WorldWideScience

Sample records for americium 242

  1. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  2. I. Nuclear Production Reaction and Chemical Isolation Procedure for Americium-240 II. New Superheavy Element Isotopes: Plutonium-242(Calcium-48,5n)(285)114

    Science.gov (United States)

    Ellison, Paul Andrew

    2011-12-01

    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242 Pu(p, 3n)240Am nuclear reaction was measured to be lower than theoretical predictions, but high enough to be the most viable nuclear reaction for the large-scale production of 240 Am. Details of the development of a chemical separation procedure for isolating 240Am from proton-irradiated 242Pu are discussed. The separation procedure, which includes two anion exchange columns and two extraction chromatography columns, was experimentally investi- gated using tracer-level 241Am, 239Pu, and model proton-induced fission products 95Zr, 95Nb, 125Sb, and 152Eu. The separation procedure was shown to have an Am/Pu separation factor of >2x10 7 and an Am yield of ˜70%. The separation procedure was found to purify the Am sample from >99.9% of Eu, Zr, Nb, and Sb. The procedure is well suited for the processing of ˜1 gram of proton-irradiated 242Pu to produce a neutron-induced fission target consisting of tens of nanograms of 240Am. Part II describes the use of the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron for the study of the 242Pu(48Ca,5n)285114 nuclear re- action. The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV ( E* = 50 MeV). The alpha decay of 285114 was followed by the sequential alpha decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269 Sg. 265Rf was observed to decay by spontaneous fission. The measured alpha-decay Q-values were compared with those from a macroscopic

  3. Investigation of the chemical explosion of an ion exchange resin column and resulting americium contamination of personnel in the 242-Z building, August 30, 1976

    Energy Technology Data Exchange (ETDEWEB)

    1976-10-19

    As a result of an explosion in the Waste Treatment Facility, 242-Z Building, 200 West Area of the Hanford Reservation on August 30, 1976, the Manager of the Richland Operations Office (RL), Energy Research and Development Administration (ERDA), appointed an ERDA Committee to conduct a formal investigation and to prepare a report on their findings of this occurrence. The Committee was instructed to conduct the investigation in accordance with ERDAMC 0502, insofar as circumstances would permit, to cover and explain technical elements of the casual sequence(s) of the occurrence, and to describe management systems which should have or could have prevented the occurrence. This report is the result of the investigation and presents the conclusions of the review.

  4. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  5. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  6. 1976 Hanford americium accident

    Energy Technology Data Exchange (ETDEWEB)

    Heid, K R; Breitenstein, B D; Palmer, H E; McMurray, B J; Wald, N

    1979-01-01

    This report presents the 2.5-year medical course of a 64-year-old Hanford nuclear chemical operator who was involved in an accident in an americium recovery facility in August 1976. He was heavily externally contaminated with americium, sustained a substantial internal deposition of this isotope, and was burned with concentrated nitric acid and injured by flying debris about the face and neck. The medical care given the patient, including the decontamination efforts and clinical laboratory studies, are discussed. In-vivo measurements were used to estimate the dose rates and the accumulated doses to body organs. Urinary and fecal excreta were collected and analyzed for americium content. Interpretation of these data was complicated by the fact that the intake resulted both from inhalation and from solubilization of the americium embedded in facial tissues. A total of 1100 ..mu..Ci was excreted in urine and feces during the first 2 years following the accident. The long-term use of diethylenetriaminepentate (DTPA), used principally as the zinc salt, is discussed including the method, route of administration, and effectiveness. To date, the patient has apparently experienced no complications attributable to this extensive course of therapy, even though he has been given approximately 560 grams of DTPA. 4 figures, 1 table.

  7. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  8. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  9. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  10. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)

    2010-07-01

    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  11. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  12. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  13. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  14. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  15. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  16. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  17. Surface complexation modeling of americium sorption onto volcanic tuff.

    Science.gov (United States)

    Ding, M; Kelkar, S; Meijer, A

    2014-10-01

    Results of a surface complexation model (SCM) for americium sorption on volcanic rocks (devitrified and zeolitic tuff) are presented. The model was developed using PHREEQC and based on laboratory data for americium sorption on quartz. Available data for sorption of americium on quartz as a function of pH in dilute groundwater can be modeled with two surface reactions involving an americium sulfate and an americium carbonate complex. It was assumed in applying the model to volcanic rocks from Yucca Mountain, that the surface properties of volcanic rocks can be represented by a quartz surface. Using groundwaters compositionally representative of Yucca Mountain, americium sorption distribution coefficient (Kd, L/Kg) values were calculated as function of pH. These Kd values are close to the experimentally determined Kd values for americium sorption on volcanic rocks, decreasing with increasing pH in the pH range from 7 to 9. The surface complexation constants, derived in this study, allow prediction of sorption of americium in a natural complex system, taking into account the inherent uncertainty associated with geochemical conditions that occur along transport pathways.

  18. 48 CFR 242.7302 - Requirements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Requirements. 242.7302 Section 242.7302 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT.../Pension Review 242.7302 Requirements. Follow the procedures at PGI 242.7302 to determine if a CIPR...

  19. 48 CFR 242.7303 - Responsibilities.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Responsibilities. 242.7303 Section 242.7303 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT.../Pension Review 242.7303 Responsibilities. Follow the procedures at PGI 242.7303 when conducting a CIPR....

  20. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)

    2000-07-01

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  1. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  2. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  3. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  4. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  5. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, Kyle Shelton [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-09-28

    These are a set of slides intended for an information session as part of recruiting activities at Brigham Young University. It gives an overview of aqueous chloride operations, specifically on plutonium and americium purification/recovery. This presentation details the steps taken perform these processes, from plutonium size reduction, dissolution, solvent extraction, oxalate precipitation, to calcination. For Americium recovery, it details the CLEAR (chloride extraction and actinide recovery) Line, oxalate precipitation and calcination.

  6. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  7. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  8. 32 CFR 242.7 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 242.7 Section 242.7 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS... SCIENCES § 242.7 Responsibilities. (a) The President of the University shall: (1) Develop and...

  9. 7 CFR 58.242 - Product adulteration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Product adulteration. 58.242 Section 58.242... Procedures § 58.242 Product adulteration. All necessary precautions shall be taken throughout the entire operation to prevent the adulteration of one product with another. The commingling of one type of liquid...

  10. 25 CFR 242.7 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Suspension. 242.7 Section 242.7 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.7 Suspension. All commercial fishing operations may be suspended by order of the Secretary at...

  11. 17 CFR 242.406 - Undermargined accounts.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer Margin Requirements for Security Futures § 242.406 Undermargined accounts. (a) Failure to satisfy margin call. If any... Regulation (§§ 242.400 through 242.406), section 220.4(d) of Regulation T (12 CFR 220.4(d))...

  12. 25 CFR 242.4 - Fishing.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Fishing. 242.4 Section 242.4 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.4 Fishing. (a) Enrolled members of the Red Lake Band of Chippewa Indians may take fish at any...

  13. 33 CFR 242.3 - References.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false References. 242.3 Section 242.3 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE FLOOD PLAIN MANAGEMENT SERVICES PROGRAM ESTABLISHMENT OF FEES FOR COST RECOVERY § 242.3 References. The references...

  14. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  15. New berkelium isotope: 242Bk

    International Nuclear Information System (INIS)

    A new isotope of berkelium, 242Bk, was produced with a cross section of approx. 10 μb in reactions of boron on uranium and nitrogen on thorium. It decays by electron capture with a half-life of 7 +- 1.3 minutes. The branching ratio for this isotope for alpha decay is less than 1% and that for spontaneous fission is less than 0.03%. 2 figures, 2 tables

  16. 242-A evaporator hazards assessment

    International Nuclear Information System (INIS)

    This document establishes the technical basis in support of Emergency Planning activities for the 242-A Evaporator, on the Hanford Site. Through this document the technical basis for the development of facility specific Emergency Action Levels and the Emergency Planning Zone is demonstrated. The evaporator sues a conventional, forced-circulation, vacuum evaporation system to concentrate radioactive waste solutions. This concentration results in the reduction in waste volume and reduces the number of double-shelled tanks required to store the waste

  17. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  18. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  19. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  20. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  1. 48 CFR 242.7301 - General.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false General. 242.7301 Section 242.7301 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES Contractor Insurance/Pension...

  2. 24 CFR 242.61 - Management.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Management. 242.61 Section 242.61... Management. The mortgagor shall provide for management of the hospital in a manner satisfactory to HUD. (a) Contract Management of Hospital. The mortgagor shall not execute a management agreement or any...

  3. 42 CFR 24.2 - Allocation.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Allocation. 24.2 Section 24.2 Public Health PUBLIC....2 Allocation. (a) The Secretary, within the number authorized in the PHS Act, shall determine the... may advise the Secretary to make adjustments to the allocation at any time. (c) The majority of...

  4. 24 CFR 242.82 - Energy conservation.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Energy conservation. 242.82 Section... INSURANCE FOR HOSPITALS Miscellaneous Requirements § 242.82 Energy conservation. Construction, mechanical equipment, and energy and metering selections shall provide cost-effective energy conservation in...

  5. Dicty_cDB: SSA242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA242 (Link to dictyBase) - G00584 DDB0206451 Contig-U04342-1 SSA...242E (Link to Original site) SSA242F 327 SSA242Z 501 SSA242P 828 SSA242E 622 Show SSA242 Library SS (Lin...Contig Contig-U04342-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA2-B/SSA...242Q.Seq.d/ Representative seq. ID SSA242E (Link to Original site) Representative DNA sequence >SSA242 (SSA...242Q) /CSM/SS/SSA2-B/SSA242Q.Seq.d/ CAAAAAAATGGGACATGATATTAAAGCAATTATAGGTTTTTCTTGCGCATTTGCAGTTGG

  6. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  7. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  8. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  9. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.

    1999-07-28

    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  10. Method for removal of plutonium impurity from americium oxides and fluorides

    Science.gov (United States)

    FitzPatrick, John R.; Dunn, Jerry G.; Avens, Larry R.

    1987-01-01

    Method for removal of plutonium impurity from americium oxides and fluorides. AmF.sub.4 is not further oxidized to AmF.sub.6 by the application of O.sub.2 F at room temperature, while plutonium compounds present in the americium sample are fluorinated to volatile PuF.sub.6, which can readily be separated therefrom, leaving the purified americium oxides and/or fluorides as the solid tetrafluoride.

  11. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  12. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  13. 10 CFR 31.8 - Americium-241 and radium-226 in the form of calibration or reference sources.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Americium-241 and radium-226 in the form of calibration or... BYPRODUCT MATERIAL § 31.8 Americium-241 and radium-226 in the form of calibration or reference sources. (a..., americium-241 or radium-226 in the form of calibration or reference sources: (1) Any person in a...

  14. Uncertainty analysis of doses from ingestion of plutonium and americium.

    Science.gov (United States)

    Puncher, M; Harrison, J D

    2012-02-01

    Uncertainty analyses have been performed on the biokinetic model for americium currently used by the International Commission on Radiological Protection (ICRP), and the model for plutonium recently derived by Leggett, considering acute intakes by ingestion by adult members of the public. The analyses calculated distributions of doses per unit intake. Those parameters having the greatest impact on prospective doses were identified by sensitivity analysis; the most important were the fraction absorbed from the alimentary tract, f(1), and rates of uptake from blood to bone surfaces. Probability distributions were selected based on the observed distribution of plutonium and americium in human subjects where possible; the distributions for f(1) reflected uncertainty on the average value of this parameter for non-specified plutonium and americium compounds ingested by adult members of the public. The calculated distributions of effective doses for ingested (239)Pu and (241)Am were well described by log-normal distributions, with doses varying by around a factor of 3 above and below the central values; the distributions contain the current ICRP Publication 67 dose coefficients for ingestion of (239)Pu and (241)Am by adult members of the public. Uncertainty on f(1) values had the greatest impact on doses, particularly effective dose. It is concluded that: (1) more precise data on f(1) values would have a greater effect in reducing uncertainties on doses from ingested (239)Pu and (241)Am, than reducing uncertainty on other model parameter values and (2) the results support the dose coefficients (Sv Bq(-1) intake) derived by ICRP for ingestion of (239)Pu and (241)Am by adult members of the public.

  15. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  16. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  17. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  18. Kilogram-scale purification of americium by ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Wheelwright, E. J.

    1979-01-01

    Sequential anion and cation exchange processes have been used for the final purification of /sup 241/Am recovered during the reprocessing of aged plutonium metallurgical scrap. Plutonium was removed by absorption of Dowex 1, X-3.5 (30 to 50 mesh) anion exchange resin from 6.5 to 7.5 M HNO/sub 3/ feed solution. Following a water dilution to 0.75 to 1.0 M HNO/sub 3/, americium was absorbed on Dowex 50W, X-8 (50 to 100 mesh) cation exchange resion. Final purification was accomplished by elution of the absorbed band down 3 to 4 successive beds of the same resin, preloaded with Zn/sup 2 +/, with an NH/sub 4/OH buffered chelating agent. The recovery of mixed /sup 241/Am-/sup 243/Am from power reactor reprocessing waste has been demonstrated. Solvent extraction was used to recover a HNO/sub 3/ solution of mixed lanthanides and actinides from waste generated by the reprocessng of 13.5 tons of Shippingport Power Reactor blanket fuel. Sequential cation exchange band-displacement processes were then used to separate americium and curium from the lanthanides and then to separate approx. 60 g of /sup 244/Cm from 1000 g of mixed /sup 241/Am-/sup 243/Am.

  19. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  20. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  1. 48 CFR 242.002 - Interagency agreements.

    Science.gov (United States)

    2010-10-01

    .../Chief Financial Officer), from non-DoD organizations, except for— (A) Quality assurance, contract... subcontracts awarded by the Small Business Administration under FAR subpart 19.8; and (C) Quality assurance and..., DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES 242.002...

  2. 48 CFR 242.7203 - Review procedures.

    Science.gov (United States)

    2010-10-01

    ... plan; and (C) Any decision to reduce progress payments or disallow costs on vouchers. (ii) The... portion of withheld amounts commensurate with the contractor's progress in making corrections. However... Management and Accounting System 242.7203 Review procedures. (a) Criteria for conducting reviews. Conduct...

  3. A Syllabus for Biol 242--Human Anatomy.

    Science.gov (United States)

    Jacob, Willis H.

    This document is the fall and spring semester course syllabus of Biology 242--Human Anatomy at Southern University (Louisiana). Sections include: (1) Descriptive Information; (2) Specification of Course Goals and Objectives; (3) Readings; (4) Description of Instructional Procedures; (5) Course Requirements; (6) Course Schedule; (7) Evaluation of…

  4. 32 CFR 242b.3 - Notice.

    Science.gov (United States)

    2010-07-01

    ... SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...-four hours before the meeting, shall be sufficient notice of any meeting. The recital by the Secretary...) Public announcement of meetings shall conform to the Public Meeting Procedures of the Board of...

  5. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  6. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  7. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  8. 42 CFR 438.242 - Health information systems.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Health information systems. 438.242 Section 438.242... Measurement and Improvement Standards § 438.242 Health information systems. (a) General rule. The State must ensure, through its contracts, that each MCO and PIHP maintains a health information system that...

  9. Determination of the242 m Am nuclear moments

    Science.gov (United States)

    Bekk, K.; Göring, S.; Kälber, W.; Meisel, G.; Rebel, H.; Sameh, A. Ali

    1988-09-01

    The hyperfine structure of Am atoms was investigated in an atomic beam by laser spectroscopy. The observed splittings were evaluated with respect to the magnetic dipole and electric quadrupole moments of242 m Am. The results are: μ I (242 m Am)=+0.97(5)nm, Q(242 m Am)=+6.5(2.0)b.

  10. Determination of the 242mAm nuclear moments

    International Nuclear Information System (INIS)

    The hyperfine structure of Am atoms was investigated in an atomic beam by laser spectroscopy. The observed splittings were evaluated with respect to the magnetic dipole and electric quadrupole moments of 242mAm. The results are: μI(242mAm) = +0.97(5) nm, Q(242mAm) = +6.5(2.0) b. (orig.)

  11. 24 CFR 242.63 - Additional indebtedness and leasing.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Additional indebtedness and leasing. 242.63 Section 242.63 Housing and Urban Development Regulations Relating to Housing and Urban... Requirements § 242.63 Additional indebtedness and leasing. The mortgagor shall not enter into any...

  12. 25 CFR 242.10 - Fishing equipment limitations.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Fishing equipment limitations. 242.10 Section 242.10 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.10 Fishing equipment limitations. (a) Any variety of fish may be taken...

  13. 25 CFR 242.5 - Disposition of unmarketable fish.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Disposition of unmarketable fish. 242.5 Section 242.5 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.5 Disposition of unmarketable fish. All unmarketable live fish...

  14. 25 CFR 242.12 - Authority to lease.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Authority to lease. 242.12 Section 242.12 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.12 Authority to lease. The Band, with the approval of the Secretary, may execute a lease...

  15. 32 CFR 242b.7 - Officers of the University.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Officers of the University. 242b.7 Section 242b...) MISCELLANEOUS GENERAL PROCEDURES AND DELEGATIONS OF THE BOARD OF REGENTS OF THE UNIFORMED SERVICES UNIVERSITY OF THE HEALTH SCIENCES § 242b.7 Officers of the University. (a) Dean of the University. (1) The...

  16. 36 CFR 242.12 - Local advisory committees.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Local advisory committees. 242.12 Section 242.12 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE..., the particular Regional Council in carrying out its function as set forth in § 242.11. (b)...

  17. 32 CFR 242b.2 - Meetings of the Board.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Meetings of the Board. 242b.2 Section 242b.2... THE HEALTH SCIENCES § 242b.2 Meetings of the Board. (a) Regular meetings. (1) The Board shall hold at... determined by the Board, meetings shall be held at the offices of the University, 4301 Jones Bridge...

  18. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  19. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  20. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules

    Science.gov (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.

    2013-07-01

    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  1. Evaluation of neutron data for plutonium-242

    International Nuclear Information System (INIS)

    The evaluation of neutron data for 242Pu is made in the energy region from 10-5 eV up to 20 MeV. The results of the evaluation are compiled in the ENDF/B-VI format. This work is performed under the Project Agreement CIS-03-95 with the International Science and Technology Center (Moscow). The Financing Party for the Project is Japan. The evaluation was requested by Japan Nuclear Data Center (JAERI). (author)

  2. Calibration of 242 Pu Tracer by Mass Spectrometry%质谱法标定242 Pu指示剂

    Institute of Scientific and Technical Information of China (English)

    李冬梅; 徐江; 杜丽丽

    2014-01-01

    将高纯242 Pu浓度标准溶液与239 Pu混合,质谱法测量R239/242(A)先标定四水硫酸钚中239 Pu的浓度;再将四水硫酸钚与待标定的242 Pu指示剂混合,测量R239/242(A),标定242 Pu 指示剂的浓度。质谱测量还可标定得到242 Pu指示剂中的钚同位素丰度。采用两次同位素稀释质谱法标定242 Pu 指示剂快捷简便,可在2日内完成。测量精度高,242 Pu浓度的相对合成标准不确定度为0.75%,该指示剂可满足高精度分析工作的需求。%242 Pu is commonly employed as tracer for determination of 239 Pu in environmental samples.The 239 Pu concentration in Pu(SO4 )2 ·4H2 O solution was determined by isotope dilution-mass spectrometry (ID-MS)using a high pure 242 Pu spike.Then the 242 Pu tracer in our laboratary was calibrated by ID-MS using the calibrated 239 Pu solution as spike.By meas-uring the atom ratio of 239 Pu to 242 Pu twice by ID-MS,the concentration and abundance of the 242 Pu tracer in laboratary were finally calibrated.This method was proved to be efficient with high precision.The process could be finished within two days with an uncertainty of 0.75%. The calibrated 242 Pu tracer in laboratory could meet the demand of high-precision analysis.

  3. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  4. Determination of the /sup 242m/Am nuclear moments

    Energy Technology Data Exchange (ETDEWEB)

    Bekk, K.; Goering, S.; Kaelber, W.; Meisel, G.; Rebel, H.; Sameh, A.A.

    1988-07-01

    The hyperfine structure of Am atoms was investigated in an atomic beam by laser spectroscopy. The observed splittings were evaluated with respect to the magnetic dipole and electric quadrupole moments of /sup 242m/Am. The results are: ..mu../sub I/(/sup 242m/Am) = +0.97(5) nm, Q(/sup 242m/Am) = +6.5(2.0) b.

  5. 242-A evaporator safety analysis report

    Energy Technology Data Exchange (ETDEWEB)

    CAMPBELL, T.A.

    1999-05-17

    This report provides a revised safety analysis for the upgraded 242-A Evaporator (the Evaporator). This safety analysis report (SAR) supports the operation of the Evaporator following life extension upgrades and other facility and operations upgrades (e.g., Project B-534) that were undertaken to enhance the capabilities of the Evaporator. The Evaporator has been classified as a moderate-hazard facility (Johnson 1990). The information contained in this SAR is based on information provided by 242-A Evaporator Operations, Westinghouse Hanford Company, site maintenance and operations contractor from June 1987 to October 1996, and the existing operating contractor, Waste Management Hanford (WMH) policies. Where appropriate, a discussion address the US Department of Energy (DOE) Orders applicable to a topic is provided. Operation of the facility will be compared to the operating contractor procedures using appropriate audits and appraisals. The following subsections provide introductory and background information, including a general description of the Evaporator facility and process, a description of the scope of this SAR revision,a nd a description of the basic changes made to the original SAR.

  6. 242-A evaporator safety analysis report

    International Nuclear Information System (INIS)

    This report provides a revised safety analysis for the upgraded 242-A Evaporator (the Evaporator). This safety analysis report (SAR) supports the operation of the Evaporator following life extension upgrades and other facility and operations upgrades (e.g., Project B-534) that were undertaken to enhance the capabilities of the Evaporator. The Evaporator has been classified as a moderate-hazard facility (Johnson 1990). The information contained in this SAR is based on information provided by 242-A Evaporator Operations, Westinghouse Hanford Company, site maintenance and operations contractor from June 1987 to October 1996, and the existing operating contractor, Waste Management Hanford (WMH) policies. Where appropriate, a discussion address the US Department of Energy (DOE) Orders applicable to a topic is provided. Operation of the facility will be compared to the operating contractor procedures using appropriate audits and appraisals. The following subsections provide introductory and background information, including a general description of the Evaporator facility and process, a description of the scope of this SAR revision,a nd a description of the basic changes made to the original SAR

  7. 10 CFR 32.57 - Calibration or reference sources containing americium-241 or radium-226: Requirements for license...

    Science.gov (United States)

    2010-01-01

    ... or radium-226: Requirements for license to manufacture or initially transfer. 32.57 Section 32.57... americium-241 or radium-226: Requirements for license to manufacture or initially transfer. An application... containing americium-241 or radium-226, for distribution to persons generally licensed under § 31.8 of...

  8. Separation and determination of americium in low-level alkaline waste of NPP origin

    Science.gov (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.

    2006-01-01

    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  9. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  10. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats.

    Science.gov (United States)

    Van der Meeren, A; Grémy, O

    2010-09-01

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO(2) powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO(2) with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO(2) with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO(2) powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO(2) with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO(2) aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions.

  11. 242-A evaporator safety analysis report

    International Nuclear Information System (INIS)

    In compliance with DOE Orders, an update of the 242-A SAR has been prepared, as documented in the referenced ECN. Several categories of changes were identified for inclusion in this revision of the SAR. These categories will be utilized to simplify the discussion of the changes for this USQ document. However, it is important to note that no new tests or experiments were included in this revision of the SAR. Editorial changes and/or informational updates to Chapters 9 and 11 were included as part of this revision. However, no changes to Operational Safety Requirements (OSRs) contained in Chapter 11 were required. General categories of changes included in this revision are listed

  12. 40 CFR 61.242-10 - Standards: Delay of repair.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards: Delay of repair. 61.242-10... Leaks (Fugitive Emission Sources) § 61.242-10 Standards: Delay of repair. (a) Delay of repair of equipment for which leaks have been detected will be allowed if repair within 15 days is...

  13. 17 CFR 242.101 - Activities by distribution participants.

    Science.gov (United States)

    2010-04-01

    ... certain other sections. Transactions complying with §§ 242.103 or 242.104; or (3) Odd-lot transactions... standardized index; or (7) De minimis transactions. Purchases during the restricted period, other than by a... quotation system or electronic communications network; or (6) Basket transactions. (i) Bids or purchases,...

  14. 40 CFR 86.242-94 - Records required.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Records required. 86.242-94 Section 86.242-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New...

  15. 24 CFR 242.45 - Early commencement of work.

    Science.gov (United States)

    2010-04-01

    ... review under 24 CFR 242.79. The work must meet all requirements and guidelines as if it were approved for... review under 24 CFR 242.79, previous participation review, and the agreement to certain conditions by the applicant. HUD will not approve such request until it has completed the environmental review under 24...

  16. 12 CFR 303.242 - Exercise of trust powers.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Exercise of trust powers. 303.242 Section 303... PROCEDURES Other Filings § 303.242 Exercise of trust powers. (a) Scope. This section contains the procedures to be followed by a state nonmember bank to seek the FDIC's prior consent to exercise trust...

  17. 40 CFR 61.242-7 - Standards: Valves.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards: Valves. 61.242-7 Section 61... (Fugitive Emission Sources) § 61.242-7 Standards: Valves. (a) Each valve shall be monitored monthly to...) If an instrument reading of 10,000 ppm or greater is measured, a leak is detected. (c)(1) Any...

  18. 7 CFR 1220.242 - Books and records.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Books and records. 1220.242 Section 1220.242 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH,...

  19. 40 CFR 60.242 - Standard for fluorides.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Standard for fluorides. 60.242 Section... Industry: Granular Triple Superphosphate Storage Facilities § 60.242 Standard for fluorides. (a) On and... atmosphere from any affected facility any gases which contain total fluorides in excess of 0.25...

  20. 24 CFR 242.72 - Leasing of hospital.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Leasing of hospital. 242.72 Section... INSURANCE FOR HOSPITALS Miscellaneous Requirements § 242.72 Leasing of hospital. Leasing of a hospital in its entirety is prohibited. Notwithstanding this prohibition, any proposal in which leasing of...

  1. 36 CFR 242.26 - Subsistence taking of wildlife.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Subsistence taking of wildlife. 242.26 Section 242.26 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF...; however, the harvester must be a Federally qualified subsistence user with customary and traditional...

  2. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  3. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  4. Apparatus for fabrication of americium- beryllium neutron sources prevents capsule contamination

    Science.gov (United States)

    Mohr, W. C.; Van Loom, J. A.

    1967-01-01

    Modified gloved enclosure is used to fill a capsule with a mixture of americium and beryllium radioactive powders to seal weld the opening, and to test it for leaks. It contains a horizontal partition, vortex mixer, mounting press, welder, test vessel, and radiation shielding to prevent surface contamination.

  5. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  6. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  7. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  8. The immunoradiometric assay for carbohydrate antigen CA-242

    International Nuclear Information System (INIS)

    Using 125I-labelled monoclonal antibody (C242) against carbohydrate antigen CA-242, the sandwich immunoradiometric assay (IRMA) was developed. In preliminary clinical application of this method, the results of serum CA-242 measurements were 2.5 ± 4.5 U/ml for 77 normal individuals, 3.5 ± 7.0 U/ml for 128 cases of benign diseases, and 56.0 ± 91.3 U/ml for 210 cases of malignant tumors. The CA-242 values of patients with malignant tumors were significantly higher than that of patients with benign diseases. Taking 12 U/ml as normal upper limit, the positive detective rates of pancreatic and colorectal cancers were 86.6% and 62.0% respectively, while the false positive rate for normal individuals was 4%

  9. 17 CFR 242.204 - Close-out requirement.

    Science.gov (United States)

    2010-04-01

    ... 600(b)(64) of Regulation NMS (17 CFR 242.600(b)(64)). Regulation ATS—Alternative Trading Systems...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation...

  10. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  11. 242-A Campaign 99-1 process control plan

    Energy Technology Data Exchange (ETDEWEB)

    LE, E.Q.

    1999-08-25

    242-A Evaporator 99-1 will process approximately one million gallons of waste from tank 102-AW in June 1999. The process control Plan provides a general description of activities, which will occur during 242-A Evaporator Campaign 99-1 and to document analyses conducted to demonstrate that 102-AW waste is acceptable for processing. Predict is a registered trademark of Risk Decisions England Corporation, United Kingdom.

  12. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  13. 17 CFR 242.302 - Recordkeeping requirements for alternative trading systems.

    Science.gov (United States)

    2010-04-01

    ... alternative trading systems. 242.302 Section 242.302 Commodity and Securities Exchanges SECURITIES AND... SECURITY FUTURES Regulation Ats-Alternative Trading Systems § 242.302 Recordkeeping requirements for alternative trading systems. To comply with the condition set forth in paragraph (b)(8) of § 242.301,...

  14. 48 CFR 252.242-7004 - Material management and accounting system.

    Science.gov (United States)

    2010-10-01

    ... accounting system. 252.242-7004 Section 252.242-7004 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009)...

  15. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  16. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  17. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  18. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)

    2002-01-01

    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  19. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  20. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  1. Calcium and zinc DTPA administration for internal contamination with plutonium-238 and americium-241.

    Science.gov (United States)

    Kazzi, Ziad N; Heyl, Alexander; Ruprecht, Johann

    2012-08-01

    The accidental or intentional release of plutonium or americium can cause acute and long term adverse health effects if they enter the human body by ingestion, inhalation, or injection. These effects can be prevented by rapid removal of these radionuclides by chelators such as calcium or zinc diethylenetriaminepentaacetate (calcium or zinc DTPA). These compounds have been shown to be efficacious in enhancing the elimination of members of the actinide family particularly plutonium and americium when administered intravenously or by nebulizer. The efficacy and adverse effects profile depend on several factors that include the route of internalization of the actinide, the type, and route time of administration of the chelator, and whether the calcium or zinc salt of DTPA is used. Current and future research efforts should be directed at overcoming limitations associated with the use of these complex drugs by using innovative methods that can enhance their structural and therapeutic properties.

  2. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  3. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1974-09-01

    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  4. Measurement of the 242Pu neutron capture cross section

    Science.gov (United States)

    Buckner, M. Q.; Wu, C. Y.; Henderson, R. A.; Bucher, B.; Bredeweg, T. A.; Baramsai, B.; Couture, A.; Jandel, M.; Mosby, S.; O'Donnell, J. M.; Ullmann, J. L.; Chyzh, A.; Dance Collaboration

    2015-10-01

    Precision (n,f) and (n, γ) cross sections are important for the network calculations of the radiochemical diagnostic chain for the U.S. DOE's Stockpile Stewardship Program. 242Pu(n, γ) cross section is relevant to the network calculations of Pu and Am. Additionally, new reactor concepts have catalyzed considerable interest in the measurement of improved cross sections for neutron-induced reactions on key actinides. To date, little or no experimental data has been reported on 242Pu(n, γ) for incident neutron energy below 50 keV. A new measurement of the 242Pu(n, γ) reaction was performed with the DANCE together with an improved PPAC for fission-fragment detection at LANSCE during FY14. The relative scale of the 242Pu(n, γ) cross section spans four orders of magnitude for incident neutron energies from thermal to ~ 30 keV. The absolute scale of the 242Pu(n, γ) cross section is set according to the measured 239Pu(n,f) resonance at 7.8 eV; the target was spiked with 239Pu for this measurement. The absolute 242Pu(n, γ) neutron capture cross section is ~ 30% higher than the cross section reported in ENDF for the 2.7 eV resonance. Latest results to be reported. Funded by U.S. DOE Contract No. DE-AC52-07NA27344 (LLNL) and DE-AC52-06NA25396 (LANL). U.S. DOE/NNSA Office of Defense Nuclear Nonproliferation Research and Development. Isotopes (ORNL).

  5. 16 CFR 24.2 - Deception as to composition.

    Science.gov (United States)

    2010-01-01

    ... LEATHER AND IMITATION LEATHER PRODUCTS § 24.2 Deception as to composition. It is unfair or deceptive to... or deceptive to use the unqualified term “leather” or other unqualified terms suggestive of leather... advertising of such products irrespective of the media used whenever statements, representations,...

  6. 36 CFR 242.18 - Regulation adoption process.

    Science.gov (United States)

    2010-07-01

    ... and B of this part shall be accepted by the Secretary of the Interior in accordance with 43 CFR part... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Regulation adoption process... SUBSISTENCE MANAGEMENT REGULATIONS FOR PUBLIC LANDS IN ALASKA Program Structure § 242.18 Regulation...

  7. 24 CFR 242.58 - Books, accounts, and financial statements.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Books, accounts, and financial... Requirements § 242.58 Books, accounts, and financial statements. (a) Books and accounts. The mortgagor's books... Agreement. (f) Books of management agents. The books and records of management agents, lessees,...

  8. 24 CFR 242.2 - Program financial self-sufficiency.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Program financial self-sufficiency... self-sufficiency and actuarial soundness; i.e., to avoid mortgage defaults and claims for insurance... AUTHORITIES MORTGAGE INSURANCE FOR HOSPITALS General Eligibility Requirements § 242.2 Program financial...

  9. 48 CFR 52.242-17 - Government Delay of Work.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Government Delay of Work....242-17 Government Delay of Work. As prescribed in 42.1305(c), insert the following clause in... services, or for supplies that are commercial or modified-commercial items. Government Delay of Work...

  10. Electron-capture delayed fission properties of 242Es

    International Nuclear Information System (INIS)

    Electron-capture delayed fission of 242Es produced via the 233U(14N,5n)242Es reaction at 87 MeV (on target) was observed to decay with a half-life of 11±3 s, consistent with the reported α-decay half-life of 242Es of 16-4+6 s. The mass-yield distribution of the fission fragments is highly asymmetric. The average pre-neutron emission total kinetic energy of the fragments was measured to be 183±18 MeV. Based on the ratio of the measured number of fission events to the measured number of α decays from the electron-capture daughter 242Cf (100% α branch), the probability of delayed fission was determined to be 0.006±0.002. This value for the delayed fission probability fits the experimental trend of increasing delayed fission probability with increasing Q value for electron capture. (c) 2000 The American Physical Society

  11. 40 CFR 98.242 - GHGs to report.

    Science.gov (United States)

    2010-07-01

    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Petrochemical Production § 98.242 GHGs to report. You must report the information in paragraphs (a) through (c) of this section: (a) CO2 CH4, and N2O process emissions from each...

  12. 17 CFR 242.607 - Customer account statements.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.607 Customer account statements. (a) No broker... the purchase or sale of, or direct orders for purchase or sale of, any NMS stock or a...

  13. 17 CFR 242.606 - Disclosure of order routing information.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.606 Disclosure of order routing information. (a... calendar quarter a report on its routing of non-directed orders in NMS securities during that quarter....

  14. 17 CFR 242.600 - NMS security designation and definitions.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false NMS security designation and... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.600 NMS security designation and...

  15. 17 CFR 242.604 - Display of customer limit orders.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.604 Display of customer limit orders. (a) Specialists and OTC market makers. For all NMS stocks: (1) Each member of a national securities exchange...

  16. 17 CFR 242.605 - Disclosure of order execution information.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.605 Disclosure of order execution information... covered orders in NMS stocks that it received for execution from any person. Such report shall be...

  17. 48 CFR 52.242-14 - Suspension of Work.

    Science.gov (United States)

    2010-10-01

    ... the work is, for an unreasonable period of time, suspended, delayed, or interrupted (1) by an act of... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Suspension of Work. 52.242... Suspension of Work. As prescribed in 42.1305(a), insert the following clause in solicitations and...

  18. 17 CFR 242.405 - Withdrawal of margin.

    Science.gov (United States)

    2010-04-01

    ... account after such withdrawal is sufficient to satisfy the required margin for the security futures and...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer Margin Requirements for Security Futures § 242.405 Withdrawal of margin. (a) By the customer. Except as...

  19. 10 CFR 431.242 - Test Procedures [Reserved

    Science.gov (United States)

    2010-01-01

    ... upstream of the draft control device of an individual, automatically operated, fossil fuel-fired appliance... intended for installation in the venting system of an individual, automatically operated, fossil fuel-fired... EQUIPMENT Unit Heaters § 431.242 Definitions concerning unit heaters. Unit heater means a self-contained...

  20. 48 CFR 952.242-70 - Technical direction.

    Science.gov (United States)

    2010-10-01

    ... required for contract performance; (4) Changes any of the expressed terms, conditions or specifications of...) Performance of the work under this contract shall be subject to the technical direction of the DOE Contracting... FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 952.242-70...

  1. Process Control Plan for 242-A Evaporator Campaign

    International Nuclear Information System (INIS)

    The wastes in tanks 107-AP and 108-AP are designated as feed for 242-A Evaporator Campaign 2000-1, which is currently scheduled for the week of April 17, 2000. Waste in tanks 107-AP and 108-AP is predominantly comprised of saltwell liquor from 200 West Tank Farms

  2. 36 CFR 242.24 - Customary and traditional use determinations.

    Science.gov (United States)

    2010-07-01

    ... AGRICULTURE SUBSISTENCE MANAGEMENT REGULATIONS FOR PUBLIC LANDS IN ALASKA Board Determinations § 242.24... Brown Bear Residents of Unit 9D and 10 (Unimak Island). Unit 9E Brown Bear Residents of Chignik, Chignik..., and Egegik. Unit 9D Caribou Residents of Unit 9D, Akutan, and False Pass. Unit 9E Caribou Residents...

  3. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)

    2010-06-15

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  4. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  5. MARIOS: Irradiation of UO{sub 2} containing 15% americium at well defined temperature

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E., E-mail: elio.dagata@ec.europa.eu [European Commission, Joint Research Centre, Institute for Energy - P.O. Box 2, 1755 ZG Petten (Netherlands); Hania, P.R. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bejaoui, S. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France); Sciolla, C.; Wyatt, T.; Hannink, M.H.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Herlet, N.; Jankowiak, A. [Commissariat a l' Energie Atomique DTEC CEA Marcoule, 30207 Bagnols sur Ceze Cedex (France); Klaassen, F.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bonnerot, J.-M. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer MARIOS is designed to check the behaviour of Minor Actinide Blanket Module concept. Black-Right-Pointing-Pointer Main requirement of the experiment is an accurate control of the temperature. Black-Right-Pointing-Pointer The swelling and the helium release will be the main output of the experiment. Black-Right-Pointing-Pointer A complementary experiment (DIAMINO), will be performed in the next future. - Abstract: Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors of long-lived nuclides like {sup 241}Am is, therefore, an option for the reduction of radiotoxicity and residual power packages as well as the repository area. The MARIOS irradiation experiment is the latest of a series of experiments on americium transmutation (e.g. EFTTRA-T4, EFTTRA-T4bis, HELIOS). MARIOS experiment is carried out in the framework of the 4-year project FAIRFUELS of the EURATOM 7th Framework Programme (FP7). During the past years of experimental work in the field of transmutation and tests of innovative nuclear fuel containing americium, the release or trapping of helium as well as swelling has shown to be the key issue for the design of such kinds of target. Therefore, the main objective of the MARIOS experiment is to study the in-pile behaviour of UO{sub 2} containing minor actinides (MAs) in order to gain knowledge on the role of the microstructure and of the temperature on the gas release and on fuel swelling. The MARIOS experiment will be conducted in the HFR (high flux reactor) in Petten (The Netherlands) and will start in the beginning of 2011. It has been planned that the experiment will last 11 cycles, corresponding to 11 months. This paper covers the description of the objective of the experiment, as well as a general description of the design of the experiment.

  6. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  7. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  8. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  9. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: sebastien.picart@cea.fr [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)

    2014-10-15

    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  10. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  11. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  12. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  13. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  14. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  15. 17 CFR 242.303 - Record preservation requirements for alternative trading systems.

    Science.gov (United States)

    2010-04-01

    ... requirements for alternative trading systems. 242.303 Section 242.303 Commodity and Securities Exchanges... REQUIREMENTS FOR SECURITY FUTURES Regulation Ats-Alternative Trading Systems § 242.303 Record preservation requirements for alternative trading systems. (a) To comply with the condition set forth in paragraph (b)(9)...

  16. 24 CFR 242.90 - Eligibility of mortgages covering hospitals in certain neighborhoods.

    Science.gov (United States)

    2010-04-01

    ... hospitals in certain neighborhoods. 242.90 Section 242.90 Housing and Urban Development Regulations Relating... UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES MORTGAGE INSURANCE FOR HOSPITALS Miscellaneous Requirements § 242.90 Eligibility of mortgages covering hospitals in certain neighborhoods. (a) A...

  17. 17 CFR 242.102 - Activities by issuers and selling security holders during a distribution.

    Science.gov (United States)

    2010-04-01

    ... selling security holders during a distribution. 242.102 Section 242.102 Commodity and Securities Exchanges... REQUIREMENTS FOR SECURITY FUTURES Regulation M § 242.102 Activities by issuers and selling security holders... or on behalf of an issuer or selling security holder, it shall be unlawful for such person, or...

  18. 46 CFR 308.306 - Second Seamen's War Risk Policy, Form MA-242.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Second Seamen's War Risk Policy, Form MA-242. 308.306... RISK INSURANCE Second Seamen's War Risk Insurance § 308.306 Second Seamen's War Risk Policy, Form MA-242. (a) The standard form of Second Seamen's War Risk Policy Form MA-242, may be obtained from...

  19. 48 CFR 242.771 - Independent research and development and bid and proposal costs.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Indirect Cost Rates 242.771 Independent research and development and bid and proposal costs. ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Independent research and development and bid and proposal costs. 242.771 Section 242.771 Federal Acquisition Regulations System...

  20. 19 CFR 24.2 - Persons authorized to receive Customs collections.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Persons authorized to receive Customs collections. 24.2 Section 24.2 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CUSTOMS FINANCIAL AND ACCOUNTING PROCEDURE § 24.2 Persons authorized to...

  1. 17 CFR 242.602 - Dissemination of quotations in NMS securities.

    Science.gov (United States)

    2010-04-01

    ... NMS securities. 242.602 Section 242.602 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.602 Dissemination of quotations...

  2. 48 CFR 352.242-72 - Native American Graves Protection and Repatriation Act.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Native American Graves Protection and Repatriation Act. 352.242-72 Section 352.242-72 Federal Acquisition Regulations System HEALTH AND HUMAN SERVICES CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 352.242-72 Native...

  3. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  4. Fission cross section for 242Am.met

    International Nuclear Information System (INIS)

    The neutron-induced fission cross section for 242Am.met (152y) was measured at the Livermore 100-MeV electron linac in the neutron energy range of 0.01 eV to 20 MeV. Fission fragments were detected using a hemispherical fission chamber. The neutron flux was measured below 10 keV using lithium glass scintillators. Above 10 keV, the 242Am.met fission cross section was measured relative to the 235U fission cross section. Below 20 eV, the data were fit with a sum of single-level Breit-Wigner resonances. Results for the distribution of fission widths, the average fission width, and the average level spacing are presented. The fission cross section in the 100 keV to 20 MeV range is compared with previous measurements

  5. Observation of cold fission in 242Pu spontaneous fission

    International Nuclear Information System (INIS)

    Coincidence γ-ray data from the spontaneous fission of 242Pu were collected at the Lawrence Berkeley Laboratory high purity Ge (HPGe) array, GAMMASPHERE. Data from several cold-fission (0 neutron emission) isotopic pairs were observed and are presented. An interesting trend in the fractional population of cold-fission events was observed and is discussed. Relative yields of Zr-Xe, Sr-Ba, and Mo-Te pairs were measured. The Zr-Xe system has the most complete data set. Some speculations on the trend in the number of neutrons emitted as a function of the mass of the Xe isotope populated are presented. Comparisons between the yields from the spontaneous fission of 242Pu and the yields from thermal-neutron-induced fission of 241Pu are also presented. copyright 1996 The American Physical Society

  6. 40 CFR 180.242 - Thiabendazole; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... Expiration/Revocation Date Apple, wet pomace 12.0 None Avocado1 10.0 None Banana, postharvest 3.0 None Bean..., tops 10.0 12/25/10 Cantaloupe1 15.0 None Carrot, roots, postharvest 10.0 None Citrus, oil 15.0 None... inadvertent residues. Editorial Note: For Federal Register citations affecting § 180.242, see the List of...

  7. Hanford facility dangerous waste permit application, 242-A evaporator

    International Nuclear Information System (INIS)

    The Hanford Facility Dangerous Waste Permit Application is considered to be a single application organized into a General Information Portion (document number DOE/RL-91-28) and a Unit-Specific Portion. The scope of the Unit-Specific Portion is limited to Part B permit application documentation submitted for individual, 'operating' treatment, storage, and/or disposal units, such as the 242-A Evaporator (this document, DOE/RL-90-42)

  8. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  9. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  10. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  11. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  12. 242-A evaporator quality assurance project plan: Revision 1

    Energy Technology Data Exchange (ETDEWEB)

    Tucker, B.J.

    1994-11-04

    The scope of this quality assurance project plan (Plan) is sampling and analytical services including, but not limited to, sample receipt, handling and storage, analytical measurements, submittal of data deliverables, archiving selected portions of samples, returning unneeded sample material to Westinghouse Hanford Company (WHC), and/or sample disposal associated with candidate feed samples and process condensate compliance samples. Sampling and shipping activities are also included within the scope. The purpose of this project is to provide planning, implementation, and assessment guidance for achieving established data quality objectives measurement parameters. This Plan requires onsite and offsite laboratories to conform to that guidance. Laboratory conformance will help ensure that quality data are being generated and therefore, that the 242-A evaporator is operating in a safe and compliant manner. The 242-A evaporator feed stream originates from double-shell tanks (DSTs) identified as candidate feed tanks. The 242-A evaporator reduces the volume of aqueous waste contained in DSTs by boiling off water and sending it to the Liquid Effluent Retention Facility (LERF) storage basin before further treatment. The slurry product is returned to DSTs. Evaporation results in considerable savings by reducing the volume of mixed waste for disposal.

  13. 242-A Evaporator waste analysis plan. Revision 4

    International Nuclear Information System (INIS)

    This waste analysis plan (WAP) provides the plan for obtaining information needed for proper waste handling and processing in the 242-A Evaporator located on the Hanford Site. Regulatory and safety issues are addressed by establishing boundary conditions for waste received and treated at the 242-A Evaporator. The boundary conditions are set by establishing limits for items such as potential exothermic reactions, waste compatibility, and control of vessel vent organic emissions. Boundary conditions are also set for operational considerations and to ensure waste acceptance at receiving facilities. The issues that are addressed in this plan include prevention of exotherms in the waste, waste compatibility, vessel vent emissions, and compatibility with the liner in the Liquid Effluent Retention Facility (LERF). The 242-A Evaporator feed stream is separated into two liquid streams: a concentrated slurry stream and a process condensate. A gaseous exhaust stream is also produced. The slurry contains the majority of the radionuclides and inorganic constituents. This stream is pumped back to the double shell tanks (DSTs) and stored for further treatment after being concentrated to target levels. The process condensate (PC) is primarily water that contains trace amounts of organic material and a greatly reduced concentration of radionuclides. The process condensate is presently stored in the (LERF) until it can be further processed in the Effluent Treatment Facility once it is operational

  14. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  15. CO observations of high-z radio galaxies MRC 2104-242 and MRC 0943-242 : spectral-line performance of the Compact Array Broadband Backend

    NARCIS (Netherlands)

    Emonts, B. H. C.; Norris, R. P.; Feain, I.; Miley, G.; Sadler, E. M.; Villar-Martin, M.; Mao, M. Y.; Oosterloo, T. A.; Ekers, R. D.; Stevens, J. B.; Wieringa, M. H.; Coppin, K. E. K.; Tadhunter, C. N.

    2011-01-01

    We present the first 7-mm observations of two high-redshift, Ly alpha-bright radio galaxies (MRC 2104-242 and MRC 0943-242) performed with the 2 x 2 GHz instantaneous bandwidth of the Compact Array Broadband Backend (CABB) at the Australia Telescope Compact Array (ATCA). The aim was to search for (C

  16. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  17. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  18. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  19. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  20. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.

    2006-08-01

    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  1. Combined procedure using radiochemical separation of plutonium, americium and uranium radionuclides for alpha-spectrometry

    International Nuclear Information System (INIS)

    Radiochemical separation of Pu, Am and U was tested from synthetic solutions and evaporator concentrate samples from nuclear power plants for isolation of each of them for alpha-spectrometry analysis. The separation was performed by anion-exchange chromatography, extraction chromatography, using TRU resin, and precipitation techniques. The aim of the study was to develop a sensitive analytical procedure for the sequential determination of 242Pu, 238Pu, 239+240Pu, 241Am and 235,238U in radioactive wastes. 238Pu, 242Pu, 243Am and 232U were used as tracers. The measurements of α emitting radionuclides were performed by semiconductor detector that is used especially when spectrometric information is needed. For synthetic solutions the chemical recovery was based on associated iron concentration and was about 93%. (author)

  2. 242-A Control System device logic software documentation. Revision 2

    Energy Technology Data Exchange (ETDEWEB)

    Berger, J.F.

    1995-05-19

    A Distributive Process Control system was purchased by Project B-534. This computer-based control system, called the Monitor and Control System (MCS), was installed in the 242-A Evaporator located in the 200 East Area. The purpose of the MCS is to monitor and control the Evaporator and Monitor a number of alarms and other signals from various Tank Farm facilities. Applications software for the MCS was developed by the Waste Treatment System Engineering Group of Westinghouse. This document describes the Device Logic for this system.

  3. Americium-Curium Stabilization - 5'' Cylindrical Induction Melter System Design Basis

    Energy Technology Data Exchange (ETDEWEB)

    Witt, D.C.

    1999-11-08

    Approximately 11,000 liters (3,600) gallons of solution containing isotopes of Am and Cm are currently stored in F-Canyon Tank 17.1. These isotopes were recovered during plutonium-242 production campaigns in the mid- and late-1970s. Experimental work for the project began in 1995 by the Savannah River Technology Center (SRTC). Details of the process are given in the various sections of this document.

  4. Americium-Curium Stabilization - 5'' Cylindrical Induction Melter System Design Basis

    International Nuclear Information System (INIS)

    Approximately 11,000 liters (3,600) gallons of solution containing isotopes of Am and Cm are currently stored in F-Canyon Tank 17.1. These isotopes were recovered during plutonium-242 production campaigns in the mid- and late-1970s. Experimental work for the project began in 1995 by the Savannah River Technology Center (SRTC). Details of the process are given in the various sections of this document

  5. Clinical evaluation of serum tumour marker CA 242 in non-small cell lung cancer.

    OpenAIRE

    Pujol, J L; Cooper, E H; Lehmann, M.; Purves, D. A.; Dan-Aouta, M.; Midander, J.; Godard, P.; Michel, F B

    1993-01-01

    CA 242, a novel tumour carbohydrate antigen present in serum (upper limit of normal values: 20.0 U ml-1), has been measured in a group of 102 pathologically confirmed non-small cell lung cancer patients. The aim of the present prospective study was to identify any relationship between pre-treatment serum CA 242 level and different features of lung cancer including prognosis. Serum CA 242 was measured using the delayed europium lanthanide fluoroimmunometric assay. Sensitivity and specificity w...

  6. Preoperative serum levels of CEA and CA 242 in colorectal cancer.

    OpenAIRE

    Carpelan-Holmström, M; Haglund, C.; Kuusela, P.; Järvinen, H; Roberts, P. J.

    1995-01-01

    Preoperative serum levels of CEA and CA 242 were determined in 260 patients with colorectal cancer and in 92 patients with benign colorectal diseases. The overall sensitivity of the CEA test was 43% and of the CA 242 test 39%. The corresponding specificities were 90% and 87% respectively, using 5 ng ml-1 as cut-off level for CEA and 20 U ml-1 for CA 242. The sensitivity of CEA was 26%, 32%, 38% and 77% for Dukes A, B, C and D colorectal cancer, and the sensitivity of CA 242 was 26%, 26%, 40% ...

  7. Comparative study of CA242 and CA19-9 for the diagnosis of pancreatic cancer.

    OpenAIRE

    Kawa, S; Tokoo, M.; Hasebe, O.; Hayashi, K.; Imai, H; Oguchi, H.; Kiyosawa, K; Furuta, S; Homma, T

    1994-01-01

    A comparative study of a new tumour marker, CA242, and CA19-9 was conducted with special reference to their diagnostic usefulness in pancreatic cancer. CA242 showed sensitivity similar to that of CA19-9 for overall cases and early cases (stage I tumour) of pancreatic cancer. For other malignancies, the positive rates of CA242 were lower than those of CA19-9 except for colorectal cancer. An important characteristics of CA242 was that it was only slightly and infrequently elevated in the sera o...

  8. 242-A campaign 95-1 post run document

    Energy Technology Data Exchange (ETDEWEB)

    Guthrie, M.D.

    1996-02-12

    The 242-A Evaporator Campaign 95-1 was started on June 6, 1995 and finished July 27, 1995. An overall Waste Volume Reduction (WVR) of 8.18 million liters (2.16 mGAL OR 87.6% WVRF) was achieved from 9.35 million liters (2.47 Mgal) of processable waste contained in 108-AP, 107-AP, 106-AW and 102-AW. Slurry generated from Campaign 95-1 consisted of 1.05 million liters (278,000 gal) of dilute double-shell slurry feed (DDSSF) with a SpG of approximately 1.34. Total process condensate discharged to LERF was 10.3 million liters (2.72 Mgal), achieving a condensate/WVR efficiency ratio of 1.26. Total throughout for Campaign 95-1 was 18.1 million liters (4.79 Mgal). B Pond discharges from steam condensate and cooling water were 15.8 and 583 million liters (4.17 and 154 Mgal) respectively. Based on 145 hours of unplanned downtime, the 242-A Evaporator maintained an operating efficiency of 86% during the 49 day campaign.

  9. 242A Distributed Control System Year 2000 Acceptance Test Report

    International Nuclear Information System (INIS)

    This report documents acceptance test results for the 242-A Evaporator distributive control system upgrade to D/3 version 9.0-2 for year 2000 compliance. This report documents the test results obtained by acceptance testing as directed by procedure HNF-2695. This verification procedure will document the initial testing and evaluation of the potential 242-A Distributed Control System (DCS) operating difficulties across the year 2000 boundary and the calendar adjustments needed for the leap year. Baseline system performance data will be recorded using current, as-is operating system software. Data will also be collected for operating system software that has been modified to correct year 2000 problems. This verification procedure is intended to be generic such that it may be performed on any D/3(trademark) (GSE Process Solutions, Inc.) distributed control system that runs with the VMSTM (Digital Equipment Corporation) operating system. This test may be run on simulation or production systems depending upon facility status. On production systems, DCS outages will occur nine times throughout performance of the test. These outages are expected to last about 10 minutes each

  10. 242A Distributed Control System Year 2000 Acceptance Test Report

    Energy Technology Data Exchange (ETDEWEB)

    TEATS, M.C.

    1999-08-31

    This report documents acceptance test results for the 242-A Evaporator distributive control system upgrade to D/3 version 9.0-2 for year 2000 compliance. This report documents the test results obtained by acceptance testing as directed by procedure HNF-2695. This verification procedure will document the initial testing and evaluation of the potential 242-A Distributed Control System (DCS) operating difficulties across the year 2000 boundary and the calendar adjustments needed for the leap year. Baseline system performance data will be recorded using current, as-is operating system software. Data will also be collected for operating system software that has been modified to correct year 2000 problems. This verification procedure is intended to be generic such that it may be performed on any D/3{trademark} (GSE Process Solutions, Inc.) distributed control system that runs with the VMSTM (Digital Equipment Corporation) operating system. This test may be run on simulation or production systems depending upon facility status. On production systems, DCS outages will occur nine times throughout performance of the test. These outages are expected to last about 10 minutes each.

  11. 242-A campaign 95-1 post run document

    International Nuclear Information System (INIS)

    The 242-A Evaporator Campaign 95-1 was started on June 6, 1995 and finished July 27, 1995. An overall Waste Volume Reduction (WVR) of 8.18 million liters (2.16 mGAL OR 87.6% WVRF) was achieved from 9.35 million liters (2.47 Mgal) of processable waste contained in 108-AP, 107-AP, 106-AW and 102-AW. Slurry generated from Campaign 95-1 consisted of 1.05 million liters (278,000 gal) of dilute double-shell slurry feed (DDSSF) with a SpG of approximately 1.34. Total process condensate discharged to LERF was 10.3 million liters (2.72 Mgal), achieving a condensate/WVR efficiency ratio of 1.26. Total throughout for Campaign 95-1 was 18.1 million liters (4.79 Mgal). B Pond discharges from steam condensate and cooling water were 15.8 and 583 million liters (4.17 and 154 Mgal) respectively. Based on 145 hours of unplanned downtime, the 242-A Evaporator maintained an operating efficiency of 86% during the 49 day campaign

  12. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  13. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  14. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  15. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  16. 48 CFR 53.242-1 - Novation and change-of-name agreements (SF 30).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Novation and change-of-name agreements (SF 30). 53.242-1 Section 53.242-1 Federal Acquisition Regulations System FEDERAL...-of-name agreements (SF 30). SF 30, Amendment of Solicitation/Modification of Contract. SF...

  17. 40 CFR 61.242-4 - Standards: Pressure relief devices in gas/vapor service.

    Science.gov (United States)

    2010-07-01

    ... devices in gas/vapor service. (a) Except during pressure releases, each pressure relief device in gas... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards: Pressure relief devices in gas/vapor service. 61.242-4 Section 61.242-4 Protection of Environment ENVIRONMENTAL PROTECTION...

  18. 48 CFR 242.1403 - Shipping documents covering f.o.b. origin shipments.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Shipping documents... SERVICES Traffic and Transportation Management 242.1403 Shipping documents covering f.o.b. origin shipments....242-7003, Application for U.S. Government Shipping Documentation/Instructions. (ii) The...

  19. 24 CFR 242.81 - Lead-based paint poisoning prevention.

    Science.gov (United States)

    2010-04-01

    ... prevention. Requirements set forth in 24 CFR part 35 apply to this program. ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Lead-based paint poisoning prevention. 242.81 Section 242.81 Housing and Urban Development Regulations Relating to Housing and...

  20. 25 CFR 242.2 - Authority to engage in commercial fishing.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Authority to engage in commercial fishing. 242.2 Section... FISHING ON RED LAKE INDIAN RESERVATION § 242.2 Authority to engage in commercial fishing. No person shall engage in commercial fishing in the waters of the Red Lakes on the Red Lake Indian Reservation in...

  1. Organic emission calculations for the 242-A evaporator vessel vent system

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, M.R.

    1996-06-20

    This document contains historical calculations originally published in the 242-A Evaporator Dangerous Waste Permit Application, DOE/RL-90-42, Rev 0. They are being released as a supporting document, along with brief explanatory information, to be used as a reference in Rev 1 of the permit application and in other supporting documents, such as the 242-A Evaporator Data Quality Objectives.

  2. 20 CFR 404.242 - Use of old-start primary insurance amount as guaranteed alternative.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Use of old-start primary insurance amount as guaranteed alternative. 404.242 Section 404.242 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts...

  3. 36 CFR 242.6 - Licenses, permits, harvest tickets, tags, and reports.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Licenses, permits, harvest tickets, tags, and reports. 242.6 Section 242.6 Parks, Forests, and Public Property FOREST SERVICE... permits (Federal Subsistence Registration Permit or Federal Designated Harvester Permit) required...

  4. Consistent Data Assimilation of Isotopes: 242Pu and 105Pd

    Energy Technology Data Exchange (ETDEWEB)

    G. Palmiotti; H. Hiruta; M. Salvatores

    2012-09-01

    In this annual report we illustrate the methodology of the consistent data assimilation that allows to use the information coming from integral experiments for improving the basic nuclear parameters used in cross section evaluation. A series of integral experiments are analyzed using the EMPIRE evaluated files for 242Pu and 105Pd. In particular irradiation experiments (PROFIL-1 and -2, TRAPU-1, -2 and -3) provide information about capture cross sections, and a critical configuration, COSMO, where fission spectral indexes were measured, provides information about fission cross section. The observed discrepancies between calculated and experimental results are used in conjunction with the computed sensitivity coefficients and covariance matrix for nuclear parameters in a consistent data assimilation. The results obtained by the consistent data assimilation indicate that not so large modifications on some key identified nuclear parameters allow to obtain reasonable C/E. However, for some parameters such variations are outside the range of 1 s of their initial standard deviation. This can indicate a possible conflict between differential measurements (used to calculate the initial standard deviations) and the integral measurements used in the statistical data adjustment. Moreover, an inconsistency between the C/E of two sets of irradiation experiments (PROFIL and TRAPU) is observed for 242Pu. This is the end of this project funded by the Nuclear Physics Program of the DOE Office of Science. We can indicate that a proof of principle has been demonstrated for a few isotopes for this innovative methodology. However, we are still far from having explored all the possibilities and made this methodology to be considered proved and robust. In particular many issues are worth further investigation: • Non-linear effects • Flexibility of nuclear parameters in describing cross sections • Multi-isotope consistent assimilation • Consistency between differential and integral

  5. 242Am/sup m/ fission cross section

    International Nuclear Information System (INIS)

    The neutron-induced fission cross section of 242Am/sup m/ has been measured over the energy region from 10-3 eV to approx.20 MeV in a series of experiments utilizing a linac-produced ''white'' neutron source and a monoenergetic source of 14.1 MeV neutrons. The cross section was measured relative to that of 235U in the thermal (0.001 to approx.3 eV) and high energy (1 keV to approx.20 MeV) regions and normalized to the ENDF/B-V 235U(n,f) evaluated cross section. In the resonance energy region (0.5 eV to 10 keV) the neutron flux was measured using thin lithium glass scintillators and the relative cross section thus obtained was normalized to the thermal energy measurement. This procedure allowed a consistency check between the thermal and high energy data. The cross section data have a statistical accuracy of approx.0.5% at thermal energies and in the 1-MeV energy region, and a systematic uncertainty of approx.5%. We confirmed that 242Am/sup m/ has the largest thermal fission cross section known with a 2200 m/sec value of 6328 b. Results of a Breit-Wigner sum-of-single-levels analysis of 48 fission resonances up to 20 eV are presented and the connection of these resonance properties to the large thermal cross section is discussed. Our measurements are compared with previously reported results

  6. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  7. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  8. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    Energy Technology Data Exchange (ETDEWEB)

    Suneesh, A.S.; Venkatesan, K.A.; Syamala, K.V.; Antony, M.P.; Vasudeva Rao, P.R. [Indira Gandhi Centre for Atomic Research, Kalpakkam (India). Fuel Chemistry Div.

    2012-07-01

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by {sup 1}H and {sup 13}C NMR, mass and IR spectroscopy. The extraction behaviour of {sup (152+154})Eu(III) and {sup 241}Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for {sup (152+154)}Eu(III) and HDEHSDGA shows the superior selectivity for {sup 241}Am(III). (orig.)

  9. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  10. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  11. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  12. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  13. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed.

  14. In vitro evaluation of the antimicrobial activity of HM-242, a novel antiseptic compound.

    Science.gov (United States)

    Okunishi, Junji; Nishihara, Yutaka; Maeda, Shirou; Ikeda, Masahiro

    2009-09-01

    The antimicrobial activities of N(4)-octyl-6,6-dimethyl-N(2)-(4-methylbenzyl)-1,6-dihydro-1,3,5-triazine-2,4-diamine (HM-242), a novel synthetic compound, were compared with those of chlorhexidine gluconate (CHG). HM-242 was a more potent microbicide than CHG in vitro; however, its minimal inhibitory concentrations were similar. In particular, HM-242 killed various Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis, both efficiently and rapidly. HM-242 also showed potent virucidal activity against enveloped viruses such as influenza virus and herpes simplex virus. These characteristics suggest that HM-242 may well be useful as an antiseptic.

  15. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    Science.gov (United States)

    Jandel, M.; Bredeweg, T. A.; Stoyer, M. A.; Wu, C. Y.; Fowler, M. M.; Becker, J. A.; Bond, E. M.; Couture, A.; Haight, R. C.; Haslett, R. J.; Henderson, R. A.; Keksis, A. L.; O'Donnell, J. M.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.; Wouters, J. M.

    2009-01-01

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for 241Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for 243Am for neutron energies between 10 eV and 250 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on 242mAm will be presented where the fission events were actively triggered during the experiments. In these experiments, a Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,γ) events from (n,f) events. The first direct observation of neutron capture on 242mAm in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  16. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Jandel, Marian [Los Alamos National Laboratory

    2008-01-01

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for {sup 241}Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for {sup 243}Am for neutron energies between 35 eV and 200 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on {sup 242m}Am will be presented, where the fission events were actively triggered during the experiments. In these experiments, the Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,{gamma}) from (n,f) events. The first evidence of neutron capture on {sup 242m}Am in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  17. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    International Nuclear Information System (INIS)

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for 241Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for 243Am for neutron energies between 35 eV and 200 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on 242mAm will be presented, where the fission events were actively triggered during the experiments. In these experiments, the Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,γ) from (n,f) events. The first evidence of neutron capture on 242mAm in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  18. 24 CFR 1000.242 - When does the requirement for exemption from taxation apply to affordable housing activities?

    Science.gov (United States)

    2010-04-01

    ... exemption from taxation apply to affordable housing activities? 1000.242 Section 1000.242 Housing and Urban... ACTIVITIES Indian Housing Plan (IHP) § 1000.242 When does the requirement for exemption from taxation apply to affordable housing activities? The requirement for exemption from taxation applies only to...

  19. 27 CFR 24.242 - Authority to use greater quantities of decolorizing material in juice or wine.

    Science.gov (United States)

    2010-04-01

    ... quantities of decolorizing material in juice or wine. 24.242 Section 24.242 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS WINE Storage, Treatment and Finishing of Wine § 24.242 Authority to use greater quantities of decolorizing material...

  20. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  1. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  2. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  3. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  4. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  5. EFFECT OF COMPOSITION OF SELECTED GROUNDWATERS FROM THE BASIN AND RANGE PROVINCE ON PLUTONIUM, NEPTUNIUM, AND AMERICIUM SPECIATION.

    Science.gov (United States)

    Rees, Terry F.; Cleveland, Jess M.; Nash, Kenneth L.

    1984-01-01

    The speciation of plutonium, neptunium, and americium was determined in groundwaters from four sources in the Basin and Range Province: the lower carbonate aquifer, Nevada Test Site (NTS) (Crystal Pool); alluvial fill, Frenchman Flat, NTS (well 5C); Hualapai Valley, Arizona (Red Lake south well); and Tularosa Basin, New Mexico (Rentfrow well). The results were interpreted to indicate that plutonium and, to a lesser extent, neptunium are least soluble in reducing groundwaters containing a large concentration of sulfate ion and a small concentration of strongly complexing anions. The results further emphasize the desirability of including studies such as this among the other site-selection criteria for nuclear waste repositories.

  6. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  7. Process control plan for 242-A Evaporator Campaign 94-2

    Energy Technology Data Exchange (ETDEWEB)

    Le, E.Q.

    1994-09-01

    242-A Evaporator Campaign 94-2 will process approximately 3.42 million gallons of dilute waste from tanks 101-AP, 107-AP, 108AP, 102-AW, and 106-AW. The process control plant describes activities which will occur during Campaign 94-2. This document also addresses compliance with the tank farm waste compatibility program, the 242-A radiological source term, the criticality prevention specifications, and effluent discharge limits.

  8. Comparative study of CA242 and CA19-9 in chronic pancreatitis.

    OpenAIRE

    Furuya, N; Kawa, S; Hasebe, O.; Tokoo, M.; Mukawa, K.; Maejima, S.; Oguchi, H.

    1996-01-01

    CA242 has been proved to be useful in the diagnosis of pancreatic cancer. The aim of the present study was to clarify the mechanisms contributing to the high specificity of CA242 as compared with CA19-9 resulting from scarce serum elevation of this antigen in patients with chronic pancreatitis by correlating serum levels and endoscopic retrograde choledocho-pancreatography (ERCP) findings and by immunohistochemical analysis. Serum CA19-9 levels were significantly elevated in patients with cal...

  9. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.

    1982-01-01

    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  10. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  11. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  12. CO observations of high-z radio galaxies MRC 2104-242 and MRC 0943-242: spectral-line performance of the Compact Array Broadband Backend

    CERN Document Server

    Emonts, B H C; Feain, I; Miley, G; Sadler, E M; Villar-Martin, M; Mao, M Y; Oosterloo, T A; Ekers, R D; Stevens, J B; Wieringa, M H; Coppin, K E K; Tadhunter, C N

    2011-01-01

    We present the first 7-millimetre observations of two high-redshift, Lya-bright radio galaxies (MRC 2104-242 and MRC 0943-242) performed with the 2 x 2 GHz instantaneous bandwidth of the Compact Array Broadband Backend (CABB) at the Australia Telescope Compact Array (ATCA). The aim was to search for 12CO(1-0) emission in these systems and test the millimetre capabilities of CABB for performing spectral line observations at high redshifts. We show that the stable band and enhanced velocity coverage of CABB, combined with hybrid array configurations, provide the ATCA with excellent 7-mm capabilities that allow reliable searches for the ground transition of CO at high redshifts. In this paper we explicitly discuss the calibration procedures used to reach our results. We set a firm upper limit to the mass of molecular gas in MRC 2104-242 (z = 2.5) of M(H2) < 2 x 10^10 (alpha_x/0.8) M_sun. For MRC 0943-242 (z=2.9) we derive an upper limit of M(H2) < 6 x 10^10 (alpha_x/0.8) M_sun. We also find a tentative 3-s...

  13. Concordant plutonium-241-americium-241 dating of environmental samples: results from forest fire ash

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, Steven J [Los Alamos National Laboratory; Oldham, Warren J [Los Alamos National Laboratory; Murrell, Michael T [Los Alamos National Laboratory; Katzman, Danny [Los Alamos National Laboratory

    2010-12-07

    We have measured the Pu, {sup 237}Np, {sup 241}Am, and {sup 151}Sm isotopic systematics for a set of forest fire ash samples from various locations in the western U.S. including Montana, Wyoming, Idaho, and New Mexico. The goal of this study is to develop a concordant {sup 241}Pu (t{sub 1/2} = 14.4 y)-{sup 241}Am dating method for environmental collections. Environmental samples often contain mixtures of components including global fallout. There are a number of approaches for subtracting the global fallout component for such samples. One approach is to use {sup 242}/{sup 239}Pu as a normalizing isotope ratio in a three-isotope plot, where this ratio for the nonglobal fallout component can be estimated or assumed to be small. This study investigates a new, complementary method of normalization using the long-lived fission product, {sup 151}Sm (t{sub 1/2} = 90 y). We find that forest fire ash concentrates actinides and fission products with {approx}1E10 atoms {sup 239}Pu/g and {approx}1E8 atoms {sup 151}Sm/g, allowing us to measure these nuclides by mass spectrometric (MIC-TIMS) and radiometric (liquid scintillation counting) methods. The forest fire ash samples are characterized by a western U.S. regional isotopic signature representing varying mixtures of global fallout with a local component from atmospheric testing of nuclear weapons at the Nevada Test Site (NTS). Our results also show that {sup 151}Sm is well correlated with the Pu nuclides in the forest fire ash, suggesting that these nuclides have similar geochemical behavior in the environment. Results of this correlation indicate that the {sup 151}Sm/{sup 239}Pu atom ratio for global fallout is {approx}0.164, in agreement with an independent estimate of 0.165 based on {sup 137}Cs fission yields for atmospheric weapons tests at the NTS. {sup 241}Pu-{sup 241}Am dating of the non-global fallout component in the forest fire ash samples yield ages in the late 1950's-early 1960's, consistent with a peak

  14. LIBS Spectral Data for a Mixed Actinide Fuel Pellet Containing Uranium, Plutonium, Neptunium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Judge, Elizabeth J. [Los Alamos National Laboratory; Berg, John M. [Los Alamos National Laboratory; Le, Loan A. [Los Alamos National Laboratory; Lopez, Leon N. [Los Alamos National Laboratory; Barefield, James E. [Los Alamos National Laboratory

    2012-06-18

    Laser-induced breakdown spectroscopy (LIBS) was used to analyze a mixed actinide fuel pellet containing 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2}. The preliminary data shown here is the first report of LIBS analysis of a mixed actinide fuel pellet, to the authors knowledge. The LIBS spectral data was acquired in a plutonium facility at Los Alamos National Laboratory where the sample was contained within a glove box. The initial installation of the glove box was not intended for complete ultraviolet (UV), visible (VIS) and near infrared (NIR) transmission, therefore the LIBS spectrum is truncated in the UV and NIR regions due to the optical transmission of the window port and filters that were installed. The optical collection of the emission from the LIBS plasma will be optimized in the future. However, the preliminary LIBS data acquired is worth reporting due to the uniqueness of the sample and spectral data. The analysis of several actinides in the presence of each other is an important feature of this analysis since traditional methods must chemically separate uranium, plutonium, neptunium, and americium prior to analysis. Due to the historic nature of the sample fuel pellet analyzed, the provided sample composition of 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2} cannot be confirm without further analytical processing. Uranium, plutonium, and americium emission lines were abundant and easily assigned while neptunium was more difficult to identify. There may be several reasons for this observation, other than knowing the exact sample composition of the fuel pellet. First, the atomic emission wavelength resources for neptunium are limited and such techniques as hollow cathode discharge lamp have different dynamics than the plasma used in LIBS which results in different emission spectra. Secondly, due to the complex sample of four actinide elements, which all have very dense electronic energy levels, there may be reactions and

  15. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  16. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state propertie...

  17. Serum level of TSGF,CA242 and CA19-9 in pancreatic cancer

    Institute of Scientific and Technical Information of China (English)

    Jing-Ting Jiang; Chang-Ping Wu; Hai-Feng Deng; Ming-Yang Lu; Jun Wu; Hong-Yu Zhang; Wen-Hui Sun; Mei Ji

    2004-01-01

    AIM: To establish a method to detect the expression of the tumor specific growth factor TSGF, CA242 and CA19-9 in serum and evaluate their value in diagnosis of pancreatic cancer.METHODS: ELISA and Biochemical colorimetric assay were used to detect the serum content of TSGF, CA242 and CA19-9 in 200 normal cases, 52 pancreatitis patients and 96 pancreatic cancer patients.RESULTS: The positive likelihood ratios of TSGF, CA242and CA19-9 were 5.4, 12.6 and 6.3, respectively, and their negative likelihood ratios were 0.10, 0.19 and 0.17,respectively. With single tumor marker diagnosed pancreatic cancer, the highest sensitivity and specificity of TSGF were 91.6% and 93.5%. In combined test with 3 markers, when all of them were positive, the sensitivity changed to 77.0%and the specificity and the positive predictive value were 100%. The levels of TSGF and CA242 were significantly higher in the patients with pancreatic cancer of head than those in the patients with pancreatic cancer of body, tail and whole pancreas, but the expression of CA19-9 had no correlation with the positions of the pancreatic cancer. The sensitivity of TSGF, CA242 and CA19-9 was increased with the progress in stages of pancreatic cancer. In stage I, the sensitivity of TSGF was markedly higher than CA242 and CA19-9.CONCLUSION: The combined use of TSGF, CA242 and CA19-9 expressions can elevate the specificity for pancreatic cancer diagnosis. And it shows that it plays an important role to differentiate positions and tissue typing. It is a forepart diagnosis for the pancreatic cancer by combination checking.There is very important correlation between the three markers and the pancreatic cancer.

  18. Measurement of Neutron Induced and Spontaneous Fission in Pu-242 at DANCE

    Science.gov (United States)

    Chyzh, Andrii; Wu, C. Y.; Henderson, R.; Couture, A.; Lee, H. Y.; Ullmann, J.; O'Donnell, J. M.; Jandel, M.; Haight, R. C.; Bredeweg, T. A.; Dance Collaboration

    2013-10-01

    Neutron capture and fission reactions are important in nuclear engineering and physics. DANCE (Detector for Advanced Neutron Capture Measurement, LANL) combined with PPAC (avalanche technique based fission tagging detector, LLNL) were used to study neutron induced and spontaneous fission in 242Pu. 2 measurements were performed in 2013. The first experiment was done without the incident neutron beam with the fission tagging ability to study γ-rays emitted in the spontaneous fission of 242Pu. The second one - with the neutron beam to measure both the neutron capture and fission reactions. This is the first direct measurement of prompt fission γ-rays in 242Pu. The γ-ray multiplicity, γ-ray energy, and total energy of γ-rays per fission in 242Pu will be presented. These distributions of the 242Pu spontaneous fission will be compared to those in the 241Pu neutron induced fission. This work was performed under the auspices of the US Department of Energy by Los Alamos National Laboratory under Contract DE-AC52-06NA25396 and Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  19. CA 242, a new tumour marker for pancreatic cancer: a comparison with CA 19-9, CA 50 and CEA.

    OpenAIRE

    Haglund, C.; Lundin, J; Kuusela, P.; Roberts, P. J.

    1994-01-01

    The serum expression of a novel tumour marker, CA 242, defined by monoclonal antibody C 242, was studied in 179 patients with pancreatic cancer. The results were compared with CA 19-9, CA 50 and CEA. CA 242 is a carbohydrate closely related, but not identical, to CA 19-9 and CA 50. The overall sensitivity of the CA 242 assay was 74%: 55% in stage I, 83% in stage II-III and 78% in stage IV disease. The specificity calculated from 112 patients with benign diseases was 91%. CA 19-9 had a higher ...

  20. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry.

    Science.gov (United States)

    Kazi, Zakir H; Cornett, Jack R; Zhao, Xaiolei; Kieser, Liam

    2014-06-01

    A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8M HNO3 with 0.05 M NaNO2 before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO3, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl3 facilitated the complete desorption of Pu. Interferences (e.g. Ca(2+), Fe(3+)) were washed off from the resin bed with excess HNO3. Using NdF3, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7±5.3% and 95.5±4.6% for (241)Am and (242)Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1±6.0 and 96.8±5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1-100 Bq kg(-1). The single column separation of Pu and Am saves reagents, separation time, and cost. PMID:24856406

  1. Delisting strategy for the Hanford Site 242-A Evaporator PUREX Plant Condensate Treatment Facility

    International Nuclear Information System (INIS)

    This document describes the strategy that the US Department of Energy, Richland Field Office intends to use in preparing the delisting petition for the 242-A Evaporator/PUREX Plant Condensate Treatment Facility. Because the 242-A Evaporator/PUREX Plant Condensate Treatment Facility will not be operational until 1994, the delisting petition will be structured as an up-front petition based on the ''multiple waste treatment facility'' approach outline in the 1985 US Environmental Protection Agency's Petitions to Delist Hazardous Waste. The 242-A evaporator/PUREX Plant Condensate Treatment Facility effluent characterization data will not be available to support the delisting petition, because the delisting petition will be submitted to the US Environmental Protection Agency before start-up of the 242-A Evaporator/PUREX Plant Condensate Treatment Facility. Therefore, the delisting petition will be based on data collected during the pilot plant testing for the 242-A Evaporator/PUREX Plant Condensate Treatment Facility. This pilot plant testing will be conducted on synthetic waste. The composition of the synthetic waste will be based on: (1) constituents of regulatory concern, and (2) on process knowledge. The pilot plant testing will be performed to determine the removal efficiencies of the process equipment at concentrations greater than reasonably could be expected in the actual waste. This strategy document also describes the logic used to develop the synthetic waste, to develop the pilot plant testing program, and to prepare the delisting petition. This strategy document also described how full-scale operating data will be collected during initial operation of the 242-A Evaporator/PUREX Plant Condensate Treatment Facility to verify information presented in the delisting petition

  2. Neutron Induced Fission Measurements of ^242mAm at DANCE

    Science.gov (United States)

    Chyzh, A.; Wu, C. Y.; Macri, R. A.; Agvaanlusan, U.; Parker, W. E.; Wilk, P. A.; Becker, J. A.; Jandel, M.; Bredeweg, T. A.; Fowler, M. M.; Bond, E. M.; Chadwick, M. B.; Clement, R. R.; Couture, A.; O'Donnell, J. M.; Haight, R. C.; Keksis, A. L.; Reifarth, R.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D.; Wilhelmy, J. B.; Wouters, J. M.

    2010-11-01

    Neutron capture and fission reactions on actinieds often present challenges in measuring each of the reaction. Fission tagging detector used along with the Detector for Advanced Neutron Capture Experiments (DANCE) provides a way to measure (n,f) and (n,γ) reactions simultaneously. DANCE was used to measure ^242mAm(n,f) reaction along with a custom made fission-tagging parallel plate avalanche counter (PPAC). The results on fission related γ-ray multiplicity distribution, the ^242mAm(n,f) cross section, and the average γ-ray energy distribution are presented.

  3. Independent Verification of Element 114 Production in the 48Ca+242Pu Reaction

    International Nuclear Information System (INIS)

    Independent verification of the production of element 114 in the reaction of 244-MeV 48Ca with 242Pu is presented. Two chains of time- and position-correlated decays have been assigned to 286114 and 287114. The observed decay modes, half-lives, and decay energies agree with published results. The measured cross sections at a center-of-target energy of 244 MeV for the 242Pu(48Ca,3-4n)287,286114 reactions were 1.4-1.2+3.2 pb each, which are lower than the reported values.

  4. The role of CA-242 and CEA in surveillance following curative resection for colorectal cancer.

    OpenAIRE

    Hall, N. R.; Finan, P. J.; Stephenson, B M; Purves, D. A.; Cooper, E H

    1994-01-01

    This study was undertaken to evaluate the role of a new tumour marker, CA-242, alone or in combination with CEA in the practical management of colorectal cancer patients after potentially curative resection. A cohort of 149 patients who had undergone 'curative' surgery was followed up according to an intensive protocol in order to detect recurrent disease. Over a median tumour marker follow-up period of 24 months there were 25 recurrences in 24 patients. Both CEA and CA-242 alone detected hal...

  5. 17 CFR 242.601 - Dissemination of transaction reports and last sale data with respect to transactions in NMS stocks.

    Science.gov (United States)

    2010-04-01

    ... reports and last sale data with respect to transactions in NMS stocks. 242.601 Section 242.601 Commodity..., AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the... transactions in NMS stocks. (a) Filing and effectiveness of transaction reporting plans. (1) Every...

  6. 40 CFR 436.242 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Effluent limitations guidelines... technology currently available. 436.242 Section 436.242 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS MINERAL MINING AND PROCESSING POINT SOURCE...

  7. 40 CFR 408.242 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Effluent limitations guidelines representing the degree of effluent reduction attainable by the application of the best practicable control technology currently available. 408.242 Section 408.242 Protection of Environment ENVIRONMENTAL...

  8. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  9. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides

    Science.gov (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.

    2015-10-01

    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  10. THE FIRST ISOLATION OF AMERICIUM IN THE FORM OF PURE COMPOUNDS - THE SPECIFIC ALPHA-ACTIVITY AND HALF-LIFE OF Am241

    Energy Technology Data Exchange (ETDEWEB)

    Cunningham, B.B.; Asprey, L.B.

    1950-07-20

    The microgram scale isolation and preparation of pure compounds of americium is described. Data are presented to show that the alpha-half-life of the isotope Am{sup 241} is 490 {+-} 14 years. The absorption spectrum of Am(III) in 1M nitric acid in the range 3500-8000 mu is given. The wave lengths of 10 of the most prominent lines in the copper spark emission spectrum of americium are given to the nearest 0.01 {angstrom}. Evidence is presented to show that the potential for the Am(III)-Am(IV) couple in acid solution is more negative than -2v and that the potential for the Am(II)-Am(III) couple is more positive than +0.9v.

  11. Determination of the 242Pu Branching Ratio via Alpha-Gamma Coincidence

    Energy Technology Data Exchange (ETDEWEB)

    Wang, T F

    2012-05-24

    When the burn-up is high, the {sup 242}Pu isotopic content becomes more important. The traditional correlation method will fail. The {sup 242}Pu isotopic content in the sample plays an essential role if the neutron coincidence method is used to quantify the total amount of plutonium. In one of the earlier measurements we had a chance to measure an isotopic pure (> 99.95 %) {sup 242}Pu thick sample and realized that the difference in the branching ratio (BR) value among current nuclear data3) for the two important gamma-rays at 103.5-keV and 158.8-keV. In this study, the thick sample was counted on a 15% ORTEC safeguards type HPGe to further improve BR determination of the 159-keV gamma-ray. Furthermore, we have made a thin {sup 242}Pu sample from the thick sample and performed alpha-gamma coincidence measurements. Our preliminary gamma-ray BR results are 4.37(6) E-4, 2.79(8) E-5, and 2.25(8) E-6 for 44.9-keV, 103.5-keV, and 158.9-keV, respectively.

  12. 48 CFR 1852.242-73 - NASA contractor financial management reporting.

    Science.gov (United States)

    2010-10-01

    ... Provisions and Clauses 1852.242-73 NASA contractor financial management reporting. As prescribed in 1842.7202, insert the following clause: NASA Contractor Financial Management Reporting (NOV 2004) (a) The Contractor shall submit NASA Contractor Financial Management Reports on NASA Forms 533 in accordance with...

  13. Recommendations for the 242Pu content evaluation using a new algorithm

    International Nuclear Information System (INIS)

    Plutonium isotopic determination by gamma spectrometry is an important nondestructive assay (NDA) method widely used by laboratories, operators, and safeguards directorates. Significant improvements have been made in the last few years on plutonium gamma-ray analysis, which have led to a very low discrepancy between gamma measurement and mass spectrometry (≤ ±2%) for the detectable isotopes. This leads to the fact that one important source of error is now the 242Pu content evaluation using correlation with the other isotopes. Moreover, the 242Pu content on the total plutonium is not negligible for typical burnup (it can reach 8 to 10% for burnup of ∼40 GWd/tonne U). This means that a lack of knowledge on the 242Pu content evaluation will generate an important error on the total plutonium mass estimation. The correlation used by many codes (like MGA) is as follows: 242Pu = C240Pu/Pu239241Pu/239Pu. This correlation leads to an average difference between NDA evaluation and mass spectrometry of ∼20%

  14. Determination of the 242Pu Branching Ratio via Alpha-Gamma Coincidence

    International Nuclear Information System (INIS)

    When the burn-up is high, the 242Pu isotopic content becomes more important. The traditional correlation method will fail. The 242Pu isotopic content in the sample plays an essential role if the neutron coincidence method is used to quantify the total amount of plutonium. In one of the earlier measurements we had a chance to measure an isotopic pure (> 99.95 %) 242Pu thick sample and realized that the difference in the branching ratio (BR) value among current nuclear data3) for the two important gamma-rays at 103.5-keV and 158.8-keV. In this study, the thick sample was counted on a 15% ORTEC safeguards type HPGe to further improve BR determination of the 159-keV gamma-ray. Furthermore, we have made a thin 242Pu sample from the thick sample and performed alpha-gamma coincidence measurements. Our preliminary gamma-ray BR results are 4.37(6) E-4, 2.79(8) E-5, and 2.25(8) E-6 for 44.9-keV, 103.5-keV, and 158.9-keV, respectively.

  15. 17 CFR 242.608 - Filing and amendment of national market system plans.

    Science.gov (United States)

    2010-04-01

    ... EXCHANGE COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.608 Filing and amendment of... Regulation NMS and part 240, subpart A of this chapter shall, in addition to compliance with this...

  16. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium

    OpenAIRE

    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray

    2009-01-01

    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  17. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  18. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  19. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  20. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: dam.prieur@gmail.com [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)

    2015-10-15

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  1. Prompt fission γ -ray spectrum characteristics from 240Pu(sf ) and 242Pu(sf )

    Science.gov (United States)

    Oberstedt, S.; Oberstedt, A.; Gatera, A.; Göök, A.; Hambsch, F.-J.; Moens, A.; Sibbens, G.; Vanleeuw, D.; Vidali, M.

    2016-05-01

    In this paper we present first results for prompt fission γ -ray spectra (PFGS) characteristics from the spontaneous fission (sf) of 240Pu and 242Pu. For 242Pu(sf ) we obtained, after proper unfolding of the detector response, an average energy per photon ɛ¯γ=(0.843 ±0.012 ) MeV, an average multiplicity M¯γ=(6.72 ±0.07 ) , and an average total γ -ray energy release per fission E¯γ ,tot = (5.66 ± 0.06) MeV. The 240Pu(sf ) emission spectrum was obtained by applying a so-called detector-response transformation function determined from the 242Pu spectrum measured in exactly the same geometry. The results are an average energy per photon ɛ¯γ=(0.80 ±0.07 ) MeV, the average multiplicity M¯γ = (8.2 ± 0.4), and an average total γ -ray energy release per fission E¯γ ,tot = (6.6 ± 0.5) MeV. The PFGS characteristics for 242Pu(sf ) are in very good agreement with those from thermal-neutron-induced fission on 241Pu and scales well with the corresponding prompt neutron multiplicity. Our results in the case of 240Pu(sf ), although drawn from a limited number of events, show a significantly enhanced average multiplicity and average total energy, but may be understood from a different fragment yield distribution in 240Pu(sf ) compared to that of 242Pu(sf ).

  2. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  3. Intramolecular sensitization of americium luminescence in solution: shining light on short-lived forbidden 5f transitions.

    Science.gov (United States)

    Sturzbecher-Hoehne, M; Yang, P; D'Aléo, A; Abergel, R J

    2016-06-14

    The photophysical properties and solution thermodynamics of water soluble trivalent americium (Am(III)) complexes formed with multidentate chromophore-bearing ligands, 3,4,3-LI(1,2-HOPO), Enterobactin, and 5-LIO(Me-3,2-HOPO), were investigated. The three chelators were shown to act as antenna chromophores for Am(III), generating sensitized luminescence emission from the metal upon complexation, with very short lifetimes ranging from 33 to 42 ns and low luminescence quantum yields (10(-3) to 10(-2)%), characteristic of Near Infra-Red emitters in similar systems. The specific emission peak of Am(III) assigned to the (5)D1 → (7)F1 f-f transition was exploited to characterize the high proton-independent stability of the complex formed with the most efficient sensitizer 3,4,3-LI(1,2-HOPO), with a log β110 = 20.4 ± 0.2 value. In addition, the optical and solution thermodynamic features of these Am(III) complexes, combined with density functional theory calculations, were used to probe the influence of electronic structure on coordination properties across the f-element series and to gain insight into ligand field effects.

  4. Nano-cerium vanadate: a novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste.

    Science.gov (United States)

    Banerjee, Chayan; Dudwadkar, Nilesh; Tripathi, Subhash Chandra; Gandhi, Pritam Maniklal; Grover, Vinita; Kaushik, Chetan Prakash; Tyagi, Avesh Kumar

    2014-09-15

    Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides (233)U (4.82 MeV α) and (241)Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr(2+), Ru(3+), Fe(3+), etc., in the uptake process indicated CeVO4 nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  5. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  6. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  7. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  8. Analytical services: 222-S characterization of 242-A Evaporator Slurry, Campaign 94-1. Addendum 1A

    International Nuclear Information System (INIS)

    During the 242-A Evaporator's 94-1 campaign, five process samples were collected from the slurry stream for waste characterization. The five samples were collected over a 36 day time span, respectively on May 4, May 9, May 16, May 23, and June 9, 1994. Sample collections were performed per the protocol described in 242-A Evaporator Waste Analysis Plan, WHC-SD-WM-EV-060, Rev. 3 and in 242-A Evaporator Quality Assurance Project Plan, WHC-SD-WM-QAPP-009, Rev. 0. Slurry waste was characterized chemically and radiochemically by the Westinghouse Hanford Company, 222-S Laboratory as directed

  9. Analytical services: 222-S characterization of 242-A Evaporator Slurry, Campaign 94-1. Addendum 1A

    Energy Technology Data Exchange (ETDEWEB)

    1994-09-13

    During the 242-A Evaporator`s 94-1 campaign, five process samples were collected from the slurry stream for waste characterization. The five samples were collected over a 36 day time span, respectively on May 4, May 9, May 16, May 23, and June 9, 1994. Sample collections were performed per the protocol described in 242-A Evaporator Waste Analysis Plan, WHC-SD-WM-EV-060, Rev. 3 and in 242-A Evaporator Quality Assurance Project Plan, WHC-SD-WM-QAPP-009, Rev. 0. Slurry waste was characterized chemically and radiochemically by the Westinghouse Hanford Company, 222-S Laboratory as directed.

  10. Measurement of the 240Am production cross section via proton irradiation of 242Pu

    International Nuclear Information System (INIS)

    A new nuclear reaction for the production of 240Am was experimentally investigated. Targets of 150-500 μg/cm2242Pu on 2 μm Ti were produced through molecular deposition. Five irradiations, in which 242Pu, natTi, and natNi targets were jointly activated with protons from the Lawrence Berkeley National Laboratory 88-Inch Cyclotron produced 240Am, 48V, and 57Ni, respectively. The radioactive decay of these nuclides was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. A maximum 242Pu(p, 3n)240Am nuclear reaction cross section was measured to be 45 ± 13 mb with 23 MeV protons. While this value is lower than theoretical predictions, it is high enough to be the most viable nuclear reaction for the large-scale production of 240Am. (orig.)

  11. New Superheavy Element Isotopes: 242Pu(48Ca,5n)285114

    International Nuclear Information System (INIS)

    The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV (E*=50 MeV). The α decay of 285114 was followed by the sequential α decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269Sg. 265Rf was observed to decay by spontaneous fission. The measured α-decay Q values were compared with those from a macroscopic-microscopic nuclear mass model to give insight into superheavy element shell effects. The 242Pu(48Ca,5n)285114 cross section was 0.6-0.5+0.9 pb.

  12. Sequence and batch language programs and alarm related C Programs for the 242-A MCS

    Energy Technology Data Exchange (ETDEWEB)

    Berger, J.F.

    1996-04-15

    A Distributive Process Control system was purchased by Project B-534, 242-A Evaporator/Crystallizer Upgrades. This control system, called the Monitor and Control system (MCS), was installed in the 242-A evaporator located in the 200 East Area. The purpose of the MCS is to monitor and control the Evaporator and monitor a number of alarms and other signals from various Tank Farm facilities. Applications software for the MCS was developed by the Waste Treatment Systems Engineering (WTSE) group of Westinghouse. The standard displays and alarm scheme provide for control and monitoring, but do not directly indicate the signal location or depict the overall process. To do this, WTSE developed a second alarm scheme.

  13. New Superheavy Element Isotopes: 242Pu(48Ca,5n)285114

    Energy Technology Data Exchange (ETDEWEB)

    Ellison, Paul A; Gregorich, Kenneth E.; Berryman, Jill S.; Bleuel, Darren L.; Clark, Roderick M.; Dragojevic, Irena; Dvorak, Jan; Fallon, Paul; Fineman-Sotomayor, Carolina; Gates, Jacklyn M.; Gothe, Oliver R.; Lee, I-Yang; Loveland, Walter D.; McLaughlin, Joseph P.; Paschalis, Stefanos; Petri, Marina-Kalliopi; Qian, Jing; Stavsetra, Liv; Wiedeking, Mathis; Nitsche, Heino

    2010-10-22

    The new, neutron-deficient, superheavy element isotope {sup 285}114 was produced in {sup 48}Ca irradiations of {sup 242}Pu targets at a center-of-target beam energy of 256 MeV (E* = 50 MeV). The {alpha} decay of {sup 285}114 was followed by the sequential {alpha} decay of four daughter nuclides, {sup 281}Cn, {sup 277}Ds, {sup 273}Hs, and {sup 269}Sg. {sup 265}Rf was observed to decay by spontaneous fission. The measured {alpha}-decay Q values were compared with those from a macroscopic-microscopic nuclear mass model to give insight into superheavy element shell effects. The {sup 242}Pu({sup 48}Ca,5n){sup 285}114 cross section was 0.6{sub -0.5}{sup +0.9} pb.

  14. Clinical evaluation of a new serum tumour marker CA 242 in pancreatic carcinoma.

    OpenAIRE

    Pasanen, P. A.; Eskelinen, M.; Partanen, K.; Pikkarainen, P; Penttilä, I.; Alhava, E

    1992-01-01

    The aim of this study was to evaluate the new monoclonal tumour marker CA 242 in the diagnosis of pancreatic carcinoma and to compare it with the established markers CA 50 and CEA. Serum concentrations were determined in 113 patients with jaundice, in 20 patients with laboratory values suggesting cholestasis, and in 60 patients with a suspicion to have chronic pancreatitis. Twenty-four of these 193 patients had pancreatic carcinoma and two patients had carcinoma of papilla of Vater. The sensi...

  15. Measurement of the 242Pu(n,f cross section at n_TOF

    Directory of Open Access Journals (Sweden)

    Tsinganis A.

    2014-03-01

    Full Text Available Knowledge of neutron cross sections of various plutonium isotopes and other minor actinides is crucial for the design of advanced nuclear systems. The 242Pu(n,f cross sections were measured at the CERN n_TOF facility, taking advantage of the wide energy range (from thermal to GeV and the high instantaneous flux of the neutron beam. In this work, preliminary results are presented along with a theoretical cross section calculation performed with the EMPIRE code.

  16. Reliable determination of 237Np in environmental solid samples using 242Pu as a potential tracer

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per;

    2011-01-01

    onto various AG 1-type anion exchangers; suitability of 242Pu as a tracer for 237Np determination in environmental solid samples; and long-term chemical stability of tetravalent Np. Experimental results revealed that the degree of resin cross-linking has a significant influence on the separation...... efficiency in terms of chemical yields of 237Np and removal of interfering nuclides. Although ca. 30% of sorbed Np onto AG 1-×4 was stripped out during HCl rinsing step for the removal of Th, chemical yield ratios of 237Np to 242Pu were proven steady with an average value of 0.67±0.04 (n=15) under selected......, thereby demonstrating the usefulness of 242Pu as a non-isotopic tracer for 237Np chemical yield monitoring. The on-column separation procedure fosters rapid analysis as required in emergency situations since each individual sample can be handled within 2.5h, and leads to a significant decrease in labor...

  17. Flurbiprofen benzyl nitrate (NBS-242) inhibits the growth of A-431 human epidermoid carcinoma cells and targets β-catenin

    Science.gov (United States)

    Nath, Niharika; Liu, Xiaoping; Jacobs, Lloydine; Kashfi, Khosrow

    2013-01-01

    Background The Wnt/β-catenin/T cell factor (TCF) signaling pathway is important in the development of nonmelanoma skin cancers (NMSCs). Nitric-oxide-releasing nonsteroidal anti-inflammatory drugs (NO-NSAIDs) are chemopreventive agents consisting of a traditional NSAID attached to an NO-releasing moiety through a chemical spacer. Previously we showed that an aromatic spacer enhanced the potency of a particular NO-NSAID compared to an aliphatic spacer. Methods We synthesized an NO-releasing NSAID with an aromatic spacer (flurbiprofen benzyl nitrate, NBS-242), and using the human skin cancer cell line A-431, we evaluated its effects on cell kinetics, Wnt/β-catenin, cyclin D1, and caspase-3. Results NBS-242 inhibited the growth of A-431 cancer cells, being ~15-fold more potent than flurbiprofen and up to 5-fold more potent than NO-flurbiprofen with an aliphatic spacer, the half maximal inhibitory concentrations (IC50) for growth inhibition being 60 ± 4 μM, 320 ± 20 μM, and 880 ± 65 μM for NBS-242, NO-flurbiprofen, and flurbiprofen, respectively. This effect was associated with inhibition of proliferation, accumulation of cells in the G0/G1 phase of the cell cycle, and an increase in apoptotic cell population. NBS-242 cleaved β-catenin both in the cytoplasm and the nucleus of A-431 cells. NBS-242 activated caspase-3 whose activation was reflected in the cleavage of procaspase-3. To test the functional consequence of β-catenin cleavage, we determined the expression of cyclin D1, a Wnt-response gene. NBS-242 reduced cyclin D1 levels in a concentration dependent manner. Conclusion These findings establish a strong inhibitory effect of NBS-242 in A-431 human epidermoid carcinoma cells. NBS-242 modulates parameters that are important in determining cellular mass. PMID:23690679

  18. Project C-018H, 242-A Evaporator/PUREX Plant Process Condensate Treatment Facility, functional design criteria. Revision 3

    International Nuclear Information System (INIS)

    This document provides the Functional Design Criteria (FDC) for Project C-018H, the 242-A Evaporator and Plutonium-Uranium Extraction (PUREX) Plant Condensate Treatment Facility (Also referred to as the 200 Area Effluent Treatment Facility [ETF]). The project will provide the facilities to treat and dispose of the 242-A Evaporator process condensate (PC), the Plutonium-Uranium Extraction (PUREX) Plant process condensate (PDD), and the PUREX Plant ammonia scrubber distillate (ASD)

  19. Functional design criteria for the 242-A evaporator and PUREX [Plutonium-Uranium Extraction] Plant condensate interim retention basin

    International Nuclear Information System (INIS)

    This document contains the functional design criteria for a 26- million-gallon retention basin and 10 million gallons of temporary storage tanks. The basin and tanks will be used to store 242-A Evaporator process condensate, the Plutonium-Uranium Extraction (PUREX) Plant process distillate discharge stream, and the PUREX Plant ammonia scrubber distillate stream. Completion of the project will allow both the 242-A Evaporator and the PUREX Plant to restart. 4 refs

  20. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  1. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level; Etude experimentale des biocinetiques de l`americium-241 chez le homard homarus gammarus. Analyse des mecanismes d`accumulation et de detoxication au niveau subcellulaire

    Energy Technology Data Exchange (ETDEWEB)

    Paquet, F.

    1991-12-01

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref.

  2. Nano-cerium vanadate: A novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Chayan; Dudwadkar, Nilesh [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tripathi, Subhash Chandra, E-mail: sctri001@gmail.com [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Gandhi, Pritam Maniklal [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Grover, Vinita [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kaushik, Chetan Prakash [Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tyagi, Avesh Kumar, E-mail: aktyagi@barc.gov.in [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2014-09-15

    Highlights: • Template free, low temperature synthesis of CeVO{sub 4} nanopowders. • Thermodynamically and kinetically favourable uptake of Am(III) and U(VI) exhibited. • K{sub d} and ΔG° values for Am(III) and U(VI) uptake in pH 1–6 are reported. • Interdiffusion coefficients and zeta potential values in pH 1–6 are reported. • Possible application in low level aqueous nuclear waste remediation. - Abstract: Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides {sup 233}U (4.82 MeV α) and {sup 241}Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3 h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr{sup 2+}, Ru{sup 3+}, Fe{sup 3+}, etc., in the uptake process indicated CeVO{sub 4} nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  3. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  4. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  5. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea.

    Science.gov (United States)

    Hunt, G J

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f1 values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Carastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 h samples of urine and faeces. Urine samples indicated f1 values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7 x 10(-4) with an arithmetic mean in the range (2-3) x 10(-4), and for americium up to 2.6 x 10(-4) with an arithmetic mean of 1.2 x 10(-4). Limited data based on volunteers eating cockles from the Solway suggest that f1 values for americium may be greater at distance from Sellafield. The measured values compare with 5 x 10(-4) used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f1 value in the region of 0.2, twice the value currently used by ICRP. For 137Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f1 = 1.0. Technetium-99 gave f1 values up to about 0.6, in reasonable conformity with the ICRP value of 0.5.

  6. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, G.J. [CEFAS Laboratory, Lowestoft, Suffolk NR33 0HT (United Kingdom)

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f{sub L} values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Cerastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 samples of urine and faeces. Urine samples indicated f{sub L} values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7x10{sup -4} with an arithmetic mean in the range (2-3)x10{sup -4}, and for americium up to 2.6x10{sup -4} with an arithmetic mean of 1.2x10{sup -4}. Limited data based on volunteers eating cockles from the Solway suggest that f{sub L} values for americium may be greater at distance from Sellafield. The measured values compare with 5x10{sup -4} used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f{sub L} value in the region of 0.2, twice the value currently used by ICRP. For {sup 137}Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f{sub L}=1.0. Technetium-99 gave f{sub L} values up to about 0.6, in reasonable conformity with the ICRP value of 0.5. (author)

  7. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  8. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level; Etude experimentale des biocinetiques de l`americium-241 chez le homard homarus gammarus. Analyse des mecanismes d`accumulation et de detoxication au niveau subcellulaire

    Energy Technology Data Exchange (ETDEWEB)

    Paquet, F.

    1993-01-01

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of {sup 241} Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention.

  9. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  10. 242-A Evaporator/Liquid Effluent Retention Facility data quality objectives

    Energy Technology Data Exchange (ETDEWEB)

    Von Bargen, B.H.

    1994-09-29

    The purpose of data quality objectives (DQO) is to determine the most cost effective methods of gathering the essential data necessary to make decisions to support successful operation of the facility. The essential data is defined by such information as sample amount, sample location, required analyses, and how sampling and analyses are performed. Successful operation is defined as meeting the campaign objectives while operating within established requirements. This DQO document addresses that portion of the system from 242-A Evaporator candidate feed tanks through discharge of process condensate to the Liquid Effluent Retention of Facility (LERF). Later revisions will incorporate and integrate the entire system, including the Effluent Treatment Facility (ETF).

  11. Pattern of leukemias : a ten-year incidence study of 242 cases.

    Directory of Open Access Journals (Sweden)

    D«SQ»Costa G

    1989-10-01

    Full Text Available This paper presents an analysis of data collected from 242 cases of acute and chronic leukemia observed during a 10-year period. The incidence of childhood leukemia was 26.45%. In the present series, it was 35.95% for ALL, 21.9% AML, 38.4% CML and 2.89% CLL. The incidences of ALL and CML were found comparable to other series from Bombay. The geographical variations in the pattern of leukemias as observed in India are discussed.

  12. Directed mutagenesis of the strongly conserved aspartate 242 in the beta-subunit of Escherichia coli proton-ATPase.

    Science.gov (United States)

    Al-Shawi, M K; Parsonage, D; Senior, A E

    1988-12-25

    Oligonucleotide-directed mutagenesis was used to substitute Asn or Val for residue Asp-242 in the beta-subunit of Escherichia coli F1-ATPase. Asp-242 is strongly conserved in beta-subunits of F1-ATPase enzymes, in a region of sequence which shows homology with numerous nucleotide-binding proteins. By analogy with adenylate kinase (Fry, D.C., Kuby, S.A., and Mildvan, A.S. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 907-911), beta-Asp-242 of F1-ATPase might participate in catalysis through electrostatic effects on the substrate Mg2+ or through hydrogen bonding to the substrate(s); an acid-base catalytic role is also plausible. The substitutions Asn and Val were chosen to affect the charge, hydrogen-bonding ability, and hydrophobicity of residue beta-Asp-242. Both mutations significantly impaired oxidative phosphorylation rates in vivo and membrane ATPase and ATP-driven proton-pumping activities in vitro. Asn-242 was more detrimental than Val-242. Purified soluble mutant F1-ATPases had normal molecular size and subunit composition, and displayed 7% (beta-Asn-242) and 17% (beta-Val-242) of normal specific Mg-ATPase activity. The relative MgATPase activities of both mutant enzymes showed similar pH dependence to normal. Relative MgATPase and CaATPase activities of normal and mutant enzymes were compared at widely varied pMg and pCa. The mutations had little effect on KM MgATP, but KM CaATP was reduced. The data showed that the carboxyl side-chain of beta-Asp-242 is not involved in catalysis either as a general acid-base catalyst or through direct involvement in any protonation/deprotonation-linked mechanism, nor is it likely to be directly involved in liganding to substrate Mg2+ during the reaction. Specificity constants (kcat/KM) for MgATP and CaATP were reduced in both mutant enzymes, showing that the mutations destabilized interactions between the catalytic nucleotide-binding domain and the transition state.

  13. Tissue expression of the tumour associated antigen CA242 in benign and malignant pancreatic lesions. A comparison with CA 50 and CA 19-9.

    OpenAIRE

    Haglund, C.; Lindgren, J.; Roberts, P. J.; Kuusela, P.; Nordling, S.

    1989-01-01

    The expression of a novel tumour associated antigen CA 242, defined by the monoclonal antibody C 242, was studied by immunoperoxidase staining in formalin-fixed, paraffin-embedded tissue sections from normal pancreata, pancreata with pancreatitis and benign and malignant pancreatic neoplasms. The antigenic determinant of the C 242 antibody is a sialylated carbohydrate structure, related but chemically different from tumour marker antigens CA 19-9 and CA 50. Thirty-eight of 41 (93%) well to mo...

  14. Combined detection of preoperative serum CEA, CA19-9 and CA242 improve prognostic prediction of surgically treated colorectal cancer patients

    OpenAIRE

    Wang, Jingtao; Xiao WANG; Yu, Fudong; Chen, Jian; Zhao, Senlin; Zhang, Dongyuan; YU, Yang; Liu, Xisheng; Tang, Huamei; Peng, Zhihai

    2015-01-01

    We assessed the prognostic significance of preoperative serum carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9) and carbohydrate antigen 242 (CA242) levels in surgically treated colorectal cancer patients. The relationship of preoperative serum CEA, CA19-9 and CA242 levels with disease characteristics was investigated in 310 patients. Correlation between tumor markers was investigated using Pearson correlation test. Univariate and multivariate survival analyses were used to s...

  15. The diagnostic value of joint detection of serum CA19-9, CA125 and CA242 for cholangiocarcinoma

    Institute of Scientific and Technical Information of China (English)

    Cui Da-Peng; Han Lei; Liu Zhen-Xian; Yang He; Zhang Ying-Chun

    2016-01-01

    Objective:To study the diagnostic value of joint detection of serum CA19-9, CA125 and CA242 for cholangiocarcinoma.Methods:A total of 35 patients with cholangiocarcinoma who received surgical resection in our hospital were selected as malignant group, 30 patients with cholelithiasis who received surgical resection in our hospital during the same period were selected as benign group, serum samples were collected before surgery to determine CA19-9, CA125 and CA242 content, and cholangiocarcinoma tissue and normal bile duct tissue were collected after surgery to determine the content of proliferation and invasion molecules. Results:Serum CA19-9, CA125 and CA242 levels of malignant group were significantly higher than those of control group; PROX-1, Ki-67, Bcl-2, Bad, Gab1, LOXL2, TRPM7 and CXCL12 levels in cholangiocarcinoma tissue were higher than those in benign bile duct tissue, and E-cadherin level was lower than that in benign bile duct tissue; serum CA19-9, CA125 and CA242 levels were positively correlated with PROX-1, Ki-67, Bcl-2, Bad, Gab1, LOXL2, TRPM7 and CXCL12 levels, and negatively correlated with E-cadherin level.Conclusion:Joint detection of serum CA19-9, CA125 and CA242 can not only provide reference for the diagnosis of cholangiocarcinoma, but can also provide basis for the evaluation of proliferation, invasion and other malignant biological behaviors.

  16. Measurement of the neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu

    International Nuclear Information System (INIS)

    The neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu have been measured from 0.1 eV to 100 keV using the Rensselaer Intense Neutron Spectrometer. Fission areas and widths were determined for several resolved low-energy resonances of /sup 242/Cm and /sup 238/Pu. The fission resonance integrals for /sup 242/Cm and /sup 238/Pu were found to be 12.9 +- 0.7 and 15.9 +- 0.6 b, respectively. The gross structure observed in the unresolved energy region of the /sup 242/Cm and /sup 238/Pu fission cross sections is suggestive of intermediate structure, and is consistent with the second well lying 2 to 3 MeV above the first well. The ENDF/B-V library fission cross section of /sup 238/Pu is, in general, not in good agreement with this measurement and a new evaluation is recommended. This is the first reported fission measurement of /sup 242/Cm in the 0.1-eV through 100-keV energy range

  17. Sensitivity and specificity of CA242 in gastro-intestinal cancer. A comparison with CEA, CA50 and CA 19-9.

    OpenAIRE

    Nilsson, O; Johansson, C.; Glimelius, B.; Persson, B.; Nørgaard-Pedersen, B.; Andrén-Sandberg, A.; Lindholm, L.

    1992-01-01

    A serological assay for the quantitative determination of the novel tumour-associated epitope CA242 was developed and used for determination of sensitivity and specificity of CA242 in gastrointestinal cancer. The CA242 assay showed a better tumour specificity than CA50 (and CA 19-9). This was most noticeable in benign hepatobiliary disease. The sensitivity at 90% specificity cut-off level was approximately three times higher for CA242 compared to CA50 in colo-rectal cancer Dukes A, B and C, w...

  18. 232Th、233U、238Pu、240Pu、242Pu、241Am、242Cm、243Cm和244Cm的裂变释放热能研究%Thermal Energy Released in Fission of 232 Th,233 U,238 Pu, 240 Pu,242 Pu,241 Am,242 Cm,243 Cm and 244 Cm

    Institute of Scientific and Technical Information of China (English)

    赵艳飞; 马续波; 陈义学

    2013-01-01

    In the nuclear reactor design ,the precise calculation of thermal fission energy is of great significance .In the pressurized water reactor ,high energy neutron-induced fission rarely occurs ,the isotopes including 233 U ,241 Am and 243 Cm are mostly induced by thermal neutrons ,while the other isotopes such as 232Th ,238Pu ,240Pu ,242Pu ,242Cm and 244 Cm are by fast neutron . In order to carry out this work , the nuclear data extracted from the latest evaluated nuclear data file (ENDF/B-Ⅶ ) were adopted ,and the energy-conservation law for the calculation of total fission energy were used , meanw hile ,with the consideration of capture energy and the correction of βand γ ,the thermal fission energy of nine isotopes was obtained .Compared with the data excerpted from IAEA issued WIMS-D database ,the results are reasonable .The thermal fission energy and its uncertainties of the nine isotopes are :(193.939 ± 0.176) MeV for 232 Th , (200.063 ± 0.084) MeV for 233 U ,(208.786 ± 1.133 ) MeV for 238 Pu ,(211.266 ± 0.220 ) MeV for 240 Pu ,(213.862 ± 0.299 ) MeV for 242 Pu ,(215.077 ± 0.210 ) MeV for 241 Am ,(218.821 ± 0.159) MeV for 242Cm ,(218.525 ± 0.388) MeV for 243Cm ,and (220.067 ± 0.131) MeV for 244 Cm ,respectively .%在核反应堆设计中,对每次裂变释放热能进行精确计算具有重要意义。在压水堆内,高能中子诱发核裂变份额很小,233 U、241 Am、243 Cm主要由热中子诱发裂变,232 T h、238 Pu、240 Pu、242 Pu、242 Cm、244 Cm主要由快中子诱发裂变。本文采用最新的核评价数据库 ENDF/B-Ⅶ,利用质量守恒法计算裂变释放总能,同时研究了中微子带走的能量,中子俘获能及β、γ修正项,最终给出了9种核素裂变释放热能。与IAEA颁布的WIMS-D格式数据库中的裂变释放热能数据的对比表明,本文所用方法计算结果合理。9种核素每次裂变释放热能分别为:232 Th ,(193.939±0.176) MeV ;233 U ,(200.063

  19. Process control plan for 242-A Evaporator Campaign 95-1

    Energy Technology Data Exchange (ETDEWEB)

    Le, E.Q.; Guthrie, M.D.

    1995-05-18

    The wastes from tanks 106-AP, 107-AP, and 106-AW have been selected to be candidate feed wastes for Evaporator Campaign 95-1. The wastes in tank 106-AP and 107-AP are primarily from B-Plant strontium processing and PUREX neutralized cladding removal, respectively. The waste in tank 106-AW originated primarily from the partially concentrated product from 242-A Evaporator Campaign 94-2. Approximately 8.67 million liters of waste from these tanks will be transferred to tank 102-AW during the campaign. Tank 102-AW is the dedicated waste feed tank for the evaporator and currently contains 647,000 liters of processable waste. The purpose of the 242-A Evaporator Campaign 95-1 Process Control Plan (hereafter referred to as PCP) is to certify that the wastes in tanks 106-AP, 107-AP, 102-AW, and 106-AW are acceptable for processing through evaporator and provide a general description of process strategies and activities which will take place during Campaign 95-1. The PCP also summarizes and presents a comprehensive characterization of the wastes in these tanks.

  20. Direct Detection of Pu-242 with a Metallic Magnetic Calorimeter Gamma-Ray Detector

    Science.gov (United States)

    Bates, C.; Pies, C.; Kempf, S.; Hengstler, D.; Fleischmann, A.; Gastaldo, L.; Enss, C.; Friedrich, S.

    2016-07-01

    Cryogenic high-resolution γ -ray detectors can improve the accuracy of non-destructive assay (NDA) of nuclear materials in cases where conventional high-purity germanium detectors are limited by line overlap or by the Compton background. We have improved the performance of gamma detectors based on metallic magnetic calorimeters (MMCs) by separating the 0.5 × 2 × 0.25 mm3 Au absorber from the Au:Er sensor with sixteen 30-\\upmu m-diameter Au posts. This ensures that the entire γ -ray energy thermalizes in the absorber before heating the Au:Er sensor, and improves the energy resolution at 35 mK to as low as 90 eV FWHM at 60 keV. This energy resolution enables the direct detection of γ -rays from Pu-242, an isotope that cannot be measured by traditional NDA and whose concentration is therefore inferred through correlations with other Pu isotopes. The Pu-242 concentration of 11.11 ± 0.42 % measured by NDA with MMCs agrees with mass spectrometry results and exceeds the accuracy of correlation measurements.

  1. Tumour associated antigen CA-50, CA-242 immunoradiometric assay (IRMA) in genitourinary malignancy and gastrointestinal carcinoma early diagnosis

    International Nuclear Information System (INIS)

    Tumour markers CA-50 and CA-242 were measured by immunometric assay (IRMA) to investigate their usefulness in the diagnosis of cancer of the pancreas, biliary tract, liver, breast, lung, gastrointestinal and genitourinary systems. The cutoff points, derived from studies on normal subjects and those with proven benign disease, were 20 u/ml and 12 u/ml for CA-50 and CA-242 respectively. Both markers were found to be generally useful with significant differences between malignant and non malignant disease. The highest positive rates, were found in cancers of the pancreas and gall bladder. The overall rate of false positives was low. It is concluded that measurements of CA-50 and CA-242 are useful in the detection of malignancy, particularly of the pancreas and biliary tract. 2 figs, 2 tabs

  2. Tumor markers CA19-9, CA242 and CEA in the diagnosis of pancreatic cancer: a meta-analysis

    OpenAIRE

    Zhang, Yimin; Yang, Jun; Li, Hongjuan; WU, YIHUA; Zhang, Honghe; Chen, Wenhu

    2015-01-01

    Background: Pancreatic cancer has the worst prognosis and early detection is crucial for improving patient prognosis. Therefore, we performed a meta-analysis to evaluate and compare the sensitivity and specificity of single test of CA19-9, CA242, and CEA, as well as combination test in pancreatic cancer detection. Methods: We searched PubMed, Embase, Medline, and Wanfang databases for studies that evaluated the diagnostic validity of CA19-9, CA242, and CEA between January 1990 and September 2...

  3. 17q24.2 microdeletions: a new syndromal entity with intellectual disability, truncal obesity, mood swings and hallucinations

    OpenAIRE

    Vergult, Sarah; Dauber, Andrew; Chiaie, Barbara Delle; Van Oudenhove, Elke; Simon, Marleen; Rihani, Ali; Loeys, Bart; Hirschhorn, Joel; Pfotenhauer, Jean; Phillips, John A.; Mohammed, Shehla; Ogilvie, Caroline; Crolla, John; Mortier, Geert; Menten, Björn

    2011-01-01

    Although microdeletions of the long arm of chromosome 17 are being reported with increasing frequency, deletions of chromosome band 17q24.2 are rare. Here we report four patients with a microdeletion encompassing chromosome band 17q24.2 with a smallest region of overlap of 713 kb containing five Refseq genes and one miRNA. The patients share the phenotypic characteristics, such as intellectual disability (4/4), speech delay (4/4), truncal obesity (4/4), seizures (2/4), hearing loss (3/4) and ...

  4. THE FLAMMABILITY ANALYSIS AND TIME TO REACH LOWER FLAMMABILITY LIMIT CALCULATIONS ON THE WASTE EVAPORATION AT 242-A EVAPORATOR

    Energy Technology Data Exchange (ETDEWEB)

    HU TA

    2007-10-31

    This document describes the analysis of the waste evaporation process on the flammability behavior. The evaluation calculates the gas generation rate, time to reach 25% and 100% of the lower flammability limit (LFL), and minimum ventilation rates for the 242-A Evaporator facility during the normal evaporation process and when vacuum is lost. This analysis performs flammability calculations on the waste currently within all 28 double-shell tanks (DST) under various evaporation process conditions to provide a wide spectrum of possible flammable gas behavior. The results of this analysis are used to support flammable gas control decisions and support and upgrade to Documented Safety Analysis for the 242-A Evaporator.

  5. Flurbiprofen benzyl nitrate (NBS-242 inhibits the growth of A-431 human epidermoid carcinoma cells and targets ß-catenin

    Directory of Open Access Journals (Sweden)

    Nath N

    2013-05-01

    Full Text Available Niharika Nath,1,2 Xiaoping Liu,3 Lloydine Jacobs,1 Khosrow Kashfi1,3 1Department of Physiology, Pharmacology, and Neuroscience, Sophie Davis School of Biomedical Education, City University of New York Medical School, New York, NY, USA; 2Department of Life Sciences, New York Institute of Technology, New York, NY, USA; 3Division of Cancer Prevention, Department of Medicine, Stony Brook University, Stony Brook, NY, USA Background: The Wnt/ß-catenin/T cell factor (TCF signaling pathway is important in the development of nonmelanoma skin cancers (NMSCs. Nitric-oxide-releasing nonsteroidal anti-inflammatory drugs (NO-NSAIDs are chemopreventive agents consisting of a traditional NSAID attached to an NO-releasing moiety through a chemical spacer. Previously we showed that an aromatic spacer enhanced the potency of a particular NO-NSAID compared to an aliphatic spacer. Methods: We synthesized an NO-releasing NSAID with an aromatic spacer (flurbiprofen benzyl nitrate, NBS-242, and using the human skin cancer cell line A-431, we evaluated its effects on cell kinetics, Wnt/ß-catenin, cyclin D1, and caspase-3. Results: NBS-242 inhibited the growth of A-431 cancer cells, being ~15-fold more potent than flurbiprofen and up to 5-fold more potent than NO-flurbiprofen with an aliphatic spacer, the half maximal inhibitory concentrations (IC50 for growth inhibition being 60 ± 4 µM, 320 ± 20 µM, and 880 ± 65 µM for NBS-242, NO-flurbiprofen, and flurbiprofen, respectively. This effect was associated with inhibition of proliferation, accumulation of cells in the G0/G1 phase of the cell cycle, and an increase in apoptotic cell population. NBS-242 cleaved ß-catenin both in the cytoplasm and the nucleus of A-431 cells. NBS-242 activated caspase-3 whose activation was reflected in the cleavage of procaspase-3. To test the functional consequence of ß-catenin cleavage, we determined the expression of cyclin D1, a Wnt-response gene. NBS-242 reduced cyclin D1 levels

  6. Measurement of the $^{240,242}$Pu(n,f) cross section at the CERN n_TOF facility

    CERN Document Server

    Tsinganis, A; Guerrero, C; Colonna, N; Calviani, M; Vlastou, R; Andriamonje, S; Vlachoudis, V; Gunsing, F; Massimi, C; Altstadt, S; Andrzejewski, J; Audouin, L; Barbagallo, M; Bécares, V; Becvár, F; Belloni, F; Billowes, J; Boccone, V; Bosnar, D; Brugger, M; Calviño, F; Cano-Ott, D; Carrapiço, C; Cerutti, F; Chin, M; Cortés, G; Cortés-Giraldo, M A; Diakaki, M; Domingo-Pardo, C; Duran, I; Dressler, R; Dzysiuk, N; Eleftheriadis, C; Ferrari, A; Fraval, K; Ganesan, S; García, A R; Giubrone, G; Gómez-Hornillos, M B; Gonçalves, I F; González-Romero, E; Griesmayer, E; Gurusamy, P; Hernández-Prieto, A; Jenkins, D G; Jericha, E; Kadi, Y; Käppeler, F; Karadimos, D; Kivel, N; Koehler, P; Kokkoris, M; Krtiˇcka, M; Kroll, J; Lampoudis, C; Langer, C; Leal-Cidoncha, E; Lederer, C; Leeb, H; Leong, L S; Losito, R; Mallick, A; Manousos, A; Marganiec, J; Martínez, T; Mastinu, P F; Mastromarco, M; Meaze, M; Mendoza, E; Mengoni, A; Milazzo, P M; Mingrone, F; Mirea, M; Mondalaers, W; Paradela, C; Pavlik, A; Perkowski, J; Plompen, A; Praena, J; Quesada, J M; Rauscher, T; Reifarth, R; Riego, A; Robles, M S; Roman, F; Rubbia, C; Sabaté-Gilarte, M; Sarmento, R; Saxena, A; Schillebeeckx, P; Schmidt, S; Schumann, D; Tagliente, G; Tain, J L; Tarrío, D; Tassan-Got, L; Valenta, S; Vannini, G; Variale, V; Vaz, P; Ventura, A; Versaci, R; Vermeulen, M J; Wallner, A; Ware, T; Weigand, M; Weiss, C; Wright, T; Zugec, P

    2014-01-01

    Knowledge of neutron cross sections of various plutonium isotopes and other minor actinides is crucial for the design of advanced nuclear systems. The $^{240 , 242}$Pu(n,f) cross sections were measured at the CERN n_TOF facility, taking advantage of the wide energy range (from thermal to GeV) and the high instantaneous f ux of the neutron beam. In this work, preliminary results for $^{242}$Pu are presented along with a theoretical cross section calculation performed with the EMPIRE code.

  7. Inhaled americium dioxide

    International Nuclear Information System (INIS)

    This project includes experiments to determine the effects of Zn-DTPA therapy on the retention, translocation and biological effects of inhaled 241AmO2. Beagle dogs that received inhalation exposure to 241AmO2 developed leukopenia, clincial chemistry changes associated with hepatocellular damage, and were euthanized due to respiratory insufficiency caused by radiation pneumonitis 120 to 131 days after pulmonary deposition of 22 to 65 μCi 241Am. Another group of dogs that received inhalation exposure to 241AmO2 and were treated daily with Zn-DTPA had initial pulmonary deposition of 19 to 26 μCi 241Am. These dogs did not develop respiratory insufficiency, and hematologic and clinical chemistry changes were less severe than in the non-DTPA-treated dogs

  8. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: wcruz@ipen.gob.pe [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos

    2013-07-01

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  9. Partitioning studies in China and the separation of americium and fission product rare earths with dialkyl phosphinic acid and its thio-substituted derivatives

    International Nuclear Information System (INIS)

    Studies on the TRPO extractions process for recovering actinides from highly active waste (HAW) and its application to the pretreatment of Chinese HAW are described. The removal of Sr by di-cyclohexyl 18 crown 6 and the removal of Cs by spherical titanium ferrous hexa-cyanate from acidic waste are also described. Results of the extraction of trivalent americium and fission product rare earths (FPREs) by dialkyl-phosphinic, dialkyl-mono-thio-phosphinic and dialkyl-di-thio-phosphinic acids are reported. Dialkyl-thio-phosphinic acid (commercial product Cyanex 301, alkyl =2, 4, 4-methyl-pentyl) shows very high selectivity towards Am. Using 1M Cyanex 301 -kerosene as extractant, 99.9 % Am can be separated from 0.5M(Pr+Nd)(NO3)3 solution with 3-4 extraction stages and 3-4 scrubbing stages. (authors)

  10. Theoretical and experimental study of the bio-geochemical behaviour of americium 241 in simplified rhizosphere conditions. Application to a calcareous agricultural soil

    International Nuclear Information System (INIS)

    Americium 241, is one of the most radio-toxic contaminant produced during the nuclear fuel cycle. It can be found in all environmental compartments, in particular the soils. The main goals of this study are to identify, quantify and model the effect of the main factors controlling the mobility of 241Am in the rhizosphere and the agricultural soils. The physico-chemical parameters of the soil and of the soil solution, the potential role of microorganisms on the sorption-desorption processes, and the speciation of americium in solution have been more particularly studied. 241Am remobilization has been studied at the laboratory using leaching experiments performed in controlled conditions on reworked calcareous soils artificially contaminated with 241Am. The soil samples have been washed out in different hydrodynamic conditions by solutions with various compositions. The eluted solution has been analyzed (pH, conductivity, ionic composition, Fetot, organic acids, 241Am) and its bacterial biomass content too. The overall results indicate that 241Am remobilization is contrasted and strongly linked with the condition under study (pH, ionic strength, glucose and/or citrate concentration). Therefore, a solution in equilibrium with the soil or containing small exudate concentrations (10-4 M) re-mobilizes only a very small part of the americium fixed on the solid phase. The desorption of 241Am corresponds to a solid/liquid coefficient of partition (Kd) of about 105 L.kg-1. A significant addition of glucose induces an important dissolution of soil carbonates by the indirect action of microorganisms, but does not significantly favor the 241Am remobilization. On the other hand, the presence of strong citrate concentrations (≥ 10-2 M) allows 300 to 10000 time greater re-mobilizations by the complexing of 241Am released after the dissolution of the carrying phases. Finally, the colloidal transport of 241Am has been systematically observed in a limited but significant extend and

  11. MR imaging of musculoskeletal tumors and tumor mimickers with intravenous gadolinium: experience with 242 patients

    International Nuclear Information System (INIS)

    Purpose. This pictorial essay reviews our experience with MR scans with gadolinium in patients with musculoskeletal tumors and tumor mimickers. Design. Review of 242 MR scans obtained in the initial evaluation of a possible primary musculoskeletal neoplasm. All scans included a T1-weighted, fat-suppressed sequence following intravenous administration of gadolinium. Results. MR scans with gadolinium did not contribute to differential diagnosis or patient management in 89% of the patients in this series. However, intravenous gadolinium did assist in guiding the biopsy of bulky lesions and evaluating treated tumor beds for possible recurrence. MR scans with gadolinium were sometimes helpful when the differential diagnosis included synovitis, Morton's neuroma or intramuscular myxoma, and when it was important to differentiate cystic from solid lesions. Conclusions. Routine use of gadolinium in every initial MR examination of a possible musculoskeletal mass is not warranted. However, there are appropriate selected indications for gadolinium administration as outlined above. (orig.). With 19 figs., 1 tab

  12. Fission cross section measurement of Am-242m using lead slowing-down spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Kai, Tetsuya; Kobayashi, Katsuhei; Yamamoto, Shuji; Fujita, Yoshiaki [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst.; Kimura, Itsuro; Ohkawachi, Yasushi; Wakabayashi, Toshio

    1998-03-01

    By making use of double fission chamber and lead slowing-down spectrometer coupled to an electron linear accelerator, fission cross section for the {sup 242m}Am(n,f) reaction has been measured relative to that for the {sup 235}U(n,f) reaction in the energy range from 0.1 eV to 10 keV. The measured result was compared with the evaluated nuclear data appeared in ENDF/B-VI and JENDL-3.2, of which evaluated data were broadened by the energy resolution function of the spectrometer. Although the JENDL-3.2 data seem to be a little smaller than the present measurement, good agreement can be seen in the general shape and the absolute values. The ENDF/B-VI data are larger more than 50 % than the present values above 3 eV. (author)

  13. Gamma-ray studies of the spontaneous fission of 242Pu and 252Cr using gammasphere

    International Nuclear Information System (INIS)

    The authors report on the new results on 242Pu and 252Cf spontaneous fission gamma-rays with emphasis on the dependence of spin distributions on numbers of neutrons emitted. The analysis has concentrated first on extracting relative intensities of ground rotational transitions as a function of number of neutrons emitted. open-quotes Cold fissionclose quotes, or zero-neutron fission, is observed in a number of fissioning systems. Some isotopic series show a trend of decreasing fragment average spin with increasing numbers of neutrons emitted, contrary to the initial expectations of a simple quantal model based on neck thickness expected at scission. A simple open-quotes atomic orbitalclose quotes model plus Coulomb excitation is compared with the data. Preliminary results from an April 1994 run using 36 Ge detectors in Early Implementation of Gammasphere coupled with 4 neutron detectors and 1 X-ray detector are shown

  14. MR imaging of musculoskeletal tumors and tumor mimickers with intravenous gadolinium: experience with 242 patients

    Energy Technology Data Exchange (ETDEWEB)

    May, D.A. [Department of Radiology, Wilford Hall USAF Medical Center, San Antonio, TX (United States)]|[WHMC/PSRD, Lackland AFB, TX (United States); Good, R.B. [Department of Radiology, Wilford Hall USAF Medical Center, San Antonio, TX (United States); Smith, D.K. [Department of Radiology, Wilford Hall USAF Medical Center, San Antonio, TX (United States); Parsons, T.W. [Department of Orthopaedic Surgery, Wilford Hall USAF Medical Center, San Antonio, TX (United States)

    1997-01-01

    Purpose. This pictorial essay reviews our experience with MR scans with gadolinium in patients with musculoskeletal tumors and tumor mimickers. Design. Review of 242 MR scans obtained in the initial evaluation of a possible primary musculoskeletal neoplasm. All scans included a T1-weighted, fat-suppressed sequence following intravenous administration of gadolinium. Results. MR scans with gadolinium did not contribute to differential diagnosis or patient management in 89% of the patients in this series. However, intravenous gadolinium did assist in guiding the biopsy of bulky lesions and evaluating treated tumor beds for possible recurrence. MR scans with gadolinium were sometimes helpful when the differential diagnosis included synovitis, Morton`s neuroma or intramuscular myxoma, and when it was important to differentiate cystic from solid lesions. Conclusions. Routine use of gadolinium in every initial MR examination of a possible musculoskeletal mass is not warranted. However, there are appropriate selected indications for gadolinium administration as outlined above. (orig.). With 19 figs., 1 tab.

  15. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  16. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 5

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 5) outlines the standards and requirements for the Fire Protection and Packaging and Transportation sections.

  17. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Document (S/RID) is contained in multiple volumes. This document (Volume 2) presents the standards and requirements for the following sections: Quality Assurance, Training and Qualification, Emergency Planning and Preparedness, and Construction.

  18. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 2

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Document (S/RID) is contained in multiple volumes. This document (Volume 2) presents the standards and requirements for the following sections: Quality Assurance, Training and Qualification, Emergency Planning and Preparedness, and Construction

  19. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID)

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 3) presents the standards and requirements for the following sections: Safeguards and Security, Engineering Design, and Maintenance

  20. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 4

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 4) presents the standards and requirements for the following sections: Radiation Protection and Operations

  1. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 4

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 4) presents the standards and requirements for the following sections: Radiation Protection and Operations.

  2. 17 CFR 242.603 - Distribution, consolidation, and display of information with respect to quotations for and...

    Science.gov (United States)

    2010-04-01

    ..., and display of information with respect to quotations for and transactions in NMS stocks. 242.603...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... with respect to quotations for and transactions in NMS stocks. (a) Distribution of information. (1)...

  3. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID)

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 3) presents the standards and requirements for the following sections: Safeguards and Security, Engineering Design, and Maintenance.

  4. High level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 6

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 6) outlines the standards and requirements for the sections on: Environmental Restoration and Waste Management, Research and Development and Experimental Activities, and Nuclear Safety.

  5. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 5

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 5) outlines the standards and requirements for the Fire Protection and Packaging and Transportation sections

  6. High level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 6

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 6) outlines the standards and requirements for the sections on: Environmental Restoration and Waste Management, Research and Development and Experimental Activities, and Nuclear Safety

  7. Combination of cetuximab and PP242 synergistically suppress the progression of wild-type KRAS colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Cheng L

    2015-11-01

    Full Text Available Lei Cheng,1,* Zuguang Xia,2,3,* Xinyu Bian,1 Guangchao Li,4 Jing Hu,1 Ya Cao,5 Qing Wang,1 Xiaoping Qian1 1Comprehensive Cancer Center of Drum-Tower Hospital, Medical School of Nanjing University, Clinical Cancer Institute of Nanjing University, Nanjing, 2Department of Medical Oncology, Fudan University Shanghai Cancer Center, Shanghai, 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 4School of Bioscience and Bioengineering, South China University of Technology, Guangzhou, Guangdong, 5Department of Biological Science and Technology and State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: Mammalian target of rapamycin (mTOR has been shown to be overactive in human colorectal cancer, but the first-generation mTOR inhibitor, rapamycin, has failed to show clinical efficacy against colorectal cancer. On the other hand, although the second-generation mTOR inhibitor, PP242, has exerted substantial efficacy, it was revealed that independent inhibition by PP242 was transient, which could lead to positive-feedback loop to EGFR. Using wild-type KRAS colorectal cancer cells as models, we investigate the treatment efficacy of a widely used anti-EGFR monoclonal antibody, cetuximab, and PP242, alone or in combination in vitro and in vivo. Results of cell viability assays confirmed the synergistic inhibitory effect of PP242 and cetuximab on the survival of Caco-2 and HT-29 cells. Moreover, the ability of cancer-cell invasion and proliferation was also significantly inhibited by the combination therapy when compared with cetuximab or PP242 alone. Interestingly, the percentage of CD44-positive cancer cells was substantially decreased by the combination therapy in comparison with PP242 alone through fluorescence-activated cell sorting. The growth of cancer stem-like cell spheres in vitro was

  8. Comparison of a new tumour marker CA 242 with CA 19-9, CA 50 and carcinoembryonic antigen (CEA) in digestive tract diseases.

    OpenAIRE

    Kuusela, P.; Haglund, C.; Roberts, P. J.

    1991-01-01

    The levels of CA 242, a new tumour marker of carbohydrate nature, were measured in sera of 185 patients with malignancies of the digestive tract and of 123 patients with benign digestive tract diseases. High percentages of elevated CA 242 levels (greater than 20 U ml-1) were recorded in patients with pancreatic and biliary cancers (68%). The sensitivity was somewhat lower than that of CA 19-9 (76%) and CA 50 (73%). On the other hand, in benign pancreatic and biliary tract diseases the CA 242 ...

  9. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-01

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  10. Effect Of Cooling Rate On Thermal And Mechanical Properties Of Cu-%24.2Mn Alloy

    International Nuclear Information System (INIS)

    In this research, different heat and mechanical treatments have been applied to the Cu-%24.2Mn and some samples have been obtained from this alloy. On these samples, phase transformations have been formed by thermal and mechanical effect. Morphological, mechanical and crystallographic properties of the phase transformations have been examined by using different physical methods. Austenite phase has been obtained in the samples which have been applied slow and rapid cooling according to the SEM analysis. It has been observed that the grain size obtained by the rapid cooling is smaller than the grain size obtained by the slow cooling. Therefore, it has been concluded that the cooling process differences, changes the grain size of the alloy. Compression stress has been applied to the alloy in order to search the deformation effect on the austenite phase transformation. The structural features of the phase transformations have been examined. Slip lines and martensite structural were observed on the surface of the alloys after the deformation. Changes in phase structure of the alloy are also examined by means of XRD technique.

  11. Fast, Low-ionization Emission Regions of the Planetary Nebula M2-42

    Science.gov (United States)

    Danehkar, A.; Parker, Q. A.; Steffen, W.

    2016-02-01

    Spatially resolved observations of the planetary nebula M2-42 (PN G008.2-04.8) obtained with the Wide Field Spectrograph on the Australian National University 2.3 m telescope have revealed the remarkable features of bipolar collimated jets emerging from its main structure. Velocity-resolved channel maps derived from the [N ii] λ6584 emission line disentangle different morphological components of the nebula. This information is used to develop a three-dimensional morpho-kinematic model, which consists of an equatorial dense torus and a pair of asymmetric bipolar outflows. The expansion velocity of about 20 km s-1 is measured from the spectrum integrated over the main shell. However, the deprojected velocities of the jets are found to be in the range of 80-160 km s-1 with respect to the nebular center. It is found that the mean density of the collimated outflows, 595 ± 125 cm-3, is five times lower than that of the main shell, 3150 cm-3, whereas their singly ionized nitrogen and sulfur abundances are about three times higher than those determined from the dense shell. The results indicate that the features of the collimated jets are typical of fast, low-ionization emission regions.

  12. Fast, low-ionization emission regions of the planetary nebula M2-42

    CERN Document Server

    Danehkar, A; Steffen, W

    2016-01-01

    Spatially resolved observations of the planetary nebula M2-42 (PN G008.2-04.8) obtained with the Wide Field Spectrograph on the Australian National University 2.3 m telescope have revealed the remarkable features of bipolar collimated jets emerging from its main structure. Velocity-resolved channel maps derived from the [N II] $\\lambda$6584 emission line disentangle different morphological components of the nebula. This information is used to develop a three-dimensional morpho-kinematic model, which consists of an equatorial dense torus and a pair of asymmetric bipolar outflows. The expansion velocity of about 20 km s$^{-1}$ is measured from the spectrum integrated over the main shell. However, the deprojected velocities of the jets are found to be in the range of 80-160 km s$^{-1}$ with respect to the nebular center. It is found that the mean density of the collimated outflows, 595 $\\pm$ 125 cm$^{-3}$, is five times lower than that of the main shell, 3150 cm$^{-3}$, whereas their singly ionized nitrogen and ...

  13. The Mysterious Morphology of MRC0943-242 as Revealed by ALMA and MUSE

    CERN Document Server

    Gullberg, Bitten; Lehnert, Matthew D; Vernet, Joel; Bacon, Roland; Drouart, Guillaume; Emonts, Bjorn; Galametz, Audrey; Ivison, Rob; Nesvadba, Nicole P H; Richard, Johan; Seymour, Nick; Stern, Daniel; Wylezalek, Dominika

    2015-01-01

    We present a pilot study of the z=2.923 radio galaxy MRC0943-242, where we for the first time combine information from ALMA and MUSE data cubes. Even with modest integration times, we disentangle an AGN and a starburst dominated set of components. These data reveal a highly complex morphology, as the AGN, starburst, and molecular gas components show up as widely separated sources in dust continuum, optical continuum and CO line emission observations. CO(1-0) and CO(8-7) line emission suggest that there is a molecular gas reservoir offset from both the dust and the optical continuum that is located ~90kpc from the AGN. The UV line emission has a complex structure in emission and absorption. The line emission is mostly due to i) a large scale ionisation cone energised by the AGN, ii) a Ly-alpha emitting bridge of gas between the radio galaxy and a heavily star-forming set of components. Strangely, the ionisation cone has no Ly-alpha emission. We find this is due to an optically thick layer of neutral gas with u...

  14. New measurement of the 242Pu(n,γ cross section at n_TOF

    Directory of Open Access Journals (Sweden)

    Lerendegui-Marco J.

    2016-01-01

    Full Text Available The use of MOX fuel (mixed-oxide fuel made of UO2 and PuO2 in nuclear reactors allows substituting a large fraction of the enriched Uranium by Plutonium reprocessed from spent fuel. With the use of such new fuel composition rich in Pu, a better knowledge of the capture and fission cross sections of the Pu isotopes becomes very important. In particular, a new series of cross section evaluations have been recently carried out jointly by the European (JEFF and United States (ENDF nuclear data agencies. For the case of 242Pu, the two only neutron capture time-of-flight measurements available, from 1973 and 1976, are not consistent with each other, which calls for a new time-of flight capture cross section measurement. In order to contribute to a new evaluation, we have perfomed a neutron capture cross section measurement at the n_TOF-EAR1 facility at CERN using four C6D6 detectors, using a high purity target of 95 mg. The preliminary results assessing the quality and limitations (background, statistics and γ-flash effects of this new experimental data are presented and discussed, taking into account that the aimed accuracy of the measurement ranges between 7% and 12% depending on the neutron energy region.

  15. Common variants on 8p12 and 1q24.2 confer risk of schizophrenia

    DEFF Research Database (Denmark)

    Shi, Yongyong; Li, Zhiqiang; Xu, Qi;

    2011-01-01

    Schizophrenia is a severe mental disorder affecting ~1% of the world population, with heritability of up to 80%. To identify new common genetic risk factors, we performed a genome-wide association study (GWAS) in the Han Chinese population. The discovery sample set consisted of 3,750 individuals...... with schizophrenia and 6,468 healthy controls (1,578 cases and 1,592 controls from northern Han Chinese, 1,238 cases and 2,856 controls from central Han Chinese, and 934 cases and 2,020 controls from the southern Han Chinese). We further analyzed the strongest association signals in an additional independent cohort...... of 4,383 cases and 4,539 controls from the Han Chinese population. Meta-analysis identified common SNPs that associated with schizophrenia with genome-wide significance on 8p12 (rs16887244, P = 1.27 × 10(-10)) and 1q24.2 (rs10489202, P = 9.50 × 10(-9)). Our findings provide new insights...

  16. Comparison of evaluations for 235U, 239Pu, 240Pu, 241Pu and 242Pu with integral measurements

    International Nuclear Information System (INIS)

    The evaluations for 235U, 239Pu, 240Pu, 241Pu and 242Pu are considered. Intercomparison is made of the neutron cross section data from INDL/A, ENDL-84, ENDF/B-5 and ENDF/B-6 (where applicable). Integral measurements of the spectrum averaged cross sections are compared to the values derived from evaluated data libraries. (author). 40 refs, 49 figs, 11 tabs

  17. Measurement of the 242Pu(n,f) Cross Section at the CERN n_TOF Facility

    CERN Document Server

    Tsinganis, A; Guerrero, C; Colonna, N; Calviani, M; Vlastou, R; Andriamonje, S; Vlachoudis, V; Gunsing, F; Massimi, C; Altstadt, S; Andrzejewski, J; Audouin, L; Barbagallo, M; Bécares, V; Bečvář, F; Belloni, F; Billowes, J; Boccone, V; Bosnar, D; Brugger, M; Calviño, F; Cano-Ott, D; Carrapiço, C; Cerutti, F; Chin, M; Cortés, G; Cortés-Giraldo, M A; Diakaki, M; Domingo-Pardo, C; Duran, I; Dressler, R; Dzysiuk, N; Eleftheriadis, C; Ferrari, A; Fraval, K; Ganesan, S; García, A R; Giubrone, G; Gómez-Hornillos, M B; Gonçalves, I F; González-Romero, E; Griesmayer, E; Gurusamy, P; Hernández-Prieto, A; Jenkins, D G; Jericha, E; Kadi, Y; Käppeler, F; Karadimos, D; Kivel, N; Koehler, P; Kokkoris, M; Krtička, M; Kroll, J; Lampoudis, C; Langer, C; Leal-Cidoncha, E; Lederer, C; Leeb, H; Leong, L S; Losito, R; Mallick, A; Manousos, A; Marganiec, J; Martínez, T; Massimi, C; Mastinu, P F; Mastromarco, M; Meaze, M; Mendoza, E; Mengoni, A; Milazzo, P M; Mingrone, F; Mirea, M; Mondalaers, W; Paradela, C; Pavlik, A; Perkowski, J; Plompen, A; Praena, J; Quesada, J M; Rauscher, T; Reifarth, R; Riego, A; Robles, M S; Roman, F; Rubbia, C; Sabaté-Gilarte, M; Sarmento, R; Saxena, A; Schillebeeckx, P; Schmidt, S; Schumann, D; Tagliente, G; Tain, J L; Tarrío, D; Tassan-Got, L; Valenta, S; Vannini, G; Variale, V; Vaz, P; Ventura, A; Versaci, R; Vermeulen, M J; Wallner, A; Ware, T; Weigand, M; Weiss, C; Wright, T; Žugec, P

    2014-01-01

    The accurate knowledge of relevant nuclear data is crucial for the design of advanced nuclear systems. These data include neutron cross sections of various plutonium isotopes and other minor actinides. The Pu-242(n,f) cross section was measured at the CERN n\\_TOF facility, taking advantage of the wide energy range (from thermal to GeV) and the high instantaneous flux of the neutron beam. Preliminary results for the measurement are presented.

  18. Association between NADPH Oxidase p22phox C242T Polymorphism and Ischemic Cerebrovascular Disease: A Meta-Analysis

    OpenAIRE

    Li, Bing-Hu; Zhang, Li-li; Zhang, Bei-Bei; Yin, Yan-Wei; Dai, Li-Meng; Pi, Yan; Guo, Lu; Chang-yue GAO; Fang, Chuan-Qin; Wang, Jing-Zhou; Li, Jing-Cheng

    2013-01-01

    Background Epidemiological studies have evaluated the association between nicotinamide adenine dinucleotide phosphate (NADPH) oxidase p22phox C242T polymorphism and risk of ischemic cerebrovascular disease (ICVD), but the results remain inconclusive. This meta-analysis was therefore designed to clarify these controversies. Methodology/Principal Findings Systematic searches of electronic databases Embase, PubMed and Web of Science, as well as hand searching of the references of identified arti...

  19. Identification of a genetic locus for ichthyosis vulgaris on chromosome 10q22.3-q24.2.

    Science.gov (United States)

    Liu, Ping; Yang, Qingyu; Wang, Xu; Feng, Aiping; Yang, Tao; Yang, Rong; Wang, Pengyun; Yuang, Mingxiong; Liu, Mugen; Liu, Jing Yu; Wang, Qing K

    2008-06-01

    Ichthyosis vulgaris (IV) is one of the most commonly inherited disorders and has an estimated prevalence rate of 2.29% in China. To date, only one gene responsible for IV, the filaggrin gene (FLG), was identified, but genetic heterogeneity exists. In this study, two Chinese families with autosomal-dominant IV were genetically characterized. The FLG gene was first excluded as the disease-causing gene in the two families. The larger family was then characterized by genome-wide linkage analysis to identify a new genetic locus for IV. Significant linkage was identified with markers on chromosome 10q22.3-q24.2 with a maximum LOD score of 3.19. No other markers showed a LOD score of >1.5. Fine mapping defined the new genetic locus within a 20.7 cM region between markers D10S569 and D10S1709. The second family also showed positive linkage to the same 10q22.3-q24.2 region. The combined maximum LOD score in the two families was 3.95. Identification of linkage in two independent families provides strong genetic evidence that a previously unreported gene for IV is located on chromosome 10q22.3-q24.2. Future studies of the candidate genes at the 10q IV locus will identify a specific gene, which will provide insights into the pathogenesis of IV.

  20. Diagnostic value of combined determination of serum tumor markers (NSE, CA-242, TPA, CEA) levels in patients with lung cancer

    International Nuclear Information System (INIS)

    Objective: To investigate the diagnostic value of combined determination of serum NSE, CA242, tissue polypeptide antigen (TPA) and CEA levels in patients with primary lung cancer. Methods: Serum NSE, CA242, TPA and CEA levels were determined with ELISA in (1) 102 patients with various types of primary lung carcinoma (adenocarcinoma 38, squamous cell carcinoma 32, small cell lung carcinoma 32) (2) 33 patients with open lung T. B. and (3) 30 controls. Results: (1) In patients with lung cancer, serum levels of all the four markers were increased and significantly higher than their respective values in patients with open lung T.B. and controls. (2) Positive rate of combined any two markers were 75% for adenocarcinoma, 50% for squamous cell carcinoma and 65% for small cell lung carcinoma, while false positive rate was only 9% for T.B patients and none for the controls. (3) The most appropriate single marker for each specific type of lung cancer was: NSE for SCLC (sensitivity 72%, specificity 97%, CA242 for adenocarcinoma sensitivity 62%, specificity 90%). Conclusion: Combined determination of these tumor markers would improve the sensitivity and specificity for diagnosis of primary lung carcinoma. (authors)

  1. The Solubility of 242PuO2 in the Presence of Aqueous Fe(II): The Impact of Precipitate Preparation

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, Andrew R.; Moore, Dean A.; Buck, Edgar C.; Conradson, Steven D.; Kukkadapu, Ravi K.; Sweet, Lucas E.; Abrecht, David G.; Ilton, Eugene S.

    2014-01-28

    The solubility of different forms of precipitated 242PuO2(am) were examined in solutions containing aqueous Fe(II) over a range of pH values. The first series of 242PuO2(am) suspensions were prepared from a 242Pu(IV) stock that had been treated with thenoyltrifluoroacetone (TTA) to remove the 241Am originating from the decay of 241Pu. These 242PuO2(am) suspensions showed much higher solubilities at the same pH value and Fe(II) concentration than previous studies using 239PuO2(am). X ray absorption fine structure (XAFS) spectroscopy of the precipitates showed a substantially reduced Pu-Pu backscatter over that previously observed in 242PuO2(am) precipitates, indicating that the 242PuO2(am) precipitates purified using TTA lacked the long range order previously found in 239PuO2(am) precipitates. The Pu(IV) stock solution was subsequently repurified using an ion exchange resin and an additional series of 242PuO2(am) precipitates prepared. These suspensions showed higher redox potentials and total aqueous Pu concentrations than the TTA purified stock solution. The higher redox potential and aqueous Pu concentrations were in general agreement with previous studies on 242PuO2(am) precipitates, presumably due to the removal of possible organic compounds originally present in the TTA purified stock. 242PuO2(am) suspensions prepared with both stock solutions showed almost identical solubilities in Fe(II) containing solutions even though the initial aqueous Pu concentrations before the addition of Fe(II) were orders of magnitude different. By examining the solubility of 242PuO2(am) prepared from both stocks in this way we have essentially approached equilibrium from both the undersaturated and oversaturated

  2. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  3. The recycling of the actinides neptunium, americium and curium in a fast power reactor to reduce the long term activity in a final store

    International Nuclear Information System (INIS)

    The starting point for the considerations and calculations given in this dissertation is the inevitable production of radioactive materials in the use of nuclear energy, which creates a considerable potential danger in a final store for a very long period. As one possibility of alleviating this problem, a concept for recycling the waste actinides neptunium, americium and curium was proposed. The waste actinides are separated in the reprocessing of burnt-up fuel elements and reach a further irradiation circuit. There they pass through the stages 'manufacture of irradiation elements', 'use in a fast power reactor' and reprocessing of irradiation elements' several times. In each irradiation and subsequent storage, about 17% of the waste actinides are removed by fission or by conversion into nuclides which can be reused as fuel, so that during the life of 40 years of the fast recycling reacor, the waste actinides can be reduced in mass by one half. In order to determine this mass reduction effect, a model calculation was developed, which includes the representation of the neutron physics and thermal properties of the reactor core and the storage and reprocessing of the irradiation elements. (orig./RB)

  4. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  5. The estimation of reactions of hematopoietic systems of organisms to the effect, caused by americium and plutonium, of nuclear industry workers

    Energy Technology Data Exchange (ETDEWEB)

    Gasteva, G. N.; Ivanova, T. A.; Gordeeva, A. A.; Suvorova, L. A.; Molokanov, A. A.; Badine, I.

    2004-07-01

    Object of research are the workers having in an organism radioactive substance (Am-241 and Pu-239). The purpose of work was the estimation of reaction hemopoietic systems of an organism on influence of americium and plutonium at workers of the nuclear industry. At the surveyed contingent of persons the determined effects caused by total influence Am-241 and Pu-239 are ascertained; chronic radiation disease with development, besides diffusive a pneumoscleoris and a chronic toxic-chemical radiating bronchitis, reactions of system of blood, jet hepatopathy which frequency accrued with increase doses loadings and essentially did not depend on age. In peripheral blood on the foreground jet changes act: hyperglobulia, the tendency to neutrophilus leukocytosis, monocytosis, increase ESR, decrease (reduction ?/G of factor reflecting weight and processing of defeat bronchus and pulmonary of system. Stable downstroke in number thrombocytes and reticulocytes in peripheral blood, their direct dependence on a doze of an irradiation, reflect hypoplastic a background hemogenesis, caused by long influence incorporatedin a bone and a bone brain of radioactive substances. At cytologic research punctate a bone brain jet changes which are expressed in increase of functional activity erythro-and myelopoiesiscome to light and provide compensatory reaction of peripheral blood. At histologic research of a bone brain and a bone fabric attributes of development atrophic process which is expressed in reduction of volume parenchyma a bone brain (a fatty atrophy) and dysplasia to a bone fabric are observed.

  6. Measurement of Am-242 fission yields at the Lohengrin spectrometer; improvement and Benchmarking of the semi-empirical code GEF

    International Nuclear Information System (INIS)

    The study of fission yields has a major impact on the characterization and understanding of the fission process and is mandatory for reactor applications. While the yields are known for the major actinides (U-235, Pu-239) in the thermal neutron-induced fission, only few measurements were performed on Am-242. Moreover, the two main data libraries do not agree among each other on the light peak. Am-241 and Am-242 are nuclei of interest for the MOX-fuel reactors and for the reduction of nuclear waste radiotoxicity using transmutation reactions. Thus, a campaign of precise measurement of the fission mass yields from the reaction Am-241(2n,f) was performed at the Lohengrin mass spectrometer (ILL, France) for both the light and the heavy peak. Forty-one masses were measured. Moreover, the measurement of the isotopic fission yields on the heavy peak by gamma-ray spectrometry led to the extraction of 20 independent isotopic yields. Our measurement was also meant to determine whether there is a difference in fission yields between the Am-242 isomeric state and its ground state as it exists in fission cross sections. The experimental method used to answer this question is based on the measurement a set of fission mass yields as a function of the ratio of Am-242gs to Am-242m fission rate. Results show that the mass yields are independent of the fission rate ratio. A future experimental campaign is proposed to observe a possible influence on the isomeric yields. The theoretical models are nowadays unable to predict the fission yields with enough accuracy and therefore we have to rely on experimental data and phenomenological models. The accuracy of the predictions of the semi empirical GEF fission model predictions makes it a useful tool for evaluation. This thesis also presents the physical content and part of the development of this model. Validation of the kinetic energy distributions, isomeric yields and fission yields predictions was performed. The extension of the GEF

  7. The mysterious morphology of MRC0943-242 as revealed by ALMA and MUSE

    Science.gov (United States)

    Gullberg, Bitten; De Breuck, Carlos; Lehnert, Matthew D.; Vernet, Joël; Bacon, Roland; Drouart, Guillaume; Emonts, Bjorn; Galametz, Audrey; Ivison, Rob; Nesvadba, Nicole P. H.; Richard, Johan; Seymour, Nick; Stern, Daniel; Wylezalek, Dominika

    2016-02-01

    We present a pilot study of the z = 2.923 radio galaxy MRC0943-242, where we combine information from ALMA and MUSE data cubes for the first time. Even with modest integration times, we disentangle the AGN and starburst dominated components. These data reveal a highly complex morphology as the AGN, starburst, and molecular gas components show up as widely separated sources in dust continuum, optical continuum, and CO line emission observations. CO(1-0) and CO(8-7) line emission suggest that there is a molecular gas reservoir offset from both the dust and the optical continuum that is located ~90 kpc from the AGN. The UV line emission has a complex structure in emission and absorption. The line emission is mostly due to a large scale ionisation cone energised by the AGN, and a Lyα emitting bridge of gas between the radio galaxy and a heavily star-forming set of components. Strangely, the ionisation cone has no Lyα emission. We find this is due to an optically thick layer of neutral gas with unity covering fraction spread out over a region of at least ~100 kpc from the AGN. Other less thick absorption components are associated with Lyα emitting gas within a few tens of kpc from the radio galaxy and are connected by a bridge of emission. We speculate that this linear structure of dust, Lyα and CO emission, and the redshifted absorption seen in the circum nuclear region may represent an accretion flow feeding gas into this massive AGN host galaxy.

  8. 242周期夫精宫腔人工授精临床观察

    Institute of Scientific and Technical Information of China (English)

    梅园园; 彭璇; 雷美云

    2012-01-01

    目的比较分析自然周期和促排卵两种方式行夫精官腔人工授精(IUI)的妊娠结局。方法回顾性分析242周期IUI患者的临床资料,其中160周期以促排卵方式行IUI,82周期采用自然周期行IUI,随访所有患者的妊娠结局。结果促排卵方式行IUI的妊娠率较自然周期组高,但两组比较无统计学差异.P〉O.05;促排卵组发生OHSS、LUFS及多胎并发症比自然周期组高,但两组比较亦无统计学差异,P〉0.05。结论虽然采用促排卵方式行IUI能提高患者妊娠率,但发生OHSS,LFUS和多胎并发症比自然周期组也高。自然周期符合自身卵泡生长规律,并可减少药物对卵巢的刺激,节约经济成本,也是值得一定推广的IUI方式。

  9. Diagnostic value of combined determinations of serum CA19-9, CA242 and CA50 levels in patients with pancreatic cancer

    International Nuclear Information System (INIS)

    Objective: To explore the diagnostic value of combined determinations of serum CA19-9, CA242 and CA50 levels in patients with pancreatic cancer. Methods: Serum CA19-9, CA242 and CA50 levels were determined with RIA in 120 patients with pancreatic cancer, 50 patients with chronic pancreatitis and 80 controls. Results: The serum levels of CA19-9, CA242 and CA50 in patients with pancreatic cancer were significantly higher than those in patients with pancreatitis and controls. With CA19-9, the diagnostic sensitivity and specificity for pancreatic cnrcinoma was 82.0% and 78.6% respectively. With CA242, the diagnostic sensitivity and specificity for pancreatic carcinoma was 78.5% and 81.6% respectively. With CA50, the diagnostic sensitivity and specificity for pancreatic carcinoma was 52.7% and 74.6% respectively. With combined determinations of CA19-9, CA242 and CA50, the sensitivity and specificity was enhanced to 96.82% and 98.75% respectively. Conclusion: Combined detection of CA19-9, CA242 and CA50 is clinically useful for early diagnosis of pancreatic cancer. (authors)

  10. The solubility of {sup 242}PuO{sub 2} in the presence of aqueous Fe(II). The impact of precipitate preparation

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, Andrew R.; Moore, Dean A.; Buck, Edgar; Kukkadapu, Ravi; Sweet, Lucas; Abrecht, David; Ilton, Eugene S. [Pacific Northwest National Laboratory, Richland, WA (United States); Conrados, Steven D. [Los Alamos National Laboratory, Los Alamos, NM (United States)

    2014-07-01

    The solubility of different forms of precipitated {sup 242}PuO{sub 2}(am) were examined in solutions containing aqueous Fe(II) over a range of pH values. The first series of {sup 242}PuO{sub 2}(am) suspensions were prepared from a {sup 242}Pu(IV) stock that had been treated with thenoyltrifluoroacetone (TTA) to remove the {sup 241}Am originating from the decay of {sup 241}Pu. These {sup 242}PuO{sub 2}(am) suspensions showed much higher solubilities at the same pH value and Fe(II) concentration than previous studies using {sup 239}PuO{sub 2}(am). X-ray absorption fine structure (XAFS) spectroscopy of the precipitates showed a substantially reduced Pu-Pu backscatter over that previously observed in {sup 239}PuO{sub 2}(am) precipitates, indicating that the {sup 242}PuO{sub 2}(am) precipitates purified using TTA lacked the long range order previously found in{sup 239}PuO{sub 2}(am) precipitates. The Pu(IV) stock solution was subsequently re-purified using an ion exchange resin and an additional series of {sup 242}PuO{sub 2}(am) precipitates prepared. These suspensions showed higher redox potentials and total aqueous Pu concentrations than the TTA purified stock solution. The higher redox potential and aqueous Pu concentrations were in general agreement with previous studies on {sup 242}PuO{sub 2}(am) precipitates, presumably due to the removal of possible organic compounds originally present in the TTA purified stock. {sup 242}PuO{sub 2}(am) suspensions prepared with both stock solutions showed almost identical solubilities in Fe(II) containing solutions even though the initial aqueous Pu concentrations before the addition of Fe(II) were orders of magnitude different. By examining the solubility of {sup 242}PuO{sub 2}(am) prepared from both stocks in this way we have essentially approached equilibrium from both the undersaturated and oversaturated conditions. The final aqueous Pu concentrations are predictable using a chemical equilibrium model which includes the

  11. 242例未行准分子激光原位角膜磨镶术患者角膜因素分析%Analysis of 242 cases which unable to carry out LASIK

    Institute of Scientific and Technical Information of China (English)

    王林; 张庆生; 王忠海

    2014-01-01

    Objective Analyze the cornea factors which result in unable to carry out the LASIK operation .Method Do retrospective analysis research and summarize 242 patients’ medical records who did not undergo LASIK because of factors in the cornea.Results In total 242 cases, 112 patient’s corneal thickness less than normal that account for the to-tal 46.3%, 87 cases of suspected keratoconus that make up 36.0%of the total, 5 cases (2.1%) of keratoconus , 25 ca-ses (10.3%) are wearing orthokeratology lens , 8 cases (3.3%) are fell ill with keratitis, 5 cases (2.0%) are due to some other corneal problems .Conclusion Corneal factors are the main reasons for unable to carry out the LASIK opera-tions , carry out strict check work on patients ’ cornea to know the relevant indications and contraindications before the oper -ation is very critical to improve the safety of the LASIK operations .%探讨因角膜因素未行准分子激光原位角膜磨镶术( LASIK)的原因。方法回顾分析242例因角膜因素未行LASIK的原因。结果在242例因角膜因素未行LASIK中,角膜厚度不足112例(46.3%),可疑圆锥角膜87例(36.0%),圆锥角膜5例(2.1%),佩戴角膜塑形镜25例(10.3%),角膜炎8例(3.3%),其它角膜因素5例(2.0%)。结论角膜因素是未行LASIK的主要原因,严格的手术前角膜筛查,掌握手术的适应证与禁忌证,可以提高LASIK手术的安全性。

  12. Evaluation of 242Pu data for the incident neutron energy range 5-20 MeV

    International Nuclear Information System (INIS)

    Models, procedures and parameters are presented for the calculation of neutron cross sections, the neutron angular distributions and the neutron energy distributions of 242Pu in the energy range 5-20 MeV. The interaction takes place through direct interaction and compound nucleus mechanism. For heavy deformed nucleus the direct interaction was treated with the coupled channel process, using the ECIS code. For the compound nucleus mechanism, a statistical treatment was used for fission, neutron elastic and inelastic scattering, radiative capture, (n,2n), (n,3n), (n,4n) cross section calculations, using the GNASH code. (R.P.)

  13. Synthesis of novel 2-(4-(2-morpholinoethoxy)phenyl)-N-phenylacetamide analogues and their antimicrobial study

    Indian Academy of Sciences (India)

    H P Jayadevappa; G Nagendrappa; S Umesh; S Chandrashekar

    2012-09-01

    A new class of potential biologically active 2-(4-(2-morpholinoethoxy)phenyl)-N-phenylacetamides has been synthesized from hydroxyphenylacetic acid. The products were characterized through IR, 1H NMR, mass spectral studies and elemental analysis. The compounds were screened for antimicrobial activity by disc agar diffusion technique. The potency of compounds is tested against variety of fungal and bacterial strains in comparison to clotrimazole and streptomycin, respectively. Some of the synthesized compounds exhibit superior in vitro activity compared to the standard drugs.

  14. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  15. 6,6 '-bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo 1,2,4 triazine-3-yl) 2,2 ' bipyridine, an effective extracting agent for the separation of americium(III) and curium(III) from the lanthanides

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and the lanthanides(III) from nitric acid by 6,6'- bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo[1,2,4]triazine-3-yl)-[2,2'] bipyridine (CyMe4-BTBP) has been studied. Since the extraction kinetics were slow, N,N'-dimethyl-N,N'-di-octyl-2-(2-hexyl-oxy-ethyl)malonamide (DMDOHEMA) was added as a phase transfer reagent. With a mixture of 0.01 M CyMe4-BTBP + 0.25 M DMDOHEMA in n -octanol, extraction equilibrium was reached within 5 min of mixing. At a nitric acid concentration of 1 M, an americium(III) distribution ratio of approx. 10 was achieved. Americium(III)/lanthanide(III) separation factors between 50 (dysprosium) and 1500 (lanthanum) were obtained. Whereas americium(III) and curium(III) were extracted as di-solvates, the stoichiometries of the lanthanide(III) complexes were not identified unambiguously, owing to the presence of DMDOHEMA. In the absence of DMDOHEMA, both americium(III) and europium(III) were extracted as di-solvates. Back-extraction with 0.1 M nitric acid was thermodynamically possible but rather slow. Using a buffered glycolate solution of pH=4, an americium(III) distribution ratio of 0.01 was obtained within 5 min of mixing. There was no evidence of degradation of the extractant, for example, the extraction performance of CyMe4-BTBP during hydrolysis with 1 M nitric acid did not change over a two month contact. (authors)

  16. Sequence and batch language programs and alarm-related ``C`` programs for the 242-A MCS. Revision 2

    Energy Technology Data Exchange (ETDEWEB)

    Berger, J.F.

    1995-03-01

    A Distributive Process Control system was purchased by Project B-534, ``242-A Evaporator/Crystallizer Upgrades``. This control system, called the Monitor and Control System (MCS), was installed in the 242-A Evaporator located in the 200 East Area. The purpose of the MCS is to monitor and control the Evaporator and monitor a number of alarms and other signals from various Tank Farm facilities. Applications software for the MCS was developed by the Waste Treatment Systems Engineering (WTSE) group of Westinghouse. The standard displays and alarm scheme provide for control and monitoring, but do not directly indicate the signal location or depict the overall process. To do this, WTSE developed a second alarm scheme which uses special programs, annunciator keys, and process graphics. The special programs are written in two languages; Sequence and Batch Language (SABL), and ``C`` language. The WTSE-developed alarm scheme works as described below: SABL relates signals and alarms to the annunciator keys, called SKID keys. When an alarm occurs, a SABL program causes a SKID key to flash, and if the alarm is of yellow or white priority then a ``C`` program turns on an audible horn (the D/3 system uses a different audible horn for the red priority alarms). The horn and flashing key draws the attention of the operator.

  17. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 4

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    Radiation protection of personnel and the public is accomplished by establishing a well defined Radiation Protection Organization to ensure that appropriate controls on radioactive materials and radiation sources are implemented and documented. This Requirements Identification Document (RID) applies to the activities, personnel, structures, systems, components, and programs involved in executing the mission of the Tank Farms. The physical boundaries within which the requirements of this RID apply are the Single Shell Tank Farms, Double Shell Tank Farms, 242-A Evaporator-Crystallizer, 242-S, T Evaporators, Liquid Effluent Retention Facility (LERF), Purgewater Storage Facility (PWSF), and all interconnecting piping, valves, instrumentation, and controls. Also included is all piping, valves, instrumentation, and controls up to and including the most remote valve under Tank Farms control at any other Hanford Facility having an interconnection with Tank Farms. The boundary of the structures, systems, components, and programs to which this RID applies, is defined by those that are dedicated to and/or under the control of the Tank Farms Operations Department and are specifically implemented at the Tank Farms.

  18. 17q24.2 microdeletions: a new syndromal entity with intellectual disability, truncal obesity, mood swings and hallucinations.

    Science.gov (United States)

    Vergult, Sarah; Dauber, Andrew; Delle Chiaie, Barbara; Van Oudenhove, Elke; Simon, Marleen; Rihani, Ali; Loeys, Bart; Hirschhorn, Joel; Pfotenhauer, Jean; Phillips, John A; Mohammed, Shehla; Ogilvie, Caroline; Crolla, John; Mortier, Geert; Menten, Björn

    2012-05-01

    Although microdeletions of the long arm of chromosome 17 are being reported with increasing frequency, deletions of chromosome band 17q24.2 are rare. Here we report four patients with a microdeletion encompassing chromosome band 17q24.2 with a smallest region of overlap of 713 kb containing five Refseq genes and one miRNA. The patients share the phenotypic characteristics, such as intellectual disability (4/4), speech delay (4/4), truncal obesity (4/4), seizures (2/4), hearing loss (3/4) and a particular facial gestalt. Hallucinations and mood swings were also noted in two patients. The PRKCA gene is a very interesting candidate gene for many of the observed phenotypic features, as this gene plays an important role in many cellular processes. Deletion of this gene might explain the observed truncal obesity and could also account for the hallucinations and mood swings seen in two patients, whereas deletion of a CACNG gene cluster might be responsible for the seizures observed in two patients. In one of the patients, the PRKAR1A gene responsible for Carney Complex and the KCNJ2 gene causal for Andersen syndrome are deleted. This is the first report of a patient with a whole gene deletion of the KCNJ2 gene. PMID:22166941

  19. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 4

    International Nuclear Information System (INIS)

    Radiation protection of personnel and the public is accomplished by establishing a well defined Radiation Protection Organization to ensure that appropriate controls on radioactive materials and radiation sources are implemented and documented. This Requirements Identification Document (RID) applies to the activities, personnel, structures, systems, components, and programs involved in executing the mission of the Tank Farms. The physical boundaries within which the requirements of this RID apply are the Single Shell Tank Farms, Double Shell Tank Farms, 242-A Evaporator-Crystallizer, 242-S, T Evaporators, Liquid Effluent Retention Facility (LERF), Purgewater Storage Facility (PWSF), and all interconnecting piping, valves, instrumentation, and controls. Also included is all piping, valves, instrumentation, and controls up to and including the most remote valve under Tank Farms control at any other Hanford Facility having an interconnection with Tank Farms. The boundary of the structures, systems, components, and programs to which this RID applies, is defined by those that are dedicated to and/or under the control of the Tank Farms Operations Department and are specifically implemented at the Tank Farms

  20. 242Pu as tracer for simultaneous determination of 237Np and 239,240Pu in environmental samples

    DEFF Research Database (Denmark)

    Chen, Q.J.; Dahlgaard, H.; Nielsen, S.P.;

    2002-01-01

    A procedure has been developed using Pu-242 as tracer for simultaneous determination of Np-237 and Pu-239,Pu-240 in environmental samples. The validity of the method has been demonstrated by ICPMS and alpha-spectroscopy for up to 10 gram soil and sediment, seawater up to 200 litres. The paper...... describes a suitable chemical procedure for Np and Pu including a quantitative pre-concentration of neptunium and plutonium, preparation of Np4+ and Pu4+, NP(NO3)(6)(2-) and Pu(NO3)(6)(2-), The ratio of Np-237/Pu-242 (or Np-237/Pu-239) before and after the procedure has been determined using 10 g soil (free...... from Np and Pu) R-before/R-after = 1.004 +/- 3.3% (S.D n = 20) and 1 litre seawater R-before/R-after = 1.019+/-1.9% (S.D., n = 12). Results from the intercomparison samples LAEA-135, LAEA-381 and from environmental samples are presented....

  1. Relationship between peripheral and mesenteric serum levels of CEA and CA 242 with staging and histopathological variables in colorectal adenocarcinoma Níveis séricos periféricos e mesentéricos de CEA e CA 242, estadiamento e variáveis histopatológicas no adenocarcinoma colorretal

    OpenAIRE

    Mauro Lamelas Cardoso; Luís Cesar Fernandes; Su Bong Kim; Delcio Matos

    2009-01-01

    PURPOSE: To compare histopathological variables and staging in colorectal adenocarcinoma cases with CEA and CA 242 in peripheral and mesenteric blood. METHODS: In 169 individuals underwent surgery for colorectal cancer, CEA and CA 242 were analyzed and compared to mesenteric and peripheral blood and correlated with macroscopic tumor's morphology and size, degree of cell differentiation, venous, neural and lymphatic involvement and TNM classification. RESULTS: There was a difference between th...

  2. Research on the controlling of rare earth permanent magnet brushless DC motor based on TMS320C242%基于TMS320C242的稀土永磁无刷直流电机控制系统研究

    Institute of Scientific and Technical Information of China (English)

    董艺

    2012-01-01

    对用TMS320C242控制稀土永磁无刷直流电机(REPMBLDCM)进行了深入的探讨。作为驱动设备,稀土永磁无刷直流电机在很多方面性能优于普通直流电机;作为控制核心,TMS320C242无论是集成度还是控制速度都远超普通的单片机。所以用TMS320C242控制REPMBLDCM可获得极为优秀的控制效果和驱动性能。%A deep discussion has been made on how to control rare earth permanent magnet brushless DC motor with TMS320C242. As a driving device, rare earth permanent magnet brushless DC motor is superior to the common DC motor in many ways. As a core of the control system, TMS320C242 is far more superior to the common single chip microcontroller unit whether on its integration or its controlling speed. Therefore, excellent control effects and driving properties can be obtained by adopting TMS320C242 to control REPMBLDCM.

  3. Relationship between peripheral and mesenteric serum levels of CEA and CA 242 with staging and histopathological variables in colorectal adenocarcinoma Níveis séricos periféricos e mesentéricos de CEA e CA 242, estadiamento e variáveis histopatológicas no adenocarcinoma colorretal

    Directory of Open Access Journals (Sweden)

    Mauro Lamelas Cardoso

    2009-10-01

    Full Text Available PURPOSE: To compare histopathological variables and staging in colorectal adenocarcinoma cases with CEA and CA 242 in peripheral and mesenteric blood. METHODS: In 169 individuals underwent surgery for colorectal cancer, CEA and CA 242 were analyzed and compared to mesenteric and peripheral blood and correlated with macroscopic tumor's morphology and size, degree of cell differentiation, venous, neural and lymphatic involvement and TNM classification. RESULTS: There was a difference between the mesenteric (M and peripheral (P serum levels of CEA (p=0.020. Higher levels of markers were correlated with venous invasion CEA (P p=0.013, CEA (M p=0.05, CA 242 (M p=0.005 and CA 242 (P p=0.038; with advanced staging CEA (P OBJETIVO: Comparar variáveis histopatológicas e graus de estadiamento do adenocarcinoma colorretal com níveis sanguíneos periféricos e mesentéricos de CEA e CA-242. MÉTODOS: Em 169 doentes submetidos ao tratamento cirúrgico por adenocarcinoma colorretal, CEA e CA-242 foram analisados e comparados quanto aos níveis sanguíneos periféricos e mesentéricos e correlacionados com o tamanho e a morfologia macroscópica do tumor, grau de diferenciação celular, invasões venosa, linfática, neural e a classificação TNM. RESULTADOS: Verificou-se diferença significante entre o nível sérico mesentérico e periférico de CEA (p= 0,02. Níveis séricos mais elevados dos marcadores foram observados e correlacionados com invasão venosa, CEA (P p=0,013, CEA(M, p=0,05, CA-242 (M p=0,005 e CA-242 (P p=0,038. Grau de estadiamento TNM avançado foi associado com CEA(P < CEA(M p<0,05, CA-242(P < CA-242(M p<0,05. Nas maiores dimensões tumorais constatou-se CEA(P < CEA(M p=0,001 e CA 242 (P < CA 242 (M (p < 0.001. O CA 242 periférico e mesentérico aumentados associaram-se com a invasão neural, p=0.014 e p=0.003, respectivamente. CONCLUSÕES: O nível sérico mesentérico de CEA é superior ao nível sérico periférico. Os níveis s

  4. Impact of the cation distribution homogeneity on the americium oxidation state in the U0.54Pu0.45Am0.01O2-x mixed oxide

    Science.gov (United States)

    Vauchy, Romain; Robisson, Anne-Charlotte; Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence; Scheinost, Andreas C.; Hodaj, Fiqiri

    2015-01-01

    The impact of the cation distribution homogeneity of the U0.54Pu0.45Am0.01O2-x mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium-plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β- decay of 241Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U-Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  5. I. Nuclear Production Reaction and Chemical Isolation Procedure for 240Am II. New Superheavy Element Isotopes: 242Pu(48Ca,5n)285-114

    OpenAIRE

    Ellison, Paul Andrew

    2011-01-01

    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242Pu(p, 3n)240Am nuclear reaction was measured to be lower than t...

  6. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions

    International Nuclear Information System (INIS)

    addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  7. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 3

    International Nuclear Information System (INIS)

    This report summarizes the studies on sorption and diffusion of Cs, Sr, Co, Ni, Am and I in common rocks in Finnish bedrock carried out in laboratory experiments. Samples used in these studies were sections of drill cores containing filled and unfilled natural fracture surfaces and drill cores with a diamond drilled longitudinal cavity in the middle of the sample (drill core cups). Samples originated from the two nuclear power plant sites in Finland: tonalite and mica gneiss from Olkiluoto in Eurajoki and rapakivi granite from Haestholmen in Loviisa. The water used in the experiments was synthetic groundwater spiked at a time with one of the radionuclides: Cs-134, Sr-90, Co-60, Ni-63, Am-241 and I-125. Contact times from one week to one year were used to evaluate time dependence of diffusion. An autoradiographic method was used for determination of the penetration depths and diffusion pathways of elements. For determination of diffusion coefficients a quantitative computerized autoradiographic method was used to get the concentration profiles of the radionuclides in the drill cores. Sorption on natural fracture surfaces was more effective than on freshly drilled core samples. Filling materials on natural fracture surfaces, except calcite, increased sorption. The distribution coefficients for drill core cups were about the same as those for unfilled natural fracture surfaces after a contact time of one week and the sorption tendency of radionuclides was: Ka(Cs) > Ka(Co) > Ka(Am) > Ka(Ni) > Ka(Sr) > Ka(I). Radionuclides were observed to penetrate into fissures of the rock matrix and high-capacity minerals. Strontium was found as far as 35 mm in a filled natural fracture surface sample of rapakivi granite after a contact time of one year. The corresponding values were 3.0 mm for cesium, 2.1 mm for cobalt and 2.6 mm for nickel. For americium no diffusion could be observed (a-values for strontium was 6.6 x 10-16-1.1 x 10-13 m2/s, for cesium 4.7 x 10-16-7.2 x 10-15 m2/s

  8. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  9. Measurement of the fission cross-section of $^{240}$Pu and $^{242}$Pu at CERN's n_TOF Facility

    CERN Multimedia

    Pavlik, A F; Gonzalez romero, E M

    The n_TOF Collaboration proposes to continue the fission program, already started in 2002-2004, taking advantage of the newly constructed Work Sector Type A, with the measurement of the two isotopes : $^{240}$ Pu and $^{242}$ Pu. They are both of major importance for reactor physics applications and are included in the Nuclear Energy Agency (NEA) High Priority List [1], in the NEA WPEC Subgroup 26 Report on the accuracy of nuclear data for advanced reactor designe [2] and in the EU 6$^{th}$ Framework Programme IP-EUROTRANS/NUDATRA reports [3]. Based on those requests, the measurement of the fission cross-section of the two Pu isotopes is one of the objectives of the project ANDES of the FP7 EURATOM program [4].

  10. Coulomb excitation of a 242Am isomeric target: E2 and E3 strengths, rotational alignment, and collective enhancement

    International Nuclear Information System (INIS)

    A 98% pure 242mAm (K=5-, t1/2=141 years) isomeric target was Coulomb excited with a 170.5-MeV 40Ar beam. The selectivity of Coulomb excitation, coupled with the sensitivity of Gammasphere plus CHICO, was sufficient to identify 46 new states up to spin 18(ℎ/2π) in at least four rotational bands; 11 of these new states lie in the isomer band, 13 in a previously unknown yrast Kπ=6- rotational band, and 13 in a band tentatively identified as the predicted yrast Kπ=5+ band. The rotational bands based on the Kπ=5- isomer and the 6- bandhead were populated by Coulomb excitation with unexpectedly equal cross sections. The γ-ray yields are reproduced by Coulomb excitation calculations using a two-particle plus rotor model (PRM), implying nearly complete ΔK=1 mixing of the two almost-degenerate rotational bands, but recovering the Alaga rule for the unperturbed states. The degeneracy of the 5- and 6- bands allows for precise determination of the mixing interaction strength V, which approaches the strong-mixing limit; this agrees with the 50% attenuation of the Coriolis matrix element assumed in the model calculations. The fractional admixture of the IKπ=66- state in the nominal 65- isomer band state is measured within the PRM as 45.6-1.1+0.3%. The E2 and M1 strengths coupling the 5- and 6- bands are enhanced significantly by the mixing, while E1 and E2 couplings to other low-K bands are not measurably enhanced. The yields of the 5+ band are reproduced by an E3 strength of ≅15 W.u., competitive with the interband E2 strength. Alignments of the identified two-particle Nilsson states in 242Am are compared with the single-particle alignments in 241Am.

  11. Clinical analysis of 242 cases of renal transplantations from China donation after citizen death%公民逝世后器官捐献肾移植242例临床分析

    Institute of Scientific and Technical Information of China (English)

    昌盛; 徐晶; 蒋继贫; 陈知水

    2015-01-01

    目的 分析单中心公民逝世后器官捐献(DCD)供肾移植的短期临床效果.方法 对2010年11月至2014年12月31日实施的242例DCD供肾移植的临床资料进行回顾性研究,统计术后1年受者和移植肾存活率,计算术后各类并发症发生率,并观察婴幼儿或儿童以及老年(年龄>60岁)供者供肾移植的临床特点.结果 共计183例DCD捐献者,供者年龄为2d至68岁,其中中国一类(国际标准化脑死亡器官捐献)供者102例,中国二类(国际标准化心死亡器官捐献)供者22例,中国三类(中国过渡时期脑-心双死亡标准器官捐献)供者59例.最终捐献247个肾脏用于移植,实施肾移植242例,其中单肾移植237例,双肾移植5例.受者年龄为(43.3±21.8)岁(12~64岁).术后1年受者总体存活率为93.8%(227/242),低于既往传统尸体肾移植95.4%的存活率,但差异无统计学意义(P>0.05).术后1年移植肾总体存活率为90.5%(219/242),低于既往传统尸体肾移植94.3%的存活率(P<0.05).术后DGF的发生率为33.1%(80/242),高于既往传统尸体肾移植23.6%的发生率(P<0.05).而术后1年急性排斥反应发生率、间质性肺炎发生率以及尿瘘、输尿管梗阻、心脑血管意外等并发症发生率与既往传统尸体肾移植相比较,差异无统计学意义(P>0.05).婴幼儿及儿童供肾移植总体结果良好,移植肾体积在术后3个月之内生长至接近成人肾脏大小.老年供肾弃用率高于总弃用率(P<0.05),但总体移植效果良好.结论 对于DCD供肾移植,严格筛选供者、加强供者濒死期器官维护、综合评估器官质量是提高受者长期存活、降低术后并发症发生率的关键.未成年供者供肾移植是解决供肾短缺的一条可行途径,无论是双肾移植还是单肾移植,均可获得优良的远期效果.而年龄>60岁供者供肾尽管弃用率较高,但只要肾脏质量评估得当,并不影响短期疗效.%Objective To

  12. C242T Polymorphism in CYBA Gene (p22phox and Risk of Coronary Artery Disease in a Population of Caucasian Italians

    Directory of Open Access Journals (Sweden)

    Sabina Nasti

    2006-01-01

    Full Text Available Background: specific polymorphisms of genes regulating intracellular redox balance and oxidative stress are related to atherogenesis. Some studies have identified a relationship between progression of atherosclerosis and C242T mutation in CYBA gene coding for p22phox, a subunit of the NADH/NADPH oxidase system.

  13. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 7. Revision 1

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 7) presents the standards and requirements for the following sections: Occupational Safety and Health, and Environmental Protection

  14. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 7. Revision 1

    Energy Technology Data Exchange (ETDEWEB)

    Burt, D.L.

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 7) presents the standards and requirements for the following sections: Occupational Safety and Health, and Environmental Protection.

  15. Method for Determination of Neptunium in Large-Sized Urine Samples Using Manganese Dioxide Coprecipitation and 242Pu as Yield Tracer

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2013-01-01

    A novel method for bioassay of large volumes of human urine samples using manganese dioxide coprecipitation for preconcentration was developed for rapid determination of 237Np. 242Pu was utilized as a nonisotopic tracer to monitor the chemical yield of 237Np. A sequential injection extraction...

  16. Sequential isotopic determination of plutonium, thorium, americium and uranium in the air filter and drinking water samples around the WIPP site

    International Nuclear Information System (INIS)

    The simultaneous determination of actinides in air filter and water samples around the WIPP site have been demonstrated. The analytical method is based on the selective separation and purification by anion exchange and Eichrome-TEVA, TRU and DGA-resin followed by determination of actinides by alpha spectrometry. Counting sources for alpha spectrometric measurements were prepared by microcoprecipitation on neodymium fluoride (NdF3). Radiochemical yields were determined using 242Pu, 229Th, 243Am and 232U as tracers. The validation of the method is performed through the analysis of reference materials or participating in laboratory intercomparison programs. The plutonium concentrations in aerosols varied seasonally, being highest in spring and summer due to the spring-time enhanced wind-storm transportation of radioactive aerosols from the stratosphere to the troposphere. The 238Pu/239+240Pu activity ratio in the aerosol samples is typically close to that of global fallout from historic above-ground nuclear weapons testing. The results presented here indicate that the source of plutonium in the WIPP environment results mainly from global nuclear fallout and there is no evidence of increases in radiological contaminants in the region that could be attributed to releases from the WIPP. (author)

  17. A novel deletion in 2q24.1q24.2 in a girl with mental retardation and generalized hypotonia: a case report

    Directory of Open Access Journals (Sweden)

    Palumbo Orazio

    2012-01-01

    Full Text Available Abstract Background Chromosomal imbalances, recognized as the major cause of mental retardation, are often due to submicroscopic deletions or duplications not evidenced by conventional cytogenetic methods. To date, interstitial deletion of long arm of chromosome 2 have been reported for more than 100 cases, although studies reporting small interstitial deletions involving the 2q24.1q24.2 region are rare. With the widespread clinical use of comparative genomic hybridization chromosomal microarray technology, several cryptic chromosome imbalances have outlined new genotype-phenotype correlations and isolated a number of distinctive clinical conditions. Results here we report on a girl with mental retardation and generalized hypotonia. A genome-wide screen for copy number variations (CNVs using single nucleotide polymorphisms (SNPs array revealed a 7.5 Mb interstitial deletion of chromosome region 2q24.1q24.2 encompassing 59 genes, which was absent in parents. The gene content analysis of the deleted region and review of the literature revealed the presence of some genes that may be indicated as good candidate in generating the main clinical features of the patient. Discussion the present case represents a further patient described in the literature with an interstitial deletion of chromosome 2q24.1q24.2. Our patient shares some clinical features with the previously reported patients carriers of overlapping 2q24 deletion. Although more cases are needed to delineate the full-blown phenotype of 2q24.1q24.2 deletion syndrome, published data and present observation suggest that hemizygosity of this region results in a clinically recognizable phenotype. Considering these clinical and cytogenetic similarities, we suggest the existence of an emerging syndrome associated to 2q24.1q24.2 region.

  18. Americium behaviour in plastic vessels

    Energy Technology Data Exchange (ETDEWEB)

    Legarda, F.; Herranz, M. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Idoeta, R., E-mail: raquel.idoeta@ehu.e [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Abelairas, A. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain)

    2010-07-15

    The adsorption of {sup 241}Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of {sup 241}Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of {sup 241}Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  19. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation; Accion EURADOS para la determinacion de americio en craneo mediante medidas in-vivo y simulacion Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ponte, M. A.; Navarro Amaro, J. F.; Perez Lopez, B.; Navarro Bravo, T.; Nogueira, P.; Vrba, T.

    2013-07-01

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  20. Critical and shielding parametric studies with the Monte Carlo code TRIPOLI to identify the key points to take into account during the transportation of blanket assemblies with high ratio of americium

    International Nuclear Information System (INIS)

    In the framework of French research program on Generation IV sodium cooled fast reactor, one possible option consists in burning minor actinides in this kind of Advanced Sodium Technological Reactor. Two types of transmutation mode are studied in the world : the homogeneous mode of transmutation where actinides are scattered with very low enrichment ratio in fissile assemblies and the heterogeneous mode where fissile core is surrounded by blanket assemblies filled with minor actinides with ratio of incorporated actinides up to 20%. Depending on which element is considered to be burnt and on its content, these minor actinides contents imply constraints on assemblies' transportation between Nuclear Power Plants and fuel cycle facilities. In this study, we present some academic studies in order to identify some key constraints linked to the residual power and neutron/gamma load of such kind of blanket assemblies. To simplify the approach, we considered a modeling of a 'model cask' dedicated to the transportation of a unique irradiated blanket assembly loaded with 20% of Americium and basically inspired from an existent cask designed initially for the damaged fissile Superphenix assembly transport. Thermal calculations performed with EDF-SYRTHES code have shown that due to thermal limitations on cladding temperature, the decay time to be considered before transportation is 20 years. This study is based on explicit 3D representations of the cask and the contained blanket assembly with the Monte Carlo code TRIPOLI/JEFF3.1.1 library and concludes that after such a decay time, the transportation of a unique Americium radial blanket is feasible only if the design of our model cask is modified in order to comply with the dose limitation criterion. (author)

  1. Deep vlt spectroscopy of high redshift radio galaxy MRC 2104{242: evidence for a metallicity gradient

    Directory of Open Access Journals (Sweden)

    R. Overzier

    2002-01-01

    Full Text Available En esta contribuci on vamos a presentar observaciones espectrosc opicas profundas del VLT (siglas en ingl es: Very Large Telescope del halo gigante de l neas de emisi on alrededor de la radiogalaxia MRC 2104{242 a z = 2:49. La morfolog a del halo viene determinado por dos regiones espaciales resueltas. Ly se extiende por > 1200 a lo largo del radioeje, C IV 1549 y He II 1640 se extienden por 800. El espectro total es t pico para radiogalaxias de alto corrimiento al rojo. Es interesante notar que N V 1240 est a presente en el espectro de la regi on asociada con el centro de la galaxia que contiene la radiofuente, la regi on del norte, mientras que est a ausente en la regi on del sur. Usando un modelo de fotoionizaci on simple, la diferencia en la emisi on N V 1240 se puede explicar por un gradiente de metalicidad en el halo. Esto es consistente con un escenario en el cual el halo se form o por un "cooling ow" masivo o tiene su origen en los residuos de la fusi on de dos o m as galaxias. Sin embargo, tambi en podr an ser importantes otros mecanismos como son las interacciones entre jets y nubes y los vientos debido a un \\starburst".

  2. Evaluation of nuclear data for 242Pu in the region of resolved and unresolved resonances (10-5 eV-200 keV)

    International Nuclear Information System (INIS)

    Neutron data for 242Pu are evaluated in the resolved and unresolved resonance regions. In the 10-5-1 keV region, the evaluation is based on the Breit-Wigner resonance parameters. In the unresolved resonance region, all types of average cross-section and width are calculated. The authors quote average parameters and cross-sections in the 1-200 keV region and analyse the errors in the evaluated data. (author)

  3. Receiver operating characteristic (ROC) curve analysis of the tumour markers CEA, CA 50 and CA 242 in pancreatic cancer; results from a prospective study.

    OpenAIRE

    Pasanen, P. A.; Eskelinen, M.; Partanen, K.; Pikkarainen, P; Penttilä, I.; Alhava, E

    1993-01-01

    The serum values of the tumour markers carcinoembryonic antigen (CEA), cancer-associated carboanhydrate antigens CA 50 and CA 242 were evaluated in 193 patients with hepatopancreato-biliary diseases by receiver operating characteristic (ROC) curve analysis in order to compare their diagnostic accuracy in pancreatic cancer (n = 26), and to define optimal cut-off levels for the serum values of these tumour markers in the diagnosis of pancreatic cancer. The ROC analysis showed that all marker te...

  4. The use of tumour markers CEA, CA-195 and CA-242 in evaluating the response to chemotherapy in patients with advanced colorectal cancer.

    OpenAIRE

    Ward, U.; Primrose, J N; Finan, P. J.; Perren, T. J.; Selby, P.; Purves, D. A.; Cooper, E H

    1993-01-01

    Tumour markers CEA, CA-195 and CA-242 were measured in 33 patients undergoing chemotherapy for advanced colorectal cancer. The aim was to determine whether they could be used to accurately monitor the course of the disease, and reduce the need for imaging. Treatment with a 5-fluorouracil based regimen resulted in a partial response in nine patients (27%), whereas the remainder either had disease stabilisation or suffered from progression. Before treatment the CEA was elevated in 85% of patien...

  5. Empiema paraneumónico: caracterización y factores asociados a morbi-mortalidad en 242 casos tratados quirúrgicamente Parapneuminic empyema: characterization and factors associated with morbility and mortality in 242 surgical cases

    Directory of Open Access Journals (Sweden)

    Roberto González L

    2012-03-01

    Full Text Available Objetivos: Describir las características y evaluar los factores asociados a morbi-mortalidad en el empiema paraneumónico (EPN tratado quirúrgicamente. Método: Revisión retrospectiva entre Enero 2000 y Agosto 2006. Se describen características y factores asociados a morbi-mortalidad, se realizó análisis univariado y multivariado utilizando programa SPSS 15.0. Resultados: 242 pacientes tenían EPN (70,6% de los empiemas tratados, 165 (68,2% fueron hombres, edad promedio 52,1 años, 229 (94,6% fueron neumonías adquiridas en la comunidad (NAC y 13 (5,4% intrahospitalarias. Se aisló gérmenes en líquido pleural en 57 (23,6%. Se realizaron 183 (75,6% decorticaciones, 49 (20,2% pleurotomías, 7 (2,9%, cirugías video-asistidas y 3 (1,2% decorticaciones con resección pulmonar. Presentaron complicaciones 65 (26,9%. Fallecieron 16 pacientes (6,6%. Se identificaron variables asociadas a morbi-mortalidad. Conclusiones: El EPN es la causa más frecuente de empiema, la mayoría está asociado a NAC y en pocos se identifican gérmenes. La decorticación es el procedimiento más frecuente. Se identificaron las variables asociadas a morbi-mortalidad en esta serie clínica.Objectives: To describe and evaluate factors associated with morbidity and mortality in surgically treated parapneumonic empyemas (PNE. Method: Retrospective review between January 2000 and August 2006. We described clinical features and we performed univariate and multivariate analysis to find the factors associated with morbidity and mortality. SPSS 15.0 program was used in the statistical analysis. Results: 242 of343 surgically treated empyemas (70.6% were paraneumonic. Of these 165 (68.2% were men, average age 52.1 years, 229 (94.6% were community-acquired pneumonia (CAP and 13 (5.4% nosocomial. Germs were isolated in pleural fluid in 57 (23.6%. Surgical procedures were: 183 (75.6% decortications, 49 (20.2% pleurotomies, 7 (2.9% video-assisted surgery and 3 (1.2% decortications

  6. C242T Polymorphism in CYBA Gene (p22phox) and Risk of Coronary Artery Disease in a Population of Caucasian Italians

    Science.gov (United States)

    Nasti, Sabina; Spallarossa, Paolo; Altieri, Paola; Garibaldi, Silvano; Fabbi, Patrizia; Polito, Luisa; Bacino, Luca; Brunelli, Michele; Brunelli, Claudio; Barsotti, Antonio; Ghigliotti, Giorgio

    2006-01-01

    Background: specific polymorphisms of genes regulating intracellular redox balance and oxidative stress are related to atherogenesis. Some studies have identified a relationship between progression of atherosclerosis and C242T mutation in CYBA gene coding for p22phox, a subunit of the NADH/NADPH oxidase system. Design: we investigated whether the C242T nucleotide transition is associated with the presence of coronary artery disease (CAD) in a population of 494 Caucasian Italians undergoing coronary angiography to diagnose the cause of chest pain. Results: the frequency of the T mutant allele that we found in 276 patients with angiographically documented CAD was significantly higher compared to what we observed in 218 subjects with normal coronary arteries (Controls) (respectively: 0.400 and 0.332, p < 0.01). The prevalence of the T allele was even stronger when we compared: 1) early onset (age ≤55) vs late onset (age ≥65) single-vessel CAD patients (respectively: 0.75 and 0.48, p < 0.05), and 2) the subgroup of CAD patients with at least one ≥98% stenosis in a coronary vessel vs those with no ≥98% stenosis in a coronary vessel (respectively: 0.425 and 0.365, p < 0.05). Conclusions: these results support the increased risk of developing early CAD and of having rapid progression of coronary stenosis in subjects carrying the C242T nucleotide transition among the Italian population. PMID:16788250

  7. De Novo 17q24.2-q24.3 microdeletion presenting with generalized hypertrichosis terminalis, gingival fibromatous hyperplasia, and distinctive facial features.

    Science.gov (United States)

    Afifi, Hanan H; Fukai, Ryoko; Miyake, Noriko; Gamal El Din, Amina A; Eid, Maha M; Eid, Ola M; Thomas, Manal M; El-Badry, Tarek H; Tosson, Angie M S; Abdel-Salam, Ghada M H; Matsumoto, Naomichi

    2015-10-01

    Generalized hypertrichosis is a feature of several genetic disorders, and the nosology of these entities is still provisional. Recent studies have implicated chromosome 17q24.2-q24.3 microdeletion and the reciprocal microduplication in a very rare form of congenital generalized hypertrichosis terminalis (CGHT) with or without gingival hyperplasia. Here, we report on a 5-year-old Egyptian girl born to consanguineous parents. The girl presented with CGHT and gingival hyperplasia for whom we performed detailed clinical, pathological, and molecular studies. The girl had coarse facies characterized by bilateral epicanthic folds, thick and abundant eyelashes, a broad nose, full cheeks, and lips that constituted the distinctive facial features for this syndrome. Biopsy of the gingiva showed epithelial marked acanthosis and hyperkeratosis with hyperplastic thick collagen bundles and dense fibrosis in the underlying tissues. Array analysis indicated a 17q24.2-q24.3 chromosomal microdeletion. We validated this microdeletion by real-time quantitative PCR and confirmed a perfect co-segregation of the disease phenotype within the family. In summary, this study indicates that 17q24.2-q24.3 microdeletion caused CGHT with gingival hyperplasia and distinctive facies, which should be differentiated from the autosomal recessive type that lacks the distinctive facies.

  8. The C242T polymorphism of the p22-phox gene (CYBA is associated with higher left ventricular mass in Brazilian hypertensive patients

    Directory of Open Access Journals (Sweden)

    Krieger José E

    2011-08-01

    Full Text Available Abstract Background Reactive oxygen species have been implicated in the physiopathogenesis of hypertensive end-organ damage. This study investigated the impact of the C242T polymorphism of the p22-phox gene (CYBA on left ventricular structure in Brazilian hypertensive subjects. Methods We cross-sectionally evaluated 561 patients from 2 independent centers [Campinas (n = 441 and Vitória (n = 120] by clinical history, physical examination, anthropometry, analysis of metabolic and echocardiography parameters as well as p22-phox C242T polymorphism genotyping. In addition, NADPH-oxidase activity was quantified in peripheral mononuclear cells from a subgroup of Campinas sample. Results Genotype frequencies in both samples were consistent with the Hardy- Weinberg equilibrium. Subjects with the T allele presented higher left ventricular mass/height2.7 than those carrying the CC genotype in Campinas (76.8 ± 1.6 vs 70.9 ± 1.4 g/m2.7; p = 0.009, and in Vitória (45.6 ± 1.9 vs 39.9 ± 1.4 g/m2.7; p = 0.023 samples. These results were confirmed by stepwise regression analyses adjusted for age, gender, blood pressure, metabolic variables and use of anti-hypertensive medications. In addition, increased NADPH-oxidase activity was detected in peripheral mononuclear cells from T allele carriers compared with CC genotype carriers (p = 0.03. Conclusions The T allele of the p22-phox C242T polymorphism is associated with higher left ventricular mass/height2.7 and increased NADPH-oxidase activity in Brazilian hypertensive patients. These data suggest that genetic variation within NADPH-oxidase components may modulate left ventricular remodeling in subjects with systemic hypertension.

  9. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive; Utilizacao de metodos radioanaliticos para determinacao de isotopos de uranio, netunio, plutonio, americio e curio em rejeitos radioativos

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca

    2012-07-01

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  10. Alpha-decay branching ratios to high-lying excited-states of the 242Cm→238pu→ 234U →230Th→226Rn decay chain

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jin-Juan; XU Chang; REN Zhong-Zhou

    2009-01-01

    We present a systematic calculation on the 0c-decay branching ratios to excited-states of an even-even α-decay chain 242Cm→238pu→234U →230Th→226Rn by the improved barrier penetration approach. The changes of the parities between the parent nuclei and the daughter nuclei are properly taken into account. The theoretical values are compared with the available experimental data and the deviation between them is within a factor of 5 in most cases.

  11. Developing an Anticancer Copper(II) Pro-Drug Based on the His242 Residue of the Human Serum Albumin Carrier IIA Subdomain.

    Science.gov (United States)

    Qi, Jinxu; Zhang, Yao; Gou, Yi; Zhang, Zhenlei; Zhou, Zuping; Wu, Xiaoyang; Yang, Feng; Liang, Hong

    2016-05-01

    To increase delivery efficiency, anticancer activity, and selectivity of anticancer metal agents in vivo, we proposed to develop the anticancer metal pro-drug based on His242 residue of the human serum albumin (HSA) carrier IIA subdomain. To confirm our hypothesis, we prepared two Cu(II) compounds [Cu(P4 mT)Cl and Cu(Bp44 mT)Cl] by modifying Cu(II) compound ligand structure. Studies with two HSA complex structures revealed that Cu(P4 mT)Cl bound to the HSA subdomain IIA via hydrophobic interactions, but Cu(Bp44 mT)Cl bound to the HSA subdomain IIA via His242 replacement of a Cl atom of Cu(Bp44 mT)Cl, and a coordination to Cu(2+). Furthermore, Cu(II) compounds released from HSA could be regulated at different pHs. In vivo data revealed that the HSA-Cu(Bp44 mT) complex increased copper's selectivity and capacity of inhibiting tumor growth compared to Cu(Bp44 mT)Cl alone. PMID:27017838

  12. Thermal neutron capture cross-section measurements of 243Am and 242Pu using the new mini-INCA α- and γ-spectroscopy station

    International Nuclear Information System (INIS)

    In the framework of the Mini-INCA project, dedicated to the study of Minor Actinide transmutation process in high neutron fluxes, an α- and γ-spectroscopy station has been developed and installed at the High Flux Reactor of the Laue-Langevin Institut. This set-up allows short irradiations as well as long irradiations in a high quasi-thermal neutron flux and post-irradiation spectroscopy analysis. It is well suited to measure precisely, in reference to 59Co cross-section, neutron capture cross-sections, for all the actinides, in the thermal energy region. The first measurements using this set-up were done on 243Am and 242Pu isotopes. Cross-section values, at En=0.025eV, were found to be (81.8+/-3.6)b for 243Am and (22.5+/-1.1)b for 242Pu. These values differ from evaluated data libraries by a factor of 9% and 17%, respectively, but are compatible with the most recent measurements, validating by the way the experimental apparatus

  13. Partial trisomy 9p22 to 9p24.2 in combination with partial monosomy 9pter in a Syrian girl

    Directory of Open Access Journals (Sweden)

    Moassass Faten

    2010-10-01

    Full Text Available Abstract Background Partial trisomy of the short arm of chromosome 9 is among the most common autosomal structural chromosomal anomalies leading to chromosomal imbalance in human. Clinical characteristics are craniofacial dysmorphism including hypertelorism, prominent nose, deep-set eyes, and down-slanting palpebral fissures. The degree of clinical severity in partial trisomy 9p roughly correlates with the size of the chromosomal imbalance. Therefore, breakpoints as well as clinical findings need to be precisely defined for differential diagnosis. Results Chromosomes of a young female were analyzed due to primary amenorrhea, short stature, developmental delay and a characteristic facial appearance. Cytogenetic analysis using GTG banding identified a karyotype 46, XX, add(9pter. Surprisingly the application of high resolution molecular cytogenetic techniques characterized a partial trisomy 9p24.2-p22 and partial monosomy 9pter-p24.2. To the best of our knowledge only four similar case were reported by now. Conclusion Attempts for genotype-phenotype correlations for partial trisomy 9p might have been hampered by the fact that more complex, cryptic aberrations were neither considered nor detected in comparable clinical cases.

  14. Methylation Status of SP1 Sites within miR-23a-27a-24-2 Promoter Region Influences Laryngeal Cancer Cell Proliferation and Apoptosis

    Directory of Open Access Journals (Sweden)

    Ye Wang

    2016-01-01

    Full Text Available DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells.

  15. ALGUNS ASPECTOS DO MANUSCRITO P-CUG MM 242: OS TENTOS E AS FANTASIAS DE ANTÓNIO CARREIRA E A SUA RELAÇÃO PRÓXIMA COM OS RICERCARI DO LIBRO PRIMO…(1547) DE JACQUES BUUS.

    OpenAIRE

    Oliveira, Filipe

    2011-01-01

    O manuscrito P-Cug MM 242 da Biblioteca Geral da Universidade de Coimbra constitui um dos grandes testemunhos do que foi a realidade da música instrumental em Portugal por volta de meados do século XVI. Em formato de partitura, inclui cópias de motetes, chansons, madrigais e diversas peças instrumentais de alguns dos principais impressos quinhentistas, flamengos e norte italianos. É também no MM 242 que se encontra copiada a totalidade da produção instrumental que até hoje conhecemos de Antón...

  16. Solubility and speciation studies of waste radionuclides pertinent to geologic disposal at Yucca Mountain: Results on neptunium, plutonium and americium in J-13 groundwater; Letter report (R707): Reporting period, October 1, 1985--September 30, 1987

    Energy Technology Data Exchange (ETDEWEB)

    Nitsche, H.; Standifer, E.M.; Lee, S.C.; Gatti, R.C.; Tucker, D.B.

    1988-01-01

    We have studied the solubilities of neptunium, plutonium, and americium in J-13 groundwater from Yucca Mountain (Nevada) at three temperatures and hydrogen ion concentrations. They are 25{degree}, 60{degree}C, and 90{degree}C and pH 5.9, 7.0, and 8.5. The results for 25{degree}C are from a study which we did during FY 1984. We included these previous results in the tables to give more information on the solubility temperature dependence; they were, however, done at only one pH (7.0). The solubilities were studied from oversaturation. The nuclides were added at the beginning of each experiment as NpO{sub 2}{sup +}, Pu{sup 4+}, and Am{sup 3+}. The neptunium solubility decreased with increasing temperature and with increasing pH. The soluble neptunium did not change oxidation state at steady state. The pentavalent neptunium was increasingly complexed by carbonate with increasing pH. All solids were crystalline and contained carbonate, except the solid formed at 90{degree}C and pH 5.9. We identified this solid as crystalline Np{sub 2}P{sub 5}. The 25{degree}C, pH 7 solid was Na{sub 3}NpO{sub 2}(CO{sub 3}){sub 2} {center_dot} nH{sub 2}O. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. Pu(V) and Pu(VI) were the dominant oxidation states in the supernatant solution; as the amount of Pu(V) increased with pH, Pu(VI) decreed. The steady-state solids were mostly amorphous, although some contained a crystalline component. They contained Pu(IV) polymer and unknown carbonates.

  17. Diagnostic value of joint detection of serum CA1 9-9,CA125 and CA242 for cholangiocarci-noma%血清 CA 19-9、CA 125、CA242联合检测对胆管癌诊断价值的评价

    Institute of Scientific and Technical Information of China (English)

    崔大鹏; 韩磊; 刘振显; 杨贺; 张迎春

    2016-01-01

    Objective:To study the diagnostic value of joint detection of serum CA1 9-9,CA125 and CA242 for cholan-giocarcinoma.Methods:A total of 35 patients with cholangiocarcinoma who received surgical resection in our hospital were se-lected as malignant group;30 patients with cholelithiasis who received surgical resection in our hospital during the same period were selected as benign group.Serum samples were collected before surgery to determine CA1 9-9,CA125 and CA242 content;and cholangiocarcinoma tissue and normal bile duct tissue were collected after surgery to determine the content of proliferation and invasion molecules.Results:Serum CA1 9-9,CA125 and CA242 levels of malignant group were significantly higher than those of control group (P <0.05);PROX-1,Ki-67,Bcl-2,Bad,Gab1,LOXL2,TRPM7 and CXCL12 levels in cholangiocar-cinoma tissue were significantly higher than those in benign bile duct tissue (P <0.05);and E-cadherin level was significantly lower than that in benign bile duct tissue (P <0.05);serum CA1 9-9,CA125 and CA242 levels were positively correlated with PROX-1,Ki-67,Bcl-2,Bad,Gab1,LOXL2,TRPM7 and CXCL12 levels,and negatively correlated with E-cadherin level. Conclusions:Joint detection of serum CA1 9-9,CA125 and CA242 can not only provide reference for the diagnosis of cholangio-carcinoma,but also can provide basis for the evaluation of proliferation,invasion and other malignant biological behaviors.%目的::研究血清 CA19-9、CA125、CA242联合检测对胆管癌的诊断价值.方法:选择在我院接受手术切除的35例胆管癌患者作为恶性组,同期在我院接受手术切除的30例胆石症患者作为良性组,术前采集血清标本并测定 CA19-9、CA125、CA242含量,术后采集胆管癌组织和正常胆管组织并测定增殖、侵袭分子的含量.结果:恶性组血清中 CA19-9、CA125、CA242的含量显著高于对照组(P <0.05);胆管癌组织中 PROX-1、Ki-67、Bcl-2、Bad、Gab1、LOXL2、TRPM7、CXCL12

  18. Neutron-induced fission cross sections of 242Pu from 0.3 MeV to 3 MeV

    Science.gov (United States)

    Salvador-Castiñeira, P.; Bryś, T.; Eykens, R.; Hambsch, F.-J.; Göök, A.; Moens, A.; Oberstedt, S.; Sibbens, G.; Vanleeuw, D.; Vidali, M.; Pretel, C.

    2015-10-01

    The majority of the next generation of nuclear power plants (GEN-IV) will work in the fast-neutron-energy region, as opposed to present day thermal reactors. This leads to new and more accurate nuclear-data needs for some minor actinides and structural materials. Following those upcoming demands, the Organisation for Economic Cooperation and Development Nuclear Energy Agency performed a sensitivity study. Based on the latter, an improvement in accuracy from the present 20% to 5% is required for the 242Pu(n ,f ) cross section. Within the same project both the 240Pu(n ,f ) cross section and the 242Pu(n ,f ) cross section were measured at the Van de Graaff accelerator of the Joint Research Centre at the Institute for Reference Materials and Measurements, where quasimonoenergetic neutrons were produced in an energy range from 0.3 MeV up to 3 MeV. A twin Frisch-grid ionization chamber has been used in a back-to-back configuration as fission-fragment detector. The 242Pu(n ,f ) cross section has been normalized to three different isotopes: 237Np(n ,f ) , 235U(n ,f ) , and 238U(n ,f ) . A comprehensive study of the corrections applied to the data and the uncertainties associated is given. The results obtained are in agreement with previous experimental data at the threshold region up to 0.8 MeV. The resonance-like structure at 0.8 to 1.1 MeV, visible in the evaluations and in most previous experimental values, was not reproduced with the same intensity in this experiment. For neutron energies higher than 1.1 MeV, the results of this experiment are slightly lower than the Evaluated Nuclear Data File/B-VII.1 evaluation but in agreement with the experiment of Tovesson et al. (2009) as well as Staples and Morley (1998). Finally, for energies above 1.5 MeV, the results show consistency with the present evaluations.

  19. The synthesis and complex anion-vacancy ordered structure of La0.33Sr0.67MnO2.42

    International Nuclear Information System (INIS)

    The low-temperature topotactic reduction of La0.33Sr0.67MnO3 with NaH results in the formation of La0.33Sr0.67MnO2.42. A combination of neutron powder and electron diffraction data show that La0.33Sr0.67MnO2.42 adopts a novel anion-vacancy ordered structure with a 6-layer OOTOOT' stacking sequence of the 'octahedral' and tetrahedral layers (Pcmb, a=5.5804(1) A, b=23.4104(7) A, c=11.2441(3) A). A significant concentration of anion vacancies at the anion site, which links neighbouring 'octahedral' layers means that only 25% of the 'octahedral' manganese coordination sites actually have 6-fold MnO6 coordination, the remainder being MnO5 square-based pyramidal sites. The chains of cooperatively twisted apex-linked MnO4 tetrahedra adopt an ordered -L-R-L-R- arrangement within each tetrahedral layer. This is the first published example of a fully refined structure of this type which exhibits such intralayer ordering of the twisted tetrahedral chains. The rationale behind the contrasting structures of La0.33Sr0.67MnO2.42 and other previously reported reduced La1-xSrxMnO3-y phases is discussed. - Graphical Abstract: The topotactic reduction of the perovskite phase La0.33Sr0.67MnO3 with NaH yields La0.33Sr0.67MnO2.42(3), which adopts a novel anion vacancy ordered structure with a 6-layer OOTOOT' stacking sequence of the 'octahedral' and tetrahedral layers. The anion site that links the neighbouring octahedral layers is partially occupied so only 25% of the 'octahedral' manganese sites actually have 6-fold MnO6 coordination. Highlights: → Topotactic reduction with NaH to form a mixed valent Mn2+/Mn3+ phase. → Novel layered anion-vacancy ordered structure. → Comparison to related brownmillerite structure types.

  20. Simultaneous measurement of 239Pu, 240Pu, 241Pu, and 242Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments

    International Nuclear Information System (INIS)

    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of 239Pu, 240Pu, 241Pu, and 242Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  1. Microwave dielectric properties and microstructure of Ba2-xSm4+2x/3Ti8+yO24+2y ceramics

    International Nuclear Information System (INIS)

    The microstructure and microwave dielectric properties of barium samarium titanium oxide Ba2-xSm4+2x/3Ti8+yO24+2y (x=0.1, y=0∼2) ceramics (BST) were investigated. The optimum compositions of BST ceramics were synthesized and discussed base on the structure formula of the tungsten-bronze-type crystal phase. Differential thermal analysis (DTA) was used to select the suitable sintering temperatures. The relative dielectric constant of the BST compositions saturated in a range from 63 to 85. Qxf values of 8500-13000 (GHz) were obtained for various y values in dense samples. The temperature coefficient of resonant frequency τf was adjusted from a negative -12 ppm per deg. C value to a positive value 17 ppm per deg. C. X-ray diffraction, SEM and EDS analysis were used to investigate the microstructure and correlate its relationship with microwave dielectric properties of BST ceramics

  2. Antihyperglycemic and antihyperlipidemic activities of 2-(4-[(2-hydroxybenzyl) amino]-phenyl amino-methyl)-phenol in STZ induced diabetic rats.

    Science.gov (United States)

    Sirasanagandla, Swapna; Kasetti, Ramesh Babu; Shaik, Abdul Nabi; Natava, Rajesh; Surtineni, Venkata Prasad; Cirradur, Suresh Reddy; Chippada, Apparao

    2013-08-01

    Oral administration of 2-(4-[(2-hydroxybenzyl) amino]-phenyl amino-methyl)-phenol (HBPMP) (30 mg/kg) to Streptozotocin (STZ) rats produced significant antidiabetic activity after 6 h of HBPMP administration. Treatment of the STZ rats with HBPMP (30 mg/kg/day) for 30 days resulted in a significant decrease in their Fasting Blood Glucose (FBG), Serum Total Cholesterol (TC), Low Density Lipoprotein-Cholesterol (LDL-C), Very Low Density Lipoprotein-Cholesterol (VLDL-C) and triglycerides (TG) along with an increase in serum High Density Lipoprotein-Cholesterol (HDL-C) levels. Activities of Serum Aspartate transaminase (AST), Alanine transaminase (ALT) and Alkaline phosphatase (ALP) and levels of blood urea and creatinine were improved to near normal levels in the treated STZ rats indicating the protective role of the HBPMP against liver and kidney damage and its non-toxic property. In conclusion, HBPMP possesses antihyperglycemic and antihyperlipidemic activities.

  3. The relationship between NAD(P)H oxidase p22phox C242T polymorphism and stroke in the population of Han nationality of Shanghai city%中国上海汉族人群NAD(P)H氧化酶p22phox亚基C242T基因多态性与脑卒中相关性

    Institute of Scientific and Technical Information of China (English)

    李洪涛; 顾彬; 于芳苹; 赵迎春; 娄晓丽; 梁冬雨

    2013-01-01

    目的:研究NAD(P)H氧化酶p22phox亚基C242T基因多态性与脑卒中的相关性.方法:收集118例脑出血患者、125例脑梗死患者和147例正常对照组,研究对象均来自上海地区汉族人群,3组在年龄、性别构成比、体质指数(BMI)等基线指标均没有明显差异,分别进行血糖、血脂等各项指标的测定,用聚合酶链反应、限制性片段长度多态性分析(PCR-RFLP)和基因测序方法比较其在不同人群中的基因突变频率.结果:脑出血组、脑梗死组CT+ TT基因型(9.3%、9.6%)和T等位基因(4.7%、5.2%),均明显高于对照组(2.0%和1.0%,P< 0.05),脑梗死组中发现1例TT基因型,出血组与正常对照组均未发现TT基因型,与基因测序结果一致.采用二分类Logistic回归分析p22phox亚基C242T基因多态性与脑出血的相关性(β=1.712,OR=5.537,95%CI:1.120~27.381,P=0.036),与脑梗死的相关性(B=1.432,OR=4.187,95%CI:0.934~18.774,P=0.061),表明C242T基因多态性可能是脑出血、脑梗死的危险因素.结论:NAD(P)H氧化酶p22phox亚基C242T多态性与脑出血、脑梗死均有一定的相关性,可能是脑卒中的一个危险因素.但与高血压和饮酒等传统危险因素相比,C242T多态性对脑梗死的影响并不显著.%Objective:To investigate the relationship between the NAD (P)H oxidase p22phox C242T gene polymorphism and stroke.Methods:In this study,118 cases of cerebral hemorrhage,125 cases of cerebral infarction and 147 healthy controls were included,all cases are Han people in Shanghai region of China.Three groups had same baseline features of age,sexual proportion and BMI.Fasting glucose,and serum lipids were tested.The genotype and allele frequencies of the p22phox C242T polymorphism were determined by polymemse chain reaction-restriction fragment length polymorphism (PCR-RFLP) and gene sequencing technology.Results:The CT+TT genotype frequencies in the cecebral hemorrhage group,cerebral infarction group

  4. Hypoxia Enhances the Toxicity of Corexit EC9500A and Chemically Dispersed Southern Louisiana Sweet Crude Oil (MC-242 to Sheepshead Minnow (Cyprinodon variegatus Larvae.

    Directory of Open Access Journals (Sweden)

    Subham Dasgupta

    Full Text Available Oil exploration and production activities are common in the northern Gulf of Mexico as well as many other coastal and near coastal areas worldwide. Seasonal hypoxia is also a common feature in the Northern Gulf, and many other coastal areas, which is likely to increase in severity and extent with continuing anthropogenic nutrient inputs. Hypoxia has well established physiological effects on many organisms, and it has been shown to enhance the toxicity of polycyclic aromatic hydrocarbons (persistent components of petroleum in fish. The goal of this study was to examine the combined effects of hypoxia and exposure to contaminants associated with oil spills. We evaluated the effects of short term (48 hr exposures to Corexit EC9500A, water accommodated fractions (WAF, and chemically enhanced water accommodated fractions (CEWAF prepared from Southern Louisiana Sweet Crude Oil (MC 242 on survival of sheepshead minnow (Cyprinodon variegatus larvae held under normoxic (ambient air or hypoxic (2 mg/L O2 conditions. Results demonstrated that hypoxia significantly enhances mortality observed in response to Corexit or CEWAF solutions. In the latter case, significant interactions between the two stressors were also observed. Our data supports the need to further evaluate the combined stresses imparted by hypoxia and exposure to petroleum hydrocarbons and dispersants.

  5. Apparent molar volumes of aqueous calcium chloride to 250{degrees}C, 400 bars, and from molalities of 0.242 to 6.150

    Energy Technology Data Exchange (ETDEWEB)

    Oakes, C.S.; Bodnar, R.J. [Virginia Polytechnic Inst. and Univ., Blacksburg, VA (United States); Simonson, J.M. [Univ. of California, Berkeley, CA (United States)

    1995-09-01

    Relative densities of CaCl{sub 2}(aq) with 0.242 {le} m/(mol-kg{sup {minus}1}) {le} 6.150 were measured with vibrating-tube densimeters between 25 and 250{degrees}C and near 70 and 400 bars. Apparent molar volumes V{sub {null}} calculated from the measured density differences were represented with the Pitzer ion-interaction treatment, with appropriate expressions chosen for the temperature and pressure dependence of the virial coefficients of the model. It was found that the partial molar volume at infinite dilution V{sub {null}}{sup o}, and the second and third virial coefficients B{sup v} and C{sup v}, were necessary to represent V{sub {null}} near the estimated experimental uncertainty. The ionic-strength dependent {Beta}{sup 1}{sup v} term in the B{sup v} coefficient was included in the fit. The representation for V{sub {null}} has been integrated with respect to pressure to establish the pressure dependence of excess free energies over the temperature range studied. The volumetric data indicate that the logarithm of the mean ionic activity coefficient, ln {gamma}{plus_minus}(CaCl{sub 2}), increases by a maximum of 0.3 at 400 bars, 250{degrees}C, and 6 mol-kg{sup {minus}1} as compared with its value at saturation pressure.

  6. The proliferation potential of neptunium and americium

    Energy Technology Data Exchange (ETDEWEB)

    An, J. S.; Shin, J. S.; Kim, J. S.; Kwack, E. H.; Kim, B. K

    2000-05-01

    It is recognized that some trans-uranic elements other than plutonium, in particular Np and Am, if will be available in sufficient quantities, could be used for nuclear explosive devices. The spent fuel has been accumulating in number of nuclear power plant and operation of large scale commercial reprocessing plants. However, these materials are not covered by the definition of special fissionable material in the Agency Statute. At the time when the Statute was adopted, the availability of meaningful quantities of separated Np and Am was remote and they were not included in the definition of special fissionable material. Then, IAEA Board decided a measure for control of Np and Am on September 1999. This report contains the control method and the characteristic of Np and Am for using domestic nuclear industries, and it can be useful for understanding how to report and account of Np and Am. (author)

  7. Delocalization and new phase in Americium: theory

    Energy Technology Data Exchange (ETDEWEB)

    Soderlind, P

    1999-04-23

    Density-functional electronic structure calculations have been used to investigate the high pressure behavior of Am. At about 80 kbar (8 GPa) calculations reveal a monoclinic phase similar to the ground state structure of plutonium ({alpha}-Pu). The experimentally suggested {alpha}-U structure is found to be substantially higher in energy. The phase transition from fcc to the low symmetry structure is shown to originate from a drastic change in the nature of the electronic structure induced by the elevated pressure. A calculated volume collapse of about 25% is associated with the transition. For the low density phase, an orbital polarization correction to the local spin density (LSD) theory was applied. Gradient terms of the electron density were included in the calculation of the exchange/correlation energy and potential, according to the generalized gradient approximation (GGA). The results are consistent with a Mott transition; the 5f electrons are delocalized and bonding on the high density side of the transition and chemically inert and non-bonding (localized) on the other. Theory compares rather well with recent experimental data which implies that electron correlation effects are reasonably modeled in our orbital polarization scheme.

  8. Evaluation of neutron data for americium-241

    Energy Technology Data Exchange (ETDEWEB)

    Maslov, V.M.; Sukhovitskij, E.Sh.; Porodzinskij, Yu.V.; Klepatskij, A.B.; Morogovskij, G.B. [Radiation Physics and Chemistry Problems Inst., Minsk-Sosny (Belarus)

    1997-03-01

    The evaluation of neutron data for {sup 241}Am is made in the energy region from 10{sup -5} eV up to 20 MeV. The results of the evaluation are compiled in the ENDF/B-VI format. This work is performed under the Project Agreement CIS-03-95 with the International Science and Technology Center (Moscow). The Financing Party for the Project is Japan. The evaluation was requested by Y. Kikuchi (JAERI). (author). 60 refs.

  9. SOME ASPECTS OF MANUSCRIPT P-CUG MM 242: ANTÓNIO CARREIRA´S KEYBOARD TENTOS AND FANTASIAS IN ITS CLOSE RELATION WITH JACQUES BUUS´S RICERCARI FROM HIS LIBRO PRIMO…(1547).

    OpenAIRE

    Oliveira, Filipe

    2011-01-01

    Manuscript P-Cug MM 242 from the Biblioteca Geral da Universidade de Coimbra contains important evidence regarding mid-sixteenth century instrumental practice in Portugal. In score-format, it includes copies of motets, chansons, madrigals and instrumental works from some of the most important Flemish and North Italian sixteenth century prints. Additionally, it contains all the music that we know so far by the most important sixteenth century Portuguese keyboard composer, António Carreira. The...

  10. A prospective study of serum tumour markers carcinoembryonic antigen, carbohydrate antigens 50 and 242, tissue polypeptide antigen and tissue polypeptide specific antigen in the diagnosis of pancreatic cancer with special reference to multivariate diagnostic score.

    OpenAIRE

    Pasanen, P. A.; Eskelinen, M.; Partanen, K.; Pikkarainen, P; Penttilä, I.; Alhava, E

    1994-01-01

    The aim of this study was to assess by a stepwise multivariate discriminant analysis the value of four current serum tumour markers - carcinoembryonic antigen (CEA), carbohydrate antigen (CA) 50 and CA 242 and tissue polypeptide antigen (TPA) - and a new serum tumour marker, tissue polypeptide specific antigen (TPS), in the diagnosis of pancreatic cancer. The serum values were measured in a prospective series of patients with jaundice, with unjaundiced cholestasis and with a suspicion of chro...

  11. Association of the NAD(P)H oxidase p22 phox gene C242T polymorphism with type 2 diabetes mellitus, diabetic nephropathy, and carotid atherosclerosis with type 2 diabetes mellitus: A meta-analysis

    OpenAIRE

    Tao Li; Hai-feng Xi; Hong-min Luo; Wen-xuan Liu; Xia Gao; Dian-wu Liu; Lei Yang

    2015-01-01

    Background: Several epidemiological studies have evaluated the association between the NAD(P)H oxidase p22 phox gene C242T polymorphism and the risk of type 2 diabetes mellitus (T2DM), diabetic nephropathy (DN), and carotid atherosclerosis with T2DM (CA), but the results are inconclusive. This meta-analysis was therefore designed to clarify these controversies. Methods: Systematic searches were performed using electronic databases such as MEDLINE, PubMed, EMBASE, and China National Knowled...

  12. Independent prognostic value of preoperative serum markers CA 242, specific tissue polypeptide antigen and human chorionic gonadotrophin beta, but not of carcinoembryonic antigen or tissue polypeptide antigen in colorectal cancer.

    OpenAIRE

    Carpelan-Holmström, M; Haglund, C.; Lundin, J; Alfthan, H.; Stenman, U H; Roberts, P. J.

    1996-01-01

    The prognostic value of preoperative serum concentrations of carcinoembryonic antigen (CEA), CA 242, tissue polypeptide antigen (TPA), specific tissue polypeptide antigen (TPS) and human chorionic gonadotrophin beta (hCG beta) in 251 patients with colorectal cancer (39 Dukes' A, 98 Dukes' B, 56 Dukes' C and 58 Dukes' D) was investigated. When using the cut-off levels recommended for diagnostic purposes, there was a significantly longer overall survival in patients with low tumour marker level...

  13. «Some aspects of P-Cug, MM 242: António Carreira’s keyboard tentos and fantasias and their close relationship with Jacques Buus’s ricercari from his Libro primo (1547)»

    OpenAIRE

    Oliveira, Filipe Mesquita de

    2013-01-01

    Manuscript P-Cug MM 242 from the Biblioteca Geral da Universidade de Coimbra contains important evidence regarding mid-sixteenth century instrumental practice in Portugal. In score-format, it includes copies of motets, chansons, madrigals and instrumental works from some of the most important Flemish and North Italian sixteenth century prints. Additionally, it contains all the music that we know so far by the most important sixteenth century Portuguese keyboard composer, António Carreira. The...

  14. SILICATE, WATER TEMPERATURE, FLUORESCENCE, PHOTOSYNTHETIC ACTIVE RADIATION (PAR) and other profile and discrete sample data collected in the Gulf of Alaska on the ALPHA HELIX cruises HX242, HX244 and others as part of the NEP project from 2001-04-18 to 2003-08-11 (NODC Accession 0113348)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113348 includes profile, discrete sample, biological, chemical and physical data collected aboard the ALPHA HELIX during cruises HX242, HX244,...

  15. SALINITY, WATER TEMPERATURE, FLUORESCENCE, PHOTOSYNTHETIC ACTIVE RADIATION (PAR) and other profile data collected in the Gulf of Alaska on the ALPHA HELIX cruises HX242, HX244 and others as part of the NEP project from 2001-04-18 to 2003-08-11 (NODC Accession 0115255)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0115255 includes profile, biological and physical data collected aboard the ALPHA HELIX during cruises HX242, HX244, HX247, HX271 and HX275 in the...

  16. CHLOROPHYLL A, growth rate and graze rate (or grazing rate) site samples data collected in the Gulf of Alaska on the ALPHA HELIX cruises HX242, HX244 and others as part of the NEP project from 2001-04-18 to 2003-08-10 (NODC Accession 0114241)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0114241 includes site samples and biological data collected aboard the ALPHA HELIX during cruises HX242, HX244, HX247, HX271 and HX275 in the Gulf of...

  17. Measurement of the Neutron Capture Cross Sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm with a Total Absorption Calorimeter at n_TOF

    CERN Multimedia

    Beer, H; Wiescher, M; Cox, J; Rapp, W; Embid, M; Dababneh, S

    2002-01-01

    Accurate and reliable neutron capture cross section data for actinides are necessary for the poper design, safety regulation and precise performance assessment of transmutation devices such as Fast Critical Reactors or Accelerator Driven Systems (ADS). The goal of this proposal is the measurement of the neutron capture cross sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm at n_TOF with an accuracy of 5~\\%. $^{233}$U plays an essential role in the Th fuel cycle, which has been proposed as a safer and cleaner alternative to the U fuel cycle. The capture cross sections of $^{237}$Np,$^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm play a key role in the design and optimization of a strategy for the Nuclear Waste Transmutation. A high accuracy can be achieved at n_TOF in such measurements due to a combination of features unique in the world: high instantaneous neutron fluence and excellent energy resolution of the facility, innovative Data Acquisition System based on flash ADCs and t...

  18. Effect of (3,5,6-trimethylpyrazin-2-yl)methyl 2-[4-(2-methylpropyl)phenyl]propanoate (ITE), a newly developed anti-inflammatory drug, on type II collagen-induced arthritis in mice.

    Science.gov (United States)

    Ma, Tao; Cao, Ying-Lin; Xu, Bei-Bei; Zhou, Xiao-Mian

    2004-06-01

    The effect of (3,5,6-trimethylpyrazin-2-yl)methyl 2-[4-(2-methylpropyl)phenyl]propanoate (ITE) on type II collagen (CII)-induced arthritis in mice was studied. Mice were immunized twice with CII, ITE being given orally once a day for 40 d after the 1st immunization. Clinical assessment showed that ITE had no effect on the day of onset of arthritis but did lowered the incidence rate of arthritis and the arthritis score. And ITE had a marked suppressive effect on the mouse hind paw edema induced by CII. ITE suppressed the delayed-type mouse ear skin reaction to CII but had no effect on the level of serum anti-CII antibodies. These results suggest that ITE inhibits the development of CII-induced arthritis in mice by suppressing delayed-type hypersensitivity to CII.

  19. Measurements of Cross Sections and Decay Properties of the Isotopes of Elements 112, 114 and 116 Produced in the Fusion Reactions $^{233,238}$U, $^{242}$Pu, and $^{248}$Cm + $^{48}$Ca

    CERN Document Server

    Oganessian, Yu T; Utyonkov, V K; Lobanov, Yu V; Abdullin, F S; Polyakov, A N; Shirokovsky, I V; Tsyganov, Yu S; Gulbekyan, G G; Bogomolov, S L; Gikal, B N; Mezentsev, A N; Iliev, S; Subbotin, V G; Sukhov, A M; Voinov, A A; Buklanov, G V; Subotic, K M; Zagrebaev, V I; Itkis, M G; Patin, J B; Moody, K J; Wild, J F; Stoyer, M A; Stoyer, N J; Shaughnessy, D A; Kenneally, J M; Wilk, P A; Lougheed, R W; Ilkaev, R I; Vesnovskii, S P

    2004-01-01

    We have studied the dependence of the production cross-sections of the isotopes $^{282,283}$112 and $^{286,287}$114 on the excitation energy of the compound nuclei $^{286}$112 and $^{290}$114. The maximum cross-section values of the \\textit{xn}-evaporation channels for the reaction $^{238}$U($^{48}$Ca, \\textit{xn})$^{286 - x}$112 were measured to be: $\\sigma _{3n}=2.5_{-1.1}^{ + 1.8} $pb and $\\sigma _{4n}=0.6_{ - 0.5}^{ + 1.6} $ pb; for the reaction $^{242}$Pu($^{48}$Ca, \\textit{xn})$^{290 - x}$114: $\\sigma _{2n}\\sim 0.5$ pb, $\\sigma _{3n}=3.6_{- 1.7}^{ + 3.4} $ pb and $\\sigma _{4n}=4.5_{ - 1.9}^{ + 3.6} $ pb. In the reaction $^{233}$U($^{48}$Ca, 2--4$n$)$^{277 - 279}$112 at $E^*=34.9\\pm $2.2 MeV we measured an upper cross-section limit of $\\sigma _{xn} \\leqslant 0.6$ pb. The observed shift of the excitation energy associated with the maximum sum evaporation residue cross section $\\sigma _{\\rm {ER}}(E^*)$ to values significantly higher than that associated with the calculated Coulomb barrier can be caused by ...

  20. Historical Review of Californium-252 Discovery and Development

    Science.gov (United States)

    Stoddard, D. H.

    1985-01-01

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed. (PLG)

  1. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  2. Study of the electrochemical oxidation of Am with lacunary heteropolyanions and silver nitrate; Etude de l'oxydation electrochimique de l'americium en presence d'heteropolyanions lacunaires et de nitrate d'argent en milieu aqueux acide

    Energy Technology Data Exchange (ETDEWEB)

    Chartier, D

    1999-07-01

    Electrochemical oxidation of Am(III) with certain lacunary heteropolyanions (LHPA {alpha}{sub 2}-P{sub 2}W{sub 17}O{sub 61}{sup 10-} or {alpha}SiW{sub 11}O{sub 39}{sup 8-}) and silver nitrate is an efficient way to prepare Am(VI). This document presents bibliographic data and an experimental study of the process. Thus, it has been established that Am(IV) is an intermediate species in the reaction and occurs in 1:1 (Amt{sup IV}LHPA) or 1:2 (Am {sup IV}(LHAP){sub 2}) complexes with the relevant LHPA. These 1:1 complexes of Am(IV) have been identified and isolated in this work whereas 1:2 complexes were known from previous studies. The reactivity of these complexes in oxidation shows that 1:1 complexes of Am(IV) are oxidised much more quickly than 1:2 complexes. Apparent stability constants of Am(III) and Am(IV) complexes with the relevant LHPA have been measured for a 1 M nitric acid medium. Thermodynamic data of the reaction are then assessed: redox potentials of Am pairs are computed for a 1 M nitric acid medium containing various amount of LHPA ligands. Those results show that the role of LHPA is to stabilize the intermediate species Am(IV) by lowering the Am(IV)/Am(III) pair potential of about 1 Volt. Nevertheless, if this stabilisation is too strong (i.e. of tungsto-silicate), the oxidation of Am(IV) requires high anodic potential (more than 2 V/ENH). Then, the faradic yield of the oxidation of americium is poor because of water oxidation. This study has also shown that the main role of silver is to catalyze the electrochemical oxidation of Am{sup IV}(LHPA){sub X} complexes. Indeed, these oxidations without silver are extremely slow. An oxygen tracer experiment has been performed during the oxidation of Am(III) in Am(VI). It has been shown that the oxygen atoms of Am(VI) (AMO{sub 2}{sup 2+}) come from water molecules of the solvent and not from the complexing oxygen atoms of the ligands. (author)

  3. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions; Fabricacion de blancos para la transmutacion de americio: sintesis de matrices inertes por el metodo sol-gel. Estudio del procedimiento de infiltracion de disoluciones radiactivas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Carretero, A. [Universidad Complutense de Madrid (Spain)

    2002-07-01

    made. In addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  4. Prevalência e padrão de distribuição das doenças cerebrovasculares em 242 idosos, procedentes de um hospital geral, necropsiados em Belo Horizonte, Minas Gerais, no período de 1976 a 1997 Prevalence and types of cerebrovascular diseases in 242 hospitalized elderly patients, autopsied in Belo Horizonte, Minas Gerais, Brazil, from 1976 to 1997

    Directory of Open Access Journals (Sweden)

    José Eymard H. Pittella

    2002-03-01

    Full Text Available OBJETIVO: Descrever a prevalência e os tipos das doenças cerebrovasculares (DCVs em indivíduos idosos necropsiados. MÉTODO: Foram consultados os laudos neuropatológicos de 242 pacientes com idade igual ou superior a 61 anos, procedentes em sua maioria do Hospital das Clínicas da Universidade Federal de Minas Gerais, em Belo Horizonte, Minas Gerais, e necropsiados consecutivamente no período 1976 a 1997. RESULTADO: Os principais grupos de doenças do sistema nervoso central (SNC foram representados por DCVs (71,9%, infecções (12,4%, neoplasias (7,1%, traumatismos crânio-encefálicos (3,7%, doenças nutricionais (2,5% e doenças degenerativas (1,7%. As DCVs mais frequentes foram: aterosclerose (61,2%, doença cerebrovascular hipertensiva (25,6% e infarto cerebral (14,9%. Observou-se aumento da frequência e da gravidade da aterosclerose e da frequência da doença cerebrovascular hipertensiva com o avançar da idade. Houve associação significativa entre doença cerebrovascular hipertensiva e aterosclerose. As DCVs foram clinicamente sintomáticas e as responsáveis diretas pelo óbito em 42,7% e 17,3% dos pacientes, respectivamente. CONCLUSÃO: As DCVs constituíram o principal grupo de doenças do SNC no idoso. A aterosclerose e a doença cerebrovascular hipertensiva foram as principais doenças deste grupo, notando-se aumento de sua frequência com o avançar da idade e associação significativa entre ambas.OBJECTIVE: To describe the prevalence and the types of cerebrovascular diseases (CVDs in autopsied elderly individuals. METHOD: Consecutive clinical charts and neuropathological reports of 242 patients aged 61 years or older were reviewed. The patients died in Hospital das Clínicas, Federal University of Minas Gerais, in Belo Horizonte, Minas Gerais, Brazil, from 1976 to 1997. RESULTS: The prevalent diseases of the central nervous system (CNS found in decreasing order were: CVDs (71.9%, infections (12.4%, neoplasms (7.1%, head

  5. Preparation of americium targets for nuclear chemistry experiments at DANCE

    International Nuclear Information System (INIS)

    Using 1 gram of 241Am from LANL stocks, the purification steps required to obtain a solution of 241Am from the original material are described. Part of the purified solution was submitted for purity analysis by mass spectrometry, radiochemistry and trace metals analysis. The impurities were expected to be 239Pu and 237Np. A second fraction of this material was used for electroplating three samples onto titanium disks that were suitable for insertion into an instrument package to be placed into the DANCE detector. The purification methods used, the electroplating setup and the solutions to various problems that were encountered in making these targets are discussed. The analytical results are discussed as well as the yields from the electrodeposition process. Comparison of these yields with those from similar experiments utilizing 235U and 243Am are also discussed. (author)

  6. Americium separation from nuclear fuel dissolution using higher oxidation states.

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher

    2009-09-01

    Much of the complexity in current AFCI proposals is driven by the need to separate the minor actinides from the lanthanides. Partitioning and recycling Am, but not Cm, would allow for significant simplification because Am has redox chemistry that may be exploited while Cm does not. Here, we have explored methods based on higher oxidation states of Am (AmV and AmVI) to partition Am from the lanthanides. In a separate but related approach we have also initiated an investigation of the utility of TRUEX Am extraction from thiocyanate solution. The stripping of loaded TRUEX by Am oxidation or SCN- has not yet proved successful; however, the partitioning of inextractable AmV by TRUEX shows promise.

  7. Recovery of neptunium, plutonium, and americium from highly active waste

    International Nuclear Information System (INIS)

    Trialkylphosphine oxides (TRPO) (alkyl is 6c-C8) were chosen as the extractant for the recovery of Np, Pu, and Am from highly active waste (HAW) because of its extraction ability, excellent solvent behavior, high radiolytic stability, and low cost. Process chemistry based on 30 vol % TRPO-kerosene as solvent is presented. Extraction of Am in the presence of macro amounts of neodymium, adjustment of Np valence by electrolytic reduction, selective stripping of actinides from loaded organic phase, and loading capacity of the solvent are included. Process parameters of multistage countercurrent extraction and stripping and the results of experimental verification are given. From HAW with ∼1 M nitric acid concentration, recovery of actinides is higher than 99.9%. The actinides extracted can be stripped out separately into Am, Np-Pu, and U fractions. The behavior of nonactinide HAW constituents, including Tc, is discussed

  8. Property Data for Simulated Americium/Curium Glasses

    International Nuclear Information System (INIS)

    The authors studied the properties of mixed lanthanide-alumino-borosilicate glasses. Fifty-five glasses were designed to augment a previous, Phase I, study by systematically varying the composition of Ln2O3 and the concentrations of Ln2O3, SiO2, B2O3, Al2O3, and SrO in glass. These glasses were designed and fabricated at the Savannah River Technology Center and tested at the Pacific Northwest National Laboratory. The properties measured include the high-temperature viscosity (η) as a function of temperature (T) and the liquidus temperature (TL) of Phase II test glasses

  9. The vapour pressure of americium(III) chloride

    International Nuclear Information System (INIS)

    Based on the method described by Fischer, an ultramicro-size appratus was developed for static determination of the saturation vapour pressure of highly radioactive materials. The apparatus was tested with MgCl2, MnCl2, HoCl3 and ScF3. The vapour pressure curves of MgCl2 and MnCl2 were in good agreement with other publications and thus proved the efficiency of the apparatus in spite of its difficulties of handling. The values measured for HoCl3 and ScF3 differed from those of earlier publications. However, these deviations have been observed before and may be the result of the different measuring principles of static and dynamic methods. For AmCl3, the following vapour pressure equation was established: log psub(Torr)=-(11826/T)+10.7. The thermodynamic parameters of the evaporation process were calculated on this basis, and the values for AmBr3 and PnCl3 were determined by extrapolation. (orig.)

  10. 1976 Hanford americium-exposure incident: accident description

    International Nuclear Information System (INIS)

    An accident is described, involving the explosion of an ion-exchange column containing about 100 g of 241Am. A chemical operator was injured in this accident, receiving acid burns and superficial cuts on the upper part of his body. From 1 to 5 curies of 241Am is estimated to have been deposited on the injured worker and on his clothing

  11. Further Studies of Plutonium and Americium at Thule, Greenland

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Dahlgaard, Henning; Nilsson, Karen Kristina;

    1984-01-01

    Eleven years after the accidental loss of nuclear weapons in 1968, the fourth scientific expedition to Thule occurred. The estimated inventory of 1 TBq 239,240Pu in the marine sediments was unchanged when compared with the estimate based on the 1974 data. Plutonium from the accident had moved...

  12. 24 CFR 242.54 - Nondiscrimination.

    Science.gov (United States)

    2010-04-01

    ... all applicable civil rights laws and regulations, including 24 CFR part 200, subpart J (Equal Employment Opportunity), and the Americans with Disabilities Act (42 U.S.C. 12101 et seq.). Racially... and sex discrimination do not affect the eligibility of hospitals for women and children....

  13. 48 CFR 242.7501 - Policy.

    Science.gov (United States)

    2010-10-01

    ... provide reasonable assurance that— (a) Applicable laws and regulations are complied with; (b) The... DEFENSE CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES Contractor Accounting Systems...

  14. 24 CFR 242.16 - Applications.

    Science.gov (United States)

    2010-04-01

    ...) Service area definition; (B) Existing or proposed hospital; (C) Designation as sole community provider... mix, market trends, population forecasts, and business climate; (v) The hospital's demonstrated ability to position itself to compete in its marketplace; (vi) Organizational affiliations...

  15. 24 CFR 242.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... acquiring new or replacement equipment may be included in the cost of construction. Days of cash on hand..., supplies, tools, books, records (whether in written or electronic form), computer equipment (hardware and... would cause an application to be rejected have been identified, and therefore there appears to be no...

  16. 32 CFR 242.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... ADMISSION POLICIES AND PROCEDURES FOR THE SCHOOL OF MEDICINE, UNIFORMED SERVICES UNIVERSITY OF THE HEALTH... advanced (junior-senior level) nonscholarship ROTC. (4) Individuals in attendance at any of the three.... Means the Medical School program of the Uniformed Services University of the Health Sciences. (e)...

  17. 17 CFR 242.402 - General provisions.

    Science.gov (United States)

    2010-04-01

    ... Regulation T, U or X of the Board of Governors of the Federal Reserve System (12 CFR parts 220, 221, and 224...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer...

  18. 17 CFR 242.401 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...) Regulation T means Regulation T promulgated by the Board of Governors of the Federal Reserve System, 12 CFR... M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer...

  19. 17 CFR 242.403 - Required margin.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer Margin... of a customer in a securities account or futures account as set forth in this section. (b) Required... be twenty (20) percent of the current market value of such security future. (2) Offsetting...

  20. 32 CFR 242.5 - Admission procedures.

    Science.gov (United States)

    2010-07-01

    ... qualified applicants, based on aptitude, intelligence, maturity, personality, emotional stability, diligence... military personnel, if required, shall be performed at the individual's supporting military medical facility and reviewed by the Department of Defense Medical Examination Review Board (DoDMERB)....

  1. 36 CFR 242.4 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... and wildlife resources and their habitats in a condition that assures stable and continuing natural... that local rural residents engaged in subsistence uses may be a natural part of that ecosystem... Rivers Systems, National Forest Monument, National Recreation Area, National Conservation Area,...

  2. 43 CFR 24.2 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... new opportunities to foster a “good neighbor” policy with the States. ...: Interior Office of the Secretary of the Interior DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE POLICY: STATE... Policy is to clarify and support the broad authorities and responsibilities of Federal 2 and...

  3. 17 CFR 242.201 - Price test.

    Science.gov (United States)

    2010-04-01

    ... M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Sho.... For the purposes of this section: (1) The term covered security shall mean any NMS stock as defined...

  4. 17 CFR 242.300 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Ats... or more of the capital of the alternative trading system. (g) NMS stock shall have the meaning... NMS stock for purposes of this Regulation ATS. (h) Effective transaction reporting plan shall have...

  5. 19 CFR 10.242 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... of a finding or trimming of non-textile materials, that the finding or trimming is a product of a... Harmonized Tariff Schedule of the United States. Knit-to-Shape Components. “Knit-to-shape,” when used with... or other personal effects during travel) and brief cases, portfolios, school bags,...

  6. 2-[4-(2-Formylphenoxybutoxy]benzaldehyde

    Directory of Open Access Journals (Sweden)

    Aliakbar Dehno Khalaji

    2011-09-01

    Full Text Available In the crystal structure of the title compound, C18H18O4, the full molecule is generated by the application of an inversion centre. The molecule is essentially planar, with an r.m.s. deviation of 0.017 (1 Å for all non-H atoms. The molecules are linked through intermolecular C—H...O interactions to form a molecular sheet parallel to the (overline{1}02 plane.

  7. Measurements of cross sections and decay properties of the isotopes of elements 112, 114, and 116 produced in the fusion reactions 233,238U, 242Pu, and 248Cm+48Ca

    International Nuclear Information System (INIS)

    We have studied the dependence of the production cross sections of the isotopes 282,283112 and 286,287114 on the excitation energy of the compound nuclei 286112 and 290114. The maximum cross section values of the xn-evaporation channels for the reaction 238U(48Ca,xn)286-x112 were measured to be σ3n=2.5-1.1+1.8 pb and σ4n=0.6-0.5+1.6 pb; for the reaction 242Pu(48Ca,xn)290-x114: σ2n∼0.5 pb, σ3n=3.6-1.7+3.4 pb, and σ4n=4.5-1.9+3.6 pb. In the reaction 233U(48Ca,2-4n)277-279112 at E*=34.9=2.2 MeV we measured an upper cross section limit of σxn≤0.6 pb. The observed shift of the excitation energy associated with the maximum sum evaporation residue cross section σER(E*) to values significantly higher than that associated with the calculated Coulomb barrier can be caused by the orientation of the deformed target nucleus in the entrance channel of the reaction. An increase of σER in the reactions of actinide targets with 48Ca is consistent with the expected increase of the survivability of the excited compound nucleus upon closer approach to the closed neutron shell N=184. In the present work we detected 33 decay chains arising in the decay of the known nuclei 282112, 283112, 286114, 287114, and 288114. In the decay of 287114(α)→283112(α)→279110(SF), in two cases out of 22, we observed decay chains of four and five sequential α transitions that end in spontaneous fission of 271Sg (Tα/SF=2.4-1.0+4.3 min) and 267Rf (TSF∼2.3 h), longer decay chains than reported previously. We observed the new nuclide 292116 (Tα=18-6+16 ms,Eα=10.66±0.07 MeV) in the irradiation of the 248Cm target at a higher energy than in previous experiments. The observed nuclear decay properties of the nuclides with Z=104-118 are compared with theoretical nuclear mass calculations and the systematic trends of spontaneous fission properties. As a whole, they give a consistent pattern of decay of the 18 even-Z neutron-rich nuclides with Z=104-118 and N=163-177. The experiments were

  8. The clinical analysis about the dilatation for the stoma narrow after operation of carcinoma of esophago cardia%扩张治疗242例食管贲门癌术后吻合口狭窄疗效分析

    Institute of Scientific and Technical Information of China (English)

    林焕雄; 蔡文

    2010-01-01

    目的 总结扩张治疗食管贲门癌术后吻合口狭窄的临床疗效.方法 采用沙氏扩张器治疗242例吻合口狭窄患者.结果 共行扩张治疗647例次,平均2.67次/人.有效率99.1%,痊愈率达87.6%.结论 采用沙氏扩张器是治疗食管贲门癌术后吻合口狭窄一种安全、简便、有效手段之一.%Objective The author summarizes the clinical curative effect about the dilatation for the stoma narrow after operation of carcinoma of esophago cardia. Methods 242 patients included were expanded with Savary-Gilliard dilator. Results 647 expanding therapies were made, average 2.67 times per patient. The effective rate is 99.1%,the recovery rate is 87.6%. Conclusion The dilatation using Savary-Gilliard dilator is one of the safe, convenient, effective methods in the treatment of stoma narrow after operation of carcinoma of esophago cardia.

  9. Two different zinc(II)-aqua complexes held up by a metal-oxide based support: Synthesis, crystal structure and catalytic activity of [HMTAH]2[{Zn(H2O)5}{Zn(H2O)4}{Mo7O24}].2H2O (HMTAH = protonated hexamethylenetetramine)

    Indian Academy of Sciences (India)

    T Arumuganathan; A Srinivasarao; T Vijay Kumar; Samar K Das

    2008-01-01

    An inorganic−organic hybrid material, [HMTAH]2[{Zn(H2O)5}{Zn(H2O)4}{Mo7O24}].2H2O (1) (where HMTAH = protonated hxamethylenetetramine) has been synthesized and structurally characterized. The compound 1 crystallizes in a monoclinic space group 2/. The crystal data of 1: = 43.12(3), = 12.399(10), = 16.285(13), = 111.131(11), = 8. Its crystal structure shows that two different Zn(II)-aqua complexes, [Zn(H2O)5]2+ and [Zn(H2O)4]2+ are covalently coordinated to a heptamolybdateanion [Mo7O24]6- resulting in an anionic species of polyoxometalate supported zinc-aqua complexes, [{Zn(H2O)}{Zn(H2O)4}{Mo7O24}]2-, that is stabilized with two protonated hexamethylenetetramine cations in the title compound 1. In the crystal structure, both lattice water molecules are found to interact with the heptamolybdate cluster anion and the protonated hexamethylenetetramine cation resulting in an intricate three-dimensional hydrogen bonding network. Interestingly, compound 1 exhibits catalytic activity towards oxidation of some primary alcohols.

  10. Simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments; Mesure des isotopes du plutonium des sediments marins par spectrometrie de masse a plasma couple inductivement haute resolution (HR ICP-MS)

    Energy Technology Data Exchange (ETDEWEB)

    Bruneau, F

    1999-07-01

    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  11. チェルノブイリ原子力発電所事故起因の環境中超ウラン元素

    OpenAIRE

    山本, 政儀

    1989-01-01

    The accident at the Chernobyl reactor site starting at 26th April 1986 caused a widespread distribution of radionuclides. In all countries radiation measurements and analyses of samples have been made to show the features to consider in a dosimetric evalution, but transuranium elements have been less investigated. In Europe, the determination of several transuranium elements, such as neptunium (Np-239), plutonium (Pu-238, 239, 240, 241), americium (Am-241) and curium (Cm-242) was possible....

  12. Investigation of the retention and distribution of americium-241 in the baboon and the enhanced removal of americium-241 from the body by diethylenetriaminepentaacetic acid (DTPA)

    International Nuclear Information System (INIS)

    Experiments were performed to study the metabolism and distribution of intravenously administered 241Am in the adult and juvenile baboon; in addition, decorporation therapy using Na3-CaDTPA was performed on selected baboons to assess the efficacy of this drug in removing systemic burdens of 241Am from this primate species. Determination of the kinetics of 241Am was accomplished principally by in vivo methodologies and by radiochemical analysis of 241Am activity of biological material. The use of Na3-CaDTPA as a therapeutic agent for the removal of 241Am from the body proved to be an effective form of treatment in the case of early administration. (U.S.)

  13. 241Am (n,gamma) isomer ratio measurement

    Energy Technology Data Exchange (ETDEWEB)

    Bond, Evelyn M [Los Alamos National Laboratory; Vieira, David J [Los Alamos National Laboratory; Moody, Walter A [Los Alamos National Laboratory; Slemmons, Alice K [Los Alamos National Laboratory

    2011-01-05

    The objective of this project is to improve the accuracy of the {sup 242}Cm/{sup 241}Am radiochemistry ratio. We have performed an activation experiment to measure the {sup 241}Am(n,{gamma}) cross section leading to either the ground state of {sup 242g}Am (t{sub 1/2} = 16 hr) which decays to {sup 242}Cm (t{sub 1/2} = 163 d) or the long-lived isomer {sup 242m}Am (t{sub 1/2} = 141 yr). This experiment will develop a new set of americium cross section evaluations that can be used with a measured {sup 242}Cm/{sup 241}Am radiochemical measurement for nuclear forensic purposes. This measurement is necessary to interpret the {sup 242}Cm/{sup 241}Am ratio because a good measurement of this neutron capture isomer ratio for {sup 241}Am does not exist. The targets were prepared in 2007 from {sup 241}Am purified from LANL stocks. Gold was added to the purified {sup 241}Am as an internal neutron fluence monitor. These targets were placed into a holder, packaged, and shipped to Forschungszentrum Karlsruhe, where they were irradiated at their Van de Graff facility in February 2008. One target was irradiated with {approx}25 keV quasimonoenergetic neutrons produced by the {sup 7}Li(p,n) reaction for 3 days and a second target was also irradiated for 3 days with {approx}500 keV neutrons. Because it will be necessary to separate the {sup 242}Cm from the {sup 241}Am in order to measure the amount of {sup 242}Cm by alpha spectrometry, research into methods for americium/curium separations were conducted concurrently. We found that anion exchange chromatography in methanol/nitric acid solutions produced good separations that could be completed in one day resulting in a sample with no residue. The samples were returned from Germany in July 2009 and were counted by gamma spectrometry. Chemical separations have commenced on the blank sample. Each sample will be spiked with {sup 244}Cm, dissolved and digested in nitric acid solutions. One third of each sample will be processed at a time

  14. 48 CFR 2452.242-71 - Contract management system.

    Science.gov (United States)

    2010-10-01

    ... DEVELOPMENT CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses... parts: (1) Baseline plan. The baseline plan shall consist of: (i) A narrative portion that: (A...) Progress reports. Progress reports shall consist of: (i) A narrative portion that: (A) Provides a...

  15. 48 CFR 1852.242-72 - Observance of legal holidays.

    Science.gov (United States)

    2010-10-01

    ... by Federal statute, Executive Order, or the President's proclamation. (b) When any holiday falls on a Saturday, the preceding Friday is observed. When any holiday falls on a Sunday, the following Monday is... representative. If the Contractor's on-site personnel work during a holiday other than those in paragraph (a)...

  16. Facility effluent monitoring plan for 242-A Evaporator facility

    International Nuclear Information System (INIS)

    A facility effluent monitoring plan is required by the US Department of Energy in DOE Order 5400.1* for any operations that involve hazardous materials and radioactive substances that could affect employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation showed the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility effluent Monitoring Plans, WHC-EP-0438-1**. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements

  17. Radiative capture on $^{242}$Pu for MOX fuel reactors

    CERN Multimedia

    The use of MOX fuel (mixed-oxide fuel made of UO$_{2}$ and PuO$_{2}$) in nuclear reactors allows substituting a large fraction of the enriched Uranium by Plutonium reprocessed from spent fuel. Indeed around 66% of the plutonium from spent fuel is made of $^{239}$Pu and $^{241}$Pu, which are fissile in thermal reactors. A typical reactor of this type uses a fuel with 7% reprocessed Pu and 93% depleted U, thus profiting from both the spent fuel and the remaining $^{238}$U following the $^{235}$U enrichment. With the use of such new fuel compositions rich in Pu the better knowledge of the capture and fission cross sections of the Pu isotopes becomes very important. This is clearly stated in the recent OECD NEA’s “High Priority Request List” and in the WPEC-26 “Uncertainty and target accuracy assessment for innovative systems using recent covariance data evaluations” report. In particular, a new series of cross section evaluations have been recently carried out jointly by the European (JEFF) and United ...

  18. Preface: phys. stat. sol. (b) 242/1

    Science.gov (United States)

    Ginzburg, V. L.; Maksimov, E. G.

    2005-01-01

    We have accepted with great pleasure the suggestion of the Guest Editor Miodrag Kuli to write a short preface to the special issue of this journal, which is devoted to the role played by electron-phonon interaction (EPI) in high-temperature superconductors (HTSC). From the very beginning, it was absolutely clear to us that there is no metal in which the EPI could be ignored, and high-temperature superconducting compounds cannot be an exception in this respect. We expressed this opinion, in particular, in our early Review Article [1] and in the talk [2] given at the Grenoble M2S HTSC Conference in 1994. We would like to emphasize that we were not in isolation. There have been many other researchers, some authors of this issue among them, who have also considered the EPI as an essential part of the physics of high-temperature superconductors. However, a large part of researchers in the field, including a few famous scientists, have considered the EPI to be irrelevant to high-temperature superconductivity. Up to now, we do not understand the scientific basis for such an opinion. Moreover, that point of view has never been shared by some other famous scientists; in this respect mention should be made of J. Friedel and A. A. Abrikosov.Turning back to physics, we would like to point out some features of high-temperature superconducting cuprates, which should lead to the existence of a strong EPI in these materials. First of all, it is the proximity of these compounds, even in the optimally doped case, to the layered ionic crystals. This fact has been emphasized in our early publications as well as in many papers by other authors, and it is discussed in detail in the Review Article by C. Falter published in this issue. There are other approaches to the HTSC compounds, which allow to consider that a strong EPI exists. They are also based on some peculiarities in the crystalline and chemical structure of these compounds, in particular, on their multiphase nanoscale structure. This point is discussed by J. Phillips in this issue.There are also many experimental indications in favor of the existence of a strong EPI in the HTSC cuprates. For example, the behavior of the electron relaxation, the peculiarities of the phonon spectra, the interaction of the Josephson current with phonons, and the electron mass renormalization. All these phenomena have been discussed in the recent Review Articles [3, 4]. Currently, additional evidence was provided which has thrown new light on the role played by the EPI in HTSC systems. These are the ARPES experiments conducted by the Stanford group, which have given an unambiguous proof of the electron mass renormalization due to the EPI. A Review Article of this group by T. Cuk et al. is also presented in this issue. We should also mention the contribution of L. Pintschovius who presented new interesting results on the electron-phonon coupling effects observed by means of inelastic neutron scattering.A comprehensive discussion of a major part of the electron-phonon coupling effects presented in the Review Articles [1, 3] has been based on the traditional approach of the Eliashberg type. Up to now, we consider this approach to be quite suitable for pursuing a number of goals, mainly for describing properties of the normal state. Nevertheless, we do not disclaim the importance of more detailed investigations of the EPI, which take into account the strong anisotropy, the interplay between electron-phonon and electron-electron interaction, and the non-adiabatic effects. Four Review Articles in this issue, by Schneider, by Rösch, Han, Gunnarsson and Crespi, by Kuli and Dolgov, and by Cappelluti and Pietronero are devoted to different aspects of these problems.To conclude, we would like to emphasize that the main problem related to the mechanism of superconductivity in the HTSC cuprates is the interplay between the strong EPI and the electron exchange and correlation. Unfortunately, previous work did not crack this problem and much effort should be made in the future. We hope that the publication of this issue will aid to attract the attention of many researchers to the investigation of unsolved problems of the EPI in HTSC systems.

  19. 17 CFR 242.100 - Preliminary note; definitions.

    Science.gov (United States)

    2010-04-01

    ... the distribution. (3) In the case of a distribution involving a merger, acquisition, or exchange offer... distribution participant, issuer, or selling security holder in connection with the acquisition or...

  20. Dicty_cDB: VSF242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TAATAGAAAATAAT sequence update 2001. 3.22 Translated Amino Acid sequence kxtw*fiipkhrirkt*t*ikeigpstklllygyq...iaptlxffflienn Translated Amino Acid sequence (All Frames) Frame A: kxtw*fiipkhrirkt*t*ikeigpstklllygyqlsrl*...istvtvvepslpfshtpktlsfavhvql lllnqlvvvleslpvvv*dknptkvtvqshqrfqfff**kinnkkkcyvqsnniici*nf iykkk--- ---rtw*fiipkhrirkt*t*ikeigps

  1. 48 CFR 1552.242-72 - Financial administrative contracting officer.

    Science.gov (United States)

    2010-10-01

    ... statements are in compliance with Cost Accounting Standards and FAR part 31; (C) Determine the contractor's compliance with Cost Accounting Standards and disclosure statements, if applicable; and (D) Negotiate price... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Financial...

  2. 48 CFR 3052.242-71 - Dissemination of contract information.

    Science.gov (United States)

    2010-10-01

    ... prescribed in (HSAR) 48 CFR 3042.202-70, insert the following clause: Dissemination of Contract Information... performance of this contract, without the prior written consent of the Contracting Officer. An electronic or... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Dissemination of...

  3. 49 CFR 24.2 - Definitions and acronyms.

    Science.gov (United States)

    2010-10-01

    ... United States as defined in 8 CFR 103.12 and includes: (i) An alien present in the United States who has... date, supported by the presentation and analysis of relevant market information. (4) Business. The term... received or earned by dependent children and full time students under 18 years of age. (See appendix...

  4. Facility effluent monitoring plan for 242-A evaporator facility

    International Nuclear Information System (INIS)

    A facility effluent monitoring plan is required by the U.S. Department of Energy in DOE Order 5400.1 for any operations that involve hazardous materials and radioactive substances that could affect employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation showed the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP-0438-1. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements. This facility effluent monitoring plan shall ensure long-range integrity of the effluent monitoring systems by requiring an update whenever a new process or operation introduces new hazardous materials or significant radioactive materials. This document must be reviewed annually even if there are no operational changes, and it must be updated, as a minimum, every three years

  5. 24 CFR 242.79 - Environmental quality determinations and standards.

    Science.gov (United States)

    2010-04-01

    ... Environmental quality determinations and standards. Requirements set forth in 24 CFR part 50, “Protection and Enhancement of Environmental Quality,” 24 CFR part 51, “Environmental Criteria and Standards,” and 24 CFR part... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Environmental...

  6. 50 CFR 216.242 - Permissible methods of taking.

    Science.gov (United States)

    2010-10-01

    ... annually). (G) Blue whale (Balaenoptera musculus)—4005 (an average of 801 annually). (ii) Odontocetes: (A... of 4202 annually). (C) Minke whale (Balaenoptera acutorostrata)—2075 (an average of 415 annually). (D) Sei whale (Balaenoptera borealis)—5285 (an average of 1057 annually). (E) Fin whale...

  7. 48 CFR 652.242-72 - Shipping Instructions.

    Science.gov (United States)

    2010-10-01

    ... from bad cross grain and from knots or knotholes that interfere with nailing or that occupy more than 1... firmly stapled in position to prevent the straps from slipping off the box. Articles must be secured...

  8. Motivation for New Measurements on 241, 242, 243Am Isotopes

    International Nuclear Information System (INIS)

    The initial objective of this work was an updated review on the Am isotopes data since the next official release (3.1) of the JEFF3 evaluated data file is foreseen around June 2005. Alternatively, this work searches for the possible reasons of the observed discrepancies between differential and integral measurement results. In particular, strong differences are encountered on σγth values and epithermal branching ratio values for the 241Am. Although the JEF2.2 validation is used as guide in parallel with a systematic study of all differential and integral results available, the need for new measurements clearly shows up. This paper finally draws up a list of desired and feasible new differential and integral measurements on the Am isotopes

  9. 40 CFR 52.242 - Disapproved rules and regulations.

    Science.gov (United States)

    2010-07-01

    ... regulations. Link to an amendment published at 75 FR 37730, June 30, 2010. (a) The following Air Pollution... Cellular (Foam) Products,” submitted on March 7, 2008 and adopted on September 7, 2007. (2) Antelope Valley Air Pollution Control District. (i) Rule 118, Emergencies, submitted on March 10, 1998. (3)...

  10. 48 CFR 242.202 - Assignment of contract administration.

    Science.gov (United States)

    2010-10-01

    ... Defense Energy Support Center, Defense Logistics Agency. (ii) Contract administration functions for base... subcontract that includes foreign contract military sale (FMS) requirements, the contract...

  11. Dicty_cDB: AFH242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CA sequence update 2001. 6. 2 Translated Amino Acid sequence claywvyntvysytsl*rii...r*snsynirslnykwss*nwc*sleelktslpisnklqs Frame C: claywvyntvysytsl*riikknkkkek*vmfmill*ldqvfqv*cvvin*krmdikf*

  12. 17 CFR 242.610 - Access to quotations.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... national securities exchange or national securities association to the quotations in an NMS stock displayed... displays quotations in an NMS stock through an SRO display-only facility shall provide a level and cost...

  13. 17 CFR 242.612 - Minimum pricing increment.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... display, rank, or accept from any person a bid or offer, an order, or an indication of interest in any NMS... accept from any person a bid or offer, an order, or an indication of interest in any NMS stock priced...

  14. 17 CFR 242.301 - Requirements for alternative trading systems.

    Science.gov (United States)

    2010-04-01

    ... COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY... forth in paragraph (b)(3)(ii) of this section, with respect to any NMS stock in which the alternative... volume of 5 percent or more of the aggregate average daily share volume for such NMS stock as reported...

  15. 17 CFR 242.505 - Exclusion for news media.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Ac... registered with the Commission as a broker or dealer or investment adviser. Regulation NMS—Regulation of...

  16. 17 CFR 242.611 - Order protection rule.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... NMS stocks that do not fall within an exception set forth in paragraph (b) of this section and, if... bid was priced higher than a protected offer in the NMS stock. (5) The transaction that...

  17. 48 CFR 242.302 - Contract administration functions.

    Science.gov (United States)

    2010-10-01

    ... solicitation or award. (S-70) Serve as the single point of contact for all Single Process Initiative (SPI... agreements for SPI processes, when authorized by the affected components. (S-71) DCMA has responsibility...

  18. 7 CFR 2.42 - Administrator, Farm Service Agency.

    Science.gov (United States)

    2010-01-01

    ...), except as delegated to the Under Secretary for Food, Nutrition, and Consumer Services in § 2.19 and to... and Consumer Service and the Agricultural Marketing Service in the procurement, handling, payment, and... Older Americans Act of 1965, as amended (42 U.S.C. 3030a), and section 4(a) of the Agriculture...

  19. 36 CFR 242.27 - Subsistence taking of fish.

    Science.gov (United States)

    2010-07-01

    ... crossing; (B) Bonanza Creek; (C) Jim River including Prospect and Douglas Creeks. (x) You may not... south of a line extending east from Cape Douglas (58°51.10' North latitude), west of 150° West longitude...' West longitude), to the northeastern tip of Mary's Island (57°42.40' North latitude, 152°32.00'...

  20. 48 CFR 1852.242-70 - Technical direction.

    Science.gov (United States)

    2010-10-01

    ... Direction (SEP 1993) (a) Performance of the work under this contract is subject to the written technical..., the fixed fee (if any), or the time required for contract performance; (4) Changes any of the expressed terms, conditions, or specifications of the contract; or (5) Interferes with the...

  1. 7 CFR 1951.242 - Servicing delinquent Community Facility loans.

    Science.gov (United States)

    2010-01-01

    ... HOUSING SERVICE, RURAL BUSINESS-COOPERATIVE SERVICE, RURAL UTILITIES SERVICE, AND FARM SERVICE AGENCY... loans. (a) For the purpose of this section, a loan is delinquent when a borrower fails to make all or... 7 Agriculture 14 2010-01-01 2009-01-01 true Servicing delinquent Community Facility loans....

  2. Facility effluent monitoring plan for 242-A evaporator facility

    Energy Technology Data Exchange (ETDEWEB)

    Crummel, G.M.; Gustavson, R.D.

    1995-02-01

    A facility effluent monitoring plan is required by the U.S. Department of Energy in DOE Order 5400.1 for any operations that involve hazardous materials and radioactive substances that could affect employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation showed the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP-0438-1. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements. This facility effluent monitoring plan shall ensure long-range integrity of the effluent monitoring systems by requiring an update whenever a new process or operation introduces new hazardous materials or significant radioactive materials. This document must be reviewed annually even if there are no operational changes, and it must be updated, as a minimum, every three years.

  3. Preface: phys. stat. sol. (b) 242/9

    Science.gov (United States)

    Sánchez, Maria

    2005-07-01

    The XVII Latin American Symposium on Solid State Physics took place in the conference rooms of the Convent San Francisco de Asis, in the heart of the Old Havana. The sixteen previous editions were organized in eight different countries; the last two were in Colombia (Cartagena, 1999) and Venezuela (Merida, 2002). After eighteen years the meeting came back to Havana in 2004.The program topics included: Surfaces and interfaces analysis; Spintronics; Magnetism; Materials and energy; Ab-initio methods, simulations and modeling in solids; Nanophysics, nanomaterials and nanotechnology; New materials, properties and applications; Preparation of materials, thin films and characterization; High temperature superconductivity; Techniques of structural analysis in solids. The program included 6 plenary talks, 13 invited talks, 58 oral presentations (in eight sessions) and 200 poster contributions (in four poster sessions).The meeting attracted more than 200 participants from 14 countries. The physica status solidi Young Researcher Award sponsored by Wiley-VCH was conferred at the meeting. This prize was divided between two participants: Clara Calderón (Study of electrical transport properties of ZnO thin films used as front contact of solar cells) from Colombia and Aim?? Pelaiz Barranco (AC behavior in lanthanum modified PZT ferroelectric ceramics) from Cuba. Special Mentions went to Val??rie Halté (Femtosec-ond dynamics of transmission of gold arrays of sub-wavelength holes) from France, Erick Larramendi Cancio (Cd desorption induced by Zn exposure during atomic layer epitaxy of CdxZn1-xTe) and Julio Cesar Rimada Herrera (Quantum and conversion efficiency calculation of AlGaAs/GaAs multiple quantum well solar cells) from Cuba.Nanostructures and in general low dimensional physics related to different systems was a very hot topic during the meeting. Some talks and presentations were devoted to optoelectronic materials and devices. Characterization of solids by different structural and optical techniques together with modeling and simulations were also important subjects of the symposium.The XVIII Symposium will be held in Mexico in 2006.The editors wish to thank all the participants who contributed to the success of the meeting and hope that it helped to develop close links between researchers and institutions of Latin America.

  4. 10 CFR 72.242 - Recordkeeping and reports.

    Science.gov (United States)

    2010-01-01

    ... NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of... fabrication deficiency affects the ability of structures, systems, and components important to safety...

  5. 36 CFR 242.11 - Regional advisory councils.

    Science.gov (United States)

    2010-07-01

    ... Board will identify the interest(s) the applicants propose to represent on the respective Regional... Regional Council. To ensure that each Council represents a diversity of interests, the Board will strive to... councils. (a) The Board shall establish a Regional Council for each subsistence resource region...

  6. Dicty_cDB: CHE242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CAGATT ATAAT sequence update 2002. 9.10 Translated Amino Acid sequence ---xikrgxanfc*xlsxgkpipxxx*rf*xh*kx*k...nce (All Frames) Frame A: ---xikrgxanfc*xlsxgkpipxxx*rf*xh*kx*kpxskxkkgfpxrsxkvxfsvgkq ikxwwxffrtitfqkespspl...slvkxsl*klkvlitlkmlkprskikkvfxqinkd*slpvnn*kmvxlsqii Frame C: ---x*kgxskfllkxfxxkahpxxxlkvlxtlkxlkaxiqxxkrvs

  7. 47 CFR 90.242 - Travelers' information stations.

    Science.gov (United States)

    2010-10-01

    ... station. (4) For a station employing a conventional radiating antenna(s) (ex. vertical monopole... point on the cable. For a conventional radiating antenna, the estimated field strength contour at 1.5 km...) For each transmitter site, the transmitter's output power, the type of antenna utilized, its...

  8. Biosorption of radionuclide Americium-241 by A. niger spore and hyphae

    International Nuclear Information System (INIS)

    The biosorption of radionuclide 241Am from solution was studied by a. niger spore and hyphae, and the effects of the operational conditions on the treatment were investigated. The results showed the treatment by A. niger spore and hyphae were very efficient. An average of 96% of the total 241Am was removed from 241Am solutions of 5.6-111 MBq/L (C0), with adsorption capacities (W) of 7.2-142.4 MBq/g biomass, 5.2-106.5 MBq/g, respectively. The biosorption equilibrium was achieved within 1 h and the optimum pH value ranged 3-0.1 mol/L HNO3 and 3-2 for spore and hyphae of A. niger, respectively. No significant effects on 241Am biosorption were observed at 15 degree C-45 degree C, or challenged with containing Au3+ or Ag+, even 2000 times above 241Am amount. the index relationship between concentrations and adsorption capacities of 241Am indicated that the 241Am biosorption by A. niger spore and hyphae obey to Freundlich adsorption equation. The adsorption behavior of A. niger spore and hyphae were basically coincident

  9. Americium and plutonium release behavior from irradiated mixed oxide fuel during heating

    Science.gov (United States)

    Sato, I.; Suto, M.; Miwa, S.; Hirosawa, T.; Koyama, S.

    2013-06-01

    The release behavior of Pu and Am was investigated under the reducing atmosphere expected in sodium cooled fast reactor severe accidents. Irradiated Pu and U mixed oxide fuels were heated at maximum temperatures of 2773 K and 3273 K. EPMA, γ-ray spectrometry and α-ray spectrometry for released and residual materials revealed that Pu and Am can be released more easily than U under the reducing atmosphere. The respective release rate coefficients for Pu and Am were obtained as 3.11 × 10-4 min-1 and 1.60 × 10-4 min-1 at 2773 K under the reducing atmosphere with oxygen partial pressure less than 0.02 Pa. Results of thermochemical calculations indicated that the main released chemical forms would likely be PuO for Pu and Am for Am under quite low oxygen partial pressure.

  10. Fabrication of uranium-americium mixed oxide fuels: thermodynamical modeling and materials properties

    International Nuclear Information System (INIS)

    Fuel irradiation in pressurized water reactors lead to the formation of fission products and minor actinides (Np, Am, Cm) which can be transmuted in fast neutrons reactors. In this context, the aim of this work was to study the fabrication conditions of the U1-yAmyO2+x fuels which exhibit particular thermodynamical properties requiring an accurate monitoring of the oxygen potential during the sintering step. For this reason, a thermodynamical model was developed to assess the optimum sintering conditions for these materials. From these calculations, U1-yAmyO2+x (y=0.10; 0.15; 0.20; 0.30) were sintered in two range of atmosphere. In hyper-stoichiometric conditions at low temperature, porous and multiphasic compounds are obtained whereas in reducing conditions at high temperature materials are dense and monophasic. XAFS analyses were performed in order to obtain additional experimental data for the thermodynamical modeling refinement. These characterizations also showed the reduction of Am(+IV) to Am(+III) and the partial oxidation of U(+IV) to U(+V) due to a charge compensation mechanism occurring during the sintering. Finally, taking into account the high - activity of Am, self-irradiation effects were studied for two types of microstructures and two Am contents (10 and 15%). For each composition, a lattice parameter increase was observed without structural change coupled with a macroscopic swelling of the pellet diameter up to 1.2% for the dense compounds and 0.6% for the tailored porosity materials. (author)

  11. Chemical behaviour of americium in natural aquatic solutions: Hydrolysis, radiolysis and redox reactions

    International Nuclear Information System (INIS)

    Hydrolysis and redox reactions of the Am(III) and Am(V) ions have been investigated in NaClO4 and NaCl solutions as well as in natural saline groundwaters. The hydrolysis constants of Am(OH)n3-n species and the solubility product of Am(OH)3(s) have been determined in 0.1 M NaClO4, 0.1 M NaCl and 0.6 M NaCl solutions. As observed in concentrated NaCl solutions (> 3 M), the α-radiation induces the radiolytic oxidation of the Cl--ion to produce Cl2, HClO, ClO- and other oxidized species, which result in a strongly oxidizing medium. Consequently Am(III) is oxidized to Am(V). Under these conditions the hydrolysis constants of AmO2(OH)n1-n species and the solubility product are also determined. The α-radiation induced radiolysis reactions in NaCl solution and the subsequent oxidation reaction of Am(III) have been systematically investigated by varying pH, NaCl concentration and specific α-activity. Also included in the investigation are a few selected groundwaters of relatively high salinity from the Gorleben aquifer systems. (orig.)

  12. Effect of solvent on in vitro dissolution: Summary of results for uranium, americium, and cobalt aerosols

    International Nuclear Information System (INIS)

    The revised 10 CFR Part 20 has adopted the ICRP Publication 30 method for calculating the committed effective dose equivalent from intakes of radionuclides. This dosimetry scheme requires knowledge or assumptions about the chemical form of the radionuclide, its particle size, and its known or assumed solubility. The solubility is classified as being either D (relatively soluble), W, or Y (relatively insoluble), depending on whether the material dissolves over periods of days, weeks, or years. Although Nuclear Regulatory Commission licensees may wish to take advantage of material-specific knowledge in order to adjust annual limits on intake and derived air concentrations, relatively few radioactive materials to which workers and the general population may be exposed have been adequately characterized either in terms of physicochemical form or solubility. Experimental measurement of solubility using some type of in vitro dissolution measurement system is therefore needed. However, there is currently no clear consensus regarding the appropriate design of in vitro dissolution systems, particularly when considering the range of different radionuclides to be studied, and the complexity of the biological mechanisms involved in the retention and clearance of inhaled deposited radioactive particles. The purpose of this study was to evaluate the effect of the several solvents on the dissolution of four test aerosols (57Co3O4, 241AmO2, ammonium diuranate [ADU], and U3O8) selected to encompass a variety of chemical and biochemical properties in vivo. The results of this study provide some guidance on the usefulness of in vitro dissolution tests for estimating the solubility of unknown radionuclide particles within the context of a simple model such as the class D, W, and Y formulation of ICRP 30

  13. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kazi, Zakir H. [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Cornett, Jack R., E-mail: jack.cornett@uottawa.ca [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Zhao, Xaiolei; Kieser, Liam [Department of Physics, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada)

    2014-06-01

    Highlights: • Am and Pu were adsorbed and separated using a single extraction chromatography DGA column. • Pu was eluted from the column completely using on-column reduction of Pu(IV) to Pu(III). • ²⁴¹Am and 239,240Pu measurements by accelerator mass spectrometry (AMS) agree with the certified values in two SRMs. Abstract: A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8 M HNO₃ with 0.05 M NaNO₂ before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO₃, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl₃ facilitated the complete desorption of Pu. Interferences (e.g. Ca²⁺, Fe³⁺) were washed off from the resin bed with excess HNO₃. Using NdF₃, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7 ± 5.3% and 95.5 ± 4.6% for ²⁴¹Am and ²⁴²Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1 ± 6.0 and 96.8 ± 5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1–100 Bq kg⁻¹. The single column separation of Pu and Am saves reagents, separation time, and cost.

  14. New Synthetic Methods and Structure-Property Relationships in Neptunium, Plutonium, and Americium Borates. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht-Schmitt, Thomas Edward

    2013-09-14

    The past three years of support by the Heavy Elements Chemistry Program have been highly productive in terms of advanced degrees awarded, currently supported graduate students, peer-reviewed publications, and presentations made at universities, national laboratories, and at international conferences. Ph.D. degrees were granted to Shuao Wang and Juan Diwu, who both went on to post-doctoral appointments at the Glenn T. Seaborg Center at Lawrence Berkeley National Laboratory with Jeff Long and Ken Raymond, respectively. Pius Adelani completed his Ph.D. with me and is now a post-doc with Peter C. Burns. Andrea Alsobrook finished her Ph.D. and is now a post-doc at Savannah River with Dave Hobbs. Anna Nelson completed her Ph.D. and is now a post-doc with Rod Ewing at the University of Michigan. As can be gleaned from this list, students supported by the Heavy Elements Chemistry grant have remained interested in actinide science after leaving my program. This follows in line with previous graduates in this program such as Richard E. Sykora, who did his post-doctoral work at Oak Ridge National Laboratory with R. G. Haire, and Amanda C. Bean, who is a staff scientist at Los Alamos National Laboratory, and Philip M. Almond and Thomas C. Shehee, who are both staff scientists at Savannah River National Laboratory, Gengbang Jin who is a staff scientist at Argonne National Lab, and Travis Bray who has been a post-doc at both LBNL and ANL. Clearly this program is serving as a pipe-line for students to enter into careers in the national laboratories. About half of my students depart the DOE complex for academia or industry. My undergraduate researchers also remain active in actinide chemistry after leaving my group. Dan Wells was a productive undergraduate of mine, and went on to pursue a Ph.D. on uranium and neptunium chalcogenides with Jim Ibers at Northwestern. After earning his Ph.D., he went directly into the nuclear industry.

  15. Separation of Americium from Fission Product Lanthanides Using Cyanex 301 Extraction

    Institute of Scientific and Technical Information of China (English)

    ZHU Yongjun; CHEN Jing

    2001-01-01

    The extraction behavior of bis (2,4,4-trimethylpentyl)dithiophosphinic acid (HBTMPDTP),purified from Cyanex 301,was studied for extracting Am3+ and trivalent lanthanides (Lns).HBTMPDTP shows very high selectivity for Am.Separation factor(SF)of Am and Eu,SF Am/Eu,(trace amount)reaches a high value of 5.9×103 and SF Am/(Pr+Nd) (macro amount)is about 2×103.The mathematical model for the distribution ratios and process parameters calculated for HBTMPDTP extraction was established and the calculated results were verified experimentally.In a five-stage countercurrent process,the extraction rates of Am and Lns were >99.999% and 0.14%,respectively,to fulfill the separation requirements.The efficiency of this process was also verified in a cross-flow extraction experiment using a genuine Am-FPLns fraction.In the presence of TBP,the extraction of Am and Eu is enhanced,but their separation is reduced to some extent.A fairly good separation was achieved in a fractional extraction process using a mixture of HBTMPDTP and TBP in kerosene at low pH.

  16. Plutonium and americium in air on the coasts of the Irish Sea

    International Nuclear Information System (INIS)

    Measurements of artificial radionuclides in air, deposition and seawater were carried out at coastal and inland locations in Cumbria, south-west Scotland, Northern Ireland and North Wales. The measurements were undertaken to determine the distribution of artificial radionuclides in the coastal environment attributable to discharges from Sellafield and to investigate the mechanisms responsible for the increased radionuclide concentration in the marine aerosol and their subsequent transfer to land. A number of different sampling methods were used and the contribution each method could make to the understanding of the marine aerosol was assessed. Measurements of the size distribution of the marine aerosol was also undertaken. The measurements demonstrated that the actinide concentrations measured in the air and deposition at coastal locations could be related to near shore sea water concentrations, but that no direct proportionality existed. It was also determined that a significant proportion of the material transferred from sea to land was associated with larger particulate present in the marine aerosol during conditions of above average onshore winds. (author)

  17. Mean squared slowing-down distance and age of americium-beryllium neutrons in perspex

    International Nuclear Information System (INIS)

    THe mean squared slowing-down distance 2>, and the age to thermal capture (Migration Area), M2, are direct measures of the slowing.down, and the spreading out, processes of neutrons in a medium. They also enter directly into reactor calculations. These parameters have been determined experimentally for Am-Be neutrons (mean energy 4.46 MeV), in a block of perspex, using the activities induced in thin indium foils from the 115In(n,γ)116In reactions. (author) 13 refs.; 5 figs.; 2 tabs

  18. Effect of solvent on in vitro dissolution: Summary of results for uranium, americium, and cobalt aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Guilmette, R.A.; Hoover, M.D.

    1995-12-01

    The revised 10 CFR Part 20 has adopted the ICRP Publication 30 method for calculating the committed effective dose equivalent from intakes of radionuclides. This dosimetry scheme requires knowledge or assumptions about the chemical form of the radionuclide, its particle size, and its known or assumed solubility. The solubility is classified as being either D (relatively soluble), W, or Y (relatively insoluble), depending on whether the material dissolves over periods of days, weeks, or years. Although Nuclear Regulatory Commission licensees may wish to take advantage of material-specific knowledge in order to adjust annual limits on intake and derived air concentrations, relatively few radioactive materials to which workers and the general population may be exposed have been adequately characterized either in terms of physicochemical form or solubility. Experimental measurement of solubility using some type of in vitro dissolution measurement system is therefore needed. However, there is currently no clear consensus regarding the appropriate design of in vitro dissolution systems, particularly when considering the range of different radionuclides to be studied, and the complexity of the biological mechanisms involved in the retention and clearance of inhaled deposited radioactive particles. The purpose of this study was to evaluate the effect of the several solvents on the dissolution of four test aerosols ({sup 57}Co{sub 3}O{sub 4}, {sup 241}AmO{sub 2}, ammonium diuranate [ADU], and U{sub 3}O{sub 8}) selected to encompass a variety of chemical and biochemical properties in vivo. The results of this study provide some guidance on the usefulness of in vitro dissolution tests for estimating the solubility of unknown radionuclide particles within the context of a simple model such as the class D, W, and Y formulation of ICRP 30.

  19. Distribution of plutonium and americium in human and animal tissues after chronic exposures

    International Nuclear Information System (INIS)

    The distribution of plutonium in the tissues of a group of southern Finns was determined. Their Pu intake had been solely from fallout via inhalation. A group of northern Finns was also studied. They obtain most of the Pu from inhalation, but also some from their diet which is rich in reindeer liver. Reindeer obtain large amounts of transuranium elements in their natural winter diet, which mainly consists of lichen. Pu-239, 240 and Am-241 were also analyzed in elk because it is closely related to reindeer but does not feed on lichen. It was found that much of the Am-241 in reindeer tissues is due to ingrowth from Pu-241 in the animal. The aim of this study to establish whether this situation is also true for the human bone. (H.K.)

  20. Separation of americium(III) from lanthanides(III) by nanofiltration-complexation in aqueous medium

    International Nuclear Information System (INIS)

    The separation of Am(III) from a mixture of lanthanides(III) was performed in aqueous medium by nanofiltration combined with a complexation step using a DTPA derivative as selective complexing agent. (author)