparable rates of intraoperative and postoperative complications in the study and control groups (p > 0.05. Clinical function, expressed as the increase in the postoperative HHS over the preoperative score, showed significantly greater improvement in the group with Impaction Bone Grafting (35.6 ± 14.3 vs. 30.8 ± 15.8; p ≤ 0.05. The study group showed better outcome especially for larger defects (types II C and III as described by Paprosky and stem diameters ≥ 17 mm. The two groups did not show significant differences in the rate of aseptic loosening (1.4% vs. 2.9% and the rate of revisions (8.6% vs. 11%. The Kaplan-Meier survival for the MRP-TITAN stem in both groups together was 93.8% after 8.8 years. [Study group 95.7% after 8.54 years ; control group 93

  14. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)


    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit rand

  15. Pure HD polarized targets

    International Nuclear Information System (INIS)

    The HD polarized target project is now ready to use a target in a physics experiment. This must be done in early 1998 at LEGS (BNL). The IPN cryogenic group takes its part in this venture by doing the transfer and in-beam cryostats. (authors)

  16. The CNGS target

    CERN Multimedia

    Patrice Loïez


    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  17. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco


    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  18. Soja transgênica BRS 243 RR: determinação de macronutrientes e das isoflavonas daidzeína e genisteína por Cromatografia Líquida de Alta Eficiência (CLAE Transgenic soybean BRS 243 RR: determination of macronutrients and isoflavones daidzein and genistein by High Performance Liquid Chromatography (HPLC

    Directory of Open Access Journals (Sweden)

    Marcela Roquim Alezandro


    Full Text Available Este trabalho teve por objetivo determinar a composição centesimal e o conteúdo de Daidzeína (D e Genisteína (G da cultivar BRS 243 RR por CLAE. O preparo da amostra para cromatografia envolveu a remoção da gordura com hexano . Os analitos foram extraídos com etanol 70% acrescido de 0,1% de ácido acético. As condições cromatográficas otimizadas foram: coluna C18, fase móvel metanol: ácido acético 5% (1:1 v/v, vazão 0,5 mL/minuto, temperatura da coluna 30 °C, volume de injeção 40 µL e leitura em 254 nm. Os parâmetros de validação avaliados foram: linearidade y = 11242 x -37433, r = 0,9976 (D e y = 18510 x -66761, r = 0,9980 (G; coeficientes de variação dos estudos de precisão intradia CV = 5,3% (D, CV = 6,7% (G e interdias CV = 8,7% (D, CV = 9,7% (G; limite de quantificação 10 µg.g-1; limite de detecção 5 µg.g-1 e recuperação 95,7%. Portanto, o método desenvolvido foi adequado para a determinação de daidzeína e genisteína em soja. Os níveis de carboidratos (31,4%, proteínas (35,9%, lipídios (20,9%, umidade (6,9%, cinzas (4,9%, daidzeína (44,1 µg.g-1 e genisteína (37,4 µg.g-1 determinados na soja transgênica foram similares aos de outros estudos com soja convencional.The objective of this work was to evaluate the proximate composition, as well as Daidzein (D and Genistein (G contents by HPLC, of BRS 243 RR soybean. Sample preparation for the chromatographic analysis involved the use of hexane to remove lipids. Isoflavones were extracted with 70% ethanol containing 0.1% acetic acid. The optimized chromatographic conditions were: C18 column, mobile phase methanol:5% acetic acid (1:1 v/v, flow rate 0.5 mL/minute, column temperature 30 °C, UV absorbance at 254 nm and volume injected 40 µL. The validation parameters were: linearity of daidzein (y = 11242 x -37433, r = 0.9976 and genistein (y = 18510 x -66761, r = 0.9980; variation coefficients obtained in intra-day precision assays [CV = 5.3% (D, CV = 6

  19. Frizzled-7 as a Potential Therapeutic Target in Colorectal Cancer

    Directory of Open Access Journals (Sweden)

    Koji Ueno


    Full Text Available We investigated whether one of the Wnt receptors, frizzled-7 (FZD7, functions in the canonical Wnt signaling pathway of colorectal cancer (CRC cells harboring an APC or CTNNB1 mutation and may be a potential therapeutic target for sporadic CRCs. The expression level of FZD gene family members in colon cancer cells and primary CRC tissues were determined by real-time PCR. Activation of the Wnt signaling pathway was evaluated by TOPflash assay. The expression level of Wnt target genes was determined by real-time polymerase chain reaction and/or Western blot analysis. Cell growth and cell invasion were assessed by MTS and matrigel assays, respectively. Among 10 FZD gene family members, FZD7 mRNA was predominantly expressed in six colon cancer cell lines with APC or CTNNB1 mutation. These six cell lines were transfected with FZD7 cDNA together with a TOPflash reporter plasmid, resulting in a 1.5- to 24.3-fold increase of Tcf transcriptional activity. The mRNA expression levels of seven known Wnt target genes were also increased by 1.5- to 3.4-fold after transfection of FZD7 cDNA into HCT-116 cells. The six cell lines were then cotransfected with FZD7-siRNA and a TOPflash reporter plasmid, which reduced Tcf transcriptional activity to 20% to 80%. FZD7-siRNA was shown to significantly decrease cell viability and in vitro invasion activity after transfection into HCT-116 cells. Our present data demonstrated that FZD7 activates the canonical Wnt pathway in colon cancer cells despite the presence of APC or CTNNB1 mutation and that FZD7-siRNA may be used as a therapeutic reagent for CRCs.

  20. Solubility and speciation studies of waste radionuclides pertinent to geologic disposal at Yucca Mountain: Results on neptunium, plutonium and americium in J-13 groundwater; Letter report (R707): Reporting period, October 1, 1985--September 30, 1987

    Energy Technology Data Exchange (ETDEWEB)

    Nitsche, H.; Standifer, E.M.; Lee, S.C.; Gatti, R.C.; Tucker, D.B.


    We have studied the solubilities of neptunium, plutonium, and americium in J-13 groundwater from Yucca Mountain (Nevada) at three temperatures and hydrogen ion concentrations. They are 25{degree}, 60{degree}C, and 90{degree}C and pH 5.9, 7.0, and 8.5. The results for 25{degree}C are from a study which we did during FY 1984. We included these previous results in the tables to give more information on the solubility temperature dependence; they were, however, done at only one pH (7.0). The solubilities were studied from oversaturation. The nuclides were added at the beginning of each experiment as NpO{sub 2}{sup +}, Pu{sup 4+}, and Am{sup 3+}. The neptunium solubility decreased with increasing temperature and with increasing pH. The soluble neptunium did not change oxidation state at steady state. The pentavalent neptunium was increasingly complexed by carbonate with increasing pH. All solids were crystalline and contained carbonate, except the solid formed at 90{degree}C and pH 5.9. We identified this solid as crystalline Np{sub 2}P{sub 5}. The 25{degree}C, pH 7 solid was Na{sub 3}NpO{sub 2}(CO{sub 3}){sub 2} {center_dot} nH{sub 2}O. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. Pu(V) and Pu(VI) were the dominant oxidation states in the supernatant solution; as the amount of Pu(V) increased with pH, Pu(VI) decreed. The steady-state solids were mostly amorphous, although some contained a crystalline component. They contained Pu(IV) polymer and unknown carbonates.

  1. Measurement of the Neutron Capture Cross Sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm with a Total Absorption Calorimeter at n_TOF

    CERN Multimedia

    Beer, H; Wiescher, M; Cox, J; Rapp, W; Embid, M; Dababneh, S


    Accurate and reliable neutron capture cross section data for actinides are necessary for the poper design, safety regulation and precise performance assessment of transmutation devices such as Fast Critical Reactors or Accelerator Driven Systems (ADS). The goal of this proposal is the measurement of the neutron capture cross sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm at n_TOF with an accuracy of 5~\\%. $^{233}$U plays an essential role in the Th fuel cycle, which has been proposed as a safer and cleaner alternative to the U fuel cycle. The capture cross sections of $^{237}$Np,$^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm play a key role in the design and optimization of a strategy for the Nuclear Waste Transmutation. A high accuracy can be achieved at n_TOF in such measurements due to a combination of features unique in the world: high instantaneous neutron fluence and excellent energy resolution of the facility, innovative Data Acquisition System based on flash ADCs and t...

  2. AA antiproton production target

    CERN Multimedia


    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  3. A folate-integrated magnetic polymer micelle for MRI and dual targeted drug delivery (United States)

    Ao, Lijiao; Wang, Bi; Liu, Peng; Huang, Liang; Yue, Caixia; Gao, Duyang; Wu, Chunlei; Su, Wu


    This paper devotes a novel micellar structure for cancer theranostics by incorporating magnetic and therapeutic functionalities into a natural sourced targeting polymer vehicle. Heparin-folic acid micelles taking advantage of both excellent loading capability and cancer targeting ability have been employed to simultaneously incorporate superparamagnetic iron oxide nanoparticles (SPIONs) and doxorubicin through an ultrasonication-assisted microemulsion method. In this system, folic acids not only take the responsibility of micelle construction, but also facilitate cellular uptake due to their specific reorganization by MCF-7 cells over-expressing folate receptors. The obtained micelles exhibit good colloidal stability, a high magnetic content, considerable drug loading and sustained in vitro drug release. These clustered SPIONs exhibited high r2 relaxivity (243.65 mM-1 s-1) and further served as efficient probes for MR imaging. Notably, the transport efficiency of these micelles could be significantly improved under an external magnetic field, owing to their quick magnetic response. As a result, the as-proposed micelle shows great potential in multimodal theranostics, including active targeting, MRI diagnosis and drug delivery.This paper devotes a novel micellar structure for cancer theranostics by incorporating magnetic and therapeutic functionalities into a natural sourced targeting polymer vehicle. Heparin-folic acid micelles taking advantage of both excellent loading capability and cancer targeting ability have been employed to simultaneously incorporate superparamagnetic iron oxide nanoparticles (SPIONs) and doxorubicin through an ultrasonication-assisted microemulsion method. In this system, folic acids not only take the responsibility of micelle construction, but also facilitate cellular uptake due to their specific reorganization by MCF-7 cells over-expressing folate receptors. The obtained micelles exhibit good colloidal stability, a high magnetic content

  4. Targeted therapies for cancer (United States)

    ... to be untrue. Possible side effects from targeted therapies include: Diarrhea Liver problems Skin problems such as rash, dry skin, and nail changes Problems with blood clotting and wound healing High blood pressure As with any treatment, you ...

  5. SETI target selection. (United States)

    Latham, D. W.; Soderblom, D. R.


    The NASA High Resolution Microwave Survey consists of two complementary elements: a Sky Survey of the entire sky to a moderate level of sensitivity; and a Targeted Search of nearby stars, one at a time, to a much deeper level of sensitivity. The authors propose strategies for target selection with two goals: to improve the chances of successful detection of signals from technical civilizations that inhabit planets around solar-type stars, and to minimize the chances of missing signals from unexpected sites.

  6. High pressure gas target (United States)

    Gelbart, W.; Johnson, R. R.; Abeysekera, B.


    Compact, high pressure, high current gas target features all metal construction and semi-automatic window assembly change. The unique aspect of this target is the domed-shaped window. The Havar alloy window is electron beam welded to a metal ring, thus forming one, interchangeable assembly. The window assembly is sealed by knife-edges locked by a pneumatic toggle allowing a quick, in situ window change.

  7. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice


    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  8. Radar target detection simulation

    Directory of Open Access Journals (Sweden)

    Tarig Ibrahim Osman


    Full Text Available Standard radar detection process requires that the sensor output is compared to a predetermined threshold. The threshold is selected based on a-priori knowledge available and/or certain assumptions. However, any knowledge and/or assumptions become in adequate due to the presence of multiple targets with varying signal return and usually non stationary background. Thus, any predetermined threshold may result in either increased false alarm rate or increased track loss. Even approaches where the threshold is adaptively varied will not perform well in situations when the signal return from the target of interest is too low compared to the average level of the background .Track-before-detect techniques eliminate the need for a detection threshold and provide detecting and tracking targets with lower signal-to-noise ratios than standard methods. However, although trackbefore-detect techniques eliminate the need for detection threshold at sensor's signal processing stage, they often use tuning thresholds at the output of the filtering stage .This paper presents a computerized simulation model for target detection process. Moreover, the proposed model method is based on the target motion models, the output of the detection process can easily be employed for maneuvering target tracking.

  9. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab


    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  10. Targeted assets risk analysis. (United States)

    Bouwsema, Barry


    Risk assessments utilising the consolidated risk assessment process as described by Public Safety Canada and the Centre for Security Science utilise the five threat categories of natural, human accidental, technological, human intentional and chemical, biological, radiological, nuclear or explosive (CBRNE). The categories of human intentional and CBRNE indicate intended actions against specific targets. It is therefore necessary to be able to identify which pieces of critical infrastructure represent the likely targets of individuals with malicious intent. Using the consolidated risk assessment process and the target capabilities list, coupled with the CARVER methodology and a security vulnerability analysis, it is possible to identify these targeted assets and their weaknesses. This process can help emergency managers to identify where resources should be allocated and funding spent. Targeted Assets Risk Analysis (TARA) presents a new opportunity to improve how risk is measured, monitored, managed and minimised through the four phases of emergency management, namely, prevention, preparation, response and recovery. To reduce risk throughout Canada, Defence Research and Development Canada is interested in researching the potential benefits of a comprehensive approach to risk assessment and management. The TARA provides a framework against which potential human intentional threats can be measured and quantified, thereby improving safety for all Canadians. PMID:23615063

  11. Production Target Design Report

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dale, Gregory E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Olivas, Eric Richard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    The Northstar 99Mo production target, a cylindrical length of 100Mo rod, has evolved considerably since its first conception.  The cylinder was very early sliced into disks to increase the heat transfer area, first to 1 mm thick disks then to the current 0.5 mm thick.  The coolant was changed early in the target development from water to helium to eliminate corrosion and dissolution.  The diameter has increased from initially 6 mm to 12 mm, the current diameter of the test target now at ANL, to nominally 28 mm (26-30.6 mm, depending upon optimal beam spot size and shape).  The length has also changed to improve the production to cost ratio, so now the target is nominally 41 mm long (excluding coolant gaps between disks), and irradiated on both ends.  This report summarizes the current status of the plant target design.

  12. Inflation Forecast Targeting: Implementing and Monitoring Inflation Targets


    Lars E.O. Svensson


    Inflation targeting is shown to imply inflation forecast targeting: the central bank's inflation forecast becomes an intermediate target. Inflation forecast targeting simplifies both implementing and monitoring of monetary policy. The inflation forecast is actually an ideal intermediate target: it is most correlated with the goal, easier to control than the goal, more observable than the goal, and very transparent. Money growth targeting generally leads to higher inflation variability than in...

  13. Setting reference targets

    International Nuclear Information System (INIS)

    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets

  14. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.


    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses...... how the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish...

  15. Targeted Phototherapy (newer phototherapy

    Directory of Open Access Journals (Sweden)



    Full Text Available Conventional phototherapy uses a whole body cabinet or body part machine such as hand, foot or scalp machines. They have many disadvantages due to which new phototherapy technique was then developed to overcome this situation. This new technique is called targeted phototherapy which includes excimer laser, intense pulse light system (IPL, photodynamic therapy and ultraviolet (UV light source with a sophisticated delivery system which is easy to be operated by hands. The mechanisms of action of targeted phototherapy systems are similar to those in conventional UVB/UVA therapy. They have many advantages like less chances of side effects, avoidance of exposure of unnecessary sites, faster response, shortening of the duration of treatments. But they have disadvantages like high costs and inability to use for extensive areas. This review article discusses targeted phototherapy in considerable to the mechanism of actions and advantages and disadvantages in comparison to the conventional phototherapy.

  16. Phoenix Color Targets (United States)


    These images of three Phoenix color targets were taken on sols 1 and 2 by the Surface Stereo Imager (SSI) on board the Phoenix lander. The bottom target was imaged in approximate color (SSI's red, green, and blue filters: 600, 530, and 480 nanometers), while the others were imaged with an infrared filter (750 nanometers). All of them will be imaged many times over the mission to monitor the color calibration of the camera. The two at the top show grains 2 to 3 millimeters in size that were likely lifted to the Phoenix deck during landing. Each of the large color chips on each target contains a strong magnet to protect the interior material from Mars' magnetic dust. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  17. Targeted polypeptide degradation (United States)

    Church, George M.; Janse, Daniel M.


    This invention pertains to compositions, methods, cells and organisms useful for selectively localizing polypeptides to the proteasome for degradation. Therapeutic methods and pharmaceutical compositions for treating disorders associated with the expression and/or activity of a polypeptide by targeting these polypeptides for degradation, as well as methods for targeting therapeutic polypeptides for degradation and/or activating therapeutic polypeptides by degradation are provided. The invention provides methods for identifying compounds that mediate proteasome localization and/or polypeptide degradation. The invention also provides research tools for the study of protein function.

  18. Fine target of deuterium

    International Nuclear Information System (INIS)

    A fine target of deuterium on a tantalum plate by the absorption method is obtained. In order to obtain the de gasification temperature an induction generator of high frequency is used and the deuterium pass is regulated by means of a palladium valve. Two vacuum measures are available, one to measure the high vacuum in the de gasification process of the tantalum plate and the other, for low vacuum, to measure the deuterium inlet in the installation and the deuterium pressure change in the installation after the absorption in the tantalum plate. A target of 48 μ gr/cm2 thick is obtained. (Author) 1 refs

  19. AA antiproton production target

    CERN Multimedia


    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  20. Major Targets for 2010

    Institute of Scientific and Technical Information of China (English)


    @@ This year, the main targets we have set for economic and social development are: increasing GDP by approximately 8 percent, creating jobs for more than 9 million people, keeping the urban registered unemployment rate no higher than 4.6 percent, holding the rise in consumer prices to around 3 percent, and improving the balance of payments.