WorldWideScience

Sample records for americium 239

  1. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  2. Determination of Neptunium, Americium and Curium in Spent Nuclear Fuel Samples by Alpha Spectrometry Using {sup 239}Np and {sup 243}Am as a Spike and a Tracer

    Energy Technology Data Exchange (ETDEWEB)

    Jeo, Kih-Soo; Song, Byung-Chul; Kim, Young-Bok; Han, Sun-Ho; Jeon, Young-Shin; Jung, Euo-Chang; Jee, Kwang-Yong [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2007-07-01

    Determination of actinide elements and fission products in spent nuclear fuels is of importance for a burnup determination and source term evaluation. Especially, the amounts of uranium and plutonium isotopes are used for the evaluation of a burnup credit in spent nuclear fuels. Additionally, other actinides such as Np, Am and Cm in spent nuclear fuel samples is also required for the purposes mentioned above. In this study, {sup 237}Np, {sup 241}Am and {sup 244}Cm were determined by an alpha spectrometry for the source term data for high burnup spent nuclear fuels ranging from 37 to 62.9 GWD/MtU as a burnup. Generally, mass spectrometry has been known as the most powerful method for isotope determinations such as high concentrations of uranium and plutonium. However, in the case of minor actinides such as Np, Am and Cm, alpha spectrometry would be recommended instead. Determination of the transuranic elements in spent nuclear fuel samples is different from that for environmental samples because the amount of each nuclide in the spent fuel samples is higher and the relative ratios between each nuclide are also different from those for environmental samples. So, it is important to select an appropriate tracer and an optimum sample size depending on the nuclides and analytical method. In this study {sup 237}Np was determined by an isotope dilution alpha(gamma) spectrometry using {sup 239}Np as a spike, and {sup 241}Am and curium isotopes were determined by alpha spectrometry using {sup 243}Am as a tracer. The content of each nuclide was compared with that by the Origen-2 code.

  3. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  4. Particulate distribution of plutonium and americium in surface waters from the Spanish Mediterranean coast

    Energy Technology Data Exchange (ETDEWEB)

    Molero, J.; Sanchez-Cabeza, J.A.; Merino, J.; Vidal-Quadras, A. [Universidad Autonoma de Barcelona (Spain); Vives Batlle, J.; Mitchell, P.I. [University Coll., Dublin (Ireland)

    1995-12-31

    Measurements of the particulate distribution of plutonium and americium in Spanish Mediterranean coastal waters have been carried out. Plutonium-239,340 and {sup 241}Am concentrations have been measured in suspended particulate matter by filtering (< 0.22 {mu}m) large volume (200-300 litres) sea water samples. Results indicate that particulate plutonium constitutes on average 11 {+-} 4% of the total concentration in sea water. In the case of americium this percentage rises to 45 {+-} 14%. From the {sup 241}Am/{sup 239,240}Pu activity ratios it is clear that suspended particulate matter is enriched in {sup 241}Am relative to {sup 239,240}Pu by a factor 8 {+-} 4. Plutonium and americium in surface Mediterranean coastal waters appear to be fractionated as they present a different transfer rate to the particles. Our measurements allowed us to estimate sediment-water distribution coefficients (K{sub d}), which are a key parameter to interpret differences between the behaviour of plutonium and americium in sea water. Distribution coefficients K{sub d} have been estimated to be (1.4 {+-} 0.5) x 10{sup 5} litres kg{sup -1} for plutonium and (0.9 {+-} 0.5) x 10{sup 6} litres kg{sup -1} for americium in surface Mediterranean coastal waters. (author).

  5. Uncertainty analysis of doses from ingestion of plutonium and americium.

    Science.gov (United States)

    Puncher, M; Harrison, J D

    2012-02-01

    Uncertainty analyses have been performed on the biokinetic model for americium currently used by the International Commission on Radiological Protection (ICRP), and the model for plutonium recently derived by Leggett, considering acute intakes by ingestion by adult members of the public. The analyses calculated distributions of doses per unit intake. Those parameters having the greatest impact on prospective doses were identified by sensitivity analysis; the most important were the fraction absorbed from the alimentary tract, f(1), and rates of uptake from blood to bone surfaces. Probability distributions were selected based on the observed distribution of plutonium and americium in human subjects where possible; the distributions for f(1) reflected uncertainty on the average value of this parameter for non-specified plutonium and americium compounds ingested by adult members of the public. The calculated distributions of effective doses for ingested (239)Pu and (241)Am were well described by log-normal distributions, with doses varying by around a factor of 3 above and below the central values; the distributions contain the current ICRP Publication 67 dose coefficients for ingestion of (239)Pu and (241)Am by adult members of the public. Uncertainty on f(1) values had the greatest impact on doses, particularly effective dose. It is concluded that: (1) more precise data on f(1) values would have a greater effect in reducing uncertainties on doses from ingested (239)Pu and (241)Am, than reducing uncertainty on other model parameter values and (2) the results support the dose coefficients (Sv Bq(-1) intake) derived by ICRP for ingestion of (239)Pu and (241)Am by adult members of the public.

  6. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  7. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    collected from the Irish coast in 1983. Fallout is found to dominate as a source of 239+240Pu north of latitude 65°N, while for 238Pu a substantial fraction originates from European nuclear fuel reprocessing facilities. The 238Pu/239+240Pu isotope ratio provides clear evidence of the transport of effluent...... of the Irish Sea) to Spitsbergen. 241Am found in Arctic waters probably originates from the decay of fallout 241Pu and, like Pu, tentatively has a residence time of the order of several years. Americium from Sellafield has an estimated mean residence time of 4–6 months in Scottish waters....

  8. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  9. Vertical and horizontal fluxes of plutonium and americium in the western Mediterranean and the Strait of Gibraltar.

    Science.gov (United States)

    León Vintró, L; Mitchell, P I; Condren, O M; Downes, A B; Papucci, C; Delfanti, R

    1999-09-30

    New data on the vertical distributions of plutonium and americium in the waters of the western Mediterranean and the Strait of Gibraltar are examined in terms of the processes governing their delivery to, transport in and removal from the water column within the basin. Residence times for plutonium and americium in surface waters of approximately 15 and approximately 3 years, respectively, are deduced, and it is shown that by the mid 1990s only approximately 35% of the 239,240Pu and approximately 5% of the 241Am deposited as weapons fallout still resided in the water column. Present 239,240Pu inventories in the water column and the underlying sediments are estimated to be approximately 25 TBq and approximately 40 TBq, respectively, which reconcile well with the time-integrated fallout deposition in this zone, taken to be approximately 69 TBq. The data show that there are significant net outward fluxes of plutonium and americium from the basin through the Strait of Gibraltar at the present time. These appear to be compensated by net inward fluxes of similar magnitude through the Strait of Sicily. Thus, the time-integrated fallout deposition in the western basin can be accounted for satisfactorily in terms of present water column and sediment inventories. Enhanced scavenging on the continental shelves, as evidenced by the appreciably higher transuranic concentrations in shelf sediments, supports this contention.

  10. 5f-Electron Delocalization in Americium

    DEFF Research Database (Denmark)

    Skriver, Hans Lomholt; Andersen, O. K.; Johansson, B.

    1980-01-01

    The pressure-volume relation for americium has been obtained without adjustable parameters from self-consistent, spin-polarized band calculations. Around 100 kbar we find a first-order transition to a state with low volume and no spin. This is consistent with preliminary high-pressure measurements....

  11. The relative physiological and toxicological properties of americium and plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Carter, R.E.; Busch, E.; Johnson, O. [and others

    1951-11-15

    The relative physiological and toxicological properties of americium and plutonium have been studied following their intravenous administration to rats. The urinary and fecal excretion of americium was similar to that of plutonium administered as Pu(N0{sub 3}){sub 4}. The deposition of americium the tissues and organs of the rat was also similar to that observed for plutonium. The liver and the skeleton were the major sites of deposition. Zirconium citrate administered 15 minutes after injection of americium increased the urinary excretion of americium and decreased the amount found in the liver and the skeleton at 4 and 16 days. LD{sub 30}{sup 50} studies showed americium was slightly less toxic when given in the acute toxic range than was plutonium. The difference was, however, too slight to be important in establishing a larger tolerance does for americium. Survival studies, hematological observations, bone marrow observations, comparison of tumor incidence and the incidence of skeletal abnormalities indicated that americium and plutonium have essentially the same chronic toxicity when given on an equal {mu}c. basis. These studies support the conclusion that the tolerance values for americium should be essentially the same as those for Plutonium.

  12. Surface complexation modeling of americium sorption onto volcanic tuff.

    Science.gov (United States)

    Ding, M; Kelkar, S; Meijer, A

    2014-10-01

    Results of a surface complexation model (SCM) for americium sorption on volcanic rocks (devitrified and zeolitic tuff) are presented. The model was developed using PHREEQC and based on laboratory data for americium sorption on quartz. Available data for sorption of americium on quartz as a function of pH in dilute groundwater can be modeled with two surface reactions involving an americium sulfate and an americium carbonate complex. It was assumed in applying the model to volcanic rocks from Yucca Mountain, that the surface properties of volcanic rocks can be represented by a quartz surface. Using groundwaters compositionally representative of Yucca Mountain, americium sorption distribution coefficient (Kd, L/Kg) values were calculated as function of pH. These Kd values are close to the experimentally determined Kd values for americium sorption on volcanic rocks, decreasing with increasing pH in the pH range from 7 to 9. The surface complexation constants, derived in this study, allow prediction of sorption of americium in a natural complex system, taking into account the inherent uncertainty associated with geochemical conditions that occur along transport pathways.

  13. Self-irradiation and oxidation effects on americium sesquioxide and Raman spectroscopy studies of americium oxides

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis [CEA, DEN, DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Cèze Cedex (France); Caraballo, Richard [CEA, DEN, DTCD/SECM/LMPA, F-30207 Bagnols-sur-Cèze Cedex (France); Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Cèze Cedex (France); Jégou, Christophe [CEA, DEN, DTCD/SECM/LMPA, F-30207 Bagnols-sur-Cèze Cedex (France); Roussel, Pascal [Unité de Catalyse et Chimie du Solide, UMR 8012 CNRS, Ecole Nationale Supérieure de Chimie de Lille BP 90108, 59652 Villeneuve d’Ascq Cedex (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, F-30207 Bagnols-sur-Cèze Cedex (France)

    2014-09-15

    Americium oxides samples were characterized by X-ray diffraction (XRD) and Raman spectroscopy, with an emphasis on their structural behavior under oxidation and self-irradiation. Raman spectra of americium dioxide (AmO{sub 2}) and sesquioxide (Am{sub 2}O{sub 3}) were obtained for the first time. With the help of literature data on isostructural oxides, Raman signatures of Ia-3 C-type Am{sub 2}O{sub 3} and P-3m1 A-type Am{sub 2}O{sub 3} are identified. For AmO{sub 2,} a clear band is noted at 390 cm{sup −1}. Its nature is compared to that of the other actinide dioxides. Am{sub 2}O{sub 3} evolution under ambient conditions and against {sup 241}Am α self-irradiation was monitored by powder XRD. The sample, initially composed of A-type Am{sub 2}O{sub 3} as major phase as well as C2/m B-type and C-type structures as minor phases, progressively oxidizes to Fm-3m AmO{sub 2−δ} over a few months. On the basis of diffractogram refinements, evolutions of unit cell volumes caused by self-irradiation are also determined and discussed. - Graphical abstract: The evolution of americium oxide under ambient conditions was monitored using XRD (X-ray diffraction) and Raman spectroscopy. After a thermal treatment under reducing conditions, a polyphasic sample mainly composed of A- and C-type americium sesquioxides is evidenced by XRD and Raman spectroscopy. The sample then evolves through two processes: oxidation and self-irradiation. The first one provokes the progressive appearance of F-type americium dioxide while the initial phases disappear, whereas the main effect of the second is a structural swelling with time. - Highlights: • The first Raman spectroscopy measurements on americium oxides were performed. • Observed Am{sub 2}O{sub 3} Raman bands were identified thanks to data on analogue compounds. • AmO{sub 2} assumed T{sub 2g} band presents a shift compared to the actinide dioxide series. • Am{sub 2}O{sub 3} evolution under self-irradiation and oxidation was also

  14. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  15. Americium/Curium Disposition Life Cycle Planning Study

    Energy Technology Data Exchange (ETDEWEB)

    Jackson, W.N. [Westinghouse Savannah River Company, AIKEN, SC (United States); Krupa, J.; Stutts, P.; Nester, S.; Raimesch, R.

    1998-04-30

    At the request of the Department of Energy Savannah River Office (DOE- SR), Westinghouse Savannah River Company (WSRC) evaluated concepts to complete disposition of Americium and Curium (Am/Cm) bearing materials currently located at the Savannah River Site (SRS).

  16. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  17. Americium and plutonium in water, biota, and sediment from the central Oregon coast

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, R. D.

    1982-06-01

    Plutonium-239, 240 and americium-241 were measured in the mussel Mytilus californianus from the region of Coos Bay, OR. The flesh of this species has a plutonium concentration of about 90 fCi/kg, and an Am-241/Pu-239, 240 ratio that is high relative to mixed fallout, ranging between two and three. Transuranic concentrations in sediment, unfiltered water, and filterable particulates were also measured; none of these materials has an Am/Pu ratio as greatly elevated as the mussels, and there is no apparent difference in the Am/Pu ratio of terrestrial runoff and coastal water. Sediment core profiles do not allow accumulation rates or depositional histories to be identified, but it does not appear that material characterized by a high Am/Pu ratio has ever been introduced to this estuary. Other bivalves (Tresus capax and Macoma nasuta) and a polychaete (Abarenicola sp.) do not have an elevated Am/Pu ratio, although the absolute activity of plutonium in the infaunal bivalves is roughly four times that in the mussels.

  18. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, Kyle Shelton [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-09-28

    These are a set of slides intended for an information session as part of recruiting activities at Brigham Young University. It gives an overview of aqueous chloride operations, specifically on plutonium and americium purification/recovery. This presentation details the steps taken perform these processes, from plutonium size reduction, dissolution, solvent extraction, oxalate precipitation, to calcination. For americium recovery, it details the CLEAR (chloride extraction and actinide recovery) Line, oxalate precipitation and calcination.

  19. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    Energy Technology Data Exchange (ETDEWEB)

    Fife, K.W.; West, M.H.

    1987-05-01

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs.

  20. Artificial radionuclides in the Northern European Marine Environment. Distribution of radiocaesium, plutonium and americium in sea water and sediments in 1995

    Energy Technology Data Exchange (ETDEWEB)

    Groettheim, Siri

    2000-07-01

    This study considers the distribution of radiocaesium, plutonium and americium in the northern marine environment. The highest radiocaesium activity in sea water was observed in Skagerrak, 26 Bq/m{sub 3}, and in surface sediments in the Norwegian Sea, 60 Bq/kg. These enhanced levels were related to Chernobyl. The highest 239,240Pu activity in surface water was measured in the western North Sea, 66 mBq/m{sub 3}. In sea water, sub-surface maxima were observed at several locations with an 239,240Pu activity up to 160 mBq/m{sub 3}, and were related to Sellafield. With the exception to the North Sea, surface sediments reflected Pu from global fallout from weapons tests only. (author)

  1. Electrodeposition of americium and physicochemical behaviour of the solution

    Energy Technology Data Exchange (ETDEWEB)

    Becerril-Vilchis, A. (Inst. Nacional de Investigaciones Nucleares, CMRI-LPR, Mexico City (Mexico)); Meas, Y. (CIDETEQ, Queretaro (Mexico)); Rojas-Hernandez, A. (Univ. Autonoma Metropolitana Iztapalapa, Area de Electroquimica, Mexico City (Mexico))

    1994-01-01

    A new method based on concepts of generalized species and equilibria, was applied to represent the thermodynamic distribution of americium species (including condensed phases) in an electrochemical system. Diagrams of the predominance-zone, Existence-predominance and Pourbaix-type for the americium/support electrolyte/water system were constructed. On the basis of these diagrams, the initial distribution of the species in the electrolyte and the deposition conditions were predicted when a current density was applied to a rotating disc electrode in steady-state. These results were related with the Hansen model for actinide electrodeposition. (orig.)

  2. Concentrations of plutonium and americium in plankton from the western Mediterranean Sea

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez-Cabeza, Joan-Albert; Merino, Juan; Masque, Pere [Insitut de Ciencia i Tecnologia Ambiental-Departament de Fisica, Universitat Autonoma de Barcelona, 08193 Bellaterra, Barcelona (Spain); Mitchell, Peter I.; Vintro, L. Leon [Department of Experimental Physics, University College Dublin, Dublin 4 (Ireland); Schell, William R. [Graduate School of Public Health, University of Pittsburgh, Pittsburgh, PA 15261 (United States); Cross, Lluisa; Calbet, Albert [Institut de Ciencies del Mar, Pg. Maritim Barceloneta, 37-49 08003, Barcelona (Spain)

    2003-07-20

    Understanding the transfer of radionuclides through the food chain leading to man and in particular, the uptake of transuranic nuclides by plankton, is basic to assess the potential radiological risk of the consumption of marine products by man. The main sources of transuranic elements in the Mediterranean Sea in the past were global fallout and the Palomares accident, although at present smaller amounts are released from nuclear establishments in the northwestern region. Plankton from the western Mediterranean Sea was collected and analyzed for plutonium and americium in order to study their biological uptake. The microplankton fractions accounted for approximately 50% of the total plutonium contents in particulate form. At Garrucha (Palomares area), microplankton showed much higher {sup 239,240}Pu activity, indicating the contamination with plutonium from the bottom sediments. Concentration factors were within the range of the values recommended by the International Atomic Energy Agency. Continental shelf mesoplankton was observed to efficiently concentrate transuranics. In open seawaters, concentrations were much lower. We speculate that sediments might play a role in the transfer of transuranics to mesoplankton in coastal waters, although we cannot discard that the difference in species composition may also play a role. In Palomares, both {sup 239,240}Pu and {sup 241}Am showed activities five times higher than the mean values observed in continental shelf mesoplankton. As the plutonium isotopic ratios in the contaminated sample were similar to those found in material related to the accident, the contamination was attributed to bomb debris from the Palomares accident. Concentration factors in mesoplankton were also in relatively good agreement with the ranges recommended by IAEA. In the Palomares station the highest concentration factor was observed in the sample that showed predominance of the dynoflagellate Ceratium spp. Mean values of the enrichment factors

  3. 32 CFR 239.7 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 239.7 Section 239.7 National... HOMEOWNERS ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.7 Responsibilities. (a) The DUSD(I&E), under the... Chief of Engineers, has been delegated authority and responsibility for the execution of HAP....

  4. 14 CFR 23.239 - Spray characteristics.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spray characteristics. 23.239 Section 23.239 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT... Handling Characteristics § 23.239 Spray characteristics. Spray may not dangerously obscure the vision...

  5. 14 CFR 121.239 - Oil valves.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Oil valves. 121.239 Section 121.239..., FLAG, AND SUPPLEMENTAL OPERATIONS Special Airworthiness Requirements § 121.239 Oil valves. (a) Each oil valve must— (1) Comply with § 121.257; (2) Have positive stops or suitable index provisions in the...

  6. 32 CFR 239.12 - Tax Documentation.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Tax Documentation. 239.12 Section 239.12 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS HOMEOWNERS ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.12 Tax Documentation. For...

  7. 33 CFR 136.239 - Proof.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Proof. 136.239 Section 136.239 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE POLLUTION... SOURCE; AND ADVERTISEMENT Procedures for Particular Claims § 136.239 Proof. In addition to...

  8. 32 CFR 239.8 - Funding.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Funding. 239.8 Section 239.8 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS HOMEOWNERS ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.8 Funding. (a) Revolving Fund Account. The revolving...

  9. 32 CFR 239.3 - Policy.

    Science.gov (United States)

    2010-07-01

    ... ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.3 Policy. (a) It is DoD policy, in implementing section 3374 of title 42, United States Code, as amended by Section 1001 of the ARRA (Public Law 111-5), that... 32 National Defense 2 2010-07-01 2010-07-01 false Policy. 239.3 Section 239.3 National...

  10. 32 CFR 239.10 - Management Controls.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Management Controls. 239.10 Section 239.10...) MISCELLANEOUS HOMEOWNERS ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.10 Management Controls. (a). Management Systems. Headquarters, USACE has an existing information management system that manages all...

  11. 48 CFR 252.239-7002 - Access.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Access. 252.239-7002... Clauses 252.239-7002 Access. As prescribed in 239.7411(a), use the following clause: Access (DEC 1991) (a) Subject to military security regulations, the Government shall permit the Contractor access at...

  12. 43 CFR 23.9 - Performance bond.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Performance bond. 23.9 Section 23.9 Public... LANDS § 23.9 Performance bond. (a)(1) Upon approval of an exploration plan or mining plan, the operator shall be required to file a suitable performance bond of not less than $2,000 with satisfactory...

  13. Supercritical Fluid Extraction of Plutonium and Americium from Soil

    Energy Technology Data Exchange (ETDEWEB)

    Fox, R.V.; Mincher, B.J.

    2002-05-23

    Supercritical fluid extraction (SFE) of plutonium and americium from soil was successfully demonstrated using supercritical fluid carbon dioxide solvent augmented with organophosphorus and beta-diketone complexants. Spiked Idaho soils were chemically and radiologically characterized, then extracted with supercritical fluid carbon dioxide at 2,900 psi and 65 C containing varying concentrations of tributyl phosphate (TBP) and thenoyltrifluoroacetone (TTA). A single 45 minute SFE with 2.7 mol% TBP and 3.2 mol% TTA provided as much as 88% {+-} 6.0 extraction of americium and 69% {+-} 5.0 extraction of plutonium. Use of 5.3 mol% TBP with 6.8 mol% of the more acidic beta-diketone hexafluoroacetylacetone (HFA) provided 95% {+-} 3.0 extraction of americium and 83% {+-} 5.0 extraction of plutonium in a single 45 minute SFE at 3,750 psi and 95 C. Sequential chemical extraction techniques were used to chemically characterize soil partitioning of plutonium and americium in pre-SFE soil samples. Sequential chemical extraction techniques demonstrated that spiked plutonium resides primarily (76.6%) in the sesquioxide fraction with minor amounts being absorbed by the oxidizable fraction (10.6%) and residual fractions (12.8%). Post-SFE soils subjected to sequential chemical extraction characterization demonstrated that 97% of the oxidizable, 78% of the sesquioxide and 80% of the residual plutonium could be removed using SFE. These preliminary results show that SFE may be an effective solvent extraction technique for removal of actinide contaminants from soil.

  14. Thermodynamic systematics of oxides of americium, curium, and neighboring elements

    Energy Technology Data Exchange (ETDEWEB)

    Morss, L.R.

    1984-01-01

    Recently-obtained calorimetric data on the sesquioxides and dioxides of americium and curium are summarized. These data are combined with other properties of the actinide elements to elucidate the stability relationships among these oxides and to predict the behavior of neighboring actinide oxides. 45 references, 4 figures, 5 tables.

  15. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  16. Environmental aspects of the transuranics: a selected, annotated bibliography. [Pu-238, Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Ensminger, J.T.; Martin, F.M.; Fore, C.S. (comps.)

    1977-03-01

    This eighth published bibliography of 427 references is compiled from the Nevada Applied Ecology Information Center's Data Base on the Environmental Aspects of the Transuranics. The data base was built to provide information support to the Nevada Applied Ecology Group (NAEG) of ERDA's Nevada Operations Office. The general scope covers environmental aspects of uranium and the transuranic elements, with emphasis on plutonium. This bibliography highlights literature on plutonium 238 and 239 and americium in the critical organs of man and animals. Supporting information on ecology of the Nevada Test Site and reviews and summarizing literature on other radionuclides have been included at the request of the NAEG. The references are arranged by subject category with leading authors appearing alphabetically in each category. Indexes are provided for author(s), geographic location, keyword(s), taxon, title, and publication description.

  17. Research program on development of advanced treatment technology for americium-containing aqueous waste in NUCEF

    Energy Technology Data Exchange (ETDEWEB)

    Mineo, Hideaki; Matsumura, Tatsuro; Tsubata, Yasuhiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1996-10-01

    A research program was prepared on the development of an advanced treatment process for the americium-containing concentrated aqueous waste in NUCEF, than allows americium recovery for the reuse and the reduction of TRU waste generation. A preliminary analysis was conducted on the separation requirements based on the components estimated for the waste. An R and D strategy was proposed from the view to reduce TRU waste generated in the processing that the highest priority is given on the control of TRU leakage such as americium into the effluent stream after americium recovery and the minimization of salt used in the separation over the decontamination of impurities from americium. The extraction chromatographic method was selected as a candidate technology for americium separation under the principle to use reagents that are functional in acidic conditions such as bidentate extractants of DHEDECMP, CMPO or diamides, considering the larger flexibilities in process modification and possible multi-component separation with compact equipment and the past achievements on the recovery of kg quantities of americium. Major R and D items extracted are screening and evaluation of extractants for americium and plutonium, optimization of separation conditions, selection of denitration method, equipment developments and development of solidification methods of discarded americium after reuse and of various kinds of separation residues. In order to cope these items, four steps of R and D program were proposed, i.e., fundamental experiment in beaker-scale on screening and evaluation of extractants, flowsheet study in bench-scale using simulated and small amount of americium aqueous waste solution to evaluate candidate process, americium recovery test in iron-shielded cell to be installed in NUCEF. It is objected to make recovery of 100g orders of americium used for research on fundamental TRU fuel properties. (J.P.N.)

  18. Dicty_cDB: SLC239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC239 (Link to dictyBase) - - - - SLC239Z (Link to Original site) - - SLC...239Z 598 - - - - Show SLC239 Library SL (Link to library) Clone ID SLC239 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC2-B/SLC...239Q.Seq.d/ Representative seq. ID SLC239Z (Link to Original site) R...epresentative DNA sequence >SLC239 (SLC239Q) /CSM/SL/SLC2-B/SLC239Q.Seq.d/ XXXXXXXXXXACAACGTCTCATTTTCGCTGGTA

  19. Supercritical Fluid Extraction of Plutonium and Americium from Soil

    Energy Technology Data Exchange (ETDEWEB)

    Fox, Robert Vincent; Mincher, Bruce Jay

    2002-08-01

    Supercritical fluid extraction (SFE) of plutonium and americium from soil was successfully demonstrated using supercritical fluid carbon dioxide solvent augmented with organophosphorus and beta-diketone complexants. Spiked Idaho soils were chemically and radiologically characterized, then extracted with supercritical fluid carbon dioxide at 2,900 psi and 65°C containing varying concentrations of tributyl phosphate (TBP) and thenoyltrifluoroacetone (TTA). A single 45 minute SFE with 2.7 mol% TBP and 3.2 mol% TTA provided as much as 88% ± 6.0 extraction of americium and 69% ± 5.0 extraction of plutonium. Use of 5.3 mol% TBP with 6.8 mol% of the more acidic beta-diketone hexafluoroacetylacetone (HFA) provided 95% ± 3.0 extraction of americium and 83% ± 5.0 extraction of plutonium in a single 45 minute SFE at 3,750 psi and 95°C. Sequential chemical extraction techniques were used to chemically characterize soil partitioning of plutonium and americium in pre-SFE soil samples. Sequential chemical extraction techniques demonstrated that spiked plutonium resides primarily (76.6%) in the sesquioxide fraction with minor amounts being absorbed by the oxidizable fraction (10.6%) and residual fractions (12.8%). Post-SFE soils subjected to sequential chemical extraction characterization demonstrated that 97% of the oxidizable, 78% of the sesquioxide and 80% of the residual plutonium could be removed using SFE. These preliminary results show that SFE may be an effective solvent extraction technique for removal of actinide contaminants from soil.

  20. Isolation of americium (5) oxalate compounds from solutions

    Energy Technology Data Exchange (ETDEWEB)

    Zubarev, V.G.; Krot, N.N.

    1982-01-01

    Certain conditions of americium (5) isolation with solutions of ammonia and KOH are studied as well as the attitude of hydroxide obtained to heating. Like neptunium (5) hydroxide americium (5) hydroxide probably has the formula AmO/sub 2/OHxxH/sub 2/O, where x is approximately equal to 2.3. It is established that during heating in the air up to 120 deg C hydroxide transforms into AmO/sub 2/. It is shown that in solutions with a high concentration of oxalate-ion americium stability in oxidation state +5 depends greatly on the pH of solution. Complex salts KAmO/sub 2/C/sub 2/O/sub 4/xxH/sub 2/O and CsAmO/sub 2/C/sub 2/O/sub 4/xxH/sub 2/O are synthesized. The identification is made according to the method of preparation and results of analysis of C/sub 2/O/sub 4//sup 2 -/: AmO/sub 2//sup +/ ratio. It is found that the salts are non-isomorphous to similar salts of pentavalent neptunium. CsAmO/sub 2/C/sub 2/O/sub 4/xxH/sub 2/O is identified in cubic crystal system with the lattice constant a=1.25 nm.

  1. Dicty_cDB: VHI239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHI239 (Link to dictyBase) - - - Contig-U15819-1 - (Link to Original site) VHI2...39F 635 - - - - - - Show VHI239 Library VH (Link to library) Clone ID VHI239 (Link to dicty...iol.tsukuba.ac.jp/CSM/VH/VHI2-B/VHI239Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >VHI239 (VHI239Q) /CSM/VH/VHI2-B/VHI239Q.Seq.d/ CAGGTAAAACTGAAGCA...KALENFAFLMQTDVSSCE--- Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHI239 (VHI2

  2. 14 CFR 27.239 - Spray characteristics.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spray characteristics. 27.239 Section 27... AIRWORTHINESS STANDARDS: NORMAL CATEGORY ROTORCRAFT Flight Ground and Water Handling Characteristics § 27.239 Spray characteristics. If certification for water operation is requested, no spray...

  3. 14 CFR 29.239 - Spray characteristics.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spray characteristics. 29.239 Section 29... AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Flight Ground and Water Handling Characteristics § 29.239 Spray characteristics. If certification for water operation is requested, no spray...

  4. 32 CFR 239.4 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... regard to marketing, applicant must demonstrate that the asking price was within the current market value... the applicant's responsibility to explain marketing efforts by detailing how the asking price was... 32 National Defense 2 2010-07-01 2010-07-01 false Definitions. 239.4 Section 239.4...

  5. Separation of americium and curium from complex chemical and radiochemical mixtures

    Energy Technology Data Exchange (ETDEWEB)

    Bochkarev, V.A.; Martynov, N.P.; Slivin, V.G.; Trikanov, A.E.; Fedyaeva, N.V.

    1988-11-01

    This work describes a method for separation and radiochemical purification of nanogram levels of americium and curium from complex chemical and radiochemical mixtures containing tens of milligrams of elements such as aluminum, iron, magnesium, calcium, barium, titanium, potassium, and others, microgram levels of uranium, neptunium, and plutonium, and fission products. Extraction coefficients of americium and curium from these elements are measured. The separation from the macrocomponents was carried out by extraction of americium and curium with butyric acid in the presence of sulfosalicylic acid. Uranium, neptunium, and plutonium were separated from hydrochloric acid solutions, while the rare earth elements were separated from lithium chloride solutions using a column of anion exchange resin AV-17. Alpha measurements were carried out on americium and curium deposited electrolytically on tantalum cathodes. The chemical yield of americium and curium was identical of greater than or equal to 94%, separation time approx. 8 h.

  6. Development of an automatic method for americium and plutonium separation and preconcentration using an multisyringe flow injection analysis-multipumping flow system.

    Science.gov (United States)

    Fajardo, Yamila; Ferrer, Laura; Gómez, Enrique; Garcias, Francesca; Casas, Monserrat; Cerdà, Víctor

    2008-01-01

    A new procedure for automatic separation and preconcentration of 241Am and 239+240Pu from interfering matrixes using transuranide (TRU)-resin is proposed. Combination of the multisyringe flow injection analysis and multipumping flow system techniques with the TRU-resin allows carrying out the sampling treatment and separation in a short time using large sample volumes. Americium is eluted from the column with 4 mol L(-1) hydrochloric acid, and then plutonium is separated via on-column Pu(IV) reduction to Pu(III) with titanium(III) chloride. The corresponding alpha activities are measured off-line, with a relative standard deviation of 3% and a lower limit of detection of 0.004 Bq mL(-1), by using a multiplanchet low-background proportional counter.

  7. Kilogram-scale purification of americium by ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Wheelwright, E. J.

    1979-01-01

    Sequential anion and cation exchange processes have been used for the final purification of /sup 241/Am recovered during the reprocessing of aged plutonium metallurgical scrap. Plutonium was removed by absorption of Dowex 1, X-3.5 (30 to 50 mesh) anion exchange resin from 6.5 to 7.5 M HNO/sub 3/ feed solution. Following a water dilution to 0.75 to 1.0 M HNO/sub 3/, americium was absorbed on Dowex 50W, X-8 (50 to 100 mesh) cation exchange resion. Final purification was accomplished by elution of the absorbed band down 3 to 4 successive beds of the same resin, preloaded with Zn/sup 2 +/, with an NH/sub 4/OH buffered chelating agent. The recovery of mixed /sup 241/Am-/sup 243/Am from power reactor reprocessing waste has been demonstrated. Solvent extraction was used to recover a HNO/sub 3/ solution of mixed lanthanides and actinides from waste generated by the reprocessng of 13.5 tons of Shippingport Power Reactor blanket fuel. Sequential cation exchange band-displacement processes were then used to separate americium and curium from the lanthanides and then to separate approx. 60 g of /sup 244/Cm from 1000 g of mixed /sup 241/Am-/sup 243/Am.

  8. 48 CFR 239.7001 - Policy.

    Science.gov (United States)

    2010-10-01

    ... Information Technology 239.7001 Policy. Agencies shall follow the procedures in DoD 4140.1-R, DoD Supply Chain Materiel Management Regulation, Chapter 9, Section C9.5, when considering the exchange or sale...

  9. Dicty_cDB: SLE239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available m_ : 1.00 48.0 %: cytoplasmic 40.0 %: nuclear 4.0 %: vacuolar 4.0 %: mitochondrial 4.0 %: peroxisomal >> prediction for SLE...SL (Link to library) SLE239 (Link to dictyBase) - - - Contig-U16455-1 SLE239Z (Link... to Original site) - - SLE239Z 598 - - - - Show SLE239 Library SL (Link to library) Clone ID SLE239 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLE2-B/SLE239Q.Seq.d/ Representative seq. ID SLE23...9Z (Link to Original site) Representative DNA sequence >SLE239 (SLE239Q) /CSM/SL/SLE2-B/SLE239Q.Seq.d/ XXXXX

  10. Hexavalent Americium Recovery Using Copper(III) Periodate

    Energy Technology Data Exchange (ETDEWEB)

    McCann, Kevin; Brigham, Derek M.; Morrison, Samuel; Braley, Jenifer C.

    2016-11-21

    Separation of americium from the lanthanides is considered one of the most difficult separation steps in closing the nuclear fuel cycle. One approach to this separation could involve oxidizing americium to the hexavalent state to form a linear dioxo cation while the lanthanides remain as trivalent ions. This work considers aqueous soluble Cu3+ periodate as an oxidant under molar nitric acid conditions to separate hexavalent Am with diamyl amylphosphonate (DAAP) in n-dodecane. Initial studies assessed the kinetics of Cu3+ periodate auto-reduction in acidic media to aid in development of the solvent extraction system. Following characterization of the Cu3+ periodate oxidant, solvent extraction studies optimized the recovery of Am from varied nitric acid media and in the presence of other fission product, or fission product surrogate, species. Short aqueous/organic contact times encouraged successful recovery of Am (distribution values as high as 2) from nitric acid media in the absence of redox active fission products. In the presence of a post-PUREX simulant aqueous feed, precipitation of tetravalent species (Ce, Ru, Zr) occurred and the distribution values of 241Am were suppressed, suggesting some oxidizing capacity of the Cu3+ periodate is significantly consumed by other redox active metals in the simulant. The manuscript demonstrates Cu3+ periodate as a potentially viable oxidant for Am oxidation and recovery and notes the consumption of oxidizing capacity observed in the presence of the post-PUREX simulant feed will need to be addressed for any approach seeking to oxidize Am for separations relevant to the nuclear fuel cycle.

  11. Oxidative Alkaline leaching of Americium from simulated high-level nuclear waste sludges

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Wendy A.; Garnov, Alexander Yu.; Rao, Linfeng; Nash, Kenneth L.; Bond, Andrew H.

    2004-01-23

    Oxidative alkaline leaching has been proposed to pre-treat the high-level nuclear waste sludges to remove some of the problematic (e.g., Cr) and/or non-radioactive (e.g., Na, Al) constituents before vitrification. It is critical to understand the behavior of actinides, americium and plutonium in particular, in oxidative alkaline leaching. We have studied the leaching behavior of americium from four different sludge simulants (BiPO{sub 4}, BiPO{sub 4 modified}, Redox, PUREX) using potassium permanganate and potassium persulfate in alkaline solutions. Up to 60% of americium sorbed onto the simulants is leached from the sludges by alkaline persulfate and permanganate. The percentage of americium leached increases with [NaOH] (between 1.0 and 5.0 M). The initial rate of americium leaching by potassium persulfate increases in the order BiPO{sub 4} sludge < Redox sludge < PUREX sludge. The data are most consistent with oxidation of Am{sup 3+} in the sludge to either AmO{sub 2}{sup +} or AmO{sub 2}{sup 2+} in solution. Though neither of these species is expected to exhibit long-term stability in solution, the potential for mobilization of americium from sludge samples would have to be accommodated in the design of any oxidative leaching process for real sludge samples.

  12. The transmutation of americium: the Ecrix experiments in Phenix; Transmutation de l'americium: les experiences ecrix dans Phenix

    Energy Technology Data Exchange (ETDEWEB)

    Garnier, J.C.; Schmidt, N. [CEA Cadarache, Dept. d' Etudes des Combustibles (DEC/SESC), 13 - Saint-Paul-lez-Durance (France); Croixmarie, Y.; Ottaviani, J.P. [CEA Cadarache, Dept. d' Etudes des Combustibles (DEC/SPUA), 13 - Saint-Paul-lez-Durance (France); Varaine, F.; Saint Jean, C. de [CEA Cadarache, Dept. d' Etudes des Reacteurs (DER/SPRC), 13 - Saint-Paul-lez-Durance (France)

    1999-07-01

    The first americium transmutation experiment in a specific target in PHENIX will occur with the ECRIX-B and ECRIX-H experiments. Beside material testing, the objective is also to represent a concept of transmutation whose specificity is to enhance the kinetics of transmutation by using a moderated spectrum. The moderator materials will be {sup 11}B{sub 4}C and CaH{sub 2} for ECRIX-B and ECRIXH respectively, the irradiation conditions have been predicted for both the neutronics and thermal. The targets (MgO-AmO{sub X} pellets) are manufactured in the ATALANTE laboratory and the design is performed according to the PHENIX operating conditions. (authors)

  13. Neutron Capture Cross Section of 239Pu

    Science.gov (United States)

    Mosby, S.; Arnold, C.; Bredeweg, T. A.; Couture, A.; Jandel, M.; O'Donnell, J. M.; Rusev, G.; Ullmann, J. L.; Chyzh, A.; Henderson, R.; Kwan, E.; Wu, C. Y.

    2014-09-01

    The 239Pu(n,γ) cross section has been measured over the energy range 10 eV - 10 keV using the Detector for Advanced Neutron Capture Experiments (DANCE) as part of a campaign to produce precision (n,γ) measurements on 239Pu in the keV region. Fission coincidences were measured with a PPAC and used to characterize the prompt fission γ-ray spectrum in this region. The resulting spectra will be used to better characterize the fission component of another experiment with a thicker target to extend the (n,γ) cross section measurement well into the keV region.

  14. Radiotoxicological analyses of {sup 239+240}Pu and {sup 241}Am in biological samples by anion-exchange and extraction chromatography: a preliminary study for internal contamination evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Ridone, S.; Arginelli, D.; Bortoluzzi, S.; Canuto, G.; Montalto, M.; Nocente, M.; Vegro, M. [Italian National Agency for New Technologies, Energy and the Environment (ENEA), Research Centre of Saluggia, Radiation Protection Institute, Saluggia, VC (Italy)

    2006-07-01

    Many biological samples (urines and faeces) have been analysed by means of chromatographic extraction columns, utilising two different resins (AG 1-X2 resin chloride and T.R.U.), in order to detect the possible internal contamination of {sup 239{sup +}}{sup 240}Pu and {sup 241}Am, for some workers of a reprocessing nuclear plant in the decommissioning phase. The results obtained show on one hand the great suitability of the first resin for the determination of plutonium, and on the other the great selectivity of the second one for the determination of americium.

  15. Reference: 239 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 239 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16015335i Bundock Paul et al. 2005 Jul. Natur...functions. An Arabidopsis hAT-like transposase is essential for plant development. 7048 282-4 16015335 2005 Jul Nature Bundock Paul|Hooykaas Paul

  16. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  17. 16 CFR 239.5 - Performance of warranties or guarantees.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Performance of warranties or guarantees. 239.5 Section 239.5 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR THE ADVERTISING OF WARRANTIES AND GUARANTEES § 239.5 Performance of warranties or guarantees....

  18. 33 CFR 117.239 - Lewes and Rehoboth Canal.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Lewes and Rehoboth Canal. 117.239 Section 117.239 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Delaware § 117.239 Lewes and Rehoboth Canal. (a) The draw of the Savannah Road/SR 18...

  19. 46 CFR 153.239 - Use of cast iron.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Use of cast iron. 153.239 Section 153.239 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK... Systems § 153.239 Use of cast iron. (a) Cast iron used in a cargo containment system must meet...

  20. 47 CFR 73.239 - Use of common antenna site.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Use of common antenna site. 73.239 Section 73.239 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES FM Broadcast Stations § 73.239 Use of common antenna site. No FM broadcast...

  1. 48 CFR 239.7405 - Delegated authority for telecommunications resources.

    Science.gov (United States)

    2010-10-01

    ... telecommunications resources. 239.7405 Section 239.7405 Federal Acquisition Regulations System DEFENSE ACQUISITION... TECHNOLOGY Telecommunications Services 239.7405 Delegated authority for telecommunications resources. The contracting officer may enter into a telecommunications service contract on a month-to-month basis or for...

  2. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez-Cabeza, J.A. E-mail: joanalbert.sanchez@uab.es; Molero, J

    2000-11-01

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6{+-}0.5 Bq m{sup -3} and 16.9{+-}1.2 mBq m{sup -3} for {sup 137}Cs and {sup 239,240}Pu, respectively. When sediment concentrations were normalized to excess {sup 210}Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of {sup 137}Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher {sup 137}Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied.

  3. Further Studies of Plutonium and Americium at Thule, Greenland

    DEFF Research Database (Denmark)

    Aarkrog, Asker; Dahlgaard, Henning; Nilsson, Karen Kristina;

    1984-01-01

    further away from the impact point and at some locations the vertical distribution indicated a downward displacement of Pu in the sediment column since 1974. Seawater and seaplants showed no evidence of the presence of Pu from sources other than fallout; but Pu in benthos varied nearly proportionally......, but in benthos 241Am/239,240Pu were two times higher than in sediments. Seaplants showed the same value of Am/Pu as seawater. There was no indication of any biomagnification of Pu or Am through the marine food chains at Thule....

  4. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats.

    Science.gov (United States)

    Van der Meeren, A; Grémy, O

    2010-09-01

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO(2) powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO(2) with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO(2) with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO(2) powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO(2) with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO(2) aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions.

  5. Transmutation of 129I, 237Np, 238Pu, 239Pu, and 241Am using neutrons produced in target-blanket system `Energy plus Transmutation' by relativistic protons

    Indian Academy of Sciences (India)

    J Adam; K Katovsky; A Balabekyan; V G Kalinnikov; M I Krivopustov; H Kumawat; A A Solnyshkin; V I Stegailov; S G Stetsenko; V M Tsoupko-Sitnikov; W Westmeier

    2007-02-01

    Target-blanket facility `Energy + Transmutation' was irradiated by proton beam extracted from the Nuclotron Accelerator in Laboratory of High Energies of Joint Institute for Nuclear Research in Dubna, Russia. Neutrons generated by the spallation reactions of 0.7, 1.0, 1.5 and 2 GeV protons and lead target interact with subcritical uranium blanket. In the neutron field outside the blanket, radioactive iodine, neptunium, plutonium and americium samples were irradiated and transmutation reaction yields (residual nuclei production yields) have been determined using -spectroscopy. Neutron field's energy distribution has also been studied using a set of threshold detectors. Results of transmutation studies of 129I, 237Np, 238Pu, 239Pu and 241Am are presented.

  6. Plutonium and americium contamination in Rocky Flats soil, 1973

    Energy Technology Data Exchange (ETDEWEB)

    Krey, P.; Hardy, E.; Volchok, H.; Toonkel, L.; Knuth, R.; Coppes, M.; Tamura, T.

    1976-03-01

    The plutonium mass isotopic analysis and the Am-241 analysis of soil samples from Rocky Flats identify the contamination as Pu which was processed in 1958. The Am-241 activity in the soil will reach its maximum in 2033 and represent 18 percent of the Pu-239-240 activity. Nuclide ratios indicate that current operations at Rocky Flats contribute little to the airborne Pu concentrations which are due to resuspension of the contaminated soil. Root uptake of Pu or Am by vegetation is slight or shows no discrimination among the isotopes and nuclides studied. The relationship between Pu deposition contour and the area enclosed by that contour has been verified for contour values extending over 7 orders of magnitude. This gives confidence to our calculations of the quantities of Pu released on and off the Rocky Flats plant site. (auth)

  7. National low-level waste management program radionuclide report series, Volume 14: Americium-241

    Energy Technology Data Exchange (ETDEWEB)

    Winberg, M.R.; Garcia, R.S.

    1995-09-01

    This report, Volume 14 of the National Low-Level Waste Management Program Radionuclide Report Series, discusses the radiological and chemical characteristics of americium-241 ({sup 241}Am). This report also includes discussions about waste types and forms in which {sup 241}Am can be found and {sup 241}Am behavior in the environment and in the human body.

  8. Understanding the Chemistry of Uncommon Americium Oxidation States for Application to Actinide/Lanthanide Separations

    Energy Technology Data Exchange (ETDEWEB)

    Leigh Martin; Bruce J. Mincher; Nicholas C. Schmitt

    2007-09-01

    A spectroscopic study of the stability of Am(V) and Am(VI) produced by oxidizing Am(III) with sodium bismuthate is presented, varying the initial americium concentration, temperature and length of the oxidation was seen to have profound effects on the resultant solutions.

  9. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  10. {sup 137}Cs, {sup 239+240}Pu and {sup 240}Pu/{sup 239}Pu atom ratios in the surface waters of the western North Pacific Ocean, eastern Indian Ocean and their adjacent seas

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Masatoshi; Zheng, Jian; Wang, Zhong-Liang [Nakaminato Laboratory for Marine Radioecology, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, Ibaraki 311-1202 (Japan)

    2006-07-31

    Surface seawater samples were collected along the track of the R/V Hakuho-Maru cruise (KH-96-5) from Tokyo to the Southern Ocean. The {sup 137}Cs activities were determined for the surface waters in the western North Pacific Ocean, the Sulu and Indonesian Seas, the eastern Indian Ocean, the Bay of Bengal, the Andaman Sea, and the South China Sea. The {sup 137}Cs activities showed a wide variation with values ranging from 1.1 Bq m{sup -3} in the Antarctic Circumpolar Region of the Southern Ocean to 3 Bq m{sup -3} in the western North Pacific Ocean and the South China Sea. The latitudinal distributions of {sup 137}Cs activity were not reflective of that of the integrated deposition density of atmospheric global fallout. The removal rates of {sup 137}Cs from the surface waters were roughly estimated from the two data sets of Miyake et al. [Miyake Y, Saruhashi K, Sugimura Y, Kanazawa T, Hirose K. Contents of {sup 137}Cs, plutonium and americium isotopes in the Southern Ocean waters. Pap Meteorol Geophys 1988;39:95-113] and this study to be 0.016 yr{sup -1} in the Sulu and Indonesian Seas, 0.033 yr{sup -1} in the Bay of Bengal and Andaman Sea, and 0.029 yr{sup -1} in the South China Sea. These values were much lower than that in the coastal surface water of the western Northwest Pacific Ocean. This was likely due to less horizontal and vertical mixing of water masses and less scavenging. {sup 239+240}Pu activities and {sup 240}Pu/{sup 239}Pu atom ratios were also determined for the surface waters in the western North Pacific Ocean, the Sulu and Indonesian Seas and the South China Sea. The {sup 240}Pu/{sup 239}Pu atom ratios ranged from 0.199+/-0.026 to 0.248+/-0.027 on average, and were significantly higher than the global stratospheric fallout ratio of 0.18. The contributions of the North Pacific Proving Grounds close-in fallout Pu were estimated to be 20% for the western North Pacific Ocean, 39% for the Sulu and Indonesian Seas and 42% for the South China Sea by using

  11. {sup 137}Cs, {sup 239+24}Pu and {sup 24}Pu/{sup 239}Pu atom ratios in the surface waters of the western North Pacific Ocean, eastern Indian Ocean and their adjacent seas

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Masatoshi [Nakaminato Laboratory for Marine Radioecology, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, Ibaraki 311-1202 (Japan)]. E-mail: m_yamada@nirs.go.jp; Zheng Jian [Nakaminato Laboratory for Marine Radioecology, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, Ibaraki 311-1202 (Japan); Wang Zhongliang [Nakaminato Laboratory for Marine Radioecology, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, Ibaraki 311-1202 (Japan); State Key Laboratory of Environmental Geochemistry, Institute of Geochemistry, Chinese Academy of Sciences, Guanshui Road 46, Guiyang 550002 (China)

    2006-07-31

    Surface seawater samples were collected along the track of the R/V Hakuho-Maru cruise (KH-96-5) from Tokyo to the Southern Ocean. The {sup 137}Cs activities were determined for the surface waters in the western North Pacific Ocean, the Sulu and Indonesian Seas, the eastern Indian Ocean, the Bay of Bengal, the Andaman Sea, and the South China Sea. The {sup 137}Cs activities showed a wide variation with values ranging from 1.1 Bq m{sup -3} in the Antarctic Circumpolar Region of the Southern Ocean to 3 Bq m{sup -3} in the western North Pacific Ocean and the South China Sea. The latitudinal distributions of {sup 137}Cs activity were not reflective of that of the integrated deposition density of atmospheric global fallout. The removal rates of {sup 137}Cs from the surface waters were roughly estimated from the two data sets of Miyake et al. [Miyake Y, Saruhashi K, Sugimura Y, Kanazawa T, Hirose K. Contents of {sup 137}Cs, plutonium and americium isotopes in the Southern Ocean waters. Pap Meteorol Geophys 1988;39:95-113] and this study to be 0.016 yr{sup -1} in the Sulu and Indonesian Seas, 0.033 yr{sup -1} in the Bay of Bengal and Andaman Sea, and 0.029 yr{sup -1} in the South China Sea. These values were much lower than that in the coastal surface water of the western Northwest Pacific Ocean. This was likely due to less horizontal and vertical mixing of water masses and less scavenging. {sup 239+24}Pu activities and {sup 24}Pu/{sup 239}Pu atom ratios were also determined for the surface waters in the western North Pacific Ocean, the Sulu and Indonesian Seas and the South China Sea. The {sup 24}Pu / {sup 239}Pu atom ratios ranged from 0.199 {+-} 0.026 to 0.248 {+-} 0.027 on average, and were significantly higher than the global stratospheric fallout ratio of 0.18. The contributions of the North Pacific Proving Grounds close-in fallout Pu were estimated to be 20% for the western North Pacific Ocean, 39% for the Sulu and Indonesian Seas and 42% for the South China Sea by

  12. 48 CFR 1552.239-70 - Rehabilitation act notice.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Rehabilitation act notice. 1552.239-70 Section 1552.239-70 Federal Acquisition Regulations System ENVIRONMENTAL PROTECTION AGENCY... substantially to the language of this clause, including this paragraph, unless otherwise authorized by...

  13. 48 CFR 1352.239-71 - Electronic and information technology.

    Science.gov (United States)

    2010-10-01

    ... technology. 1352.239-71 Section 1352.239-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE... Electronic and information technology. As prescribed in 48 CFR 1339.270(a), insert the following provision: Electronic and Information Technology (APR 2010) (a) To be considered eligible for award, offerors...

  14. 48 CFR 2452.239-71 - Information Technology Virus Security.

    Science.gov (United States)

    2010-10-01

    ... contractor shall include the following statement on deliveries of hardware, software, and data products... delivery of hardware, software, or data on diskettes under this contract. (d) This clause shall not limit... Virus Security. 2452.239-71 Section 2452.239-71 Federal Acquisition Regulations System DEPARTMENT...

  15. 40 CFR 86.238-94-86.239-94 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false 86.238-94-86.239-94 Section 86.238-94-86.239-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... 1994 and Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New...

  16. 48 CFR 252.239-7008 - Reuse arrangements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reuse arrangements. 252... Provisions And Clauses 252.239-7008 Reuse arrangements. As prescribed in 239.7411(a), use the following clause: Reuse Arrangements (DEC 1991) (a) When feasible, the Contractor shall reuse canceled...

  17. National Low-Level Waste Management Program Radionuclide Report Series, Volume 17: Plutonium-239

    Energy Technology Data Exchange (ETDEWEB)

    J. P. Adams; M. L. Carboneau

    1999-03-01

    This report, Volume 17 of the National Low-Level Waste Management Program Radionuclide Report Series, discusses the radiological and chemical characteristics of plutonium-239 (Pu-239). This report also discusses waste types and forms in which Pu-239 can be found, waste and disposal information on Pu-239, and Pu-239 behavior in the environment and in the human body.

  18. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  19. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  20. Calcium and zinc DTPA administration for internal contamination with plutonium-238 and americium-241.

    Science.gov (United States)

    Kazzi, Ziad N; Heyl, Alexander; Ruprecht, Johann

    2012-08-01

    The accidental or intentional release of plutonium or americium can cause acute and long term adverse health effects if they enter the human body by ingestion, inhalation, or injection. These effects can be prevented by rapid removal of these radionuclides by chelators such as calcium or zinc diethylenetriaminepentaacetate (calcium or zinc DTPA). These compounds have been shown to be efficacious in enhancing the elimination of members of the actinide family particularly plutonium and americium when administered intravenously or by nebulizer. The efficacy and adverse effects profile depend on several factors that include the route of internalization of the actinide, the type, and route time of administration of the chelator, and whether the calcium or zinc salt of DTPA is used. Current and future research efforts should be directed at overcoming limitations associated with the use of these complex drugs by using innovative methods that can enhance their structural and therapeutic properties.

  1. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  2. On the Convergence of the Electronic Structure Properties of the FCC Americium (001) Surface

    OpenAIRE

    Gao, Da; Ray, Asok K.

    2006-01-01

    Electronic and magnetic properties of the fcc Americium (001) surface have been investigated via full-potential all-electron density-functional electronic structure calculations at both scalar and fully relativistic levels. Effects of various theoretical approximations on the fcc Am (001) surface properties have been thoroughly examined. The ground state of fcc Am (001) surface is found to be anti-ferromagnetic with spin-orbit coupling included (AFM-SO). At the ground state, the magnetic mome...

  3. Radiography Facility - Building 239 Independent Validation Review

    Energy Technology Data Exchange (ETDEWEB)

    Altenbach, T J; Beaulieu, R A; Watson, J F; Wong, H J

    2010-02-02

    The purpose of this task was to perform an Independent Validation Review to evaluate the successful implementation and effectiveness of Safety Basis controls, including new and revised controls, to support the implementation of a new DSA/TSR for B239. This task addresses Milestone 2 of FY10 PEP 7.6.6. As the first IVR ever conducted on a LLNL nuclear facility, it was designated a pilot project. The review follows the outline developed for Milestone 1 of the PEP, which is based on the DOE Draft Guide for Performance of Independent Verification Review of Safety Basis Controls. A formal Safety Basis procedure will be developed later, based on the lessons learned with this pilot project. Note, this review is termed a ''Validation'' in order to be consistent with the PEP definition and address issues historically raised about verification mechanisms at LLNL. Validation is intended to confirm that implementing mechanisms realistically establish the ability of TSR LCO, administrative control or safety management program to accomplish its intended safety function and that the controls are being implemented. This effort should not, however, be confused with a compliance assessment against all relevant DOE requirements and national standards. Nor is it used as a vehicle to question the derivation of controls already approved by LSO unless a given TSR statement simply cannot be implemented as stated.

  4. [ECG indices in dogs after inhalation of 239Pu].

    Science.gov (United States)

    Karpova, V N

    1985-11-01

    Dogs of both sexes aged 2 to 4 were subjected to inhalation inoculation with polymer 239Pu or submicron 239PuO2 aerosols in amounts close to acute, subacute and chronically effective ones. ECG was recorded in standard, amplified and single leads (V3). All calculations were done by lead II. Signs of the right heart overburdening were noted in the presence of the P-pulmonale complex, deep S1 wave or cardiac electrical axis of SI-SII-SIII type. Signs of the right heart overburdening were revealed after inhalation of polimer 239Pu (70%). The absence of similar changes in damage caused by 239Pu could be attributed to its fast resorption from the lungs resulting in more moderate lesion of the respiratory organs.

  5. 7 CFR 205.239 - Livestock living conditions.

    Science.gov (United States)

    2010-01-01

    ... Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Organic Production and Handling Requirements § 205.239 Livestock...

  6. MARIOS: Irradiation of UO{sub 2} containing 15% americium at well defined temperature

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E., E-mail: elio.dagata@ec.europa.eu [European Commission, Joint Research Centre, Institute for Energy - P.O. Box 2, 1755 ZG Petten (Netherlands); Hania, P.R. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bejaoui, S. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France); Sciolla, C.; Wyatt, T.; Hannink, M.H.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Herlet, N.; Jankowiak, A. [Commissariat a l' Energie Atomique DTEC CEA Marcoule, 30207 Bagnols sur Ceze Cedex (France); Klaassen, F.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bonnerot, J.-M. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer MARIOS is designed to check the behaviour of Minor Actinide Blanket Module concept. Black-Right-Pointing-Pointer Main requirement of the experiment is an accurate control of the temperature. Black-Right-Pointing-Pointer The swelling and the helium release will be the main output of the experiment. Black-Right-Pointing-Pointer A complementary experiment (DIAMINO), will be performed in the next future. - Abstract: Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors of long-lived nuclides like {sup 241}Am is, therefore, an option for the reduction of radiotoxicity and residual power packages as well as the repository area. The MARIOS irradiation experiment is the latest of a series of experiments on americium transmutation (e.g. EFTTRA-T4, EFTTRA-T4bis, HELIOS). MARIOS experiment is carried out in the framework of the 4-year project FAIRFUELS of the EURATOM 7th Framework Programme (FP7). During the past years of experimental work in the field of transmutation and tests of innovative nuclear fuel containing americium, the release or trapping of helium as well as swelling has shown to be the key issue for the design of such kinds of target. Therefore, the main objective of the MARIOS experiment is to study the in-pile behaviour of UO{sub 2} containing minor actinides (MAs) in order to gain knowledge on the role of the microstructure and of the temperature on the gas release and on fuel swelling. The MARIOS experiment will be conducted in the HFR (high flux reactor) in Petten (The Netherlands) and will start in the beginning of 2011. It has been planned that the experiment will last 11 cycles, corresponding to 11 months. This paper covers the description of the objective of the experiment, as well as a general description of the design of the experiment.

  7. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  8. Pu-239 and Pu-240 inventories and Pu-240/ Pu-239 atom ratios in the water column off Sanriku, Japan.

    Science.gov (United States)

    Yamada, Masatoshi; Zheng, Jian; Aono, Tatsuo

    2013-04-01

    A magnitude 9.0 earthquake and subsequent tsunami occurred in the Pacific Ocean off northern Honshu, Japan, on 11 March 2011 which caused severe damage to the Fukushima Dai-ichi Nuclear Power Plant. This accident has resulted in a substantial release of radioactive materials to the atmosphere and ocean, and has caused extensive contamination of the environment. However, no information is available on the amounts of radionuclides such as Pu isotopes released into the ocean at this time. Investigating the background baseline concentration and atom ratio of Pu isotopes in seawater is important for assessment of the possible contamination in the marine environment. Pu-239 (half-life: 24,100 years), Pu-240 (half-life: 6,560 years) and Pu-241 (half-life: 14.325 years) mainly have been released into the environment as the result of atmospheric nuclear weapons testing. The atom ratio of Pu-240/Pu-239 is a powerful fingerprint to identify the sources of Pu in the ocean. The Pu-239 and Pu-240 inventories and Pu-240/Pu-239 atom ratios in seawater samples collected in the western North Pacific off Sanriku before the accident at Fukushima Dai-ichi Nuclear Power Plant will provide useful background baseline data for understanding the process controlling Pu transport and for distinguishing additional Pu sources. Seawater samples were collected with acoustically triggered quadruple PVC sampling bottles during the KH-98-3 cruise of the R/V Hakuho-Maru. The Pu-240/Pu-239 atom ratios were measured with a double-focusing SF-ICP-MS, which was equipped with a guard electrode to eliminate secondary discharge in the plasma and to enhance overall sensitivity. The Pu-239 and Pu-240 concentrations were 2.07 and 1.67 mBq/m3 in the surface water, respectively, and increased with depth; a subsurface maximum was identified at 750 m depth, and the concentrations decreased with depth, then increased at the bottom layer. The total Pu-239+240 inventory in the entire water column (depth interval 0

  9. Penetration and decontamination of americium-241 ex vivo using fresh and frozen pig skin.

    Science.gov (United States)

    Tazrart, A; Bolzinger, M A; Moureau, A; Molina, T; Coudert, S; Angulo, J F; Briancon, S; Griffiths, N M

    2017-04-01

    Skin contamination is one of the most probable risks following major nuclear or radiological incidents. However, accidents involving skin contamination with radionuclides may occur in the nuclear industry, in research laboratories and in nuclear medicine departments. This work aims to measure the penetration of the radiological contaminant Americium ((241)Am) in fresh and frozen skin and to evaluate the distribution of the contamination in the skin. Decontamination tests were performed using water, Fuller's earth and diethylene triamine pentaacetic acid (DTPA), which is the recommended treatment in case of skin contamination with actinides such as plutonium or americium. To assess these parameters, we used the Franz cell diffusion system with full-thickness skin obtained from pigs' ears, representative of human skin. Solutions of (241)Am were deposited on the skin samples. The radioactivity content in each compartment and skin layers was measured after 24 h by liquid scintillation counting and alpha spectrophotometry. The Am cutaneous penetration to the receiver compartment is almost negligible in fresh and frozen skin. Multiple washings with water and DTPA recovered about 90% of the initial activity. The rest remains fixed mainly in the stratum corneum. Traces of activity were detected within the epidermis and dermis which is fixed and not accessible to the decontamination.

  10. {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am levels in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France)

    Energy Technology Data Exchange (ETDEWEB)

    Rousseau, G.; Mokili, M.B.; Le Roy, C.; Pagano, V. [SUBATECH/IN2P3 (France); Gontier, G.; Boyer, C. [EDF-DPI-DIN-CIDEN (France); Chardon, P. [CNRS/IN2P3 (France); Hemidy, P.Y. [EDF-DPN-UNIE-GPRE-IEV (France)

    2014-07-01

    Plutonium and americium long-lived alpha emitter isotopes can be found in the environment because of atmospheric global fallout due to thermonuclear tests performed between 1945 and 1980, to the American SNAP 9A satellite explosion in 1964, to the Chernobyl nuclear power plant accident,... In France, the nuclear safety authority does not allow the release of artificial alpha emitters from nuclear power plants. Thus, monitoring is performed to verify the absence of these alpha emitters in liquid discharges to respect the limits set by the regulations. These thresholds ensure a very low dosimetric impact to the population compared to other radionuclides. With the objective of environmental monitoring around nuclear facilities, activity measurements of long-lived alpha emitters are carried out to detect the traces of these radionuclides. Analysis of low activity by alpha spectrometry after chemical steps were performed and used to determine the {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am activities on a large set of environmental solid samples likely to be encountered in environmental monitoring as soils, sediments, terrestrial and aquatic bio-indicators. The samples collected in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France) was investigated for the 2009-2014 period. It was found that the mean activity concentration of the most frequently detected was for the radionuclide {sup 238}Pu: from <0.00031 to 0.0061 Bq/kg dry in terrestrial samples and from <0.00086 to 0.011 Bq/kg dry in aquatic samples; for the radionuclide {sup 239+240}Pu: from 0.00041 to 0.150 Bq/kg dry in terrestrial samples and from 0.0023 to 0.240 Bq/kg dry in aquatic samples and for the radionuclide {sup 241}Am: from <0.00086 to 0.087 Bq/kg dry in terrestrial samples and from 0.0022 to 0.120 Bq/kg dry in aquatic samples. {sup 238}Pu/{sup 239+240}Pu and {sup 241}Am/{sup 239+240}Pu ratios determined are in accordance with an environmental contamination due to

  11. Determination of {sup 238}Pu, {sup 239+240}Pu, {sup 241}Pu and {sup 241}Am in radioactive waste from IPEN reactor

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca; Taddei, Maria Helena T.; Cheberle, Sandra M.; Ferreira, Marcelo T., E-mail: bgeraldo@cnen.gov.b, E-mail: mhtaddei@cnen.gov.b, E-mail: scsantos@cnen.gov.b, E-mail: ferreira@cnen.gov.b [Brazilian Nuclear Energy Commission (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Lab. of Pocos de Caldas; Marumo, Julio T., E-mail: jtmarumo@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Ion exchange resin is a common type of radioactive waste arising from treatment of coolant water of the main circuit of research and nuclear power reactors. This waste contains high concentrations of fission and activation products. The management of this waste includes its characterization in order to determine and quantify specific radionuclides including those known as difficult-to-measure radionuclides (RDM). The analysis of RDMs generally involves expensive and time-consuming complex radiochemical analysis for purification and separation of the radionuclides. The objective of this work is to show an easy methodology for quantifying plutonium and americium isotopes in spent ion exchange resin, used for purification of the cooling water of the IEA-R1 reactor located at the Nuclear and Energy Research Institute, IPEN-CNEN/SP. The resins were destroyed by acid digestion, followed by purification and separation of the Pu and Am isotopes with anionic and chromatographic resins. {sup 238}Pu, {sup 239}+{sup 24}'0Pu, and {sup 24}'1Am isotopes were analyzed in an alpha spectrometer equipped with surface barrier detectors. {sup 241}Pu isotope was analyzed by liquid scintillation counting. Chemical recovery yield ranged from 73 to 98% for Pu and 77 to 98% for Am, demonstrating that the methodology is suitable for identification and quantification of the isotopes studied in spent resins. (author)

  12. Magnesium ionophore II as an extraction agent for trivalent europium and americium

    Energy Technology Data Exchange (ETDEWEB)

    Makrlik, Emanuel [Czech Univ. of Life Sciences, Prague (Czech Republic). Faculty of Environmental Sciences; Vanura, Petr [Univ. of Chemistry and Technology, Prague (Czech Republic). Dept. of Analytical Chemistry

    2016-11-01

    Solvent extraction of microamounts of trivalent europium and americium into nitrobenzene by using a mixture of hydrogen dicarbollylcobaltate (H{sup +}B{sup -}) and magnesium ionophore II (L) was studied. The equilibrium data were explained assuming that the species HL{sup +}, HL{sup +}{sub 2}, ML{sup 3+}{sub 2}, and ML{sup 3+}{sub 3} (M{sup 3+} = Eu{sup 3+}, Am{sup 3+}; L=magnesium, ionophore II) are extracted into the nitrobenzene phase. Extraction and stability constants of the cationic complex species in nitrobenzene saturated with water were determined and discussed. From the experimental results it is evident that this effective magnesium ionophore II receptor for the Eu{sup 3+} and Am{sup 3+} cations could be considered as a potential extraction agent for nuclear waste treatment.

  13. Imitators of plutonium and americium in a mixed uranium- plutonium nitride fuel

    Science.gov (United States)

    Nikitin, S. N.; Shornikov, D. P.; Tarasov, B. A.; Baranov, V. G.; Burlakova, M. A.

    2016-04-01

    Uranium nitride and mix uranium nitride (U-Pu)N is most popular nuclear fuel for Russian Fast Breeder Reactor. The works in hot cells associated with the radiation exposure of personnel and methodological difficulties. To know the main physical-chemical properties of uranium-plutonium nitride it necessary research to hot cells. In this paper, based on an assessment of physicochemical and thermodynamic properties of selected simulators Pu and Am. Analogues of Pu is are Ce and Y, and analogues Am - Dy. The technique of obtaining a model nitride fuel based on lanthanides nitrides and UN. Hydrogenation-dehydrogenation- nitration method of derived powders nitrides uranium, cerium, yttrium and dysprosium, held their mixing, pressing and sintering, the samples obtained model nitride fuel with plutonium and americium imitation. According to the results of structural studies have shown that all the samples are solid solution nitrides rare earth (REE) elements in UN.

  14. The Role of Colloids in the Transport of Plutonium and Americium: Implications for

    Energy Technology Data Exchange (ETDEWEB)

    Kersting, A B

    2003-09-17

    Colloids are small particulates (ranging in size from 1 to 0.001 micron) composed of inorganic and organic material and found in all natural water. Due to their small size, they have the ability to remain suspended in water and transported. Small amounts of plutonium (Pu) and americium (Am) can adsorb (attach) to colloids, and/or form colloidal-sized polymers and migrate in water. At Rocky Flats Environmental Technology Site (RFETS) sedimentation and resuspension of particulates and colloids in surface waters represent the dominant process for Pu and Am migration. The amount of Pu and Am that can be transported at RFETS has been quantified in the Pathway Analysis Report. The Pathway Analysis Report shows that the two dominant pathways for Pu and Am transport at RFETS are air and surface water. Shallow groundwater and biological pathways are minor.

  15. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  16. 48 CFR 652.239-71 - Security Requirements for Unclassified Information Technology Resources.

    Science.gov (United States)

    2010-10-01

    ... Unclassified Information Technology Resources. 652.239-71 Section 652.239-71 Federal Acquisition Regulations... Provisions and Clauses 652.239-71 Security Requirements for Unclassified Information Technology Resources. As... Technology Resources (SEP 2007) (a) General. The Contractor shall be responsible for information...

  17. 48 CFR 1252.239-70 - Security requirements for unclassified information technology resources.

    Science.gov (United States)

    2010-10-01

    ... unclassified information technology resources. 1252.239-70 Section 1252.239-70 Federal Acquisition Regulations... of Provisions and Clauses 1252.239-70 Security requirements for unclassified information technology... Unclassified Information Technology Resources (APR 2005) (a) The Contractor shall be responsible...

  18. 48 CFR 352.239-72 - Security requirements for Federal information technology resources.

    Science.gov (United States)

    2010-10-01

    ... Federal information technology resources. 352.239-72 Section 352.239-72 Federal Acquisition Regulations... Provisions and Clauses 352.239-72 Security requirements for Federal information technology resources. As... Federal Information Technology Resources (January 2010) (a) Applicability. This clause applies whether...

  19. 40 CFR 81.239 - Upper Rio Grande Valley Intrastate Air Quality Control Region.

    Science.gov (United States)

    2010-07-01

    ... Air Quality Control Regions § 81.239 Upper Rio Grande Valley Intrastate Air Quality Control Region. The Upper Rio Grande Valley Intrastate Air Quality Control Region (New Mexico) consists of the... Quality Control Region. 81.239 Section 81.239 Protection of Environment ENVIRONMENTAL PROTECTION...

  20. 42 CFR 403.239 - Submittal of material to retain certification.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Submittal of material to retain certification. 403.239 Section 403.239 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND... Certification Program: General Provisions § 403.239 Submittal of material to retain certification. (a)...

  1. Preliminary Study on the Determination of ~(235)U and ~(239)Pu Using Delayed Neutron Counting Method

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    The preliminary study on the fast measurements of 235U and 239Pu in samples containing 235U, 239Pu and 235U-239Pu mixture using delayed neutron counting method is introduced. All samples were irradiated for 30 s using the 30 kW Miniature Neutron

  2. 16 CFR 239.4 - “Lifetime” and similar representations.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false âLifetimeâ and similar representations. 239.4 Section 239.4 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR THE ADVERTISING OF WARRANTIES AND GUARANTEES § 239.4 “Lifetime” and similar representations. If...

  3. Separation of oxidized americium from lanthanides by use of pillared metal(IV) phosphate-phosphonate hybrid materials

    Energy Technology Data Exchange (ETDEWEB)

    Burns, J.D.; Clearfield, A. [Texas A and M Univ., College Station, TX (United States). Dept. of Chemistry; Borkowski, M.; Reed, D.T. [Los Alamos National Laboratory, Carlsbad, NM (United States). Earth and Environmental Sciences Div.

    2012-07-01

    Closing the nuclear fuel cycle in the US poses many challenges, one of which is found in the waste streams, which contain both trivalent lanthanides and actinides. The separation of americium from the raffinate will dramatically reduce the long-term radiotoxicity of the waste. The sorption of americium in both the tri- and pentavalent oxidation states was observed for four M(IV) phosphate-phosphonate ion exchange materials in nitric acid at pH 2. High selectivity was observed for reduced Am(III) with K{sub d} values ca. 6 x 10{sup 5} mL/g, while the K{sub d} values for Am(V) were much lower. A new method of synthesizing and stabilizing AmO{sub 2}{sup +} to yield a lifetime of at least 24 h in acidic media using a combination of sodium persulfate and calcium hypochlorite will be described.

  4. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state properties...... spectrum at ambient pressure relate, for some parameter choices, well to peak positions in the calculated density of states function of Am-I....

  5. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  6. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  7. Plutonium and americium inventories in atmospheric fallout and sediment cores from Blelham Tarn, Cumbria (UK)

    Energy Technology Data Exchange (ETDEWEB)

    Michel, H. E-mail: herve.michel@unice.fr; Barci-Funel, G.; Dalmasso, J.; Ardisson, G.; Appleby, P.G.; Haworth, E.; El-Daoushy, F

    2002-07-01

    The objective of this paper is to report on the results of a study of {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am inventories onto Blelham Tarn in Cumbria (UK). The atmospheric fallout inventory was obtained by analysing soil cores and the results are in good agreement with the literature: 101 Bq m{sup -2} for {sup 239+240}Pu; 4.5 Bq m{sup -2} for {sup 238}Pu and 37 Bq m{sup -2} for {sup 241}Am. The sediment core inventory for the whole lake is compared to the atmospheric fallout inventory. The sediment activity is 60-80% higher than the estimated fallout activity, showing a catchment area contribution and in particular the stream input.

  8. Plutonium and americium inventories in atmospheric fallout and sediment cores from Blelham Tarn, Cumbria (UK).

    Science.gov (United States)

    Michel, H; Barci-Funel, G; Dalmasso, J; Ardisson, G; Appleby, P G; Haworth, E; El-Daoushy, F

    2002-01-01

    The objective of this paper is to report on the results of a study of 238Pu, 239 + 240Pu and 241Am inventories onto Blelham Tarn in Cumbria (UK). The atmospheric fallout inventory was obtained by analysing soil cores and the results are in good agreement with the literature: 101 Bq m(-2) for 239 + 240Pu; 4.5 Bq m(-2) for 238Pu and 37 Bq m(-2) for 241Am. The sediment core inventory for the whole lake is compared to the atmospheric fallout inventory. The sediment activity is 60-80% higher than the estimated fallout activity, showing a catchment area contribution and in particular the stream input.

  9. Neutron Resonance Parameters and Covariance Matrix of 239Pu

    Energy Technology Data Exchange (ETDEWEB)

    Derrien, Herve [ORNL; Leal, Luiz C [ORNL; Larson, Nancy M [ORNL

    2008-08-01

    In order to obtain the resonance parameters in a single energy range and the corresponding covariance matrix, a reevaluation of 239Pu was performed with the code SAMMY. The most recent experimental data were analyzed or reanalyzed in the energy range thermal to 2.5 keV. The normalization of the fission cross section data was reconsidered by taking into account the most recent measurements of Weston et al. and Wagemans et al. A full resonance parameter covariance matrix was generated. The method used to obtain realistic uncertainties on the average cross section calculated by SAMMY or other processing codes was examined.

  10. Disposition of plutonium-239 via production of fission molybdenum-99.

    Science.gov (United States)

    Mushtaq, A

    2011-04-01

    A heritage of physical consequences of the U.S.-Soviet arms race has accumulated, the weapons-grade plutonium (WPu), which will become excess as a result of the dismantlement of the nuclear weapons under the arms reduction agreements. Disposition of Pu has been proposed by mixing WPu with high-level radioactive waste with subsequent vitrification into large, highly radioactive glass logs or fabrication into mixed oxide fuel with subsequent irradiation in existing light water reactors. A potential option may be the production of medical isotope molybdenum-99 by using Pu-239 targets.

  11. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  12. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  13. Experimental studies on the biokinetics of plutonium and americium in the cephalopod Octopus vulgaris

    Energy Technology Data Exchange (ETDEWEB)

    Guary, J.C.; Fowler, S.W.

    1982-03-05

    Radiotracer experiments using the photon-emitters /sup 237/Pu and /sup 241/Am were performed to examine uptake, tissue distribution and retention of plutonium and americium in the cephalopod Octopus vulgaris Cuvier. A 2 wk exposure in contaminated sea water resulted in twice as much /sup 237/Pu being taken up by whole octopus as /sup 241/Am. Immediately following uptake approximately 41% and 73% of the /sup 237/Pu and /sup 241/Am respectively were located in the branchial hearts. Depuration rates for both radionuclides were identical; approximately 46% of both radionuclides initially incorporated were associated with a long-lived compartment which turned over very slowly (Tbsub(1/2) = 1.5 yr). Longer exposures to /sup 241/Am resulted in an increase in the size of the slowly exchanging /sup 241/Am pool in the octopus. After 2 mo depuration, the majority of the residual activity of both radionuclides was in the branchial hearts. On average 33% of the /sup 241/Am ingested with food was assimilated into tissues, primarily the hepatopancreas. Different whole-body /sup 241/Am excretion rates were observed at different times following assimilation and were related to transfer processes taking place within internal tissues, most notably between hepatopancreas and the branchial hearts. Relationships between circulatory and excretory functions of these 2 organs are discussed and a physiological mechanism is proposed to explain the observed patterns of /sup 241/Am excretion in O. vulgaris.

  14. In Vitro Dissolution Tests of Plutonium and Americium Containing Contamination Originating From ZPPR Fuel Plates

    Energy Technology Data Exchange (ETDEWEB)

    William F. Bauer; Brian K. Schuetz; Gary M. Huestis; Thomas B. Lints; Brian K. Harris; R. Duane Ball; Gracy Elias

    2012-09-01

    Assessing the extent of internal dose is of concern whenever workers are exposed to airborne radionuclides or other contaminants. Internal dose determinations depend upon a reasonable estimate of the expected biological half-life of the contaminants in the respiratory tract. One issue with refractory elements is determining the dissolution rate of the element. Actinides such as plutonium (Pu) and Americium (Am) tend to be very refractory and can have biological half-lives of tens of years. In the event of an exposure, the dissolution rates of the radionuclides of interest needs to be assessed in order to assign the proper internal dose estimates. During the November 2011 incident at the Idaho National Laboratory (INL) involving a ZPPR fuel plate, air filters in a constant air monitor (CAM) and a giraffe filter apparatus captured airborne particulate matter. These filters were used in dissolution rate experiments to determine the apparent dissolution half-life of Pu and Am in simulated biological fluids. This report describes these experiments and the results. The dissolution rates were found to follow a three term exponential decay equation. Differences were noted depending upon the nature of the biological fluid simulant. Overall, greater than 95% of the Pu and 93% of the Am were in a very slow dissolving component with dissolution half-lives of over 10 years.

  15. Plutonium and americium monazite materials: Solid state synthesis and X-ray diffraction study

    Energy Technology Data Exchange (ETDEWEB)

    Bregiroux, D. [DEN/DEC/SPUA, Commissariat a l' Energie Atomique, Cadarache, 13108 Saint Paul Lez Durance (France); Laboratoire Science des Procedes Ceramiques et de Traitements de Surface, UMR CNRS-Universite no. 6638, Batiment Chimie, 123 avenue Albert Thomas, 87060 Limoges (France); E-mail: damien.bregiroux@ccr.jussieu.fr; Belin, R. [DEN/DEC/SPUA, Commissariat a l' Energie Atomique, Cadarache, 13108 Saint Paul Lez Durance (France); Valenza, P. [DEN/DEC/SPUA, Commissariat a l' Energie Atomique, Cadarache, 13108 Saint Paul Lez Durance (France); Audubert, F. [DEN/DEC/SPUA, Commissariat a l' Energie Atomique, Cadarache, 13108 Saint Paul Lez Durance (France); Bernache-Assollant, D. [Ecole Nationale Superieure des Mines, 158 Cours Fauriel, 42023 Saint Etienne (France)

    2007-06-30

    High-temperature solid state syntheses of monazite powders containing plutonium (III), plutonium (IV) and americium (III) were performed. Resulting powders were characterized by X-ray diffraction. Pu{sup 3+}PO{sub 4} was readily obtained as a single phase by heating a Pu{sup 4+}O{sub 2}-NH{sub 4}H{sub 2}PO{sub 4} mixture under argon atmosphere. Traces of tetravalent plutonium phosphate Pu{sup 4+}P{sub 2}O{sub 7} were detected when synthesized under air atmosphere. The incorporation of (Pu{sup 4+},Ca{sup 2+}) in the monazite structure was investigated under air and argon atmosphere. We showed that Pu{sup 4+} is fully reduced in Pu{sup 3+} under argon atmosphere whereas, under air, the compound with the formula Pu{sub 0.4}{sup 3+}Pu{sub 0.3}{sup 4+}Ca{sub 0.3}{sup 2+}PO{sub 4} was obtained. Pure Am{sup 3+}PO{sub 4} was also synthesized under argon atmosphere. X-ray patterns revealed a complete amorphisation of the monazite structure at a relatively low cumulative alpha dose for {sup 241}AmPO{sub 4}.

  16. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    Energy Technology Data Exchange (ETDEWEB)

    Suneesh, A.S.; Venkatesan, K.A.; Syamala, K.V.; Antony, M.P.; Vasudeva Rao, P.R. [Indira Gandhi Centre for Atomic Research, Kalpakkam (India). Fuel Chemistry Div.

    2012-07-01

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by {sup 1}H and {sup 13}C NMR, mass and IR spectroscopy. The extraction behaviour of {sup (152+154})Eu(III) and {sup 241}Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for {sup (152+154)}Eu(III) and HDEHSDGA shows the superior selectivity for {sup 241}Am(III). (orig.)

  17. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed.

  18. Yeast Interacting Proteins Database: YDL239C, YLR423C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p...0 0 - - - - - 0 0 34 - Show YDL239C Bait ORF YDL239C Bait gene name ADY3 Bait des...ure at the leading edge of the prospore membrane via interaction with spindle pole body components; potentia

  19. Vertical distributions of radionuclides ((239+240)Pu, (240)Pu/(239)Pu, and (137)Cs) in sediment cores of Lake Bosten in Northwestern China.

    Science.gov (United States)

    Liao, Haiqing; Bu, Wenting; Zheng, Jian; Wu, Fengchang; Yamada, Masatoshi

    2014-04-01

    Artificial radionuclides ((137)Cs, (239+240)Pu, (241)Pu, (241)Am) deposited in lacustrine sediments have been used for dating as well as radionuclide source identification. In the present work, we investigated the vertical distributions of (239+240)Pu and (137)Cs activities, (240)Pu/(239)Pu atom ratios, and (239+240)Pu/(137)Cs activity ratios in sediment cores collected from Lake Bosten, which is the lake closest to the Lop Nor Chinese Nuclear Weapon Test site in northwestern China. Uniformly high concentrations of (239+240)Pu and (137)Cs were found in the upper layers deposited since 1964 in the sediment cores, and these were controlled by the resuspension of soil containing radionuclides from the nearby land surface. As the Chinese nuclear tests varied remarkably in yield, the mixing of the tropospheric deposition from these tests and the stratospheric deposition of global fallout has led to a (240)Pu/(239)Pu atom ratio that is similar to that of global fallout and to a (239+240)Pu/(137)Cs activity ratio that is slightly higher than that of global fallout. However, a low (240)Pu/(239)Pu atom ratio of 0.080 and high (239+240)Pu/(137)Cs activity ratio of 0.087, significantly different from the global fallout values, were observed in one sediment core (07BS10-2), indicating the inhomogenous tropospheric deposition from the Chinese nuclear tests in Lake Bosten during 1967-1973. These results are important to understand the influence of the CNTs on the radionuclide contamination in Lake Bosten.

  20. AMS of natural 236U and 239Pu produced in uranium ores

    Science.gov (United States)

    Wilcken, K. M.; Barrows, T. T.; Fifield, L. K.; Tims, S. G.; Steier, P.

    2007-06-01

    The rare isotopes 236U and 239Pu are produced naturally by neutron capture in uranium ores. Here we measure 236U and 239Pu by accelerator mass spectrometry (AMS) in the same ore samples for the first time. To ensure efficient extraction of both elements and isotopic equilibrium between the 239Pu in the ore and a 242Pu spike, we developed a new sample preparation protocol. AMS has clear advantages over previous methods because it achieves better discrimination against molecular interferences with higher sensitivity and shorter counting times. Measurements of 236U and 239Pu hold considerable promise as proxy indicators of neutron flux and uranium concentration.

  1. Assessment of Neptunium, Americium, and Curium in the Savannah River Site Environment

    Energy Technology Data Exchange (ETDEWEB)

    Carlton, W.H. [Westinghouse Savannah River Company, AIKEN, SC (United States)

    1997-12-17

    A series of documents has been published in which the impact of various radionuclides released to the environment by Savannah River Site (SRS) operations has been assessed. The quantity released, the disposition of the radionuclides in the environment, and the dose to offsite individuals has been presented for activation products, carbon cesium, iodine, plutonium, selected fission products, strontium, technetium, tritium, uranium, and the noble gases. An assessment of the impact of nonradioactive mercury also has been published.This document assesses the impact of radioactive transuranics released from SRS facilities since the first reactor became operational late in 1953. The isotopes reported here are 239Np, 241Am, and 244Cm.

  2. Vertical distribution of radiocaesium, plutonium and americium in the Catalan Sea (northwestern Mediterranean)

    Energy Technology Data Exchange (ETDEWEB)

    Molero, J.; Sanchez-Cabeza, J.A.; Merino, J.; Pujol, Ll.; Vidal-Quadras, A. [Universidad Autonoma de Barcelona (Spain). Facultad de Ciencias; Mitchell, P.I. [University Coll., Dublin (Ireland). Lab. of Radiation Physics

    1995-07-01

    Caesium-137, {sup 239,240}Pu and {sup 241}Am concentration profiles (0-1000 m) have been determined in unfiltered large volume water samples collected from the Catalan Sea (northwestern Mediterranean). Results showed that radiocaesium concentration decreases quickly through the water column while the transuranic concentration increases with depth, showing a faster migration to the bottom layers. Comparing our results with those reported by other authors (1975-1980), radiocaesium input from Chernobyl releases has been identified through the profile. In addition, transuranic concentrations have decreased considerably in the different layers of the profile. (Author).

  3. Gamma-ray Output Spectra from 239Pu Fission

    Directory of Open Access Journals (Sweden)

    Ullmann John

    2015-01-01

    Full Text Available Gamma-ray multiplicities, individual gamma-ray energy spectra, and total gamma energy spectra following neutron-induced fission of 239Pu were measured using the DANCE detector at Los Alamos. Corrections for detector response were made using a forward-modeling technique based on propagating sets of gamma rays generated from a paramaterized model through a GEANT model of the DANCE array and adjusting the parameters for best fit to the measured spectra. The results for the gamma-ray spectrum and multiplicity are in general agreement with previous results, but the measured total gamma-ray energy is about 10% higher. A dependence of the gamma-ray spectrum on the gamma-ray multplicity was also observed. Global model calculations of the multiplicity and gamma energy distributions are in good agreement with the data, but predict a slightly softer total-energy distribution.

  4. Americium/Lanthanide Separations in Alkaline Solutions for Advanced Nuclear Fuel Cycles

    Energy Technology Data Exchange (ETDEWEB)

    Goff, George S. [Los Alamos National Laboratory; Long, Kristy Marie [Los Alamos National Laboratory; Reilly, Sean D. [Los Alamos National Laboratory; Jarvinen, Gordon D. [Los Alamos National Laboratory; Runde, Wolfgang H. [Los Alamos National Laboratory

    2012-06-11

    Project goals: Can used nuclear fuel be partitioned by dissolution in alkaline aqueous solution to give a solution of uranium, neptunium, plutonium, americium and curium and a filterable solid containing nearly all of the lanthanide fission products and certain other fission products? What is the chemistry of Am/Cm/Ln in oxidative carbonate solutions? Can higher oxidation states of Am be stabilized and exploited? Conclusions: Am(VI) is kinetically stable in 0.5-2.0 M carbonate solutions for hours. Aliquat 336 in toluene has been successfully shown to extract U(VI) and Pu(VI) from carbonate solutions. (Stepanov et al 2011). Higher carbonate concentration gives lower D, SF{sub U/Eu} for = 4 in 1 M K{sub 2}CO{sub 3}. Experiments with Am(VI) were unsuccessful due to reduction by the organics. Multiple sources of reducing organics...more optimization. Reduction experiments of Am(VI) in dodecane/octanol/Aliquat 336 show that after 5 minutes of contact, only 30-40% of the Am(VI) has been reduced. Long enough to perform an extraction. Shorter contact times, lower T, and lower Aliquat 336 concentration still did not result in any significant extraction of Am. Anion exchange experiments using a strong base anion exchanger show uptake of U(VI) with minimal uptake of Nd(III). Experiments with Am(VI) indicate Am sorption with a Kd of 9 (10 minute contact) but sorption mechanism is not yet understood. SF{sub U/Nd} for = 7 and SF{sub U/Eu} for = 19 after 24 hours in 1 M K{sub 2}CO{sub 3}.

  5. 16 CFR 239.1 - Purpose and scope of the guides.

    Science.gov (United States)

    2010-01-01

    ... Advertising of Warranties and Guarantees are intended to help advertisers avoid unfair or deceptive practices... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Purpose and scope of the guides. 239.1 Section 239.1 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR...

  6. 16 CFR 239.2 - Disclosures in warranty or guarantee advertising.

    Science.gov (United States)

    2010-01-01

    ... advertising. 239.2 Section 239.2 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES... advertising. (a) If an advertisement mentions a warranty or guarantee that is offered on the advertised... mentions a warranty or guarantee that is offered on the advertised product, the advertisement...

  7. 40 CFR 239.4 - Narrative description of state permit program.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Narrative description of state permit program. 239.4 Section 239.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID... Narrative description of state permit program. The description of a state's program must include: (a)...

  8. 48 CFR 252.239-7012 - Title to telecommunication facilities and equipment.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Title to telecommunication... CLAUSES Text of Provisions And Clauses 252.239-7012 Title to telecommunication facilities and equipment. As prescribed in 239.7411(b), use the following clause: Title to Telecommunication Facilities...

  9. 49 CFR Appendix A to Part 239 - Schedule of Civil Penalties 1

    Science.gov (United States)

    2010-10-01

    ...,000 6,000 (ii) Emergency windows tested too infrequently 1,500 3,000 (b)(3) Failure to repair an... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PASSENGER TRAIN EMERGENCY PREPAREDNESS Pt. 239, App. A Appendix A to... Requirements: 239.101(a) Failure of a railroad to adopt a written emergency preparedness plan $7,500 $11,000...

  10. Concordant plutonium-241-americium-241 dating of environmental samples: results from forest fire ash

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, Steven J [Los Alamos National Laboratory; Oldham, Warren J [Los Alamos National Laboratory; Murrell, Michael T [Los Alamos National Laboratory; Katzman, Danny [Los Alamos National Laboratory

    2010-12-07

    We have measured the Pu, {sup 237}Np, {sup 241}Am, and {sup 151}Sm isotopic systematics for a set of forest fire ash samples from various locations in the western U.S. including Montana, Wyoming, Idaho, and New Mexico. The goal of this study is to develop a concordant {sup 241}Pu (t{sub 1/2} = 14.4 y)-{sup 241}Am dating method for environmental collections. Environmental samples often contain mixtures of components including global fallout. There are a number of approaches for subtracting the global fallout component for such samples. One approach is to use {sup 242}/{sup 239}Pu as a normalizing isotope ratio in a three-isotope plot, where this ratio for the nonglobal fallout component can be estimated or assumed to be small. This study investigates a new, complementary method of normalization using the long-lived fission product, {sup 151}Sm (t{sub 1/2} = 90 y). We find that forest fire ash concentrates actinides and fission products with {approx}1E10 atoms {sup 239}Pu/g and {approx}1E8 atoms {sup 151}Sm/g, allowing us to measure these nuclides by mass spectrometric (MIC-TIMS) and radiometric (liquid scintillation counting) methods. The forest fire ash samples are characterized by a western U.S. regional isotopic signature representing varying mixtures of global fallout with a local component from atmospheric testing of nuclear weapons at the Nevada Test Site (NTS). Our results also show that {sup 151}Sm is well correlated with the Pu nuclides in the forest fire ash, suggesting that these nuclides have similar geochemical behavior in the environment. Results of this correlation indicate that the {sup 151}Sm/{sup 239}Pu atom ratio for global fallout is {approx}0.164, in agreement with an independent estimate of 0.165 based on {sup 137}Cs fission yields for atmospheric weapons tests at the NTS. {sup 241}Pu-{sup 241}Am dating of the non-global fallout component in the forest fire ash samples yield ages in the late 1950's-early 1960's, consistent with a peak

  11. Sequential determination of natural ({sup 232}Th, {sup 238}U) and anthropogenic ({sup 137}Cs, {sup 90}Sr, {sup 241}Am, {sup 239+240}Pu) radionuclides in environmental matrix

    Energy Technology Data Exchange (ETDEWEB)

    Michel, H.; Levent, D.; Barci, V.; Barci-Funel, G.; Hurel, C. [Laboratoire de Radiochimie, Sciences Analytiques et Environnement (LRSAE), Universite de Nice Sophia-Antipolis 06108 Nice Cedex (France)

    2008-07-01

    A new sequential method for the determination of both natural (U, Th) and anthropogenic (Sr, Cs, Pu, Am) radionuclides has been developed for application to soil and sediment samples. The procedure was optimised using a reference sediment (IAEA-368) and reference soils (IAEA-375 and IAEA-326). Reference materials were first digested using acids (leaching), 'total' acids on hot plate, and acids in microwave in order to compare the different digestion technique. Then, the separation and purification were made by anion exchange resin and selective extraction chromatography: Transuranic (TRU) and Strontium (SR) resins. Natural and anthropogenic alpha radionuclides were separated by Uranium and Tetravalent Actinide (UTEVA) resin, considering different acid elution medium. Finally, alpha and gamma semiconductor spectrometer and liquid scintillation spectrometer were used to measure radionuclide activities. The results obtained for strontium-90, cesium-137, thorium-232, uranium- 238, plutonium-239+240 and americium-241 isotopes by the proposed method for the reference materials provided excellent agreement with the recommended values and good chemical recoveries. (authors)

  12. In situ characterization of uranium and americium oxide solid solution formation for CRMP process: first combination of in situ XRD and XANES measurements.

    Science.gov (United States)

    Caisso, Marie; Picart, Sébastien; Belin, Renaud C; Lebreton, Florent; Martin, Philippe M; Dardenne, Kathy; Rothe, Jörg; Neuville, Daniel R; Delahaye, Thibaud; Ayral, André

    2015-04-14

    Transmutation of americium in heterogeneous mode through the use of U1-xAmxO2±δ ceramic pellets, also known as Americium Bearing Blankets (AmBB), has become a major research axis. Nevertheless, in order to consider future large-scale deployment, the processes involved in AmBB fabrication have to minimize fine particle dissemination, due to the presence of americium, which considerably increases the risk of contamination. New synthesis routes avoiding the use of pulverulent precursors are thus currently under development, such as the Calcined Resin Microsphere Pelletization (CRMP) process. It is based on the use of weak-acid resin (WAR) microspheres as precursors, loaded with actinide cations. After two specific calcinations under controlled atmospheres, resin microspheres are converted into oxide microspheres composed of a monophasic U1-xAmxO2±δ phase. Understanding the different mechanisms during thermal conversion, that lead to the release of organic matter and the formation of a solid solution, appear essential. By combining in situ techniques such as XRD and XAS, it has become possible to identify the key temperatures for oxide formation, and the corresponding oxidation states taken by uranium and americium during mineralization. This paper thus presents the first results on the mineralization of (U,Am) loaded resin microspheres into a solid solution, through in situ XAS analysis correlated with HT-XRD.

  13. A Method for Continuous (239)Pu Determinations in Arctic and Antarctic Ice Cores.

    Science.gov (United States)

    Arienzo, M M; McConnell, J R; Chellman, N; Criscitiello, A S; Curran, M; Fritzsche, D; Kipfstuhl, S; Mulvaney, R; Nolan, M; Opel, T; Sigl, M; Steffensen, J P

    2016-07-05

    Atmospheric nuclear weapons testing (NWT) resulted in the injection of plutonium (Pu) into the atmosphere and subsequent global deposition. We present a new method for continuous semiquantitative measurement of (239)Pu in ice cores, which was used to develop annual records of fallout from NWT in ten ice cores from Greenland and Antarctica. The (239)Pu was measured directly using an inductively coupled plasma-sector field mass spectrometer, thereby reducing analysis time and increasing depth-resolution with respect to previous methods. To validate this method, we compared our one year averaged results to published (239)Pu records and other records of NWT. The (239)Pu profiles from the Arctic ice cores reflected global trends in NWT and were in agreement with discrete Pu profiles from lower latitude ice cores. The (239)Pu measurements in the Antarctic ice cores tracked low latitude NWT, consistent with previously published discrete records from Antarctica. Advantages of the continuous (239)Pu measurement method are (1) reduced sample preparation and analysis time; (2) no requirement for additional ice samples for NWT fallout determinations; (3) measurements are exactly coregistered with all other chemical, elemental, isotopic, and gas measurements from the continuous analytical system; and (4) the long half-life means the (239)Pu record is stable through time.

  14. LIBS Spectral Data for a Mixed Actinide Fuel Pellet Containing Uranium, Plutonium, Neptunium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Judge, Elizabeth J. [Los Alamos National Laboratory; Berg, John M. [Los Alamos National Laboratory; Le, Loan A. [Los Alamos National Laboratory; Lopez, Leon N. [Los Alamos National Laboratory; Barefield, James E. [Los Alamos National Laboratory

    2012-06-18

    Laser-induced breakdown spectroscopy (LIBS) was used to analyze a mixed actinide fuel pellet containing 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2}. The preliminary data shown here is the first report of LIBS analysis of a mixed actinide fuel pellet, to the authors knowledge. The LIBS spectral data was acquired in a plutonium facility at Los Alamos National Laboratory where the sample was contained within a glove box. The initial installation of the glove box was not intended for complete ultraviolet (UV), visible (VIS) and near infrared (NIR) transmission, therefore the LIBS spectrum is truncated in the UV and NIR regions due to the optical transmission of the window port and filters that were installed. The optical collection of the emission from the LIBS plasma will be optimized in the future. However, the preliminary LIBS data acquired is worth reporting due to the uniqueness of the sample and spectral data. The analysis of several actinides in the presence of each other is an important feature of this analysis since traditional methods must chemically separate uranium, plutonium, neptunium, and americium prior to analysis. Due to the historic nature of the sample fuel pellet analyzed, the provided sample composition of 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2} cannot be confirm without further analytical processing. Uranium, plutonium, and americium emission lines were abundant and easily assigned while neptunium was more difficult to identify. There may be several reasons for this observation, other than knowing the exact sample composition of the fuel pellet. First, the atomic emission wavelength resources for neptunium are limited and such techniques as hollow cathode discharge lamp have different dynamics than the plasma used in LIBS which results in different emission spectra. Secondly, due to the complex sample of four actinide elements, which all have very dense electronic energy levels, there may be reactions and

  15. 48 CFR 239.7406 - Cost or pricing data and information other than cost or pricing data.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Cost or pricing data and information other than cost or pricing data. 239.7406 Section 239.7406 Federal Acquisition Regulations System... ACQUISITION OF INFORMATION TECHNOLOGY Telecommunications Services 239.7406 Cost or pricing data...

  16. 78 FR 71983 - Delegation of Functions Under Sections 1261(b) and 1262(a) of Public Law 112-239

    Science.gov (United States)

    2013-11-29

    ... Sections 1261(b) and 1262(a) of Public Law 112-239 #0; #0; #0; Presidential Documents #0; #0; #0;#0;Federal...(a) of Public Law 112-239 Memorandum for the Secretary of State the Secretary of Commerce By the... section 1262(a) of the National Defense Authorization Act for Fiscal Year 2013, Public Law 112- 239....

  17. Yeast Interacting Proteins Database: YDL239C, YDR273W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p...it as prey (1) YDR273W DON1 Meiosis-specific component of the spindle pole body, ...0 - - - - - 0 0 5 - Show YDL239C Bait ORF YDL239C Bait gene name ADY3 Bait descri... at the leading edge of the prospore membrane via interaction with spindle pole body components; potentially

  18. Yeast Interacting Proteins Database: YDL239C, YOR324C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p... as bait (0) 4 5 3 4 0 0 0 0 0 - - - - - 0 0 4 - Show YDL239C Bait ORF YDL239C Ba... a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle pole

  19. AMS of natural {sup 236}U and {sup 239}Pu produced in uranium ores

    Energy Technology Data Exchange (ETDEWEB)

    Wilcken, K.M. [Department of Nuclear Physics, RSPhysSE, Australian National University, Canberra, ACT 0200 (Australia)]. E-mail: k.wilcken@suerc.gla.ac.uk; Barrows, T.T. [Department of Nuclear Physics, RSPhysSE, Australian National University, Canberra, ACT 0200 (Australia); Fifield, L.K. [Department of Nuclear Physics, RSPhysSE, Australian National University, Canberra, ACT 0200 (Australia); Tims, S.G. [Department of Nuclear Physics, RSPhysSE, Australian National University, Canberra, ACT 0200 (Australia); Steier, P. [VERA Laboratory, Institute for Isotopic Research and Nuclear Physics, University of Vienna, Waehringer Strasse 17, A-1090 Vienna (Austria)

    2007-06-15

    The rare isotopes {sup 236}U and {sup 239}Pu are produced naturally by neutron capture in uranium ores. Here we measure {sup 236}U and {sup 239}Pu by accelerator mass spectrometry (AMS) in the same ore samples for the first time. To ensure efficient extraction of both elements and isotopic equilibrium between the {sup 239}Pu in the ore and a {sup 242}Pu spike, we developed a new sample preparation protocol. AMS has clear advantages over previous methods because it achieves better discrimination against molecular interferences with higher sensitivity and shorter counting times. Measurements of {sup 236}U and {sup 239}Pu hold considerable promise as proxy indicators of neutron flux and uranium concentration.

  20. Plutonium isotopes 238Pu, 239+240Pu, 241Pu and 240Pu/239Pu atomic ratios in the southern Baltic Sea ecosystem

    Directory of Open Access Journals (Sweden)

    Dagmara I. Strumińska-Parulska

    2010-09-01

    Full Text Available The paper summarizes the results of plutonium findings in atmospheric fallout samples and marine samples from the southern Baltic Sea during our research in 1986-2007. The activities of 238Pu and 239+240Pu isotopes were measured with an alpha spectrometer. The activities of 241Pu were calculated indirectly by 241Am activity measurements 16-18 years after the Chernobyl accident. The 240Pu/239Pu atomic ratios were measured using accelerator mass spectrometry (AMS. The 241Pu activities indicate that the main impact of the Chernobyl accident was on the plutonium concentration in the components of the Baltic Sea ecosystem examined in this work. The highest 241Pu/239+240Pu activity ratio was found in sea water (140 ± 33. The AMS measurements of atmospheric fallout samples collected during 1986 showed a significant increase in the 240Pu/239Pu atomic ratio from 0.29 ± 0.04 in March 1986 to 0.47 ± 0.02 in April 1986.

  1. Neutronic Study of Burnup, Radiotoxicity, Decay Heat and Basic Safety Parameters of Mono-Recycling of Americium in French Pressurised Water Reactors

    Directory of Open Access Journals (Sweden)

    Robert Bright Mawuko Sogbadji

    2017-03-01

    Full Text Available The reprocessing of actinides with long half-life has been non-existent except for plutonium (Pu. This work looks at reducing the actinides inventory nuclear fuel waste meant for permanent disposal. The uranium oxide fuel (UOX assembly, as in the open cycle system, was designed to reach a burnup of 46GWd/T and 68GWd/T using the MURE code. The MURE code is based on the coupling of a static Monte Carlo code and the calculation of the evolution of the fuel during irradiation and cooling periods. The MURE code has been used to address two different questions concerning the mono-recycling of americium (Am in present French pressurised water reactors (PWR. These are reduction of americium in the clear fuel cycle and the safe quantity of americium that can be introduced into mixed oxide (MOX as fuel. The spent UOX was reprocessed to fabricate MOX assemblies, by the extraction of plutonium and addition of depleted uranium to reach burnups of 46GWd/T and 68GWd/T, taking into account various cooling times of the spent UOX assembly in the repository. The effect of cooling time on burnup and radiotoxicity was then ascertained. After 30 years of cooling in the repository, the spent UOX fuel required a higher concentration of Pu to be reprocessed into MOX fuel due to the decay of Pu-241. Americium, with a mean half-life of 432 years, has a high radiotoxicity level, high mid-term residual heat and is a precursor for other long-lived isotopes. An innovative strategy would be to reprocess not only the plutonium from the UOX spent fuel but also the americium isotopes, which presently dominate the radiotoxicity of waste. The mono-recycling of Am is not a definitive solution because the once-through MOX cycle transmutation of Am in a PWR is not enough to destroy all americium. The main objective is to propose a ‘waiting strategy’ for both Am and Pu in the spent fuel so that they can be made available for further transmutation strategies. The MOX and

  2. THE FIRST ISOLATION OF AMERICIUM IN THE FORM OF PURE COMPOUNDS - THE SPECIFIC ALPHA-ACTIVITY AND HALF-LIFE OF Am241

    Energy Technology Data Exchange (ETDEWEB)

    Cunningham, B.B.; Asprey, L.B.

    1950-07-20

    The microgram scale isolation and preparation of pure compounds of americium is described. Data are presented to show that the alpha-half-life of the isotope Am{sup 241} is 490 {+-} 14 years. The absorption spectrum of Am(III) in 1M nitric acid in the range 3500-8000 mu is given. The wave lengths of 10 of the most prominent lines in the copper spark emission spectrum of americium are given to the nearest 0.01 {angstrom}. Evidence is presented to show that the potential for the Am(III)-Am(IV) couple in acid solution is more negative than -2v and that the potential for the Am(II)-Am(III) couple is more positive than +0.9v.

  3. 熔岩玻璃体239Pu在地下水中的迁移模拟研究%Migration Simulation of 239 Pu in Groundwater From Melt Glass

    Institute of Scientific and Technical Information of China (English)

    包敏; 王群书

    2014-01-01

    According to the circumstances of an underground nuclear test CHESHIRE at the Nevada Test Site ,a model was developed to simulate the dissolution and migration of 239 Pu from melt glass in groundwater .The release rate of 239 Pu was calculated and the released 239 Pu was divided into dissolved fraction and colloid fraction . The pollution plumes for dissolved 239 Pu and colloid 239 Pu were simulated in 100 000 years by software FEFLOW .The results show that the dissolved 239 Pu can’t migration far away from the melt glass and sorption coefficient is the key parameter .If sorption coefficient is more than 10 mL/g ,the long distance migration of dissolved 239 Pu can be ignored .The colloid 239 Pu plume will be long-standing in the downstream of the melt glass .The 239 Pu con-centration at 1.3 km away from the melt glass would be 10-2 Bq/L for a long time .The parameters effecting colloid 239 Pu migration are the melt glass release rate ,the colloid fraction ratio and aquifer conductivity .It can be concluded that only colloid 239 Pu can migrate far away from the melt glass .%针对内华达核试验场CHESHIRE地下核试验状况和近场水文地质参数,建立了熔岩玻璃体239 Pu的溶解释放和迁移模型。估算了熔岩玻璃体释放产生239 Pu的速率,将释放出的239 Pu分为溶解态和胶体态,以软件FEFLOW作为建模工具,数值模拟了10万年内溶解态239 Pu和胶体态239 Pu在地下水中的污染羽分布。模拟结果表明,溶解态239 Pu不能发生远距离迁移,影响迁移的关键参数是分配系数,当分配系数大于10 mL/g后,可忽略溶解态239 Pu的远距离迁移;胶体态239 Pu在爆心下游形成较固定的污染晕,距爆心1.3 km处的胶体态239 Pu的模拟活度浓度长期处于10-2 Bq/L ;影响胶体态239 Pu迁移的主要因素包括熔岩玻璃体的溶解速度、熔岩玻璃体释放239 Pu形成胶体态239 Pu的比例、岩层渗透系数。由

  4. Extension of 239+240Pu sediment geochronology to coarse-grained marine sediments

    Science.gov (United States)

    Kuehl, Steven A.; Ketterer, Michael E.; Miselis, Jennifer L.

    2012-01-01

    Sediment geochronology of coastal sedimentary environments dominated by sand has been extremely limited because concentrations of natural and bomb-fallout radionuclides are often below the limit of measurement using standard techniques. ICP-MS analyses of 239+240Pu from two sites representative of traditionally challenging (i.e., low concentration) environments provide a "proof of concept" and demonstrate a new application for bomb-fallout radiotracers in the study of sandy shelf-seabed dynamics. A kasten core from the New Zealand shelf in the Southern Hemisphere (low fallout), and a vibracore from the sandy nearshore of North Carolina (low particle surface area) both reveal measurable 239+240Pu activities at depth. In the case of the New Zealand site, independently verified steady-state sedimentation results in a 239+240Pu profile that mimics the expected atmospheric fallout. The depth profile of 239+240Pu in the North Carolina core is more uniform, indicating significant sediment resuspension, which would be expected in this energetic nearshore environment. This study, for the first time, demonstrates the utility of 239+240Pu in the study of sandy environments, significantly extending the application of bomb-fallout isotopes to coarse-grained sediments, which compose the majority of nearshore regions.

  5. Functional sorbents for selective capture of plutonium, americium, uranium, and thorium in blood.

    Science.gov (United States)

    Yantasee, Wassana; Sangvanich, Thanapon; Creim, Jeffery A; Pattamakomsan, Kanda; Wiacek, Robert J; Fryxell, Glen E; Addleman, R Shane; Timchalk, Charles

    2010-09-01

    Self-assembled monolayer on mesoporous supports (SAMMS) are hybrid materials created from attachment of organic moieties onto very high surface area mesoporous silica. SAMMS with surface chemistries including three isomers of hydroxypyridinone, diphosphonic acid, acetamide phosphonic acid, glycinyl urea, and diethylenetriamine pentaacetate (DTPA) analog were evaluated for chelation of actinides ((239)Pu, (241)Am, uranium, thorium) from blood. Direct blood decorporation using sorbents does not have the toxicity or renal challenges associated with traditional chelation therapy and may have potential applications for critical exposure cases, reduction of nonspecific dose during actinide radiotherapy, and for sorbent hemoperfusion in renal insufficient patients, whose kidneys clear radionuclides at a very slow rate. Sorption affinity (K(d)), sorption rate, selectivity, and stability of SAMMS were measured in batch contact experiments. An isomer of hydroxypyridinone (3,4-HOPO) on SAMMS demonstrated the highest affinity for all four actinides from blood and plasma and greatly outperformed the DTPA analog on SAMMS and commercial resins. In batch contact, a fifty percent reduction of actinides in blood was achieved within minutes, and there was no evidence of protein fouling or material leaching in blood after 24 h. The engineered form of SAMMS (bead format) was further evaluated in a 100-fold scaled-down hemoperfusion device and showed no blood clotting after 2 h. A 0.2 g quantity of SAMMS could reduce 50 wt.% of 100 ppb uranium in 50 mL of plasma in 18 min and that of 500 dpm mL(-1) in 24 min. 3,4-HOPO-SAMMS has a long shelf-life in air and at room temperature for at least 8 y, indicating its feasibility for stockpiling in preparedness for an emergency. The excellent efficacy and stability of SAMMS materials in complex biological matrices suggest that SAMMS can also be used as orally administered drugs and for wound decontamination. By changing the organic groups of

  6. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Kazi, Zakir H. [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Cornett, Jack R., E-mail: jack.cornett@uottawa.ca [Department of Earth Science, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada); Zhao, Xaiolei; Kieser, Liam [Department of Physics, University of Ottawa, 140 Louis Pasteur Avenue, Ottawa K1N 6N5 (Canada)

    2014-06-01

    Highlights: • Am and Pu were adsorbed and separated using a single extraction chromatography DGA column. • Pu was eluted from the column completely using on-column reduction of Pu(IV) to Pu(III). • ²⁴¹Am and 239,240Pu measurements by accelerator mass spectrometry (AMS) agree with the certified values in two SRMs. Abstract: A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8 M HNO₃ with 0.05 M NaNO₂ before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO₃, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl₃ facilitated the complete desorption of Pu. Interferences (e.g. Ca²⁺, Fe³⁺) were washed off from the resin bed with excess HNO₃. Using NdF₃, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7 ± 5.3% and 95.5 ± 4.6% for ²⁴¹Am and ²⁴²Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1 ± 6.0 and 96.8 ± 5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1–100 Bq kg⁻¹. The single column separation of Pu and Am saves reagents, separation time, and cost.

  7. Establishment of AIDS Animal Model with SIVmac239 Infected Chinese Rhesus Monkey

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    In the present research, two Chinese rhesus monkeys were inoculated intravenously with 5000 TCID50 of SIVmac239. The changes in the numbers of CD4+T lymphocyte in peripheral blood,plasma viral loads, proviral DNA and humoral antibodies against virus were periodically monitored during 121 days. At the early stage of infection, proviral DNA had been detected in PBMCs, and infectious SIVmac239 virus had been isolated from PBMCs. At the same period, the numbers of CD4+T lymphocytes were significantly decreased, and maintained at low level during the 121-day period of infection. Plasma viral loads reached the peak at week 2 post-inoculation and kept at a steady state subsequently. Moreover, antibodies against viral proteins were detected from plasma. All the results showed that the two Chinese rhesus monkeys had been infected with SIVmac239 successfully. This animal model can be applied for further AIDS researches.

  8. Histamine H3 receptor antagonism by ABT-239 attenuates kainic acid induced excitotoxicity in mice.

    Science.gov (United States)

    Bhowmik, Malay; Saini, Neeru; Vohora, Divya

    2014-09-18

    The multifaceted pathogenesis of temporal lobe epilepsy (TLE) offers a number of adjunctive therapeutic prospects. One such therapeutic strategy could be targeting H3 receptor (H3R) by selective H3R antagonists which are perceived to have antiepileptic and neuroprotective potential. Kainic acid (KA) induced seizure, a reliable model of TLE, triggers epileptogenic events resulting from initial neuronal death and ensuing recurring seizures. The present study aimed to determine whether pre-treatment with ABT-239, a novel H3R antagonist, and its combinations with sodium valproate (SVP) and TDZD-8 (glycogen synthase kinase-3β (GSK3β) inhibitor) can prevent the excitotoxic events in mice exposed to KA (10 mg/kg i.p.). ABT-239 (1 and 3 mg/kg i.p.) significantly attenuated KA-mediated behavioural and excitotoxic anomalies and restored altered expression of Bax, cleaved caspase-3, phospho-Akt (Ser473) and cAMP response element binding protein (CREB). Surprisingly, restoration of Bcl2 and phospho-GSK3β (Ser9) by ABT-239 did not reach the level of statistical significance. Co-administration of ABT-239 (1 and 3 mg/kg) with a sub-effective dose of SVP (150 mg/kg i.p.) yielded improved efficacy than when given alone. Similarly, low and high dose combinations of ABT-239 (1 and 3 mg/kg) with TDZD-8 (5 and 10 mg/kg i.p.) produced greater neuroprotection than any other treatment group. Our findings suggests a neuroprotective potential of ABT-239 and its combinations with SVP and TDZD-8 against KA-induced neurotoxicity, possibly mediated through in part each by modulating Akt/GSK3β and CREB pathways. The use of H3R antagonists as adjuvant in the treatment of human TLE might find potential utility, and can be pursued further.

  9. 137Cs and (239+240)Pu levels in the Asia-Pacific regional seas.

    Science.gov (United States)

    Duran, E B; Povinec, P P; Fowler, S W; Airey, P L; Hong, G H

    2004-01-01

    137Cs and (239+240)Pu data in seawater, sediment and biota from the regional seas of Asia-Pacific extending from 50 degrees N to 60 degrees S latitude and 60 degrees E to 180 degrees E longitude based on the Asia-Pacific Marine Radioactivity Database (ASPAMARD) are presented and discussed. 137Cs levels in surface seawater have been declining to its present median value of about 3 Bq/m3 due mainly to radioactive decay, transport processes, and the absence of new significant inputs. (239+240)Pu levels in surface seawater are much lower, with a median of about 6 mBq/m3. (239+240)Pu appears to be partly scavenged by particles and is therefore more readily transported down the water column. As with seawater, (239+240)Pu concentrations are lower than 137Cs in surface sediment. The median 137Cs concentration in surface sediment is 1.4 Bq/kg dry, while that of (239+240)Pu is only 0.2 Bq/kg dry. The vertical profiles of both 137Cs and (239+240)Pu in the sediment column of coastal areas are different from deep seas which can be attributed to the higher sedimentation rates and additional contribution of run-offs from terrestrial catchment areas in the coastal zone. Comparable data for biota are far less extensive than those for seawater and sediment. The median 137Cs concentration in fish (0.2 Bq/kg wet) is higher than in crustaceans (0.1 Bq/kg wet) or mollusks (0.1 Bq/kg wet). Benchmark values (as of 2001) for 137Cs and (239+240)Pu concentrations in seawater, sediment and biota are established to serve as reference values against which the impact of future anthropogenic inputs can be assessed. ASPAMARD represents one of the most comprehensive compilations of available data on 137Cs and (239+240)Pu in particular, and other anthropogenic as well as natural radionuclides in seawater, sediment and biota from the Asia-Pacific regional seas.

  10. Yeast Interacting Proteins Database: YDL239C, YDR148C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p...s prey as bait (0) 4 15 2 5 0 0 0 0 0 - - - - - 0 0 3 - Show YDL239C Bait ORF YDL...mbly of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindl

  11. Yeast Interacting Proteins Database: YDL239C, YPL255W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p...it as prey (1) YPL255W BBP1 Protein required for the spindle pole body (SPB) dupl...ows with this prey as bait (0) 4 8 3 4 0 0 0 0 0 - - - - - 0 0 7 - Show YDL239C Bait ORF YDL...ediate assembly of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindl

  12. Yeast Interacting Proteins Database: YDL239C, YAL028W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p...(1) Rows with this prey as bait (0) 4 5 4 7 0 0 0 0 0 - - - - - 0 0 3 - Show YDL239C Bait ORF YDL... to mediate assembly of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindl

  13. Yeast Interacting Proteins Database: YDL239C, YBR072W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p... (3) Rows with this prey as bait (0) 4 52 1 1 0 0 0 0 0 - - - - - 0 0 3 - Show YDL239C Bait ORF YDL...ht to mediate assembly of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindl

  14. Yeast Interacting Proteins Database: YDL239C, YLR072W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... of a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle p... with this prey as prey (1) Rows with this prey as bait (0) 4 5 4 7 0 0 0 0 0 - - - - - 0 0 4 - Show YDL239C Bait ORF YDL...pore membrane via interaction with spindle pole body components; potentially phosphorylated by Cdc28p Rows w

  15. Intramolecular sensitization of americium luminescence in solution: shining light on short-lived forbidden 5f transitions.

    Science.gov (United States)

    Sturzbecher-Hoehne, M; Yang, P; D'Aléo, A; Abergel, R J

    2016-06-14

    The photophysical properties and solution thermodynamics of water soluble trivalent americium (Am(III)) complexes formed with multidentate chromophore-bearing ligands, 3,4,3-LI(1,2-HOPO), Enterobactin, and 5-LIO(Me-3,2-HOPO), were investigated. The three chelators were shown to act as antenna chromophores for Am(III), generating sensitized luminescence emission from the metal upon complexation, with very short lifetimes ranging from 33 to 42 ns and low luminescence quantum yields (10(-3) to 10(-2)%), characteristic of Near Infra-Red emitters in similar systems. The specific emission peak of Am(III) assigned to the (5)D1 → (7)F1 f-f transition was exploited to characterize the high proton-independent stability of the complex formed with the most efficient sensitizer 3,4,3-LI(1,2-HOPO), with a log β110 = 20.4 ± 0.2 value. In addition, the optical and solution thermodynamic features of these Am(III) complexes, combined with density functional theory calculations, were used to probe the influence of electronic structure on coordination properties across the f-element series and to gain insight into ligand field effects.

  16. Response of avalanche photo-diodes of the CMS Electromagnetic Calorimeter to neutrons from an Americium-Beryllium source.

    CERN Document Server

    Deiters, Konrad; Renker, Dieter

    2010-01-01

    The response of avalanche photo-diodes (APDs) used in the CMS Electromagnetic Calorimeter to low energy neutrons from an Americium-Beryllium source is reported. Signals due to recoil protons from neutron interactions with the hydrogen nuclei in the protective epoxy layer, mainly close to the silicon surface of the APD, have been identified. These signals increase in size with the applied bias voltage more slowly than the nominal gain of the APDs, and appear to have a substantially lower effective gain at the operating voltage. The signals originating from interactions in the epoxy are mostly equivalent to signals of a few GeV in CMS, but range up to a few tens of GeV equivalent. There are also signals not attributed to reactions in the epoxy extending up to the end of the range of these measurements, a few hundreds of GeV equivalent. Signals from the x-rays from the source can also be in the GeV equivalent scale in CMS. Simulations used to describe events due to particle interactions in the APDs need to take ...

  17. Nano-cerium vanadate: a novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste.

    Science.gov (United States)

    Banerjee, Chayan; Dudwadkar, Nilesh; Tripathi, Subhash Chandra; Gandhi, Pritam Maniklal; Grover, Vinita; Kaushik, Chetan Prakash; Tyagi, Avesh Kumar

    2014-09-15

    Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides (233)U (4.82 MeV α) and (241)Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr(2+), Ru(3+), Fe(3+), etc., in the uptake process indicated CeVO4 nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  18. 48 CFR 652.239-70 - Information Technology Security Plan and Accreditation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Information Technology... Clauses 652.239-70 Information Technology Security Plan and Accreditation. As prescribed in 639.107-70(a), insert the following provision: Information Technology Security Plan and Accreditation (SEP 2007)...

  19. 48 CFR 1252.239-71 - Information technology security plan and accreditation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan...

  20. Presence of plutonium isotopes, {sup 239}Pu and {sup 240}Pu, in soils from Chile

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, E., E-mail: echamizo@us.es [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Garcia-Leon, M., E-mail: manugar@us.es [Departamento de Fisica Atomica, Molecular y Nuclear, Universidad de Sevilla, Avda. Reina Mercedes sn, 41012 Seville (Spain); Peruchena, J.I., E-mail: jiperuchena@gmail.com [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Cereceda, F., E-mail: francisco.cereceda@usm.cl [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Vidal, V., E-mail: victor.vidal@usm.cl [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Pinilla, E., E-mail: epinilla@unex.es [Departamento de Quimica Analitica, Facultad de Ciencias, Universidad de Extremadura, Avda. de Elvas sn, 06071 Badajoz (Spain); Miro, C., E-mail: cmiro@unex.es [Departamento de Fisica Aplicada, Universidad de Extremadura, Avda. de la Universidad sn, 10071 Caceres (Spain)

    2011-12-15

    Plutonium is present in every environmental compartment, due to a variety of nuclear activities. The Southern Hemisphere has received about 20% of the global {sup 239}Pu and {sup 240}Pu environmental inventory, with an important contribution of the so-called tropospheric fallout from both the atmospheric nuclear tests performed in the French Polynesia and in Australia by France and United Kingdom, respectively. In this work we provide new data on the impact of these tests to South America through the study of {sup 239}Pu and {sup 240}Pu in soils from different areas of Northern, Central and Southern Chile. The obtained results point out to the presence of debris from the French tests in the 20-40 Degree-Sign Southern latitude range, with {sup 240}Pu/{sup 239}Pu atomic ratios quite heterogeneous and ranging from 0.02 to 0.23. They are significantly different from the expected one for the global fallout in the Southern Hemisphere for the 30-53 Degree-Sign S latitude range (0.185 {+-} 0.047), but they follow the same trend as the reported values by the Department of Energy of United States for other points with similar latitudes. The {sup 239+240}Pu activity inventories show as well a wider variability range in that latitude range, in agreement with the expected heterogeneity of the contamination.

  1. Phenylalanine and tyrosine metabolism in the facultative methylotroph Nocardia sp. 239

    NARCIS (Netherlands)

    Boer, L. de; Harder, W.; Dijkhuizen, L.

    1988-01-01

    Nocardia sp. 239 is able to use L-tyrosine and both D- and L-phenylalanine as carbon-, energy- and nitrogen sources for growth. The catabolism of these compounds is by way of (4-hydroxy)phenylpyruvate and (4-hydroxy)phenylacetate as intermediates and the pathways merge at the level of homogentisate.

  2. Regulation of aromatic amino acid biosynthesis in the ribulose monophosphate cycle methylotroph Nocardia sp. 239

    NARCIS (Netherlands)

    Boer, L. de; Vrijbloed, J.W.; Grobben, G.; Dijkhuizen, L.

    1989-01-01

    The regulation of aromatic amino acid biosynthesis in Nocardia sp. 239 was studied. In cell-free extracts 3-deoxy-D-arabinoheptulosonate 7-phosphate (DAHP) synthase activity was inhibited in a cumulative manner by tryptophan, phenylalanine and tyrosine. Chorismate mutase was inhibited by both phenyl

  3. Nucleogenic {sup 36}Cl, {sup 236}U and {sup 239}Pu in uranium ores

    Energy Technology Data Exchange (ETDEWEB)

    Wilcken, K.M. [Department of Nuclear Physics, RSPhysSE, Australian National University, Canberra, ACT 0200 (Australia); Scottish Universities Environmental Research Centre, Scottish Enterprise Technology Park, Rankine Avenue, East Kilbride G75 0QF (United Kingdom)], E-mail: K.Wilcken@suerc.gla.ac.uk; Fifield, L.K.; Barrows, T.T.; Tims, S.G.; Gladkis, L.G. [Department of Nuclear Physics, RSPhysSE, Australian National University, Canberra, ACT 0200 (Australia)

    2008-08-15

    The nucleogenic isotopes {sup 36}Cl, {sup 236}U and {sup 239}Pu are produced naturally in subsurface environments via neutron capture of thermal and epithermal neutrons. Concentrations are, however, very low and accelerator mass spectrometry (AMS) is required for quantitative measurements. A particular challenge is presented by the measurement of {sup 236}U/{sup 238}U ratios down to the level of 10{sup -13} that is expected from rocks with low uranium concentration. Here, we present the AMS methodology that has been developed at the ANU for measuring {sup 236}U/{sup 238}U ratios at this level. The more established methodologies for {sup 36}Cl and {sup 239}Pu measurements are also summarised. These capabilities are then used to characterize the {sup 36}Cl, {sup 236}U and {sup 239}Pu concentrations in a range of uranium ores. A simple model of the neutron production and capture processes in subsurface environments has been developed and is presented. It is shown that nucleogenic {sup 36}Cl, {sup 236}U and {sup 239}Pu can be used to determine both thermal and epithermal neutron fluxes in subsurface environments. Potential applications include uranium exploration and monitoring of the environmental impact of uranium mining.

  4. Nucleogenic 36Cl, 236U and 239Pu in uranium ores

    Science.gov (United States)

    Wilcken, K. M.; Fifield, L. K.; Barrows, T. T.; Tims, S. G.; Gladkis, L. G.

    2008-08-01

    The nucleogenic isotopes 36Cl, 236U and 239Pu are produced naturally in subsurface environments via neutron capture of thermal and epithermal neutrons. Concentrations are, however, very low and accelerator mass spectrometry (AMS) is required for quantitative measurements. A particular challenge is presented by the measurement of 236U/ 238U ratios down to the level of 10 -13 that is expected from rocks with low uranium concentration. Here, we present the AMS methodology that has been developed at the ANU for measuring 236U/ 238U ratios at this level. The more established methodologies for 36Cl and 239Pu measurements are also summarised. These capabilities are then used to characterize the 36Cl, 236U and 239Pu concentrations in a range of uranium ores. A simple model of the neutron production and capture processes in subsurface environments has been developed and is presented. It is shown that nucleogenic 36Cl, 236U and 239Pu can be used to determine both thermal and epithermal neutron fluxes in subsurface environments. Potential applications include uranium exploration and monitoring of the environmental impact of uranium mining.

  5. Rapid Separation of 239Pu and 241Am in Environment Soil Samples

    Institute of Scientific and Technical Information of China (English)

    YANG; Jin-ling; ZHANG; Ji-qiao; HUANG; Kun; DING; You-qian; ZHAO; Ya-ping

    2015-01-01

    In the nuclear sites and the surroundings which are the main environmental monitored area,the allowances of 239Pu and 241 Am are less than0.1Bq/g as the extremely toxic species.So it is very important and practical to establish rapid and convenient analysis methods for them.With

  6. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations

    Science.gov (United States)

    Noguere, G.; Bouland, O.; Bernard, D.; Leconte, P.; Blaise, P.; Peneliau, Y.; Vidal, J. F.; De Saint Jean, C.; Leal, L.; Schillebeeckx, P.; Kopecky, S.; Lampoudis, C.

    2013-03-01

    Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  7. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations

    Directory of Open Access Journals (Sweden)

    Schillebeeckx P.

    2013-03-01

    Full Text Available Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  8. 48 CFR 352.239-73 - Electronic information and technology accessibility.

    Science.gov (United States)

    2010-10-01

    ... Clauses 352.239-73 Electronic information and technology accessibility. (a) As prescribed in 339.201-70(a), the Contracting Officer shall insert the following provision: Electronic and Information Technology... Board Electronic and Information (EIT) Accessibility Standards (36 CFR Part 1194), require that,...

  9. Influence of thermal and resonance neutron on fast neutron flux measurement by Pu-239 fission chamber

    CERN Document Server

    zeng, Lina; Song, Lingli; Zheng, Chun

    2014-01-01

    The Pu-239 fission chambers are widely used to measure fission spectrum neutron flux due to a flat response to fast neutrons. However, in the mean time the resonance and thermal neutrons can cause a significant influence on the measurement if they are moderated, which could be eliminated by using B and Cd covers. At a column enriched uranium fast neutron critical assembly, the fission reaction rates of Pu-239 are measured as 1.791*10-16,2.350*10-16 and 1.385*10-15 per second for 15mm thick B cover, 0.5mm thick Cd cover, and no cover respectively. While the fission reaction rate of Pu-239 is rapidly increased to 2.569*10-14 for a 20mm thick polythene covering fission chamber. The average Pu-239 fission cross-section of thermal and resonance neutrons is calculated to be 500b and 24.95b with the assumption of 1/v and 1/E spectra respectively, then thermal, resonance and fast neutron flux are achieved to be 2.30*106,2.24*106 and 1.04*108cm-2s-1.

  10. 33 CFR 239.7 - Separation of flood control works from urban drainage.

    Science.gov (United States)

    2010-07-01

    ... COVERED FLOOD CONTROL CHANNELS § 239.7 Separation of flood control works from urban drainage. Covered channels are likely to be considered in boundary areas demarking urban drainage and flood control... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Separation of flood control...

  11. Yield-Energy Evaluation of 85Kr of 239Pu+n Fission

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    <正>The yields of 85Kr, the important production of the 239Pu fission, were re-evaluated over the incident neutron energy 1-15 MeV, based upon all the experimental data. The yields as function of energ

  12. Estimates for Pu-239 loadings in burial ground culverts based on fast/slow neutron measurements

    Energy Technology Data Exchange (ETDEWEB)

    Winn, W.G.; Hochel, R.C.; Hofstetter, K.J.; Sigg, R.A.

    1989-08-15

    This report provides guideline estimates for Pu-239 mass loadings in selected burial ground culverts. The relatively high recorded Pu-239 contents of these culverts have been appraised as suspect relative to criticality concerns, because they were assayed only with the solid waste monitor (SWM) per gamma-ray counting. After 1985, subsequent waste was also assayed with the neutron coincidence counter (NCC), and a comparison of the assay methods showed that the NCC generally yielded higher assays than the SWM. These higher NCC readings signaled a need to conduct non-destructive/non-intrusive nuclear interrogations of these culverts, and a technical team conducted scoping measurements to illustrate potential assay methods based on neutron and/or gamma counting. A fast/slow neutron method has been developed to estimate the Pu-239 in the culverts. In addition, loading records include the SWM assays of all Pu-239 cuts of some of the culvert drums and these data are useful in estimating the corresponding NCC drum assays from NCC vs SWM data. Together, these methods yield predictions based on direct measurements and statistical inference.

  13. Solid Phase Extraction Disk Procedure to Determine 239Pu in Soils

    Directory of Open Access Journals (Sweden)

    ZHANG Ji-qiao;ZHAO Ya-ping;DING You-qian;ZHANG Sheng-dong;YANG Jin-ling

    2016-11-01

    Full Text Available 239Pu in many soil samples should be analyzed to survey radioactive pollution level in nuclear facilities and its affinity environment efficiently. In order to input the opt conditions for column experiment, the experiments of the static adsorption coefficient of 239Pu to solid phase extraction disk with different contact time, concentration of HNO3 and different temperature were carried out. The chemical procedure for the rapid separation and determination of 239Pu in soils had been formulated, which using solid phase extraction disk (EmporeTM Anion Exchange-SR as extraction material and liquid scintillation spectrometry counting as measurement. In the procedure, soil sample usage was 10 g, and were leached by 8 mol/L HNO3, the chemical recovery of the procedure was about 78.9%, and the minimum detectable concentration was 3.7 Bq/kg. It took less than 3 hours once and the presence of 137Cs, 90Sr-90Y and natural uranium, 241Am, 99Tc did not interfere with the procedure, owning high DF of them. The procedure can be used extensively in determination of 239Pu in soils.

  14. 48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991)...

  15. 48 CFR 1552.239-103 - Acquisition of Energy Star Compliant Microcomputers, Including Personal Computers, Monitors and...

    Science.gov (United States)

    2010-10-01

    ... Compliant Microcomputers, Including Personal Computers, Monitors and Printers. 1552.239-103 Section 1552.239... Star Compliant Microcomputers, Including Personal Computers, Monitors and Printers. As prescribed in... Personal Computers, Monitors, and Printers (APR 1996) (a) The Contractor shall provide computer...

  16. 17 CFR 239.34 - Form F-4, for registration of securities of foreign private issuers issued in certain business...

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Form F-4, for registration of securities of foreign private issuers issued in certain business combination transactions. 239.34 Section 239.34 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORMS PRESCRIBED UNDER...

  17. 17 CFR 239.17a - Form N-3, registration statement for separate accounts organized as management investment companies.

    Science.gov (United States)

    2010-04-01

    ... statement for separate accounts organized as management investment companies. 239.17a Section 239.17a... accounts organized as management investment companies. Form N-3 shall be used for registration under the... register under the Investment Company Act of 1940 as management investment companies, and certain...

  18. Potential of Vetiveria zizanoides L. Nash for phytoremediation of plutonium ((239)Pu): Chelate assisted uptake and translocation.

    Science.gov (United States)

    Singh, Shraddha; Fulzele, D P; Kaushik, C P

    2016-10-01

    Plants have demonstrated a great potential to remove toxic elements from soils and solutions and been successfully used for phytoremediation of important radionuclides. Uptake potential of vetiver plants (V. zizanoides) for the remediation of (239)Pu in hydroponic and soil conditions was studied in the present work. High efficiency of V. zizanoides for the removal of (239)Pu was recorded with 66.2% being removed from the hydroponic solution after 30 days. However, remediation of (239)Pu from soil was limited. Remediation of (239)Pu from soil was increased with the addition of chelating agents citric acid (CA) and diethylenetriaminepentaacetic acid (DTPA). Accumulation of (239)Pu was recorded higher in roots than shoots, however its translocation from roots to shoots increased in the presence of chelators in hydroponic as well as soil conditions. DTPA was found more effective than CA showing higher translocation index (TI). Increase in TI was observed 8 and 6 times in the solution and soil respectively when plants were exposed to (239)Pu-DTPA in comparison to only (239)Pu. The present study demonstrates that V. zizanoides plant is a potential plant for phytoremediation of (239)Pu.

  19. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  20. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea.

    Science.gov (United States)

    Hunt, G J

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f1 values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Carastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 h samples of urine and faeces. Urine samples indicated f1 values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7 x 10(-4) with an arithmetic mean in the range (2-3) x 10(-4), and for americium up to 2.6 x 10(-4) with an arithmetic mean of 1.2 x 10(-4). Limited data based on volunteers eating cockles from the Solway suggest that f1 values for americium may be greater at distance from Sellafield. The measured values compare with 5 x 10(-4) used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f1 value in the region of 0.2, twice the value currently used by ICRP. For 137Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f1 = 1.0. Technetium-99 gave f1 values up to about 0.6, in reasonable conformity with the ICRP value of 0.5.

  1. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, G.J. [CEFAS Laboratory, Lowestoft, Suffolk NR33 0HT (United Kingdom)

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f{sub L} values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Cerastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 samples of urine and faeces. Urine samples indicated f{sub L} values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7x10{sup -4} with an arithmetic mean in the range (2-3)x10{sup -4}, and for americium up to 2.6x10{sup -4} with an arithmetic mean of 1.2x10{sup -4}. Limited data based on volunteers eating cockles from the Solway suggest that f{sub L} values for americium may be greater at distance from Sellafield. The measured values compare with 5x10{sup -4} used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f{sub L} value in the region of 0.2, twice the value currently used by ICRP. For {sup 137}Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f{sub L}=1.0. Technetium-99 gave f{sub L} values up to about 0.6, in reasonable conformity with the ICRP value of 0.5. (author)

  2. Nano-cerium vanadate: A novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Chayan; Dudwadkar, Nilesh [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tripathi, Subhash Chandra, E-mail: sctri001@gmail.com [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Gandhi, Pritam Maniklal [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Grover, Vinita [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kaushik, Chetan Prakash [Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tyagi, Avesh Kumar, E-mail: aktyagi@barc.gov.in [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2014-09-15

    Highlights: • Template free, low temperature synthesis of CeVO{sub 4} nanopowders. • Thermodynamically and kinetically favourable uptake of Am(III) and U(VI) exhibited. • K{sub d} and ΔG° values for Am(III) and U(VI) uptake in pH 1–6 are reported. • Interdiffusion coefficients and zeta potential values in pH 1–6 are reported. • Possible application in low level aqueous nuclear waste remediation. - Abstract: Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides {sup 233}U (4.82 MeV α) and {sup 241}Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3 h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr{sup 2+}, Ru{sup 3+}, Fe{sup 3+}, etc., in the uptake process indicated CeVO{sub 4} nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  3. Characterization of a neutron source of {sup 239}PuBe; Caracterizacion de una fuente de neutrones de {sup 239}PuBe

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez V, R.; Chacon R, A.; Hernandez D, V. M.; Mercado, G. A.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Ramirez G, J. [Instituto Nacional de Estadistica Geografia e Informatica, Direccion General de Innovacion y Tecnologia de Informacion, Av. Heroes de Nacozari Sur 2301, Fracc. Jardines del Parque, 20276 Aguascalientes (Mexico)], e-mail: ruben_zac@yahoo.com

    2009-10-15

    The spectrum equivalent dose and environmental equivalent dose f a {sup 239}PuBe source have been determined. The appropriate handling of a neutron source depends on the knowledge of its characteristics, such as its energy distribution, total rate of flowing and dosimetric magnitudes. In many facilities have not spectrometer that allows to determine the spectrum and then area monitors are used that give a dosimetric magnitude starting from measuring the flowing rate and the use of conversion factors, however this procedure has many limitations and it is preferable to measure the spectra and starting from this information the interest dosimetric magnitudes are calculated. In this work a Bonner sphere spectrometer has been used with a {sup 6}LiI(Eu) scintillator obtaining the count rates that produce, to a distance of 100 cm, a {sup 239}PuBe source of 1.85E(11) Bq. The spectrum was reconstructed starting from the count rates using BUNKIUT code and response matrix UTA4. With the spectrum information was calculated the source intensity, total flow, energy average, equivalent dose rate, environmental equivalent dose rate, equivalent dose coefficient and environmental equivalent dose coefficient. By means of two area monitors for neutrons, Eberline ASP-1 and LB 6411 of Berthold the equivalent dose and environmental equivalent dose were measured. The determinate values were compared with those reported in literature and it found that are coincident inside 17%. (Author)

  4. The 239 Pu(n,2n)238Pu cross section: preliminary calculations

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H; Reffo, G; Ross, M A; White, R M

    1999-03-12

    The primary motivation for the present work is to provide theoretical values for the ratio of the partial 239Pu(n,2nx{gamma})238Pu to total 239 Pu(n,2n)238Pu cross section for several discrete gamma transitions. Results and conclusions of preliminary calculations from threshold to 20 MeV are presented. Calculations are based on theoretical models with parameters obtained from the literature or from our ad hoc systematics. Optical model cross sections and transmission coefficients were determined using the coupled-channels method. The calculations included a preequilibrium component followed by multiple particle and gamma-ray emissions. Fission competition was included at all stages of de-excitation. Suggestions for further verifications and possible improvements are provided.

  5. Dependence of dose coefficients for inhaled 239Pu on absorption parameters.

    Science.gov (United States)

    Suzuki, K; Sekimoto, H; Ishigure, N

    2001-01-01

    With regard to dissolution of particles in the respiratory tract after inhalation, the International Commission on Radiological Protection (ICRP) has classified all radionuclides into only three types according to the chemical form of compounds, and default values of absorption parameters are proposed for each type. However, it is just a simplification to estimate doses for practical use, and there is a possibility of unfitness in such an assortment. A code has been developed to reproduce the ICRP's dose coefficients for 239Pu, which is one of the most important elements for occupational exposure. By using this code, the respective absorption parameters were modified, and the effect owing to these changes evaluated. It was shown consequently that changes of absorption parameters do not greatly influence the effective doses of 239Pu for workers.

  6. Relationship between the mutation of G239V point in SLC17A3 gene and primary gout

    Institute of Scientific and Technical Information of China (English)

    WANG Bao-ping; LI Chang-gui; HAN Lin; JIA Zhao-tong

    2013-01-01

    Objective To explore the relationship between the mutation of G239V point in SLC 17A3 gene and primary gout.Methods The single nucleotide polymorphism (SNP) of gene in 530 sporadic patients with primary gout was detected with Taq man probe real-time fluorescence quantitative PCR.Results No mutation was detected the site of G239V in SLC17A3 gene in the 530 patients.Conclusions Attack of primary gout doesn' t correlate with the mutation of G239V point in SLC17A3 gene,indicating heterogeneity of primay gout.

  7. Bestimmung des (631)K=1/2, I=1/2-Zustandes im U 239

    DEFF Research Database (Denmark)

    Maier, Bernd P. K.

    1965-01-01

    Theγ-ray spectrometer at the DR 3-reactor at Risø was used to investigate the low energyγ-lines of U 239 which are emitted during neutron-capture in U 238. Very closely lying lines have been found between 500 and 650 keV. The big intensity of the 133 keV line and the lack of other transitions...

  8. Sediment budget for Murder Creek, Georgia, USA, from Pu239+240 - determined soil erosion rates

    Science.gov (United States)

    Stubblefield, A. P.; Matissoff, G.; Ketterer, M. E.; Whiting, P. J.

    2005-12-01

    Soil inventories of the radionuclides Cs137 and Pb210 have been used in a variety of environments as indicators for erosion and depositional processes. Development of sediment budgets for entire watersheds from radionuclide data has been somewhat constrained because limited sample numbers may not adequately characterize the wide range of geomorphic conditions and land uses found in heterogeneous environments. The measurement of Pu239+240 shows great potential for developing quantitative watershed sediment budgets. With inductively-coupled plasma mass spectrometry, hundreds of samples may be processed in dramatically shorter times than the gamma spectrometry method used for Cs137 or alpha spectrometry method used for Pb210. We collected surface soil samples from Murder Creek in the Piedmont region of Georgia, USA, to compare Pu239+240 inventories with Cs137 and Pb210 inventories for a range of land uses in a predominantly forested watershed. Excellent correlations were found for radionuclide inventories (r2 =0.88, n = 38) and high resolution (4 mm) depth profiles. The second objective was to generate a sediment budget using the full Pu239+240 dataset (n = 309). Average Pu239+240 inventories were 70.0 Bq/m2 for hardwood forest, 60.0 Bq/m2 for pine plantation, 65.1 Bq/m2 for pine forest, 66.7 Bq/m2 for row crop agriculture and 67.9 Bq/m2 for pasture. The sediment budget will be constructed by converting inventories into site-specific erosion rates. Erosion rates will be scaled up to the watershed scale using GIS coverages of land use, soil, slope, and slope position. Results will be compared with Murder Creek sediment budgets in the scientific literature generated from RUSLE erosion modeling, USGS monitoring networks and reservoir sedimentation.

  9. Prompt γ-ray production in neutron-induced fission of 239Pu

    Science.gov (United States)

    Ullmann, J. L.; Bond, E. M.; Bredeweg, T. A.; Couture, A.; Haight, R. C.; Jandel, M.; Kawano, T.; Lee, H. Y.; O'Donnell, J. M.; Hayes, A. C.; Stetcu, I.; Taddeucci, T. N.; Talou, P.; Vieira, D. J.; Wilhelmy, J. B.; Becker, J. A.; Chyzh, A.; Gostic, J.; Henderson, R.; Kwan, E.; Wu, C. Y.

    2013-04-01

    Background: The prompt gamma-ray spectrum from fission is important for understanding the physics of nuclear fission, and also in applications involving fission. Relatively few measurements of the prompt gamma spectrum from 239Pu(n,f) have been published.Purpose: This experiment measured the multiplicity, individual gamma energy spectrum, and total gamma energy spectrum of prompt fission gamma rays from 239Pu(n,f) in the neutron energy range from thermal to 30 keV, to test models of fission and to provide information for applications.Method: Gamma rays from neutron-induced fission of 239Pu were measured using the DANCE gamma-ray calorimeter. Fission events were tagged by detecting fission products in a parallel-plate avalanche counter in the center of DANCE. The measurements were corrected for detector response using a geant4 model of DANCE. A detailed analysis for the gamma rays from the 1+ resonance complex at 10.93 eV is presented.Results: A six-parameter analytical parametrization of the fission gamma-ray spectrum was obtained. A Monte Carlo Hauser-Feshbach calculation provided good general agreement with the data, but some differences remain to be resolved.Conclusions: An analytic parametrization can be made of the gamma-ray multiplicity, energy distribution, and total-energy distribution for the prompt gamma rays following neutron-induced fission of 239Pu. This parametrization may be useful for applications. Modern Monte Carlo Hauser-Feshbach calculations can do a good job of calculating the fission gamma-ray emission spectrum, although some details remain to be understood.

  10. Phenylalanine and tyrosine metabolism in the facultative methylotroph Nocardia sp. 239

    OpenAIRE

    De Boer, L.; Harder, W; Dijkhuizen, L

    1988-01-01

    Nocardia sp. 239 is able to use L-tyrosine and both D- and L-phenylalanine as carbon-, energy- and nitrogen sources for growth. The catabolism of these compounds is by way of (4-hydroxy)phenylpyruvate and (4-hydroxy)phenylacetate as intermediates and the pathways merge at the level of homogentisate. The conversion of the amino acids into (4-hydroxy)phenylpyruvate is catalyzed by an inducible NAD-dependent phenylalanine dehydrogenase and L-tyrosine aminotransferase, respectively. Incubation of...

  11. Cognitive deficits in familial Alzheimer's disease associated with M239V mutation of presenilin 2.

    Science.gov (United States)

    Giovagnoli, Anna Rita; Marcon, Gabriella; Giaccone, Giorgio; Confaloni, Anna Maria; Tagliavini, Fabrizio

    2006-01-01

    The neuropsychological assessment of non-demented subjects with gene mutation of familial Alzheimer's disease (AD) provides a model for exploring the early cognitive features of the disease. We evaluated 1 patient and 6 non-demented subjects belonging to a family with AD with M239V mutation of the presenilin 2 gene, aiming to verify the contribution of specific cognitive patterns to the characterization of familial AD. One patient, 3 non-demented subjects with M239V mutation and 3 subjects without mutation from the same family underwent neuropsychological testing. The patient's cognitive profile was characterized by anosognosia, visuospatial agnosia, apraxia and fluent aphasia. Of the 3 non-demented subjects with mutation, 1 showed no deficits, another constructive apraxia and the third spatial perception and memory deficits. The 3 subjects without mutation showed normal abilities. The cognitive deficits of the non-demented subjects with mutations indicate focal dysfunction of the posterior cortical areas, resembling the more extended parieto-occipito-temporal dysfunction of the demented patient. Such grading of visuospatial, praxis, and language impairments highlights a distinctive pattern related to the M239V mutation of the presenilin 2 gene.

  12. Clinical features of 239 cases of pituitary adenomas%垂体肿瘤239例临床特征分析

    Institute of Scientific and Technical Information of China (English)

    陈刚; 卓雅芬; 姚瑾; 梁继兴; 黄惠彬; 李连涛; 林丽香

    2010-01-01

    Objective To study clinical feature and therapeutic choice of pituitary adenomas. Methods The clinical data of 239 cases of pituitary adenomas were analyzed. Results Total 93 male and 146 female cases were recruited. The average age was (43.8 ± 14.9 ) years old (3.9-77 years). Prolactinomas were the most common pituitary adenomas (26.8%) , 179 patients (74.9%) underwent surgery, of which 108 (60.3%) with transsphenoidal approach and 71 (39.7%) transcranial approach. The other 60 cases were treated nonsurgically. Conclusions Pituitary adenomas may present hormonal abnormalities or neurological symptoms.Some adenomas were accidently detected by MRI. Prolactinomas were the most common pituitary adenomas.%目的 探讨垂体瘤的临床特征及治疗方案.方法 回顾性分析福建省立医院自1994年1月至2007年6月间收住的239例垂体瘤患者的临床资料.结果 239例垂体腺瘤中,男性93例(38.9%),女性146例(61.1%).诊断时的平均年龄为(43.8±14.9)岁(范围为3.9~77岁).依据临床表现、影像学及内分泌检查、免疫组织化学染色所示,催乳素瘤为最常见的肿瘤(26.8%).手术治疗179例(74.9%),其中经蝶入路108例(60.3%),经额入路71例(39.7%),非手术治疗及随访者60例(25.1%).结论 垂体瘤可表现为内分泌异常、神经系统症状或其他原因行MRI意外发现;催乳素瘤为最常见的肿瘤.

  13. The structures of CyMe4-BTBP complexes of americium(iii) and europium(iii) in solvents used in solvent extraction, explaining their separation properties.

    Science.gov (United States)

    Ekberg, Christian; Löfström-Engdahl, Elin; Aneheim, Emma; Foreman, Mark R StJ; Geist, Andreas; Lundberg, Daniel; Denecke, Melissa; Persson, Ingmar

    2015-11-14

    Separation of trivalent actinoid (An(iii)) and lanthanoid (Ln(iii)) ions is extremely challenging due to their similar ionic radii and chemical properties. Poly-aromatic nitrogen compounds acting as tetradentate chelating ligands to the metal ions in the extraction, have the ability to sufficiently separate An(iii) from Ln(iii). One of these compounds, 6,6'-bis(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-benzol[1,2,4]triazin-3-yl)[2,2]bipyridine, CyMe4-BTBP, has proven to be resistant towards acidic environments and strong radiation from radioactive decomposition. EXAFS studies of the dicomplexes of CyMe4-BTBP with americium(iii) and europium(iii) in nitrobenzene, cyclohexanone, 1-hexanol, 1-octanol and malonamide (DMDOHEMA) in 1-octanol have been carried out to get a deeper understanding of the parameters responsible for the separation. The predominating complexes independent of solvent used are [Am(CyMe4-BTBP)2(NO3)](2+) and [Eu(CyMe4-BTBP)2](3+), respectively, which are present as outer-sphere ion-pairs with nitrate ions in the studied solvents with low relative permittivity. The presence of a nitrate ion in the first coordination sphere of the americium(iii) complex compensates the charge density of the complex considerably in comparison when only outer-sphere ion-pairs are formed as for the [Eu(CyMe4-BTBP)2](3+) complex. The stability and solubility of a complex in a solvent with low relative permittivity increase with decreasing charge density. The [Am(CyMe4-BTBP)2(NO3)](2+) complex will therefore be increasingly soluble and stabilized over the [Eu(CyMe4-BTBP)2](3+) complex in solvents with decreasing relative permittivity of the solvent. The separation of americium(iii) from europium(iii) with CyMe4-BTBP as extraction agent will increase with decreasing relative permittivity of the solvent, and thereby also with decreasing solubility of CyMe4-BTBP. The choice of solvent is therefore a balance of a high separation factor and sufficient solubility of the CyMe4-BTBP

  14. 血流感染MRSA中的ST239克隆株快速检测与分析%Application of rapid detection of MRSA ST239 clones in bloodstream infections

    Institute of Scientific and Technical Information of China (English)

    姚杰; 杨凯; 刘周; 陈礼文; 周强; 管世鹤

    2015-01-01

    目的 评价多重PCR法对耐甲氧西林金黄色葡萄球菌(MRSA) ST239克隆株的快速检测及合肥地区血流感染MRSA的分子流行现状.方法 收集2008年至2013年安徽医科大学第一附属医院及第二附属医院临床分离的血流感染金黄色葡萄球菌的106株MRSA进行相关耐药性分析,并采用多重PCR技术对ST239型克隆株进行快速检测,同时运用多位点序列分型(MLST)加以确认及葡萄球菌染色体mec基因盒(SCCmec)分型分析.结果 106株血流感染金黄色葡萄球菌中MRSA有51株,占48.1%,MRSA均为多耐药菌,对红霉素、氨基糖苷类和喹诺酮类耐药率明显高于甲氧西林敏感金黄色葡萄球菌(MSSA),MRSA和MSSA对磺胺甲噁唑/甲氧苄啶的敏感率分别为86.3%和 94.5%;51株MRSA中有47株为ST239快速检测阳性,阳性率高达92.2%;随机选取20株ST239初筛阳性的MRSA经MLST验证和SCCmec分型后确认为MRSA-ST239-SCCmecⅢ型.结论 合肥地区血流感染MRSA近半数为多重耐药克隆MRSA-ST239-SCCmecⅢ型,运用多重PCR技术能够快速检测ST239克隆株.%Objective To evaluation the method of rapid detection of Methicillin-resistant Stphylococcus aureus (MRSA) ST239 clones with multiplex PCR assay and investigation of the epidemic status of MRSA blood stream infections in Hefei area.Methods Antibiotic susceptibility testing were applied to MRSA isolates from bloodstream infection,rapid screening and confirmation of MRSA ST239 clones by using multiplex PCR,Multilocus Sequence typing (MLST) and Staphyloccoccal Cassette Chromosome mec(SCCmec) typing.Results 51 of 106 clinic isolates Staphylococcus aureus were identified as MRSA,accounting for 48.1%.The resistance rate of MRSA to erythromycin,aminoglycosides and quinolone were significantly higher than Methicillin Sensitive Staphylococcus aureus (MSSA).Both MRSA and MSSA had a high sensitivity to cotrimoxazole,the sensivity rates were 86.3% and 94.5%,respectively; 47 of 51

  15. A multi-radionuclide approach to evaluate the suitability of (239+240)Pu as soil erosion tracer.

    Science.gov (United States)

    Meusburger, Katrin; Mabit, Lionel; Ketterer, Michael; Park, Ji-Hyung; Sandor, Tarjan; Porto, Paolo; Alewell, Christine

    2016-10-01

    Fallout radionuclides have been used successfully worldwide as tracers for soil erosion, but relatively few studies exploit the full potential of plutonium (Pu) isotopes. Hence, this study aims to explore the suitability of the plutonium isotopes (239)Pu and (240)Pu as a method to assess soil erosion magnitude by comparison to more established fallout radionuclides such as (137)Cs and (210)Pbex. As test area an erosion affected headwater catchment of the Lake Soyang (South Korea) was selected. All three fallout radionuclides confirmed high erosion rates for agricultural sites (>25tha(-1)yr(-1)). Pu isotopes further allowed determining the origin of the fallout. Both (240)Pu/(239)Pu atomic ratios and (239+240)Pu/(137)Cs activity ratios were close to the global fallout ratio. However, the depth profile of the (239+240)Pu/(137)Cs activity ratios in undisturbed sites showed lower ratios in the top soil increments, which might be due to higher migration rates of (239+240)Pu. The activity ratios further indicated preferential transport of (137)Cs from eroded sites (higher ratio compared to the global fallout) to the depositional sites (smaller ratio). As such the (239+240)Pu/(137)Cs activity ratio offered a new approach to parameterize a particle size correction factor that can be applied when both (137)Cs and (239+240)Pu have the same fallout source. Implementing this particle size correction factor in the conversion of (137)Cs inventories resulted in comparable estimates of soil loss for (137)Cs and (239+240)Pu. The comparison among the different fallout radionuclides highlights the suitability of (239+240)Pu through less preferential transport compared to (137)Cs and the possibility to gain information regarding the origin of the fallout. In conclusion, (239+240)Pu is a promising soil erosion tracer, however, since the behaviour i.e. vertical migration in the soil and lateral transport during water erosion was shown to differ from that of (137)Cs, there is a clear

  16. Transuranic advanced disposal systems: preliminary /sup 239/Pu waste-disposal criteria for Hanford

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.E. Jr.; Aaberg, R.L.; Napier, B.A.; Soldat, J.K.

    1982-09-01

    This report contains the draft results of a study sponsored by the US Department of Energy (DOE) to determine preliminary /sup 239/Pu waste disposal criteria for the Hanford Site. The purpose of this study is to provide a preliminary evaluation of the feasibility of various defense TRU advanced disposal options at the Hanford Site. Advanced waste disposal options include those developed to provide greater confinement than provided by shallow-land burial. They will be used to complement the waste geologic disposal in achieving permanent disposal of selected TRU wastes. An example systems analysis is discussed with assumed performance objectives and Hanford-specific disposal conditions, waste forms, site characteristics, and engineered barriers. Preliminary waste disposal criteria for /sup 239/Pu are determined by applying the Allowable Residual Contamination Level (ARCL) method. This method is based on compliance with a radiation dose rate limit through a site-specific analysis of the potential for radiation exposure to individuals. A 10,000-year environmental performance period is assumed, and the dose rate limit for human intrusion is assumed to be 500 mrem/yr to any exposed individual. Preliminary waste disposal criteria derived by this method for /sup 239/Pu in soils at the Hanford Site are: 0.5 nCi/g in soils between the surface and a depth of 1 m, 2200 nCi/g of soil at a depth of 5 m, and 10,000 nCi/g of soil at depths 10 m and below. These waste disposal criteria are based on exposure scenarios that reflect the dependence of exposure versus burial depth. 5 figures, 7 tables.

  17. European roe deer antlers as an environmental archive for fallout (236)U and (239)Pu.

    Science.gov (United States)

    Froehlich, M B; Steier, P; Wallner, G; Fifield, L K

    2016-01-01

    Anthropogenic (236)U and (239)Pu were measured in European roe deer antlers hunted between 1955 and 1977 which covers and extends beyond the period of intensive nuclear weapons testing (1954-1962). The antlers were hunting trophies, and hence the hunting area, the year of shooting and the approximate age of each animal is given. Uranium and plutonium are known to deposit in skeletal tissue. Since antler histology is similar to bone, both elements were expected in antlers. Furthermore, roe deer shed their antlers annually, and hence antlers may provide a time-resolved environmental archive for fallout radionuclides. The radiochemical procedure is based on a Pu separation step by anion exchange (Dowex 1 × 8) and a subsequent U purification by extraction chromatography using UTEVA(®). The samples were measured by Accelerator Mass Spectrometry at the VERA facility (University of Vienna). In addition to the (236)U and (239)Pu concentrations, the (240)Pu/(239)Pu isotopic ratios were determined with a mean value of 0.172 ± 0.023 which is in agreement with the ratio of global fallout (∼0.18). Rather high (236)U/(238)U ratios of the order of 10(-6) were observed. These measured ratios, where the (236)U arises only from global fallout, have implications for the use of the (236)U/(238)U ratio as a fingerprint for nuclear accidents or releases from nuclear facilities. Our investigations have shown the potential to use antlers as a temporally resolved archive for the uptake of actinides from the environment.

  18. {sup 239+240}Pu in the Barents Sea Regions. Sources and radioecological assessment

    Energy Technology Data Exchange (ETDEWEB)

    Iosjpe, Mikhail [Norwegian Radiation Protection Authority, P.O. Box 55, N-1332 Oesteraas (Norway)

    2014-07-01

    The radioecological assessment for {sup 239+240}Pu in the Barents sea regions was made using the compartment modelling approach. The following sources of radioactive contamination were under consideration: global fallout from atmospheric testing of nuclear weapons, transport of {sup 239+240}Pu from the Sellafield and La Hauge nuclear plants and underwater testing of nuclear weapons in Chernaya Bay, Novaya Zemlya. The box model developed at NRPA uses a modified approach for compartmental modeling, which takes into account the dispersion of radionuclides over time. The box structures for surface, mid-depth and deep water layers have been developed based on the description of polar, Atlantic and deep waters in the Arctic Ocean and the Northern Seas, as well as site-specific information for the boxes. The volume of the three water layers in each box has been calculated using detailed bathymetry together with Geographical Information Systems. The box model includes the processes of advection of radioactivity between compartments, sedimentation, diffusion of radioactivity through pore water in sediments, resuspension, mixing due to bioturbation, particle mixing and a burial process for radionuclides in deep sediment layers. Radioactive decay is calculated for all compartments. The contamination of biota is further calculated from the known radionuclide concentrations in filtered seawater in the different water regions. Doses to man are calculated on the basis of seafood consumptions, in accordance with available data for seafood catches and assumptions about human diet in the respective areas. Dose to biota are determined on the basis of calculated radionuclide concentrations in marine organisms, water and sediment, using dose conversion factors. Results of the calculations show that atmospheric deposition is the dominant source for the Barents Sea, except for the Chernaya Bay region. It is also demonstrated that the impact of the Sellafield nuclear facilities has

  19. Yeast Interacting Proteins Database: YDR176W, YDL239C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available the SAGA complex, and the SLIK complex Rows with this bait as bait (4) Rows with this bait as prey (0) YDL23... a Don1p-containing structure at the leading edge of the prospore membrane via interaction with spindle pole...it as bait (4) Rows with this bait as prey Rows with this bait as prey (0) Prey ORF YDL239C Prey gene name A...ining structure at the leading edge of the prospore membrane via interaction with spindle pole body componen

  20. Determination of Atto- to Femtogram Levels of Americium and Curium Isotopes in Large-Volume Urine Samples by Compact Accelerator Mass Spectrometry.

    Science.gov (United States)

    Dai, Xiongxin; Christl, Marcus; Kramer-Tremblay, Sheila; Synal, Hans-Arno

    2016-03-01

    Ultralow level analysis of actinides in urine samples may be required for dose assessment in the event of internal exposures to these radionuclides at nuclear facilities and nuclear power plants. A new bioassay method for analysis of sub-femtogram levels of Am and Cm in large-volume urine samples was developed. Americium and curium were co-precipitated with hydrous titanium oxide from the urine matrix and purified by column chromatography separation. After target preparation using mixed titanium/iron oxides, the final sample was measured by compact accelerator mass spectrometry. Urine samples spiked with known quantities of Am and Cm isotopes in the range of attogram to femtogram levels were measured for method evaluation. The results are in good agreement with the expected values, demonstrating the feasibility of compact accelerator mass spectrometry (AMS) for the determination of minor actinides at the levels of attogram/liter in urine samples to meet stringent sensitivity requirements for internal dosimetry assessment.

  1. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: wcruz@ipen.gob.pe [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos

    2013-07-01

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  2. Analysis of pathological data of renal biopsy: a report of 239 cases%肾活检239例病理资料分析

    Institute of Scientific and Technical Information of China (English)

    冯立英; 王志东

    2012-01-01

    Objective To investigate the correlation between epidemiological characteristics and clinical manifestations, and between pathology type and clinical manifestations of kidney diseases among 239 cases in our hospital. Methods Between September 2004 and October 2011, a retrospective study was done in in-patients after renal biopsy, including sex, age, clinical syndrome and pathology type. Results In this group (male: female vs 1:1.39), the mean age was 39.1. Notably, the kidney diseases were most likely to occur between 30 and 39 years old. Of clinical manifestations, nephrotic syndrome (53.1%) was most commonly seen, followed by urinary abnormalities (36.0%). The pathology types of nephrotic syndrome were membranous nephropathy (29.9%) and minimal change disease (21.3%), while those of urinary abnormalities were IgA nephropathy (40.7%) and Henoch-Schonlein purpura glomerulonephritis (15.1%). Of the 239 patients, the occurrence rate of primary glomerular disease was 76.2%. Notably, IgA nephropathy was 33.0%, followed by membranous nephropathy (26.4%). On other hand, the occurrence rate of secondary glomerulosclerosis was 19.2%. Notably, lupus nephritis (34.8%) was the most commonly found, followed by Henoch-Schonlein purpura glomerulonephritis (28.3%). Conclusion Primary glomerular disease was the most common kidney disease, and nephrotic syndrome was the most common clinical manifestation. Adolescents were high-risk populations.%目的 了解我院239例肾脏疾病的流行病学特点及病理类型与临床表现之间的联系.方法 回顾性分析我院2004年9月至2011年10月经皮肾穿刺活检术住院患者的性别、年龄、临床表现、病理类型.结果 本组患者的平均年龄39.1岁,30~39岁为肾脏病的高发年龄段,男女比例为1∶1.39.临床表现以肾病综合征最多见,占53.1%,其次为尿检异常占36.0%.肾病综合征的病理类型依次为:膜性肾病(MN)29.9%,微小病变21.3%;尿检异常的病

  3. Americium-241 Decorporation Model

    Science.gov (United States)

    2014-10-01

    sources when combined with beryllium. Radioactive sources are used for a number of industrial applications that range from oil well logging devices...is any exposure resulting in a 50-year whole-body committed effective dose greater than 200 mSv (Rojas- Palma 2009). Therefore, the model can also...Tracheobronchial geometry: Human, dog, rat, hamster (Report LF-53). Lovelace Foundation, Albuquerque, NM Rojas- Palma C, et al. 2009. TMT Handbook

  4. Input contribution and vertical migration of plutonium, americium and cesium in lake sediments (Belham Tarn, Cumbria, UK)

    Energy Technology Data Exchange (ETDEWEB)

    Michel, H.; Barci-Funel, G.; Barci, V.; Ardisson, G. [Lab. de Radiochimie et de Radioecologie, Univ. de Nice Sophia Antipolis, Nice (France)

    2002-07-01

    The record of the global atmospheric fallout could be found in the lake sediments. A mass balance for fallout radionuclides in Blelham Tarn and its catchment is established. The sediment activity contribution is coming from direct atmospheric fallout and from indirect atmospheric fallout via the catchment. The catchement activity is conveyed to the sediment by the rivers and the direct streaming. A comparison of the fallout and the sediment inventory allows the activity estimation of these different contributions and to understand the mobility of these elements on the catchment and in the sediments. The study of activity profile in sediment core allows to characterise the different radioactive events occurred in the past. For the lake Blelham, the results show two cesium activity peaks and only one peak for transuranic activities. The deepest peaks correspond to the atmospheric nuclear test fallout in the sixties (1963) and the second peak to the Chernobyl accident (1986). The activity ratio {sup 239-240}Pu/{sup 137}Cs allows estimating the ratio between cesium activities in sediments coming from these two events. Plutonium and cesium diffusion coefficients are calculated with a simple analytical model. (orig.)

  5. A multi-radionuclide approach to evaluate the suitability of {sup 239+240}Pu as soil erosion tracer

    Energy Technology Data Exchange (ETDEWEB)

    Meusburger, Katrin, E-mail: Katrin.Meusburger@unibas.ch [Environmental Geosciences, University of Basel, Bernoullistrasse 30, CH-4056 Basel (Switzerland); Mabit, Lionel, E-mail: L.Mabit@iaea.org [Soil and Water Management and Crop Nutrition Laboratory, FAO/IAEA Agriculture & Biotechnology Laboratory, IAEA Laboratories, Seibersdorf (Austria); Ketterer, Michael, E-mail: mkettere@msudenver.edu [Chemistry Department, Metropolitan State University of Denver, CO (United States); Park, Ji-Hyung, E-mail: jhp@ewha.ac.kr [Department of Environmental Science & Engineering, Ewha Womans University, Seoul 120-750 (Korea, Republic of); Sandor, Tarjan [Radioanalytical Reference Laboratory, Central Agricultural Office Food and Feed Safety Directorate (Hungary); Porto, Paolo, E-mail: paolo.porto@unirc.it [Dipartimento di AGRARIA, Università degli Studi “Mediterranea” di Reggio Calabria (Italy); Alewell, Christine, E-mail: Christine.Alewell@unibas.ch [Environmental Geosciences, University of Basel, Bernoullistrasse 30, CH-4056 Basel (Switzerland)

    2016-10-01

    Fallout radionuclides have been used successfully worldwide as tracers for soil erosion, but relatively few studies exploit the full potential of plutonium (Pu) isotopes. Hence, this study aims to explore the suitability of the plutonium isotopes {sup 239}Pu and {sup 240}Pu as a method to assess soil erosion magnitude by comparison to more established fallout radionuclides such as {sup 137}Cs and {sup 210}Pb{sub ex}. As test area an erosion affected headwater catchment of the Lake Soyang (South Korea) was selected. All three fallout radionuclides confirmed high erosion rates for agricultural sites (> 25 t ha{sup −1} yr{sup −1}). Pu isotopes further allowed determining the origin of the fallout. Both {sup 240}Pu/{sup 239}Pu atomic ratios and {sup 239+240}Pu/{sup 137}Cs activity ratios were close to the global fallout ratio. However, the depth profile of the {sup 239+240}Pu/{sup 137}Cs activity ratios in undisturbed sites showed lower ratios in the top soil increments, which might be due to higher migration rates of {sup 239+240}Pu. The activity ratios further indicated preferential transport of {sup 137}Cs from eroded sites (higher ratio compared to the global fallout) to the depositional sites (smaller ratio). As such the {sup 239+240}Pu/{sup 137}Cs activity ratio offered a new approach to parameterize a particle size correction factor that can be applied when both {sup 137}Cs and {sup 239+240}Pu have the same fallout source. Implementing this particle size correction factor in the conversion of {sup 137}Cs inventories resulted in comparable estimates of soil loss for {sup 137}Cs and {sup 239+240}Pu. The comparison among the different fallout radionuclides highlights the suitability of {sup 239+240}Pu through less preferential transport compared to {sup 137}Cs and the possibility to gain information regarding the origin of the fallout. In conclusion, {sup 239+240}Pu is a promising soil erosion tracer, however, since the behaviour i.e. vertical migration in the

  6. Comparison between Different Scheduling Strategies by Using Cost239 Optical Network

    Directory of Open Access Journals (Sweden)

    Pooja Meena, Manish Shrivastava, Sushil Chaturvedi

    2012-12-01

    Full Text Available In this paper we present different demand policies in scheduled lightpath demand (SLDs .SLD is a demand for a set of lightpaths (connections, defined by a tuple (s,d,n,α,ω where s and d are the source and destination nodes of the lightpaths, n is the number of requested lightpaths α, ω and are the set-up and tear-down times of the lightpaths. The objective of this paper to increase resource utilization ratio by using channel reuse. In this paper we works on Cost 239 network by assigning the same channel to several lightpaths, by using different wavelengths which varies according to the time (set-up and tear-down.By comparison of demand policies which also depend upon time(set-up and tear-down every demand policy has own schedule. By using Cost 239 network we found the result which demand policy is effective and scheduled first and we compare each policy by using graphical representation and then find which policy is best for scheduling and increase the resource utilization .

  7. SALT reveals the barium central star of the planetary nebula Hen 2-39

    CERN Document Server

    Miszalski, B; Jones, D; Karakas, A I; Köppen, J; Tyndall, A A; Mohamed, S S; Rodríguez-Gil, P; Santander-García, M

    2013-01-01

    Classical barium stars are binary systems which consist of a late-type giant enriched in carbon and slow neutron capture (s-process) elements and an evolved white dwarf (WD) that is invisible at optical wavelengths. The youngest observed barium stars are surrounded by planetary nebulae (PNe), ejected soon after the wind accretion of polluted material when the WD was in its preceeding asymptotic giant branch (AGB) phase. Such systems are rare but powerful laboratories for studying AGB nucleosynthesis as we can measure the chemical abundances of both the polluted star and the nebula ejected by the polluter. Here we present evidence for a barium star in the PN Hen 2-39. The polluted giant is very similar to that found in WeBo 1. It is a cool (Teff=4250 +/- 150 K) giant enhanced in carbon ([C/H]=0.42 +/- 0.02 dex) and barium ([Ba/Fe]=1.50 +/- 0.25 dex). A spectral type of C-R3 C_24 nominally places Hen 2-39 amongst the peculiar early R-type carbon stars, however the barium enhancement and likely binary status mea...

  8. Consistent Data Assimilation of Actinide Isotopes: 235U and 239Pu

    Energy Technology Data Exchange (ETDEWEB)

    G. Palmiottti; H. Hiruta; M. Salvatores

    2011-09-01

    In this annual report we illustrate the methodology of the consistent data assimilation that allows to use the information coming from integral experiments for improving the basic nuclear parameters used in cross section evaluation. A series of integral experiments were analyzed using the EMPIRE evaluated files for {sup 235}U, {sup 238}U, and {sup 239}Pu. Inmost cases the results have shown quite large worse results with respect to the corresponding existing evaluations available for ENDF/B-VII. The observed discrepancies between calculated and experimental results were used in conjunction with the computed sensitivity coefficients and covariance matrix for nuclear parameters in a consistent data assimilation. Only the GODIVA and JEZEBEL experimental results were used, in order to exploit information relative to the isotope of interest that are, in this particular case: {sup 235}U and {sup 239}Pu. The results obtained by the consistent data assimilation indicate that with reasonable modifications (mostly within the initial standard deviation) it is possible to eliminate the original large discrepancies on the K{sub eff} of the two critical configurations. However, some residual discrepancy remains for a few fission spectral indices that are, most likely, to be attributed to the detector cross sections.

  9. Advanced disposal systems for transuranic waste: Preliminary disposal criteria for Plutonium-239 at Hanford

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.E.; Napier, B.A.; Soldat, J.K.

    1983-01-01

    An evaluation of the feasibility and potential application of advanced disposal systems is being conducted for defense transuranic (TRU) wastes at the Hanford site. The advanced waste disposal options include those developed to provide ''greater confinement'' than provided by shallow-land burial. An example systems analysis is discussed with assumed performance objectives and various Hanford-specific disposal conditions, waste forms, site characteristics, and engineered barriers. Preliminary waste disposal criteria for /sup 239/Pu are determined by applying the allowable residual contamination level (ARCL) method. This method is based on compliance with a radiation dose rate limit through a site specific analysis of the potential for radiation exposure to individuals. A 10,000-year environmental performance period is assumed, and the dose rate limit for human intrusion is assumed to be 500 mrem/yr to any exposed individual. Preliminary waste disposal criteria derived by this method for /sup 239/Pu in soils at the Hanford Site are 0.5 nCi/g in soils between the surface and a depth of 1 m, 2200 nCi/g of soil at a depth of 5 m, and 10,000 nCi/g of soil at depths 10 m and below. These waste disposal criteria are based on exposure scenarios that reflect the dependence of exposure versus burial depth.

  10. Transuranic advanced disposal systems: preliminary /sup 239/Pu waste-disposal criteria for Hanford

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, W.E. Jr.; Napier, B.A.; Soldat, J.K.

    1982-08-01

    An evaluation of the feasibility and potential application of advanced disposal systems is being conducted for defense transuranic (TRU) wastes at the Hanford Site. The advanced waste disposal options include those developed to provide greater confinement than provided by shallow-land burial. An example systems analysis is discussed with assumed performance objectives and various Hanford-specific disposal conditions, waste forms, site characteristics, and engineered barriers. Preliminary waste disposal criteria for /sup 239/Pu are determined by applying the Allowable Residual Contamination Level (ARCL) method. This method is based on compliance with a radiation dose rate limit through a site-specific analysis of the potential for radiation exposure to individuals. A 10,000 year environmental performance period is assumed, and the dose rate limit for human intrusion is assumed to be 500 mrem/y to any exposed individual. Preliminary waste disposal criteria derived by this method for /sup 239/Pu in soils at the Hanford Site are: 0.5 nCi/g in soils between the surface and a depth of 1 m, 2200 nCi/g of soil at a depth of 5 m, and 10,000 nCi/g of soil at depths 10 m and below. These waste disposal criteria are based on exposure scenarios that reflect the dependence of exposure versus burial depth. 2 figures, 5 tables.

  11. Transuranic concentrations in reef and pelagic fish from the Marshall Islands. [/sup 239/Pu, /sup 240/Pu

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V.E.; Eagle, R.J.; Wong, K.M.; Jokela, T.A.

    1980-09-01

    Concentrations of /sup 239 + 240/Pu are reported in tissues of several species of reef and pelagic fish caught at 14 different atolls in the northern Marshall Islands. Several regularities that are species dependent are evident in the distribution of /sup 239 + 240/Pu among different body tissues. Concentrations in liver always exceeded those in bone and concentrations were lowest in the muscle of all fish analyzed. A progressive discrimination against /sup 239 + 240/Pu was observed at successive trophic levels at all atolls except Bikini and Enewetak, where it was difficult to conclude if any real difference exists between the average concentration factor for /sup 239 + 240/Pu among all fish, which include bottom feeding and grazing herbivores, bottom feeding carnivores, and pelagic carnivores from different atoll locations. The average concentration of /sup 239 + 240/Pu in the muscle of surgeonfish from Bikini and Enewetak was not significantly different from the average concentrations determined in these fish at the other, lesser contaminated atolls. Concentrations among all 3rd, 4th, and 5th trophic level species are highest at Bikini where higher environmental concentrations are found. The reasons for the anomalously low concentrations in herbivores from Bikini and Enewetak are not known.

  12. Spatial statistical analysis of contamination level of 241Am and 239Pu, Thule, North-West Greenland

    Energy Technology Data Exchange (ETDEWEB)

    Strodl Andersen, J. (JSA EnviroStat (Denmark))

    2011-10-15

    A spatial analysis of data on radioactive pollution on land at Thule, North-West Greenland is presented. The data comprises levels of 241Am and 239,240Pu on land. Maximum observed level of 241Am is 2.8x105 Bq m-2. Highest levels were observed near Narsaarsuk. This area was also sampled most intensively. In Groennedal the maximum observed level of 241Am is 1.9-104 Bq m-2. Prediction of the overall amount of 241Am and 239,240Pu is based on grid points within the range from the nearest measurement location. The overall amount is therefore highly dependent on the model. Under the optimal spatial model for Narsaarsuk, within the area of prediction, the predicted total amount of 241Am is 45 GBq and the predicted total amount of 239,240Pu is 270 GBq. (Author)

  13. An examination of the potential fission-bomb weaponizability of nuclides other than 235U and 239Pu

    Science.gov (United States)

    Reed, B. Cameron

    2017-01-01

    Long-lived fissionable isotopes other than uranium-235 and plutonium-239 are examined for possible use in fission weapons. A few other isotopes are potentially weaponizable and in some cases have been tried or their criticality experimentally demonstrated. In most cases, however, promising isotopes are either extremely rare, difficult to produce in quantity, or hazardous to handle. Some isotopes can serve to boost the yield of fission weapons, but 235U and 239Pu are likely to remain the only practical primary fuels for nuclear weapons. In view of this, and the fact that this analysis gives no engineering details on the design of nuclear weapons, this paper will be of no assistance to putative bomb-makers; rather, my purpose is to clarify the physics similarities between 235U and 239Pu that make them suitable candidates for fission weapons.

  14. 239Pu(n,2n) 238Pu cross section inferred from IDA calculations and GEANIE measurements

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H; Ormand, W E; Dietrich, F S

    2000-09-01

    This report presents the latest {sup 239}Pu(n,2n){sup 238}Pu cross sections inferred from calculations performed with the nuclear reaction-modeling code system, IDA, coupled with experimental measurements of partial {gamma}-ray cross sections for incident neutron energies ranging from 5.68 to 17.18 MeV. It is found that the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section peaks at E{sub inc} {approx} 11.4 MeV with a peak value of approximately 326 mb. At E{sub inc} {approx} 14 MeV, the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section is found to be in good agreement with previous radio-chemical measurements by Lockheed. However, the shape of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section differs significantly from previous evaluations of ENDL, ENDF/B-V and ENDF/B-VI. In our calculations, direct, preequilibrium, and compound reactions are included. Also considered in the modeling are fission and {gamma}-cascade processes in addition to particle emission. The main components of physics adopted and the parameters used in our calculations are discussed. Good agreement of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross sections derived separately from IDA and GNASH calculations is shown. The two inferences provide an estimate of variations in the deduced {sup 239}Pu(n,2n){sup 238}Pu cross section originating from modeling.

  15. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-07

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼ 15, ∼ 90, and ∼ 200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process.

  16. Combined exposure of F344 rats to beryllium metal and plutonium-239 dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Finch, G.L.; Carlton, W.W.; Rebar, A.H. [Purdue Univ., Lafayette, IN (United States)] [and others

    1995-12-01

    Nuclear weapons industry workers have the potential for inhalation exposures to plutonium (Pu) and other agents, such as beryllium (Be) metal. The purpose of this ongoing study is to investigate potential interactions between Pu and Be in the production of lung tumors in rats exposed by inhalation to particles of {sup 239}PuO{sub 2}, Be metal, or these agents in combination. Inhaled Pu deposited in the lung delivers high-linear-energy transfer, alpha-particle radiation and is known to induce pulmonary cancer in laboratory animals. Although the epidemiological evidence implicating Be in the induction of human lung cancer is weak and controversial, various studies in laboratory animals have demonstrated the pulmonary carcinogenicity of Be. As a result, Be is classified as a suspect human carcinogen in the United STates and as a demonstrated human carcinogen by the International Agency for Research on Cancer. This study is in progress.

  17. Calculation of 239Pu fission observables in an event-by-event simulation

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, R; Randrup, J; Pruet, J; Younes, W

    2010-03-31

    The increased interest in more exclusive fission observables has demanded more detailed models. We describe a new computational model, FREYA, that aims to meet this need by producing large samples of complete fission events from which any observable of interest can then be extracted consistently, including any interesting correlations. The various model assumptions are described and the potential utility of the model is illustrated. As a concrete example, we use formal statistical methods, experimental data on neutron production in neutron-induced fission of {sup 239}Pu, along with FREYA, to develop quantitative insights into the relation between reaction observables and detailed microscopic aspects of fission. Current measurements of the mean number of prompt neutrons emitted in fission taken together with less accurate current measurements for the prompt post-fission neutron energy spectrum, up to the threshold for multi-chance fission, place remarkably fine constraints on microscopic theories.

  18. Investigation of zircon/zirconia ceramics doped with {sup 239}Pu and {sup 238}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Burakov, B.E.; Anderson, E.B.; Zamoryanskaya, M.V.; Nikolaeva, E.V.; Strykanova, E.E.; Yagovkina, M.A. [V.G. Khlopin Radium Institute, Saint Petersburg (Russian Federation)

    2001-07-01

    Several samples of crystalline double-phase ceramics based on zircon, (Zr,Pu)SiO{sub 4} and zirconia, (Zr,Pu)O{sub 2}, were synthesized by sintering in air, precursors containing approximately 5-6 and 10 wt% {sup 239}Pu, respectively. One sample doped with 5-6 wt% {sup 238-39-40}Pu was also obtained under the same conditions. All ceramic samples were studied by X-ray powder diffraction (XRD), scanning electron microscopy (SEM), electron probe microanalysis (EPMA) and MCC-1 leach test in deionized water at 90 C. Results indicate that even radiation damaged zircon/zirconia ceramics retain high chemical resistance and mechanical durability. (author)

  19. Characterization of a {sup 239}PuBe isotopic neutron source

    Energy Technology Data Exchange (ETDEWEB)

    Vega C, H. R.; Hernandez D, V. M. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Rivera M, T. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Calz. Legaria No. 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Sanchez, A., E-mail: fermineutron@yahoo.com [IPN, Escuela Superior de Fisica y Matematicas, 07738 Mexico D. F. (Mexico)

    2012-10-15

    A Bonner sphere spectrometer was used to determine the features of a {sup 239}PuBe neutron source used to operate the ESFM-Ipn Subcritical Reactor. The spectrometer is a {sup 6}Lil(Eu) scintillator and 2, 3, 5, 8, 10 and 12 inches-diameter polyethylene spheres, that was located 100 cm from the neutron source. The count rates obtained with the spectrometer were unfolded using the NSDUAZ code and neutron spectrum, total fluence, and ambient dose equivalent were determined. A Monte Carlo calculation, using the MCNP5 code, was carried out to estimate the spectrum and integral features being less that values obtained experimentally due to the presence of {sup 241}Pu in the Pu used to fabricate the source. Using the experimental information the actual neutron yield and the mass fraction of {sup 241}Pu was estimated. (Author)

  20. Performance Assessment of 239 Series Sub-cooling Heat Exchangers for the Large Hadron Collider

    CERN Document Server

    Riddone, G; Roussel, P; Moracchioli, R; Tavian, L

    2006-01-01

    Helium sub-cooling heat exchangers of the counter-flow type are used to minimize the vapor fraction produced in the final expansion of the 1.9 K distributed cooling loops used for cooling the superconducting magnets of the Large Hadron Collider (LHC). These components are of compact design, featuring low-pressure drop and handling very low pressure vapor at low temperature. Following a qualification phase of prototypes, a contract has been placed in European industry for the supply of 239 heat exchanger units. Different levels of extracted heat load require three different variants of heat exchangers. This paper will describe the manufacturing phase with emphasis on the main difficulties encountered to keep the production quality after a brief recall of the prototype phase. Finally, the acceptance tests performed at room temperature and at the nominal cryogenic condition at the factory and at CEA-Grenoble will be presented.

  1. Dependence of dose coefficients for {sup 239}Pu on transfer rates and absorption parameters

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, K.; Sekimoto, H. [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan); Ishigure, N. [Division of Radiotoxicology and Protection, National Institute of Radiological Sciences, Chiba (Japan)

    2000-05-01

    As it is reported of the biokinetic models and parameter values of the International Commission on Radiological Protection (ICRP) for dose estimation have uncertainties owing to insufficiency of human data. For most radionuclides, the data underlying such models and parameters of ICRP usually depend on animal experiments. Moreover, these values or model parameter are also greatly different between mammalian species. Recently, various radiation protection organizations are considering the biokinetic uncertainties from standpoints of data's sources, quality and completeness. In practice, a sensitivity analysis of doses to parameters is significant for the purpose of risk assessment. In general, movement or material in the body is depicted as a system of first-order processes, and parameter values are expressed as transfer rates between compartments. In this study, we made a code to reproduce the ICRP's dose coefficients for {sup 239}Pu, which is one of the most important elements for occupational exposure and its effective dose is much concerned with its own distribution in the body for dominance of alpha-decay. By using this code, we modified each transfer rate in a factor of 2, 3 and 4 in order to evaluate the effects, and calculated the sensitivities of effective doses due to these changes. Additionally, we examined the effects of modification of absorption parameters f{sub r}, S{sub r} and S{sub s}, which represent the absorption of particles from respiratory tract into blood. Consequently, the transfer rates that give a large sensitivity were specified, and it was shown that changes of transfer rates and absorption parameters are not so influential on effective doses for {sup 239}Pu in many cases. (author)

  2. Radioecologycal study of 239/240Pu in Bangka Island and Muria Peninsula: Determination of 239/240Pu in marine sediment and seawater as part of baseline data collecting for sitting of candidates of first Indonesia NPP

    Science.gov (United States)

    Suseno, Heny; Wisnubroto, Djarot S.

    2014-03-01

    Radioisotope Pu-239/240 are alpha emitting nuclides important indicators of radioactive contamination of the marine environment. Global fallout is the main source of plutonium in the marine environment. There are very limited study on 239/240Pu in Indonesia coastal environments. The data of this radioisotopes is needed for baseline data of nuclear power plant (NPP) site candidates both in Bangka Island and Muria Peninsula. Bottom sediments play an important role in radioecological studies of the marine environment because a large proportion of radioactive substances entering the sea is adsorbed over time onto suspended particulate matter and deposited in sediments. Plutonium is particle reactive and deposited in marine sediment. Radioisotope 239/240Pu was determinated by alpha spectrometry after radiochemical procedure that was performed in both water and marine sediment from Bangka Island and Muria Peninsula. The sediment baseline of concentration 239/240Pu in Bangka Island and Muria Peninsula were range from 0.013 to 0.021 Bq.kg-1 and 0.018 to 0.024 Bq.kg-1 respectively. The water baseline concentration this isotope were range from 2.73 to 4.05 mBq.m-3 and 2.98 to 4.50 mBq.m-3.

  3. Radioecologycal study of {sup 239/240}Pu in Bangka Island and Muria Peninsula: Determination of {sup 239/240}Pu in marine sediment and seawater as part of baseline data collecting for sitting of candidates of first Indonesia NPP

    Energy Technology Data Exchange (ETDEWEB)

    Suseno, Heny, E-mail: henis@batan.go.id [Radioactive Waste Technology Center - The Indonesian National Nuclear Energy Agency (Indonesia); Wisnubroto, Djarot S. [The Indonesian National Nuclear Energy Agency (Indonesia)

    2014-03-24

    Radioisotope Pu-239/240 are alpha emitting nuclides important indicators of radioactive contamination of the marine environment. Global fallout is the main source of plutonium in the marine environment. There are very limited study on {sup 239/240}Pu in Indonesia coastal environments. The data of this radioisotopes is needed for baseline data of nuclear power plant (NPP) site candidates both in Bangka Island and Muria Peninsula. Bottom sediments play an important role in radioecological studies of the marine environment because a large proportion of radioactive substances entering the sea is adsorbed over time onto suspended particulate matter and deposited in sediments. Plutonium is particle reactive and deposited in marine sediment. Radioisotope {sup 239/240}Pu was determinated by alpha spectrometry after radiochemical procedure that was performed in both water and marine sediment from Bangka Island and Muria Peninsula. The sediment baseline of concentration {sup 239/240}Pu in Bangka Island and Muria Peninsula were range from 0.013 to 0.021 Bq.kg{sup −1} and 0.018 to 0.024 Bq.kg{sup −1} respectively. The water baseline concentration this isotope were range from 2.73 to 4.05 mBq.m{sup −3} and 2.98 to 4.50 mBq.m{sup −3}.

  4. (137)Cs, (239+240)Pu concentrations and the (240)Pu/(239)Pu atom ratio in a sediment core from the sub-aqueous delta of Yangtze River estuary.

    Science.gov (United States)

    Pan, S M; Tims, S G; Liu, X Y; Fifield, L K

    2011-10-01

    A sediment core collected from the sub-aqueous delta of the Yangtze River estuary was subjected to analyses of (137)Cs and plutonium (Pu) isotopes. The (137)Cs was measured using γ-spectrometry at the laboratories at the Nanjing University and Pu isotopes were determined with Accelerator Mass Spectrometry (AMS), measurements made at the Australian National University. The results show considerable structure in the depth concentration profiles of the (137)Cs and (239+240)Pu. The shape of the vertical (137)Cs distribution in the sediment core was similar to that of the Pu. The maximum (137)Cs and (239+240)Pu concentrations were 16.21 ± 0.95 mBq/g and 0.716 ± 0.030 mBq/g, respectively, and appear at same depth. The average (240)Pu/(239)Pu atom ratio was 0.238 ± 0.007 in the sediment core, slightly higher than the average global fallout value. The changes in the (240)Pu/(239)Pu atom ratios in the sediment core indicate the presence of at least two different Pu sources, i.e., global fallout and another source, most likely close-in fallout from the Pacific Proving Grounds (PPG) in the Marshall Islands, and suggest the possibility that Pu isotopes are useful as a geochronological tool for coastal sediment studies. The (137)Cs and (239+240)Pu inventories were estimated to be 7100 ± 1200 Bq/m(2) and 407 ± 27 Bq/m(2), respectively. Approximately 40% of the (239+240)Pu inventory originated from the PPG close-in fallout and about 50% has derived from land-origin global fallout transported to the estuary by the river. This study confirms that AMS is a useful tool to measure (240)Pu/(239)Pu atom ratio and can provide valuable information on sedimentary processes in the coastal environment.

  5. 16 CFR 239.3 - “Satisfaction Guarantees” and similar representations in advertising; disclosure in advertising...

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false âSatisfaction Guaranteesâ and similar... GUIDES FOR THE ADVERTISING OF WARRANTIES AND GUARANTEES § 239.3 “Satisfaction Guarantees” and similar representations in advertising; disclosure in advertising that mentions “satisfaction guarantees” or...

  6. Purification, characterization and regulation of a monomeric L-phenylalanine dehydrogenase from the facultative methylotroph Nocardia sp. 239

    NARCIS (Netherlands)

    Boer, L. de; Rijssel, M. van; Euverink, G.J.; Dijkhuizen, L.

    1989-01-01

    In Nocardia sp. 239 D-phenylalanine is converted into L-phenylalanine by an inducible amino acid racemase. The further catabolism of this amino acid involves an NAD-dependent L-phenylalanine dehydrogenase. This enzyme was detected only in cells grown on L- or D-phenylalanine and in batch cultures hi

  7. Draft Genome Sequence of Microbacterium sp. Strain Alg239_V18, an Actinobacterium Retrieved from the Marine Sponge Spongia sp.

    Science.gov (United States)

    Karimi, Elham; Gonçalves, Jorge M S; Reis, Margarida; Costa, Rodrigo

    2017-01-19

    Here, we describe the draft genome sequence of Microbacterium sp. strain Alg239_V18, an actinobacterium retrieved from the marine sponge Spongia sp. Genome annotation revealed a vast gene repertoire involved in antibiotic and heavy metal-resistance, and a versatile carbohydrate assimilation metabolism with potential for chitin utilization.

  8. 17 CFR 239.18 - Form S-11, for registration under the Securities Act of 1933 of securities of certain real estate...

    Science.gov (United States)

    2010-04-01

    ... under the Securities Act of 1933 of securities of certain real estate companies. 239.18 Section 239.18... Securities Act of 1933 of securities of certain real estate companies. This form shall be used for registration under the Securities Act of 1933 of (a) securities issued by real estate investment trusts,...

  9. Suitability of 239+240Pu and 137Cs as tracers for soil erosion assessment in mountain grasslands.

    Science.gov (United States)

    Alewell, Christine; Meusburger, Katrin; Juretzko, Gregor; Mabit, Lionel; Ketterer, Michael E

    2014-05-01

    Anthropogenic radionuclides have been distributed globally due to nuclear weapons testing, nuclear accidents, nuclear weapons fabrication, and nuclear fuel reprocessing. While the negative consequences of this radioactive contamination are self-evident, the ubiquitous fallout radionuclides (FRNs) distribution form the basis for the use as tracers in ecological studies, namely for soil erosion assessment. Soil erosion is a major threat to mountain ecosystems worldwide. We compare the suitability of the anthropogenic FRNs, 137Cs and 239+240Pu as soil erosion tracers in two alpine valleys of Switzerland (Urseren Valley, Canton Uri, Central Swiss Alps and Val Piora, Ticino, Southern Alps). We sampled reference and potentially erosive sites in transects along both valleys. 137Cs measurements of soil samples were performed with a Li-drifted Germanium detector and 239+240Pu with ICP-MS. Our data indicates a heterogeneous deposition of the 137Cs, since most of the fallout origins from the Chernobyl April/May 1986 accident, when large parts of the European Alps were still snow-covered. In contrast, 239+240Pu fallout originated mainly from 1950s to 1960s atmospheric nuclear weapons tests, resulting in a more homogenous distribution and thus seems to be a more suitable tracer in mountainous grasslands. Soil erosion assessment using 239+240Pu as a tracer pointed to a huge dynamic and high heterogeneity of erosive processes (between sedimentation of 1.9 and 7 t ha(-1) yr(-1) and erosion of 0.2-16.4 t ha(-1) yr(-1) in the Urseren Valley and sedimentation of 0.4-20.3 t ha(-1) yr(-1) and erosion of 0.1-16.4 t ha(-1) yr(-1) at Val Piora). Our study represents a novel and successful application of 239+240Pu as a tracer of soil erosion in a mountain environment.

  10. Measurement of fallout radionuclides, (239)(,240)Pu and (137)Cs, in soil and creek sediment: Sydney Basin, Australia.

    Science.gov (United States)

    Smith, B S; Child, D P; Fierro, D; Harrison, J J; Heijnis, H; Hotchkis, M A C; Johansen, M P; Marx, S; Payne, T E; Zawadzki, A

    2016-01-01

    Soil and sediment samples from the Sydney basin were measured to ascertain fallout radionuclide activity concentrations and atom ratios. Caesium-137 ((137)Cs) was measured using gamma spectroscopy, and plutonium isotopes ((239)Pu and (240)Pu) were quantified using accelerator mass spectrometry (AMS). Fallout radionuclide activity concentrations were variable ranging from 0.6 to 26.1 Bq/kg for (137)Cs and 0.02-0.52 Bq/kg for (239+240)Pu. Radionuclides in creek sediment samples were an order of magnitude lower than in soils. (137)Cs and (239+240)Pu activity concentration in soils were well correlated (r(2) = 0.80) although some deviation was observed in samples collected at higher elevations. Soil ratios of (137)Cs/(239+240)Pu (decay corrected to 1/1/2014) ranged from 11.5 to 52.1 (average = 37.0 ± 12.4) and showed more variability than previous studies. (240)Pu/(239)Pu atom ratios ranged from 0.117 to 0.165 with an average of 0.146 (±0.013) and an error weighted mean of 0.138 (±0.001). These ratios are lower than a previously reported ratio for Sydney, and lower than the global average. However, these ratios are similar to those reported for other sites within Australia that are located away from former weapons testing sites and indicate that atom ratio measurements from other parts of the world are unlikely to be applicable to the Australian context.

  11. Pu-239 organ specific dosimetric model applied to non-human biota

    Science.gov (United States)

    Kaspar, Matthew Jason

    There are few locations throughout the world, like the Maralinga nuclear test site located in south western Australia, where sufficient plutonium contaminate concentration levels exist that they can be utilized for studies of the long-term radionuclide accumulation in non-human biota. The information obtained will be useful for the potential human users of the site while also keeping with international efforts to better understand doses to non-human biota. In particular, this study focuses primarily on a rabbit sample set collected from the population located within the site. Our approach is intended to employ the same dose and dose rate methods selected by the International Commission on Radiological Protection and adapted by the scientific community for similar research questions. These models rely on a series of simplifying assumptions on biota and their geometry; in particular; organisms are treated as spherical and ellipsoidal representations displaying the animal mass and volume. These simplifications assume homogeneity of all animal tissues. In collaborative efforts between Colorado State University and the Australian Nuclear Science and Technology Organisation (ANSTO), we are expanding current knowledge on radionuclide accumulation in specific organs causing organ-specific dose rates, such as Pu-239 accumulating in bone, liver, and lungs. Organ-specific dose models have been developed for humans; however, little has been developed for the dose assessment to biota, in particular rabbits. This study will determine if it is scientifically valid to use standard software, in particular ERICA Tool, as a means to determine organ-specific dosimetry due to Pu-239 accumulation in organs. ERICA Tool is normally applied to whole organisms as a means to determine radiological risk to whole ecosystems. We will focus on the aquatic model within ERICA Tool, as animal organs, like aquatic organisms, can be assumed to lie within an infinite uniform medium. This model would

  12. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241; Estudo da aplicacao de biossorventes no tratamento de rejeitos radioativos liquidos contendo americio-241

    Energy Technology Data Exchange (ETDEWEB)

    Borba, Tania Regina de

    2010-07-01

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  13. 239Pu Prompt Fission Neutron Spectra Impact on a Set of Criticality and Experimental Reactor Benchmarks

    Science.gov (United States)

    Peneliau, Y.; Litaize, O.; Archier, P.; De Saint Jean, C.

    2014-04-01

    A large set of nuclear data are investigated to improve the calculation predictions of the new neutron transport simulation codes. With the next generation of nuclear power plants (GEN IV projects), one expects to reduce the calculated uncertainties which are mainly coming from nuclear data and are still very important, before taking into account integral information in the adjustment process. In France, future nuclear power plant concepts will probably use MOX fuel, either in Sodium Fast Reactors or in Gas Cooled Fast Reactors. Consequently, the knowledge of 239Pu cross sections and other nuclear data is crucial issue in order to reduce these sources of uncertainty. The Prompt Fission Neutron Spectra (PFNS) for 239Pu are part of these relevant data (an IAEA working group is even dedicated to PFNS) and the work presented here deals with this particular topic. The main international data files (i.e. JEFF-3.1.1, ENDF/B-VII.0, JENDL-4.0, BRC-2009) have been considered and compared with two different spectra, coming from the works of Maslov and Kornilov respectively. The spectra are first compared by calculating their mathematical moments in order to characterize them. Then, a reference calculation using the whole JEFF-3.1.1 evaluation file is performed and compared with another calculation performed with a new evaluation file, in which the data block containing the fission spectra (MF=5, MT=18) is replaced by the investigated spectra (one for each evaluation). A set of benchmarks is used to analyze the effects of PFNS, covering criticality cases and mock-up cases in various neutron flux spectra (thermal, intermediate, and fast flux spectra). Data coming from many ICSBEP experiments are used (PU-SOL-THERM, PU-MET-FAST, PU-MET-INTER and PU-MET-MIXED) and French mock-up experiments are also investigated (EOLE for thermal neutron flux spectrum and MASURCA for fast neutron flux spectrum). This study shows that many experiments and neutron parameters are very sensitive to

  14. Using 239Pu as a tracer for fine sediment sources in the Daly River, Northern Australia

    Science.gov (United States)

    Lal, R.; Fifield, L. K.; Tims, S. G.; Wasson, R. J.; Howe, D.

    2015-04-01

    The Daly River drains a large (52500 km2) and mainly undisturbed catchment in the Australian wet-dry tropics. Clearing and cropping since 2002 have raised concerns about possible increased sediment input into the river and motivated this study of its fine sediment sources. Using 239Pu as a tracer it is shown that the fine sediments originate mainly from erosion by gullying and channel change. Although the results also indicate that the surface soil contribution to the river channel sediments from sheet erosion has increased to 5-22% for the Daly River and 7-28% for the Douglas River (a tributary of the Daly River) in 2009 vs. 3-6% for the Daly River and 4-9% for the Douglas River in 2005. This excess top soil likely originates from thecleared land adjacent to the Daly River since 2005. However, channel widening largely as a result of hydrologic change is still the dominant sediment source in this catchment.

  15. Using 239Pu as a tracer for fine sediment sources in the Daly River, Northern Australia

    Directory of Open Access Journals (Sweden)

    Lal R.

    2015-01-01

    Full Text Available The Daly River drains a large (52500 km2 and mainly undisturbed catchment in the Australian wet–dry tropics. Clearing and cropping since 2002 have raised concerns about possible increased sediment input into the river and motivated this study of its fine sediment sources. Using 239Pu as a tracer it is shown that the fine sediments originate mainly from erosion by gullying and channel change. Although the results also indicate that the surface soil contribution to the river channel sediments from sheet erosion has increased to 5-22% for the Daly River and 7-28% for the Douglas River (a tributary of the Daly River in 2009 vs. 3-6% for the Daly River and 4-9% for the Douglas River in 2005. This excess top soil likely originates from thecleared land adjacent to the Daly River since 2005. However, channel widening largely as a result of hydrologic change is still the dominant sediment source in this catchment.

  16. Pu239 Cross-Section Variations Based on Experimental Uncertainties and Covariances

    Energy Technology Data Exchange (ETDEWEB)

    Sigeti, David Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Williams, Brian J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Parsons, D. Kent [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-10-18

    Algorithms and software have been developed for producing variations in plutonium 239 neutron cross sections based on experimental uncertainties and covariances. The varied cross- section sets may be produced as random samples from the multi- variate normal distribution defined by an experimental mean vector and covariance matrix, or they may be produced as Latin- Hypercube/Orthogonal-Array samples (based on the same means and covariances) for use in parametrized studies. The variations obey two classes of constraints that are obligatory for cross-section sets and which put related constraints on the mean vector and covariance matrix that detemine the sampling. Because the experimental means and covariances do not obey some of these constraints to sufficient precision, imposing the constraints requires modifying the experimental mean vector and covariance matrix. Modification is done with an algorithm based on linear algebra that minimizes changes to the means and covariances while insuring that the operations that impose the different constraints do not conflict with each other.

  17. Pu239 Cross-Section Variations Based on Experimental Uncertainties and Covariances

    Energy Technology Data Exchange (ETDEWEB)

    Sigeti, David Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Williams, Brian J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Parsons, D. Kent [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-10-18

    Algorithms and software have been developed for producing variations in plutonium-239 neutron cross sections based on experimental uncertainties and covariances. The varied cross-section sets may be produced as random samples from the multi-variate normal distribution defined by an experimental mean vector and covariance matrix, or they may be produced as Latin-Hypercube/Orthogonal-Array samples (based on the same means and covariances) for use in parametrized studies. The variations obey two classes of constraints that are obligatory for cross-section sets and which put related constraints on the mean vector and covariance matrix that detemine the sampling. Because the experimental means and covariances do not obey some of these constraints to sufficient precision, imposing the constraints requires modifying the experimental mean vector and covariance matrix. Modification is done with an algorithm based on linear algebra that minimizes changes to the means and covariances while insuring that the operations that impose the different constraints do not conflict with each other.

  18. Photofission product yields of 238U and 239Pu with 22-MeV bremsstrahlung

    Science.gov (United States)

    Wen, Xianfei; Yang, Haori

    2016-06-01

    In homeland security and nuclear safeguards applications, non-destructive techniques to identify and quantify special nuclear materials are in great demand. Although nuclear materials naturally emit characteristic radiation (e.g. neutrons, γ-rays), their intensity and energy are normally low. Furthermore, such radiation could be intentionally shielded with ease or buried in high-level background. Active interrogation techniques based on photofission have been identified as effective assay approaches to address this issue. In designing such assay systems, nuclear data, like photofission product yields, plays a crucial role. Although fission yields for neutron-induced reactions have been well studied and readily available in various nuclear databases, data on photofission product yields is rather scarce. This poses a great challenge to the application of photofission techniques. In this work, short-lived high-energy delayed γ-rays from photofission of 238U were measured in between linac pulses. In addition, a list-mode system was developed to measure relatively long-lived delayed γ-rays from photofission of 238U and 239Pu after the irradiation. Time and energy information of each γ-ray event were simultaneously recorded by this system. Cumulative photofission product yields were then determined using the measured delayed γ-ray spectra.

  19. Spatial statistical analysis of contamination level of 241Am and 239Pu, Thule, North-West Greenland

    DEFF Research Database (Denmark)

    Strodl Andersen, Jens

    A spatial analysis of data on radioactive pollution on land at Thule, North-West Greenland is presented. The data comprises levels of 241Am and 239,240Pu on land. Maximum observed level of 241Am is 2.8×105 Bq m-2. Highest levels were observed near Narsaarsuk. This area was also sampled most...... intensively. In Grønnedal the maximum observed level of 241Am is 1.9×104 Bq m-2. Prediction of the overall amount of 241Am and 239,240Pu is based on grid points within the range from the nearest measurement location. The overall amount is therefore highly dependent on the model. Under the optimal spatial...

  20. Revisiting the U-238 thermal capture cross section and gamma-raymission probabilities from Np-239 decay

    Energy Technology Data Exchange (ETDEWEB)

    Trkov, A.; Molnar, G.L.; Revay, Zs.; Mughabghab, S.F.; Firestone,R.B.; Pronyaev, V.G.; Nichols, A.L.; Moxon, M.C.

    2005-03-03

    The precise value of the thermal capture cross section of238U is uncertain, and evaluated cross sections from various sourcesdiffer by more than their assigned uncertainties. A number of theoriginal publications have been reviewed to assess the discrepant data,corrections were made for more recent standard cross sections andotherconstants, and one new measurement was analyzed. Due to the strongcorrelations in activation measurements, the gamma-ray emissionprobabilities from the beta decay of 239Np were also analyzed. As aresult of the analysis, a value of 2.683 +- 0.012 barns was derived forthe thermal capture cross section of 238U. A new evaluation of thegamma-ray emission probabilities from 239Np decay was alsoundertaken.

  1. Probing energy dissipation, γ-ray and neutron multiplicity in the thermal neutron-induced fission of {sup 239}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Pahlavani, M.R.; Mirfathi, S.M. [University of Mazandaran, Department of Nuclear Physics, Faculty of Basic Science, Babolsar (Iran, Islamic Republic of)

    2016-04-15

    The incorporation of the four-dimensional Langevin equations led to an integrative description of fission cross-section, fragment mass distribution and the multiplicity and energy distribution of prompt neutrons and γ-rays in the thermal neutron-induced fission of {sup 239}Pu. The dynamical approach presented in this paper thoroughly reproduces several experimental observables of the fission process at low excitation energy. (orig.)

  2. Estimation of uncertainties in resonance parameters of {sup 56}Fe, {sup 239}Pu, {sup 240}Pu and {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Nakagawa, Tsuneo; Shibata, Keiichi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-05-01

    Uncertainties have been estimated for the resonance parameters of {sup 56}Fe, {sup 239}Pu, {sup 240}Pu and {sup 238}U contained in JENDL-3.2. Errors of the parameters were determined from the measurements which the evaluation was based on. The estimated errors have been compiled in the MF32 of the ENDF format. The numerical results are given in tables. (author)

  3. Diverse Host Responses and Outcomes following Simian Immunodeficiency Virus SIVmac239 Infection in Sooty Mangabeys and Rhesus Macaques

    Science.gov (United States)

    Kaur, Amitinder; Grant, Robert M.; Means, Robert E.; McClure, Harold; Feinberg, Mark; Johnson, R. Paul

    1998-01-01

    Sooty mangabeys naturally infected with simian immunodeficiency virus (SIV) do not develop immunodeficiency despite the presence of viral loads of 105 to 107 RNA copies/ml. To investigate the basis of apathogenic SIV infection in sooty mangabeys, three sooty mangabeys and three rhesus macaques were inoculated intravenously with SIVmac239 and evaluated longitudinally for 1 year. SIVmac239 infection of sooty mangabeys resulted in 2- to 4-log-lower viral loads than in macaques and did not reproduce the high viral loads observed in natural SIVsmm infection. During acute SIV infection, polyclonal cytotoxic T-lymphocyte (CTL) activity coincident with decline in peak plasma viremia was observed in both macaques and mangabeys; 8 to 20 weeks later, CTL activity declined in the macaques but was sustained and broadly directed in the mangabeys. Neutralizing antibodies to SIVmac239 were detected in the macaques but not the mangabeys. Differences in expression of CD38 on CD8+ T lymphocytes or in the percentage of naive phenotype T cells expressing CD45RA and CD62L-selection did not correlate with development of AIDS in rhesus macaques. In macaques, the proportion of CD4+ T lymphocytes expressing CD25 declined during SIV infection, while in mangabeys, CD25-expressing CD4+ T lymphocytes increased. Longitudinal evaluation of cytokine secretion by flow cytometric analysis of unstimulated lymphocytes revealed elevation of interleukin-2 and gamma interferon in a macaque and only interleukin-10 in a concurrently infected mangabey during acute SIV infection. Differences in host responses following experimental SIVmac239 infection may be associated with the divergent outcome in sooty mangabeys and rhesus macaques. PMID:9811693

  4. Study of neutron-deficient isotopes of Fl in the 239Pu, 240Pu + 48Ca reactions

    Science.gov (United States)

    Voinov, A. A.; Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu Ts; Rykaczewski, K. P.; Abdullin, F. Sh; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu S.; Subbotin, V. G.; Sukhov, A. M.; Sabelnikov, A. V.; Vostokin, G. K.; Hamilton, J. H.; Stoyer, M. A.; Strauss, S. Y.

    2016-07-01

    The results of the experiments aimed at the synthesis of Fl isotopes in the 239Pu + 48Ca and 240Pu + 48Ca reactions are presented. The experiment was performed using the Dubna gas-filled recoil separator at the U400 cyclotron. In the 239Pu+48Ca experiment one decay of spontaneously fissioning 284Fl was detected at 245-MeV beam energy. In the 240Pu+48Ca experiment three decay chains of 285Fl were detected at 245 MeV and four decays were assigned to 284Fl at the higher 48Ca beam energy of 250 MeV. The α-decay energy of 285Fl was measured for the first time and decay properties of its descendants 281Cn, 277Ds, 273Hs, 269Sg, and 265Rf were determined more precisely. The cross section of the 239Pu(48Ca,3n)284Fl reaction was observed to be about 20 times lower than those predicted by theoretical models and 50 times less than the value measured in the 244Pu+48Ca reaction. The cross sections of the 240Pu(48Ca,4-3n)284,285Fl at both 48Ca energies are similar and exceed that observed in the reaction with lighter isotope 239Pu by a factor of 10. The decay properties of the synthesized nuclei and their production cross sections indicate rapid decrease of stability of superheavy nuclei with departing from the neutron number N=184 predicted to be the next magic number.

  5. Effects of combined exposure of F344 rats to inhaled Plutonium-239 dioxide and a chemical carcinogen (NNK)

    Energy Technology Data Exchange (ETDEWEB)

    Lundgren, D.L.; Carlton, W.W. [Purdue Univ., Lafayette, IN (United States); Griffith, W.C. [and others

    1995-12-01

    Workers in nuclear weapons facilities have a significant potential for exposure to chemical carcinogens and to radiation from external sources or from internally deposited radionuclides such as {sup 239}Pu. Although the carcinogenic effects of inhaled {sup 239}Pu and many chemicals have been studied individually, very little information is available on their combined effects. One chemical carcinogen that workers could be exposed to via tobacco smoke is the tobacco-specific nitrosamine 4-(N-methyl-n-nitrosamino)-1-(3-pyridyl)-1(3-pyridyl)-1-butanone (NNK), a product of tobacco curing and the pyrolysis of nicotine in tobacco. NNK causes lung tumors in rats, regardless of the route of administration and to a lesser extent liver, nasal, and pancreatic tumors. From the results presented, it can be concluded that exposure to a chemical carcinogen (NNK) in combination with {alpha}-particle radiation from inhaled {sup 239}PuO{sub 2} acts in, at best, an additive manner in inducing lung cancer in rats.

  6. Distribution and source of (129)I, (239)(,240)Pu, (137)Cs in the environment of Lithuania.

    Science.gov (United States)

    Ežerinskis, Ž; Hou, X L; Druteikienė, R; Puzas, A; Šapolaitė, J; Gvozdaitė, R; Gudelis, A; Buivydas, Š; Remeikis, V

    2016-01-01

    Fifty five soil samples collected in the Lithuania teritory in 2011 and 2012 were analyzed for (129)I, (137)Cs and Pu isotopes in order to investigate the level and distribution of artificial radioactivity in Lithuania. The activity and atomic ratio of (238)Pu/((239,24)0)Pu, (129)I/(127)I and (131)I/(137)Cs were used to identify the origin of these radionuclides. The (238)Pu/(239+240)Pu and (240)Pu/(239)Pu ratios in the soil samples analyzed varied in the range of 0.02-0.18 and 0.18-0.24, respectively, suggesting the global fallout as the major source of Pu in Lithuania. The values of 10(-9) to 10(-6) for (129)I/(127)I atomic ratio revealed that the source of (129)I in Lithuania is global fallout in most cases though several sampling sites shows a possible impact of reprocessing releases. Estimated (129)I/(131)I ratio in soil samples from the southern part of Lithuania shows negligible input of the Chernobyl fallout. No correlation of the (137)Cs and Pu isotopes with (129)I was observed, indicating their different sources terms. Results demonstrate uneven distribution of these radionuclides in the Lithuanian territory and several sources of contamination i.e. Chernobyl accident, reprocessing releases and global fallout.

  7. Distribution and source of 129I, 239,240Pu, 137Cs in the environment of Lithuania

    DEFF Research Database (Denmark)

    Ezerinskis, Z.; Hou, Xiaolin; Druteikiene, R.;

    2016-01-01

    Fifty five soil samples collected in the Lithuania teritory in 2011 and 2012 were analyzed for 129I, 137Cs and Pu isotopes in order to investigate the level and distribution of artificial radioactivity in Lithuania. The activity and atomic ratio of 238Pu/239,240Pu, 129I/127I and 131I/137Cs were...... used to identify the origin of these radionuclides. The 238Pu/239þ240Pu and 240Pu/239Pu ratios in the soil samples analyzed varied in the range of 0.02e0.18 and 0.18e0.24, respectively, suggesting the global fallout as the major source of Pu in Lithuania. The values of 109 to 106 for 129I/127I atomic...... ratio revealed that the source of 129I in Lithuania is global fallout in most cases though several sampling sites shows a possible impact of reprocessing releases. Estimated 129I/131I ratio in soil samples from the southern part of Lithuania shows negligible input of the Chernobyl fallout...

  8. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  9. Spa therapy for elderly: a retrospective study of 239 older patients with osteoarthritis

    Science.gov (United States)

    Karagülle, Mine; Kardeş, Sinan; Dişçi, Rian; Gürdal, Hatice; Karagülle, Müfit Zeki

    2016-10-01

    Very few studies tested the effectiveness of spa therapy in older patients with osteoarthritis. Therefore, we aimed to evaluate the short-term effects of spa therapy in patients aged 65 years and older with generalized, knee, hip, and cervical and lumbar spine osteoarthritis. In an observational retrospective study design at the Medical Ecology and Hydroclimatology Department of Istanbul Medical Faculty, we analyzed the records of 239 patients aged over 65 years with the diagnosis of all types of osteoarthritis who were prescribed a spa therapy course in some spa resorts in Turkey between 7 March 2002 and 31 December 2012. They travelled to a spa resort where they stayed at a thermal spa hotel and followed the usual therapy packages for 2 weeks. Patients were assessed by an experienced physician within a week before the spa journey and within a week after the completion of the spa therapy. Compared with baseline in whole sample, statistically significant improvements were observed in pain (visual analog scale, VAS), patient and physician global assessments (VAS), Health Assessment Questionnaire disability index (HAQ-DI), Lequesne algofunctional index (LAFI) for knee, Western Ontario and McMaster Universities index (WOMAC), Waddell disability index (WDI), and Neck Pain and Disability Scale (NPAD). According to Outcome Measures in Rheumatology—Osteoarthritis Research Society International (OMERACT-OARSI) Set of Responder Criteria, responder rate were 63.8 % (51/80) in generalized, 52 % (13/25) in knee, 50 % (2/4) in hip, 66.7 % (8/12) in lumbar, and 100 % (6/6) in cervical osteoarthritis subgroups. Spa therapy improved pain and physical functional status in older patients with osteoarthritis, especially generalized osteoarthritis and multiple joint osteoarthritis with involvement of knee. This improvement was clinically important in majority of the patients. To confirm the results of this preliminary study, there is a need of a randomized controlled clinical study

  10. Spa therapy for elderly: a retrospective study of 239 older patients with osteoarthritis

    Science.gov (United States)

    Karagülle, Mine; Kardeş, Sinan; Dişçi, Rian; Gürdal, Hatice; Karagülle, Müfit Zeki

    2016-01-01

    Very few studies tested the effectiveness of spa therapy in older patients with osteoarthritis. Therefore, we aimed to evaluate the short-term effects of spa therapy in patients aged 65 years and older with generalized, knee, hip, and cervical and lumbar spine osteoarthritis. In an observational retrospective study design at the Medical Ecology and Hydroclimatology Department of Istanbul Medical Faculty, we analyzed the records of 239 patients aged over 65 years with the diagnosis of all types of osteoarthritis who were prescribed a spa therapy course in some spa resorts in Turkey between 7 March 2002 and 31 December 2012. They travelled to a spa resort where they stayed at a thermal spa hotel and followed the usual therapy packages for 2 weeks. Patients were assessed by an experienced physician within a week before the spa journey and within a week after the completion of the spa therapy. Compared with baseline in whole sample, statistically significant improvements were observed in pain (visual analog scale, VAS), patient and physician global assessments (VAS), Health Assessment Questionnaire disability index (HAQ-DI), Lequesne algofunctional index (LAFI) for knee, Western Ontario and McMaster Universities index (WOMAC), Waddell disability index (WDI), and Neck Pain and Disability Scale (NPAD). According to Outcome Measures in Rheumatology—Osteoarthritis Research Society International (OMERACT-OARSI) Set of Responder Criteria, responder rate were 63.8 % (51/80) in generalized, 52 % (13/25) in knee, 50 % (2/4) in hip, 66.7 % (8/12) in lumbar, and 100 % (6/6) in cervical osteoarthritis subgroups. Spa therapy improved pain and physical functional status in older patients with osteoarthritis, especially generalized osteoarthritis and multiple joint osteoarthritis with involvement of knee. This improvement was clinically important in majority of the patients. To confirm the results of this preliminary study, there is a need of a randomized controlled clinical study

  11. Comparative genomics and drug resistance of a geographic variant of ST239 methicillin-resistant Staphylococcus aureus emerged in Russia.

    Directory of Open Access Journals (Sweden)

    Tatsuo Yamamoto

    Full Text Available Two distinct classes of methicillin-resistant Staphylococcus aureus (MRSA are spreading in hospitals (as hospital-acquired MRSA, HA-MRSA and in the community (as community-acquired MRSA, CA-MRSA. Multilocus sequence type (ST 239 MRSA, one of the most worldwide-disseminated lineages, has been noted as a representative HA-MRSA. Here, we isolated ST239 MRSA (spa type 3 [t037] and staphylococcal cassette chromosome mec [SCCmec] type III.1.1.1 and its novel variant with ST239/spa351 (t030/SCCmecIII.1.1.4 (SCCmecIII(R not only from hospitals but also from patients with urethritis in the community in Russia. The Russian variant (strain 16K possessed a hybrid genome consisting of CC8 and CC30, similar to the ST239/spa3/SCCmecIII.1.1.1 HA-MRSA (TW20 genome, but with marked diversity. The 16K' CC30 section had SCCmecIII(R carrying the dcs-carrying unit (which corresponded to the SCCmecIVc J3 joining region of ST30 CA-MRSA, lacked SCCmercury, and possessed a novel mobile element structure (MES16K carrying the ccrC-carrying unit (with the recombinase gene ccrC1 allele 3 and drug resistance tranposons. The Russian variant included strains with a high ability to transfer its multiple drug resistance by conjugation; e.g., for strain 16K, the transfer frequency of a chloramphenicol resistance plasmid (p16K-1 with 2.9 kb in size reached 1.4×10(-2, followed by Tn554 conjugative transfer at 3.6×l0(-4. The Russian variant, which has been increasing recently, included divergent strains with different plasmid patterns and pulsed field gel electrophoresis profiles. The data demonstrate the alternative nature of ST239 MRSA as CA-MRSA and also as a drug resistance disseminator, and its micro but dynamic evolution in Russia.

  12. Use of fission track analysis technique for the determination of MicroBequerel level of 239Pu in urine samples from radiation workers handling MOX fuel.

    Science.gov (United States)

    Yadav, J R; Rao, D D; Kumar, Ranjeet; Aggarwal, S K

    2011-07-01

    Fission track analysis (FTA) technique for the determination of (239)Pu excreted through urine has been standardized using blank samples, tracer and (239)Pu spikes. Double stage anion exchange separation protocol has been applied and an average radiochemical recovery of (239)Pu of 18% was obtained. An average track registration efficiency of 11 tracks per μBq of (239)Pu, irradiated to 0.35×10(17) neutron fluence was established. Reagent blank urine samples from 11 controlled subjects were analyzed by FTA and an average of 149±14 tracks was obtained. Minimum detectable activity of 34μBqL(-1) of urine sample was obtained and will be useful for monitoring chronic exposure cases handling MOX fuel.

  13. Carcinogenesis From Inhaled (PuO2)-Pu-239 in Beagles: Evidence for Radiation Homeostasis at Low Doses?

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, Darrell R.; Weller, Richard E.

    2010-09-01

    From the early 1970s to the late 1980s, Pacific Northwest National Laboratory conducted life-span studies in beagle dogs on the biological effects of inhaled plutonium (239PuO2, 238PuO2, and 239Pu[NO3]4) to help predict risks associated with accidental intakes in workers. Years later, the purpose of the present follow-up study is to reassess the dose-response relationship for lung cancer induction in the 239PuO2 dogs compared to controls, with particular focus on the dose-response at low lung doses. A 239PuO2 aerosol (2.3 μm AMAD, 1.9 μm GSD) was administered to six groups of 20 young (18-month old) beagle dogs (10 males and 10 females) by inhalation at six different activity levels, as previously described in Laboratory reports. Control dogs were sham-exposed. In dose level 1, initial pulmonary lung depositions were 130 ± 48 Bq (3.5 ± 1.3 nCi), corresponding to 1 Bq g-1 lung tissue (0.029 ± 0.001 nCi g-1. Groups 2 through 6 received initial lung depositions (mean values) of 760, 2724, 10345, 37900, and 200000 Bq (22, 79, 300, 1100, and 5800 nCi) 239PuO2, respectively. For each dog, the absorbed dose to lungs was calculated from the initial lung burden and the final lung burden at time of death and lung mass, assuming a single, long-term retention function. Insoluble plutonium oxide exhibited long retention times in the lungs. Increased dose-dependent mortality due to lung cancer (bronchiolar-alveolar carcinoma, adenocarcinoma, epidermoid carcinoma) and radiation pneumonitis (highest exposures group) was observed in dogs exposed to 239PuO2. Calculated lung doses ranged from a few cGy in early-sacrificed dogs to 7764 cGy in dogs that experienced early deaths from radiation pneumonitis. Data were regrouped by lifetime lung dose and plotted as a function of lung tumor incidence. Lung tumor incidence in controls and zero-dose exposed dogs was 18% (5/28). However, no lung tumors were observed in 16 dogs with the lowest lung doses (8 to 22 cGy, mean 14.4 ± 7.6 c

  14. Plutonium Isotopes ((239-241)Pu) Dissolved in Pacific Ocean Waters Detected by Accelerator Mass Spectrometry: No Effects of the Fukushima Accident Observed.

    Science.gov (United States)

    Hain, Karin; Faestermann, Thomas; Fimiani, Leticia; Golser, Robin; Gómez-Guzmán, José Manuel; Korschinek, Gunther; Kortmann, Florian; Lierse von Gostomski, Christoph; Ludwig, Peter; Steier, Peter; Tazoe, Hirofumi; Yamada, Masatoshi

    2017-02-21

    The concentration of plutonium (Pu) and the isotopic ratios of (240)Pu to (239)Pu and (241)Pu to (239)Pu were determined by accelerator mass spectrometry (AMS) in Pacific Ocean water samples (20 L each) collected in late 2012. The isotopic Pu ratios are important indicators of different contamination sources and were used to identify a possible release of Pu into the ocean by the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. In particular, (241)Pu is a well-suited indicator for a recent entry of Pu because (241)Pu from fallout of nuclear weapon testings has already significantly decayed. A total of 10 ocean water samples were prepared at the Radiochemie München of the TUM and analyzed at the Vienna Environmental Research Laboratory (VERA). Several samples showed a slightly elevated (240)Pu/(239)Pu ratio of up to 0.22 ± 0.02 compared to global fallout ((240)Pu/(239)Pu = 0.180 ± 0.007), whereas all measured (241)Pu-to-(239)Pu ratios were consistent with nuclear weapon fallout ((241)Pu/(239)Pu < 2.4 × 10(-3)), which means that no impact from the Fukushima accident was detected. From the average (241)Pu-to-(239)Pu ratio of 8-2(+3) ×10(-4) at a sampling station located at a distance of 39.6 km to FDNPP, the 1-σ upper limit for the FDNPP contribution to the (239)Pu inventory in the water column was estimated to be 0.2%. Pu, with the signature of weapon-grade Pu was found in a single sample collected around 770 km off the west coast of the United States.

  15. 29 CFR 779.239 - Meaning of “engaged in commerce or in the production of goods for commerce.”

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Meaning of âengaged in commerce or in the production of goods for commerce.â 779.239 Section 779.239 Labor Regulations Relating to Labor (Continued) WAGE AND... commerce or in the production of goods for commerce.” The term “engaged in commerce or in the production...

  16. Time-resolved record of (236)U and (239,240)Pu isotopes from a coral growing during the nuclear testing program at Enewetak Atoll (Marshall Islands).

    Science.gov (United States)

    Froehlich, M B; Chan, W Y; Tims, S G; Fallon, S J; Fifield, L K

    2016-12-01

    A comprehensive series of nuclear tests were carried out by the United States at Enewetak Atoll in the Marshall Islands, especially between 1952 and 1958. A Porites Lutea coral that was growing in the Enewetak lagoon within a few km of all of the high-yield tests contains a continuous record of isotopes, which are of interest (e.g. (14)C, (236)U, (239,240)Pu) through the testing period. Prior to the present work, (14)C measurements at ∼2-month resolution had shown pronounced peaks in the Δ(14)C data that coincided with the times at which tests were conducted. Here we report measurements of (236)U and (239,240)Pu on the same coral using accelerator mass spectrometry, and again find prominent peaks in the concentrations of these isotopes that closely follow those in (14)C. Consistent with the (14)C data, the magnitudes of these peaks do not, however, correlate well with the explosive yields of the corresponding tests, indicating that smaller tests probably contributed disproportionately to the debris that fell in the lagoon. Additional information about the different tests can also be obtained from the (236)U/(239)Pu and (240)Pu/(239)Pu ratios, which are found to vary dramatically over the testing period. In particular, the first thermonuclear test, Ivy-Mike, has characteristic (236)U/(239)Pu and (240)Pu/(239)Pu signatures which are diagnostic of the first arrival of nuclear test material in various archives.

  17. Comparison of 241Am, (239,240)Pu and 137Cs concentrations in soil around rocky flats.

    Science.gov (United States)

    Hulse, S E; Ibrahim, S A; Whicker, F W; Chapman, P L

    1999-03-01

    Gamma spectroscopy measurements were used to estimate concentrations of 241Am and 137Cs in soil profiles to depths of 21 cm at on-site and off-site locations around the Rocky Flats Environmental Technology Site and at regional background locations east of the Front Range between Colorado's borders with New Mexico and Wyoming. Concentrations of these radionuclides were compared with concentrations of (239,240)Pu in the same samples. Concentrations of 241Am in soil from depths of 0 to 3 cm decreased in an easterly direction from more than 5.3 kBq kg(-1) near the 903 pad to background levels of 1.3 Bq kg(-1) 5 to 7 km away at a rate that was nearly proportional to the inverse square of distance. Deposits of 137Cs were ubiquitous, averaging 0.12 kBq kg(-1) in soil from depths of 0 to 3 cm, but were unevenly distributed around Rocky Flats and the regional background locations. Deviations from the uniform exponential rate at which soil concentrations of 137Cs typically decreased with depth, -0.25 cm(-1) at undisturbed sites, enabled us to determine that about 10% of our sampling sites had been disturbed by erosion, tillage, or other factors. The mean rate at which (239,240)Pu decreased with depth was about the same, -0.23 cm(-1), throughout the study area. Soil concentrations of 241Am decreased with depth at a similar mean rate of -0.22 cm(-1) at locations close to the 903 pad where measurements were robust. Ratios between 241Am or (239,240)Pu and 137Cs proved more useful for delineating the extent and pattern of contamination from Rocky Flats than did activity concentrations in soil.

  18. Reactor Decay Heat in 239Pu: Solving the Gamma Discrepancy in the 4–3000-s Cooling Period

    Energy Technology Data Exchange (ETDEWEB)

    Algora, A.; Sonzogni, A.; Algora,A.; Jordan,D.; Tain,J.L.; Rubio,B.; Agramunt,J.; Perez-Cerdan,A.B.; Molina,F; Caballero,L.; Nacher,E.; Krasznahorkay,A.; Hunyadi,M.D.; Gulyas,J; Vitez,A.; Csatlos,M.; Csige,L.; Aysto,J.; Penttila,H.; Moore,I.D.; Eronen,T.; Jokinen,A.; Nieminen,A.; Hakala,J.; Karvonen,P.; Kankainen,A.; Saastamoinen,A.; Rissanen,J.; Kessler,T.; Weber,C.; Ronkainen,J.; Rahaman,S.; Elomaa,V.; Rinta-Antila,S.; Hager,U.; Sonoda,T.; Burkard,K.; Huller,W.; Batist,L.; Gelletly,W.; Nichols,A.L.; Yoshida,T.; Sonzogni,A.A.; Perajarvi,K.

    2010-11-08

    The {beta} feeding probability of {sup 102,104,105,106,107}Tc, {sup 105}Mo, and {sup 101}Nb nuclei, which are important contributors to the decay heat in nuclear reactors, has been measured using the total absorption technique. We have coupled for the first time a total absorption spectrometer to a Penning trap in order to obtain sources of very high isobaric purity. Our results solve a significant part of a long-standing discrepancy in the {gamma} component of the decay heat for {sup 239}Pu in the 4-3000 s range.

  19. Commentary on inhaled {sup 239}PuO{sub 2} in dogs - a prophylaxis against lung cancer?

    Energy Technology Data Exchange (ETDEWEB)

    Cuttler, J.M. [Cuttler and Assoc., Vaughan, Ontario (Canada); Feinendegen, L. [Brookhaven National Laboratories, Upton, New York (United States)

    2015-06-15

    Several studies on the effect of inhaled plutonium-dioxide particulates and the incidence of lung tumors in dogs reveal beneficial effects when the cumulative alpha-radiation dose is low. There is a threshold at an exposure level of about 100 cGy for excess tumor incidence and reduced lifespan. The observations conform to the expectations of the radiation hormesis dose-response model and contradict the predictions of the Linear No-Threshold (LNT) hypothesis. These studies suggest investigating the possibility of employing low-dose alpha-radiation, such as from {sup 239}PuO {sub 2} inhalation, as a prophylaxis against lung cancer. (author)

  20. First measurements of (236)U concentrations and (236)U/(239)Pu isotopic ratios in a Southern Hemisphere soil far from nuclear test or reactor sites.

    Science.gov (United States)

    Srncik, M; Tims, S G; De Cesare, M; Fifield, L K

    2014-06-01

    The variation of the (236)U and (239)Pu concentrations as a function of depth has been studied in a soil profile at a site in the Southern Hemisphere well removed from nuclear weapon test sites. Total inventories of (236)U and (239)Pu as well as the (236)U/(239)Pu isotopic ratio were derived. For this investigation a soil core from an undisturbed forest area in the Herbert River catchment (17°30' - 19°S) which is located in north-eastern Queensland (Australia) was chosen. The chemical separation of U and Pu was carried out with a double column which has the advantage of the extraction of both elements from a relatively large soil sample (∼20 g) within a day. The samples were measured by Accelerator Mass Spectrometry using the 14UD pelletron accelerator at the Australian National University. The highest atom concentrations of both (236)U and (239)Pu were found at a depth of 2-3 cm. The (236)U/(239)Pu isotopic ratio in fallout at this site, as deduced from the ratio of the (236)U and (239)Pu inventories, is 0.085 ± 0.003 which is clearly lower than the Northern Hemisphere value of ∼0.2. The (236)U inventory of (8.4 ± 0.3) × 10(11) at/m(2) was more than an order of magnitude lower than values reported for the Northern Hemisphere. The (239)Pu activity concentrations are in excellent agreement with a previous study and the (239+240)Pu inventory was (13.85 ± 0.29) Bq/m(2). The weighted mean (240)Pu/(239)Pu isotopic ratio of 0.142 ± 0.005 is slightly lower than the value for global fallout, but our results are consistent with the average ratio of 0.173 ± 0.027 for the southern equatorial region (0-30°S).

  1. Neuropathological and clinical phenotype of an Italian Alzheimer family with M239V mutation of presenilin 2 gene.

    Science.gov (United States)

    Marcon, Gabriella; Giaccone, Giorgio; Cupidi, Chiara; Balestrieri, Matteo; Beltrami, Carlo Alberto; Finato, Nicoletta; Bergonzi, Paolo; Sorbi, Sandro; Bugiani, Orso; Tagliavini, Fabrizio

    2004-03-01

    Presenilin 1 and 2 are 2 highly homologous genes involved in familial Alzheimer disease. While more than 100 mutations in presenilin 1 are known to segregate with the disease in familial Alzheimer disease, only 9 mutations of presenilin 2 have been identified to date. We report the clinical and neuropathological phenotype of FLO10, the large Italian Alzheimer kindred associated with methionine to valine substitution at residue 239 of presenilin 2. The patients showed a remarkable variability in age of onset of symptoms, disease duration, and clinical presentation. The neuropathological study of 2 patients revealed peculiar features in addition to neurofibrillary changes and A beta amyloid deposits in the neuropil and vessel wall. Ectopic neurons in the subcortical white matter, often containing neurofibrillary tangles, were found in both patients, one of whom presented with epilepsy. Furthermore, 1 patient showed an unusually high number of ghost tangles in the cerebral cortex. These observations indicate that the Alzheimer kindred FLO10 associated with M239V mutation of presenilin 2 is characterized by some peculiarities of the clinical and neuropathologic phenotype compared to sporadic Alzheimer disease.

  2. A modelling study on {sup 137}Cs and {sup 239,240}Pu behaviour in the Alboran Sea, western Mediterranean

    Energy Technology Data Exchange (ETDEWEB)

    Perianez, R. [Departamento Fisica Aplicada I, E.U. Ingenieria Tecnica Agricola, Universidad de Sevilla, Ctra., Utrera km 1, 41013 Sevilla (Spain)], E-mail: rperianez@us.es

    2008-04-15

    A model for simulating the dispersion processes of {sup 137}Cs and {sup 239,240}Pu in the Alboran Sea is described. The model consists of two hydrodynamic models: a 2D depth-averaged model and a two-layer model which provide tidal and geostrophic currents, respectively; a sediment transport model which provides suspended particle concentrations and sedimentation rates over the domain; and the radionuclide dispersion model including interactions of dissolved radionuclides with suspended particles and bed sediments. These processes are formulated using kinetic transfer coefficients. The hydrodynamic and sediment models are run and validated in advance, and their results are then used to simulate the dispersion of {sup 137}Cs and {sup 239,240}Pu, which are introduced from atmospheric fallout. Radionuclide concentrations in the water column and distributions in bed sediments have been compared with measurements in the sea. Both set of data are, in general, in agreement. The model has also been applied to calculate radionuclide fluxes through the Strait of Gibraltar. These computed fluxes have been compared with previous estimations as well.

  3. A generalized method for characterization of 235U and 239Pu content using short-lived fission product gamma spectroscopy

    Science.gov (United States)

    Knowles, Justin; Skutnik, Steven; Glasgow, David; Kapsimalis, Roger

    2016-10-01

    Rapid nondestructive assay methods for trace fissile material analysis are needed in both nuclear forensics and safeguards communities. To address these needs, research at the Oak Ridge National Laboratory High Flux Isotope Reactor Neutron Activation Analysis facility has developed a generalized nondestructive assay method to characterize materials containing fissile isotopes. This method relies on gamma-ray emissions from short-lived fission products and makes use of differences in fission product yields to identify fissile compositions of trace material samples. Although prior work has explored the use of short-lived fission product gamma-ray measurements, the proposed method is the first to provide a complete characterization of isotopic identification, mass ratios, and absolute mass determination. Successful single fissile isotope mass recoveries of less than 6% recovery bias have been conducted on standards of 235U and 239Pu as low as 12 ng in less than 10 minutes. Additionally, mixtures of fissile isotope standards containing 235U and 239Pu have been characterized as low as 198 ng of fissile mass with less than 7% recovery bias. The generalizability of this method is illustrated by evaluating different fissile isotopes, mixtures of fissile isotopes, and two different irradiation positions in the reactor. It is anticipated that this method will be expanded to characterize additional fissile nuclides, utilize various irradiation facilities, and account for increasingly complex sample matrices.

  4. 242Pu as tracer for simultaneous determination of 237Np and 239,240Pu in environmental samples

    DEFF Research Database (Denmark)

    Chen, Q.J.; Dahlgaard, H.; Nielsen, S.P.;

    2002-01-01

    A procedure has been developed using Pu-242 as tracer for simultaneous determination of Np-237 and Pu-239,Pu-240 in environmental samples. The validity of the method has been demonstrated by ICPMS and alpha-spectroscopy for up to 10 gram soil and sediment, seawater up to 200 litres. The paper...... describes a suitable chemical procedure for Np and Pu including a quantitative pre-concentration of neptunium and plutonium, preparation of Np4+ and Pu4+, NP(NO3)(6)(2-) and Pu(NO3)(6)(2-), The ratio of Np-237/Pu-242 (or Np-237/Pu-239) before and after the procedure has been determined using 10 g soil (free...... from Np and Pu) R-before/R-after = 1.004 +/- 3.3% (S.D n = 20) and 1 litre seawater R-before/R-after = 1.019+/-1.9% (S.D., n = 12). Results from the intercomparison samples LAEA-135, LAEA-381 and from environmental samples are presented....

  5. Migration of (137)Cs, (90)Sr, and (239+240)Pu in Mediterranean forests: influence of bioavailability and association with organic acids in soil.

    Science.gov (United States)

    Guillén, J; Baeza, A; Corbacho, J A; Muñoz-Muñoz, J G

    2015-06-01

    The understanding of downward migration of anthropogenic radionuclides in soil is a key factor in the assessment of their environmental behavior. There are several factors that can affect this process, such as the radionuclide source, their chemical form, soil and environmental characteristics, etc. Two Mediterranean pinewood ecosystems in Spain, which were affected mainly by global fallout, were selected to assess the migration of (137)Cs, (90)Sr, and (239+240)Pu. Using auxiliary modeling (diffusion-convection equation and compartmental model), it followed from field observations that the migration velocities of (90)Sr and (239+240)Pu were similar and higher than that of (137)Cs. The downward migration of radionuclides can be considered a consequence of their association with soil particles. A sequential speciation procedure also confirmed that (90)Sr was the most bioavailable radionuclide followed by (239+240)Pu and (137)Cs. Although this can explain the different velocity of (90)Sr and (137)Cs, bioavailability could not explain by itself the similar velocities of (239+240)Pu and (90)Sr. The presence of organic acids in the soil can also influence the migration of radionuclides attached to them, which decreased in the order: (239+240)Pu > (90)Sr > (137)Cs. Thus, the joint consideration of bioavailable and humic + fulvic acid fractions can explain the observed differences in the downward velocities.

  6. Fission Product Yields of 233U, 235U, 238U and 239Pu in Fields of Thermal Neutrons, Fission Neutrons and 14.7-MeV Neutrons

    Science.gov (United States)

    Laurec, J.; Adam, A.; de Bruyne, T.; Bauge, E.; Granier, T.; Aupiais, J.; Bersillon, O.; Le Petit, G.; Authier, N.; Casoli, P.

    2010-12-01

    The yields of more than fifteen fission products have been carefully measured using radiochemical techniques, for 235U(n,f), 239Pu(n,f) in a thermal spectrum, for 233U(n,f), 235U(n,f), and 239Pu(n,f) reactions in a fission neutron spectrum, and for 233U(n,f), 235U(n,f), 238U(n,f), and 239Pu(n,f) for 14.7 MeV monoenergetic neutrons. Irradiations were performed at the EL3 reactor, at the Caliban and Prospero critical assemblies, and at the Lancelot electrostatic accelerator in CEA-Valduc. Fissions were counted in thin deposits using fission ionization chambers. The number of fission products of each species were measured by gamma spectrometry of co-located thick deposits.

  7. Soluble guanylyl cyclase-activated cyclic GMP-dependent protein kinase inhibits arterial smooth muscle cell migration independent of VASP-serine 239 phosphorylation.

    Science.gov (United States)

    Holt, Andrew W; Martin, Danielle N; Shaver, Patti R; Adderley, Shaquria P; Stone, Joshua D; Joshi, Chintamani N; Francisco, Jake T; Lust, Robert M; Weidner, Douglas A; Shewchuk, Brian M; Tulis, David A

    2016-09-01

    Coronary artery disease (CAD) accounts for over half of all cardiovascular disease-related deaths. Uncontrolled arterial smooth muscle (ASM) cell migration is a major component of CAD pathogenesis and efforts aimed at attenuating its progression are clinically essential. Cyclic nucleotide signaling has long been studied for its growth-mitigating properties in the setting of CAD and other vascular disorders. Heme-containing soluble guanylyl cyclase (sGC) synthesizes cyclic guanosine monophosphate (cGMP) and maintains vascular homeostasis predominantly through cGMP-dependent protein kinase (PKG) signaling. Considering that reactive oxygen species (ROS) can interfere with appropriate sGC signaling by oxidizing the cyclase heme moiety and so are associated with several CVD pathologies, the current study was designed to test the hypothesis that heme-independent sGC activation by BAY 60-2770 (BAY60) maintains cGMP levels despite heme oxidation and inhibits ASM cell migration through phosphorylation of the PKG target and actin-binding vasodilator-stimulated phosphoprotein (VASP). First, using the heme oxidant ODQ, cGMP content was potentiated in the presence of BAY60. Using a rat model of arterial growth, BAY60 significantly reduced neointima formation and luminal narrowing compared to vehicle (VEH)-treated controls. In rat ASM cells BAY60 significantly attenuated cell migration, reduced G:F actin, and increased PKG activity and VASP Ser239 phosphorylation (pVASP·S239) compared to VEH controls. Site-directed mutagenesis was then used to generate overexpressing full-length wild type VASP (FL-VASP/WT), VASP Ser239 phosphorylation-mimetic (FL-VASP/239D) and VASP Ser239 phosphorylation-resistant (FL-VASP/239A) ASM cell mutants. Surprisingly, FL-VASP/239D negated the inhibitory effects of FL-VASP/WT and FL-VASP/239A cells on migration. Furthermore, when FL-VASP mutants were treated with BAY60, only the FL-VASP/239D group showed reduced migration compared to its VEH controls

  8. The APETALA-2-like transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice.

    Directory of Open Access Journals (Sweden)

    Mahmoud W Yaish

    2010-09-01

    Full Text Available The interaction between phytohormones is an important mechanism which controls growth and developmental processes in plants. Deciphering these interactions is a crucial step in helping to develop crops with enhanced yield and resistance to environmental stresses. Controlling the expression level of OsAP2-39 which includes an APETALA 2 (AP2 domain leads to phenotypic changes in rice. Overexpression of OsAP2-39 leads to a reduction in yield by decreasing the biomass and the number of seeds in the transgenic rice lines. Global transcriptome analysis of the OsAP2-39 overexpression transgenic rice revealed the upregulation of a key abscisic acid (ABA biosynthetic gene OsNCED-I which codes for 9-cis-epoxycarotenoid dioxygenase and leads to an increase in the endogenous ABA level. In addition to OsNCED-1, the gene expression analysis revealed the upregulation of a gene that codes for the Elongation of Upper most Internode (EUI protein, an enzyme that catalyzes 16α, 17-epoxidation of non-13-hydroxylated GAs, which has been shown to deactivate gibberellins (GAs in rice. The exogenous application of GA restores the wild-type phenotype in the transgenic line and ABA application induces the expression of EUI and suppresses the expression of OsAP2-39 in the wild-type line. These observations clarify the antagonistic relationship between ABA and GA and illustrate a mechanism that leads to homeostasis of these hormones. In vivo and in vitro analysis showed that the expression of both OsNCED-1 and EUI are directly controlled by OsAP2-39. Together, these results reveal a novel mechanism for the control of the ABA/GA balance in rice which is regulated by OsAP2-39 that in turn regulates plant growth and seed production.

  9. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation; Accion EURADOS para la determinacion de americio en craneo mediante medidas in-vivo y simulacion Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ponte, M. A.; Navarro Amaro, J. F.; Perez Lopez, B.; Navarro Bravo, T.; Nogueira, P.; Vrba, T.

    2013-07-01

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  10. Generation of neutralizing antibodies and divergence of SIVmac239 in cynomolgus macaques following short-term early antiretroviral therapy.

    Directory of Open Access Journals (Sweden)

    Gülşen Ozkaya Sahin

    Full Text Available Neutralizing antibodies (NAb able to react to heterologous viruses are generated during natural HIV-1 infection in some individuals. Further knowledge is required in order to understand the factors contributing to induction of cross-reactive NAb responses. Here a well-established model of experimental pathogenic infection in cynomolgus macaques, which reproduces long-lasting HIV-1 infection, was used to study the NAb response as well as the viral evolution of the highly neutralization-resistant SIVmac239. Twelve animals were infected intravenously with SIVmac239. Antiretroviral therapy (ART was initiated ten days post-inoculation and administered daily for four months. Viral load, CD4(+ T-cell counts, total IgG levels, and breadth as well as strength of NAb in plasma were compared simultaneously over 14 months. In addition, envs from plasma samples were sequenced at three time points in all animals in order to assess viral evolution. We report here that seven of the 12 animals controlled viremia to below 10(4 copies/ml of plasma after discontinuation of ART and that this control was associated with a low level of evolutionary divergence. Macaques that controlled viral load developed broader NAb responses early on. Furthermore, escape mutations, such as V67M and R751G, were identified in virus sequenced from all animals with uncontrolled viremia. Bayesian estimation of ancestral population genetic diversity (PGD showed an increase in this value in non-controlling or transient-controlling animals during the first 5.5 months of infection, in contrast to virus-controlling animals. Similarly, non- or transient controllers displayed more positively-selected amino-acid substitutions. An early increase in PGD, resulting in the generation of positively-selected amino-acid substitutions, greater divergence and relative high viral load after ART withdrawal, may have contributed to the generation of potent NAb in several animals after SIVmac239 infection

  11. Americium behaviour in plastic vessels

    Energy Technology Data Exchange (ETDEWEB)

    Legarda, F.; Herranz, M. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Idoeta, R., E-mail: raquel.idoeta@ehu.e [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Abelairas, A. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain)

    2010-07-15

    The adsorption of {sup 241}Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of {sup 241}Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of {sup 241}Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  12. Subchronic inhalation of carbon tetrachloride alters the tissue retention of acutely inhaled plutonium-239 nitrate in F344 rats and syrian golden hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Benson, J.M.; Barr, E.B.; Lundgren, D.L. [and others

    1995-12-01

    Carbon tetrachloride (CCl{sub 4}) has been used extensively in the nuclear weapons industry, so it is likely that nuclear plant workers have been exposed to both CCl{sub 4} and plutonium compounds. Future exposures may occur during {open_quotes}cleanup{close_quotes} operations at weapons productions sites such as the Hanford, Washington, and Rocky Flats, Colorado, facilities. Inhalation of 20 and 100 ppm CCl{sub 4} by hamsters reduces uptake of {sup 239}Pu solubilized from lung, shunting the {sup 239}Pu to the skeleton.

  13. Applicability of 239Pu as a tracer for soil erosion in the wet-dry tropics of northern Australia

    Science.gov (United States)

    Lal, R.; Tims, S. G.; Fifield, L. K.; Wasson, R. J.; Howe, D.

    2013-01-01

    The technique of accelerator mass spectroscopy (AMS) has been employed to determine modern soil loss rates through the analysis of 239Pu profiles in soil cores from the Daly basin in Northern Territory, Australia. In areas in which soil conservation banks were not present or were only added recently (soil loss rates over the past ∼50 years were 7.5-19.5 t ha-1 a-1. The measured rates are up to 5 times higher compared to agricultural and uncultivated areas within soil conservation banks in other parts of the catchment. High intensity seasonal rainfall combined with reduction in land cover due to grazing and episodic bush fires are primary factors influencing erosion although other impacts on the landscape such as tillage generated runoff and land clearing seem to be responsible for accelerated sediment production.

  14. Applicability of {sup 239}Pu as a tracer for soil erosion in the wet-dry tropics of northern Australia

    Energy Technology Data Exchange (ETDEWEB)

    Lal, R., E-mail: rajeev.lal@anu.edu.au [Department of Nuclear Physics, Research School of Physics and Engineering, Australian National University, Canberra, ACT 0200 (Australia); Tims, S.G.; Fifield, L.K. [Department of Nuclear Physics, Research School of Physics and Engineering, Australian National University, Canberra, ACT 0200 (Australia); Wasson, R.J.; Howe, D. [Charles Darwin University, Darwin, NT 0810 (Australia)

    2013-01-15

    The technique of accelerator mass spectroscopy (AMS) has been employed to determine modern soil loss rates through the analysis of {sup 239}Pu profiles in soil cores from the Daly basin in Northern Territory, Australia. In areas in which soil conservation banks were not present or were only added recently (<25a) and which had a history of grazing and cultivation the measured soil loss rates over the past {approx}50 years were 7.5-19.5 t ha{sup -1} a{sup -1}. The measured rates are up to 5 times higher compared to agricultural and uncultivated areas within soil conservation banks in other parts of the catchment. High intensity seasonal rainfall combined with reduction in land cover due to grazing and episodic bush fires are primary factors influencing erosion although other impacts on the landscape such as tillage generated runoff and land clearing seem to be responsible for accelerated sediment production.

  15. Alpha and conversion electron spectroscopy of 238,239Pu and 241Am and alpha-conversion electron coincidence measurements

    Energy Technology Data Exchange (ETDEWEB)

    Dion, Michael P.; Miller, Brian W.; Warren, Glen A.

    2016-09-01

    A technique to determine the isotopics of a mixed actinide sample has been proposed by measuring the coincidence of the alpha particle during radioactive decay with the conversion electron (or Auger) emitted during the relaxation of the daughter isotope. This presents a unique signature to allow the deconvolution of isotopes that possess overlapping alpha particle energy. The work presented here are results of conversion electron spectroscopy of 241Am, 238Pu and 239Pu using a dual-stage peltier-cooled 25 mm2 silicon drift detector. A passivated ion implanted planar silicon detector provided measurements of alpha spectroscopy. The conversion electron spectra were evaluated from 20–55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information to aid in the coincident measurement approach.

  16. Performance Study of RS (255, 239 and RS (255.233 Used Respectively in DVB-T and NASA

    Directory of Open Access Journals (Sweden)

    Hajri Abdesslam

    2016-11-01

    Full Text Available The error correction codes have a wide range of applications in digital communication (satellite, wireless and digital data storage. This paper presents a comparative study of performance between RS (255, 239 and RS (255.233 used respectively in the Digital Video Broadcasting – Terrestrial (DVB-T and National Aeronautics and Space Administration (NASA. The performances were evaluated by applying modulation scheme in additive white Gaussian noise (AWGN channel. Performances of modulation with RS codes are evaluated in bit error rate (BER and signal energy -to- noise power density ratio (Eb / No. The analysis is studied with the help of MATLAB simulator to analyze a communication link with AWGN Channel, and different modulations.

  17. Fission fragment charge and mass distributions in 239Pu(n,f) in the adiabatic nuclear energy density functional theory

    CERN Document Server

    Regnier, D; Schunck, N; Verriere, M

    2016-01-01

    Accurate knowledge of fission fragment yields is an essential ingredient of numerous applications ranging from the formation of elements in the r-process to fuel cycle optimization for nuclear energy. The need for a predictive theory applicable where no data is available is an incentive to develop a fully microscopic approach to fission dynamics. In this work, we calculate the pre-neutron emission charge and mass distributions of the fission fragments formed in the neutron-induced fission of 239Pu using a microscopic method based on nuclear energy density functional (EDF) method, where large amplitude collective motion is treated adiabatically using the time dependent generator coordinate method (TDGCM) under the Gaussian overlap approximation (GOA). Fission fragment distributions are extracted from the flux of the collective wave packet through the scission line. We find that the main characteristics of the fission charge and mass distributions can be well reproduced by existing energy functionals even in tw...

  18. Evaluating the 239Pu Prompt Fission Neutron Spectrum Induced by Thermal to 30 MeV Neutrons

    Science.gov (United States)

    Neudecker, D.; Talou, P.; Kawano, T.; Kahler, A. C.; Rising, M. E.; White, M. C.

    2016-03-01

    We present a new evaluation of the 239Pu prompt fission neutron spectrum (PFNS) induced by thermal to 30 MeV neutrons. Compared to the ENDF/B-VII.1 evaluation, this one includes recently published experimental data as well as an improved and extended model description to predict PFNS. For instance, the pre-equilibrium neutron emission component to the PFNS is considered and the incident energy dependence of model parameters is parametrized more realistically. Experimental and model parameter uncertainties and covariances are estimated in detail. Also, evaluated covariances are provided between all PFNS at different incident neutron energies. Selected evaluation results and first benchmark calculations using this evaluation are briefly discussed.

  19. References to Studies of 137Cs, 90Sr and 239+240Pu in the Pacific Ocean a Bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V.E.

    2001-02-01

    This report contains a listing of publications known to this author on reported concentrations, reviews and discussions of {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu in seawater, sediment and the biota from parts of the North and South Pacific Ocean. Each reference has been assigned an accession number consisting of the first three letters of the first author's last name followed by the first letter of the first name, the year of the publication and an assigned number. Studies in both the coastal areas and the open ocean are included as well as those providing data within lagoons of coral atolls. Some references to the radionuclides in the Indian Ocean are also provided.

  20. Evaluating the 239Pu Prompt Fission Neutron Spectrum Induced by Thermal to 30 MeV Neutrons

    Directory of Open Access Journals (Sweden)

    Neudecker D.

    2016-01-01

    Full Text Available We present a new evaluation of the 239Pu prompt fission neutron spectrum (PFNS induced by thermal to 30 MeV neutrons. Compared to the ENDF/B-VII.1 evaluation, this one includes recently published experimental data as well as an improved and extended model description to predict PFNS. For instance, the pre-equilibrium neutron emission component to the PFNS is considered and the incident energy dependence of model parameters is parametrized more realistically. Experimental and model parameter uncertainties and covariances are estimated in detail. Also, evaluated covariances are provided between all PFNS at different incident neutron energies. Selected evaluation results and first benchmark calculations using this evaluation are briefly discussed.

  1. Polonium 210Po, uranium (234U, 238U and plutonium (238Pu, 239+240Pu bioaccumulation in marine birds

    Directory of Open Access Journals (Sweden)

    Strumińska-Parulska D. I.

    2013-04-01

    Full Text Available The aim of this work was the determination of 210Po, 234U, 238U, 238Pu and 239+240Pu concentration in marine birds which permanently or temporally live in the southern Baltic Sea coast. We chose 11 species of seabirds: three species permanently residing at southern Baltic Sea, four species of wintering birds and three species of migrating birds. The results show that analyzed radionuclides are non-uniformly distributed in the marine birds. The highest activities of 210Po were observed in feathers, muscles and liver. The highest uranium content was found in liver, rest of viscera and feathers, while plutonium in the digestion organs and feathers. Omnivore seabirds accumulated more polonium, plutonium than species that feed on fish, while herbivore seabirds accumulated more uranium than carnivore.

  2. Fission Product Yield Study of 235U, 238U and 239Pu Using Dual-Fission Ionization Chambers

    Science.gov (United States)

    Bhatia, C.; Fallin, B.; Howell, C.; Tornow, W.; Gooden, M.; Kelley, J.; Arnold, C.; Bond, E.; Bredeweg, T.; Fowler, M.; Moody, W.; Rundberg, R.; Rusev, G.; Vieira, D.; Wilhelmy, J.; Becker, J.; Macri, R.; Ryan, C.; Sheets, S.; Stoyer, M.; Tonchev, A.

    2014-05-01

    To resolve long-standing differences between LANL and LLNL regarding the correct fission basis for analysis of nuclear test data [M.B. Chadwick et al., Nucl. Data Sheets 111, 2891 (2010); H. Selby et al., Nucl. Data Sheets 111, 2891 (2010)], a collaboration between TUNL/LANL/LLNL has been established to perform high-precision measurements of neutron induced fission product yields. The main goal is to make a definitive statement about the energy dependence of the fission yields to an accuracy better than 2-3% between 1 and 15 MeV, where experimental data are very scarce. At TUNL, we have completed the design, fabrication and testing of three dual-fission chambers dedicated to 235U, 238U, and 239Pu. The dual-fission chambers were used to make measurements of the fission product activity relative to the total fission rate, as well as for high-precision absolute fission yield measurements. The activation method was employed, utilizing the mono-energetic neutron beams available at TUNL. Neutrons of 4.6, 9.0, and 14.5 MeV were produced via the 2H(d,n)3He reaction, and for neutrons at 14.8 MeV, the 3H(d,n)4He reaction was used. After activation, the induced γ-ray activity of the fission products was measured for two months using high-resolution HPGe detectors in a low-background environment. Results for the yield of seven fission fragments of 235U, 238U, and 239Pu and a comparison to available data at other energies are reported. For the first time results are available for neutron energies between 2 and 14 MeV.

  3. Historical changes in 239Pu and 240Pu sources in sedimentary records in the East China Sea: Implications for provenance and transportation

    DEFF Research Database (Denmark)

    Wang, Jinlong; Baskaran, Mark; Hou, Xiaolin

    2017-01-01

    Concentrations and isotopic compositions of plutonium (Pu) are widely used for its source identification and to determine transport processes of Pu-associated particulate matter and water. We investigated the concentrations of 239Pu and 240Pu and their ratios in a number of sediment samples from...

  4. Resolving Nevada Test Site and global fallout plutonium in attic dust and soils using [sup 137]Cs/[sup 239+240]Pu activity ratios

    Energy Technology Data Exchange (ETDEWEB)

    Cizdziel, J. (Univ. of Nevada, Reno, NV (United States)); Hodge, V. (Univ. of Nevada, Las Vegas, NV (United States). Dept. of Chemistry); Faller, S. (Environmental Protection Agency, Las Vegas, NV (United States). Radiation and Indoor Environments National Lab.)

    1999-07-01

    A simple equation using only [sup 137]Cs/[sup 239+240]Pu activity ratios was developed and evaluated as a means of resolving the plutonium in attic dust and soil from Nevada and Utah that came from Nevada Test Site fallout from that which came from global fallout. Applied to a historical data set of [sup 137]Cs and [sup 239+240]Pu activity concentrations in soils from Nevada and Utah, the activity ratio method gives results similar to the traditional [sup 240]Pu/[sup 239]Pu isotope mass ratio method. Considering the difficulty and expense of determining the [sup 240]Pu/[sup 239]Pu atom ratios, this activity ratio method is simpler, faster, and less costly, and may be useful for detecting and/or monitoring plutonium contamination in soils. Applied to samples of attic dust and soil collected from throughout southern Nevada and Utah during 1996 and 1997, it was found that all sites surveyed showed the presence of Nevada Test Site plutonium. Over 90% of the plutonium found in the samples from Beatty, Tonopah, and Queen City Summit, Nevada can be attributed to the Nevada Test Site.

  5. Comparison of cytotoxic and genotoxic effects of plutonium-239 alpha particles and mobile phone GSM 900 radiation in the Allium cepa test.

    Science.gov (United States)

    Pesnya, Dmitry S; Romanovsky, Anton V

    2013-01-20

    The goal of this study was to compare the cytotoxic and genotoxic effects of plutonium-239 alpha particles and GSM 900 modulated mobile phone (model Sony Ericsson K550i) radiation in the Allium cepa test. Three groups of bulbs were exposed to mobile phone radiation during 0 (sham), 3 and 9h. A positive control group was treated during 20min with plutonium-239 alpha-radiation. Mitotic abnormalities, chromosome aberrations, micronuclei and mitotic index were analyzed. Exposure to alpha-radiation from plutonium-239 and exposure to modulated radiation from mobile phone during 3 and 9h significantly increased the mitotic index. GSM 900 mobile phone radiation as well as alpha-radiation from plutonium-239 induced both clastogenic and aneugenic effects. However, the aneugenic activity of mobile phone radiation was more pronounced. After 9h of exposure to mobile phone radiation, polyploid cells, three-groups metaphases, amitoses and some unspecified abnormalities were detected, which were not registered in the other experimental groups. Importantly, GSM 900 mobile phone radiation increased the mitotic index, the frequency of mitotic and chromosome abnormalities, and the micronucleus frequency in a time-dependent manner. Due to its sensitivity, the A. cepa test can be recommended as a useful cytogenetic assay to assess cytotoxic and genotoxic effects of radiofrequency electromagnetic fields.

  6. 17 CFR 239.43 - Form F-N, appointment of agent for service of process by foreign banks and foreign insurance...

    Science.gov (United States)

    2010-04-01

    ... for service of process by foreign banks and foreign insurance companies and certain of their holding companies and finance subsidiaries making public offerings of securities in the United States. 239.43... holding companies and finance subsidiaries making public offerings of securities in the United...

  7. Perturbation in the {sup 240}Pu/{sup 239}Pu global fallout ratio in local sediment following the nuclear accidents at Thule (Greenland) and Palomares (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Mitchell, P.I.; Vintro, L.L. [University Coll., Dublin (Ireland). Dept. of Physics; Dahlgaard, H. [Risoe National Lab., Roskilde (Denmark); Gasco, C.; Sanchez-Cabeza, J.A. [Barcelona Univ. (Spain). Dept. de Fisica Teorica

    1995-12-31

    It is well established that the main source of the plutonium found in marine sediments throughout the Northern Hemisphere is global stratospheric fallout, characterized by a typical {sup 240}Pu/{sup 239}Pu atom ratio of {approx}0.18. Measurements of perturbations in this ratio at various sites which had been subjected to close-in fallout, mainly from surface-based testing, has confirmed the feasibility of using this ratio to distinguish plutonium from different fallout sources. In the present study, the {sup 240}Pu/{sup 239}Pu ratio has been examined in samples of sediment collected at Thule (Greenland) and Palomares (Spain), where accidents involving the release and dispersion of plutonium from fractured nuclear weapons occurred in 1968 and 1966, respectively. The {sup 240}Pu/{sup 239}Pu ratio was measured by high-resolution alpha spectrometry and spectral deconvolution. The analytical results showed that at Thule the mean {sup 240}Pu/{sup 239}Pu atom ratio was 0.033{+-}0.004, while at Palomares the equivalent ratio appeared to be significantly higher at 0.056{+-}0.003. Both ratios are consistent with those reported for soils samples at the Nevada site and Nagasaki, and are clearly indicative of weapons-grade plutonium. 27 refs., 1 fig., 2 tabs.

  8. Determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using radiochemical separation combined with radiometric and mass spectrometric measurements.

    Science.gov (United States)

    Xu, Yihong; Qiao, Jixin; Hou, Xiaolin; Pan, Shaoming; Roos, Per

    2014-02-01

    This paper reports an analytical method for the determination of plutonium isotopes ((238)Pu, (239)Pu, (240)Pu, (241)Pu) in environmental samples using anion exchange chromatography in combination with extraction chromatography for chemical separation of Pu. Both radiometric methods (liquid scintillation counting and alpha spectrometry) and inductively coupled plasma mass spectrometry (ICP-MS) were applied for the measurement of plutonium isotopes. The decontamination factors for uranium were significantly improved up to 7.5 × 10(5) for 20 g soil compared to the level reported in the literature, this is critical for the measurement of plutonium isotopes using mass spectrometric technique. Although the chemical yield of Pu in the entire procedure is about 55%, the analytical results of IAEA soil 6 and IAEA-367 in this work are in a good agreement with the values reported in the literature or reference values, revealing that the developed method for plutonium determination in environmental samples is reliable. The measurement results of (239+240)Pu by alpha spectrometry agreed very well with the sum of (239)Pu and (240)Pu measured by ICP-MS. ICP-MS can not only measure (239)Pu and (240)Pu separately but also (241)Pu. However, it is impossible to measure (238)Pu using ICP-MS in environmental samples even a decontamination factor as high as 10(6) for uranium was obtained by chemical separation.

  9. Plutonium concentration and (240)Pu/(239)Pu atom ratio in biota collected from Amchitka Island, Alaska: recent measurements using ICP-SFMS.

    Science.gov (United States)

    Bu, Kaixuan; Cizdziel, James V; Dasher, Douglas

    2013-10-01

    Three underground nuclear tests, including the Unites States' largest, were conducted on Amchitka Island, Alaska. Monitoring of the radiological environment around the island is challenging because of its remote location. In 2008, the Department of Energy (DOE) Office of Legacy Management (LM) became responsible for the long term maintenance and surveillance of the Amchitka site. The first DOE LM environmental survey occurred in 2011 and is part of a cycle of activities that will occur every 5 years. The University of Alaska Fairbanks, a participant in the 2011 study, provided the lichen (Cladonia spp.), freshwater moss (Fontinalis neomexicanus), kelp (Eualaria fistulosa) and horse mussel (Modiolus modiolus) samples from Amchitka Island and Adak Island (a control site). These samples were analyzed for (239)Pu and (240)Pu concentration and (240)Pu/(239)Pu atom ratio using inductively coupled plasma sector field mass spectrometry (ICP-SFMS). Plutonium concentrations and (240)Pu/(239)Pu atom ratios were generally consistent with previous terrestrial and marine studies in the region. The ((239)+)(240)Pu levels (mBq kg(-1), dry weight) ranged from 3.79 to 57.1 for lichen, 167-700 for kelp, 27.9-148 for horse mussel, and 560-573 for moss. Lichen from Adak Island had higher Pu concentrations than Amchitka Island, the difference was likely the result of the higher precipitation at Adak compared to Amchitka. The (240)Pu/(239)Pu atom ratios were significantly higher in marine samples compared to terrestrial and freshwater samples (t-test, p Pu occurred into the North Pacific Ocean, likely from the Marshall Island high yield nuclear tests, but other potential sources, such as the Kamchatka Peninsula Rybachiy Naval Base and Amchitka Island underground nuclear test site cannot be ruled out.

  10. Short-Lived Fission Products Yield Measurement for 239pu(nth ,f)%239Pu(nth,f)短寿命裂变产物产额测量

    Institute of Scientific and Technical Information of China (English)

    刘世龙; 杨毅; 冯晶

    2012-01-01

    采用γ能谱相对测量方法,以97Zr为内标参考核素,完成了239Pu( nth,f)短寿命裂变产物88Rb、95Y、101Mo、101Tc、…Csg、142 La等核素的累积产额测量.实验测得88Rb、”Y、101Mo、101Tc、38Csg、142La的累积产额数据分别为(1.32±0.05)%、(4.69±0.22)%、(6.13±0.32)%、(6.10土0.22)%、(6.24±0.24)%、(4.74±o.17)%.对高纯锗探测器中高能端效率刻度、样品封装与辐照、γ谱测量几何条件设计、γ谱测量与数据分析进行了研究.实验测量裂变产物核素分别位于非对称裂变质量分布双驼峰曲线轻峰的左侧、中部和右侧,重峰的中部与右侧.%The cumulative fission yields of short-lived nuclides 88Rb, 95Y, 101Mo, 101Tc, 119 Cs81 and 14!La in thermal neutron induced fission of 230Pu have been determined by gamma-ray spectrometry relative method. "Zr is selected as the reference nuclide. The determined cumulative fission yields are given as following: the Y(88Rb) = (1. 32 + 0. 05) %, Y(95Y) = (4.69 + 0.22)%, Y(101Mo) = (6. 13 + 0. 32 )%, Y(10'Tc)= (6.10 + 0.22)%, Y(I38Cse) = (6. 24 + 0. 24)%, Y(14ELa) = (4. 74 + 0. 17)%. The major work include HPGe detector efficiency calibration, sample sealing and irradiation, gamma-ray measurement and data analysis. The determined nuclides are located in left, middle, right of light group, and in middle, right of heavy group for asymmetric fission model. The accurate yields data supply a gap for domestic nuclear database, and reflect the fission products mass distribution character in thermal neutron induced fission of 239Pu.

  11. Design of 10Gb/s Reed-Solomon(255,239) Decoder%10Gb/s Reed-Solomon(255,239)解码器的设计

    Institute of Scientific and Technical Information of China (English)

    肖洁; 王志功; 胡庆生; 张军

    2005-01-01

    文章介绍10Gb/s Reed-Solomon(255,239)解码器的设计与实现.在优化解码器处理流程的基础上,通过采用4路数据复用解关键方程单元的方法,降低硬件实现的复杂度,减小芯片面积.除此之外,该解码器还具有对不可纠错码块进行判断和处理的功能.该解码器已采用Synopsys EDA工具和TSMC 0.18μmCMOS工艺实现了综合.结果表明,此设计完全可以实现10Gb/s RS码的解码功能,并且实现的复杂度大大降低.

  12. Mental health status of 239 foreign employees in Guangzhou%广州市239名外资企业员工心理健康状况调查分析

    Institute of Scientific and Technical Information of China (English)

    张知光; 丁明; 蒲晓霜; 谢才文

    2011-01-01

    目的 了解外资企业员工心理健康状况及影响因素,为改善外资企业员工心理健康状况和更好地开展心理健康教育及干预工作提供参考依据.方法 采用症状自评量表SCL-90对广州经济技术开发区2家外资企业员工进行心理健康状况测评,并与全国常模进行对比,采用t检验、方差分析比较不同性别、年龄、文化程度的员工心理状况,应用逐步多元线性回归方法对心理健康影响因素进行多因素分析.结果 共发放问卷250份,收回有效问卷239份,有效率为95.6%.其中男女分别为73、166人;平均年龄为(29.11±3.75)岁;初中及以下占49.0%,高中及中专占19.7%,大专及以上占31.4%.239名外企员工SCL-90总分为(138.29±43.41)分.总均分、躯体化症状、抑郁、焦虑、敌对、恐怖、精神病性因子得分都比全国成人常模高(P<0.05),总分超过160分的有57人,占23.9%,阳性项目超过43项的有63人,占26.3%.中度及以上心理问题、需要心理干预的员工17人,占7.1%.逐步多元线性回归分析结果显示,文化程度是SCL-90量表总均分及强迫、焦虑、偏执、精神病性因子的影响因素(P<0.05),学历越高总均分及4个因子得分越高,偏回归系数分别为0.076、0.119、0.112、0.113、0.119,男性躯体化因子得分比女性高(偏回归系数为-0.160,P<0.05).结论 受调查的外资企业员工有心理问题的现象比较普遍,心理健康水平偏低,文化程度是心理健康的重要影响因素.%Objective To explore the mental health status and related influencing factors of foreign employees in order to provide reference bases for improving their mental health and for effective mental health education and intervention. Methods Mental health symptoms of employees in two foreign - funded enterprises were measured using the Symptom Checklist - 90 ( SCL - 90 ) in Guangzhou Economic and Technological Development Zone. The results were compared with the

  13. Photofission product yields of {sup 238}U and {sup 239}Pu with 22-MeV bremsstrahlung

    Energy Technology Data Exchange (ETDEWEB)

    Wen, Xianfei; Yang, Haori, E-mail: haori.yang@oregonstate.edu

    2016-06-11

    In homeland security and nuclear safeguards applications, non-destructive techniques to identify and quantify special nuclear materials are in great demand. Although nuclear materials naturally emit characteristic radiation (e.g. neutrons, γ-rays), their intensity and energy are normally low. Furthermore, such radiation could be intentionally shielded with ease or buried in high-level background. Active interrogation techniques based on photofission have been identified as effective assay approaches to address this issue. In designing such assay systems, nuclear data, like photofission product yields, plays a crucial role. Although fission yields for neutron-induced reactions have been well studied and readily available in various nuclear databases, data on photofission product yields is rather scarce. This poses a great challenge to the application of photofission techniques. In this work, short-lived high-energy delayed γ-rays from photofission of {sup 238}U were measured in between linac pulses. In addition, a list-mode system was developed to measure relatively long-lived delayed γ-rays from photofission of {sup 238}U and {sup 239}Pu after the irradiation. Time and energy information of each γ-ray event were simultaneously recorded by this system. Cumulative photofission product yields were then determined using the measured delayed γ-ray spectra.

  14. Neutron-induced transmutation reactions in 237Np, 238Pu, and 239Pu at the massive natural uranium spallation target

    Science.gov (United States)

    Zavorka, L.; Adam, J.; Baldin, A. A.; Caloun, P.; Chilap, V. V.; Furman, W. I.; Kadykov, M. G.; Khushvaktov, J.; Pronskikh, V. S.; Solnyshkin, A. A.; Sotnikov, V.; Stegailov, V. I.; Suchopar, M.; Tsoupko-Sitnikov, V. M.; Tyutyunnikov, S. I.; Voronko, V.; Vrzalova, J.

    2015-04-01

    Transmutation reactions in the 237Np, 238Pu, and 239Pu samples were investigated in the neutron field generated inside a massive (m = 512 kg) natural uranium spallation target. The uranium target assembly QUINTA was irradiated with the deuteron beams of kinetic energy 2, 4, and 8 GeV provided by the Nuclotron accelerator at the Joint Institute for Nuclear Research (JINR) in Dubna. The neutron-induced transmutation of the actinide samples was measured off-line by implementing methods of gamma-ray spectrometry with HPGe detectors. Results of measurement are expressed in the form of both the individual reaction rates and average fission transmutation rates. For the purpose of validation of radiation transport programs, the experimental results were compared with simulations of neutron production and distribution performed by the MCNPX 2.7 and MARS15 codes employing the INCL4-ABLA physics models and LAQGSM event generator, respectively. In general, a good agreement between the experimental and calculated reaction rates was found in the whole interval of provided beam energies.

  15. Migration of plutonium from freshwater ecosystem at Hanford. [/sup 238/Pu, /sup 239/Pu, /sup 240/Pu

    Energy Technology Data Exchange (ETDEWEB)

    Emery, R. M.; Klopfer, D. C.; McShane, M. C.

    1977-09-01

    A reprocessing waste pond at Hanford has been inventoried to determine quantities of plutonium (Pu) that have been accumulated since its formation in 1944. Expressions of export were developed from these inventory data and from informed assumptions about the vectors which act to mobilize material containing Pu. This 14-acre pond provides a realistic illustration of the mobility of Pu in a lentic ecosystem. The ecological behavior of Pu in this pond is similar to that in other contaminated aquatic systems having widely differing limnological characteristics. Since its creation, this pond has received about one Ci of /sup 239/,/sup 240/Pu and /sup 238/Pu, most of which has been retained by its sediments. Submerged plants, mainly diatoms and Potamogeton, accumulate >95% of the Pu contained in biota. Emergent insects are the only direct biological route of export, mobilizing about 5 x 10/sup 3/ nCi of Pu annually, which is also the estimated maximum quantity of the Pu exported by waterfowl, birds and mammals collectively. There is no apparent significant export by wind, and it is not likely that Pu has migrated to the ground water below U-Pond via percolation. Although this pond has a rapid flushing rate, a eutrophic nutrient supply with a diverse biotic profile, and interacts with an active terrestrial environment, it appears to effectively bind Pu and prevent it from entering pathways to man and other life.

  16. (236)U and (239,)(240)Pu ratios from soils around an Australian nuclear weapons test site.

    Science.gov (United States)

    Tims, S G; Froehlich, M B; Fifield, L K; Wallner, A; De Cesare, M

    2016-01-01

    The isotopes (236)U, (239)Pu and (240)Pu are present in surface soils as a result of global fallout from nuclear weapons tests carried out in the 1950's and 1960's. These isotopes potentially constitute artificial tracers of recent soil erosion and sediment movement. Only Accelerator Mass Spectrometry has the requisite sensitivity to measure all three isotopes at these environmental levels. Coupled with its relatively high throughput capabilities, this makes it feasible to conduct studies of erosion across the geographical extent of the Australian continent. In the Australian context, however, global fallout is not the only source of these isotopes. As part of its weapons development program the United Kingdom carried out a series of atmospheric and surface nuclear weapons tests at Maralinga, South Australia in 1956 and 1957. The tests have made a significant contribution to the Pu isotopic abundances present in the region around Maralinga and out to distances ∼1000 km, and impact on the assessment techniques used in the soil and sediment tracer studies. Quantification of the relative fallout contribution derived from detonations at Maralinga is complicated owing to significant contamination around the test site from numerous nuclear weapons safety trials that were also carried out around the site. We show that (236)U can provide new information on the component of the fallout that is derived from the local nuclear weapons tests, and highlight the potential of (236)U as a new fallout tracer.

  17. Alpha and conversion electron spectroscopy of 238,239Pu and 241Am and alpha-conversion electron coincidence measurements

    Science.gov (United States)

    Dion, Michael P.; Miller, Brian W.; Warren, Glen A.

    2016-09-01

    A technique to determine the isotopic constituents of a mixed actinide sample has been proposed by a coincident alpha-conversion electron measurement. This presents a unique signature to allow the unfolding of isotopes that possess overlapping alpha particle energy and reduce backgrounds of an unseparated sample. The work presented here are results of conversion electron spectroscopy of 241Am, 238Pu and 239Pu using a dual-stage peltier-cooled 25 mm2 silicon drift detector and alpha spectroscopy with a passivated ion implanted planar silicon detector. The conversion electron spectra were evaluated from 20-55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information and calibration to aid in the coincident measurement approach. Furthermore, an alpha-conversion electron spectrometer was assembled using the silicon based detectors described and results of a coincident spectrum analysis is reported for 241Am.

  18. Neutron emission effects on fragment mass and kinetic energy distribution from fission of 239Pu induced by thermal neutrons

    Science.gov (United States)

    Montoya, M.; Rojas, J.; Lobato, I.

    2010-08-01

    The average of fragment kinetic energy (E*) and the multiplicity of prompt neutrons (ν) as a function of fragment mass (m*), as well as the fragment mass yield (Y(m*)) from thermal neutron-induced fission of 239Pu have been measured by Tsuchiya et al.. In that work the mass and kinetic energy are calculated from the measured kinetic energy of one fragment and the difference of time of flight of the two complementary fragments. However they do not present their results about the standard deviation σE*(m*). In this work we have made a numerical simulation of that experiment which reproduces its results, assuming an initial distribution of the primary fragment kinetic energy (E(A)) with a constant value of the standard deviation as function of fragment mass (σE(A)). As a result of the simulation we obtain the dependence σE*(m*) which presents an enhancement between m* = 92 and m* = 110, and a peak at m* = 121.

  19. Feasibility study of U-235, Pu-239 and Pu-240 content determination in an irradiated fuel by neutron transmission analysis

    Energy Technology Data Exchange (ETDEWEB)

    Naguib, K.; Michaiel, M.L.; Morcos, H.N

    1998-07-01

    A proposed nondestructive method and its feasibility for the determination of U-235, Pu-239 and Pu-240 contents in an irradiated fuel is described. The method is based on the use of shape fit analysis of the Time-Of-Flight (TOF) neutron transmission data of the irradiated fuel for neutron energies below 3 eV. The neutron transmission experiment of the irradiated fuel is planned to carry out using one of the TOF spectrometers installed at ET-RR-1 reactor. The computer code SHAPE is adapted taking into account the known parameters of resonances of certain fissile and fission product nuclei to provide the fit analysis. The content of the gross-fissile and fission product isotopes are determined from the burn-up calculations of the fuel assembly of the ET-RR-1 reactor with defined history. The effect of both uncertainties in resonance parameters on the deduced contents of fissile nuclei and statistical accuracy of the TOF measurements are estimated.

  20. Photo-fission Product Yield Measurements at Eγ=13 MeV on 235U, 238U, and 239Pu

    Science.gov (United States)

    Tornow, W.; Bhike, M.; Finch, S. W.; Krishichayan, Fnu; Tonchev, A. P.

    2016-09-01

    We have measured Fission Product Yields (FPYs) in photo-fission of 235U, 238U, and 239Pu at TUNL's High-Intensity Gamma-ray Source (HI γS) using mono-energetic photons of Eγ = 13 MeV. Details of the experimental setup and analysis procedures will be discussed. Yields for approximately 20 fission products were determined. They are compared to neutron-induced FPYs of the same actinides at the equivalent excitation energies of the compound nuclear systems. In the future photo-fission data will be taken at Eγ = 8 . 0 and 10.5 MeV to find out whether photo-fission exhibits the same so far unexplained dependence of certain FPYs on the energy of the incident probe, as recently observed in neutron-induced fission, for example, for the important fission product 147Nd. Work supported by the U. S. Dept. of Energy, under Grant No. DE-FG02-97ER41033, and by the NNSA, Stewardship Science Academic Alliances Program, Grant No. DE-NA0001838 and the Lawrence Livermore, National Security, LLC under Contract No. DE-AC52-07NA27344.

  1. Selectivity of bis-triazinyl bipyridine ligands for americium(III) in Am/Eu separation by solvent extraction. Part 1. Quantum mechanical study on the structures of BTBP complexes and on the energy of the separation.

    Science.gov (United States)

    Narbutt, Jerzy; Oziminski, Wojciech P

    2012-12-21

    Theoretical studies were carried out on two pairs of americium and europium complexes formed by tetra-N-dentate lipophilic BTBP ligands, neutral [ML(NO(3))(3)] and cationic [ML(2)](3+) where M = Am(III) or Eu(III), and L = 6,6'-bis-(5,6-diethyl-1,2,4-triazin-3-yl)-2,2'-bipyridine (C2-BTBP). Molecular structures of the complexes have been optimized at the B3LYP/6-31G(d) level and total energies of the complexes in various media were estimated using single point calculations performed at the B3LYP/6-311G(d,p) and MP2/6-311G(d,p) levels of theory. In the calculations americium and europium ions were treated using pseudo-relativistic Stuttgart-Dresden effective core potentials and the accompanying basis sets. Selectivity in solvent extraction separation of two metal ions is a co-operative function of contributions from all extractable metal complexes, which depend on physico-chemical properties of each individual complex and on its relative amount in the system. Semi-quantitative analysis of BTBP selectivity in the Am/Eu separation process, based on the contributions from the two pairs of Am(III) and Eu(III) complexes, has been carried out. To calculate the energy of Am/Eu separation, a model of the extraction process was used, consisting of complex formation in water and transfer of the formed complex to the organic phase. Under the assumptions discussed in the paper, this simple two-step model results in reliable values of the calculated differences in the energy changes for each pair of the Am/Eu complexes in both steps of the process. The greater thermodynamic stability (in water) of the Am-BTBP complexes, as compared with the analogous Eu species, caused by greater covalency of the Am-N than Eu-N bonds, is most likely the main reason for BTBP selectivity in the separation of the two metal ions. The other potential reason, i.e. differences in lipophilic properties of the analogous complexes of Am and Eu, is less important with regard to this selectivity.

  2. Assinatura da deposição atmosférica de testes nucleares em sedimentos da costa brasileira (240+239Pu e 137Cs

    Directory of Open Access Journals (Sweden)

    Christian J. Sanders

    2012-01-01

    Full Text Available The aim of this review is to take a look at Cold War era nuclear tests signatures found in Brazilian coastal sediments. Both137Cs and 240+239Pu signatures have been documented in mangrove, coastal mudflats and continental shelf sediments, associated with above ground nuclear tests beginning in the 1950's. The dates associated to the anthropogenic radionuclide signatures 137Cs and 240+239Pu along sediment columns are confirmed by 210Pb geochronology in many of the studies highlighted in this review. The results outlined in this review characterize the extent to which nuclear fallout products reach the Brazilian coast in quantities sufficient for detection, allowing the use of these radioisotopes as geochronometers.

  3. Reassessment of 239Pu on planchets from human urine samples at ultra-trace levels using Aridus-ICPSFMS and AMS.

    Science.gov (United States)

    Hernández-Mendoza, Héctor; Chamizo, Elena; Delgado, Antonio; García-León, Manuel; Yllera, Abel

    2012-12-01

    New analytical methods developed at the facilities here, based on two ultra-sensitive mass spectrometry (MS) techniques, inductively coupled plasma sector field mass spectrometer with a desolvator system (Aridus-ICP-SFMS) and accelerator MS (AMS), have been applied in this work for the reassessment of (239)Pu in alpha spectrometry (AS) planchets corresponding to spiked human urine samples. The obtained (239)Pu minimum detectable activities (MDAs) values by Aridus-ICP-SFMS and AMS were 3 fg (∼6.92 µBq) and 0.4 fg (∼0.92 µBq), respectively, per sample, which are much better than those attainable by AS [50 fg (∼115.3 µBq) of (239)Pu per sample, approximately]. Therefore, it is demonstrated that the MS techniques employed in this work are very powerful tools for internal dosimetry studies in human urine samples, giving excellent results when the reassessment of AS planchets is needed (samples with a Pu concentration below or at the MDA levels measurable by AS). This work is the continuation of an article published in J. Anal. At. Spectrom. 25 (1410-1415) 2010.

  4. Feasibility study of 235U and 239Pu characterization in radioactive waste drums using neutron-induced fission delayed gamma rays

    Science.gov (United States)

    Nicol, T.; Pérot, B.; Carasco, C.; Brackx, E.; Mariani, A.; Passard, C.; Mauerhofer, E.; Collot, J.

    2016-10-01

    This paper reports a feasibility study of 235U and 239Pu characterization in 225 L bituminized waste drums or 200 L concrete waste drums, by detecting delayed fission gamma rays between the pulses of a deuterium-tritium neutron generator. The delayed gamma yields were first measured with bare samples of 235U and 239Pu in REGAIN, a facility dedicated to the assay of 118 L waste drums by Prompt Gamma Neutron Activation Analysis (PGNAA) at CEA Cadarache, France. Detectability in the waste drums is then assessed using the MCNPX model of MEDINA (Multi Element Detection based on Instrumental Neutron Activation), another PGNAA cell dedicated to 200 L drums at FZJ, Germany. For the bituminized waste drum, performances are severely hampered by the high gamma background due to 137Cs, which requires the use of collimator and shield to avoid electronics saturation, these elements being very penalizing for the detection of the weak delayed gamma signal. However, for lower activity concrete drums, detection limits range from 10 to 290 g of 235U or 239Pu, depending on the delayed gamma rays of interest. These detection limits have been determined by using MCNPX to calculate the delayed gamma useful signal, and by measuring the experimental gamma background in MEDINA with a 200 L concrete drum mock-up. The performances could be significantly improved by using a higher interrogating neutron emission and an optimized experimental setup, which would allow characterizing nuclear materials in a wide range of low and medium activity waste packages.

  5. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes; Utilizacao de metodos radioanaliticos para a determinacao de isotopos de uranio, plutonio, americio e curio em rejeitos radioativos

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca

    2012-07-01

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  6. Adjustment of a direct method for the determination of man body burden in Pu-239 on by X-ray detection of U-235; Mise au point d'une methode directe de determination de la charge corporelle en plutonium 239 chez l'homme par detection X de l'uranium 235

    Energy Technology Data Exchange (ETDEWEB)

    Boulay, P. [Commissariat a l' Energie Atomique, Bruyeres-le-Chatel (France). Centre d' Etudes

    1968-04-01

    The use of Pu-239 on a larger scale sets a problem about the contamination measurement by aerosol at lung level. A method of direct measurement of Pu-239 lung burden is possible, thanks to the use of a large area window proportional counter. A counter of such pattern, has been especially carried out for this purpose. The adjustment of the apparatus allows an adequate sensibility to detect a contamination at the maximum permissible body burden level. Besides, a method for individual 'internal calibration', with a plutonium mock: the protactinium-233, is reported. (author) [French] L'utilisation a une echelle de plus en plus large du plutonium-239 pose un probleme de la mesure de la contamination par aerosol au niveau du poumon. Une methode de mesure directe de la charge pulmonaire en plutonium-239 est possible grace a l'utilisation d'un compteur proportionnel a fenetre de grande surface. Un compteur de ce type a specialement ete realise dans ce but. La mise au point de l'appareillage permet une sensibilite suffisante pour deceler une contamination au niveau de la Q.M.A (quantite maximale admissible). D'autre part, une methode 'd'etalonnage interne' de l'individu a l'aide d'un simulateur de plutonium, le protactinium-233, est decrite. (auteur)

  7. A new salicylate synthase AmS is identified for siderophores biosynthesis in Amycolatopsis methanolica 239(T).

    Science.gov (United States)

    Xie, Feng; Dai, Shengwang; Shen, Jinzhao; Ren, Biao; Huang, Pei; Wang, Qiushui; Liu, Xueting; Zhang, Buchang; Dai, Huanqin; Zhang, Lixin

    2015-07-01

    Siderophores are important for the growth of bacteria or the applications in treatment of iron overload-associated diseases due to the iron-chelating property. Salicylate synthase played a key role in the biosynthesis of some NRPS-derived siderophores by the providing of an iron coordination moiety as the initial building block. A new salicylate synthase, namely AmS, was identified in the biosynthesis pathway of siderophore amychelin in Amycolatopsis methanolica 239(T), since it shunt chorismate, an integrant precursor, from primary to secondary metabolite flow. The amino acid sequence alignment and phylogenetic analysis showed that AmS grouped into a new cluster. In vitro assays of AmS revealed its wide temperature tolerance ranged from 0 to 40 °C and narrow pH tolerant ranged from 7.0 to 9.0. AmS was resistant to organic solvents and non-ionic detergents. Moreover, AmS converted chorismate to salicylate with K m of 129.05 μM, k cat of 2.20 min(-1) at optimal conditions, indicating its low substrate specificity and comparable velocity to reported counterparts (Irp9 and MbtI). These properties of AmS may improve the iron-seizing ability of A. methanolica to compete with its neighbors growing in natural environments. Most importantly, serine and cysteine residues were found to be important for the catalytic activity of AmS. This study presented AmS as a new cluster of salicylate synthase and the reaction mechanism and potential applications of salicylate synthase were highlighted as well.

  8. Delayed Fission Gamma-ray Characteristics of Th-232 U-233 U-235 U-238 and Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Lane, Taylor [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Parma, Edward J. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)

    2015-08-01

    Delayed fission gamma-rays play an important role in determining the time dependent ioniz- ing dose for experiments in the central irradiation cavity of the Annular Core Research Reactor (ACRR). Delayed gamma-rays are produced from both fission product decay and from acti- vation of materials in the core, such as cladding and support structures. Knowing both the delayed gamma-ray emission rate and the time-dependent gamma-ray energy spectrum is nec- essary in order to properly determine the dose contributions from delayed fission gamma-rays. This information is especially important when attempting to deconvolute the time-dependent neutron, prompt gamma-ray, and delayed gamma-ray contribution to the response of a diamond photo-conducting diode (PCD) or fission chamber in time frames of milliseconds to seconds following a reactor pulse. This work focused on investigating delayed gamma-ray character- istics produced from fission products from thermal, fast, and high energy fission of Th-232, U-233, U-235, U-238, and Pu-239. This work uses a modified version of CINDER2008, a transmutation code developed at Los Alamos National Laboratory, to model time and energy dependent photon characteristics due to fission. This modified code adds the capability to track photon-induced transmutations, photo-fission, and the subsequent radiation caused by fission products due to photo-fission. The data is compared against previous work done with SNL- modified CINDER2008 [ 1 ] and experimental data [ 2 , 3 ] and other published literature, includ- ing ENDF/B-VII.1 [ 4 ]. The ability to produce a high-fidelity (7,428 group) energy-dependent photon fluence at various times post-fission can improve the delayed photon characterization for radiation effects tests at research reactors, as well as other applications.

  9. Epidemiological profile of 239 traumatic spinal cord injury cases over a period of 12 years in Tianjin, China

    Science.gov (United States)

    Feng, Hong-Yong; Ning, Guang-Zhi; Feng, Shi-Qing; Yu, Tie-Qiang; Zhou, Heng-Xing

    2011-01-01

    Study design Hospital-based retrospective review. Objective To describe the epidemiological characteristics and trends of traumatic spinal cord injury in Tianjin, China. Setting Tianjin Medical University General Hospital. Methods Medical records of 239 patients with traumatic spinal cord injury admitted to a general hospital from 1998 to 2009 were reviewed. Variables included gender, age, marital status, occupation, etiology, time of injury, level, and severity of injury. Epidemiological characteristics of different countries were compared. Results Over this period, the mean age of patients with traumatic spinal cord injury was 45.4 ± 14.1 years, and the male/female ratio was 4.6:1. In all, 86.2% were married. The leading cause was fall (52.3%), followed by motor vehicle collision (36.4%). The most common injury site was the cervical spinal cord, accounting for 82.0%. Incomplete tetraplegia made up for 59.4%, followed by complete tetraplegia (22.6%). Eight patients died after operation, six of whom died from respiratory complications. Conclusion The results of this study are in accordance with that of most other developing countries; falls and motor vehicle collisions were the two leading causes, but the mean age was older. Percentage of the aged with traumatic spinal cord injury was increasing. The low-falls group tended to expand over this period. All these data indicated that the preventive programs should focus on the traffic accidents and falls, and more attention should be paid to the aged for the vulnerability to low fall. PMID:21903012

  10. A study on artificial radionuclides ({sup 134}Cs, {sup 137}Cs and {sup 239+240}Pu) distribution in the sediment form lake euiam

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seung Hwan; Lee, Sang Han; Oh, Jung Suk; Choi, Jong Ki [Korea Research Institute of Standards and Science, Daejeon (Korea, Republic of); Kang, Tae Gu [National Institute of Environmental Research, Sejong (Korea, Republic of)

    2015-12-15

    The objective of this study is to identify the radionuclide distribution in public water by carrying out the analysis of artificial radionuclides(({sup 134}Cs, {sup 137}Cs, {sup 239+240}Pu), natural radionuclide({sup 210}Pb) and TOC in the lake Euiam sediment in Chuncheon, South Korea. The {sup 134}Cs concentration in all lake sediments showed below MDA values, and the {sup 137}Cs concentration in lake sediment were ranged from MDA to 8.79 Bq · kg{sup -1}-dry. The {sup 137}Cs concentrations in surface sediment were reported to be 2.4 to 4.2 Bq · kg{sup -1}-dry. The lowest concentration of {sup 137}Cs was reported at St. 4 and the highest concentration was reported at St. 3, respectively. The {sup 239+240}Pu concentration in lake sediment were ranged from 0.049 to 0.47 Bq · kg{sup -1}-dry. The lowest concentration of was reported at St. 2 and the highest concentration was reported at St. 3. The correlation(r) between the {sup 239+240}Pu concentration and {sup 137}Cs concentration in lake sediment presented higher values (0.54 to 0.97) and this suggests the behavior and origin of {sup 137}Cs is identical to the {sup 239+240}Pu in the sediment. The {sup 134}Cs concentration below MDA value and the {sup 239+240}Pu/{sup 134}Cs ratio(mean value of 0.041) indicated that the artificial radionuclides in the sediment were originated from global fallout by the atmospheric testing of nuclear weapons conducted by former USSR and U.S.A, but not from the Fukushima Daiichi NPP accident. The sedimentation rate derived from {sup 2}'1{sup 0}Pb age-dating method at St. 2 is calculated to be 0.31±0.06 cm · y{sup -1}. This value is similar to the value (0.41±0.05 cm · y{sup -1}) estimated from the {sup 137}Cs maximum peak produced from early 1960's. The content of TOC in lake Euiam sediments varied from 0.20 to 13.01%. While the highest correlation between TOC and {sup 137}Cs concentration in the sediment were found at St. 1, the others presented the low correlation.

  11. {sup 239,} {sup 240,} {sup 241}Pu fingerprinting of plutonium in western US soils using ICPMS: solution and laser ablation measurements

    Energy Technology Data Exchange (ETDEWEB)

    Cizdziel, James V. [University of Nevada - Las Vegas, Harry Reid Center for Environmental Studies, Las Vegas, NV (United States); Ketterer, Michael E. [Northern Arizona University, Department of Chemistry and Biochemistry, Box 5698, Flagstaff, AZ (United States); Farmer, Dennis [University of Nevada - Las Vegas, Department of Health Physics, Las Vegas, NV (United States); Faller, Scott H. [US Environmental Protection Agency, Radiation and Indoor Environments National Laboratory, Box 98517, Las Vegas, NV (United States); Hodge, Vernon F. [University of Nevada - Las Vegas, Department of Chemistry, Las Vegas, NV (United States)

    2008-01-15

    Sector field inductively coupled plasma mass spectrometry (SF-ICPMS) has been used with analysis of solution samples and laser ablation (LA) of electrodeposited alpha sources to characterize plutonium activities and atom ratios prevalent in the western USA. A large set of surface soils and attic dusts were previously collected from many locations in the states of Nevada, Utah, Arizona, and Colorado; specific samples were analyzed herein to characterize the relative contributions of stratospheric fallout vs. Nevada Test Site (NTS) plutonium. This study illustrates two different ICPMS-based analytical strategies that are successful in fingerprinting Pu in environmental soils and dusts. Two specific datasets have been generated: (1) soils are leached with HNO{sub 3}-HCl, converted into electrodeposited alpha sources, counted by alpha spectrometry, then re-analyzed using laser ablation SF-ICPMS; (2) samples are completely dissolved by treatment with HNO{sub 3}-HF-H{sub 3}BO{sub 3}, Pu fractions are prepared by extraction chromatography, and analyzed by SF-ICPMS. Optimal laser ablation and ICPMS conditions were determined for the re-analysis of archived alpha spectrometry ''planchette'' sources. The best ablation results were obtained using a large spot size (200 {mu}m), a defocused beam, full repetition rate (20 Hz) and scan rate (200 {mu}m s{sup -1}); LA-ICPMS data were collected with a rapid electrostatic sector scanning experiment. Less than 10% of the electroplated surface area is consumed in the LA-ICPMS analysis, which would allow for multiple re-analyses. Excellent agreement was found between {sup 239+240}Pu activities determined by LA-ICPMS vs. activity results obtained by alpha spectrometry for the same samples ten years earlier. LA-ICPMS atom ratios for {sup 240}Pu/{sup 239}Pu and {sup 241}Pu/{sup 239}Pu range from 0.038-0.132 and 0.00034-0.00168, respectively, and plot along a two-component mixing line ({sup 241}Pu/{sup 239}Pu = 0

  12. Fission fragment charge and mass distributions in 239Pu(n ,f ) in the adiabatic nuclear energy density functional theory

    Science.gov (United States)

    Regnier, D.; Dubray, N.; Schunck, N.; Verrière, M.

    2016-05-01

    Background: Accurate knowledge of fission fragment yields is an essential ingredient of numerous applications ranging from the formation of elements in the r process to fuel cycle optimization for nuclear energy. The need for a predictive theory applicable where no data are available, together with the variety of potential applications, is an incentive to develop a fully microscopic approach to fission dynamics. Purpose: In this work, we calculate the pre-neutron emission charge and mass distributions of the fission fragments formed in the neutron-induced fission of 239Pu using a microscopic method based on nuclear density functional theory (DFT). Methods: Our theoretical framework is the nuclear energy density functional (EDF) method, where large-amplitude collective motion is treated adiabatically by using the time-dependent generator coordinate method (TDGCM) under the Gaussian overlap approximation (GOA). In practice, the TDGCM is implemented in two steps. First, a series of constrained EDF calculations map the configuration and potential-energy landscape of the fissioning system for a small set of collective variables (in this work, the axial quadrupole and octupole moments of the nucleus). Then, nuclear dynamics is modeled by propagating a collective wave packet on the potential-energy surface. Fission fragment distributions are extracted from the flux of the collective wave packet through the scission line. Results: We find that the main characteristics of the fission charge and mass distributions can be well reproduced by existing energy functionals even in two-dimensional collective spaces. Theory and experiment agree typically within two mass units for the position of the asymmetric peak. As expected, calculations are sensitive to the structure of the initial state and the prescription for the collective inertia. We emphasize that results are also sensitive to the continuity of the collective landscape near scission. Conclusions: Our analysis confirms

  13. The Relationship between Coping-style and Self-acceptance among 239 Female Addicts%239例女性戒毒人员应对方式与自我接纳的相关分析

    Institute of Scientific and Technical Information of China (English)

    曹婧; 王凤兰; 闫晓丽; 姜峰

    2014-01-01

    Objectives To explore the relationship between coping-style and self-acceptance among female addicts. Methods 239 female addicts were randomly selected and tested with the self-acceptance questionnaire (SAQ)and the cop-ing-style questionnaire (TCSQ).Results The positive coping-style (35.24 ±7.02)and negative coping-style (32.56 ± 7.12)were significantly higher than the norm (30.26 ±8.74,21.25 ± 7.41).The level of self-acceptance (18.94 ± 4.13)and total score of self-acceptance (39.66±6.09)were significantly lower than the norm (21.76±4.43,42.06 ±6.63 ).The level of self-acceptance was negatively correlated with the negative coping-style (r =-0.346,P <0.01),and the level of self-evaluation was positively correlated with positive coping-style (r =0.203,P <0.01 ). Positive coping-style (r=0.241,P <0.01)and negative coping-style (r=-0.261,P <0.01)had a significantly positive corre-lation and a significantly negative correlation with the total score of self-acceptance respectively.Coping-style could be predicted by self-acceptance to some extent.Conclusions There is a certain psychological problem in female addicts,and they are more likely to use negative coping-style and have lower self-acceptance.%目的:了解女性吸毒者自我接纳与应对方式的特点及其之间的关系。方法运用特质应对方式问卷(TCSQ)和自我接纳问卷(SAQ)对山西省某强制戒毒所女性吸毒人员调查分析。结果女性戒毒人员的积极应对方式(t=10.972,P <0.01)和消极应对方式(t=24.562,P <0.01)得分高于常模;自我接纳因子(t =-10.576,P <0.01)与自我接纳总分(t=-6.091,P <0.01)得分低于常模;自我接纳因子与消极应对方式呈显著负相关(r=-0.346,P <0.01);自我评价因子与积极应对方式呈显著正相关(r =0.203,P <0.01);自我接纳总分与消极应对显著负相关(r=-0.261,P <0.01),与积极应对呈正相关(r=0.241,P <0.01)。自我接纳对应对方式有一定的预测作用(P <0.01)。

  14. Exploratory study of fission product yields of neutron-induced fission of 235U , 238U , and 239Pu at 8.9 MeV

    Science.gov (United States)

    Bhatia, C.; Fallin, B. F.; Gooden, M. E.; Howell, C. R.; Kelley, J. H.; Tornow, W.; Arnold, C. W.; Bond, E.; Bredeweg, T. A.; Fowler, M. M.; Moody, W.; Rundberg, R. S.; Rusev, G. Y.; Vieira, D. J.; Wilhelmy, J. B.; Becker, J. A.; Macri, R.; Ryan, C.; Sheets, S. A.; Stoyer, M. A.; Tonchev, A. P.

    2015-06-01

    Using dual-fission chambers each loaded with a thick (200 -400 -mg /c m2) actinide target of 235 ,238U or 239Pu and two thin (˜10 -100 -μ g /c m2) reference foils of the same actinide, the cumulative yields of fission products ranging from 92Sr to 147Nd have been measured at En= 8.9 MeV . The 2H(d ,n ) 3He reaction provided the quasimonoenergetic neutron beam. The experimental setup and methods used to determine the fission product yield (FPY) are described, and results for typically eight high-yield fission products are presented. Our FPYs for 235U(n ,f ) , 238U(n ,f ) , and 239Pu(n ,f ) at 8.9 MeV are compared with the existing data below 8 MeV from Glendenin et al. [Phys. Rev. C 24, 2600 (1981), 10.1103/PhysRevC.24.2600], Nagy et al. [Phys. Rev. C 17, 163 (1978), 10.1103/PhysRevC.17.163], Gindler et al. [Phys. Rev. C 27, 2058 (1983), 10.1103/PhysRevC.27.2058], and those of Mac Innes et al. [Nucl. Data Sheets 112, 3135 (2011), 10.1016/j.nds.2011.11.009] and Laurec et al. [Nucl. Data Sheets 111, 2965 (2010), 10.1016/j.nds.2010.11.004] at 14.5 and 14.7 MeV, respectively. This comparison indicates a negative slope for the energy dependence of most fission product yields obtained from 235U and 239Pu , whereas for 238U the slope issue remains unsettled.

  15. Determination of the {sup 240}Pu/{sup 239}Pu atom ratio in low activity environmental samples by alpha spectrometry and spectral deconvolution

    Energy Technology Data Exchange (ETDEWEB)

    Leon Vintro, L. [University Coll., Dublin (Ireland). Dept. of Experimental Phys.; Mitchell, P.I. [University Coll., Dublin (Ireland). Dept. of Experimental Phys.; Condren, O.M. [University Coll., Dublin (Ireland). Dept. of Experimental Phys.; Moran, M. [Lawrence Livermore National Lab., Livermore, CA (United States); Vives i Batlle, J. [University Coll., Dublin (Ireland). Dept. of Experimental Phys.; Sanchez-Cabeza, J.A. [Dept. de Fisica, Universidad Autonoma de Barcelona, Bellaterra (Spain)

    1996-02-01

    In this paper, a simple technique, based on commercially-available software developed for gamma spectra analysis (MicroSAMPO {sup trademark}), is described by which this complex multiplet can be resolved at the much lower activities typical of many environmental samples. In our approach, it is not necessary to make any alterations to the normal alpha spectrometric set-up (including energy dispersion), other than to improve collimation. The instrumental function is defined for each spectrum by fitting a modified gaussian with exponential tails to the comparatively well-resolved {sup 242}Pu ``doublet`` (used as tracer) and, if present, the {sup 238}Pu ``doublet``. The fitted peaks are used to create an energy calibration file with which, using published energy data, the positions (in channels) of the component peaks of the multiplet are predicted. These positions are not altered subsequently when MicroSAMPO`s interactive multiplet analysis facility is used to quantify the relative spectral intensities of the components. Before calculating the {sup 240}Pu/{sup 239}Pu ratio, it is advisable to correct for coincidence summing of alpha particles and conversion electrons. The technique has been applied to the determination of the {sup 240}Pu/{sup 239}Pu ratio in a set of environmental samples, most of which were supplied by IAEA-MEL under their laboratory intercomparison programme. Subsequently, replicate samples were analysed independently using thermal ionisation mass spectrometry. The agreement between the two sets of data was most satisfactory. Further validation of this deconvolution technique was provided by the good agreement between the measured alpha-emission probabilities for the component peaks in the {sup 239,240}Pu multiplet and published values. (orig.).

  16. Feasibility study of {sup 235}U and {sup 239}Pu characterization in radioactive waste drums using neutron-induced fission delayed gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    Nicol, T. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); FZJ, Institute of Energy and Climate Research – Nuclear Waste Management and Reactor Safety, Wilhelm-Johnen-Straße, d-52425 Jülich (Germany); Pérot, B., E-mail: bertrand.perot@cea.fr [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); Carasco, C. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); Brackx, E. [CEA, DEN, Marcoule, Metallography and Chemical Analysis Laboratory, F-30207 Bagnols-sur-Cèze (France); Mariani, A.; Passard, C. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); Mauerhofer, E. [FZJ, Institute of Energy and Climate Research – Nuclear Waste Management and Reactor Safety, Wilhelm-Johnen-Straße, d-52425 Jülich (Germany); Collot, J. [Laboratoire de Physique Subatomique et de Cosmologie, Université Grenoble Alpes, CNRS/IN2P3 Grenoble (France)

    2016-10-01

    This paper reports a feasibility study of {sup 235}U and {sup 239}Pu characterization in 225 L bituminized waste drums or 200 L concrete waste drums, by detecting delayed fission gamma rays between the pulses of a deuterium-tritium neutron generator. The delayed gamma yields were first measured with bare samples of {sup 235}U and {sup 239}Pu in REGAIN, a facility dedicated to the assay of 118 L waste drums by Prompt Gamma Neutron Activation Analysis (PGNAA) at CEA Cadarache, France. Detectability in the waste drums is then assessed using the MCNPX model of MEDINA (Multi Element Detection based on Instrumental Neutron Activation), another PGNAA cell dedicated to 200 L drums at FZJ, Germany. For the bituminized waste drum, performances are severely hampered by the high gamma background due to {sup 137}Cs, which requires the use of collimator and shield to avoid electronics saturation, these elements being very penalizing for the detection of the weak delayed gamma signal. However, for lower activity concrete drums, detection limits range from 10 to 290 g of {sup 235}U or {sup 239}Pu, depending on the delayed gamma rays of interest. These detection limits have been determined by using MCNPX to calculate the delayed gamma useful signal, and by measuring the experimental gamma background in MEDINA with a 200 L concrete drum mock-up. The performances could be significantly improved by using a higher interrogating neutron emission and an optimized experimental setup, which would allow characterizing nuclear materials in a wide range of low and medium activity waste packages.

  17. Cross-section measurements for {sup 239}Pu(n,f) and {sup 6}Li(n,{alpha}) with a lead slowing-down spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Rochman, D. [National Nuclear Data Center, Brookhaven National Laboratory, Upton, NY 11973-5000 (United States)]. E-mail: drochman@bnl.gov; Haight, R.C. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: haight@lanl.gov; O' Donnell, J.M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: odonnell@lanl.gov; Wender, S.A. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: wender@lanl.gov; Vieira, D.J. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: vieira@lanl.gov; Bond, E.M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: bond@lanl.gov; Bredeweg, T.A. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: toddb@lanl.gov; Wilhelmy, J.B. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)]. E-mail: j_wilhelmy@lanl.gov; Granier, T. [Commissariat a l' Energie Atomique, 91680 Bruyeres-le-Chatel (France)]. E-mail: granier@cea.fr; Ethvignot, T. [Commissariat a l' Energie Atomique, 91680 Bruyeres-le-Chatel (France)]. E-mail: ethvignot@cea.fr; Petit, M. [Commissariat a l' Energie Atomique, 91680 Bruyeres-le-Chatel (France)]. E-mail: petit@cea.fr; Danon, Y. [Rensselaer Polytechnic Institute, Troy, NY 12180 (United States)]. E-mail: danony@rpi.edu; Romano, C. [Rensselaer Polytechnic Institute, Troy, NY 12180 (United States)]. E-mail: romanc2@rpi.edu

    2006-08-01

    We present fission cross-section measurements with {approx}10ng of {sup 239}Pu performed using the LANSCE Lead Slowing-Down Spectrometer. Results of Li6(n,{alpha}) measurements with a sample size of 760ng of {sup 6}Li are also reported. This technical achievement demonstrates the feasibility of measuring neutron-induced fission cross-section on samples with 10ng of fissile actinides that are available on ultra-small quantities. Furthermore, results on neutron-induced alpha emission show that measurements for astrophysics purposes are feasible with the LSDS.

  18. Cross-section measurements for 239Pu(n,f) and 6Li(n, α) with a lead slowing-down spectrometer

    Science.gov (United States)

    Rochman, D.; Haight, R. C.; O'Donnell, J. M.; Wender, S. A.; Vieira, D. J.; Bond, E. M.; Bredeweg, T. A.; Wilhelmy, J. B.; Granier, T.; Ethvignot, T.; Petit, M.; Danon, Y.; Romano, C.

    2006-08-01

    We present fission cross-section measurements with ˜10 ng of 239Pu performed using the LANSCE Lead Slowing-Down Spectrometer. Results of Li6(n,α) measurements with a sample size of 760 ng of 6Li are also reported. This technical achievement demonstrates the feasibility of measuring neutron-induced fission cross-section on samples with 10 ng of fissile actinides that are available on ultra-small quantities. Furthermore, results on neutron-induced alpha emission show that measurements for astrophysics purposes are feasible with the LSDS.

  19. Criticality Evaluation of Plutonium-239 Moderated by High-Density Polyethylene in Stainless Steel and Aluminum Containers Suitable for Non-Exclusive Use Transport

    Energy Technology Data Exchange (ETDEWEB)

    Watson, T T

    2007-08-10

    Research is conducted at the Joint Actinide Shock Physics Experimental Facility (JASPER) on the effects of high pressure and temperature environments on plutonium-239, in support of the stockpile stewardship program. Once an experiment has been completed, it is necessary to transport the end products for interim storage or final disposition. Federal shipping regulations for nonexclusive use transportation require that no more than 180 grams of fissile material are present in at least 360 kilograms of contiguous non-fissile material. To evaluate the conservatism of these regulatory requirements, a worst-case scenario of 180g {sup 239}Pu and a more realistic scenario of 100g {sup 239}Pu were modeled using one of Lawrence Livermore National Laboratory's Monte Carlo transport codes known as COG 10. The geometry consisted of {sup 239}Pu spheres homogeneously mixed with high-density polyethylene surrounded by a cube of either stainless steel 304 or aluminum. An optimized geometry for both cube materials and hydrogen-to-fissile isotope (H/X) ratio were determined for a single unit. Infinite and finite 3D arrays of these optimized units were then simulated to determine if the systems would exceed criticality. Completion of these simulations showed that the optimal H/X ratio for the most reactive units ranged from 800 to 1600. A single unit of either cube type for either scenario would not reach criticality. An infinite array was determined to reach criticality only for the 180g case. The offsetting of spheres in their respective cubes was also considered and showed a considerable decrease in the number of close-packed units needed to reach criticality. These results call into question the current regulations for fissile material transport, which under certain circumstances may not be sufficient in preventing the development of a critical system. However, a conservative, theoretical approach was taken in all assumptions and such idealized configurations may not be

  20. Evaluation of fission cross sections and covariances for {sup 233}U, {sup 235}U, {sup 238}U, {sup 239}Pu, {sup 240}Pu, and {sup 241}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Kawano, Toshihiko [Kyushu Univ., Fukuoka (Japan); Matsunobu, Hiroyuki [Data Engineering, Inc. (Japan); Murata, Toru [AITEL Corporation, Tokyo (JP)] [and others

    2000-02-01

    A simultaneous evaluation code SOK (Simultaneous evaluation on KALMAN) has been developed, which is a least-squares fitting program to absolute and relative measurements. The SOK code was employed to evaluate the fission cross sections of {sup 233}U, {sup 235}U, {sup 238}U, {sup 239}Pu, {sup 240}Pu, and {sup 241}Pu for the evaluated nuclear data library JENDL-3.3. Procedures of the simultaneous evaluation and the experimental database of the fission cross sections are described. The fission cross sections obtained were compared with evaluated values given in JENDL-3.2 and ENDF/B-VI. (author)

  1. American Chemical Society-239th national meeting--Investigating new therapeutic candidates: part 1. 21-25 March 2010, San Francisco, CA, USA.

    Science.gov (United States)

    Macauley, Donald

    2010-05-01

    The American Chemical Society 239th National Meeting, held in San Francisco, included topics covering developments related to the chemical optimization of therapeutics. This conference report highlights selected presentations on agents under investigation for the treatment of neurological disorders, malaria, HBV and diabetes. Investigational drugs discussed include PF-4888086, PF-4778574 and SAM-531 (all Pfizer Inc), a series of spirotetrahydro-beta-carbolines from Novartis AG, a series of biaryl ether analogs from Merck & Co Inc, and PF-04620110 (Pfizer Inc/Bristol-Myers Squibb Co).

  2. The Association of Inbreeding With Lung Fibrosis Incidence in Beagle Dogs That Inhaled 238PuO2 or 239PuO2.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Dulaney A.; Brigantic, Andrea M.; Morgan, William F.

    2011-09-12

    Studies of health effects in animals after exposure to internally deposited radionuclides were intended to supplement observational studies in humans. Both nuclear workers and Beagle dogs have exhibited plutonium associated lung fibrosis; however, the dogs smaller gene pool may limit the applicability of findings to humans. Data on Beagles that inhaled either plutonium-238 dioxide (238PuO2) or plutonium-239 dioxide (239PuO2) were analyzed. Wright's Coefficient of Inbreeding was used to measure genetic or familial susceptibility and was assessed as an explanatory variable when modeling the association between lung fibrosis incidence and plutonium exposure. Lung fibrosis was diagnosed in approximately 80% of the exposed dogs compared with 23.7% of the control dogs. The maximum degree of inbreeding was 9.4%. Regardless of isotope, the addition of inbreeding significantly improved the model in female dogs but not in males. In female dogs an increased inbreeding coefficient predicted decreased hazard of a lung fibrosis diagnosis. Lung fibrosis was common in these dogs with inbreeding affecting models of lung fibrosis incidence in females but not in males. The apparent protective effect in females predicted by these models of lung fibrosis incidence is likely to be minimal given the small degree of inbreeding in these groups.

  3. Development of self-interrogation neutron resonance densitometry (SINRD) to measure U-235 and Pu-239 content in a PWR spent fuel assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lafleur, Adrienne M [Los Alamos National Laboratory; Charlton, William S [Los Alamos National Laboratory; Menlove, Howard O [Los Alamos National Laboratory; Swinhoe, Martyn T [Los Alamos National Laboratory

    2009-01-01

    The use of Self-Interrogation Neutron Resonance Densitometry (SINRD) to measure the {sup 235}U and {sup 239}Pu content in a PWR spent fuel assembly was investigated via Monte Carlo N-Particle eXtended transport code (MCNPX) simulations. The sensitivity of SINRD is based on using the same fissile materials in the fission chambers as are present in the fuel because the effect of resonance absorption lines in the transmitted flux is amplified by the corresponding (n, f) reaction peaks in fission chamber. These simulations utilize the {sup 244}Cm spontaneous fission neutrons to self-interrogate the fuel pins. The amount of resonance absorption of these neutrons in the fuel can be measured using {sup 235}U and {sup 239}Pu fission chambers placed adjacent to the assembly. We used ratios of different fission chambers to reduce the sensitivity of the measurements to extraneous material present in fuel. The development of SINRD to measure the fissile content in spent fuel is of great importance to the improvement of nuclear safeguards and material accountability. Future work includes the use of this technique to measure the fissile content in FBR spent fuel and heavy metal product from reprocessing methods.

  4. Measurement of the 240Pu/239Pu mass ratio using a transition-edge-sensor microcalorimeter for total decay energy spectroscopy.

    Science.gov (United States)

    Hoover, Andrew S; Bond, Evelyn M; Croce, Mark P; Holesinger, Terry G; Kunde, Gerd J; Rabin, Michael W; Wolfsberg, Laura E; Bennett, Douglas A; Hays-Wehle, James P; Schmidt, Dan R; Swetz, Daniel; Ullom, Joel N

    2015-04-07

    We have developed a new category of sensor for measurement of the (240)Pu/(239)Pu mass ratio from aqueous solution samples with advantages over existing methods. Aqueous solution plutonium samples were evaporated and encapsulated inside of a gold foil absorber, and a superconducting transition-edge-sensor microcalorimeter detector was used to measure the total reaction energy (Q-value) of nuclear decays via heat generated when the energy is thermalized. Since all of the decay energy is contained in the absorber, we measure a single spectral peak for each isotope, resulting in a simple spectral analysis problem with minimal peak overlap. We found that mechanical kneading of the absorber dramatically improves spectral quality by reducing the size of radioactive inclusions within the absorber to scales below 50 nm such that decay products primarily interact with atoms of the host material. Due to the low noise performance of the microcalorimeter detector, energy resolution values of 1 keV fwhm (full width at half-maximum) at 5.5 MeV have been achieved, an order of magnitude improvement over α-spectroscopy with conventional silicon detectors. We measured the (240)Pu/(239)Pu mass ratio of two samples and confirmed the results by comparison to mass spectrometry values. These results have implications for future measurements of trace samples of nuclear material.

  5. The production of {sup 238-242}Pu(n,γ){sup 239-243}Pu fissionable fluids in a fusion-fission hybrid reactor

    Energy Technology Data Exchange (ETDEWEB)

    Guenay, Mehtap [Inoenue Univ., Malatya (Turkey). Physics Dept.

    2014-03-15

    In this study, the effect of spent fuel grade plutonium content on {sup 239-243}Pu was investigated in a designed hybrid reactor system. In this system, the fluids were composed of a molten salt, heavy metal mixture with increased mole fractions 99-95 % Li{sub 20}Sn{sub 80}-1-5 % SFG-Pu, 99-95 % Li{sub 20}Sn{sub 80}-1-5 % SFG-PuF{sub 4}, 99-95 % Li{sub 20}Sn{sub 80}-1-5 % SFG-PuO{sub 2}. Beryllium (Be) is a neutron multiplier by (n,2n) reactions. Thence, a Be zone of 3 cm thickness was used in order to contribute to fissile fuel breeding between the liquid first wall and a 9Cr2WVTa ferritic steel blanket which is used as structural material. The production of {sup 238-242}Pu(n,γ){sup 239-243}Pu was calculated in liquid first wall, blanket and shielding zones. Three-dimensional nucleonic calculations were performed by using the most recent version MCNPX-2.7.0 Monte Carlo code and nuclear data library ENDF/B-VII.0. (orig.)

  6. Detection and antibiotic susceptibility of mycoplasma isolates from 239 cervicitis patients%宫颈炎239例分泌物支原体检测及抗生素敏感性分析

    Institute of Scientific and Technical Information of China (English)

    陈瑛; 李静宜; 辛德莉

    2015-01-01

    Objective To analyze the antibiotic susceptibility of Ureaplasma urealytium(Uu)and Macoplasma hominis(Mh)isolates isolated from patients with cervicitis in order to provide reference for clinical diagnosis and treatment. Methods Cervical secretions of 239 cervicitis patients were obtained. The culture,identification,susceptibility testing were carried out with complex mycoplasma kits. Results The isolation rates of Uu,Uu/ Mh, and Mh were 33.1%,13.0%,and 1.3%,respectively(the total isolation rate was 47. 3%). Susceptibility testing showed that 79 Uu positive isolates were highly sensitive to tetracycline:doxycycline 97.5%,minocycline 97.4%;they showed different sensitivities to macrolides antibiotics:clarithromycin 94. 9%,azithromycin 75.9%,josamycin 96.2%,erythromycin 44.3%,roxithromycin 32.9%;for quinolone antibiotics,they were sensitive(89.9%)to gatifloxacin,but not to levofloxacin and sparfloxacin. The 31 Uu/ Mh positive isolates were susceptible to minocycline 83.9%,doxycyline 87.1%,josa-mycin 83.9%,gatifloxacin 35.5%,respectively. But,they were not susceptible to sparfloxacin,levofloxacin,azithromycin,erythromycin,clarithromy-cin,roxithromycin,and clindamycin. The 3 Mh isolates were not calculated,because the number was too small. Conclusion Mycoplasma isolation rate of cervical secretions collected from the patients with cervicitis was high. Uu isolation rate was higher than Uu/ Mh,and it was susceptible to most of tet-racyclines and macrolides antibiotics. Because sensible antibiotics were less,tetracyclines antibiotics should be prioritized in the treatment of patients from whom Uu and Mh were isolated.%目的:对门诊宫颈炎患者解脲脲原体(解脲支原体)和人型支原体(人型支原体)进行分析,了解抗生素敏感情况,为临床诊疗提供实验依据。方法无菌采集宫颈炎患者的宫颈分泌物,支原体相关试剂盒进行支原体的培养、鉴定和药物敏感试验。结果支原体总检出率为47.3

  7. American Chemical Society-239th national meeting--Investigating new therapeutic candidates: part 2. 21-25 March 2010, San Francisco, CA, USA.

    Science.gov (United States)

    Kirkham, Konrad

    2010-05-01

    The American Chemical Society 239th National Meeting, held in San Francisco, included topics covering developments related to the chemical optimization of therapeutics. This conference report highlights selected presentations on second-generation cholesterol absorption inhibitors (CAIs), CCK2 receptor antagonists to prevent acid rebound, HIF-PH inhibitors for anemia, the neonatal Fc receptor (FcRn) as a target for autoimmune disease, and GPR119 agonists and GLP-1 receptor agonists for the treatment of diabetes. Investigational drugs discussed include LPD-608 (Lipideon Biotechnology AG), a second-generation CAI series from Merck & Co Inc, JNJ-26070109 and JNJ-42041935 (both Johnson & Johnson), SYN-1436 (Syntonix Pharmaceuticals Inc), a series of GPR119 agonists from Roche Holding AG and Schering-Plough Research Institute, and a series of GLP-1 receptor agonists from Bristol-Myers Squibb Co.

  8. Standardization of (166m)Ho and 243Am/239Np by live-timed anti-coincidence counting with extending dead time.

    Science.gov (United States)

    da Silva, C J; Loureiro, J S; Delgado, J U; Poledna, R; Moreira, D S; Iwahara, A; Tauhata, L; da Silva, R L; Lopes, R T

    2012-09-01

    The National Laboratory for Metrology of Ionizing Radiation (LNMRI)/Brazil acquired (166m)Ho and (243)Am/(239)Np solutions from commercial suppliers in order to realize primary standardization and therefore reducing the associated uncertainties. The method used in the standardization was the live-timed 4πβ(LS)-γ(ΝaI(Tl)) anticoincidence counting. The live-timed anticoincidence system is operated since 2006 in LNMRI and is composed of two MTR2 modules donated by Laboratoire National Henri Becquerel (LNE-LNHB)/France. The data acquisition system uses a homemade LabView program and an Excel file for calculus. These systems have been used for primary standardization at LNMRI for many radionuclides and recently took part in the (124)Sb and (177)Lu International Key Comparisons with good performance.

  9. Spatial distribution of (241)Am, (137)Cs, (238)Pu, (239,240)Pu and (241)Pu over 17 year periods in the Ravenglass saltmarsh, Cumbria, UK.

    Science.gov (United States)

    Oh, J-S; Warwick, P E; Croudace, I W

    2009-01-01

    Ninety five surface scrape samples were collected at the Ravenglass saltmarsh and analysed for radionuclides by alpha spectrometry ((238)Pu and (239,240)Pu), gamma spectrometry ((241)Am and (137)Cs) and liquid scintillation counting ((241)Pu). Both (241)Am and (137)Cs activities are compared with those reported by Horrill [1983. Concentrations and spatial distribution of radioactivity in an ungrazed saltmarsh. In: Coughtrey, P.J. (Ed.), Ecological Aspects of Radionuclide Release. British Ecological Society Special Publication No. 3. Blackwell, Oxford, pp. 119-215.] Significant decreases in activities for both radionuclides were observed which is caused by the declining levels of discharges from the Sellafield nuclear reprocessing plant since the 1980s. It has been concluded that the spatial distribution of these radionuclides are controlled by the tidal currents and the clay contents in the sediments. There is evidence of surface erosion of the saltmarsh and redistribution of radionuclides in the saltmarsh using isotopic ratios of measured Pu.

  10. FPGA Implementation of A New Chien Search Block for Reed-Solomon Codes RS (255, 239 Used In Digital Video Broadcasting DVB-T

    Directory of Open Access Journals (Sweden)

    El Habti El Idrissi Anas

    2014-08-01

    Full Text Available The Reed-Solomon codes RS are widely used in communication systems, in particular forming part of the specification for the ETSI digital terrestrial television standard. In this paper a simple algorithm for error detection in the Chien Search block is proposed. This algorithm is based on a simple factorization of the error locator polynomial, which allows reducing the number of components required to implement the proposed algorithm on FPGA board. Consequently, it reduces the power consumption with a percentage which can reach 50 % compared to the basic RS decoder. First, we developed the design of Chien Search Block Second, we generated and simulated the hardware description language source code using Quartus software tools,finally we implemented the proposed algorithm of Chien search block for Reed-Solomon codesRS (255, 239 on FPGA board to show both the reduced hardware resources and low complexity compared to the basic algorithm.

  11. Effect of plasma viremia on apoptosis and immunophenotype of dendritic cells subsets in acute SIVmac239 infection of Chinese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Hou-Jun Xia

    Full Text Available Non-human primates such as Chinese rhesus macaques (Ch Rhs provide good animal models for research on human infectious diseases. Similar to humans, there are two principal subsets of dendritic cells (DCs in the peripheral blood of Ch Rhs: myeloid DCs (mDCs and plasmacytoid DCs (pDCs. In this study, two-color fluorescence-activated cell sorting (FACS analyses were used to identify the main DC subsets, namely CD1c(+ mDCs and pDCs from Ch Rhs. Then, the apoptosis and immunophenotype changes of DCs subsets were first described during the acute phase of SIVmac239 infection. Both the DCs subsets showed decreased CD4 expression and enhanced CCR5 expression; in particular, those of pDCs significantly changed at most time points. Interestingly, the plasma viral loads were negatively correlated with CD4 expression, but were positively correlated with CCR5 expression of pDCs. During this period, both CD1c(+ mDCs and pDCs were activated by enhancing expressions of co-stimulatory molecules, accompanied with increase in CCR7. Either CD80 or CD86 expressed on CD1c(+ mDCs and pDCs was positively correlated with the plasma viral loads. Our analysis demonstrates that the pDCs were more prone to apoptosis after infection during the acute phase of SIVmac239 infection, which may be due to their high expressions of CD4 and CCR5. Both DCs subsets activated through elevating the expression of co-stimulatory molecules, which was beneficial in controlling the replication of SIV. However, a mere broad immune activation initiated by activated DCs may lead to tragic AIDS progression.

  12. Integration of measurements with atmospheric dispersion models: Source term estimation for dispersal of (239)Pu due to non-nuclear detonation of high explosive

    Science.gov (United States)

    Edwards, L. L.; Harvey, T. F.; Freis, R. P.; Pitovranov, S. E.; Chernokozhin, E. V.

    1992-10-01

    The accuracy associated with assessing the environmental consequences of an accidental release of radioactivity is highly dependent on our knowledge of the source term characteristics and, in the case when the radioactivity is condensed on particles, the particle size distribution, all of which are generally poorly known. This paper reports on the development of a numerical technique that integrates the radiological measurements with atmospheric dispersion modeling. This results in a more accurate particle-size distribution and particle injection height estimation when compared with measurements of high explosive dispersal of (239)Pu. The estimation model is based on a non-linear least squares regression scheme coupled with the ARAC three-dimensional atmospheric dispersion models. The viability of the approach is evaluated by estimation of ADPIC model input parameters such as the ADPIC particle size mean aerodynamic diameter, the geometric standard deviation, and largest size. Additionally we estimate an optimal 'coupling coefficient' between the particles and an explosive cloud rise model. The experimental data are taken from the Clean Slate 1 field experiment conducted during 1963 at the Tonopah Test Range in Nevada. The regression technique optimizes the agreement between the measured and model predicted concentrations of (239)Pu by varying the model input parameters within their respective ranges of uncertainties. The technique generally estimated the measured concentrations within a factor of 1.5, with the worst estimate being within a factor of 5, very good in view of the complexity of the concentration measurements, the uncertainties associated with the meteorological data, and the limitations of the models. The best fit also suggest a smaller mean diameter and a smaller geometric standard deviation on the particle size as well as a slightly weaker particle to cloud coupling than previously reported.

  13. Variation of the activity concentrations and fluxes of natural (210Po, 210Pb) and anthropogenic (239,240Pu, 137Cs) radionuclides in the Strait of Gibraltar (Spain).

    Science.gov (United States)

    Gascó, C; Antón, M P; Delfanti, R; González, A M; Meral, J; Papucci, C

    2002-01-01

    The activity concentrations and fluxes of natural (210Pb, 210Po) and anthropogenic (239,240Pu, 137Cs) radionuclides have been determined in the different water masses crossing the Strait of Gibraltar. New data have been gathered during four multidisciplinary and multinational sampling campaigns, performed between 1997 and 1999 within the framework of the CANIGO-FLUGIST Project. Mean activity concentrations of 210Po (1.53+/-0.34 Bq m(-3), n = 30) and 210Pb (1.16+/-0.50 Bq m(-3), n = 31) in the Atlantic water entering the Mediterranean basin are about double those measured in the Mediterranean outflow, namely 0.84+/-0.34 Bq m(-3) (n = 22) for 210Po and 0.66+/-0.34 Bq m(-3) (n = 22) for 210Pb. The opposite trend is observed for 231,240Pu, with average concentrations of 9.9+/-3.0 mBq m(-3) (n = 29) in the incoming Atlantic flow and 22.0+/-3.0 mBq m(-3) (n = 22) in the outpouring Mediterranean water. In the case of 137Cs, the same concentrations were quantified in the waters moving inwards (2.52+/-0.28 Bq m(-3), n = 27) and outwards (2.14+/-0.52 Bq m(-3), n = 21) from the Mediterranean Sea. On this basis, the Mediterranean basin experiences a net annual input flux of 14 TBq of 210Pb and 19 TBq of 210Po, and a net annual loss of 0.34 TBq of 239,240Pu, while--at present--137Cs input and output fluxes appear to be balanced.

  14. Determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using radiochemical separation combined with radiometric and mass spectrometric measurements

    DEFF Research Database (Denmark)

    Xu, Yihong; Qiao, Jixin; Hou, Xiaolin

    2014-01-01

    This paper reports an analytical method for the determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using anion exchange chromatography in combination with extraction chromatography for chemical separation of Pu. Both radiometric methods (liquid scintillation...

  15. Delocalization and new phase in Americium: theory

    Energy Technology Data Exchange (ETDEWEB)

    Soderlind, P

    1999-04-23

    Density-functional electronic structure calculations have been used to investigate the high pressure behavior of Am. At about 80 kbar (8 GPa) calculations reveal a monoclinic phase similar to the ground state structure of plutonium ({alpha}-Pu). The experimentally suggested {alpha}-U structure is found to be substantially higher in energy. The phase transition from fcc to the low symmetry structure is shown to originate from a drastic change in the nature of the electronic structure induced by the elevated pressure. A calculated volume collapse of about 25% is associated with the transition. For the low density phase, an orbital polarization correction to the local spin density (LSD) theory was applied. Gradient terms of the electron density were included in the calculation of the exchange/correlation energy and potential, according to the generalized gradient approximation (GGA). The results are consistent with a Mott transition; the 5f electrons are delocalized and bonding on the high density side of the transition and chemically inert and non-bonding (localized) on the other. Theory compares rather well with recent experimental data which implies that electron correlation effects are reasonably modeled in our orbital polarization scheme.

  16. The proliferation potential of neptunium and americium

    Energy Technology Data Exchange (ETDEWEB)

    An, J. S.; Shin, J. S.; Kim, J. S.; Kwack, E. H.; Kim, B. K

    2000-05-01

    It is recognized that some trans-uranic elements other than plutonium, in particular Np and Am, if will be available in sufficient quantities, could be used for nuclear explosive devices. The spent fuel has been accumulating in number of nuclear power plant and operation of large scale commercial reprocessing plants. However, these materials are not covered by the definition of special fissionable material in the Agency Statute. At the time when the Statute was adopted, the availability of meaningful quantities of separated Np and Am was remote and they were not included in the definition of special fissionable material. Then, IAEA Board decided a measure for control of Np and Am on September 1999. This report contains the control method and the characteristic of Np and Am for using domestic nuclear industries, and it can be useful for understanding how to report and account of Np and Am. (author)

  17. Evaluation of neutron data for americium-241

    Energy Technology Data Exchange (ETDEWEB)

    Maslov, V.M.; Sukhovitskij, E.Sh.; Porodzinskij, Yu.V.; Klepatskij, A.B.; Morogovskij, G.B. [Radiation Physics and Chemistry Problems Inst., Minsk-Sosny (Belarus)

    1997-03-01

    The evaluation of neutron data for {sup 241}Am is made in the energy region from 10{sup -5} eV up to 20 MeV. The results of the evaluation are compiled in the ENDF/B-VI format. This work is performed under the Project Agreement CIS-03-95 with the International Science and Technology Center (Moscow). The Financing Party for the Project is Japan. The evaluation was requested by Y. Kikuchi (JAERI). (author). 60 refs.

  18. Determination of Fission Product Yields of 235U, 238U and 239Pu for Neutron Energies from 0.5 to 14.8 MeV

    Science.gov (United States)

    Gooden, Matthew; Arnold, Charles; Becker, John; Bhatia, Chitra; Bhike, Megha; Fowler, Malcolm; Howell, Calvin; Kelley, John; Stoyer, Mark; Tonchev, Anton; Tornow, Werner; Vieira, Dave; Wilhelmy, Jerry

    2014-03-01

    A joint TUNL-LANL-LLNL collaboration has been formed to study the issue of possible energy dependences for certain fission product isotopes. Work has been carried out at the TUNL 10 MV Tandem accelerator which produces nearly mono-energetic neutrons via either 2H(d,n)3He,3H(d,n)4He,or3H(p,n)3He reactions. Three dual fission ionization chambers dedicated to 235U, 238U and 239Pu thick target foils and thin monitor foils respectively, were exposed to the neutron beams. After irradiation, thick target foils were gamma counted over a period of 1-2 months and characteristic gamma rays from fission products were recorded using HPGe detectors at TUNL's low background counting area. Using the dual fission chambers, relative fission product yield were determined at a high precision of 2-3 % as well as absolute fission product yields at a lower precision of 5-6 %. Preliminary results will be presented for a number of fission product isotopes over the incident neutron energy range of 0.5 to 14.8 MeV.

  19. Energy Dependence of Neutron-Induced Fission Product Yields of 235U, 238U and 239Pu Between 0.5 and 14.8 MeV

    Science.gov (United States)

    Gooden, Matthew; Tornow, Werner; Tonchev, Anton; Vieira, Dave; Wilhelmy, Jerry; Arnold, Charles; Fowler, Malcolm; Stoyer, Mark

    2014-09-01

    Under a joint collaboration between TUNL-LANL-LLNL, a set of absolute fission product yield measurements have been performed. The energy dependence of a number of cumulative fission products between 0.5 and 14.8 MeV have been measured using quasi-monoenergetic neutron beams for three actinide targets, 235U, 238U and 239Pu, between 0.5 and 14.8 MeV. The FPYs were measured by a combination of activation utilizing specially designed dual-fission chambers and γ-ray counting. The dual-fission chambers are back-to-back ionization chambers encasing a target with thin deposits of the same target isotope in each chamber. This method allows for the direct measurement of the fission rate in the activation target with no reference to the fission cross-section, reducing uncertainties. γ-ray counting was performed on well-shield HPGe detectors over a period of 2 months per activation to properly identify fission products. Reported are absolute cumulative fission product yields for incident neutron energies of 0.5, 1.37, 2.4, 4.6 and 14.8 MeV.

  20. Capture and Fission rate of 232-Th, 238-U, 237-Np and 239-Pu from spallation neutrons in a huge block of lead.

    CERN Document Server

    Vlachoudis, Vasilis

    2000-01-01

    The study is centered on the research of the incineration possibility of nuclear waste, by the association of a particle accelerator with a multiplying medium of neutrons, in the project "Energy Amplifier" of C. Rubbia. It consists of the experimental determination of the rates of capture and fission of certain elements (232-Th, 238-U, 237-Np and 239-Pu) subjected to a fluence of fast spallation neutrons. These neutrons are produced by the interaction of high kinetic energy protons (several GeV) provided by the CERN-PS accelerator, on a large lead solid volume. The measurement techniques used in this work, are based on the activation of elements in the lead volume and the subsequent gamma spectroscopy of the activated elements, and also by the detection of fission fragment traces. The development, of a Monte Carlo code makes it possible, on one hand, to better understand the relevant processes, and on the other hand, to validate the code, by comparison with measurements, for the design and the construction of...

  1. Microdistribution and Long-Term Retention of 239Pu (NO3)4 in the Respiratory Tracts of an Acutely Exposed Plutonium Worker and Experimental Beagle Dogs

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Christopher E.; Wilson, Dulaney A.; Brooks, Antone L.; McCord, Stacey; Dagle, Gerald E.; James, Anthony C.; Tolmachev, Sergei Y.; Thrall, Brian D.; Morgan, William F.

    2012-11-01

    The long-term retention of inhaled soluble forms of plutonium raises concerns as to the potential health effects in persons working in nuclear energy or the nuclear weapons program. The distributions of long-term retained inhaled plutonium-nitrate [239Pu (NO3)4] deposited in the lungs of an accidentally exposed nuclear worker (Human Case 0269) and in the lungs of experimentally exposed beagle dogs with varying initial lung depositions were determined via autoradiographs of selected histological lung, lymph node, trachea, and nasal turbinate tissue sections. These studies showed that both the human and dogs had a non-uniform distribution of plutonium throughout the lung tissue. Fibrotic scar tissue effectively encapsulated a portion of the plutonium and prevented its clearance from the body or translocation to other tissues and diminished dose to organ parenchyma. Alpha radiation activity from deposited plutonium in Human Case 0269 was observed primarily along the sub-pleural regions while no alpha activity was seen in the tracheobronchial lymph nodes of this individual. However, relatively high activity levels in the tracheobronchial lymph nodes of the beagles indicated the lymphatic system was effective in clearing deposited plutonium from the lung tissues. In both the human case and beagle dogs, the appearance of retained plutonium within the respiratory tract was inconsistent with current biokinetic models of clearance for soluble forms of plutonium. Bound plutonium can have a marked effect on the dose to the lungs and subsequent radiation exposure has the potential increase in cancer risk.

  2. Alpha and conversion electron spectroscopy of {sup 238,239}Pu and {sup 241}Am and alpha-conversion electron coincidence measurements

    Energy Technology Data Exchange (ETDEWEB)

    Dion, Michael P., E-mail: michael.dion@pnnl.gov; Miller, Brian W.; Warren, Glen A.

    2016-09-11

    A technique to determine the isotopic constituents of a mixed actinide sample has been proposed by a coincident alpha-conversion electron measurement. This presents a unique signature to allow the unfolding of isotopes that possess overlapping alpha particle energy and reduce backgrounds of an unseparated sample. The work presented here are results of conversion electron spectroscopy of {sup 241}Am, {sup 238}Pu and {sup 239}Pu using a dual-stage peltier-cooled 25 mm{sup 2} silicon drift detector and alpha spectroscopy with a passivated ion implanted planar silicon detector. The conversion electron spectra were evaluated from 20–55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information and calibration to aid in the coincident measurement approach. Furthermore, an alpha-conversion electron spectrometer was assembled using the silicon based detectors described and results of a coincident spectrum analysis is reported for {sup 241}Am.

  3. Mixed tau, TDP-43 and p62 pathology in FTLD associated with a C9ORF72 repeat expansion and p.Ala239Thr MAPT (tau) variant.

    Science.gov (United States)

    King, Andrew; Al-Sarraj, Safa; Troakes, Claire; Smith, Bradley N; Maekawa, Satomi; Iovino, Mariangela; Spillantini, Maria Grazia; Shaw, Christopher E

    2013-02-01

    A massive intronic GGGGCC hexanucleotide repeat expansion in C9ORF72 has recently been identified as the most common cause of familial and sporadic amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). We have previously demonstrated that C9ORF72 mutant cases have a specific pathological profile with abundant p62-positive, TDP-43-negative cytoplasmic and intranuclear inclusions within cerebellar granular cells of the cerebellum and pyramidal cells of the hippocampus in addition to classical TDP-43 pathology. Here, we report mixed tau and TDP-43 pathology in a woman with behavioural variant FTLD who had the C9ORF72 mutation, and the p.Ala239Thr variant in MAPT (microtubule associated protein tau) gene not previously associated with tau pathology. Two of her brothers, who carried the C9ORF72 mutation, but not the MAPT variant, developed classical ALS without symptomatic cognitive changes. The dominant neuropathology in this woman with FTLD was a tauopathy with Pick's disease-like features. TDP-43 labelling was mainly confined to Pick bodies, but p62-positive, TDP-43-negative inclusions, characteristic of C9ORF72 mutations, were present in the cerebellum and hippocampus. Mixed pathology to this degree is unusual. One might speculate that the presence of the C9ORF72 mutation might influence tau deposition in what was previously thought to be a "benign" variant in MAPT in addition to the aggregation of TDP-43 and other as yet unidentified proteins decorated with ubiquitin and p62.

  4. Inhaled /sup 239/PuO/sub 2/ and/or total-body gamma radiation: Early mortality and morbidity in rats and dogs

    Energy Technology Data Exchange (ETDEWEB)

    Filipy, R.E.; Decker, J.R.; Lai, Y.L.; Lauhala, K.E.; Buschbom, R.L.; Hiastala, M.P.; McGee, D.R.; Park, J.F.; Kuffel, E.G.; Ragan, H.A.; Cannon, W.C.; Yaniv, S.S.; Scott, B.R.

    1988-08-01

    Rats and beagle dogs were given doses of /sup 60/Co gamma radiation and/or body burdens of /sup 239/PuO/sub 2/ within lethal ranges in an experiment to determine and compare morbidity and mortality responses of both species within 1 year after exposure. Radiation-induced morbidity was assessed by measuring changes in body weights, hematologic parameters, and pulmonary-function parameters. Gamma radiation caused transient morbidity, reflected by immediately depressed blood cell concentrations and by long-term loss of body weight and diminished pulmonary function in animals of both species that survived the acute gamma radiation syndrome. Inhaled plutonium caused a loss of body weight and diminished pulmonary function in both species, but its only effect on blood cell concentrations was lymphocytopenia in dogs. Combined gamma irradiation and plutonium lung burdens were synergistic, in that animals receiving both radiation insults had higher morbidity and mortality rates than would be predicted based on the effect of either kind of radiation alone. Plutonium lung burdens enhanced the effect of gamma radiation in rats within the first 30 days of exposure, and gamma radiation enhanced the long-term effect of plutonium lung burdens in both species. Rats were less sensitive to both kinds of radiation, whether administered alone or in combination. 71 refs., 105 figs., 48 tabs.

  5. Depletion of CD8+ cells does not affect the lifespan of productively infected cells during pathogenic sivmac239 infection of rhesus macaques

    Energy Technology Data Exchange (ETDEWEB)

    Shudo, Emi [Los Alamos National Laboratory; Ribeiro, Ruy M [Los Alamos National Laboratory; Perelson, Alan S [Los Alamos National Laboratory

    2008-01-01

    While CD8+ T cell responses are clearly important in anti-viral immunity during HIV/SIV infection, the mechanisms by which CD8+ T cells induce this effect remain poorly understood, as emphasized by the failure of the Merck adenovirus-based, cytotoxic T lymphocyte (CTL)-inducing AIDS vaccine in a large phase IIb clinical trial. In this study, we measured the in vivo effect of CD8+ lymphocytes on the lifespan of productively infected cells during chronic SIVmac239 infection of rhesus macaques by treating two groups of animals (i.e., CD8+ lymphocyte-depleted or controls) with antiretroviral therapy (PMPA and FTC). The lifespan of productively infected cells was calculated based on the slope of the decline of SIV plasma viremia using a well-accepted mathematical model. We found that, in both early (i.e., day 57 post-inoculation) and late (i.e., day 177 post-inoculation) chronic SIV infection, depletion of CD8+ lymphocytes did not result in an increased lifespan of productively infected cells in vivo. This result indicates that direct killing of cells producing virus is unlikely to be a major mechanism underlying the anti-viral effect of CD8+ T cells during SIV infection. These results have profound implications for the development of AIDS vaccines.

  6. Transmutation of $^{239}$Pu and Other Nuclides Using Spallation Neutrons Produced by Relativistic Protons Reacting with Massive U- and Pb-Targets

    CERN Document Server

    Adam, J; Bamblevski, V P; Barabanov, M Yu; Bradnova, V; Chaloun, P; Hella, K M; Kalinnikov, V G; Krivopustov, M I; Kulakov, B A; Perelygin, V P; Pronskikh, V S; Pavliouk, A V; Solnyshkin, A A; Sosnin, A N; Stegailov, V I; Tsoupko-Sitnikov, V M; Zaverioukha, O S; Adloff, J C; Debeauvais, M; Brandt, R; Langrock, E J; Vater, P; Van, J S; Westmeier, W; Dwivedi, K K; Guo Shi Lun; Li Li Qiang; Hashemi-Nezhad, S R; Kievets, M K; Lomonosova, E M; Zhuk, I V; Modolo, G; Odoj, R; Zamani-Valassiadou, M

    2001-01-01

    Experimental studies on the transmutation of some long-lived radioactive waste nuclei, such as ^{129}I, ^{237}Np, and ^{239}Pu, as well as on natural uranium and lanthanum (all of them used as sensors) were carried out at the Synchrophasotron of the Laboratory for High Energies (JINR, Dubna). Spallation neutrons were produced by relativistic protons with energies in the range of 0.5 GeV\\le E(p)\\le 1.5 GeV interacting with 20 cm long uranium or lead target stacks. The targets were surrounded by 6 cm paraffin moderators. The radioactive sensors mentioned above were positioned on the outside surface of the moderator and contained typically approximately 0.5 up to 1 gram of long-lived isotopes. The highly radioactive targets were produced perfectly well-sealed in aluminum containers by the Institute of Physics and Power Engineering, Obninsk, Russia. From the experimentally observed transmutation rates one can easily extrapolate, that in a subcritical nuclear power assembly (or "energy amplifier") using a 10 mA pr...

  7. Fluid dynamics simulation of highly loaded anion-exchange chromatography of Np(IV) based on adsorption isotherm determined by {sup 237+239}Np

    Energy Technology Data Exchange (ETDEWEB)

    Yamamura, T. [Institute for Materials Research, Tohoku University, Sendai, Miyagi 980-8577 (Japan)], E-mail: yamamura@imr.tohoku.ac.jp; Mitsugashira, T. [Institute for Materials Research, Tohoku University, Oarai, Ibaraki 311-1313 (Japan); Shiokawa, Y. [Institute for Materials Research, Tohoku University, Sendai, Miyagi 980-8577 (Japan); Aoki, D.; Homma, Y. [Institute for Materials Research, Tohoku University, Oarai, Ibaraki 311-1313 (Japan)

    2007-10-11

    In order to investigate the optimum condition for anion-exchange chromatography for purification and recovery of actinide(IV) constituting transuranium elements, a convective-diffusion equation model treating mass balance and Langmuir-type kinetics in porous system, which was developed for thorium(IV) by us, was applied to neptunium(IV). Absorption isotherm of neptunium(IV) to anion-exchange (MSA-1) resin was carried out by using {sup 237+239}Np in 6N HNO{sub 3} media and hereby parameters of the Langmuir-type kinetics were determined as k{sub 0} = 2.5 x 10{sup 3} and s{sub max} = 1.0. Accompanied with the fluid dynamics parameters already determined for the column system used for {sup 227+232}Th, elution curves of neptunium(IV) at highly loaded condition were estimated by the numerical calculation. According to the result, the loading of more than 10% of resin capacity leads to rapid breakthrough and severe tailing of neptunium which lowers purity and yield in the purification procedure. This numerical calculation will serve as a valuable measure to figure out column operation conditions for purification and recovery of transuranium elements.

  8. Microdistribution and long-term retention of 239Pu (NO3)4 in the respiratory tracts of an acutely exposed plutonium worker and experimental beagle dogs.

    Science.gov (United States)

    Nielsen, Christopher E; Wilson, Dulaney A; Brooks, Antone L; McCord, Stacey L; Dagle, Gerald E; James, Anthony C; Tolmachev, Sergei Y; Thrall, Brian D; Morgan, William F

    2012-11-01

    The long-term retention of inhaled soluble forms of plutonium raises concerns as to the potential health effects in persons working in nuclear energy or the nuclear weapons program. The distributions of long-term retained inhaled plutonium-nitrate [(239)Pu (NO(3))(4)] deposited in the lungs of an accidentally exposed nuclear worker (Human Case 0269) and in the lungs of experimentally exposed beagle dogs with varying initial lung depositions were determined via autoradiographs of selected histologic lung, lymph node, trachea, and nasal turbinate tissue sections. These studies showed that both the human and dogs had a nonuniform distribution of plutonium throughout the lung tissue. Fibrotic scar tissue effectively encapsulated a portion of the plutonium and prevented its clearance from the body or translocation to other tissues and diminished dose to organ parenchyma. Alpha radiation activity from deposited plutonium in Human Case 0269 was observed primarily along the subpleural regions while no alpha activity was seen in the tracheobronchial lymph nodes of this individual. However, relatively high activity levels in the tracheobronchial lymph nodes of the beagles indicated the lymphatic system was effective in clearing deposited plutonium from the lung tissues. In both the human case and beagle dogs, the appearance of retained plutonium within the respiratory tract was inconsistent with current biokinetic models of clearance for soluble forms of plutonium. Bound plutonium can have a marked effect on the dose to the lungs and subsequent radiation exposure has the potential to increase cancer risk.

  9. Measurement of electro-sprayed 238 and 239+240 plutonium isotopes using 4{pi}-alpha spectrometry. Application to environmental samples; Spectrometrie alpha 4{pi} de sources d'actinides realisees par electronebulisation. Developpement et optimisation d'un protocole applique au mesurage des isotopes 238 et 239+240 du plutonium dans l'environnement

    Energy Technology Data Exchange (ETDEWEB)

    Charmoille-Roblot, M. [CEA/Fontenay-aux-Roses, Dept. de Protection de l' Environnement (DPRE), 92 (France)]|[Paris-11 Univ., 91 - Orsay (France)

    1999-07-01

    A new protocol for plutonium deposition using the electro-spray technique coupled with 4{pi}-{alpha} spectrometry is proposed to improve the detection limit, shorten the counting time. In order to increase the detection efficiency, it was proposed to measure 238 and 239+240 plutonium isotopes electro-sprayed deposit simultaneously on both sides of the source support, that must be as transparent as possible to alpha-emissions, in a two-alpha detectors chamber. A radiochemical protocol was adapted to electro-spray constraints and a very thin carbon foil was selected for 4{pi} -alpha spectrometry. The method was applied to a batch of sediment samples and gave the same results as an electrodeposited source measured using conventional alpha spectrometry with a 25 % gain on counting time and 10 % on plutonium 238 detection limit. Validation and application of the technique have been made on reference samples. (author)

  10. Donepezil, an acetylcholine esterase inhibitor, and ABT-239, a histamine H3 receptor antagonist/inverse agonist, require the integrity of brain histamine system to exert biochemical and procognitive effects in the mouse.

    Science.gov (United States)

    Provensi, Gustavo; Costa, Alessia; Passani, M Beatrice; Blandina, Patrizio

    2016-10-01

    Histaminergic H3 receptors (H3R) antagonists enhance cognition in preclinical models and modulate neurotransmission, in particular acetylcholine (ACh) release in the cortex and hippocampus, two brain areas involved in memory processing. The cognitive deficits seen in aging and Alzheimer's disease have been associated with brain cholinergic deficits. Donepezil is one of the acetylcholinesterase (AChE) inhibitor approved for use across the full spectrum of these cognitive disorders. We addressed the question if H3R antagonists and donepezil require an intact histamine neuronal system to exert their procognitive effects. The effect of the H3R antagonist ABT-239 and donepezil were evaluated in the object recognition test (ORT), and on the level of glycogen synthase kinase 3 beta (GSK-3β) phosphorylation in normal and histamine-depleted mice. Systemic administration of ABT-239 or donepezil ameliorated the cognitive performance in the ORT. However, these compounds were ineffective in either genetically (histidine decarboxylase knock-out, HDC-KO) or pharmacologically, by means of intracerebroventricular (i.c.v.) injections of the HDC irreversible inhibitor a-fluoromethylhistidine (a-FMHis), histamine-deficient mice. Western blot analysis revealed that ABT-239 or donepezil systemic treatments increased GSK-3β phosphorylation in cortical and hippocampal homogenates of normal, but not of histamine-depleted mice. Furthermore, administration of the PI3K inhibitor LY294002 that blocks GSK-3β phosphorylation, prevented the procognitive effects of both drugs in normal mice. Our results indicate that both donepezil and ABT-239 require the integrity of the brain histaminergic system to exert their procognitive effects and strongly suggest that impairments of PI3K/AKT/GSK-3β intracellular pathway activation is responsible for the inefficacy of both drugs in histamine-deficient animals.

  11. Analysis of {sup 236}U and plutonium isotopes, {sup 239,240}Pu, on the 1 MV AMS system at the Centro Nacional de Aceleradores, as a potential tool in oceanography

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, Elena; López-Lora, Mercedes [Centro Nacional de Aceleradores (Universidad de Sevilla, Consejo Superior de Investigaciones Científicas, Junta de Andalucía), Thomas Alva Edison 7, 41092 Seville (Spain); Villa, María [Departamento de Física Aplicada II, Universidad de Sevilla, Av. Reina Mercedes 4A, 41012 Seville (Spain); Servicio de Radioisótopos, Centro de Investigación, Tecnología e Innovación, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Seville (Spain); Casacuberta, Núria [Laboratory of Ion Beam Physics, ETH Zürich, Otto-Stern-Weg 5, CH-8093 Zürich (Switzerland); López-Gutiérrez, José María [Centro Nacional de Aceleradores (Universidad de Sevilla, Consejo Superior de Investigaciones Científicas, Junta de Andalucía), Thomas Alva Edison 7, 41092 Seville (Spain); Departamento de Física Aplicada I, Escuela Universitaria Politécnica, Universidad de Sevilla, Virgen de África 7, 41011 Seville (Spain); Pham, Mai Khanh [IAEA-Environment Laboratories, Monte Carlo 98000 (Monaco)

    2015-10-15

    The performance of the 1 MV AMS system at the CNA (Centro Nacional de Aceleradores, Seville, Spain) for {sup 236}U and {sup 239,240}Pu measurements has been extensively investigated. A very promising {sup 236}U/{sup 238}U abundance sensitivity of about 3 × 10{sup −11} has been recently achieved, and background figures for {sup 239}Pu of about 10{sup 6} atoms were reported in the past. These promising results lead to the use of conventional low energy AMS systems for the analysis of {sup 236}U and {sup 239}Pu and its further application in environmental studies. First {sup 236}U results obtained on our AMS system for marine samples (sediments and water) are presented here. Results of two new IAEA reference materials (IAEA-410 and IAEA-412, marine sediments from Pacific Ocean) are reported. The obtained {sup 236}U/{sup 239}Pu atom ratios, of 0.12 and 0.022, respectively, show a dependency with the contamination source (i.e. local fallout from the US tests performed at the Bikini Atoll and general fallout). The results obtained for a third IAEA reference material (IAEA-381, seawater from the Irish Sea), are also presented. In the following, the uranium and plutonium isotopic compositions obtained on a set of 5 intercomparison seawater samples from the Arctic Ocean provided by the ETH Zürich are discussed. By comparing them with the obtained results on the 600 kV AMS facility Tandy at the ETH Zürich, we demonstrate the solidity of the CNA technique for {sup 236}U/{sup 238}U determinations at, at least, 7 × 10{sup −10} level. Finally, these results are discussed in their environmental context.

  12. Ultra-trace determination of (90)Sr, (137)Cs, (238)Pu, (239)Pu, and (240)Pu by triple quadruple collision/reaction cell-ICP-MS/MS: Establishing a baseline for global fallout in Qatar soil and sediments.

    Science.gov (United States)

    Amr, Mohamed A; Helal, Abdul-Fattah I; Al-Kinani, Athab T; Balakrishnan, Perumal

    2016-03-01

    The development of practical, fast, and reliable methods for the ultra-trace determination of anthropogenic radionuclides (90)Sr, (137)Cs, (238)Pu, (239)Pu, and (240)Pu by triple quadruple collision/reaction cell inductively coupled plasma mass spectrometry (CRC-ICP-MS/MS) were investigated in term of its accuracy and precision for producing reliable results. The radionuclides were extracted from 1 kg of the environmental soil samples by concentrated nitric and hydrochloric acids. The leachate solutions were measured directly by triple quadrupole CRC-ICP-MS/MS. For quality assurance, a chemical separation of the concerned radionuclides was conducted and then measured by single quadrupole-ICP-MS. The developed methods were next applied to measure the anthropogenic radionuclides (90)Sr, (137)Cs, (238)Pu, (239)Pu, and (240)Pu in soil samples collected throughout the State of Qatar. The average concentrations of (90)Sr, (137)Cs, (238)Pu, (239)Pu, and (240)Pu were 0.606 fg/g (3.364 Bq/kg), 0.619 fg/g (2.038 Bq/kg), 0.034 fg/g (0.0195 Bq/kg), 65.59 fg/g (0.150 Bq/kg), and 12.06 fg/g (0.103 Bq/kg), respectively.

  13. Simultaneous determination of radiocesium ((135)Cs, (137)Cs) and plutonium ((239)Pu, (240)Pu) isotopes in river suspended particles by ICP-MS/MS and SF-ICP-MS.

    Science.gov (United States)

    Cao, Liguo; Zheng, Jian; Tsukada, Hirofumi; Pan, Shaoming; Wang, Zhongtang; Tagami, Keiko; Uchida, Shigeo

    2016-10-01

    Due to radioisotope releases in the Fukushima Dai-ichi Nuclear Power Plant (FDNPP) accident, long-term monitoring of radiocesium ((135)Cs and (137)Cs) and Pu isotopes ((239)Pu and (240)Pu) in river suspended particles is necessary to study the transport and fate of these long-lived radioisotopes in the land-ocean system. However, it is expensive and technically difficult to collect samples of suspended particles from river and ocean. Thus, simultaneous determination of multi-radionuclides remains as a challenging topic. In this study, for the first time, we report an analytical method for simultaneous determination of radiocesium and Pu isotopes in suspended particles with small sample size (1-2g). Radiocesium and Pu were sequentially pre-concentrated using ammonium molybdophosphate and ferric hydroxide co-precipitation, respectively. After the two-stage ion-exchange chromatography separation from the matrix elements, radiocesium and Pu isotopes were finally determined by ICP-MS/MS and SF-ICP-MS, respectively. The interfering elements of U ((238)U(1)H(+) and (238)U(2)H(+) for (239)Pu and (240)Pu, respectively) and Ba ((135)Ba(+) and (137)Ba(+) for (135)Cs and (137)Cs, respectively) were sufficiently removed with the decontamination factors of 1-8×10(6) and 1×10(4), respectively, with the developed method. Soil reference materials were utilized for method validation, and the obtained (135)Cs/(137)Cs and (240)Pu/(239)Pu atom ratios, and (239+240)Pu activities showed a good agreement with the certified/information values. In addition, the developed method was applied to analyze radiocesium and Pu in the suspended particles of land water samples collected from Fukushima Prefecture after the FDNPP accident. The (135)Cs/(137)Cs atom ratios (0.329-0.391) and (137)Cs activities (23.4-152Bq/g) suggested radiocesium contamination of the suspended particles mainly originated from the accident-released radioactive contaminates, while similar Pu contamination of suspended

  14. Immunogenicity of seven new recombinant yellow fever viruses 17D expressing fragments of SIVmac239 Gag, Nef, and Vif in Indian rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Mauricio A Martins

    Full Text Available An effective vaccine remains the best solution to stop the spread of human immunodeficiency virus (HIV. Cellular immune responses have been repeatedly associated with control of viral replication and thus may be an important element of the immune response that must be evoked by an efficacious vaccine. Recombinant viral vectors can induce potent T-cell responses. Although several viral vectors have been developed to deliver HIV genes, only a few have been advanced for clinical trials. The live-attenuated yellow fever vaccine virus 17D (YF17D has many properties that make it an attractive vector for AIDS vaccine regimens. YF17D is well tolerated in humans and vaccination induces robust T-cell responses that persist for years. Additionally, methods to manipulate the YF17D genome have been established, enabling the generation of recombinant (rYF17D vectors carrying genes from unrelated pathogens. Here, we report the generation of seven new rYF17D viruses expressing fragments of simian immunodeficiency virus (SIVmac239 Gag, Nef, and Vif. Studies in Indian rhesus macaques demonstrated that these live-attenuated vectors replicated in vivo, but only elicited low levels of SIV-specific cellular responses. Boosting with recombinant Adenovirus type-5 (rAd5 vectors resulted in robust expansion of SIV-specific CD8(+ T-cell responses, particularly those targeting Vif. Priming with rYF17D also increased the frequency of CD4(+ cellular responses in rYF17D/rAd5-immunized macaques compared to animals that received rAd5 only. The effect of the rYF17D prime on the breadth of SIV-specific T-cell responses was limited and we also found evidence that some rYF17D vectors were more effective than others at priming SIV-specific T-cell responses. Together, our data suggest that YF17D - a clinically relevant vaccine vector - can be used to prime AIDS virus-specific T-cell responses in heterologous prime boost regimens. However, it will be important to optimize rYF17D

  15. Uncertainty analyses in the resolved resonance region of {sup 235}U, {sup 238}U, and {sup 239}Pu with the Reich-Moore R-matrix theory for JENDL-3.2

    Energy Technology Data Exchange (ETDEWEB)

    Kawano, Toshihiko [Kyushu University, Interdisciplinary Graduate School of Engineering Sciences, Kasuga, Fukuoka (Japan); Shibata, Keiichi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2002-08-01

    A simple method to estimate covariances for resolved resonance parameters was developed. Although a large number of resolved resonances are observed for major actinides, uncertainties in averaged cross sections are more important than those in resonance parameters in reactor calculations. The method developed here derives a covariance matrix for the resolved resonance parameters which gives an appropriate uncertainty of the averaged cross sections. The method was adopted to evaluate the covariance data for {sup 235}U, {sup 238}U, and {sup 239}Pu resonance parameters in JENDL-3.2, with the Reich-Moore R-matrix formula. (author)

  16. Influences of parameter uncertainties within the ICRP-66 respiratory tract model: regional tissue doses for 239PuO2 and 238UO2/238U3O8.

    Science.gov (United States)

    Farfán, Eduardo B; Huston, Thomas E; Bolch, W Emmett; Vernetson, William G; Bolch, Wesley E

    2003-04-01

    This paper extends an examination of the influence of parameter uncertainties on regional doses to respiratory tract tissues for short-ranged alpha particles using the ICRP-66 respiratory tract model. Previous papers examined uncertainties in the deposition and clearance aspects of the model. The critical parameters examined in this study included target tissue depths, thicknesses, and masses, particularly within the thoracic or lung regions of the respiratory tract. Probability density functions were assigned for the parameters based on published data. The probabilistic computer code LUDUC (Lung Dose Uncertainty Code) was used to assess regional and total lung doses from inhaled aerosols of 239PuO2 and 238UO2/238U3O8. Dose uncertainty was noted to depend on the particle aerodynamic diameter. Additionally, dose distributions were found to follow a lognormal distribution pattern. For 239PuO2 and 238UO2/238U3O8, this study showed that the uncertainty in lung dose increases by factors of approximately 50 and approximately 70 for plutonium and uranium oxides, respectively, over the particle size range from 0.1 to 20 microm. For typical exposure scenarios involving both radionuclides, the ratio of the 95% dose fractile to the 5% dose fractile ranged from approximately 8-10 (corresponding to a geometric standard deviation, or GSD, of about 1.7-2) for particle diameters of 0.1 to 1 microm. This ratio increased to about 370 for plutonium oxide (GSD approximately 4.5) and to about 600 for uranium oxide (GSD approximately 5) as the particle diameter approached 20 microm. However, thoracic tissue doses were quite low at larger particle sizes because most of the deposition occurred in the extrathoracic airways. For 239PuO2, median doses from LUDUC were found be in general agreement with those for Reference Man (via deterministic LUDEP 2.0 calculations) in the particle range of 0.1 to 5 microm. However, median doses to the basal cell nuclei of the bronchial airways (BB

  17. New measurements of (n,γ) and (n,fission) cross sections and capture-to-fission ratios for ^233,235U and ^239Pu using the DANCE 4π BaF2 array

    Science.gov (United States)

    Bredeweg, T. A.; Jandel, M.; Fowler, M. M.; Bond, E. M.; Haight, R. C.; Keksis, A. L.; O'Donnell, J. M.; Reifarth, R.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.; Wouters, J. M.; Becker, J. A.; Parker, W. E.; Wu, C. Y.; Baker, J. D.; McGrath, C. A.

    2009-10-01

    Accurate neutron nuclear data are important to many issues in stockpile stewardship, nuclear reactor design and re-certification, nuclear non-proliferation and nuclear forensics. Of particular interest are the production and destruction reactions for all of the major and most of the minor actinides. The competition between capture and fission in many of the actinides presents both an obstacle and an opportunity for large γ detector arrays such as DANCE. Additional instrumentation is required to deconvolve the two contributions to the total observed γ-ray spectrum. However, conducting a simultaneous measurement can simplify background treatment and other sources of systematic uncertainty. An outline of the current experimental program will be presented along with results from neutron capture measurements on ^233,235U and ^239Pu.

  18. Synchronous Changes of the Shape of Histograms Constructed from the Results of Measurements of 90-Sr Beta-Decay and 239-Pu Alpha-Decay Observed in More than 3000 km Distant Laboratories

    Directory of Open Access Journals (Sweden)

    Filin E. Y.

    2015-07-01

    Full Text Available It was discovered many years ago that histograms constructed from the results of mea- surements of various natural processes are not random. The histogram shape was demonstrated to be determined by the diurnal rotation and circumsolar movement of the Earth and to be independent of the nature of the process considered [1-17]. The results of those works change our basic views about stochasticity of natural processes. When the time series of physical measurements, which are traditionally considered stochastic, are transformed into the series of histograms constructed for an optimally small num- ber of the results (i.e., optimally short segment of the time series, one can see regular changes in the histogram shape. The paper illustrates the main manifestations of this phenomenon by comparing the results of 90 Sr -radioactivity and 239 Pu -decay mea- surements, with the distance between the laboratories in which the data were collected being about 3000 km.

  19. Proceedings of the NEANDC/NEACRP specialists meeting on fast neutron fission cross sections of U-233, U-235, U-238, and Pu-239, June 28--30, 1976, at Argonne National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Poenitz, W P; Guenther, P T

    1976-01-01

    Data files of all available data of absolute cross section measurements of U-233, U-235, U-238 and Pu-239, and of the ratios of U-233, U-238, and Pu-239 to U-235 were assembled at Argonne National Laboratory for use by the two Working Groups. The data files of absolute cross sections included also data measured relative to one of the standard cross sections H(n,n), Li-6(n,..cap alpha..), and B-10(n,..cap alpha..), and the ratio data files included ratios derived from absolute values which were measured in an identical type of experiment by the same group of experimenters. The subject files (e.g., U-235-Absolute, or U-238/U-235-Ratio, etc.) consisted of ''Sets.'' These sets contained the data from one experimental group which may have been published at different times. The assembling of the files was started with an extract from the CSISRS data files of the National Neutron Cross Section Center at the Brookhaven National Laboratory. Ratios were derived from quoted consistent sets of absolute cross sections, or from data which were actually measured as ratios but quoted as absolute values. The latter type of data was eliminated from the data files on absolute values. The files were improved by an extensive search for errors and data missing on the original CSISRS files at the time the extract was made. Other additions to the present subject files came from presentations made at this meeting and are described in the proceedings.

  20. Study of the electrochemical oxidation of Am with lacunary heteropolyanions and silver nitrate; Etude de l'oxydation electrochimique de l'americium en presence d'heteropolyanions lacunaires et de nitrate d'argent en milieu aqueux acide

    Energy Technology Data Exchange (ETDEWEB)

    Chartier, D

    1999-07-01

    Electrochemical oxidation of Am(III) with certain lacunary heteropolyanions (LHPA {alpha}{sub 2}-P{sub 2}W{sub 17}O{sub 61}{sup 10-} or {alpha}SiW{sub 11}O{sub 39}{sup 8-}) and silver nitrate is an efficient way to prepare Am(VI). This document presents bibliographic data and an experimental study of the process. Thus, it has been established that Am(IV) is an intermediate species in the reaction and occurs in 1:1 (Amt{sup IV}LHPA) or 1:2 (Am {sup IV}(LHAP){sub 2}) complexes with the relevant LHPA. These 1:1 complexes of Am(IV) have been identified and isolated in this work whereas 1:2 complexes were known from previous studies. The reactivity of these complexes in oxidation shows that 1:1 complexes of Am(IV) are oxidised much more quickly than 1:2 complexes. Apparent stability constants of Am(III) and Am(IV) complexes with the relevant LHPA have been measured for a 1 M nitric acid medium. Thermodynamic data of the reaction are then assessed: redox potentials of Am pairs are computed for a 1 M nitric acid medium containing various amount of LHPA ligands. Those results show that the role of LHPA is to stabilize the intermediate species Am(IV) by lowering the Am(IV)/Am(III) pair potential of about 1 Volt. Nevertheless, if this stabilisation is too strong (i.e. of tungsto-silicate), the oxidation of Am(IV) requires high anodic potential (more than 2 V/ENH). Then, the faradic yield of the oxidation of americium is poor because of water oxidation. This study has also shown that the main role of silver is to catalyze the electrochemical oxidation of Am{sup IV}(LHPA){sub X} complexes. Indeed, these oxidations without silver are extremely slow. An oxygen tracer experiment has been performed during the oxidation of Am(III) in Am(VI). It has been shown that the oxygen atoms of Am(VI) (AMO{sub 2}{sup 2+}) come from water molecules of the solvent and not from the complexing oxygen atoms of the ligands. (author)

  1. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions; Fabricacion de blancos para la transmutacion de americio: sintesis de matrices inertes por el metodo sol-gel. Estudio del procedimiento de infiltracion de disoluciones radiactivas

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez Carretero, A. [Universidad Complutense de Madrid (Spain)

    2002-07-01

    made. In addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  2. Historical Review of Californium-252 Discovery and Development

    Science.gov (United States)

    Stoddard, D. H.

    1985-01-01

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed. (PLG)

  3. 241镅跟骨骨密度测定在骨质疏松症中的初步应用 ——与腰椎骨密度测定的对比研究%Preliminary application of 241-Americium calcaneus bone mineral density measurement in osteoporosis ——comparison with double X-ray densitometry of the lumber spine

    Institute of Scientific and Technical Information of China (English)

    管梁; 朱承谟; 李培勇; 王辉; 濮鸣芳; 仇季高

    2001-01-01

    Bone mineral density (BMD) of calcaneus in 54 normals, 45 Osteoporosis, 25 suspected osteoporosis and 16 other non-osteoporosis patients, a total of 140 cases were measured by HUAKE (HK-1) 241-Americium BMD absorpmetry, among them 43 were compared with that of lumber spine (L2—L4) measured by Lunar Corporation's Expert-XL absorpmeter. BMD of normal group of calcaneus was (409.8±79.4)mg/cm2. The BMD were decreased slowly with the increased age. The BMD of osteoporosis, suspected osteoporosis and non-osteoporosis group were 230.3±62.3, 395.7±57.4 and 363.3±51.9mg/cm2 respectively. The BMD of osteoporosis group was much lower than that of normal group, and also lower than that of the other two groups, among 26 patients (57.78%) had bone fracture, all was in accordance with the clinical diagnosis of osteoporosis. The BMD of suspected ospteoporosis and non-osteoporosis had no significant difference with normal group. The coefficient variation (CV) of BMD in repeated measurement in calcaneus of 4 pariticipants was less than 1.2%. The correlative coefficient (r) between BMD of calcaneus and lumber spine (L2—L4) group was 0.6824. The correlative coefficient of normal young adult-matched percentage and T value in 2 groups were 0.6863 and 0.6755 respectively, whereas aged-matched percentage, Z value were 0.4614 and 0.5009 respectively. In conclusion 241-Americium calcaneus BMD absorpmetry has the advantage of low price, easy to operate, reliable and valuable in diagnosis osteoporosis. The correlations of calcaneus and lumber spine BMD, normal young adult-matched percentagy and T value were rather good.%为评价跟骨骨密度测定在骨质疏松症中的初步临床应用及与腰椎测定结果的相关性,用国产华科(HK-1型)241镅骨密度仪测定了140例跟骨骨密度(BMD)。其中正常人组54例,骨质疏松确诊组45例,骨质疏松可疑组25例和其他非骨质疏松组16例。其中43例与美国Luner 公司的Expert-XL图像骨密度仪腰

  4. Decay Heat Analyses after Thermal-Neutron Fission of {sup 235}U and {sup 239}Pu by SCALE-6.1.3 with Recently Available Fission Product Yield Data

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Do Heon; Gil, Choong-Sup; Lee, Young-Ouk [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2014-10-15

    The heat reaches about 1.5% after one hour and falls to 0.4% after a day. After a week it will be about 0.2%. The reactor, however, still requires further cooling for several years to keep the fuel rods safe. In general, the decay heat in the reactors can be calculated using a summation calculation method, which is simply the sum of the activities of the fission products produced during the fission process and after the reactor shutdown weighted by the mean decay energies. Consequently, the method is strongly dependent on the available nuclear structure data. Nowadays, the method has been implemented in various burnup and depletion programs such as ORIGEN and CINDER. In this study, the decay heat measurements after thermal-neutron fission of {sup 235}U and {sup 239}Pu have been evaluated by the ORIGEN-S with the decay data and fission product yield libraries included in the SCALE-6.1.3 software package. The new libraries were applied to the decay heat calculations, and the results were compared with those by the ORIGEN reference calculation. The decay heat measurements for very short cooling times after thermal-neutron fission of {sup 235}U and {sup 239}Pu have been evaluated by the ORIGEN-S summation calculation. The reference calculation results by the latest ORIGEN data libraries of the SCALE-6.1.3 have been validated with the measurements by ORNL and Studsvik. In addition, the generation of the new ORIGEN yield libraries has been completed based on the ENDF/B-VII.1, JEFF-3.1.1, JENDL/FPY-2011, and JENDL-4.0. The new libraries have been successfully applied to the decay heat calculations and comparative analyses have been devoted to verifying the importance of the fission product yield data when estimating the decay heat values for each isotope in a very short time. The decay data library occupies an important position in the ORIGEN summation calculation along with the fission product yield library.

  5. Spatial distribution of {sup 241}Am, {sup 137}Cs, {sup 238}Pu, {sup 239,240}Pu and {sup 241}Pu over 17 year periods in the Ravenglass saltmarsh, Cumbria, UK

    Energy Technology Data Exchange (ETDEWEB)

    Oh, J.-S. [GAU-Radioanalytical, School of Ocean and Earth Science, National Oceanography Centre, Southampton SO14 3ZH (United Kingdom)], E-mail: jsoh@noc.soton.ac.uk; Warwick, P.E. [GAU-Radioanalytical, School of Ocean and Earth Science, National Oceanography Centre, Southampton SO14 3ZH (United Kingdom)], E-mail: pew@noc.soton.ac.uk; Croudace, I.W. [GAU-Radioanalytical, School of Ocean and Earth Science, National Oceanography Centre, Southampton SO14 3ZH (United Kingdom)], E-mail: iwc@noc.soton.ac.uk

    2009-07-15

    Ninety five surface scrape samples were collected at the Ravenglass saltmarsh and analysed for radionuclides by alpha spectrometry ({sup 238}Pu and {sup 239,240}Pu), gamma spectrometry ({sup 241}Am and {sup 137}Cs) and liquid scintillation counting ({sup 241}Pu). Both {sup 241}Am and {sup 137}Cs activities are compared with those reported by Horrill [1983. Concentrations and spatial distribution of radioactivity in an ungrazed saltmarsh. In: Coughtrey, P.J. (Ed.), Ecological Aspects of Radionuclide Release. British Ecological Society Special Publication No. 3. Blackwell, Oxford, pp. 119-215.] Significant decreases in activities for both radionuclides were observed which is caused by the declining levels of discharges from the Sellafield nuclear reprocessing plant since the 1980s. It has been concluded that the spatial distribution of these radionuclides are controlled by the tidal currents and the clay contents in the sediments. There is evidence of surface erosion of the saltmarsh and redistribution of radionuclides in the saltmarsh using isotopic ratios of measured Pu.

  6. Estimation of covariances of {sup 16}O, {sup 23}Na, Fe, {sup 235}U, {sup 238}U and {sup 239}Pu neutron nuclear data in JENDL-3.2

    Energy Technology Data Exchange (ETDEWEB)

    Shibata, Keiichi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nakajima, Yutaka; Kawano, Toshihiko; Oh, Soo-Youl; Matsunobu, Hiroyuki; Murata, Toru

    1997-10-01

    Covariances of nuclear data have been estimated for 6 nuclides contained in JENDL-3.2. The nuclides considered are {sup 16}O, {sup 23}Na, Fe, {sup 235}U, {sup 238}U, and {sup 239}Pu, which are regarded as important for the nuclear design study of fast reactors. The physical quantities for which covariances are deduced are cross sections, resolved and unresolved resonance parameters, and the first order Legendre-polynomial coefficient for the angular distribution of elastically scattered neutrons. As for {sup 235}U, covariances were obtained also for the average number of neutrons emitted in fission. The covariances were estimated by using the same methodology that had been used in the JENDL-3.2 evaluation in order to keep a consistency between mean values and their covariances. The least-squares fitting code GMA was used in estimating covariances for reactions of which JENDL-3.2 cross sections had been evaluated by taking account of measurements. In nuclear model calculations, the covariances were calculated by the KALMAN system. The covariance data obtained were compiled in the ENDF-6 format, and will be put into the JENDL-3.2 Covariance File which is one of JENDL special purpose files. (author). 193 refs.

  7. Estimation of multi-group cross section covariances for {sup 235,238}U, {sup 239}Pu, {sup 241}Am, {sup 56}Fe, {sup 23}Na and {sup 27}Al

    Energy Technology Data Exchange (ETDEWEB)

    De Saint Jean, C.; Archier, P.; Noguere, G.; Litaize, O.; Vaglio-Gaudard, C.; Bernard, D.; Leray, O. [CEA, DEN, DER, Cadarache, F-13108 Saint-Paul-lez-Durance (France)

    2012-07-01

    This paper presents the methodology used to estimate multi-group covariances for some major isotopes used in reactor physics. The starting point of this evaluation is the modelling of the neutron induced reactions based on nuclear reaction models with parameters. These latest are the vectors of uncertainties as they are absorbing uncertainties and correlation arising from the confrontation of nuclear reaction model to microscopic experiment. These uncertainties are then propagated towards multi-group cross sections. As major breakthroughs were then asked by nuclear reactor physicists to assess proper uncertainties to be used in applications, a solution is proposed by the use of integral experiment information at two different stages in the covariance estimation. In this paper, we will explain briefly the treatment of all type of uncertainties, including experimental ones (statistical and systematic) as well as those coming from validation of nuclear data on dedicated integral experiment (nuclear data oriented). We will illustrate the use of this methodology with various isotopes such as {sup 235,238}U, {sup 239}Pu, {sup 241}Am, {sup 56}Fe, {sup 23}Na and {sup 27}Al. (authors)

  8. Distribution and inventories of fallout radionuclides ({sup 239+24}Pu, {sup 137}Cs) and {sup 21}Pb to study the filling velocity of salt marshes in Donana National Park (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Gasco, C. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain); Anton, M.P. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain)]. E-mail: maripaz.anton@ciemat.es; Pozuelo, M. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain); Clemente, L. [Consejo Superior de Investigaciones Cientificas, Instituto de Recursos Naturales y Agrobiologia, CSIC-IRNA, Departamento de Geoecologia, Avda. Reina Mercedes s/n, Sevilla 41012 (Spain); Rodriguez, A. [Universidad de Huelva, Departamento de Geodinamica y Paleontologia, Avda. de las Fuerzas Armadas s/n, Huelva 21071 (Spain); Yanez, C. [Consejo Superior de Investigaciones Cientificas, Instituto de Recursos Naturales y Agrobiologia, CSIC-IRNA, Departamento de Geoecologia, Avda. Reina Mercedes s/n, Sevilla 41012 (Spain); Gonzalez, A. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain); Meral, J. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain)

    2006-07-01

    Within an extensive multinational and multidisciplinary project carried out in Donana National Park (Spain) to investigate its preservation and regeneration, the filling velocity of the salt marshes has been evaluated through the calculation of their average sediment accumulation rates. {sup 239+24}Pu and {sup 137}Cs from weapons testing fallout and total {sup 21}Pb distribution profiles and inventories have been determined in some of the most characteristic zones of the park, namely, the ponds (or 'lucios') and the waterjets (or 'canos'). Plutonium inventories range from 16 to 101 Bq m{sup -2}, {sup 137}Cs values fluctuate between 514 and 3758 Bq m{sup -2} and unsupported {sup 21}Pb values comprise between 124 and 9398 Bq m{sup -2}. Average sedimentation rates range from 3 to 5 mm y{sup -1} (1952-2002). These data are higher than those obtained by carbon dating for the period 6500 AD-present, estimated as 1.5-2 mm y{sup -1}, suggesting an increase in the accumulation of sediments and the alteration of the park's hydrodynamics caused by the re-channeling of the major rivers feeding the salt marshes.

  9. A method of measurement of (239)Pu, (240)Pu, (241)Pu in high U content marine sediments by sector field ICP-MS and its application to Fukushima sediment samples.

    Science.gov (United States)

    Bu, Wenting; Zheng, Jian; Guo, Qiuju; Aono, Tatsuo; Tazoe, Hirofumi; Tagami, Keiko; Uchida, Shigeo; Yamada, Masatoshi

    2014-01-01

    An accurate and precise analytical method is highly needed for the determination of Pu isotopes in marine sediments for the long-term marine environment monitoring that is being done since the Fukushima Dai-ichi Nuclear Power Plant accident. The elimination of uranium from the sediment samples needs to be carefully checked. We established an analytical method based on anion-exchange chromatography and SF-ICP-MS in this work. A uranium decontamination factor of 2 × 10(6) was achieved, and the U concentrations in the final sample solutions were typically below 4 pg mL(-1), thus no extra correction of (238)U interferences from the Pu spectra was needed. The method was suitable for the analysis of (241)Pu in marine sediments using large sample amounts (>10 g). We validated the method by measuring marine sediment reference materials and our results agreed well with the certified and the literature values. Surface sediments and one sediment core sample collected after the nuclear accident were analyzed. The characterization of (241)Pu/(239)Pu atom ratios in the surface sediments and the vertical distribution of Pu isotopes showed that there was no detectable Pu contamination from the nuclear accident in the marine sediments collected 30 km off the plant site.

  10. Accumulation of polonium 210Po, uranium (234U and 238U and plutonium (238Pu and 239+240Pu in tissues and organs of deer Carvidae from northern Poland

    Directory of Open Access Journals (Sweden)

    Strumińska-Parulska D. I.

    2013-04-01

    Full Text Available Livers, kidneys and muscles of large herbivorous animals: roe deer (Capreolus capreolus, red deer (Cervus elaphus and fallow deer (Dama dama, collected in northern Poland, were the subject of the investigation. Polonium, uranium and plutonium activities were measured using alpha spectrometry along with relevant radiochemical procedures. The average concentrations of 210Po ranged between 0.02±0.01 Bq kg−1 ww in muscles and 7.15±0.12 Bq kg−1 ww in kidneys. The concentration of 238U ranged widely between 2.49±0.18 and 69.37±5.45 mBq kg−1 ww. The average concentrations of 239+240Pu ranged between 0.18±0.04 mBq kg−1 ww in muscle and 2.77±0.60 mBq kg−1 ww in kidneys. Statistical analysis showed that the sampling location, sex, age and species did not influence on the radioisotope activities in the analyzed samples.

  11. Americium separation from nuclear fuel dissolution using higher oxidation states.

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher

    2009-09-01

    Much of the complexity in current AFCI proposals is driven by the need to separate the minor actinides from the lanthanides. Partitioning and recycling Am, but not Cm, would allow for significant simplification because Am has redox chemistry that may be exploited while Cm does not. Here, we have explored methods based on higher oxidation states of Am (AmV and AmVI) to partition Am from the lanthanides. In a separate but related approach we have also initiated an investigation of the utility of TRUEX Am extraction from thiocyanate solution. The stripping of loaded TRUEX by Am oxidation or SCN- has not yet proved successful; however, the partitioning of inextractable AmV by TRUEX shows promise.

  12. Property Data for Simulated Americium/Curium Glasses

    Energy Technology Data Exchange (ETDEWEB)

    Riley, B.J.; Smith, D.E.; Peeler, D.K.; Reamer, I.A.; Vienna, J.D.; Schweiger, M.J.

    1999-10-20

    The authors studied the properties of mixed lanthanide-alumino-borosilicate glasses. Fifty-five glasses were designed to augment a previous, Phase I, study by systematically varying the composition of Ln{sub 2}O{sub 3} and the concentrations of Ln{sub 2}O{sub 3}, SiO{sub 2}, B{sub 2}O{sub 3}, Al{sub 2}O{sub 3}, and SrO in glass. These glasses were designed and fabricated at the Savannah River Technology Center and tested at the Pacific Northwest National Laboratory. The properties measured include the high-temperature viscosity ({eta}) as a function of temperature (T) and the liquidus temperature (T{sub L}) of Phase II test glasses.

  13. Biosorption of americium-241 by immobilized Rhizopus arrihizus

    Energy Technology Data Exchange (ETDEWEB)

    Liao Jiali E-mail: liaojiali@163.com; Yang Yuanyou; Luo Shunzhong; Liu Ning; Jin Jiannan; Zhang Taiming; Zhao Pengji

    2004-01-01

    Rhizopus arrihizus (R. arrihizus), a fungus, which in previous experiments had shown encouraging ability to remove {sup 241}Am from solutions, was immobilized by calcium alginate and other reagents. The various factors affecting {sup 241}Am biosorption by the immobilized R. arrihizus were investigated. The results showed that not only can immobilized R. arrihizus adsorb {sup 241}Am as efficiently as free R. arrihizus, but that also can be used repeatedly or continuously. The biosorption equilibrium was achieved within 2 h, and more than 94% of {sup 241}Am was removed from {sup 241}Am solutions of 1.08 MBq/l by immobilized R. arrihizu in the pH range 1-7. Temperature did not affect the adsorption on immobilized R. arrihizus in the range 15-45 deg. C. After repeated adsorption for 8 times, the immobilized R. arrihizus still adsorbed more than 97% of {sup 241}Am. At this time, the total adsorption of {sup 241}Am was more than 88.6 KBq/g, and had not yet reached saturation. Ninety-five percent of the adsorbed {sup 241}Am was desorbed by saturated EDTA solution and 98% by 2 mol/l HNO{sub 3}.

  14. QTL Information Table: 239 [Q-TARO

    Lifescience Database Archive (English)

    Full Text Available ve effects and additive-by-additive epistatic effects of QTLs for yield traits in a... 97B Milyang 46 A RG561 RM228 pha Zhuang, J.Y., Fan, Y.Y., Rao, Z.M., Wu, J.L., Xia, Y.W., and Zheng, K.L. (2002). Analysis on additi

  15. 48 CFR 239.7401 - Definitions.

    Science.gov (United States)

    2010-10-01

    ...-stock company, trust, governmental body, or corporation not subject to regulation by a U.S. governmental... which regulate a company owned by the same entity which creates the regulatory body. (d) Noncommon..., images, sounds, or intelligence of any nature, by wire, cable, satellite, fiber optics, laser, radio,...

  16. Plutonium 238/239 Decorporation Model

    Science.gov (United States)

    2014-10-01

    Ionizing Radiation, 3rd ed. Philadelphia, Saunders. Maydew RC, Bush J. 1997. America’s Lost H-Bomb: Palomares, Spain, 1966. Sunflower University Press...3 ∗ The movement of plutonium particulates within the respiratory tract is depicted in Figure 6 and can be represented by the following

  17. TMFunction data: 239 [TMFunction[Archive

    Lifescience Database Archive (English)

    Full Text Available HC. J Biol Chem. 2000 Jul 14;275(28):21017-24 mutagenesis ... affinity chromatography 1AJJ ... LDLR_HUMAN (P01130) Helix ... ligand binding site; surface exposed; acidic residue; conserved

  18. 48 CFR 239.7408-1 - General.

    Science.gov (United States)

    2010-10-01

    ....” (c) Special construction costs may be— (1) A contingent liability for using telecommunications...) Expediting provision of facilities; or (4) Providing specially constructed channel facilities to meet... costs. These costs are usually expressed in terms of a termination liability, as provided in...

  19. 32 CFR 239.6 - Eligibility.

    Science.gov (United States)

    2010-07-01

    ... rehabilitation, or due to retirement in connection with such disability, and (C) Who needs to market the primary... a family member caregiver or the need to find work more accommodating to the disability.) (ii... Force. (B) Who relocate from their primary residence in furtherance of medical treatment,...

  20. Calorimetry of low mass Pu239 items

    Energy Technology Data Exchange (ETDEWEB)

    Cremers, Teresa L [Los Alamos National Laboratory; Sampson, Thomas E [Los Alamos National Laboratory

    2010-01-01

    Calorimetric assay has the reputation of providing the highest precision and accuracy of all nondestructive assay measurements. Unfortunately, non-destructive assay practitioners and measurement consumers often extend, inappropriately, the high precision and accuracy of calorimetric assay to very low mass items. One purpose of this document is to present more realistic expectations for the random uncertainties associated with calorimetric assay for weapons grade plutonium items with masses of 200 grams or less.

  1. 49 CFR 239.107 - Emergency exits.

    Science.gov (United States)

    2010-10-01

    ... a desk-top computer (i.e., monitor, central processing unit, and keyboard) and either a facsimile... service, except for self-propelled cars designed to carry baggage, mail, or express: (1) That all...

  2. 7 CFR 23.9 - General.

    Science.gov (United States)

    2010-01-01

    ... “Title V” authorizes funds to finance work authorized under title V which serve two or more States; in... responsive to rural development needs and activities. (c) The Regional Programs will concentrate on the high... purposes; the development of strategies and procedures on high priority rural development problems...

  3. 49 CFR 239.7 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... sleeping car or coach assigned to intercity service, other than food, beverage, or security service. Division headquarters means the location designated by the railroad where a high-level operating manager (e... the Administrator's delegate. Control center means a central location on a railroad...

  4. Energy Dependence of Fission Product Yields from 235U, 238U and 239Pu for Incident Neutron Energies Between 0.5 and 14.8 MeV

    Science.gov (United States)

    Gooden, M. E.; Arnold, C. W.; Becker, J. A.; Bhatia, C.; Bhike, M.; Bond, E. M.; Bredeweg, T. A.; Fallin, B.; Fowler, M. M.; Howell, C. R.; Kelley, J. H.; Krishichayan; Macri, R.; Rusev, G.; Ryan, C.; Sheets, S. A.; Stoyer, M. A.; Tonchev, A. P.; Tornow, W.; Vieira, D. J.; Wilhelmy, J. B.

    2016-01-01

    Fission Product Yields (FPY) have historically been one of the most observable features of the fission process. They are known to have strong variations that are dependent on the fissioning species, the excitation energy, and the angular momentum of the compound system. However, consistent and systematic studies of the variation of these FPY with energy have proved challenging. This is caused primarily by the nature of the experiments that have traditionally relied on radiochemical procedures to isolate specific fission products. Although radiochemical procedures exist that can isolate all products, each element presents specific challenges and introduces varying degrees of systematic errors that can make inter-comparison of FPY uncertain. Although of high importance in fields such as nuclear forensics and Stockpile Stewardship, accurate information about the energy dependence of neutron induced FPY are sparse, due primarily to the lack of suitable monoenergetic neutron sources. There is a clear need for improved data, and to address this issue, a collaboration was formed between Los Alamos National Laboratory (LANL), Lawrence Livermore National Laboratory (LLNL) and the Triangle Universities Nuclear Laboratory (TUNL) to measure the energy dependence of FPY for 235U, 238U and 239Pu. The measurements have been performed at TUNL, using a 10 MV Tandem Van de Graaff accelerator to produce monoenergetic neutrons at energies between 0.6 MeV to 14.8 MeV through a variety of reactions. The measurements have utilized a dual-fission chamber, with thin (10-100 μg/cm2) reference foils of similar material to a thick (100-400 mg) activation target held in the center between the chambers. This method allows for the accurate determination of the number of fissions that occurred in the thick target without requiring knowledge of the fission cross section or neutron fluence on target. Following activation, the thick target was removed from the dual-fission chamber and gamma

  5. Simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments; Mesure des isotopes du plutonium des sediments marins par spectrometrie de masse a plasma couple inductivement haute resolution (HR ICP-MS)

    Energy Technology Data Exchange (ETDEWEB)

    Bruneau, F

    1999-07-01

    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  6. Seasonal variations in activity concentrations of {sup 137}Cs, {sup 40}K, {sup 7}Be, {sup 228}Ac, {sup 99}Tc, {sup 90}Sr, and {sup 239/240}Pu in Fucus vesiculosus and Ascophyllum nodosum from the South-Eastern coast of Norway

    Energy Technology Data Exchange (ETDEWEB)

    Raaum, A.; Christensen, G.C. [Institute for Energy Technology, Health and Safety Dept., Kjeller (Norway)

    2004-07-01

    Brown algae have been proven to be useful indicator organisms for heavy metals and radionuclides in the marine environments due to their ability to concentrate elements from the ambient water. There is quite a lot of data available on {sup 137}Cs in brown algae, especially for Fucus Vesiculosus. Fucus Vesiculosus is also commonly used to monitor the impact of the releases of {sup 99}Tc from the reprocessing plant in Sellafield. There is however a lack of data for other long-lived anthropogenic nuclides as {sup 90}Sr and Pu, and for natural occurring radionuclides. There is also a need for more knowledge about the mechanisms for uptake and accumulation of the different elements, and about different factors influencing the uptake. In this study activity concentrations of {sup 137}Cs, {sup 40}K, {sup 7}Be, {sup 228}Ac, {sup 99}Tc, {sup 90}Sr and {sup 239/240}Pu are measured in whole plants of Fucus vesiculosus and Ascophyllum nodosum collected over a period of one year from the south-eastern coast of Norway. Significant differences between the two species have been found. For {sup 137}Cs, {sup 40}K, {sup 7}Be, {sup 228}Ra and {sup 239/240}Pu, the activity concentrations were significantly higher in Fucus vesiculosus than in Ascophyllum nodosum, whereas for {sup 99}Tc the activity concentrations were higher in Ascophyllum nodosum than in Fucus vesiculosus. There were great seasonal variations in the concentrations of the measured radionuclides. For {sup 99}Tc there was also a difference in the temporal pattern for the two species. Possible uptake mechanisms will be discussed based on the results and on the known physiological differences between the two species. (author)

  7. Modification of a loop sequence between α-helices 6 and 7 of virus capsid (CA protein in a human immunodeficiency virus type 1 (HIV-1 derivative that has simian immunodeficiency virus (SIVmac239 vif and CA α-helices 4 and 5 loop improves replication in cynomolgus monkey cells

    Directory of Open Access Journals (Sweden)

    Adachi Akio

    2009-08-01

    Full Text Available Abstract Background Human immunodeficiency virus type 1 (HIV-1 productively infects only humans and chimpanzees but not cynomolgus or rhesus monkeys while simian immunodeficiency virus isolated from macaque (SIVmac readily establishes infection in those monkeys. Several HIV-1 and SIVmac chimeric viruses have been constructed in order to develop an animal model for HIV-1 infection. Construction of an HIV-1 derivative which contains sequences of a SIVmac239 loop between α-helices 4 and 5 (L4/5 of capsid protein (CA and the entire SIVmac239 vif gene was previously reported. Although this chimeric virus could grow in cynomolgus monkey cells, it did so much more slowly than did SIVmac. It was also reported that intrinsic TRIM5α restricts the post-entry step of HIV-1 replication in rhesus and cynomolgus monkey cells, and we previously demonstrated that a single amino acid in a loop between α-helices 6 and 7 (L6/7 of HIV type 2 (HIV-2 CA determines the susceptibility of HIV-2 to cynomolgus monkey TRIM5α. Results In the study presented here, we replaced L6/7 of HIV-1 CA in addition to L4/5 and vif with the corresponding segments of SIVmac. The resultant HIV-1 derivatives showed enhanced replication capability in established T cell lines as well as in CD8+ cell-depleted primary peripheral blood mononuclear cells from cynomolgus monkey. Compared with the wild type HIV-1 particles, the viral particles produced from a chimeric HIV-1 genome with those two SIVmac loops were less able to saturate the intrinsic restriction in rhesus monkey cells. Conclusion We have succeeded in making the replication of simian-tropic HIV-1 in cynomolgus monkey cells more efficient by introducing into HIV-1 the L6/7 CA loop from SIVmac. It would be of interest to determine whether HIV-1 derivatives with SIVmac CA L4/5 and L6/7 can establish infection of cynomolgus monkeys in vivo.

  8. Plutonium interaction with a bacterial strain isolated from the waste isolation pilot plant (WIPP) environment

    Energy Technology Data Exchange (ETDEWEB)

    Strietelmeier, B.A.; Kraus, S.M.; Leonard, P.A.; Triay, I.R. [Los Alamos National Lab., NM (United States)] [and others

    1996-12-31

    This work was conducted as part of a series of experiments to determine the association and interaction of various actinides with bacteria isolated from the WIPP site. The majority of bacteria that exist at the site are expected to be halophiles, or extreme halophiles, due to the high concentration of salt minerals at the location. Experiments were conducted to determine the toxicity of plutonium-n-239, neptunium-237 and americium-243 to several species of these halophiles and the results were reported elsewhere. As an extension of these experiments, we report an investigation of the type of association that occurs between {sup 239}Pu and the isolate WIPP-1A, isolated by staff at Brookhaven National Laboratory, when grown in a high-salt, defined medium. Using scanning electron microscopy (SEM) techniques, we demonstrate a surface association of the {sup 239}Pu with the bacterial cells.

  9. Dicty_cDB: SHE239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Lib_D Pinus taeda cDNA clone PIMFW90 3' end, mRNA sequence. 48 0.27 1 DT364098 |DT364098.1 JGI_ANNN9278.rev ANNN Pimephales promelas... Whole (L) Pimephales promelas cDNA clone ANNN9278 3', mR...NA sequence. 48 0.27 1 DT347978 |DT347978.1 JGI_CAAX10802.fwd CAAX Pimephales promelas testis 7-8 month adul...ts, males and females pooled (L) Pimephales promelas cDNA clone CAAX10802 5', mRNA sequence. 48 0.27 1 DT309...975 |DT309975.1 JGI_CAAX1517.fwd CAAX Pimephales promelas testis 7-8 month adults, males and females pooled (L) Pimephales promelas

  10. 32 CFR 239.9 - Application Processing Procedures.

    Science.gov (United States)

    2010-07-01

    ... = Military PCS. (iv) State: State abbreviation. (v) Installation Number: The five digit ZIP code of the... which they depart. (vi) Application Number: Sequential beginning with 0001. ER30SE09.249 (d) Real Estate Values. (1) Because the PFMV is the purchase price for Expanded HAP, no appraisal of the property...

  11. 48 CFR 352.239-70 - Standard for security configurations.

    Science.gov (United States)

    2010-10-01

    ... systems using Windows XPTM and Windows VistaTM, including desktops and laptops—regardless of function—but not including servers. (b) The Contractor shall apply approved security configurations to information... (HSPD-12) card readers with the purchase of servers, desktops, and laptops; and (2) comply with...

  12. Dicty_cDB: CHS239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available neering clone MHPN192d01. 42 9.9 1 AZ781723 |AZ781723.1 2M0021H18F Mouse 10kb plasm...end partial sequence. 42 9.9 1 CR029411 |CR029411.1 Forward strand read from insert in 5'HPRT insertion targeting and chromosome engi

  13. Dicty_cDB: SHB239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available qqvelqrshqrqpf Frame C: ---segatggnsgaaiga**wccxwsx*xrcxxsk*wxctwcx*wkqxrcxwcckxk*wr cswsk*wcrncck*wcrxcc...k*wcrxcck*rkqcrcnwcckwk*wrcswsk*wcrncck* wcck*wccncck*wccswsk*wccncck*wrcncckwwkwckw

  14. 40 CFR 180.239 - Phosphamidon; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ...) PESTICIDE PROGRAMS TOLERANCES AND EXEMPTIONS FOR PESTICIDE CHEMICAL RESIDUES IN FOOD Specific Tolerances... residues of the insecticide phosphamidon (2-chloro-2-diethylcarbamoyl-1-methylvinyl dimethyl...

  15. Neutron powder diffraction study of 239PuD x

    Science.gov (United States)

    Bartscher, W.; Boeuf, A.; Caciuffo, R.; Fournier, J. M.; Haschke, J. M.; Manes, L.; Rebizant, J.; Rustichelli, F.; Ward, J. W.

    1985-05-01

    A neutron powder diffraction study has been carried out on several deuterids of Plutonium (PuD 2.25,PuD 2.33, PuD 2.65) to determine the positions of deuterium atoms in the host metal f.c.c. lattice. It has been found that vacancies occur in the tetrahedral sites. Moreover, with increasing deuterium concentration, octahedral interstitial deuterium atoms are displaced from their ideal positions. These results can be explained by the formation of clusters. Finally, at low temperature, these compounds become ferromagnetically ordered. An ordered magnetic moment μ 0≈0.8 μ B has been measured on all compounds.

  16. Dicty_cDB: AFI239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehydration Library Tortula ruralis ...7908 O17908 H06O01.1 PROTEIN. [1] ;, mRNA sequence. 70 4e-08 1 CN206834 |CN206834.1 Tor7258 Game

  17. Dicty_cDB: CFH239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ffifiiynlixlif*wqn*k*lfil**ffvvvsnflldtkrrllhfihlqvicipl liifghvivsltktvdsvhlnaimpvsmqfsrppmrsstvmntcfhyfile...vkxxdckxtxkxxsxxxl Frame C: *iiiffifiiynlixlif*wqn*k*lfil**ffvvvsnflldtkrrllhfihlqvicipl liifghvivsltktvdsvhlnaim

  18. 48 CFR 352.239-71 - Standard for encryption language.

    Science.gov (United States)

    2010-10-01

    ... Representative. (c) The Contractor shall use the Key Management Key (see FIPS 201, Chapter 4, as amended) on the... Contractor's property management/control system or establish a separate procedure to account for all laptop... and use a key recovery mechanism to ensure the ability for authorized personnel to decrypt and...

  19. [239Pu and chromosomal aberrations in human peripheral blood lymphocytes].

    Science.gov (United States)

    Okladnikova, N D; Osovets, S V; Kudriavtseva, T I

    2009-01-01

    The genome status in somatic cells was assessed using the chromosomal aberration (CA) test in peripheral blood lymphocytes from 194 plutonium workers exposed to occupational radiation mainly from low-transportable compounds of airborne 230Pu. Pu body burden at the time of cytogenetic study varied from values close to the method sensitivity to values multiply exceeding the permissible level. Standard (routine) methods of peripheral blood lymphocytes cultivation were applied. Chromatid- and chromosomal-type structural changes were estimated. Aberrations were estimated per 100 examined metaphase cells. The quantitative relationship between the CA frequency and Pu body burden and the absorbed dose to the lung was found. Mathematical processing of results was carried out based on the phenomenological model. The results were shown as theoretical and experimental curves. The threshold of the CA yield was 0.43 +/- 0.03 kBq (Pu body burden) and 6.12 +/- 1.20 cGy (absorbed dose to the lung).

  20. Toxicological versus Radiological Hazards of {sup 239}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Tansky, R.R.

    2001-07-26

    Plutonium is frequently referred to as ''the most toxic substance known to man''. While there are other chemicals that cause more immediately serious health consequences, plutonium does have the lowest permissible levels for any of the radioactive elements. Concentration limits for plutonium and its compounds are based on its radiotoxicity, specifically carcinogenicity, not on its chemical toxicity.

  1. Phenotype-gene: 239 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available d in organ named vascular leaf during process named senescence in period of sporophyte senescent stage for A...ss named senescence in period of sporophyte senescent stage http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u739i AT5G05700

  2. Dicty_cDB: AFF239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SSESD XDRFXNINNDDXDXPXXQQQPVXQPEXEXXXQEXEKVXEPIXEXXXKVEXKVEEPVAEQX XXKVXEPVXAEXXKVEEPXTEEXKVEE Translated Am...VXEPIXEXXXKVEXKVEEPVAEQX XXKVXEPVXAEXXKVEEPXTEEXKVEE Frame C: lfifvlyslfisflyidkf

  3. Dicty_cDB: VSI239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ) Frame A: kink*yknkikr*inkfkqliiiiikk**ylkimkfdsiqf*nqyyyyyyclsmviivkq hnnf*mkilimhylenin...ikr*xnkfkqliiiiikk**ylkimkfdsiqf*nqyyyyyyclsmvii vkqhnnf*mkilimhyleninlkksikpnn**kmtqicipigqrfqqqqqtnqtnqikd

  4. Some comments on the toxicity of /sup 239/Pu

    Energy Technology Data Exchange (ETDEWEB)

    Rowland, R.E.

    1978-01-01

    There is no simple method of expressing a concept such as toxicity. The toxicity of a material depends upon its form (solid, liquid, or gas), the method of entry into the body (ingestion, inhalation, or abrasion), and the individual it enters (young, old, sick, well, heavy cigarette smoker, or consumer of alcohol). Thus, statements such as ''plutonium is the most toxic material known to man'' are not only incorrect; they are meaningless. By taking the one aspect of plutonium which can be quantitated in a meaningful manner, the induction of malignant bone sarcomas in humans, the incremental risk presented to those who have been exposed to this radioelement has been shown to be quite small. By means of a hypothetical exposure of radium dial workers to plutonium instead of radium, an industry-wide exposure to plutonium would have been less harmful than the actual exposure to radium, in spite of the fact that plutonium appears to be far more toxic than radium. Further, the observation that, after radium was recognized as a toxic material, it no longer was a hazard in the dial industry, clearly demonstrates that hazardous radioactive materials can be handled safely. This has been demonstrated again with plutonium, for even though much larger quantities have been handled by many more individuals, there are no demonstrable cases of malignancies induced by this hazardous material. The absence of clearly demonstrable excesses of lung cancer in the large group of long-term thorium workers is reassuring, for it may imply that low doses to the lung have a very low probability of inducing lung cancers. It is concluded that plutonium, a highly toxic material, can be handled safely, as are many other hazardous materials that play important roles in our daily lives.

  5. Lessons learned in the accident of contamination with Pu-239; Lecciones aprendidas en el accidente de contaminacion con Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Molina, G.; Ruiz C, M.; Angeles C, A.; Benitez S, J.A. [ININ, 52045 Estado de Mexico (Mexico)]. e-mail: gm@nuclear.inin.mx

    2004-07-01

    This work describes the lessons learned during the accident by transuranic contamination in the National Institute of Nuclear Research happened between 1998 and 2003. The origin of the same one is the not authorized transfer of 0.51 g of plutonium metallic used as pattern source in the Department of Metrology to a laboratory which lacked of physical infrastructure, training and team to manipulate this source. (Author)

  6. Geological and physicochemical controls of the spatial distribution of partition coefficients for radionuclides (Sr-90, Cs-137, Co-60, Pu-239,240 and Am-241) at a site of nuclear reactors and radioactive waste disposal (St. Petersburg region, Russian Federation).

    Science.gov (United States)

    Rumynin, Vyacheslav G; Nikulenkov, Anton M

    2016-10-01

    The paper presents a study of the sorption properties of sediments of different geological ages and lithological types, governing radionuclide retention in the subsurface (up to 160 m beneath the surface) within the area of potential influence of the Northwestern Center of Atomic Energy (NWCAE), St. Petersburg region, RF. The focus of this work is mostly on the sedimentary rocks of two types, i.e., weakly cemented sandstone and lithified clay formations of Cambrian and Vendian series. The first lithological unit is associated with a groundwater reservoir (Lomonosov aquifer), and the second one, with both a relative aquitard in the upper part of the Vendian formation (Kotlin clay) and a regional aquifer (Gdov aquifer) in the lower part of the formation. The main mechanisms responsible for the variability of the sorption distribution coefficient (Kd, defined as the ratio of the concentration of solute on solid phase to its concentration in solution at equilibrium) was identified for radionuclides such as Sr-90, Cs-137, Co-60, Pu-239,240, and Am-241. It was shown that the main factors contributing to the chemical heterogeneity of the Cambrian sandstone were related to the presence of secondary minerals (iron and magnesium oxides and hydroxides produced by the weathering process) in trace amounts, forming correlated layer structures. The statistical analysis of nonlinear isotherms confirmed this conclusion. For the Vendian formation, a determinate trend was established in the Kd change over depth as a result of temporal trends in the sedimentation process and pore-water chemistry. The geostatistical characteristics and the spatial correlation models for describing linear sorption of different radionuclides are not identical, and the exhibition of chemical heterogeneity of sedimentary rock of a particular lithological type depends on radionuclide chemistry. Moreover, variogram analysis for some Kd data sets (both in Cambrian and Vendian formations) demonstrates the

  7. Americium and plutonium separation by extraction chromatography for determination by accelerator mass spectrometry.

    Science.gov (United States)

    Kazi, Zakir H; Cornett, Jack R; Zhao, Xaiolei; Kieser, Liam

    2014-06-04

    A simple method was developed to separate Pu and Am using single column extraction chromatography employing N,N,N',N'-tetra-n-octyldiglycolamide (DGA) resin. Isotope dilution measurements of Am and Pu were performed using accelerator mass spectrometry (AMS) and alpha spectrometry. For maximum adsorption Pu was stabilized in the tetra valent oxidation state in 8M HNO3 with 0.05 M NaNO2 before loading the sample onto the resin. Am(III) was adsorbed also onto the resin from concentrated HNO3, and desorbed with 0.1 M HCl while keeping the Pu adsorbed. The on-column reduction of Pu(IV) to Pu(III) with 0.02 M TiCl3 facilitated the complete desorption of Pu. Interferences (e.g. Ca(2+), Fe(3+)) were washed off from the resin bed with excess HNO3. Using NdF3, micro-precipitates of the separated isotopes were prepared for analysis by both AMS and alpha spectrometry. The recovery was 97.7±5.3% and 95.5±4.6% for (241)Am and (242)Pu respectively in reagents without a matrix. The recoveries of the same isotopes were 99.1±6.0 and 96.8±5.3% respectively in garden soil. The robustness of the method was validated using certified reference materials (IAEA 384 and IAEA 385). The measurements agree with the certified values over a range of about 1-100 Bq kg(-1). The single column separation of Pu and Am saves reagents, separation time, and cost.

  8. Neutron capture and neutron-induced fission experiments on americium isotopes with DANCE

    Science.gov (United States)

    Jandel, M.; Bredeweg, T. A.; Stoyer, M. A.; Wu, C. Y.; Fowler, M. M.; Becker, J. A.; Bond, E. M.; Couture, A.; Haight, R. C.; Haslett, R. J.; Henderson, R. A.; Keksis, A. L.; O'Donnell, J. M.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D. J.; Wilhelmy, J. B.; Wouters, J. M.

    2009-01-01

    Neutron capture cross section data on Am isotopes were measured using the Detector for Advanced Neutron Capture Experiments (DANCE) at Los Alamos National Laboratory. The neutron capture cross section was determined for 241Am for neutron energies between thermal and 320 keV. Preliminary results were also obtained for 243Am for neutron energies between 10 eV and 250 keV. The results on concurrent neutron-induced fission and neutron-capture measurements on 242mAm will be presented where the fission events were actively triggered during the experiments. In these experiments, a Parallel-Plate Avalanche Counter (PPAC) detector that surrounds the target located in the center of the DANCE array was used as a fission-tagging detector to separate (n,γ) events from (n,f) events. The first direct observation of neutron capture on 242mAm in the resonance region in between 2 and 9 eV of the neutron energy was obtained.

  9. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    A dynamic extraction system exploiting sequential injection (SI) for sequential extractions incorporating a specially designed extraction column is developed to fractionate radionuclides in environmental solid samples such as soils and sediments. The extraction column can contain a large amount...... of the two radionuclides. However, the dynamic system is fully automated, eliminates manual separations, significantly reduces the operational time required, and offers detailed kinetic information....

  10. Effect of solvent on in vitro dissolution: Summary of results for uranium, americium, and cobalt aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Guilmette, R.A.; Hoover, M.D.

    1995-12-01

    The revised 10 CFR Part 20 has adopted the ICRP Publication 30 method for calculating the committed effective dose equivalent from intakes of radionuclides. This dosimetry scheme requires knowledge or assumptions about the chemical form of the radionuclide, its particle size, and its known or assumed solubility. The solubility is classified as being either D (relatively soluble), W, or Y (relatively insoluble), depending on whether the material dissolves over periods of days, weeks, or years. Although Nuclear Regulatory Commission licensees may wish to take advantage of material-specific knowledge in order to adjust annual limits on intake and derived air concentrations, relatively few radioactive materials to which workers and the general population may be exposed have been adequately characterized either in terms of physicochemical form or solubility. Experimental measurement of solubility using some type of in vitro dissolution measurement system is therefore needed. However, there is currently no clear consensus regarding the appropriate design of in vitro dissolution systems, particularly when considering the range of different radionuclides to be studied, and the complexity of the biological mechanisms involved in the retention and clearance of inhaled deposited radioactive particles. The purpose of this study was to evaluate the effect of the several solvents on the dissolution of four test aerosols ({sup 57}Co{sub 3}O{sub 4}, {sup 241}AmO{sub 2}, ammonium diuranate [ADU], and U{sub 3}O{sub 8}) selected to encompass a variety of chemical and biochemical properties in vivo. The results of this study provide some guidance on the usefulness of in vitro dissolution tests for estimating the solubility of unknown radionuclide particles within the context of a simple model such as the class D, W, and Y formulation of ICRP 30.

  11. Rapid selective separation of americium/curium from simulated nuclear forensic matrices using triazine ligands

    Energy Technology Data Exchange (ETDEWEB)

    Higginson, Matthew A.; Livens, Francis R.; Heath, Sarah L. [Manchester Univ. (United Kingdom). Centre for Radiochemistry Research; Thompson, Paul; Marsden, Olivia J. [AWE, Aldermaston, Reading (United Kingdom); Harwood, Laurence M.; Hudson, Michael J. [Reading Univ. (United Kingdom). Dept. of Chemistry; Lewis, Frank W. [Reading Univ. (United Kingdom). Dept. of Chemistry; Northumbria Univ., Newcastle upon Tyne (United Kingdom). Dept. of Chemical and Forensic Sciences

    2015-07-01

    In analysis of complex nuclear forensic samples containing lanthanides, actinides and matrix elements, rapid selective extraction of Am/Cm for quantification is challenging, in particular due the difficult separation of Am/Cm from lanthanides. Here we present a separation process for Am/Cm(III) which is achieved using a combination of AG1-X8 chromatography followed by Am/Cm extraction with a triazine ligand. The ligands tested in our process were CyMe{sub 4}-BTPhen, CyMe{sub 4}-BTBP, CA-BTP and CA-BTPhen. Our process allows for purification and quantification of Am and Cm (recoveries 80% - 100%) and other major actinides in < 2 d without the use of multiple columns or thiocyanate. The process is unaffected by high level Ca(II)/Fe(III)/Al(III) (10 mg mL{sup -1}) and thus requires little pre-treatment of samples.

  12. Americium-Curium Stabilization - 5'' Cylindrical Induction Melter System Design Basis

    Energy Technology Data Exchange (ETDEWEB)

    Witt, D.C.

    1999-11-08

    Approximately 11,000 liters (3,600) gallons of solution containing isotopes of Am and Cm are currently stored in F-Canyon Tank 17.1. These isotopes were recovered during plutonium-242 production campaigns in the mid- and late-1970s. Experimental work for the project began in 1995 by the Savannah River Technology Center (SRTC). Details of the process are given in the various sections of this document.

  13. Subsurface Behavior of Plutonium and Americium at Non-Hanford Sites and Relevance to Hanford

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Riley, Robert G.

    2008-02-01

    Seven sites where Pu release to the environment has raised significant environmental concerns have been reviewed. A summary of the most significant hydrologic and geochemical features, contaminant release events and transport processes relevant to Pu migration at the seven sites is presented.

  14. New Synthetic Methods and Structure-Property Relationships in Neptunium, Plutonium, and Americium Borates. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht-Schmitt, Thomas Edward

    2013-09-14

    The past three years of support by the Heavy Elements Chemistry Program have been highly productive in terms of advanced degrees awarded, currently supported graduate students, peer-reviewed publications, and presentations made at universities, national laboratories, and at international conferences. Ph.D. degrees were granted to Shuao Wang and Juan Diwu, who both went on to post-doctoral appointments at the Glenn T. Seaborg Center at Lawrence Berkeley National Laboratory with Jeff Long and Ken Raymond, respectively. Pius Adelani completed his Ph.D. with me and is now a post-doc with Peter C. Burns. Andrea Alsobrook finished her Ph.D. and is now a post-doc at Savannah River with Dave Hobbs. Anna Nelson completed her Ph.D. and is now a post-doc with Rod Ewing at the University of Michigan. As can be gleaned from this list, students supported by the Heavy Elements Chemistry grant have remained interested in actinide science after leaving my program. This follows in line with previous graduates in this program such as Richard E. Sykora, who did his post-doctoral work at Oak Ridge National Laboratory with R. G. Haire, and Amanda C. Bean, who is a staff scientist at Los Alamos National Laboratory, and Philip M. Almond and Thomas C. Shehee, who are both staff scientists at Savannah River National Laboratory, Gengbang Jin who is a staff scientist at Argonne National Lab, and Travis Bray who has been a post-doc at both LBNL and ANL. Clearly this program is serving as a pipe-line for students to enter into careers in the national laboratories. About half of my students depart the DOE complex for academia or industry. My undergraduate researchers also remain active in actinide chemistry after leaving my group. Dan Wells was a productive undergraduate of mine, and went on to pursue a Ph.D. on uranium and neptunium chalcogenides with Jim Ibers at Northwestern. After earning his Ph.D., he went directly into the nuclear industry.

  15. Americium-241 and plutonium-237 turnover in mussels ( Mytilus galloprovincialis) living in field enclosures

    Science.gov (United States)

    Guary, J. C.; Fowler, S. W.

    1981-02-01

    Loss of 241Am and 237Pu from contaminated mussels ( Mytilus galloprovincialis) living in situ in the Mediterranean Sea is described as the sum of three exponential functions. In the case of 241Am, two short-lived compartments representing a total of 80% of the incorporated radionuclide turned over rapidly with biological half-lives of 2 and 3 weeks. The remaining fraction of 241Am, associated with a long-lived compartment, was lost at an extremely slow rate ( Tb1/2=1·3 years). Plutonium-237 turnover in the two short-lived compartments (containing 70% of the Pu) was more rapid ( Tb1/2=1-2 days and 2 weeks) than that of 241Am; however, there was some indication that subsequent loss rates of the two radionuclides in long-lived compartments may be similar if determined over comparable periods of time. Loss rates of 241Am differed for the various tissues, with the most rapid rates occurring in gill, viscera and shell. Abrupt changes in loss observed in muscle and mantle suggested a translocation of 241Am to muscle and mantle during depuration. Whole shell contained by far the largest fraction (˜90%) of both 241Am and 237Pu taken up; in addition, these radionuclides are not irreversibly bound to mussel shell but readily leach into the water. These observations suggest that mollusc shell may influence the biogeochemistry of transuranic elements in littoral zones.

  16. Fundamental chemistry and materials science of americium in selected immobilization glasses

    Energy Technology Data Exchange (ETDEWEB)

    Haire, R.G. [Oak Ridge National Lab., TN (United States); Stump, N.A. [Winston-Salem State Univ., NC (United States). Dept. of Physical Sciences

    1996-12-01

    We have pursued some of the fundamental chemistry and materials science of Am in 3 glass matrices, two being high-temperature (850 and 1400 C mp) silicate-based glasses and the third a sol-gel glass. Optical spectroscopy was the principal tool. One aspect of this work was to determine the oxidation state exhibited by Am in these matrices, as well as factors that control or may alter this state. A correlation was noted between the oxidation state of the f-elements in the two high-temperature glasses with their high-temperature oxide chemistries. One exception was Am: although AmO{sub 2} is the stable oxide encountered in air, when this dioxide was incorporated into the high-temperature glasses, only trivalent Am was found in the products. When Am(III) was used to prepare the sol-gel glasses at ambient temperature, and after these products were heated in air to 800 C, only Am(III) was observed. Potential explanations for the unexpected Am behavior is offered in the context of its basic chemistry. Experimental spectra, spectroscopic assignments, etc. are discussed.

  17. Americium, curium and neodymium analysis in ECRIX-H irradiated pellet. Sample preparation for TIMS measurements

    Energy Technology Data Exchange (ETDEWEB)

    Esbelin, E.; Buravand, E. [Commissariat a l' Energie Atomique, Bagnols-sur-Ceze (France). Centre de Marcoule; Bejaoui, S.; Lamontagne, J.; Bonnerot, J.M. [Commissariat a l' Energie Atomique, St-Paul-Lez-Durance (France). Centre de Cadarache

    2013-08-01

    This paper concerns quantitative isotopic analysis of Am, Cm and Nd contained in an irradiated AmO{sub 1.62}/MgO pellet. The complete analysis protocol is described, from dissolution of the pellets in a shielded line to the laboratory glove separation processes box for TIMS analysis. Emphasis is placed on the separation processes: by ion exchange resin in a hot cell and by HPLC in the laboratory. Intermediate measurements by X-ray fluorescence, alpha spectrometry, and ICP-AES are described. (orig.)

  18. Optimization of TRPO Process Parameters for Americium Extraction from High Level Waste

    Institute of Scientific and Technical Information of China (English)

    CHEN Jing; WANG Jianchen; SONG Chongli

    2001-01-01

    The numerical calculations for Am multistage fractional extraction by trialkyl phosphine oxide (TRPO) were verified by a hot test.1750 L/t-U high level waste (HLW) was used as the feed to the TRPO process.The analysis used the simple objective function to minimize the total waste content in the TRPO process streams.Some process parameters were optimized after other parameters were selected.The optimal process parameters for Am extraction by TRPO are:10 stages for extraction and 2 stages for scrubbing;a flow rate ratio of 0.931 for extraction and 4.42 for scrubbing;nitric acid concentration of 1.35 mol/L for the feed and 0.5 mol/L for the scrubbing solution.Finally,the nitric acid and Am concentration profiles in the optimal TRPO extraction process are given.

  19. Criteria Considered in Selecting Feed Items for Americium-241 Oxide Production Operations

    Energy Technology Data Exchange (ETDEWEB)

    Schulte, Louis D. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-01-30

    The analysis in this document serves the purpose of defining a number of attributes in selection of feed items to be utilized in recovery/recycle of Pu and also production operations of 241AmO2 material intended to meet specification requirements. This document was written in response to a specific request on the part of the 2014 annual program review which took place over the dates of October 28-29, 2014. A number of feed attributes are noted including: (1) Non-interference with existing Pu recovery operations; (2) Content of sufficient 241Am to allow process efficiency in recovery operations; (3) Absence of indications that 243Am might be mixed in with the Pu/241Am material; (4) Absence of indications that Cm might be mixed in with the Pu/241Am material; (5) Absence of indications of other chemical elements that would present difficulty in chemical separation from 241Am; (6) Feed material not expected to present difficulty in dissolution; (7) Dose issues; (8) Process efficiency; (9) Size; (10) Hazard associated with items and package configuration in the vault; (11) Within existing NEPA documentation. The analysis in this document provides a baseline of attributes considered for feed materials, but does not presume to replace the need for technical expertise and judgment on the part of individuals responsible for selecting the material feed to be processed. This document is not comprehensive as regards all attributes that could prove to be important. The value of placing a formal QA hold point on accepting feed items versus more informal management of feed items is discussed in the summation of this analysis. The existing planned QA hold points on 241AmO2 products produced and packaged may be adequate as the entire project is based on QA of the product rather than QA of the process. The probability of introduction of items that would inherently cause the241AmO2 products produced to be outside of specification requirements appears to be rather small.

  20. The prospect of uranium nitride (UN) and mixed nitride fuel (UN-PuN) for pressurized water reactor

    Science.gov (United States)

    Syarifah, Ratna Dewi; Suud, Zaki

    2015-09-01

    Design study of small Pressurized Water Reactors (PWRs) core loaded with uranium nitride fuel (UN) and mixed nitride fuel (UN-PuN), Pa-231 as burnable poison, and Americium has been performed. Pa-231 known as actinide material, have large capture cross section and can be converted into fissile material that can be utilized to reduce excess reactivity. Americium is one of minor actinides with long half life. The objective of adding americium is to decrease nuclear spent fuel in the world. The neutronic analysis results show that mixed nitride fuel have k-inf greater than uranium nitride fuel. It is caused by the addition of Pu-239 in mixed nitride fuel. In fuel fraction analysis, for uranium nitride fuel, the optimum volume fractions are 45% fuel fraction, 10% cladding and 45% moderator. In case of UN-PuN fuel, the optimum volume fractions are 30% fuel fraction, 10% cladding and 60% coolant/ moderator. The addition of Pa-231 as burnable poison for UN fuel, enrichment U-235 5%, with Pa-231 1.6% has k-inf more than one and excess reactivity of 14.45%. And for mixed nitride fuel, the lowest value of reactivity swing is when enrichment (U-235+Pu) 8% with Pa-231 0.4%, the excess reactivity value 13,76%. The fuel pin analyze for the addition of Americium, the excess reactivity value is lower than before, because Americium absorb the neutron. For UN fuel, enrichment U-235 8%, Pa-231 1.6% and Am 0.5%, the excess reactivity is 4.86%. And for mixed nitride fuel, when enrichment (U-235+Pu) 13%, Pa-231 0.4% and Am 0.1%, the excess reactivity is 11.94%. For core configuration, it is better to use heterogeneous than homogeneous core configuration, because the radial power distribution is better.

  1. Behavior of Sr-90 and transuranic elements in three areas in Finland[Radioecology

    Energy Technology Data Exchange (ETDEWEB)

    Ikaeheimonen, T.K.; Vartti, V.P.; Ilus, E. [STUK - Radiation and Nuclear Safety Authority, Helsinki (Finland)

    2006-04-15

    The study was carried out in three areas (both terrestrial and aquatic): in the Maenttae area in Central Finland and in the environs of the Loviisa and Olkiluoto Nuclear Power Plants. The highest Sr-90 concentrations were found in Ebilobium angustifolium, being 70 - 90 Bq/kg d.w., and Empetrum nigrum, 15 - 60 Bq/kg d.w. Concentrations of more than 10 Bq/kg d.w. were also detected in leaves of birch (Betula pendula), in berries of Empetrum nigrum and in ferns (Dryopteris carthusiana, Dryopteris expansa, Polypodium vulgare). The Sr-90 concentrations in mushrooms were less than 10 Bq/kg d.w. and varied considerably from one species to another. The concentrations of Pu-239,240 were below the detection limits in mushrooms and berries. Detectable amounts of Pu-239,240 were found in ferns. Am-241 was detected in ferns, but also in a Cantharellus tubaeformis sample and in Calluna vulgaris, in which the Pu-239,240 concentrations were below the detection limits. The highest concentrations of Sr-90 in fresh water environment were detected in shells and flesh of freshwater clam, Anodonta sp., and in marine environment in Saduria entomon and Macoma balthica. In Anodonta sp. (both shells and flesh), also Pu-239,240 and Am-241 were detected. Pu-239,240 was detectable in almost all the marine samples. Concentration factors (CF) of Pu-239,240 were roughly at the same level or greater than those of Sr-90, especially in the marine environment. Best indicator organism for Sr in the fresh water environment was Anodonta sp., and then Nuphar lutea (CFs 10{sup 3} - 10{sup 4}); and Macoma balthica and Fucus vesiculosus in the marine environment. Roots of Nymphaea candida and flesh of Anodonta sp. accumulated best Pu-239,240 in fresh water environment; The CFs of Pu-239,240 were greater in the marine environment compared to those in fresh water environment. Phytoplankton and periphyton accumulate most efficiently Pu-239,240 in the marine environment. The behavior of plutonium and americium

  2. Radionuclide concentrations in honey bees from Area G at TA-54 during 1997. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Haarmann, T.K.; Fresquez, P.R.

    1998-07-01

    Honey bees were collected from two colonies located at Los Alamos National Laboratory`s Area G, Technical Area 54, and from one control (background) colony located near Jamez Springs, NM. Samples were analyzed for the following: cesium ({sup 137}Cs), americium ({sup 241}Am), plutonium ({sup 238}Pu and {sup 239,240}Pu), tritium ({sup 3}H), total uranium, and gross gamma activity. Area G sample results from both colonies were higher than the upper (95%) level background concentration for {sup 238}Pu and {sup 3}H.

  3. Analysis of nuclear materials by energy dispersive x-ray fluorescence and spectral effects of alpha decay

    Energy Technology Data Exchange (ETDEWEB)

    Worley, Christopher G [Los Alamos National Laboratory

    2009-01-01

    Energy dispersive X-ray fluorescence (EDXRF) spectra collected from alpha emitters are complicated by artifacts inherent to the alpha decay process, particularly when using portable instruments. For example, {sup 239}Pu EDXRF spectra exhibit a prominent uranium L X-ray emission peak series due to sample alpha decay rather than source-induced X-ray fluorescence. A portable EDXRF instrument was used to collect spectra from plutonium, americium, and a Pu-contaminated steel sample. The plutonium sample was also analyzed by wavelength dispersive XRF to demonstrate spectral differences observed when using these very different instruments.

  4. Neutron Nuclear Data Evaluation of Actinoid Nuclei for CENDL-3.1

    CERN Document Server

    Guo-Chang, Chen; Bao-Sheng, Yu; Guo-You, Tang; Zhao-Min, Shi; Xi, Tao

    2011-01-01

    New evaluations for several actinoids of the third version of China Evaluated Nuclear Data Library (CENDL-3.1) have been completed during the period between 2000 and 2005. The evaluations are for all neutron induced reactions with Uranium, Neptunium, Plutonium and Americium in the mass range A=232-241, 236-239, 236-246 and 240-244, respectively, and cover the incident neutron energy up to 20 MeV. In present evaluation, much more efforts were devoted to improve reliability of nuclide for available new measured data, especially scarce experimental data. A general description for the evaluation of several actinoids data were presented.

  5. Pu and Am determination in the environment—method development

    Science.gov (United States)

    Afonin, M.; Simonoff, M.; Donard, O.; Michel, H.; Ardisson, G.

    2003-01-01

    A high resolution inductively coupled plasma mass spectrometric (HR-ICP-MS) method for the determination of plutonium isotopes, Am and the 240Pu/239Pu isotope ratio utilising modification of Pu-02-RC Plutonium in Soil Samples, Pu-03-RC Plutonium in Soil Residue—Total Dissolution Method, Pu-11-RC Plutonium Purification—Ion Exchange Technique, Pu-12-RC Plutonium and/or Americium in Soil or Sediments, HASL-300 was developed. Total plutonium concentrations (239+240Pu) measured in environmental samples by this HR-ICP-MS method were in good agreement with recommended data obtained from a-spectrometry. It was achieved the decreasing of the time to analyze the samples over than 33%.

  6. Actinide partitioning and transmutation program. Progress report, July 1--September 30, 1977

    Energy Technology Data Exchange (ETDEWEB)

    Tedder, D.W.; Blomeke, J.O. (comps.)

    1978-02-01

    In Purex process modifications, two cold runs with mixer-settlers were made on the extraction and stripping of ruthenium and zirconium without the presence of uranium. Efforts in actinide recovery from solids were directed toward the determination of dissolution parameters in various reagents for /sup 241/Am and /sup 239/Pu oxide mixtures, /sup 233/U oxide, /sup 237/Np oxide, /sup 244/Cm oxide, /sup 232/Th oxide, and PuO/sub 2/. Studies in americium-curium recovery with OPIX (oxalate precipitation and ion exchange), Talspeak, and cation exchange chromatography focused on the feasibility of forming oxalate precipitates in continuous systems, the effects of zirconium on Talspeak, and methods for removing solvent degradation products of the Talspeak system. In studies of americium-curium recovery using bidentate extractants, additional distribution coefficients for actinides and other key elements between reduced synthetic LWR waste solution and 30 percent dihexyl-N, N-diethyl-carbamylmethylene phosphonate in diisopropylbenzene were measured. Studies in the americium-curium recovery using inorganic ion exchange media to determine the pH dependence of lanthanide ion affinity for niobate, titanate, and zirconate ion exchange materials have been completed. A modified flowsheet for the extraction of uranium, neptunium, plutonium, americium, and curium from high-level liquid waste is presented. Evaluation of methods for measuring actinides from incinerator ash is continuing. A preliminary evaluation of methods for treatment of salt waste and waste waters was completed. In thermal reactor transmutation studies, waste actinides from an LWR lattice containing mixed uranium-plutonium assemblies were recycled in separate target assemblies. (LK)

  7. A Review of Subsurface Behavior of Plutonium and Americium at the 200-PW-1/3/6 Operable Units

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Riley, Robert G.

    2008-01-31

    This report begins with a brief summary of the history and current status of 200-PW-1/3/6 OUs in section 2.0. This is followed by a description of our concentual model of Pu/Am migration at the 200-PW-1/3/6 OUs, during both past artificial recharge conditions and current natural recharge condictions (section 3.0). Section 4.0 discusses data gaps and information needs. The final section (section 5.0) provides recommendations for futher work to address the data gaps and information needs identified in section 4.0.

  8. Analysis of cascade impactor and EPA method 29 data from the americium/curium pilot melter system

    Energy Technology Data Exchange (ETDEWEB)

    Zamecnik, J.R.

    1997-11-01

    The offgas system of the Am/Cm pilot melter at TNX was characterized by measuring the particulate evolution using a cascade impactor and EPA Method 29. This sampling work was performed by John Harden of the Clemson Environmental Technologies Laboratory, under SCUREF Task SC0056. Elemental analyses were performed by the SRTC Mobile Laboratory.Operation of the Am/Cm melter with B2000 frit has resulted in deposition of PbO and boron compounds in the offgas system that has contributed to pluggage of the High Efficiency Mist Eliminator (HEME). Sampling of the offgas system was performed to quantify the amount of particulate in the offgas system under several sets of conditions. Particulate concentration and particle size distribution were measured just downstream of the melter pressure control air addition port and at the HEME inlet. At both locations, the particulate was measured with and without steam to the film cooler while the melter was idled at about 1450 degrees Celsius. Additional determinations were made at the melter location during feeding and during idling at 1150 degrees Celsius rather than 1450 degrees Celsius (both with no steam to the film cooler). Deposition of particulates upstream of the melter sample point may have, and most likely did occur in each run, so the particulate concentrations measured do no necessarily reflect the total particulate emission at the melt surface. However, the data may be used in a relative sense to judge the system performance.

  9. Rapid selective separation of americium/curium\\ud from simulated nuclear forensic matrices using\\ud triazine ligands

    OpenAIRE

    Higginson, Matthew A.; Thompson, Paul; Marsden, Olivia J.; Livens, Francis R.; Harwood, Laurence M.; Lewis, Frank W.; Hudson, Michael J.; Heath, Sarah L.

    2015-01-01

    In analysis of complex nuclear forensic samples\\ud containing lanthanides, actinides and matrix elements,\\ud rapid selective extraction of Am/Cm for quantification\\ud is challenging, in particular due the difficult separation\\ud of Am/Cm from lanthanides. Here we present\\ud a separation process for Am/Cm(III) which is achieved\\ud using a combination of AG1-X8 chromatography followed\\ud by Am/Cm extraction with a triazine ligand. The ligands\\ud tested in our process were CyMe4-BTPhen, CyMe4-\\u...

  10. LITERATURE REVIEW ON THE SORPTION OF PLUTONIUM, URANIUM, NEPTUNIUM, AMERICIUM AND TECHNETIUM TO CORROSION PRODUCTS ON WASTE TANK LINERS

    Energy Technology Data Exchange (ETDEWEB)

    Li, D.; Kaplan, D.

    2012-02-29

    The Savannah River Site (SRS) has conducted performance assessment (PA) calculations to determine the risk associated with closing liquid waste tanks. The PA estimates the risk associated with a number of scenarios, making various assumptions. Throughout all of these scenarios, it is assumed that the carbon-steel tank liners holding the liquid waste do not sorb the radionuclides. Tank liners have been shown to form corrosion products, such as Fe-oxyhydroxides (Wiersma and Subramanian 2002). Many corrosion products, including Fe-oxyhydroxides, at the high pH values of tank effluent, take on a very strong negative charge. Given that many radionuclides may have net positive charges, either as free ions or complexed species, it is expected that many radionuclides will sorb to corrosion products associated with tank liners. The objective of this report was to conduct a literature review to investigate whether Pu, U, Np, Am and Tc would sorb to corrosion products on tank liners after they were filled with reducing grout (cementitious material containing slag to promote reducing conditions). The approach was to evaluate radionuclides sorption literature with iron oxyhydroxide phases, such as hematite ({alpha}-Fe{sub 2}O{sub 3}), magnetite (Fe{sub 3}O{sub 4}), goethite ({alpha}-FeOOH) and ferrihydrite (Fe{sub 2}O{sub 3} {center_dot} 0.5H{sub 2}O). The primary interest was the sorption behavior under tank closure conditions where the tanks will be filled with reducing cementitious materials. Because there were no laboratory studies conducted using site specific experimental conditions, (e.g., high pH and HLW tank aqueous and solid phase chemical conditions), it was necessary to extend the literature review to lower pH studies and noncementitious conditions. Consequently, this report relied on existing lower pH trends, existing geochemical modeling, and experimental spectroscopic evidence conducted at lower pH levels. The scope did not include evaluating the appropriateness of K{sub d} values for the Fe-oxyhydroxides, but instead to evaluate whether it is a conservative assumption to exclude this sorption process of radionuclides onto tank liner corrosion products in the PA model. This may identify another source for PA conservatism since the modeling did not consider any sorption by the tank liner.

  11. Fission Product Yields from Fission Spectrum n+ 239Pu for ENDF/B-VII.1

    Science.gov (United States)

    Chadwick, M. B.; Kawano, T.; Barr, D. W.; Mac Innes, M. R.; Kahler, A. C.; Graves, T.; Selby, H.; Burns, C. J.; Inkret, W. C.; Keksis, A. L.; Lestone, J. P.; Sierk, A. J.; Talou, P.

    2010-12-01

    We describe a new cumulated fission product yield (FPY) evaluation for fission spectrum neutrons on plutonium that updates the ENDF/B-VI evaluation by England and Rider, for the forthcoming ENDF/B-VII.1 database release. We focus on FPs that are needed for high accuracy burnup assessments; that is, for inferring the number of fissions in a neutron environment. Los Alamos conducted an experiment in the 1970s in the Bigten fast critical assembly to determine fission product yields as part of the Interlaboratory Reaction Rate (ILRR) collaboration, and this has defined the Laboratory's fission standard to this day. Our evaluation includes use of the LANL-ILRR measurements (not previously available to evaluators) as well as other Laboratory FPY measurements published in the literature, especially the high-accuracy mass spectrometry data from Maeck and others. Because the measurement database for some of the FPs is small — especially for 99Mo — we use a meta-analysis that incorporates insights from other accurately-measured benchmark FP data, using R-value ratio measurements. The meta-analysis supports the FP measurements from the LANL-ILRR experiment. Differences between our new evaluations and ENDF/B-VI are small for some FPs (less than 1-2%-relative for 95Zr, 140Ba, 144Ce), but are larger for 99Mo (4%-relative) and 147Nd (5%-relative, at 1.5 MeV) respectively. We present evidence for an incident neutron energy dependence to the 147Nd fission product yield that accounts for observed differences in the FPY at a few-hundred keV average energy in fast reactors versus measurements made at higher average neutron energies in Los Alamos' fast critical assemblies. Accounting for such FPY neutron energy dependencies is important if one wants to reach a goal of determining the number of fissions to accuracies of 1-2%. An evaluation of the energy-dependence of fission product yields is given for all A values based on systematical trends in the measured data, with a focus on the energy dependence over the fast neutron energy range from 0.2-2 MeV. Based on these trends, we present an evaluation of the FPY data at 0.5 and 2.0 MeV average incident neutron energies. This new set of ENDF/B-VII data will enable users to linearly interpolate between the pooled FPY data at ˜0.5 MeV and our new data at 2 MeV to obtain FPYs at other energies. We intend to release the ENDF/B-VII.1 database in December 2011, and all released data are subject to CSEWG approval. It is possible that the released evaluated data will differ from those presented in this paper; the evaluated date presented here can be referred to as ENDF/B-VII.1 beta 0.

  12. Yeast Interacting Proteins Database: YDL239C, YHR184W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available it as prey (1) YHR184W SSP1 Protein involved in the control of meiotic nuclear division and coordination... the control of meiotic nuclear division and coordination of meiosis with spore formation; transcription is

  13. Sangre y vino en el juramento de Lisístrata (vv. 181-239)

    OpenAIRE

    García Soler, María José

    2002-01-01

    (ES) En el presente artículo trata de poner de relieve los mecanismos utilizados por Aristófanes en Lisístrata para presentar de forma paródica el sacrificio juratorio con el que las mujeres sellan el pacto para obligar a sus maridos a que firmen la paz. Se analiza en este trabajo la utilización del vocabulario específico y la organización básica de este ritual, que Aristófanes conserva intacto, en contraste con la sustitución operada en cuanto a la persona que realiza el sacrificio y a la ví...

  14. Yeast Interacting Proteins Database: YBR239C, YPL133C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available cytoplasm and nucleus; null mutation affects periodicity of transcriptional and metabolic oscillation; play...ion; GFP-fusion protein localizes to the cytoplasm and nucleus; null mutation affects periodic

  15. Event-by-Event Study of Prompt Neutrons from 239Pu

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, R; Randrup, J; Pruet, J; Younes, W

    2010-01-15

    Employing a recently developed Monte Carlo model, we study the fission of {sup 240}Pu induced by neutrons with energies from thermal to just below the threshold for second chance fission. Current measurements of the mean number of prompt neutrons emitted in fission, together with less accurate measurements of the neutron energy spectra, place remarkably fine constraints on predictions of microscopic calculations. In particular, the total excitation energy of the nascent fragments must be specified to within 1 MeV to avoid disagreement with measurements of the mean neutron multiplicity. The combination of the Monte Carlo fission model with a statistical likelihood analysis also presents a powerful tool for the evaluation of fission neutron data. Of particular importance is the fission spectrum, which plays a key role in determining reactor criticality. We show that our approach can be used to develop an estimate of the fission spectrum with uncertainties several times smaller than current experimental uncertainties for outgoing neutron energies of less than 2 MeV.

  16. Event-by-event study of prompt neutrons from 239Pu(n,f)

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, R; Randrup, J; Pruet, J; Younes, W

    2009-07-23

    Employing a recently developed Monte-Carlo model, we study the fission of {sup 240}Pu induced by neutrons with energies from thermal to just below the threshold for second chance fission. Current measurements of the mean number of prompt neutrons emitted in fission, together with less accurate measurements of the neutron energy spectra, place remarkably fine constraints on predictions of microscopic calculations. In particular, the total excitation energy of the nascent fragments must be specified to within 1MeV to avoid disagreement with measurements of the mean neutron multiplicity. The combination of the Monte-Carlo fission model with a statistical likelihood analysis also presents a powerful tool for the evaluation of fission neutron data. Of particular importance is the fission spectrum, which plays a key role in determining reactor criticality. We show that our approach can be used to develop an estimate of the fission spectrum with uncertainties several times smaller than current experimental uncertainties for outgoing neutron energies of less than 2 MeV.

  17. Yeast Interacting Proteins Database: YDL239C, YPL070W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available it as prey (1) YPL070W MUK1 Cytoplasmic protein of unknown function containing a Vps9 domain; computation...ey description Cytoplasmic protein of unknown function containing a Vps9 domain; computational analysis of l

  18. Yeast Interacting Proteins Database: YDL239C, YKL103C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available that belongs to the peptidase family M18; often used as a marker protein in studies of autophagy and cytosol...ily M18; often used as a marker protein in studies of autophagy and cytosol to vacuole targeting (CVT) pathw

  19. Yeast Interacting Proteins Database: YDL239C, YPL124W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available it as prey (1) YPL124W SPC29 Inner plaque spindle pole body (SPB) component, links...ndle pole body (SPB) component, links the central plaque component Spc42p to the inner plaque component Spc1

  20. 48 CFR 1352.239-72 - Security requirements for information technology resources.

    Science.gov (United States)

    2010-10-01

    ..., computer ethics, and best practices, in accordance with DOC IT Security Program Policy, chapter 15, section... term “Sensitive” is defined by the guidance set forth in the Computer Security Act of 1987 (Pub. L. 100... of computer systems, networks, and telecommunications systems. (c) The contractor shall...

  1. Investigation of plutonium-239 conditioning in monazite and brabantite matrices: Synthesis and characterization

    Energy Technology Data Exchange (ETDEWEB)

    Glorieux, B.; Jorion, F.; Montel, J.M.; Matecki, M.; Deschanels, X.; Coutures, JP

    2004-07-01

    In response to the 1991 French radioactive waste management act, a research program was set up between the CNRS, the CEA and French universities to propose effective minor actinide disposal matrices capable of loading 10 wt% of actinide oxides and ensuring a hundred-fold better leaching performance than 'R7T7' glass. The lanthanide ortho-phosphates LaPO{sub 4} could constitute an excellent matrix for this purpose. In this type of structure, the (PO{sub 4}){sup 3-} negative entity is compensated by trivalent cations such as La, Ce, Gd, Pu, Am (monazite) or equal fractions of divalent and tetravalent cations such as Ca{sup 2+}Th{sup 4+}, Ca{sup 2+}U{sup 4+}, Ca{sup 2+}Np{sup 4+} (brabantite). Previous leach tests and geological discoveries have shown that these materials are highly resistant to leaching and conserve their crystalline state even in aqueous media. These points led us to investigate the incorporation of 10 wt% PuO{sub 2} in monazite and brabantite materials and to study the effects of self-irradiation on their structural states. Prior to plutonium conditioning tests, experiments were performed in the laboratory using cerium and thorium oxides according to the following reactions: (1-3x)LaPO{sub 4} + 2xCe{sup 4+}O{sub 2} + xLa(PO{sub 3}){sub 3} {yields} La{sub 1-2x}Ce{sub 2x}{sup 3+}PO{sub 4} + x/2O{sub 2}; (1-3x)LaPO{sub 4} + xTh{sup 4+}O{sub 2} + xCaO + xLa(PO{sub 3}){sub 3} {yields} La{sub 1-2x}Ca{sub x}Th{sub x}{sup 4+}PO{sub 4}. Cerium oxide was used to study the reduction of a tetravalent cation to a trivalent state in a phosphate structure and to prepare for Pu{sup 3+} conditioning. Thorium was used to study the conditioning of tetravalent cations such as Pu{sup 4+}. The parameters and sintering reaction of the final product were optimized. In a radioactive laboratory, PuO{sub 2} was then substituted for CeO{sub 2} and ThO{sub 2} in the first and second reactions mentioned above, respectively. The synthesis and sintering procedures were unchanged. X-ray diffraction analysis of the powder before and after sintering showed promising results that are discussed. (authors)

  2. Scientific Opinion on the re-evaluation of hexamethylene tetramine (E 239 as a food additive

    Directory of Open Access Journals (Sweden)

    EFSA Panel on Food Additives and Nutrient Sources added to food (ANS

    2014-06-01

    Full Text Available Hexamethylene tetramine (HMT is a food additive, currently only permitted in EU for use in Provolone cheese. The maximum permitted level is 25 mg/kg residual amount, expressed as formaldehyde, the break down product of HMT under acidic conditions. HMT has been previously evaluated by the Joint Expert Committee on Food Additives (JECFA, 1974 who established an ADI of 0.15 mg/kg bw/day based on a reproductive study with a NOEL of 15 mg/kg bw/day. Due to the limitations in the database the Panel could not identify a critical study and therefore to derive an ADI. However, the Panel noted that the exposure to formaldehyde from HMT of high level consumers of Provolone cheese equalled 18 µg formaldehyde/kg bw/day in adults and could be as high as 87 µg formaldehyde/kg bw/day in children according to a theoretical conservative assumption that all ripened cheese consumed was Provolone cheese. Considering the estimated exposure from the very limited permitted use, the toxicological database on HMT, the data from use of HMT therapeutically, the available oral toxicity and toxicokinetic data of formaldehyde and the magnitude of the potential effect on intracellular formaldehyde levels arising from this use of HMT, the Panel concluded that the use of HMT in Provolone cheese at the MPL of 25 mg/kg residual amount, expressed as formaldehyde, would not be of safety concern. However the Panel considered that any increase in the permitted uses of HMT or increases in the MPL of 25 mg /kg residual amount, expressed as formaldehyde would need detailed assessment which might require new toxicity data as well as use levels and/or an evaluation of its impact on formaldehyde levels in vivo.

  3. 40 CFR 725.239 - Use of specific microorganisms in activities conducted outside a structure.

    Science.gov (United States)

    2010-07-01

    ... resistance, the structural gene must be limited to the genera Bradyrhizobium and Rhizobium. (B) The...) Rhizobium meliloti. To qualify for an exemption under this section, all of the following conditions must be met for a test involving Rhizobium meliloti: (1) Characteristics of recipient microorganism....

  4. Yeast Interacting Proteins Database: YDL239C, YGR268C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available 7 CuraGen (0 or 1) 0 S. Fields (0 or 1) 0 Association (0 or 1,YPD) 0 Complex (0 o...re on bait (YPD) 4 Literature on prey (YPD) 5 Literature shared by bait and prey 4 Literature sharing score

  5. MRSA genotypes in Turkey: persistence over 10 years of a single clone of ST239.

    NARCIS (Netherlands)

    Alp, E.; Klaassen, C.H.; Doganay, M.; Altoparlak, U.; Aydin, K.; Engin, A.; Kuzucu, C.; Ozakin, C.; Ozinel, M.A.; Turhan, O.; Voss, A.

    2009-01-01

    OBJECTIVES: Methicillin-resistant Staphylococcus aureus (MRSA) is a significant cause of life-threatening human infections. The clinical impact of MRSA is mounting, not only due to the ever-increasing prevalence but also due to the occurrence of new, community-acquired MRSA strains. The aim of this

  6. Yeast Interacting Proteins Database: YGR239C, YDR142C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ing PTS2; interacts with Pex7p; partially redundant with Pex18p Rows with this bait as bait (2) Rows with th...2; interacts with Pex7p; partially redundant with Pex18p Rows with this bait as bait Rows with this bait as

  7. Fusion and fission studies for the system /sup 32/S + /sup 239/U

    Energy Technology Data Exchange (ETDEWEB)

    Freifelder, R.H.

    1985-01-01

    The total fusion cross section has been measured at energies from 0.93 to 1.08 times the s-wave interaction barrier for the system /sup 32/S + /sup 238/U. Measurements were made by detecting coincident fission fragments following full momentum transfer in two position sensitive parallel plate avalanche counters. Fission fragment angular distributions were measured from 90/sup 0/ to 166/sup 0/ in the center of mass for all energies except the lowest where the angular range was 127/sup 0/ to 170/sup 0/. The experimental total fusion cross section was first compared to a one dimensional barrier penetration model which severely underpredicted the data. Then the data were compared to the predictions of coupled channels calculations where the first 2/sup +/ and then higher lying states in /sup 238/U were included. The calculations with only the 2/sup +/ state were able to predict the trend in the data quite well. Inclusion of the higher lying states made no appreciable change in the fusion cross section suggesting that for nuclei which may be characterized as highly rotational, coupling to the lowest lying state may be able to reproduce the measured fusion cross section.

  8. Ultrasensitive detection and dose reconstruction for plutonium-239 through fission track analysis of urine

    Science.gov (United States)

    Krahenbuhl, Melinda Pearl

    1998-12-01

    This dissertation addresses a number of deficiencies in currently used Fission Track Analysis (FTA) methodology and introduces improvements to make FTA a more reliable research tool. The refined methodology, described herein, includes a chemically-induced precipitation phase followed by anion exchange chromatography and employs a chemical tracer, Plutonium236 (Pu236). An inverse correlation between Pu recovery and sample volume has been established, and tests confirm that larger sample volumes do not result in higher accuracy or lower detection limits. Subsequently, the optimal sample volume is determined to be approximately 2 liters and the detection limit for this volume is established at 2.8 muBq/L (76 aCi/L). In comparison, the detection limits of two alternate methodologies are 2 muBq (at Brookhaven National Lab) and 3.2 muBq (at the University Hospital in Lund, Sweden). A comparative review evaluates the strengths and weaknesses of these methodologies by comparing pivotal aspects of each laboratory's process. The obvious strength of FTA is the low detection limit for fissile materials. The greatest weakness is the lack of independent confirmation for the results of the three respective methodologies. Additionally, each laboratory's unique nomenclature has made comparison and evaluation problematic and has lead to occasional misinterpretation of numeric data. Addressing the scientific and engineering community's lack of confidence in FTA will require more complete disclosure of techniques and protocols, including documentation of experimental failures. In experiments detailed in this dissertation, the refined FTA methodology was used to determine the Pu236 concentration in urine for two unique populations, radiation workers and the general population. The results of this analysis were used to predict dose according to several different interpretations of the ICRP recommendations. These predictions focused on the liver, lung and skeletal systems. Predicted doses ranged from 0.02 fSv to 300 fSv as a function of organ and sample collection time. As anticipated, predicted dose to the lungs represented the highest predicted dose to any compartment of the body.

  9. 16 CFR 23.9 - Additional guidance for the use of quality marks.

    Science.gov (United States)

    2010-01-01

    ... quality marks. As used in these guides, the term quality mark means any letter, figure, numeral, symbol.... (a) Deception as to applicability of marks. (1) If a quality mark on an industry product is... part's true composition. (2) If a quality mark is applicable to only part of an industry product,...

  10. 高原军事训练筋膜间隙综合征239

    Institute of Scientific and Technical Information of China (English)

    陈云光

    2003-01-01

    @@ 骨筋膜间隙综合征(Osteofascial Compartment Syndrome,OCS)或筋膜间隙综合征(Compartment Syndrome,CS),系指肢体创伤后发生在四肢特定的由骨、骨间膜、肌间隔和深筋膜形成的骨筋膜间隙内的进行性病变,即由于间隙内容物的增加,压力增高,致间隙内容物主要是肌肉与神经干发生急性进行性缺血坏死.

  11. Matrix effects corrections in DDT assay of {sup 239}Pu with the CTEN instrument

    Energy Technology Data Exchange (ETDEWEB)

    Hollas, C.L.; Arnone, G.; Brunson, G.; Coop, K. [Los Alamos National Lab., NM (United States)

    1997-11-01

    The accuracy of transuranic (TRU) waste assay using the differential die-away technique depends upon significant corrections to compensate for the effects of the matrix material in which the TRU waste is located. We have used a new instrument, the combined thermal/epithermal neutron (CTEN) instrument for the assay of TRU waste, to develop methods to improve the accuracy of these corrections. Neutrons from a pulsed 14-MeV neutron generator are moderated in the walls of the CTEN cavity and induce fission in the TRU material. The prompt neutrons from these fission events are detected in cadmium-wrapped {sup 3}He neutron detectors. We have developed methods of data acquisition and analysis to extract correlation in the neutron signals resulting from fission during active interrogation. This correlation information, in conjunction with the total number of neutrons detected, is used to determine the fraction of fission neutrons transmitted through the matrix material into the {sup 3}He detectors. This determination allows us to cleanly separate the matrix effects into two processes: matrix modification upon the neutron interrogating flux and matrix modification upon the fraction of fission neutrons transmitted to the neutron detectors. Recent results indicate that for some matrix systems, corrections for position dependent effects within the matrix are possible. 7 refs., 7 figs., 1 tab.

  12. Yeast Interacting Proteins Database: YDL239C, YML042W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available th this prey as bait (1) Literature on bait (YPD) 4 Literature on prey (YPD) 18 Literature shared by bait and prey 2 Literature shari...ng score 2 CuraGen (0 or 1) 0 S. Fields (0 or 1) 0 Association (0 or 1,YPD) 0 Compl

  13. Ambient air sampling for radioactive air contaminants at Los Alamos National Laboratory: A large research and development facility

    Energy Technology Data Exchange (ETDEWEB)

    Eberhart, C.F.

    1998-09-01

    This paper describes the ambient air sampling program for collection, analysis, and reporting of radioactive air contaminants in and around Los Alamos National Laboratory (LANL). Particulate matter and water vapor are sampled continuously at more than 50 sites. These samples are collected every two weeks and then analyzed for tritium, and gross alpha, gross beta, and gamma ray radiation. The alpha, beta, and gamma measurements are used to detect unexpected radionuclide releases. Quarterly composites are analyzed for isotopes of uranium ({sup 234}U, {sup 235}U, {sup 238}U), plutonium ({sup 238}Pu, {sup 239/249}Pu), and americium ({sup 241}Am). All of the data is stored in a relational database with hard copies as the official records. Data used to determine environmental concentrations are validated and verified before being used in any calculations. This evaluation demonstrates that the sampling and analysis process can detect tritium, uranium, plutonium, and americium at levels much less than one percent of the public dose limit of 10 millirems. The isotopic results also indicate that, except for tritium, off-site concentrations of radionuclides potentially released from LANL are similar to typical background measurements.

  14. Isotope ratio analysis of individual sub-micrometer plutonium particles with inductively coupled plasma mass spectrometry.

    Science.gov (United States)

    Esaka, Fumitaka; Magara, Masaaki; Suzuki, Daisuke; Miyamoto, Yutaka; Lee, Chi-Gyu; Kimura, Takaumi

    2010-12-15

    Information on plutonium isotope ratios in individual particles is of great importance for nuclear safeguards, nuclear forensics and so on. Although secondary ion mass spectrometry (SIMS) is successfully utilized for the analysis of individual uranium particles, the isobaric interference of americium-241 to plutonium-241 makes difficult to obtain accurate isotope ratios in individual plutonium particles. In the present work, an analytical technique by a combination of chemical separation and inductively coupled plasma mass spectrometry (ICP-MS) is developed and applied to isotope ratio analysis of individual sub-micrometer plutonium particles. The ICP-MS results for individual plutonium particles prepared from a standard reference material (NBL SRM-947) indicate that the use of a desolvation system for sample introduction improves the precision of isotope ratios. In addition, the accuracy of the (241)Pu/(239)Pu isotope ratio is much improved, owing to the chemical separation of plutonium and americium. In conclusion, the performance of the proposed ICP-MS technique is sufficient for the analysis of individual plutonium particles.

  15. Environmental, safety, and health plan for the remedial investigation of Waste Area Grouping 10, Operable Unit 3, at Oak Ridge National Laboratory, Oak Ridge, Tennessee. Environmental Restoration Program

    Energy Technology Data Exchange (ETDEWEB)

    1993-10-01

    This document outlines the environmental, safety, and health (ES&H) approach to be followed for the remedial investigation of Waste Area Grouping (WAG) 10 at Oak at Ridge National Laboratory. This ES&H Plan addresses hazards associated with upcoming Operable Unit 3 field work activities and provides the program elements required to maintain minimal personnel exposures and to reduce the potential for environmental impacts during field operations. The hazards evaluation for WAG 10 is presented in Sect. 3. This section includes the potential radiological, chemical, and physical hazards that may be encountered. Previous sampling results suggest that the primary contaminants of concern will be radiological (cobalt-60, europium-154, americium-241, strontium-90, plutonium-238, plutonium-239, cesium-134, cesium-137, and curium-244). External and internal exposures to radioactive materials will be minimized through engineering controls (e.g., ventilation, containment, isolation) and administrative controls (e.g., procedures, training, postings, protective clothing).

  16. Neutron nuclear data evaluation of actinide nuclei for CENDL-3.1

    Institute of Scientific and Technical Information of China (English)

    CHEN Guo-Chang; CAO Wen-Tian; YU Bao-Sheng; TANG Guo-You; SHI Zhao-Min; TAO Xi

    2012-01-01

    New evaluations for several actinide nuclei of the third version of Chinese Evaluated Nuclear Data Library for Neutron Reaction Data (CENDL-3.1) have been completed and released.The evaluation is for all neutron induced reactions with uranium,neptunium,plutonium and americium in the mass range A=232-241,236-239,236-246 and 240-244,respectively,and cover the incident neutron energy up to 20 MeV.In the present evaluation,much more effort was devoted to improving the reliability of the evaluated nuclear data for available new measured data,especially scarce or absent experimental data.A general description for the evaluation of several actinides' data is presented.

  17. Probabilistic performance-assessment modeling of the mixed waste landfill at Sandia National Laboratories.

    Energy Technology Data Exchange (ETDEWEB)

    Peace, Gerald (Jerry) L. (.); Goering, Timothy James (GRAM, Inc.); Miller, Mark Laverne; Ho, Clifford Kuofei

    2007-01-01

    A probabilistic performance assessment has been conducted to evaluate the fate and transport of radionuclides (americium-241, cesium-137, cobalt-60, plutonium-238, plutonium-239, radium-226, radon-222, strontium-90, thorium-232, tritium, uranium-238), heavy metals (lead and cadmium), and volatile organic compounds (VOCs) at the Mixed Waste Landfill (MWL). Probabilistic analyses were performed to quantify uncertainties inherent in the system and models for a 1,000-year period, and sensitivity analyses were performed to identify parameters and processes that were most important to the simulated performance metrics. Comparisons between simulated results and measured values at the MWL were made to gain confidence in the models and perform calibrations when data were available. In addition, long-term monitoring requirements and triggers were recommended based on the results of the quantified uncertainty and sensitivity analyses.

  18. Radioactive sample effects on EDXRF spectra

    Energy Technology Data Exchange (ETDEWEB)

    Worley, Christopher G [Los Alamos National Laboratory

    2008-01-01

    Energy dispersive X-ray fluorescence (EDXRF) is a rapid, straightforward method to determine sample elemental composition. A spectrum can be collected in a few minutes or less, and elemental content can be determined easily if there is adequate energy resolution. Radioactive alpha emitters, however, emit X-rays during the alpha decay process that complicate spectral interpretation. This is particularly noticeable when using a portable instrument where the detector is located in close proximity to the instrument analysis window held against the sample. A portable EDXRF instrument was used to collect spectra from specimens containing plutonium-239 (a moderate alpha emitter) and americium-241 (a heavy alpha emitter). These specimens were then analyzed with a wavelength dispersive XRF (WDXRF) instrument to demonstrate the differences to which sample radiation-induced X-ray emission affects the detectors on these two types of XRF instruments.

  19. The technological safety in facilities that manage radioactive sources; La seguridad tecnologica en instalaciones que manejan fuentes radiactivas

    Energy Technology Data Exchange (ETDEWEB)

    Lizcano, D., E-mail: david.lizcano@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

    2014-10-15

    The sealed radioactive sources are used inside a wide range of applications in the medicine, industry and investigation around the world. These sources can contain a great radionuclides variety, exhibiting a wide spectrum of activities and radiological half lives. This way, we can find pattern sources of radionuclides as Americium-241, Plutonium-238, Plutonium-239, Thorium-228 and Thorium-230, etc., with some activity of kBq in research laboratories, Iridium-192 and Cesium-137 sources used in brachytherapy with GBq activities, until sources with P Bq activities in industrial irradiators of Cobalt-60 and Cesium-137. This document approach the physical safety that entities like the IAEA recommends for the facilities that contain sealed sources, especially the measures that are taking in the Instituto Nacional de Investigaciones Nucleares (ININ) and others government facilities. (Author)

  20. Direct isotope ratio analysis of individual uranium-plutonium mixed particles with various U/Pu ratios by thermal ionization mass spectrometry.

    Science.gov (United States)

    Suzuki, Daisuke; Esaka, Fumitaka; Miyamoto, Yutaka; Magara, Masaaki

    2015-02-01

    Uranium and plutonium isotope ratios in individual uranium-plutonium (U-Pu) mixed particles with various U/Pu atomic ratios were analyzed without prior chemical separation by thermal ionization mass spectrometry (TIMS). Prior to measurement, micron-sized particles with U/Pu ratios of 1, 5, 10, 18, and 70 were produced from uranium and plutonium certified reference materials. In the TIMS analysis, the peaks of americium, plutonium, and uranium ion signals were successfully separated by continuously increasing the evaporation filament current. Consequently, the uranium and plutonium isotope ratios, except the (238)Pu/(239)Pu ratio, were successfully determined for the particles at all U/Pu ratios. This indicates that TIMS direct analysis allows for the measurement of individual U-Pu mixed particles without prior chemical separation.

  1. THE FEATURES OF BYOCINETICS OF PLUTONIUM AND OTHERS HEPATO-OSTEOTROPIC RADIONUCLIDES AFTER INTRAVENOUS INFUSION OF SODIUM ETYLENDYAMINTETRAACETAT

    Directory of Open Access Journals (Sweden)

    V. S. Repin

    2013-01-01

    Full Text Available In experimental work with experimental animals it is shown that creation of artificial deficiency of calcium in the blood of rats at the 2-hours infusion of sodium salt EDTA stimulates activation of resorption processes in a skeleton and promotes increase an urine temp excretion of plutonium-239, americium-241 and ittrium-91 whereas the temp of calcium-45 excretion with urine decreases and becomes below the level which was before EDTA intake. Activation of resorption processes begins after12 hours from the moment of EDTA intake and proceeds within 3 days and more. The effect can find practical application in the estimation of radionuclides content in a skeleton by method of indirect dosimetry using the value of excretion with urine velocity.

  2. University of Washington's radioecological studies in the Marshall Islands, 1946-1977.

    Science.gov (United States)

    Donaldson, L R; Seymour, A H; Nevissi, A E

    1997-07-01

    Since 1946, personnel from the School of Fisheries, University of Washington (Applied Fisheries Laboratory, 1943-1958; Laboratory of Radiation Biology, 1958-1967; and Laboratory of Radiation Ecology, since 1967), have studied the effects of nuclear detonations and the ensuing radioactivity on the marine and terrestrial environments throughout the Central Pacific. A collection of reports and publications about these activities plus a collection of several thousand samples from these periods are kept at the School of Fisheries. General findings from the surveys show that (1) fission products were prevalent in organisms of the terrestrial environment whereas activation products were prevalent in marine organisms; (2) the best biological indicators of fallout radionuclides by environments were (a) terrestrial-coconuts, land crabs; (b) reef-algae, invertebrates; and (c) marine-plankton, fish. Studies of plutonium and americium in Bikini Atoll showed that during 1971-1977 the highest concentrations of 241Am, 2.85 Bq g(-1) (77 pCi g(-1)) and 239,240Pu, 4.44 Bq g(-1) (120 pCi g(-1)), in surface sediments were found in the northwest part of the lagoon. The concentrations in the bomb craters were substantially lower than these values. Concentrations of soluble and particulate plutonium and americium in surface and deep water samples showed distributions similar to the sediment samples. That is, the highest concentration of these radionuclides in the water column were at locations with highest sediment concentration. Continuous circulation of water in the lagoon and exchange of water with open ocean resulted in removal of 111 G Bq y(-1) (3 Ci y(-1)) 241Am and 222 G Bq y(-1) (6 Ci y(-1)) 239,240Pu into the North Equatorial Current. A summary of the surveys, findings, and the historical role of the Laboratory in radioecological studies of the Marshall Islands are presented.

  3. The effect of carbonate soil on transport and dose estimates for long-lived radionuclides at a U.S. Pacific test site

    Energy Technology Data Exchange (ETDEWEB)

    Conrado, C L; Hamilton, T F; Robison, W L; Stoker, A C

    1999-01-01

    The US conducted a series of nuclear tests from 1946 to 1958 at Bikini, a coral atoll, in the Marshall Islands (MI). The aquatic and terrestrial environments of the atoll are still contaminated with several long-lived radionuclides that were generated during testing. The four major radionuclides found in terrestrial plants and soils are Cesium-137 ({sup 137}Cs), Strontium-90 ({sup 90}Sr), Plutonium-239+240 ({sup 239+240}Pu) and Americium-241 ({sup 241}Am). {sup 137}Cs in the coral soils is more available for uptake by plants than {sup 137}Cs associated with continental soils of North America or Europe. Soil-to-plant {sup 137}Cs median concentration ratios (CR) (kBq kg{sup {minus}1} dry weight plant/kBq kg{sup {minus}1} dry weight soil) for tropical fruits and vegetables range between 0.8 and 36, much larger than the range of 0.005 to 0.5 reported for vegetation in temperate zones. Conversely, {sup 90}Sr median CRs range from 0.006 to 1.0 at the atoll versus a range from 0.02 to 3.0 for continental silica-based soils. Thus, the relative uptake of {sup 137}Cs and {sup 90}Sr by plants in carbonate soils is reversed from that observed in silica-based soils. The CRs for {sup 239+240}Pu and {sup 241}Am are very similar to those observed in continental soils. Values range from 10{sup {minus}6} to 10{sup {minus}4} for both {sup 239+240}Pu and {sup 241}Am. No significant difference is observed between the two in coral soil.

  4. Investigation of the chemical explosion of an ion exchange resin column and resulting americium contamination of personnel in the 242-Z building, August 30, 1976

    Energy Technology Data Exchange (ETDEWEB)

    1976-10-19

    As a result of an explosion in the Waste Treatment Facility, 242-Z Building, 200 West Area of the Hanford Reservation on August 30, 1976, the Manager of the Richland Operations Office (RL), Energy Research and Development Administration (ERDA), appointed an ERDA Committee to conduct a formal investigation and to prepare a report on their findings of this occurrence. The Committee was instructed to conduct the investigation in accordance with ERDAMC 0502, insofar as circumstances would permit, to cover and explain technical elements of the casual sequence(s) of the occurrence, and to describe management systems which should have or could have prevented the occurrence. This report is the result of the investigation and presents the conclusions of the review.

  5. Aqueous complexation of citrate with neodymium(III) and americium(III): a study by potentiometry, absorption spectrophotometry, microcalorimetry, and XAFS.

    Science.gov (United States)

    Brown, M Alex; Kropf, A Jeremy; Paulenova, Alena; Gelis, Artem V

    2014-05-07

    The aqueous complexation of Nd(III) and Am(III) with anions of citrate was studied by potentiometry, absorption spectrophotometry, microcalorimetry, and X-ray absorption fine structure (XAFS). Using potentiometric titration data fitting the metal-ligand (L) complexes that were identified for Nd(III) were NdHL, NdL, NdHL2, and NdL2; a review of trivalent metal-citrate complexes is also included. Stability constants for these complexes were calculated from potentiometric and spectrophotometric titrations. Microcalorimetric results concluded that the entropy term of complex formation is much more dominant than the enthalpy. XAFS results showed a dependence in the Debye-Waller factor that indicated Nd(iii)-citrate complexation over the pH range of 1.56-6.12.

  6. Americium(III) oxidation by copper(III) periodate in nitric acid solution as compared with the action of Bi(V) compounds of sodium, lithium, and potassium

    Energy Technology Data Exchange (ETDEWEB)

    Sinkov, Sergey I.; Lumetta, Gregg J. [Pacific Northwest National Laboratory, Radiochemical Processing Lab., Richland, WA (United States)

    2015-07-01

    The oxidative action of a Cu(III) periodate compound toward Am(III) in nitric acid was studied. The extent of oxidation of Am(III) to Am(VI) was investigated using a constant initial Cu(III)-to-Am(III) molar ratio of 10:1 and varying nitric acid concentrations from 0.25 to 3.5 mol/L. From 0.25 to 3 mol/L HNO3, more than 98% of the Am(III) was oxidized to Am(VI); however, at 3.5 mol/L HNO{sub 3}, the conversion to Am(VI) was only 80%. Increasing the Cu(III)-to-Am(III) molar ratio to 20:1 in 3.5 mol/L HNO{sub 3} resulted in 98% conversion to Am(VI). For comparison, oxidation of Am(III) with NaBiO{sub 3} was studied at 3.5 mol/L HNO{sub 3} and the same stoichiometric excess of Bi(V) oxidant over Am(III) (stoichiometric ratio of 3.33:1). With NaBiO{sub 3}, the extent of Am(III) conversion to Am(VI) was only 19%, while with the Cu(III) compound this value was found to be about 4 times higher under otherwise identical conditions. Similar results were obtained with other Bi(V) salts. These results show that the Cu(III) periodate compound is a superior oxidant to NaBiO{sub 3}, yielding rapid conversion to Am(VI) in a homogeneous acidic solution, and is, therefore, an excellent candidate for further development of Am separation systems.

  7. Chemical speciation of strontium, americium, and curium in high level waste: Predictive modeling of phase partitioning during tank processing. Annual progress report, October 1996--September 1997

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, A.R. [Pacific Northwest National Lab., Richland, WA (US); Choppin, G. [Florida State Univ., Tallahassee, FL (US)

    1997-12-31

    'The program at Florida State University was funded to collaborate with Dr. A. Felmy (PNNL) on speciation in high level wastes and with Dr. D. Rai (PNNL) on redox of Pu under high level waste conditions. The funding provided support for 3 research associates (postdoctoral researchers) under Professor G. R. Choppin as P.I. Dr. Kath Morris from U. Manchester (Great Britain), Dr. Dean Peterman and Dr. Amy Irwin (both from U. Cincinnati) joined the laboratory in the latter part of 1996. After an initial training period to become familiar with basic actinide chemistry and radiochemical techniques, they began their research. Dr. Peterman was assigned the task of measuring Th-EDTA complexation prior to measuring Pu(IV)-EDTA complexation. These studies are associated with the speciation program with Dr. Felmy. Drs. Morris and Irwin initiated research on redox of plutonium with agents present in the Hanford Tanks as a result of radiolysis or from use in separations. The preliminary results obtained thus far are described in this report. It is expected that the rate of progress will continue to increase significantly as the researchers gain more experience with plutonium chemistry.'

  8. Studies on the feasibility of using completely incinerable reagents for the single-cycle separation of americium(III) from simulated high-level liquid waste

    Energy Technology Data Exchange (ETDEWEB)

    Nayak, P.K.; Kumaresan, R.; Venkatesan, K.A.; Subramanian, G.G.S.; Prathibha, T.; Syamala, K.V.; Selvan, B. Robert; Rajeswari, S.; Antony, M.P.; Rao, P.R. Vasudeva [Indira Gandhi Centre for Atomic Research, Kalpakkam (India). Fuel Chemistry Div.; Chaurasia, Shivkumar; Bhanage, B.M. [Institute of Chemical Technology, Mumbai (India)

    2015-06-01

    The extraction and stripping behavior of various metal ions present in the fast reactor simulated high-level liquid waste (FR-SHLLW) was studied using a solvent phase composed of a neutral extractant, N,N,-didodecyl-N',N'-dioctyl-3-oxapentane-1,5-diamide (D{sup 3}DODGA) and an acidic extractant, di-2-ethylhexyl diglycolamic acid (HDEHDGA) in n-dodecane (n-DD). The third phase formation behavior of the solvent formulation D{sup 3}DODGA + HDEHDGA/n-DD, was studied when it was contacted with FR-SHLLW, and the concentration of neutral and acidic extractant needed to avoid the third phase formation was optimized. The distribution ratio of various metal ions present in FR-SHLLW was measured in a solution of 0.1 M D{sup 3}DODGA + 0.2 M HDEHDGA/n-DD. The extraction of Am(III) was accompanied by the co-extraction of lanthanides and unwanted metal ions such as Zr(IV), Y(III), and Pd(II). A procedure was developed to minimize the extraction of unwanted metal ions by using aqueous soluble complexing agents in FR-SHLLW. Based on those results, the counter-current mixer-settler run was performed in a 20-stage mixer-settler. Quantitative extraction of Am(III), Ln(III), Y(III), and Sr(II) in 0.1 M D{sup 3}DODGA + 0.2 M HDEHDGA/n-DD was observed. The recovery of Am(III) from the loaded organic phase was carried out by the optimized aqueous formulation composed of 0.01 M diethylenetriaminepentaacetic acid (DTPA) + 0.5 M citric acid (CA) at pH 1.5. The stripping of Am(III) was accompanied by co-stripping of some early lanthanides. However the later lanthanides (Eu(III) and beyond) were not back extracted to Am(III) product. Therefore, the studies foresee the possibility of intra-lanthanides as well as lanthanide-actinide separation in a single-processing cycle.

  9. Proceedings of the specialists' meeting on nuclear data of plutonium and americium isotopes for reactor applications. [BNL, Nov. 20-21, 1978

    Energy Technology Data Exchange (ETDEWEB)

    Chrien, R E [ed.

    1979-05-01

    Separate abstracts were prepared for 17 of the papers in these Proceedings. The remaining six have already been cited in ERA, and can be located by referring to the entry CONF-781174-- in the Report Number Index. (RWR)

  10. An updated dose assessment for Rongelap Island

    Energy Technology Data Exchange (ETDEWEB)

    Robison, W.L.; Conrado, C.L.; Bogen, K.T.

    1994-07-01

    We have updated the radiological dose assessment for Rongelap Island at Rongelap Atoll using data generated from field trips to the atoll during 1986 through 1993. The data base used for this dose assessment is ten fold greater than that available for the 1982 assessment. Details of each data base are presented along with details about the methods used to calculate the dose from each exposure pathway. The doses are calculated for a resettlement date of January 1, 1995. The maximum annual effective dose is 0.26 mSv y{sup {minus}1} (26 mrem y{sup {minus}1}). The estimated 30-, 50-, and 70-y integral effective doses are 0.0059 Sv (0.59 rem), 0.0082 Sv (0.82 rem), and 0.0097 Sv (0.97 rem), respectively. More than 95% of these estimated doses are due to 137-Cesium ({sup 137}Cs). About 1.5% of the estimated dose is contributed by 90-Strontium ({sup 90}Sr), and about the same amount each by 239+240-Plutonium ({sup 239+240}PU), and 241-Americium ({sup 241}Am).

  11. Effect of Potassium on Uptake of 137Cs in Food Crops Grown on Coral Soils: Annual Crops at Bikini Atoll

    Energy Technology Data Exchange (ETDEWEB)

    Stone, E R; Robinson, W

    2002-02-01

    In 1954 a radioactive plume from the thermonuclear device code named BRAVO contaminated the principal residential islands, Eneu and Bikini, of Bikini Atoll (11{sup o} 36 minutes N; 165{sup o} 22 minutes E), now part of the Republic of the Marshall Islands. The resulting soil radioactivity diminished greatly over the three decades before the studies discussed below began. By that time the shorter-lived isotopes had all but disappeared, but strontium-90 ({sup 90}Sr), and cesium-137, ({sup 137}Cs) were reduced by only one half-life. Minute amounts of the long-lived isotopes, plutonium-239+240 ({sup 239+240}Pu) and americium-241 ({sup 241}Am), were present in soil, but were found to be inconsequential in the food chain of humans and land animals. Rather, extensive studies demonstrated that the major concern for human health was {sup 137}Cs in the terrestrial food chain (Robison et al., 1983; Robison et al., 1997). The following papers document results from several studies between 1986 and 1997 aimed at minimizing the {sup 137}Cs content of annual food crops. The existing literature on radiocesium in soils and plant uptake is largely a consequence of two events: the worldwide fallout of 1952-58, and the fallout from Chernobyl. The resulting studies have, for the most part, dealt either with soils containing some amount of silicate clays and often with appreciable K, or with the short-term development of plants in nutrient cultures.

  12. Insights into the dual activity of SIVmac239 Vif against human and African green monkey APOBEC3G.

    Directory of Open Access Journals (Sweden)

    Ritu Gaur

    Full Text Available Human immunodeficiency virus type 1 (HIV-1 Vif is essential for viral evasion of the host antiviral protein APOBEC3G (APO3G. The Vif protein from a distantly related African green monkey (Agm simian immunodeficiency virus (SIVagm is unable to suppress the antiviral activity of human APO3G but is active against Agm APO3G. SIVmac Vif on the other hand, possesses antiviral activity against both human and Agm APO3G. In this study, we were interested in mapping domains in SIVmac Vif that are responsible for its dual activity against human and Agm APO3G. We constructed a series of Vif chimeras by swapping domains in SIVmac Vif with equivalent regions from SIVagm Vif and determined their activity against human and Agm APO3G. We found that replacing any region in SIVmac Vif by corresponding fragments from SIVagm Vif only moderately reduced the activity of the chimeras against Agm APO3G but in all cases resulted in a severe loss of activity against human APO3G. These results suggest that the domains in SIVmac Vif required for targeting human and Agm APO3G are distinct and cannot be defined as linear amino acid motifs but rather appear to depend on the overall structure of full-length SIVmac Vif.

  13. Heterogeneous reduction of {sup 239}PuO{sub 2} by aqueous Fe(II) in the presence of hematite

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, A.R.; Moore, D.A.; Qafoku, O.; Buck, E.; Ilton, E.S. [Pacific Northwest National Laboratory, Richland, WA (United States); Conradson, S.D. [Los Alamos National Laboratory, NM (United States)

    2013-07-01

    The reduction of PuO{sub 2}(am) by Fe(II) in the presence and absence of hematite was studied over a range of pH values and oxidation/reduction potentials. In contrast to thermodynamic predictions, the presence of hematite did not have a major effect on the overall reduction of PuO{sub 2}(am) to aqueous Pu(III). Instead the aqueous Pu(III) concentrations at longer time frames were accurately predicted using the measured Fe(II) concentration and existing thermodynamic data for the reaction: H{sub 2}O + H{sup +} + Fe{sup 2+} + PuO{sub 2}(am) {r_reversible} Pu{sup 3+} + Fe(OH){sub 3}(am) with log K = -0.6. The accuracy of this approach in all solutions containing aqueous Fe(II), coupled with the apparent lack of oxidation of Fe(II) by O{sub 2}(g), suggests that the Fe(OH){sub 3}(am) is formed by the oxidation of Fe(II) to Fe(III) by radiolysis. The continued generation of reactive amorphous iron hydroxide by radiolysis prevents thermodynamic equilibrium from being reached with more stable ferric oxide compounds, except possibly under acidic conditions where amorphous ferric hydroxide is soluble. The use of measured pe values, instead of aqueous Fe(II) measurements, also yields reasonable predictions of the final Pu(III) concentrations although the predictions are more uncertain. (orig.)

  14. Evaluation of fission product yields from fission spectrum n+239Pu using a meta analysis of benchmark data

    Science.gov (United States)

    Chadwick, Mark B.

    2009-10-01

    Los Alamos conducted a dual fission-chamber experiment in the 1970s in the Bigten critical assembly to determine fission product data in a fast (fission neutron spectrum) environment, and this defined the Laboratory's fission basis today. We describe how the data from this experiment are consistent with other benchmark fission product yield measurements for 95,97Zr, 140Ba, 143,144Ce, 137Cs from the NIST-led ILRR fission chamber experiments, and from Maeck's mass-spectrometry data. We perform a new evaluation of the fission product yields that is planned for ENDF/B-VII.1. Because the measurement database for some of the FPs is small—especially for 147Nd and 99Mo—we use a meta-analysis that incorporates insights from other accurately-measured benchmark FP data. The %-relative changes compared to ENDF/B-VI are small for some FPs (less than 1% for 95Zr, 140Ba, 144Ce), but are larger for 99Mo (3%) and 147Nd (5%). We suggest an incident neutron energy dependence to the 147Nd fission product yield that accounts for observed differences in the FPY at a few-hundred keV average energy in fast reactors versus measurements made at higher average energies.

  15. Direct Measurement of U235 and Pu239 in Spent Fuel Rods with Gamma-Ray Mirrors

    Energy Technology Data Exchange (ETDEWEB)

    Ziock, Klaus-Peter [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Alameda, J. B. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Brejnholt, N. F. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Decker, T. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Descalle, M. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Fernandez-Perea, M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hill, R. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Kisner, R. A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Melin, A. M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Patton, B. W. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Ruz, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Soufli, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2013-09-30

    The amounts of fissile Pu and U in spent nuclear fuel are of primary concern to the safeguards community. In particular, there are issues when safeguards transitions from an item accountancy basis (such as fuel bundles) to a fissile material mass basis as occurs when spent fuel enters a reprocessing plant. Discrepancies occur because item accountancy requires estimating the content of fissile material using indirect techniques such as the fuel burn-up and item-level measurements of radiation emissions from fission by-products. Direct measurement of the fissile content by monitoring line emissions from fissile species themselves is impossible because the lines are much weaker than those emitted by shorter-lived isotopes in the fuel. The goal of this project is to develop a technique to directly measure these weaker lines despite the presence of overwhelming radiation from other isotopes. This is achieved by using gamma-ray mirrors as a narrow band-pass filter. The mirrors reflect only energies of interest toward a HPGe detector that is shielded from direct view of the spent fuel and its fierce emissions. This can significantly improve the reliability with which the mass of fissile material is tracked.

  16. Sediment chronology in San Francisco Bay, California, defined by 210Pb, 234Th, 137Cs, and 239,340Pu

    Science.gov (United States)

    Fuller, C.C.; van Geen, Alexander; Baskaran, M.; Anima, R.

    1999-01-01

    Sediment chronologies based on radioisotope depth profiles were developed at two sites in the San Francisco Bay estuary to provide a framework for interpreting historical trends in organic compound and metal contaminant inputs. At Richardson Bay near the estuary mouth, sediments are highly mixed by biological and/or physical processes. Excess  penetration ranged from 2 to more than 10 cm at eight coring sites, yielding surface sediment mixing coefficients ranging from 12 to 170 cm2/year. At the site chosen for contaminant analyses, excess  activity was essentially constant over the upper 25 cm of the core with an exponential decrease below to the supported activity between 70 and 90 cm. Both  and  penetrated to 57-cm depth and have broad subsurface maxima between 33 and 41 cm. The best fit of the excess  profile to a steady state sediment accumulation and mixing model yielded an accumulation rate of 0.825 g/cm2/year (0.89 cm/year at sediment surface), surface mixing coefficient of 71 cm2/year, and 33-cm mixed zone with a half-Gaussian depth dependence parameter of 9 cm. Simulations of  and  profiles using these parameters successfully predicted the maximum depth of penetration and the depth of maximum  and  activity. Profiles of successive 1-year hypothetical contaminant pulses were generated using this parameter set to determine the age distribution of sediments at any depth horizon. Because of mixing, sediment particles with a wide range of deposition dates occur at each depth. A sediment chronology was derived from this age distribution to assign the minimum age of deposition and a date of maximum deposition to a depth horizon. The minimum age of sediments in a given horizon is used to estimate the date of first appearance of a contaminant from its maximum depth of penetration. The date of maximum deposition is used to estimate the peak year of input for a contaminant from the depth interval with the highest concentration of that contaminant. Because of the extensive mixing, sediment-bound constituents are rapidly diluted with older material after deposition. In addition, contaminants persist in the mixed zone for many years after deposition. More than 75 years are required to bury 90% of a deposited contaminant below the mixed zone. Reconstructing contaminant inputs is limited to changes occurring on a 20-year time scale. In contrast, mixing is much lower relative to accumulation at a site in San Pablo Bay. Instead, periods of rapid deposition and/or erosion occurred as indicated by frequent sand-silt laminae in the X-radiograph. , , and excess  activity all penetrated to about 120 cm. The distinct maxima in the fallout radionuclides at 105–110 cm yielded overall linear sedimentation rates of 3.9 to 4.1 cm/year, which are comparable to a rate of 4.5±1.5 cm/year derived from the excess  profile.

  17. Corrigendum to 'Pluto's atmospheric structure from the July 2007 stellar occultation' [Icarus 239 (2014) 15-22

    Science.gov (United States)

    Olkin, Catherine B.; Young, Leslie A.; French, Richard G.; Young, Eliot F.; Buie, Marc W.; Howell, Robert R.; Regester, Jeffrey; Ruhland, Catherine R.; Natusch, Tim; Ramm, David J.; Giles, A. Barry; Greenhill, John G.

    2016-05-01

    The authors regret that two coauthors were inadvertently not included in the author list. They are A. Barry. Giles and John. G. Greenhill at School of Physical Sciences, University of Tasmania, Private Bag 37, Hobart, TAS 7001, Australia

  18. Procedures for determination of 239,240Pu, 241Am, 237Np, 234,238U, 2

    DEFF Research Database (Denmark)

    Chen, Q.J.; Aarkrog, Asker; Nielsen, Sven Poul;

    2001-01-01

    Since 1987, the Department of Nuclear Safety Research, Risø National Laboratory has developed procedures for analysis of low-level amounts of radioactivity in large samples of 200 liters seawater, 10 gram sediment, soil and other environmental materials.These analytical procedures provide high ch...

  19. Effect of carbonate soil on transport and dose estimates from long-lived radionuclides at U. S. Pacific Test Site

    Energy Technology Data Exchange (ETDEWEB)

    Conrado, C.L.; Hamilton, T.F.; Robison, W.L.; Stoker, A.C.

    1998-09-01

    The United States conducted a series of nuclear tests from 1946 to 1958 at Bikini, a coral atoll, in the Marshall Islands (MI). The aquatic and terrestrial environments of the atoll are still contaminated with several long-lived radionuclides that were generated during testing. The four major radionuclides found in terrestrial plants and soils are Cesium-137 ({sup 137} Cs), Strontium-90 ({sup 90} Sr), Plutonium-239+ 240 ({sup 239+240}Pu) and Americium-241 ({sup 241}Am). {sup 137}Cs in the coral soils is more available for uptake by plants than {sup 137}Cs associated with continental soils of North America or Europe. Soil-to-plant {sup 137}Cs median concentration ratios (CR) (kBq kg{sup {minus}1} dry weight plant/kBq kg {sup {minus}1} dry weight soil) for tropical fruits and vegetables range between 0.8 and 36, much larger than the range of 0.005 to 0.5 reported for vegetation in temperate zones. Conversely, {sup 90}Sr median CRs range from 0.006 to 1.0 at the atoll versus a range from 0.02 to 3.0 for continental silica-based soils. Thus, the relative uptake of {sup 137}Cs and {sup 90}Sr by plants in carbonate soils is reversed from that observed in silica-based soils. The CRs for {sup 239+240}Pu and {sup 241}Am are very similar to those observed in continental soils. Values range from 10{sup {minus}6} to 10{sup {minus}4} for both {sup 239+240}Pu and {sup 241}Am. No significant difference is observed between the two in coral soil. The uptake of {sup 137}Cs by plants is enhanced because of the absence of mineral binding sites and the low concentration of potassium in the coral soil. {sup 137}Cs is bound to the organic fraction of the soil, whereas {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am are primarily bound to soil particles. Assessment of plant uptake for {sup 137}Cs and {sup 90}Sr into locally grown food crops was a major contributing factor in (1) reliably predicting the radiological dose for returning residents, and (2) developing a strategy to limit the

  20. On weapons plutonium in the arctic environment (Thule, Greenland)

    Energy Technology Data Exchange (ETDEWEB)

    Eriksson, M

    2002-04-01

    This thesis concerns a nuclear accident that occurred in the Thule (Pituffik) area, NW Greenland in 1968, called the Thule accident.Results are based on different analytical techniques, i.e. gamma spectrometry, alpha spectrometry, ICP-MS, SEM with EDX and different sediment models, i.e. (CRS, CIC). The scope of the thesis is the study of hot particles. Studies on these have shown several interesting features, e.g. that they carry most of the activity dispersed from the accident, moreover, they have been very useful in the determination of the source term for the Thule accident debris. Paper I, is an overview of the results from the Thule-97 expedition. This paper concerns the marine environment, i.e. water, sediment and benthic animals in the Bylot Sound. The main conclusions are; that plutonium is not transported from the contaminated sediments into the surface water in this shelf sea, the debris has been efficiently buried in the sediment to great depth as a result of biological activity and transfer of plutonium to benthic biota is low. Paper II, concludes that the resuspension of accident debris on land has been limited and indications were, that americium has a faster transport mechanism from the catchment area to lakes than plutonium and radio lead. Paper III, is a method description of inventory calculation techniques in sediment with heterogeneous activity concentration, i.e. hot particles are present in the samples. It is concluded that earlier inventory estimates have been under estimated and that the new inventory is about 3.8 kg (10 TBq) of {sup 239,240}Pu. Paper IV, describes hot particle separation/identification techniques using real-time digital image systems. These techniques are much faster than conventionally used autoradiography and give the results in real time. Paper V, is a study of single isolated hot particles. The most interesting result is that the fission material in the weapons involved in the accident mostly consisted of {sup 235}U

  1. Recent actinide nuclear data efforts with the DANCE 4{pi} BaF{sub 2} array

    Energy Technology Data Exchange (ETDEWEB)

    Bredeweg, T.A.; Bond, E.M.; Couture, A.J.; Fitzpatrick, J.R.; Haight, R.C.; Hill, T.S.; Jandel, M.; O' Donnell, J.M.; Reifarth, R.; Rundberg, R.S.; Slemmons, A.K.; Tovesson, F.K.; Ullmann, J.L.; Vieira, D.J.; Wilhelmy, J.B.; Fowler, M.M.; Wouters, J.M. [Los Alamos National Laboratory, Los Alamos, NM (United States); Agvaanluvsan, U.; Becker, J.A.; Macri, R.A.; Parker, W.E.; Wilk, P.A.; Wu, C.Y. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Ethvignot, T.; Granier, T. [CEA Bruyeres-le-Chatel, 91 (France)

    2008-07-01

    Much of the recent work in the DANCE collaboration has focused on nuclides of interest to stockpile stewardship, attribution science and the advanced fuel cycle initiative. As an example, we have recently begun a program to produce high precision measurements of the key production and destruction reactions of important nuclear fuel elements and radiochemical diagnostic isotopes. The neutron capture targets that have been fielded under this program include several isotopes of uranium, plutonium and americium. However, neutron capture measurements on many of the actinides are complicated by the presence of {gamma}-rays arising from low energy neutron-induced fission. To overcome this difficulty we have designed and implemented a dual parallel-plate avalanche counter fission-tagging detector. This design provides a high efficiency for detecting fission fragments and is self-contained to allow loading of pre-assembled target/detector assemblies into the neutron beam line at DANCE. Neutron capture measurements have been performed on {sup 234,235,236}U. The results for {sup 236}U are consistent with the Endf/B-6 evaluation while the results for {sup 234}U are as much as 20% lower than the Endf/B-6 evaluation in the keV region. The DANCE results for {sup 234}U(n,{gamma}) have been incorporated into the Endf/B-7 evaluation. Planned measurements on {sup 238,239}Pu are also discussed.

  2. Laboratory column experiments for radionuclide adsorption studies of the Culebra dolomite member of the Rustler Formation

    Energy Technology Data Exchange (ETDEWEB)

    Lucero, D.A.; Heath, C.E. [Sandia National Labs., Albuquerque, NM (United States); Brown, G.O. [Oklahoma State Univ., Stillwater, OK (United States). Biosystems and Agricultural Engineering Dept.

    1998-04-01

    Radionuclide transport experiments were carried out using intact cores obtained from the Culebra member of the Rustler Formation inside the Waste Isolation Pilot Plant, Air Intake Shaft. Twenty-seven separate tests are reported here and include experiments with {sup 3}H, {sup 22}Na, {sup 241}Am, {sup 239}Np, {sup 228}Th, {sup 232}U and {sup 241}Pu, and two brine types, AIS and ERDA 6. The {sup 3}H was bound as water and provides a measure of advection, dispersion, and water self-diffusion. The other tracers were injected as dissolved ions at concentrations below solubility limits, except for americium. The objective of the intact rock column flow experiments is to demonstrate and quantify transport retardation coefficients, (R) for the actinides Pu, Am, U, Th and Np, in intact core samples of the Culebra Dolomite. The measured R values are used to estimate partition coefficients, (kd) for the solute species. Those kd values may be compared to values obtained from empirical and mechanistic adsorption batch experiments, to provide predictions of actinide retardation in the Culebra. Three parameters that may influence actinide R values were varied in the experiments; core, brine and flow rate. Testing five separate core samples from four different core borings provided an indication of sample variability. While most testing was performed with Culebra brine, limited tests were carried out with a Salado brine to evaluate the effect of intrusion of those lower waters. Varying flow rate provided an indication of rate dependent solute interactions such as sorption kinetics.

  3. Radiological and Environmental Research Division annual report, January-December 1981: ecology

    Energy Technology Data Exchange (ETDEWEB)

    1982-07-01

    Highlights of progress accomplished during the year ending December 1981 are presented. Some of the subjects discussed are: the effects of acid deposition on crop-soil systems; the effects of energy-related pollutants on crops, including field corn, which was found to be quite resistant to both O/sub 3/ and SO/sub 2/; the synergistic effects of SO/sub 2/ and NO/sub x/ on soybean productivity; the impact of acid rain on food crops and the dependence of these effects on the chemical composition of rain; the effects of acid rain on soil systems; /sup 239/ /sup 240/Pu, /sup 241/Am, and /sup 243/ /sup 244/Am in a core from the Saquenay Fjord, Quebec; rate of removal of natural thorium isotopes from Lake Michigan water; influence of colloidal dissolved organic carbon on the sorption of plutonium on natural sediments; the behavior of americium in natural waters; and near-bottom currents and sediment resuspension in Lake Michigan. Separate abstracts have been prepared for 12 reports for inclusion in the Energy Data Base. (RJC)

  4. Amchitka Island, Alaska, special sampling project 1997

    Energy Technology Data Exchange (ETDEWEB)

    U.S. Department of Energy, Nevada Operations Office

    2000-06-28

    This 1997 special sampling project represents a special radiobiological sampling effort to augment the 1996 Long-Term Hydrological Monitoring Program (LTHMP) for Amchitka Island in Alaska. Lying in the western portion of the Aleutian Islands arc, near the International Date Line, Amchitka Island is one of the southernmost islands of the Rat Island Chain. Between 1965 and 1971, the U.S. Atomic Energy Commission conducted three underground nuclear tests on Amchitka Island. In 1996, Greenpeace collected biota samples and speculated that several long-lived, man-made radionuclides detected (i.e., americium-241, plutonium-239 and -240, beryllium-7, and cesium-137) leaked into the surface environment from underground cavities created during the testing. The nuclides of interest are detected at extremely low concentrations throughout the environment. The objectives of this special sampling project were to scientifically refute the Greenpeace conclusions that the underground cavities were leaking contaminants to the surface. This was achieved by first confirming the presence of these radionuclides in the Amchitka Island surface environment and, second, if the radionuclides were present, determining if the source is the underground cavity or worldwide fallout. This special sampling and analysis determined that the only nonfallout-related radionuclide detected was a low level of tritium from the Long Shot test, which had been previously documented. The tritium contamination is monitored and continues a decreasing trend due to radioactive decay and dilution.

  5. Preparation of alpha sources using magnetohydrodynamic electrodeposition for radionuclide metrology.

    Science.gov (United States)

    Panta, Yogendra M; Farmer, Dennis E; Johnson, Paula; Cheney, Marcos A; Qian, Shizhi

    2010-02-01

    Expanded use of nuclear fuel as an energy resource and terrorist threats to public safety clearly require the development of new state-of-the-art technologies and improvement of safety measures to minimize the exposure of people to radiation and the accidental release of radiation into the environment. The precision in radionuclide metrology is currently limited by the source quality rather than the detector performance. Electrodeposition is a commonly used technique to prepare massless radioactive sources. Unfortunately, the radioactive sources prepared by the conventional electrodeposition method produce poor resolution in alpha spectrometric measurements. Preparing radioactive sources with better resolution and higher yield in the alpha spectrometric range by integrating magnetohydrodynamic convection with the conventional electrodeposition technique was proposed and tested by preparing mixed alpha sources containing uranium isotopes ((238)U, (234)U), plutonium ((239)Pu), and americium ((241)Am) for alpha spectrometric determination. The effects of various parameters such as magnetic flux density, deposition current and time, and pH of the sample solution on the formed massless radioactive sources were also experimentally investigated.

  6. Contaminant monitoring of biota downstream of a radioactive liquid waste treatment facility, Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Bennett, K.D.; Biggs, J.R.; Fresquez, P.R. [Los Alamos National Lab., NM (United States). Environment, Safety, and Health Div.

    1996-12-31

    Small mammals, plants, and sediments were sampled at one upstream location (Site 1) and two downstream locations (Site 2 and Site 3) from the National Pollution Discharge Elimination System (NPDES) outfall {number_sign}051-051 in Mortandad Canyon, Los Alamos National Laboratory, Los Alamos, New Mexico. The purpose of the sampling was to identify radionuclides potentially present, to quantitatively estimate and compare the amount of radionuclide uptake at specific locations (Site 2 and Site 3) within Mortandad Canyon to an upstream site (Site 1), and to identify the primary mode (inhalation/ingestion or surface contact) of contamination to small mammals. Three composite samples of at least five animals per sample were collected at each site. The pelt was separated from the carcass of each animal and both were analyzed independently. In addition, three composite samples were also collected for plants and sediments at each site. Samples were analyzed for americium ({sup 241}Am), strontium ({sup 90}Sr), plutonium ({sup 238}Pu and {sup 239}Pu), and total uranium (U). With the exception of total U, all mean radionuclide concentrations in small mammal carcasses and sediments were significantly higher at Site 2 than Site 1 or Site 3. No differences were detected in the mean radionuclide concentration of plant samples between sites. However, some radionuclide concentrations found at all three sites were higher than regional background. No differences were found between mean carcass radionuclide concentrations and mean pelt radionuclide concentrations, indicating that the two primary modes of contamination may be equally occurring.

  7. Radioactivity in Norwegian Waters: Distribution in seawater and sediments, and uptake in marine organisms

    Energy Technology Data Exchange (ETDEWEB)

    Heldal, Hilde Elise

    2001-07-01

    Prior to the detonation of the first thermonuclear bomb, small amounts of radioactivity, for example in mineral water, were considered to be health enriching. Negative experiences related to thermonuclear bombs and several nuclear accidents have, however, changed people's attitude towards radioactivity during the past 40-50 years. Today, there is a common concern for regular and potential accidental releases of radioactivity from sources such as Sellafield. Although this is important, incorrect assessments of the effects of these releases (e.g. created by uncritical journalism) have the potential to harm the country's fisheries and economy. Therefore, it is of major importance to document up-to-date levels of radioactive contamination of the marine environment, and be able to place these into the proper perspectives. The main topics of the thesis may be summarised as follows: (1) Distribution of Caesium-137, Plutonium-238, Plutonium-239,240 and Americium-241 in sediments with emphasis on the Spitsbergen-Bear Island area, (2) Uptake of Caesium-137 in phytoplankton representative for the Barents and Norwegian Seas phytoplankton communities (laboratory experiments), (3) Bioaccumulation of Caesium-137 in food webs in the Barents and Norwegian Seas, (4) Geographical variations of Caesium-137 in harbour porpoises (Phocoena phocoena) along the Norwegian coast, (5) Transport times for Technetium-99 from Sellafield to various locations along the Norwegian coast and the Arctic Ocean.

  8. Evaluation of background concentrations of selected chemical and radiochemical constituents in water from the eastern Snake River Plain aquifer at and near the Idaho National Laboratory, Idaho

    Science.gov (United States)

    Bartholomay, Roy C.; L. Flint Hall,

    2016-05-05

    The U.S. Geological Survey and Idaho Department of Environmental Quality Idaho National Laboratory (INL) Oversight Program in cooperation with the U.S. Department of Energy determined background concentrations of selected chemical and radiochemical constituents in the eastern Snake River Plain aquifer to aid with ongoing cleanup efforts at the INL. Chemical and radiochemical constituents including calcium, magnesium, sodium, potassium, silica, chloride, sulfate, fluoride, bicarbonate, chromium, nitrate, tritium, strontium-90, chlorine-36, iodine-129, plutonium-238, plutonium-239, -240 (undivided), americium-241, technetium-99, uranium-234, uranium-235, and uranium-238 were selected for the background study because they were either not analyzed in earlier studies or new data became available to give a more recent determination of background concentrations. Samples of water collected from wells and springs at and near the INL that were not believed to be influenced by wastewater disposal were used to identify background concentrations. Groundwater in the eastern Snake River Plain aquifer at and near the INL was divided into two major water types (western tributary and eastern regional) based on concentrations of lithium less than and greater than 5 micrograms per liter (μg/L). Median concentrations for each constituent were used to define the upper limit of background.

  9. Artificial (Pu {sup 90}Sr, {sup 241}Am) and natural (U) isotopes in human bones from Poland

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, J.W.; Tomankiewicz, E. [Institute of Nuclear Phyics (Poland); Golec, E.; Golec, J.; Nowak, S.; Szczygiel, E. [The 5th Military Clinical Hospital and Polyclinic (Poland); Kuzma, K. [General Hospital (Poland)

    2014-07-01

    In two papers we have presented results if analyses of artificial isotopes ({sup 238,239,240}Pu, {sup 241}Am and {sup 90}Sr) content in human bones, using samples collected during hip joint replacement surgery. Since the patients were members of general population (not exposed in any particular form to artificial radionuclides) results can be treated as current background level for Poland and perhaps also whole central Europe. During this project the open question appeared - what is the level in human bones of natural alpha emitters like {sup 238}U-, {sup 234}U, for instance. Therefore about 30 human hip joint bone samples are being now analysed for the presence of uranium along with mentioned above artificial radionuclides. Samples are ashen and sequential radiochemical analyse is applied for separation of Pu, Sr and Am isotopes followed by separation of uranium using anion exchange resin. Measurements of plutonium, americium and uranium are performed using alpha spectrometry. That for {sup 90}Sr is done by LSC. Results will be presented during conference. Document available in abstract form only. (authors)

  10. Effect of transplutonium doping on approach to long-life core in uranium-fueled PWR

    Energy Technology Data Exchange (ETDEWEB)

    Peryoga, Yoga; Saito, Masaki; Artisyuk, Vladimir [Tokyo Inst. of Tech. (Japan). Research Lab. for Nuclear Reactors; Shmelev, Anatolii [Moscow Engineering Physics Institute, Moscow (Russian Federation)

    2002-08-01

    The present paper advertises doping of transplutonium isotopes as an essential measure to improve proliferation-resistance properties and burnup characteristics of UOX fuel for PWR. Among them {sup 241}Am might play the decisive role of burnable absorber to reduce the initial reactivity excess while the short-lived nuclides {sup 242}Cm and {sup 244}Cm decay into even plutonium isotopes, thus increasing the extent of denaturation for primary fissile {sup 239}Pu in the course of reactor operation. The doping composition corresponds to one discharged from a current PWR. For definiteness, the case identity is ascribed to atomic percentage of {sup 241}Am, and then the other transplutonium nuclide contents follow their ratio as in the PWR discharged fuel. The case of 1 at% doping to 20% enriched uranium oxide fuel shows the potential of achieving the burnup value of 100 GWd/tHM with about 20% {sup 238}Pu fraction at the end of irradiation. Since so far, americium and curium do not require special proliferation resistance measures, their doping to UOX would assist in introducing nuclear technology in developing countries with simultaneous reduction of accumulated minor actinides stockpiles. (author)

  11. Interaction and transport of actinides in natural clay rock with consideration of humic substances and clay organics. Characterization and quantification of the influence of clay organics on the interaction and diffusion of uranium and americium in the clay. Joint project

    Energy Technology Data Exchange (ETDEWEB)

    Bernhard, Gert [Helmholtz-Zentrum Dresden-Rossendorf e.V. (Germany). Inst. of Radiochemistry; Schmeide, Katja; Joseph, Claudia; Sachs, Susanne; Steudtner, Robin; Raditzky, Bianca; Guenther, Alix

    2011-07-01

    The objective of this project was the study of basic interaction processes in the systems actinide - clay organics - aquifer and actinide - natural clay - clay organics - aquifer. Thus, complexation, redox, sorption and diffusion studies were performed. To evaluate the influence of nitrogen, phosphorus and sulfur containing functional groups of humic acid (HA) on the complexation of actinides in comparison to carboxylic groups, the Am(III) and U(VI) complexation by model ligands was studied by UV-Vis spectroscopy and TRLFS. The results show that Am(III) is mainly coordinated via carboxylic groups, however, probably stabilized by nitrogen groups. The U(VI) complexation is dominated by carboxylic groups, whereas nitrogen and sulfur containing groups play a minor role. Phosphorus containing groups may contribute to the U(VI) complexation by HA, however, due to their low concentration in HA they play only a subordinate role compared to carboxylic groups. Applying synthetic HA with varying sulfur contents (0 to 6.9 wt.%), the role of sulfur functionalities of HA for the U(VI) complexation and Np(V) reduction was studied. The results have shown that sulfur functionalities can be involved in U(VI) humate complexation and act as redox-active sites in HA for the Np(V) reduction. However, due to the low content of sulfur in natural HA, its influence is less pronounced. In the presence of carbonate, the U(VI) complexation by HA was studied in the alkaline pH range by means of cryo-TRLFS (-120 C) and ATR FT-IR spectroscopy. The formation of the ternary UO{sub 2}(CO{sub 3}){sub 2}HA(II){sup 4-} complex was detected. The complex formation constant was determined with log {beta}{sub 0.1} M = 24.57 {+-} 0.17. For aqueous U(VI) citrate and oxalate species, luminescence emission properties were determined by cryo-TRLFS and used to determine stability constants. The existing data base could be validated. The U(VI) complexation by lactate, studied in the temperature range 7 to 65 C, was found to be endothermic and entropy-driven. In contrast, the complex stability constants determined for U(VI) humate complexation at 20 and 40 C are comparable, however, decrease at 60 C. For aqueous U(IV) citrate, succinate, mandelate and glycolate species stability constants were determined. These ligands, especially citrate, increase solubility and mobility of U(IV) in solution due to complexation. The U(VI) sorption onto crushed Opalinus Clay (OPA, Mont Terri, Switzerland) was studied in the absence and presence of HA or low molecular weight organic acids, in dependence on temperature and CO2 presence using OPA pore water as background electrolyte. Distribution coefficients (K{sub d}) were determined for the sorption of U(VI) and HA onto OPA with (0.0222 {+-} 0.0004) m{sup 3}/kg and (0.129 {+-} 0.006) m{sup 3}/kg, respectively. The U(VI) sorption is not influenced by HA ({<=}50 mg/L), however, decreased by low molecular weight organic acids ({>=} 1 x 10{sup -5} M), especially by citrate and tartrate. With increasing temperature, the U(VI) sorption increases both in the absence and in the presence of clay organics. The U(VI) diffusion in compacted OPA is not influenced by HA at 25 and 60 C. Predictions of the U(VI) diffusion show that an increase of the temperature to 60 C does not accelerate the migration of U(VI). With regard to uranium-containing waste, it is concluded that OPA is suitable as host rock for a future nuclear waste repository since OPA has a good retardation potential for U(VI). (orig.)

  12. Monitored Natural Attenuation of Inorganic Contaminants in Ground Water Volume 3 Assessment for Radionuclides IncludingTritium, Radon, Strontium, Technetium, Uranium, Iodine, Radium, Thorium, Cesium, and Plutonium-Americium

    Science.gov (United States)

    The current document represents the third volume of a set of three volumes that address the technical basis and requirements for assessing the potential applicability of MNA as part of a ground-water remedy for plumes with nonradionuclide and/or radionuclide inorganic contamina...

  13. Study of plutonium and americium contamination in agricultural area, radiological impact caused by consumption of vegetables of this area; Estudio de la contaminacion de plutonio y americio en un area agricola, impacto radiologico ocasionado por consumo de vegetales contaminados

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa, Assuncion; Aragon, Antonio; Cruz, Berta de la; Gutierrez, Jose [Centro de Investigaciones Energeticas Medioambientales y Tecnologicas, Madrid (Spain). Dept. de Impacto Ambiental de la Energia

    2001-07-01

    The transuranide concentration has been studied for 30 years in vegetable production, crops in wide extensions and in private-owned farms, all of them situated within the Pu-contaminated area of Palomares due to an air accident in 1966. Based on these studies, a preliminary estimation of the radiological risk caused by the consumption of these products by the inhabitants was possible. The results show that most of the fruits present a surface contamination, which disappears or is significantly reduced when they are washed. The contamination present in edible parts of the vegetables, as well as the contamination of other products included in the diet, has facilitated the estimation of the effective dose for ingestion and the committed effective dose for 50 years for the inhabitants. The main conclusions are: those plants, whose cultivation period is less than a year, present a low level of contamination; the green parts of the plants have a higher contamination than the fruits; the Pu soil to plant transfer factor is very low. In general, those plants that have remained in the contaminated land for several years present a high contamination level; the ingestion of products from Palomares does not represent an important risk for the population, even in the case that the products were totally consumed by a critical group.( author)

  14. Supported liquid inorganic membranes for nuclear waste separation

    Energy Technology Data Exchange (ETDEWEB)

    Bhave, Ramesh R; DeBusk, Melanie M; DelCul, Guillermo D; Delmau, Laetitia H; Narula, Chaitanya K

    2015-04-07

    A system and method for the extraction of americium from radioactive waste solutions. The method includes the transfer of highly oxidized americium from an acidic aqueous feed solution through an immobilized liquid membrane to an organic receiving solvent, for example tributyl phosphate. The immobilized liquid membrane includes porous support and separating layers loaded with tributyl phosphate. The extracted solution is subsequently stripped of americium and recycled at the immobilized liquid membrane as neat tributyl phosphate for the continuous extraction of americium. The sequestered americium can be used as a nuclear fuel, a nuclear fuel component or a radiation source, and the remaining constituent elements in the aqueous feed solution can be stored in glassified waste forms substantially free of americium.

  15. PLANTS AS BIO-MONITORS FOR 137CS, 238PU, 239, 240PU AND 40K AT THE SAVANNAH RIVER SITE

    Energy Technology Data Exchange (ETDEWEB)

    Caldwell, E.; Duff, M.; Ferguson, C.

    2010-12-16

    The nuclear fuel cycle generates a considerable amount of radioactive waste, which often includes nuclear fission products, such as strontium-90 ({sup 90}Sr) and cesium-137 ({sup 137}Cs), and actinides such as uranium (U) and plutonium (Pu). When released into the environment, large quantities of these radionuclides can present considerable problems to man and biota due to their radioactive nature and, in some cases as with the actinides, their chemical toxicity. Radionuclides are expected to decay at a known rate. Yet, research has shown the rate of elimination from an ecosystem to differ from the decay rate due to physical, chemical and biological processes that remove the contaminant or reduce its biological availability. Knowledge regarding the rate by which a contaminant is eliminated from an ecosystem (ecological half-life) is important for evaluating the duration and potential severity of risk. To better understand a contaminants impact on an environment, consideration should be given to plants. As primary producers, they represent an important mode of contamination transfer from sediments and soils into the food chain. Contaminants that are chemically and/or physically sequestered in a media are less likely to be bio-available to plants and therefore an ecosystem.

  16. Changes in the Shape of Histograms Constructed from the Results of 239-Pu Alpha-Activity Measurements Correlate with the Deviations of the Moon from the Keplerian Orbit

    Directory of Open Access Journals (Sweden)

    Shapovalov S. N.

    2009-10-01

    Full Text Available We have found that the shape of the histograms, constructed on the basis of the results of radioactivity measurements, changes in correlation with the distortions of the lunar Keplerian orbit (due to the gravitational influence of the Sun. Taking into account that the phenomenon of "macroscopic fluctuations" (regular changes in the fine structure of histograms constructed from the results of measurements of natural processes does not depend on the nature of the process under study, one can consider the correlation of the histogram shape with the Moon's deviations from the Keplerian orbit to be independent from the nature of the process the histograms were obtained on.

  17. Changes in the Shape of Histograms Constructed from the Results of 239-Pu Alpha-Activity Measurements Correlate with the Deviations of the Moon from the Keplerian Orbit

    Directory of Open Access Journals (Sweden)

    Shapovalov S. N.

    2009-10-01

    Full Text Available We have found that the shape of the histograms, constructed on the basis of the results of radioactivity measurements, changes in correlation with the distortions of the lunar Keplerian orbit (due to the gravitational influence of the Sun. Taking into account that the phenomenon of “macroscopic fluctuations” (regular changes in the fine structure of histograms constructed from the results of measurements of natural processes does not depend on the nature of the process under study, one can consider the correlation of the histogram shape with the Moon’s deviations from the Keplerian orbit to be independent from the nature of the process the histograms were obtained on.

  18. 17 CFR 239.40 - Form F-10, for registration under the Securities Act of 1933 of securities of certain Canadian...

    Science.gov (United States)

    2010-04-01

    ... class of the subject securities. (g) In the case of a business combination, the securities to be... reorganization requiring the vote of shareholders of the participating companies (a “business combination”). (b... obligations, provided, however, that in the case of a business combination, each participating company...

  19. Middlesex Sampling Plant environmental report for calendar year 1992, 239 Mountain Avenue, Middlesex, New Jersey. Formerly Utilized Sites Remedial Action Program (FUSRAP)

    Energy Technology Data Exchange (ETDEWEB)

    1993-05-01

    This report describes the environmental surveillance program at the Middlesex Sampling Plant (MSP) and provides the results for 1992. The site, in the Borough of Middlesex, New Jersey, is a fenced area and includes four buildings and two storage piles that contain 50,800 m{sup 3} of radioactive and mixed hazardous waste. More than 70 percent of the MSP site is paved with asphalt. The MSP facility was established in 1943 by the Manhattan Engineer District (MED) to sample, store, and/or ship uranium, thorium, and beryllium ores. In 1955 the Atomic Energy Commission (AEC), successor to MED, terminated the operation and later used the site for storage and limited sampling of thorium residues. In 1967 AEC activities ceased, onsite structures were decontaminated, and the site was certified for unrestricted use under criteria applicable at that time. In 1980 the US Department of Energy (DOE) initiated a multiphase remedial action project to clean up several vicinity properties onto which contamination from the plant had migrated. Material from these properties was consolidated into the storage piles onsite. Environmental surveillance of MSP began in 1980 when Congress added the site to DOE`s Formerly Utilized Sites Remedial Action Program. The environmental surveillance program at MSP includes sampling networks for radon and thoron in air; external gamma radiation exposure; and radium-226, radium-228, thorium-230, thorium-232, and total uranium in surface water, sediment, and groundwater. Additionally, chemical analyses are performed to detect metals and organic compounds in surface water and groundwater and metals in sediments. This program assists in fulfilling th DOE policy of measuring and monitoring effluents from DOE activities and calculating hypothetical doses.

  20. High workload and job stress are associated with lower practice performance in general practice: an observational study in 239 general practices in the Netherlands.

    NARCIS (Netherlands)

    Hombergh, P. van den; Kunzi, B.; Elwyn, G.; Doremalen, J.H.M. van; Akkermans, R.P.; Grol, R.P.T.M.; Wensing, M.J.P.

    2009-01-01

    BACKGROUND: The impact of high physician workload and job stress on quality and outcomes of healthcare delivery is not clear. Our study explored whether high workload and job stress were associated with lower performance in general practices in the Netherlands. METHODS: Secondary analysis of data fr