WorldWideScience

Sample records for americium 238

  1. Calcium and zinc DTPA administration for internal contamination with plutonium-238 and americium-241.

    Science.gov (United States)

    Kazzi, Ziad N; Heyl, Alexander; Ruprecht, Johann

    2012-08-01

    The accidental or intentional release of plutonium or americium can cause acute and long term adverse health effects if they enter the human body by ingestion, inhalation, or injection. These effects can be prevented by rapid removal of these radionuclides by chelators such as calcium or zinc diethylenetriaminepentaacetate (calcium or zinc DTPA). These compounds have been shown to be efficacious in enhancing the elimination of members of the actinide family particularly plutonium and americium when administered intravenously or by nebulizer. The efficacy and adverse effects profile depend on several factors that include the route of internalization of the actinide, the type, and route time of administration of the chelator, and whether the calcium or zinc salt of DTPA is used. Current and future research efforts should be directed at overcoming limitations associated with the use of these complex drugs by using innovative methods that can enhance their structural and therapeutic properties.

  2. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  3. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  4. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  5. 1976 Hanford americium accident

    Energy Technology Data Exchange (ETDEWEB)

    Heid, K R; Breitenstein, B D; Palmer, H E; McMurray, B J; Wald, N

    1979-01-01

    This report presents the 2.5-year medical course of a 64-year-old Hanford nuclear chemical operator who was involved in an accident in an americium recovery facility in August 1976. He was heavily externally contaminated with americium, sustained a substantial internal deposition of this isotope, and was burned with concentrated nitric acid and injured by flying debris about the face and neck. The medical care given the patient, including the decontamination efforts and clinical laboratory studies, are discussed. In-vivo measurements were used to estimate the dose rates and the accumulated doses to body organs. Urinary and fecal excreta were collected and analyzed for americium content. Interpretation of these data was complicated by the fact that the intake resulted both from inhalation and from solubilization of the americium embedded in facial tissues. A total of 1100 ..mu..Ci was excreted in urine and feces during the first 2 years following the accident. The long-term use of diethylenetriaminepentate (DTPA), used principally as the zinc salt, is discussed including the method, route of administration, and effectiveness. To date, the patient has apparently experienced no complications attributable to this extensive course of therapy, even though he has been given approximately 560 grams of DTPA. 4 figures, 1 table.

  6. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  7. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  8. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  9. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)

    2010-07-01

    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  10. WEB 238 Courses Tutorial / indigohelp

    OpenAIRE

    neha

    2015-01-01

    WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs  

  11. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  12. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  13. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  14. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  15. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  16. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  17. Surface complexation modeling of americium sorption onto volcanic tuff.

    Science.gov (United States)

    Ding, M; Kelkar, S; Meijer, A

    2014-10-01

    Results of a surface complexation model (SCM) for americium sorption on volcanic rocks (devitrified and zeolitic tuff) are presented. The model was developed using PHREEQC and based on laboratory data for americium sorption on quartz. Available data for sorption of americium on quartz as a function of pH in dilute groundwater can be modeled with two surface reactions involving an americium sulfate and an americium carbonate complex. It was assumed in applying the model to volcanic rocks from Yucca Mountain, that the surface properties of volcanic rocks can be represented by a quartz surface. Using groundwaters compositionally representative of Yucca Mountain, americium sorption distribution coefficient (Kd, L/Kg) values were calculated as function of pH. These Kd values are close to the experimentally determined Kd values for americium sorption on volcanic rocks, decreasing with increasing pH in the pH range from 7 to 9. The surface complexation constants, derived in this study, allow prediction of sorption of americium in a natural complex system, taking into account the inherent uncertainty associated with geochemical conditions that occur along transport pathways.

  18. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)

    2000-07-01

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  19. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  20. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  1. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  2. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  3. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, Kyle Shelton [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-09-28

    These are a set of slides intended for an information session as part of recruiting activities at Brigham Young University. It gives an overview of aqueous chloride operations, specifically on plutonium and americium purification/recovery. This presentation details the steps taken perform these processes, from plutonium size reduction, dissolution, solvent extraction, oxalate precipitation, to calcination. For Americium recovery, it details the CLEAR (chloride extraction and actinide recovery) Line, oxalate precipitation and calcination.

  4. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  5. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  6. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  7. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  8. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  9. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  10. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  11. Economical Production of Pu-238

    Energy Technology Data Exchange (ETDEWEB)

    Steven D. Howe; Douglas Crawford; Jorge Navarro; Terry Ring

    2013-02-01

    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238. The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100 M to get to production levels. The Center for Space Nuclear Research has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. The new process will also produce dramatically less waste. Potentially, the front end costs could be provided by private industry such that the government only had to pay for the product produced. Under a NASA Phase I NIAC grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce at least 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. In addition, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  12. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  13. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  14. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  15. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.

    1999-07-28

    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  16. Method for removal of plutonium impurity from americium oxides and fluorides

    Science.gov (United States)

    FitzPatrick, John R.; Dunn, Jerry G.; Avens, Larry R.

    1987-01-01

    Method for removal of plutonium impurity from americium oxides and fluorides. AmF.sub.4 is not further oxidized to AmF.sub.6 by the application of O.sub.2 F at room temperature, while plutonium compounds present in the americium sample are fluorinated to volatile PuF.sub.6, which can readily be separated therefrom, leaving the purified americium oxides and/or fluorides as the solid tetrafluoride.

  17. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  18. 16 CFR 238.1 - Bait advertisement.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Bait advertisement. 238.1 Section 238.1 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES AGAINST BAIT ADVERTISING § 238.1 Bait advertisement. No advertisement containing an offer to sell a product should be...

  19. 49 CFR 238.427 - Suspension system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Suspension system. 238.427 Section 238.427... Equipment § 238.427 Suspension system. (a) General requirements. (1) Suspension systems shall be designed to... equipment. (2) Passenger equipment shall meet the safety performance standards for suspension...

  20. 49 CFR 238.227 - Suspension system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Suspension system. 238.227 Section 238.227 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Equipment § 238.227 Suspension system. On or after November 8, 1999— (a) All passenger equipment...

  1. 47 CFR 90.238 - Telemetry operations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Telemetry operations. 90.238 Section 90.238... MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.238 Telemetry operations. The use of telemetry is authorized under this part on the following frequencies. (a) 72-76 MHz (in...

  2. 49 CFR 238.217 - Side structure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Side structure. 238.217 Section 238.217 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Equipment § 238.217 Side structure. Each passenger car shall comply with the following: (a) Side posts...

  3. 49 CFR 238.425 - Electrical system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electrical system. 238.425 Section 238.425... Equipment § 238.425 Electrical system. (a) Circuit protection. (1) The main propulsion power line shall be... the operating environment. (2) The electronic equipment shall not produce electrical noise...

  4. 49 CFR 238.225 - Electrical system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electrical system. 238.225 Section 238.225... Equipment § 238.225 Electrical system. All passenger equipment shall comply with the following: (a... produce electrical noise that affects the safe performance of train line control and communications...

  5. 46 CFR 153.238 - Required materials.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Required materials. 153.238 Section 153.238 Shipping... BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Design and Equipment Cargo Containment Systems § 153.238 Required materials. When one of the following paragraphs of this section...

  6. 33 CFR 238.3 - References.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false References. 238.3 Section 238.3 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE WATER RESOURCES POLICIES AND AUTHORITIES: FLOOD DAMAGE REDUCTION MEASURES IN URBAN AREAS § 238.3 References....

  7. Environmental aspects of the transuranics: a selected, annotated bibliography. [Pu-238, Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Ensminger, J.T.; Martin, F.M.; Fore, C.S. (comps.)

    1977-03-01

    This eighth published bibliography of 427 references is compiled from the Nevada Applied Ecology Information Center's Data Base on the Environmental Aspects of the Transuranics. The data base was built to provide information support to the Nevada Applied Ecology Group (NAEG) of ERDA's Nevada Operations Office. The general scope covers environmental aspects of uranium and the transuranic elements, with emphasis on plutonium. This bibliography highlights literature on plutonium 238 and 239 and americium in the critical organs of man and animals. Supporting information on ecology of the Nevada Test Site and reviews and summarizing literature on other radionuclides have been included at the request of the NAEG. The references are arranged by subject category with leading authors appearing alphabetically in each category. Indexes are provided for author(s), geographic location, keyword(s), taxon, title, and publication description.

  8. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  9. 10 CFR 31.8 - Americium-241 and radium-226 in the form of calibration or reference sources.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Americium-241 and radium-226 in the form of calibration or... BYPRODUCT MATERIAL § 31.8 Americium-241 and radium-226 in the form of calibration or reference sources. (a..., americium-241 or radium-226 in the form of calibration or reference sources: (1) Any person in a...

  10. Uncertainty analysis of doses from ingestion of plutonium and americium.

    Science.gov (United States)

    Puncher, M; Harrison, J D

    2012-02-01

    Uncertainty analyses have been performed on the biokinetic model for americium currently used by the International Commission on Radiological Protection (ICRP), and the model for plutonium recently derived by Leggett, considering acute intakes by ingestion by adult members of the public. The analyses calculated distributions of doses per unit intake. Those parameters having the greatest impact on prospective doses were identified by sensitivity analysis; the most important were the fraction absorbed from the alimentary tract, f(1), and rates of uptake from blood to bone surfaces. Probability distributions were selected based on the observed distribution of plutonium and americium in human subjects where possible; the distributions for f(1) reflected uncertainty on the average value of this parameter for non-specified plutonium and americium compounds ingested by adult members of the public. The calculated distributions of effective doses for ingested (239)Pu and (241)Am were well described by log-normal distributions, with doses varying by around a factor of 3 above and below the central values; the distributions contain the current ICRP Publication 67 dose coefficients for ingestion of (239)Pu and (241)Am by adult members of the public. Uncertainty on f(1) values had the greatest impact on doses, particularly effective dose. It is concluded that: (1) more precise data on f(1) values would have a greater effect in reducing uncertainties on doses from ingested (239)Pu and (241)Am, than reducing uncertainty on other model parameter values and (2) the results support the dose coefficients (Sv Bq(-1) intake) derived by ICRP for ingestion of (239)Pu and (241)Am by adult members of the public.

  11. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  12. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  13. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  14. Kilogram-scale purification of americium by ion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Wheelwright, E. J.

    1979-01-01

    Sequential anion and cation exchange processes have been used for the final purification of /sup 241/Am recovered during the reprocessing of aged plutonium metallurgical scrap. Plutonium was removed by absorption of Dowex 1, X-3.5 (30 to 50 mesh) anion exchange resin from 6.5 to 7.5 M HNO/sub 3/ feed solution. Following a water dilution to 0.75 to 1.0 M HNO/sub 3/, americium was absorbed on Dowex 50W, X-8 (50 to 100 mesh) cation exchange resion. Final purification was accomplished by elution of the absorbed band down 3 to 4 successive beds of the same resin, preloaded with Zn/sup 2 +/, with an NH/sub 4/OH buffered chelating agent. The recovery of mixed /sup 241/Am-/sup 243/Am from power reactor reprocessing waste has been demonstrated. Solvent extraction was used to recover a HNO/sub 3/ solution of mixed lanthanides and actinides from waste generated by the reprocessng of 13.5 tons of Shippingport Power Reactor blanket fuel. Sequential cation exchange band-displacement processes were then used to separate americium and curium from the lanthanides and then to separate approx. 60 g of /sup 244/Cm from 1000 g of mixed /sup 241/Am-/sup 243/Am.

  15. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  16. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  17. Dicty_cDB: SLA238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA238 (Link to dictyBase) - - - Contig-U16382-1 SLA238Z (Link... to Original site) - - SLA238Z 648 - - - - Show SLA238 Library SL (Link to library) Clone ID SLA238 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLA2-B/SLA238Q.Seq.d/ Representative seq. ID SLA23...8Z (Link to Original site) Representative DNA sequence >SLA238 (SLA238Q) /CSM/SL/SLA2-B/SLA238Q.Seq.d/ XXXXX...ATATTTAAAT GTATAATAATAATAAAATATAATTATTTTTAATGGTTGTTGATCTTTATCCGACTATC sequence update 1997. 5. 7 Translated

  18. 49 CFR 238.201 - Scope/alternative compliance.

    Science.gov (United States)

    2010-10-01

    ... in § 238.229, all such passenger equipment remains subject to the safety appliance requirements... locomotives; § 238.211—collision posts; § 238.213—corner posts; § 238.215—rollover strength; § 238.217—side structure; § 238.219—truck-to-car-body attachment; and § 238.223—locomotive fuel tanks) do not apply...

  19. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  20. MGA Analysis on Elevated 238 Pu Samples

    Science.gov (United States)

    Wang, T. F.; Moody, K. J.; Raschke, K. E.; Ruhter, W. D.

    2002-10-01

    Plutonium gamma-ray data analysis, in the 100-keV region, using MGA has been improved to overcome the original maximum limit of 2% 238Pu relative plutonium content in a sample in order to perform an analysis. MGA analysis results of elevated 238Pu samples are compared to the results from mass spectrometry.

  1. 49 CFR 238.103 - Fire safety.

    Science.gov (United States)

    2010-10-01

    ..., 1999 (see 49 CFR parts 200-399, revised as of October 1, 1999), if prior to June 25, 2002 the material... 49 Transportation 4 2010-10-01 2010-10-01 false Fire safety. 238.103 Section 238.103..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General...

  2. 40 CFR 238.20 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Definitions. 238.20 Section 238.20 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING DEGRADABLE PLASTIC RING... means the percent increase in length of the plastic material caused by a tensile load....

  3. 40 CFR 238.30 - Requirement.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 238.30 Section 238.30 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING DEGRADABLE PLASTIC RING... Condensation Apparatus for Exposure of Photodegradable Plastics”, using cycle A; or (2) 35 days, during...

  4. 49 CFR 238.423 - Fuel tanks.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Fuel tanks. 238.423 Section 238.423 Transportation....423 Fuel tanks. (a) External fuel tanks. Each type of external fuel tank must be approved by FRA's Associate Administrator for Safety upon a showing that the fuel tank provides a level of safety at...

  5. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  6. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  7. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  8. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  9. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules

    Science.gov (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.

    2013-07-01

    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  10. Dicty_cDB: SSI238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI238 (Link to dictyBase) - G00811 DDB0185146 Contig-U10256-1 SSI...238Z (Link to Original site) - - SSI238Z 724 - - - - Show SSI238 Library SS (Link to library) Clone ID SSI...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSI2-B/SSI238Q.Seq.d/ ...Representative seq. ID SSI238Z (Link to Original site) Representative DNA sequence >SSI238 (SSI238Q) /CSM/SS/SSI2-B/SSI...(All Frames) Frame A: ---hyhlctir*fiiifqissilcikyysnik*kwpqpked*teknhl*f*vknklln*

  11. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  12. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  13. Medical grade 238Pu from 241Am: progress report

    International Nuclear Information System (INIS)

    Shielding requirements for fabrication of americium targets were evaluated, a preliminary flowsheet for processing the irradiated Am targets was developed, and the AMRAD computer program, which models the irradiation cycle, was improved

  14. Plutonium-238 processing at Savannah River Plant

    Energy Technology Data Exchange (ETDEWEB)

    Burney, G.A.

    1983-01-01

    Plutonium-238 is produced by irradiating NpO/sub 2/-Al cermet slugs or tubes with neutrons. The neptunium-237 is produced as a by-product when natural or enriched uranium is irradiated with neutrons. The neptunium is separated by solvent extraction and ion exchange and precipitated as neptunium oxalate. Neptunium oxalate is calcined to neptunium oxide and fabricated into targets for irradiation. The irradiation conditions are controlled to produce plutonium with 80 to 90 wt % /sup 238/Pu.

  15. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  16. On an investigation of the dynamics of ternary fission for the system 238U + 238U

    International Nuclear Information System (INIS)

    With the three center model we have studied the dynamics of ternary fission for the system 238U + 238U by solving the one-dimensional collective Schroedinger equation with the potential energy surface given by the liquid-drop model and the mass parameters given by the Werner-Wheeler method

  17. Redefining design criteria for Pu-238 gloveboxes

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, S.V.

    1998-12-31

    Enclosures for confinement of special nuclear materials (SNM) have evolved into the design of gloveboxes. During the early stages of glovebox technology, established practices and process operation requirements defined design criteria. Proven boxes that performed and met or exceeded process requirements in one group or area, often could not be duplicated in other areas or processes, and till achieve the same success. Changes in materials, fabrication and installation methods often only met immediate design criteria. Standardization of design criteria took a big step during creation of ``Special-Nuclear Materials R and D Laboratory Project, Glovebox standards``. The standards defined design criteria for every type of process equipment in its most general form. Los Alamos National Laboratory (LANL) then and now has had great success with Pu-238 processing. However with ever changing Environment Safety and Health (ES and H) requirements and Ta-55 Facility Configuration Management, current design criteria are forced to explore alternative methods of glovebox design fabrication and installation. Pu-238 fuel processing operations in the Power Source Technologies Group have pushed the limitations of current design criteria. More than half of Pu-238 gloveboxes are being retrofitted or replaced to perform the specific fuel process operations. Pu-238 glovebox design criteria are headed toward process designed single use glovebox and supporting line gloveboxes. Gloveboxes that will house equipment and processes will support TA-55 Pu-238 fuel processing needs into the next century and extend glovebox expected design life.

  18. 10 CFR 32.57 - Calibration or reference sources containing americium-241 or radium-226: Requirements for license...

    Science.gov (United States)

    2010-01-01

    ... or radium-226: Requirements for license to manufacture or initially transfer. 32.57 Section 32.57... americium-241 or radium-226: Requirements for license to manufacture or initially transfer. An application... containing americium-241 or radium-226, for distribution to persons generally licensed under § 31.8 of...

  19. Separation and determination of americium in low-level alkaline waste of NPP origin

    Science.gov (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.

    2006-01-01

    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  20. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  1. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats.

    Science.gov (United States)

    Van der Meeren, A; Grémy, O

    2010-09-01

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO(2) powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO(2) with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO(2) with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO(2) powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO(2) with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO(2) aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions.

  2. 33 CFR 238.5 - Comprehensive planning.

    Science.gov (United States)

    2010-07-01

    ..., responsible local planning organizations should provide information and assist the Corps in development of... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Comprehensive planning. 238.5... Comprehensive planning. Coordinated comprehensive planning at the regional or river basin level, or for an...

  3. /sup 238/U issues resolved and unresolved

    Energy Technology Data Exchange (ETDEWEB)

    de Saussure, G.; Smith, A.B.

    1982-01-01

    The interaction of 1 eV to 20 MeV neutrons with /sup 238/U is discussed with emphasis on recently resolved and remaining issues relevant to both application need and physical understanding. The apparent inability of older /sup 238/U evaluations to predict the measured /sup 238/U capture rate in thermal critical lattices has stimulated several recent precise measurements of the /sup 238/U cross sections, reanalysis of older data, and improved evaluations. The recent evaluations predict satisfactorily the /sup 238/U capture rate in thermal critical lattices. In the region from 1.5 to 4 keV there are differences of the order of 15%, sometimes larger, between the values of the neutron widths of the main resonances reported by several experimenters or obtained by different evaluators. Above 4 keV there are only sparse results of resonance analysis and most evaluations adopt a statistical treatment of the resonance structure. Some factors affecting the determination of the average properties of the resonance parameters are discussed. Above the inelastic-scattering threshold, energy-averaged neutron total, scattering, capture and fission cross sections are reviewed in a unified manner integrating measurement, calculation and evaluation. (n;n') and (n;2n') energy-transfer mechanisms are addressed. Particular attention is given to neutron capture, stressing precisions consistent with applied need. Fission properties are discussed including: prompt and delayed fission-neutron spectra and nubar, and fission-product yields. Physical understanding is assayed, with attention to compound-nucleus and direct-reaction mechanisms, and applications impact is illustrated in the context of fast-breeder-reactor performance. 95 references.

  4. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  5. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  6. Apparatus for fabrication of americium- beryllium neutron sources prevents capsule contamination

    Science.gov (United States)

    Mohr, W. C.; Van Loom, J. A.

    1967-01-01

    Modified gloved enclosure is used to fill a capsule with a mixture of americium and beryllium radioactive powders to seal weld the opening, and to test it for leaks. It contains a horizontal partition, vortex mixer, mounting press, welder, test vessel, and radiation shielding to prevent surface contamination.

  7. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  8. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  9. 49 CFR 238.321 - Out-of-service credit.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Out-of-service credit. 238.321 Section 238.321... Requirements for Tier I Passenger Equipment § 238.321 Out-of-service credit. When a passenger car is out of... out-of-service credit....

  10. 43 CFR 23.8 - Approval of mining plan.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Approval of mining plan. 23.8 Section 23.8 Public Lands: Interior Office of the Secretary of the Interior SURFACE EXPLORATION, MINING AND RECLAMATION OF LANDS § 23.8 Approval of mining plan. (a) Before surface mining operations may commence...

  11. 49 CFR 238.315 - Class IA brake test.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Class IA brake test. 238.315 Section 238.315... Requirements for Tier I Passenger Equipment § 238.315 Class IA brake test. (a) Except as provided in paragraph (b) of this section, either a Class I or a Class IA brake test shall be performed: (1) Prior to...

  12. 40 CFR 238.10 - Purpose and applicability.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Purpose and applicability. 238.10 Section 238.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) OCEAN DUMPING DEGRADABLE PLASTIC RING CARRIERS General Provisions § 238.10 Purpose and applicability. The purpose of...

  13. 49 CFR 238.403 - Crash energy management.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Crash energy management. 238.403 Section 238.403... Equipment § 238.403 Crash energy management. (a) Each power car and trailer car shall be designed with a crash energy management system to dissipate kinetic energy during a collision. The crash...

  14. 33 CFR 110.238 - Apra Harbor, Guam.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Apra Harbor, Guam. 110.238 Section 110.238 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.238 Apra Harbor, Guam. (a) The anchorage grounds (Datum: WGS 84). (1) General Anchorage. The...

  15. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  16. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  17. Transmutation of 129I, 237Np, 238Pu, 239Pu, and 241Am using neutrons produced in target-blanket system `Energy plus Transmutation' by relativistic protons

    Indian Academy of Sciences (India)

    J Adam; K Katovsky; A Balabekyan; V G Kalinnikov; M I Krivopustov; H Kumawat; A A Solnyshkin; V I Stegailov; S G Stetsenko; V M Tsoupko-Sitnikov; W Westmeier

    2007-02-01

    Target-blanket facility `Energy + Transmutation' was irradiated by proton beam extracted from the Nuclotron Accelerator in Laboratory of High Energies of Joint Institute for Nuclear Research in Dubna, Russia. Neutrons generated by the spallation reactions of 0.7, 1.0, 1.5 and 2 GeV protons and lead target interact with subcritical uranium blanket. In the neutron field outside the blanket, radioactive iodine, neptunium, plutonium and americium samples were irradiated and transmutation reaction yields (residual nuclei production yields) have been determined using -spectroscopy. Neutron field's energy distribution has also been studied using a set of threshold detectors. Results of transmutation studies of 129I, 237Np, 238Pu, 239Pu and 241Am are presented.

  18. Search for surviving actinides and superheavy nuclei in damped collisions of 238U with 238U and 248Cm

    International Nuclear Information System (INIS)

    In the present talk aspects of the reaction mechanism related to the survival probability of the heaviest fragments in 238U + 238U collisions are discussed first. This is followed by a description of the experiments that have been performed to search for surviving superheavy fragments in the 238U + 238U reaction and by a presentation of the results obtained so far. In a third section our recent first attempts with the 238U + 248Cm reaction are described and preliminary results are discussed. (orig.)

  19. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  20. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  1. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  2. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  3. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)

    2002-01-01

    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  4. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  5. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  6. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  7. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1974-09-01

    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  8. 238Pu surface contamination of MHW impact shell assembly

    International Nuclear Information System (INIS)

    238PuO2 contamination of the grit blasted surface of the primary impact shell assembly (PISA) of the multi-hundred watt isotopic heat source was measured. The study determined the amount and distribution of the 238PuO2 and characterization of its behavior during aging at 13500C. The results concluded that normal decontamination effectively removes the superficial 238PuO2 but does not extract the 238PuO2 which is deep within the grit blasted structure. Subsequent heating results in migration of microcurie amounts of plutonium out of the grit blasted structure

  9. Dynamical Effects of Orientations on reaction 238U+238U near Coulomb Barrier

    International Nuclear Information System (INIS)

    The dynamical effects of three orientations (nose-nose, nose-side, and side-side) on reaction 238U+238U have been investigated by using Improved Quantum Molecular Dynamics(ImQMD) model. Due to Coulomb repulsive interaction, the change of the deformations or orientations of colliding nuclei is found even before touching configuration, especially for nose-nose. The average lifetime of the giant system and the probability producing super-heavy fragments (SHF) with Z>110 are found to be dependent on the orientations of two nuclei. At the time of 1000fm/c after re-separation of giant system, side-side orientation provide a larger probability of producing SHF than nose-nose case. And the maximum value of the probability locates a smaller incident energy for side-side orientation compared with nose-nose.

  10. Study on the formation of the composite system of 238U+238U

    Institute of Scientific and Technical Information of China (English)

    WU Xi-Zhen; TIAN Jun-Long; ZHAO Kai; ZHANG Ying-Xun; LI Zhu-Xia

    2009-01-01

    Strongly damped reactions of 238U+238U, at Ecm = 680-1880 MeV have been studied based on the improved quantum molecular dynamics model. We find that at a certain energy region the entrance channel potential is weakly repulsive and the dissipation is very strong after touching configuration, these two effects make the time delay of re-separation for colliding system. The single particle potential well of the transiently formed composite system has Coulomb barrier about 15-20 MeV high at the surface, which makes the excited unbound protons being still embedded in the potential well and moving in a common mono-single particle potential for a period of time and thus restrains from quick decay of the composite system.

  11. Containment of nitric acid solutions of Plutonium-238

    Science.gov (United States)

    Reimus, M. A. H.; Silver, G. L.; Pansoy-Hjelvik, L.; Ramsey, K. B.

    1999-01-01

    The corrosion of various metals that could be used to contain nitric acid solutions of Pu-238 has been studied. Tantalum and tantalum/2.5% tungsten resisted the test solvent better than 304L stainless steel and several INCONEL alloys. The solvent used to imitate nitric acid solutions of Pu-238 contained 70% nitric acid, hydrofluoric acid, and ammonium hexanitratocerate.

  12. 40 CFR 86.238-94-86.239-94 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false 86.238-94-86.239-94 Section 86.238-94-86.239-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... 1994 and Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New...

  13. 16 CFR 238.0 - Bait advertising defined. 1

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Bait advertising defined. 1 238.0 Section... BAIT ADVERTISING § 238.0 Bait advertising defined. 1 1 For the purpose of this part “advertising” includes any form of public notice however disseminated or utilized. Bait advertising is an alluring...

  14. 49 CFR 238.413 - End structures of trailer cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false End structures of trailer cars. 238.413 Section... II Passenger Equipment § 238.413 End structures of trailer cars. (a) Except as provided in paragraph (b) of this section, the end structure of a trailer car shall be designed to include the...

  15. Updated and Revised Neutron Nuclear Data for 238Pu

    Institute of Scientific and Technical Information of China (English)

    YU; Bao-sheng; CHEN; Guo-chang

    2013-01-01

    238Pu is one of minor actinide,which is nuclear fuel produced by interaction with neutrons in reactor.The nuclear data are especially important for application involving computational neutronics method and transmutation performance analyses in advanced fuel cycle system.The 238Pu evaluated data in

  16. New heavy neutron-rich isotope 238Th

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    A new nuclide 238Th has been produced via multinucleon transferreaction by 60 MeV/u 18O ion irradiation of the natural uranium.The thorium wasradiochemically separated from the mixture of uranium and reaction products.Theactivity of thorium was measured by using an HPGe detector and a planar HPGedetector. The 238Th has been identified for the first time by measuringthe growth and decay of the γ-rays from its daughter 238Pa. Thehalf-life of 238Th was determined tobe 9.4±2.0 min. In addition, a new γ-ray of 89.0±0.3 keVwith T1/2=8.9±1.5 min wasfound in the γ spectrum gated with X-rays of Pa and assigned to238Th β- decay basedon measurements of transition energy and half life.

  17. New heavy neutron—rich isotope 238Th

    Institute of Scientific and Technical Information of China (English)

    XUYanbing; YUANShuanggui; 等

    1999-01-01

    A new nuclide 238Th has been produced via multinucleon transfer reaction by 60MeV/u 18O ion irradiation of the natural uranium.The thorium was radiochemically separated from the mixture of uranium and reaction products.The activity of thorium was mneasured by using an HPGe detector and a planar HPGe detector.The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa.The half-life of 238Th was determined to be 9.4±2.0min .Inaddition a new γ-ray of 89.0±0.3keV with T1/2=8.9±1.5min was found in the γ spectrum gated with X-rays of Pa and assigned to 238Th β- decay based on measurements of transition energy and half life.

  18. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)

    2010-06-15

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  19. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  20. MARIOS: Irradiation of UO{sub 2} containing 15% americium at well defined temperature

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E., E-mail: elio.dagata@ec.europa.eu [European Commission, Joint Research Centre, Institute for Energy - P.O. Box 2, 1755 ZG Petten (Netherlands); Hania, P.R. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bejaoui, S. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France); Sciolla, C.; Wyatt, T.; Hannink, M.H.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Herlet, N.; Jankowiak, A. [Commissariat a l' Energie Atomique DTEC CEA Marcoule, 30207 Bagnols sur Ceze Cedex (France); Klaassen, F.C. [Nuclear Research and Consultancy Group, P.O. Box 25, 1755 ZG Petten (Netherlands); Bonnerot, J.-M. [Commissariat a l' Energie Atomique, DEC CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer MARIOS is designed to check the behaviour of Minor Actinide Blanket Module concept. Black-Right-Pointing-Pointer Main requirement of the experiment is an accurate control of the temperature. Black-Right-Pointing-Pointer The swelling and the helium release will be the main output of the experiment. Black-Right-Pointing-Pointer A complementary experiment (DIAMINO), will be performed in the next future. - Abstract: Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors of long-lived nuclides like {sup 241}Am is, therefore, an option for the reduction of radiotoxicity and residual power packages as well as the repository area. The MARIOS irradiation experiment is the latest of a series of experiments on americium transmutation (e.g. EFTTRA-T4, EFTTRA-T4bis, HELIOS). MARIOS experiment is carried out in the framework of the 4-year project FAIRFUELS of the EURATOM 7th Framework Programme (FP7). During the past years of experimental work in the field of transmutation and tests of innovative nuclear fuel containing americium, the release or trapping of helium as well as swelling has shown to be the key issue for the design of such kinds of target. Therefore, the main objective of the MARIOS experiment is to study the in-pile behaviour of UO{sub 2} containing minor actinides (MAs) in order to gain knowledge on the role of the microstructure and of the temperature on the gas release and on fuel swelling. The MARIOS experiment will be conducted in the HFR (high flux reactor) in Petten (The Netherlands) and will start in the beginning of 2011. It has been planned that the experiment will last 11 cycles, corresponding to 11 months. This paper covers the description of the objective of the experiment, as well as a general description of the design of the experiment.

  1. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  2. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  3. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  4. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: sebastien.picart@cea.fr [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)

    2014-10-15

    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  5. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  6. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  7. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  8. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  9. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  10. Screening and verification of proteins that interact with HSPC238.

    Science.gov (United States)

    Tan, Jia-Yu; Chen, Jing-Lin; Huang, Xiang; Yuan, Chun-Lei

    2015-12-01

    HSPC238 is a recently identified tumor suppressor and demonstrates ubiquitin ligase E3 enzyme activity. HSPC238 was found to be significantly downregulated in human hepatocellular carcinoma (HCC) in vivo and to inhibit the proliferation and invasion of hepatoma cells in vitro; however, the underlying molecular mechanism is largely unknown. In the present study, we screened for and identified proteins that physically interact with HSPC238. A bait vector for yeast two-hybrid was constructed with human HSPC238 gene cDNA. Yeast two-hybrid screening was performed using a human fetal liver cDNA library. Multiple reporter gene assays, DNA sequencing and BLAST comparison analysis were performed on positive clones. Protein interaction of screened candidates with HSPC238 was further validated by confocal microscopy, co-immunoprecipitation and pull-down assays. Yeast two-hybrid screening demonstrated 124 positive clones. Multiple reporter gene assays with LacZ, HIS and ADE2 selective media identified 12 genes. Further co-localization, co-immunoprecipitation and pull-down assays demonstrated that HMOX1, RPS27A, ubiquitinB and MT2A interacted with HSPC238. These four proteins are involved in tumor development and progression, and are associated with the ubiquitin-proteasome pathway. Our results suggest that HSPC238 may play a tumor suppressor role and interact with these proteins via the ubiquitin-proteasome pathway. The identification and validation of proteins interacting with HSP238 may lead to the discovery of novel mechanisms through which HSPC238 suppresses tumorigenesis in human hepatocellular carcinoma.

  11. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  12. Neutron Capture and Fission Measurement on ^238Pu at DANCE

    Science.gov (United States)

    Chyzh, Andrii; Wu, Ching-Yen; Kwan, Elaine; Henderson, Roger; Gostic, Jolie; Couture, Aaron; Young, Hye; Ullmann, John; O'Donnell, John; Jandel, Marian; Haight, Robert; Bredeweg, Todd

    2012-10-01

    Neutron capture and fission reactions on actinides are important in nuclear engineering and physics. DANCE (Detector for Advanced Neutron Capture Measurement, LANL) combined with PPAC (avalanche technique based fission tagging detector, LLNL) were used to study the neutron capture reactions in ^238Pu. Because of extreme spontaneous α-radioactivity in ^238Pu and associated safety issues, 3 separate experiments were performed in 2010-2012. The 1st measurement was done without fission tagging on a 396-μg thick target. The 2nd one was with PPAC on the same target. The 3rd final measurement was done on a thin target with a mass of 40 μg in order to reduce α-background load on PPAC. This was the first such measurement in a laboratory environment. The absolute ^238Pu(n,γ) cross section is presented together with the prompt γ-ray multiplicity in the ^238Pu(n,f) reaction.

  13. Containment of nitric acid solutions of Plutonium-238

    International Nuclear Information System (INIS)

    The corrosion of various metals that could be used to contain nitric acid solutions of Pu-238 has been studied. Tantalum and tantalum/2.5% tungsten resisted the test solvent better than 304L stainless steel and several INCONEL alloys. The solvent used to imitate nitric acid solutions of Pu-238 contained 70% nitric acid, hydrofluoric acid, and ammonium hexanitratocerate. copyright 1999 American Institute of Physics

  14. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  15. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  16. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  17. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  18. Near Threshold Coincident Electrofission of Uranium -238.

    Science.gov (United States)

    Dowell, David Harry

    Using the 100% duty cycle electron beam from the University of Illinois MUSL-2 accelerator, inelastic electron scattering form factors have been measured in coincidence with the fission decay of ('238)U. Data was taken at effective elastic momentum transfers of .36, .41 .45 and .59 fm(' -1) and electron-fission fragment angular correlations were measured perpendicular to and along the momentum transfer axis. The beam energies used were 67.11, 56.91 and 46.49 MeV, with the outgoing electron detected at 60(DEGREES) and 80(DEGREES), relative to the beam direction. The electron energy resolution was .1% and the form factors were measured for excitation energies from 2 to 12 MeV. Thin films of scintillator plastic (.5 mg/cm('2)) were used to detect the fission fragments from a 1 mg/cm('2) UF(,4) target evaporated onto a .240 mg/cm('2) aluminum backing. A prominent, anisotropic threshold peak is seen in the coincident form factors. An analysis of the q-dependence of the data and of the angular correlation indicates the observed strength is E2. Fission threshold for this E2 strength is about 5.7 MeV as compared with 6 MeV for E1 decays. The peak itself is due to the onset of neutron competition at 6.15 MeV. The threshold region, when analyzed using a Gaussian K-distribution to describe the statistical density of K -states near the fission barrier, exhibits a step-like change in the value of K(,0)('2) at .7 MeV above threshold. This indicates a possible energy gap in the E2 transition states. The decay is isotropic above 7.5 MeV excitation energy. From 7 to 11.7 MeV, the distribution of E2/EO strength is relatively flat with the total strength in this region exhausting approximately 10% of an energy weighted sum rule. A comparison with hadron scattering experiments suggests that some of the strength near 11.5 MeV is due to the fission decay of the giant monopole resonance with a fission probability similar to that of E2 transitions.

  19. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  20. Combined procedure using radiochemical separation of plutonium, americium and uranium radionuclides for alpha-spectrometry

    International Nuclear Information System (INIS)

    Radiochemical separation of Pu, Am and U was tested from synthetic solutions and evaporator concentrate samples from nuclear power plants for isolation of each of them for alpha-spectrometry analysis. The separation was performed by anion-exchange chromatography, extraction chromatography, using TRU resin, and precipitation techniques. The aim of the study was to develop a sensitive analytical procedure for the sequential determination of 242Pu, 238Pu, 239+240Pu, 241Am and 235,238U in radioactive wastes. 238Pu, 242Pu, 243Am and 232U were used as tracers. The measurements of α emitting radionuclides were performed by semiconductor detector that is used especially when spectrometric information is needed. For synthetic solutions the chemical recovery was based on associated iron concentration and was about 93%. (author)

  1. Economical Production of Pu-238: NIAC Phase I Final Report

    Science.gov (United States)

    Howe, Steven D.; Crawford, Douglas; Navarro, Jorge; O'Brien, Robert C.; Katalenich, Jeff; Ring, Terry

    2016-01-01

    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238 (Pu-238). The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100M to get to production levels. The Center for Space Nuclear Research (CSNR) has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. Potentially, the front end capital costs could be provided by private industry such that the government only had to pay for the product produced. In the Phase I NIAC (NASA Innovative Advanced Concepts) grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. Finally, as the study progressed, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  2. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  3. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  4. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  5. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  6. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.

    2006-08-01

    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  7. Neutron Capture Cross Section Measurement on $^{238}$Pu at DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Chyzh, A; Wu, C Y

    2011-02-14

    The proposed neutron capture measurement for {sup 238}Pu was carried out in Nov-Dec, 2010, using the DANCE array at LANSCE, LANL. The total beam-on-target time is about 14 days plus additional 5 days for the background measurement. The target was prepared at LLNL with the new electrplating cell capable of plating the {sup 238}Pu isotope simultaneously on both sides of the 3-{micro}m thick Ti backing foil. A total mass of 395 {micro}g with an activity of 6.8 mCi was deposited onto the area of 7 mm in diameter. The {sup 238}Pu sample was enriched to 99.35%. The target was covered by 1.4 {micro}m double-side aluminized mylar and then inserted into a specially designed vacuum-tight container, shown in Fig. 1, for the {sup 238}Pu containment. The container was tested for leaks in the vacuum chamber at LLNL. An identical container without {sup 238}Pu was made as well and used as a blank for the background measurement.

  8. Neutron Capture Cross Section Measurement on 238Pu at DANCE

    International Nuclear Information System (INIS)

    The proposed neutron capture measurement for 238Pu was carried out in Nov-Dec, 2010, using the DANCE array at LANSCE, LANL. The total beam-on-target time is about 14 days plus additional 5 days for the background measurement. The target was prepared at LLNL with the new electrplating cell capable of plating the 238Pu isotope simultaneously on both sides of the 3-(micro)m thick Ti backing foil. A total mass of 395 (micro)g with an activity of 6.8 mCi was deposited onto the area of 7 mm in diameter. The 238Pu sample was enriched to 99.35%. The target was covered by 1.4 (micro)m double-side aluminized mylar and then inserted into a specially designed vacuum-tight container, shown in Fig. 1, for the 238Pu containment. The container was tested for leaks in the vacuum chamber at LLNL. An identical container without 238Pu was made as well and used as a blank for the background measurement.

  9. Simultaneous evaluation for (n,f) cross section of 235U, 239Pu, 238U and (n,γ) cross sections of 238U

    International Nuclear Information System (INIS)

    The fission cross sections for 235U, 238U, 239Pu, the capture cross sections for 238U and the ratios for 239Pu(n,f)/235U(n,f), 238U(m,f)/235U(n,f), 238U(n,γ)/235U(n,f) were firstly evaluated respectively. The experimental data were collected, analysed, selected and corrected. The data were fitted with spline fit program

  10. Technology and fabrication of plutonium-238 radionuclide heat sources

    Science.gov (United States)

    Malikh, Y. A.; Aldoshin, A. I.; Danilkin, E. A.

    1996-03-01

    This paper outlines a brief technical description of the facility for production of plutonium-238 and fabrication of Radionuclide Heat Sources (RHS) containing Pu-238. Technical capabilities of the RHS fabrication facility are presented. The results of development of the RHS design for sea application are discussed. RHS fuel pellet comprises the tantalum shell with an annular slot intended for release of radiogenic helium and the Pu-238 dioxide core with reinforcing elements inside which contact with the shell. RHS is a double encapsulation consisting of the inner ``power'' capsule and the outer corrosion-resistant capsule. The chromium-nickel-molybdenum XH65MB alloy which is equivalent to Hastelloy-C alloy has been selected as a material for both capsules. Upon expiration of working life, RHS design is capable of withstanding the internal pressure of radiogenic helium at 1073 K within 30 minutes and the external hydrostatic pressure of 100 MPa at normal temperature.

  11. Toxicity of inhaled 238PuO2 II

    International Nuclear Information System (INIS)

    Studies are in progress to determine dose-response relationships for inhaled 238PuO2. Beagle dogs were given a single, brief, nose-only inhalation exposure to aerosols of monodisperse particles of 238PuO2. Aerosols of two sizes were used, 1.5 μm aerodynamic diameter (AD) and 3.0 μm AD. Dogs were exposed to achieve initial lung burdens of 0.56, 0.28, 0.14, 0.07, 0.03 or 0.01 μCi 238PuO2/kg body weight. Twelve dogs were exposed at each activity level to each aerosol particle size. The local dose around each 3.0 μm AD particle was 10 times higher than the local dose around 1.5 μm AD particles, but the dose averaged over the whole lung was the same at each activity level for both particle sizes. The lung retention of 238Pu was divided into two phases of clearance. During the first 100 days after exposure, the average retention half-time for 238Pu in the lung was 310 days. When the solubility changed due to particle breakup, the retention half-time decreased to 180 days during the period from 1OO to 1,500 days after exposure. The first biological effects observed were lymphopenia and neutropenia in peripheral blood. To date, 28 Beagle dogs have died at times from 536 to 1683 days after exposure. Initial lung burdens for the dead dogs ranged from 0.18 to 2.2 μCi 238Pu/kg body weight. Nine died with radiation pneumonitis and pulmonary fibrosis, 10 died with lung tumors and 19 dogs died with bone tumors. There are 116 exposed and 22 control dogs surviving and under observation. Current patterns of dose versus response are discussed. (author)

  12. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  13. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  14. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  15. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  16. Characterization of Pu-238 Heat Source Granule Containment

    Energy Technology Data Exchange (ETDEWEB)

    Richardson, Paul Dean II [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sanchez, Joey Leo [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wall, Angelique Dinorah [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Chavarria, Rene [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-02-11

    The Milliwatt Radioisotopic Themoelectric Generator (RTG) provides power for permissive-action links. Essentially these are nuclear batteries that convert thermal energy to electrical energy using a doped silicon-germanium thermopile. The thermal energy is provided by a heat source made of 238Pu, in the form of 238PuO2 granules. The granules are contained by 3 layers of encapsulation. A thin T-111 liner surrounds the 238PuO2 granules and protects the second layer (strength member) from exposure to the fuel granules. An outer layer of Hastalloy-C protects the T-111 from oxygen embrittlement. The T-111 strength member is considered the critical component in this 238PuO2 containment system. Any compromise in the strength member seen during destructive testing required by the RTG surveillance program is characterized. The T-111 strength member is characterized through Scanning Electron Microscopy (SEM), and Metallography. SEM is used in the Secondary Electron mode to reveal possible grain boundary deformation and/or cracking in the region of the strength member weld. Deformation and cracking uncovered by SEM are further characterized by Metallography. Metallography sections are mounted and polished, observed using optical microscopy, then documented in the form of microphotographs. SEM mat further be used to examine polished Metallography mounts to characterize elements using the SEM mode of Energy Dispersive X-ray spectroscopy (EDS).

  17. 48 CFR 552.238-77 - Definition (Federal Supply Schedules).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Definition (Federal Supply... ADMINISTRATION CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 552.238-77 Definition (Federal Supply Schedules). As prescribed in 538.7004(a), insert the...

  18. Main-Belt Comet 238P/Read Revisited

    CERN Document Server

    Hsieh, Henry H; Pittichova, Jana

    2011-01-01

    We present a series of observations of the return of activity in main-belt comet 238P/Read. Using data obtained in July and August 2010 when 238P appeared to be largely inactive, we find best-fit IAU phase function parameters of H=19.05+/-0.05 mag, corresponding to a nucleus radius of r_n ~ 0.4 km (assuming an albedo of p_R=0.05), and G=-0.03+/-0.05. Observations from September 2010 onward show a clear rise in activity, causing both a notable change in visible morphology and increasing photometric excesses beyond what would be expected based on bare nucleus observations. By the end of the observing period reported on here, the dust mass in the coma shows indications of reaching a level comparable to that observed in 2005, but further observations are highly encouraged once 238P again becomes observable from Earth in mid-2011 to confirm whether this level of activity is achieved, or if a notable decrease in activity strength compared to 2005 can be detected. Comet 238P is now the second main-belt comet (after ...

  19. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  20. Determination of {sup 238}Pu, {sup 239+240}Pu, {sup 241}Pu and {sup 241}Am in radioactive waste from IPEN reactor

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca; Taddei, Maria Helena T.; Cheberle, Sandra M.; Ferreira, Marcelo T., E-mail: bgeraldo@cnen.gov.b, E-mail: mhtaddei@cnen.gov.b, E-mail: scsantos@cnen.gov.b, E-mail: ferreira@cnen.gov.b [Brazilian Nuclear Energy Commission (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Lab. of Pocos de Caldas; Marumo, Julio T., E-mail: jtmarumo@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Ion exchange resin is a common type of radioactive waste arising from treatment of coolant water of the main circuit of research and nuclear power reactors. This waste contains high concentrations of fission and activation products. The management of this waste includes its characterization in order to determine and quantify specific radionuclides including those known as difficult-to-measure radionuclides (RDM). The analysis of RDMs generally involves expensive and time-consuming complex radiochemical analysis for purification and separation of the radionuclides. The objective of this work is to show an easy methodology for quantifying plutonium and americium isotopes in spent ion exchange resin, used for purification of the cooling water of the IEA-R1 reactor located at the Nuclear and Energy Research Institute, IPEN-CNEN/SP. The resins were destroyed by acid digestion, followed by purification and separation of the Pu and Am isotopes with anionic and chromatographic resins. {sup 238}Pu, {sup 239}+{sup 24}'0Pu, and {sup 24}'1Am isotopes were analyzed in an alpha spectrometer equipped with surface barrier detectors. {sup 241}Pu isotope was analyzed by liquid scintillation counting. Chemical recovery yield ranged from 73 to 98% for Pu and 77 to 98% for Am, demonstrating that the methodology is suitable for identification and quantification of the isotopes studied in spent resins. (author)

  1. Sequential leaching extraction of 239,240Pu, 238Pu, 241Pu, 237Np and 241Am from a mud sample: An intercomparison study

    International Nuclear Information System (INIS)

    The transuranics content of a mud sample taken from a nuclear waste storage container was analysed employing two different sequential extraction methods. The following fractions were isolated: (1)Water soluble (2) Readily available (3) Carbonate bound and specifically adsorbed (4) Organically bound (5) Oxide and hydroxides bound and (6) residual. Both methods differ in the reagents employed, the extraction sequence applied as well as the temperature and means of extraction. The 239,240Pu, 238Pu, 237Np and 241Am extracted in each phase were determined using standard radiochemical procedures. 241Pu was analysed through the 241Am in-growth on just one old disk of the residual fraction containing plutonium. Plutonium was mainly associated to organic-oxides fractions (89-92 %). The percentage extracted in each fraction depended on the method and the extraction sequence used. The soluble fraction of plutonium was less than 13%. Neptunium seemed to be the more soluble than the other transuranics (27%) and the americium showed a tendency to be associated to carbonates (30%). (author)

  2. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  3. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  4. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    Energy Technology Data Exchange (ETDEWEB)

    Suneesh, A.S.; Venkatesan, K.A.; Syamala, K.V.; Antony, M.P.; Vasudeva Rao, P.R. [Indira Gandhi Centre for Atomic Research, Kalpakkam (India). Fuel Chemistry Div.

    2012-07-01

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by {sup 1}H and {sup 13}C NMR, mass and IR spectroscopy. The extraction behaviour of {sup (152+154})Eu(III) and {sup 241}Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for {sup (152+154)}Eu(III) and HDEHSDGA shows the superior selectivity for {sup 241}Am(III). (orig.)

  5. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  6. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  7. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  8. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  9. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed.

  10. Verification of uranium 238 quantity calculated using waste assay systems

    International Nuclear Information System (INIS)

    The amount of 238U in uranium-contaminated waste drums generated in the decommissioning of nuclear facilities is evaluated from γ-ray measurement. We used the γ-ray measurement system made from CANBERRA(Qualitative and Quantitative (Q2) Low Level Waste Assay Systems) and measured the waste drums. This system assumes uniform distribution of uranium. But, homogeneity can not be checked with real waste drums. Authors developed the new analysis technique which calculates the amount of uranium by correcting the influence of uneven distribution of the uranium. As a result of evaluating using the new analysis technique, the error which influences quantitative value of 238U has been evaluated. (author)

  11. Design of a Pu-238 waste incineration process

    International Nuclear Information System (INIS)

    Combustible 238Pu waste is generated as a result of normal operation and decommissioning activity at the Savannah River Plant and is being retrievably stored at the Plant. As part of the long-term plan to process the stored waste and current waste in preparation for future disposition, a 238Pu incinceration process is being cold-tested at SRL. The incineration process consists of a continuous-feed preparation system, a two-stage, electrically fired incinerator, and a filtration off-gas system. Process equipment has been designed, fabricated, and installed for nonradioactive testing and cold run-in. Design features to maximize the ability to remotely maintain the equipment were incorporated into the process. Interlock, alarm, and control functions are provided by a programmable controller. Cold testing is scheduled to be completed in 1986

  12. Electric and Magnetic Dipole States in ^238U

    Science.gov (United States)

    Hammond, S. L.; Adekola, A.; Angell, C. T.; Karwowski, H. J.; Howell, C. R.; Kwan, E.; Rusev, G.; Tonchev, A. P.; Tornow, W.; Kelley, J. H.

    2010-11-01

    An investigation of dipole states in ^238U is important for the fundamental understanding of its structure. Precise experimental information on the distribution of M1 and E1 transitions in ^238U has been obtained using the nuclear resonance fluorescence technique at the High-Intensity γ-ray Source at the Triangle Universities Nuclear Laboratory. Using 100% linearly-polarized, monoenergetic γ-ray beams between incident energies of 2.0 - 5.5 MeV, the spin, parity, width, and γ-strength of the ground-state deexcitations were determined. These measurements will form a unique data set that can be used for comparison with theoretical models of collective excitations in heavy, deformed nuclei. The data can also provide isotope-specific signatures to search for special nuclear materials.

  13. 49 CFR 238.219 - Truck-to-car-body attachment.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Truck-to-car-body attachment. 238.219 Section 238... I Passenger Equipment § 238.219 Truck-to-car-body attachment. Passenger equipment shall have a truck-to-car-body attachment with an ultimate strength sufficient to resist without failure the...

  14. 238Pu fuel form processes. Final report, January-September 1983

    International Nuclear Information System (INIS)

    Progress is reported on the following: analytical studies of weld-quench cracking in DOP-26 iridium alloy, iridium/238PuO2 compatibility test, surface area measurements of 238PuO2 using the Blaine air permeability apparatus, and helium release from 238PuO2

  15. 28 CFR 2.38 - Community supervision by U.S. Probation Officers.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Community supervision by U.S. Probation Officers. 2.38 Section 2.38 Judicial Administration DEPARTMENT OF JUSTICE PAROLE, RELEASE, SUPERVISION AND... § 2.38 Community supervision by U.S. Probation Officers. (a) Pursuant to sections 3655 and...

  16. Recovery and purification of uranium-234 from aged plutonium-238

    International Nuclear Information System (INIS)

    The current production methods used to recover and purify uranium-234 from aged plutonium-238 at Mound Laboratory are presented. The three chemical separation steps are described in detail. In the initial separation step, the bulk of the plutonium is precipitated as the oxalate. Successively lower levels of plutonium are achieved by anion exchange in nitrate media and by anion exchange in chloride media. The procedures used to characterize and analyze the final U3O8 are given

  17. Delayed fission of the 238U muonic atom

    International Nuclear Information System (INIS)

    The time distributions of fission and muon free decay events with respect to the moment of the muon-stop event have been measured for double and triple coincidences between these three events. The triple-coincidence time distributions give an indication of the o-curence of two new effects: the delayed fission of muonic 238U atom and conversion of muons from the fission fragments

  18. Stability of DMHAN on 238Pu α-Radiolysis

    Institute of Scientific and Technical Information of China (English)

    WANG; Liang; HE; Hui; SONG; Peng

    2013-01-01

    238Pu was used asαliquid inside source(does rate:34.0 Gy·g-1·min-1)for the radiolysis of N,N-dimethylhydroxylamine(DMHAN).DMHAN can reduce Pu(Ⅳ)efficiently,in nitric acid solution,Pu should be trivalence while DMHAN exists.Characteristic wavelength of Pu(Ⅲ)and Pu(Ⅳ)in radiolysis

  19. /sup 238/Pu processing at the Savannah River Plant

    Energy Technology Data Exchange (ETDEWEB)

    Burney, G.A.

    1983-01-01

    /sup 238/Pu is produced by irradiating /sup 237/Np. The /sup 237/Np is produced as a byproduct when natural or enriched uranium is irradiated with neutrons. The /sup 237/Np is separated by solvent extraction and ion exchange. It is converted to NpO/sub 2/ and fabricated into targets for irradiation. The irradiated targets are cooled and dissolved in strong nitric acid. The /sup 238/Pu and /sup 237/Np are separated from fission products and other cationic impurities and from each other by three cycles of anion exchange. The /sup 237/Np is recycled to produce more targets for irradiation. The pure /sup 238/Pu solution is precipitated as Pu oxalate and calcined to PuO/sub 2/. After several powder-conditioning steps, the PuO/sub 2/ is hot pressed into fuel forms. Each form is encased in iridium for loading into a specially designed power unit for space application. 8 references, 9 figures, 1 table.

  20. Mechanical properties of /sup 238/PuO/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Petrovic, J.J.; Hecker, S.S.; Land, C.C.; Rohr, D.L.

    1977-04-01

    The mechanical properties of /sup 238/PuO/sub 2/ have been examined in the Los Alamos Scientific Laboratory mechanical test facility built to handle ..cap alpha..-radioactive materials. Compression tests were conducted as a function of temperature, strain rate, grain size, density, and storage time. At temperatures less than or equal to 1400/sup 0/C, test specimens of /sup 238/PuO/sub 2/ exhibit pseudobrittle behavior due to internal cracks. Plastic deformation is ''localized'' at the crack tips. Generalized plastic deformation is observed at 1500/sup 0/C. Ultimate stress values decrease markedly with increasing temperature and decreasing strain rate, and decrease less with decreasing density, increasing storage time, and increasing grain size. Room temperature fracture is transgranular, whereas intergranular fracture predominates at elevated temperatures. Crack-free specimens of /sup 239/PuO/sub 2/ exhibit extensive plastic deformation at 1000/sup 0/C and above. The relationship of these test results to the impact properties of /sup 238/PuO/sub 2/ fuel in radioisotope thermoelectric generators is discussed.

  1. Pu-238 assay performance with the Canberra IQ3 system

    Energy Technology Data Exchange (ETDEWEB)

    Booth, L.; Gillespie, B.; Seaman, G.

    1997-11-01

    Canberra Industries has recently completed a demonstration project at the Westinghouse Savannah River Site (WSRC) to characterize 55-gallon drums containing Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 waste to detection limits of less than 50 nCi/g using gamma assay techniques. This would permit reclassification of these drums from transuranic (TRU) waste to low-level waste (LLW). The instrument used for this assay was a Canberra IQ3 high sensitivity gamma assay system, mounted in a trailer. The results of the measurements demonstrate achievement of detection levels as low as 1 nCi/g for low density waste drums, and good correlation with known concentrations in several test drums. In addition, the data demonstrates significant advantages for using large area low-energy germanium detectors for achieving the lowest possible MDAs for gamma rays in the 80-250 keV range. 1 fig., 2 tabs.

  2. {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am levels in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France)

    Energy Technology Data Exchange (ETDEWEB)

    Rousseau, G.; Mokili, M.B.; Le Roy, C.; Pagano, V. [SUBATECH/IN2P3 (France); Gontier, G.; Boyer, C. [EDF-DPI-DIN-CIDEN (France); Chardon, P. [CNRS/IN2P3 (France); Hemidy, P.Y. [EDF-DPN-UNIE-GPRE-IEV (France)

    2014-07-01

    Plutonium and americium long-lived alpha emitter isotopes can be found in the environment because of atmospheric global fallout due to thermonuclear tests performed between 1945 and 1980, to the American SNAP 9A satellite explosion in 1964, to the Chernobyl nuclear power plant accident,... In France, the nuclear safety authority does not allow the release of artificial alpha emitters from nuclear power plants. Thus, monitoring is performed to verify the absence of these alpha emitters in liquid discharges to respect the limits set by the regulations. These thresholds ensure a very low dosimetric impact to the population compared to other radionuclides. With the objective of environmental monitoring around nuclear facilities, activity measurements of long-lived alpha emitters are carried out to detect the traces of these radionuclides. Analysis of low activity by alpha spectrometry after chemical steps were performed and used to determine the {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am activities on a large set of environmental solid samples likely to be encountered in environmental monitoring as soils, sediments, terrestrial and aquatic bio-indicators. The samples collected in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France) was investigated for the 2009-2014 period. It was found that the mean activity concentration of the most frequently detected was for the radionuclide {sup 238}Pu: from <0.00031 to 0.0061 Bq/kg dry in terrestrial samples and from <0.00086 to 0.011 Bq/kg dry in aquatic samples; for the radionuclide {sup 239+240}Pu: from 0.00041 to 0.150 Bq/kg dry in terrestrial samples and from 0.0023 to 0.240 Bq/kg dry in aquatic samples and for the radionuclide {sup 241}Am: from <0.00086 to 0.087 Bq/kg dry in terrestrial samples and from 0.0022 to 0.120 Bq/kg dry in aquatic samples. {sup 238}Pu/{sup 239+240}Pu and {sup 241}Am/{sup 239+240}Pu ratios determined are in accordance with an environmental contamination due to

  3. Polonium 210Po, uranium (234U, 238U and plutonium (238Pu, 239+240Pu bioaccumulation in marine birds

    Directory of Open Access Journals (Sweden)

    Strumińska-Parulska D. I.

    2013-04-01

    Full Text Available The aim of this work was the determination of 210Po, 234U, 238U, 238Pu and 239+240Pu concentration in marine birds which permanently or temporally live in the southern Baltic Sea coast. We chose 11 species of seabirds: three species permanently residing at southern Baltic Sea, four species of wintering birds and three species of migrating birds. The results show that analyzed radionuclides are non-uniformly distributed in the marine birds. The highest activities of 210Po were observed in feathers, muscles and liver. The highest uranium content was found in liver, rest of viscera and feathers, while plutonium in the digestion organs and feathers. Omnivore seabirds accumulated more polonium, plutonium than species that feed on fish, while herbivore seabirds accumulated more uranium than carnivore.

  4. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  5. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  6. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  7. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  8. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  9. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  10. EFFECT OF COMPOSITION OF SELECTED GROUNDWATERS FROM THE BASIN AND RANGE PROVINCE ON PLUTONIUM, NEPTUNIUM, AND AMERICIUM SPECIATION.

    Science.gov (United States)

    Rees, Terry F.; Cleveland, Jess M.; Nash, Kenneth L.

    1984-01-01

    The speciation of plutonium, neptunium, and americium was determined in groundwaters from four sources in the Basin and Range Province: the lower carbonate aquifer, Nevada Test Site (NTS) (Crystal Pool); alluvial fill, Frenchman Flat, NTS (well 5C); Hualapai Valley, Arizona (Red Lake south well); and Tularosa Basin, New Mexico (Rentfrow well). The results were interpreted to indicate that plutonium and, to a lesser extent, neptunium are least soluble in reducing groundwaters containing a large concentration of sulfate ion and a small concentration of strongly complexing anions. The results further emphasize the desirability of including studies such as this among the other site-selection criteria for nuclear waste repositories.

  11. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  12. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  13. Phosphate fertilizer influence on {sup 238} U content in vegetables

    Energy Technology Data Exchange (ETDEWEB)

    Lauria D, C.; Rodrigues S, J.I. [Instituto de Radioprotecao e Dosimetria (IRD/CNEN), Av. Salvador Allende s/n, Rio de Janeiro-RJ (Brazil); Ribeiro, F.C.A. [Centro Regional de Ciencias Nucleares (CRCN/CNEN) Av. Prof. Luiz Freire 200 Cidade Universitaria Recife-PE (Brazil)]. e-mail: dejanira@ird.gov.br

    2006-07-01

    Uranium is a naturally radioactive element, which is usually found in soils, superficial and ground water, vegetables and animals. After ingestion by human beings, most is excreted in few days by feces and urine, without reaching the bloodstream. However, a small part circulates through the body, being accumulated in the soft tissues, as kidneys. A minor fraction can remain in bones per some years, being able through the radioactive decay to irradiate adjacent tissues. Phosphate fertilizers used in conventional crop management can present variable amounts of uranium. In accordance with origin and use, the fertilizer can raise the content of this element in vegetables, and consequently to increase the human exposure for radiation due the consumption of vegetables. It is estimated that the use of phosphate fertilizer has at least doubled the prolonged exposure of humans from ingestion of food. This work aims to evaluate the contribution of organic and chemical fertilizer on the concentration of {sup 238} U in vegetable samples. An experiment with black beans (a very important vegetable for Brazilian people) was conducted in a field which soil has never been fertilized with any sort of fertilizer, located near to the Rio de Janeiro city. On the organic management, bovine manure was used, while on conventional management urea, potassium chloride and superphosphate were used. Simultaneously, black bean samples from not fertilized management were collected. In addition, lettuce and carrot samples from organic and conventional managements were collected in Nova Friburgo farms (the most important vegetable supplier of Rio de Janeiro city market). The analyses of {sup 238} U have been carried out by conventional fluorimetric method. The geometric mean of {sup 238} U concentrations in the carrot and lettuce samples from conventional management were similar with those from organic management, while for beans the conventional samples had higher values than those ones found in

  14. Neutron Induced Capture and Fission Processes on 238U

    OpenAIRE

    Oprea Cristiana; Oprea Alexandru

    2016-01-01

    Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit – Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present...

  15. Dicty_cDB: SLD238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Value N ( AU052389 ) Dictyostelium discoideum slug cDNA, clone SLD238. 533 e-156... 2 ( AU052473 ) Dictyostelium discoideum slug cDNA, clone SLD384. 533 e-156 2 ( AU053348 ) Dictyostelium discoideum slug... cDNA, clone SLI436. 533 e-156 2 ( AU052949 ) Dictyostelium discoideum slug cDNA, clone SLF368. ...533 e-156 2 ( AU033974 ) Dictyostelium discoideum slug cDNA, clone SLB679. 533 e-...156 2 ( AU052416 ) Dictyostelium discoideum slug cDNA, clone SLD280. 533 e-156 2 ( AU052488 ) Dictyostelium discoideum slug

  16. Charge-pickup of 238U at relativistic energies

    International Nuclear Information System (INIS)

    Cross sections for the charge-pickup of 238U projectiles were measured at E/A=600 and 1000 MeV for seven different targets (Be, C, Al, Cu, In, Au and U). Events with two fission fragments with a sum charge of 93 in the exit channel were selected. Due to the significant excitation energy, the dominant part of produced Np nuclei fission instead of decaying to the ground state by evaporation. The observed cross sections can be well reproduced by intranuclear-cascade-plus-evaporation calculations and, therefore, confirm recent results that no exotic processes are needed to explain charge-pickup processes. (orig.)

  17. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.

    1982-01-01

    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  18. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  19. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  20. HSPC238相互作用蛋白RPL5的初步筛选%Preliminary screening of RPL5 interacting with HSPC238

    Institute of Scientific and Technical Information of China (English)

    陈敬林; 黄湘; 谭家余; 钟裕恒; 万志丹

    2015-01-01

    Objective:To construct a bait vector for HSPC238, and to screen the target proteins which interact with the HSPC238.Methods:Gene synthesis method was used to synthetic gene HSPC238, then connected with the pGBKT7 vector after digesting by the sfiIA and sfiIB,to obtain the bait plasmid pGBKT7-HSPC238,then transferred into the yeast strains AH109 with the empty plasmid pGBKT7after sequencing,to observe its self-activating effect in the nutrient deficiencies medium,and further to screen the target proteins which interact with HSPC238 from the human fetal liver cDNA library.Results:The bait vector pGBKT7-HSPC238 was successfully constructed,and it had no self-activating effect through the phenotypic screening,after the yeast two-hybrid technology with literature analysis,we preliminary screened and found that the ribosomal protein L5(RPL5) may be the one of the target proteins which interacted with HSPC238 from the human fetal liver cDNA library.Conclusion: We successfully constructed the bait plasmid vector PGBKT7-HSPC238,and after the yeast two-hybrid technology with literature analysis,we preliminary screened and found that the ribosomal protein L5( RPL5) may be the one of the target proteins which interacted with HSPC238.%目的:构建HSPC238诱饵载体,筛选与HSPC238相互作用的目标蛋白。方法:基因合成法合成HSPC238基因,sfiIA和sfiIB双酶切后与pGBKT7诱饵载体连接,获得诱饵质粒pGBKT7-HSPC238,经测序鉴定后与酵母双杂交空质粒pGBKT7共同转化到酵母菌株AH109,在营养缺陷培养基中观察pGBKT7-HSPC238的自激活作用,进一步从人胎肝cDNA文库中筛选与HSPC238相互作用的目标蛋白。结果:诱饵载体pGBKT7-HSPC238构建成功,经表型筛选检测无自激活作用,经酵母双杂交技术结合文献分析,从人胎肝cDNA文库中初步筛选发现核糖体蛋白L5(Ribosomal protein L5,RPL5)可能是HSPC238相互作用的目标蛋白之一

  1. LIBS Spectral Data for a Mixed Actinide Fuel Pellet Containing Uranium, Plutonium, Neptunium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Judge, Elizabeth J. [Los Alamos National Laboratory; Berg, John M. [Los Alamos National Laboratory; Le, Loan A. [Los Alamos National Laboratory; Lopez, Leon N. [Los Alamos National Laboratory; Barefield, James E. [Los Alamos National Laboratory

    2012-06-18

    Laser-induced breakdown spectroscopy (LIBS) was used to analyze a mixed actinide fuel pellet containing 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2}. The preliminary data shown here is the first report of LIBS analysis of a mixed actinide fuel pellet, to the authors knowledge. The LIBS spectral data was acquired in a plutonium facility at Los Alamos National Laboratory where the sample was contained within a glove box. The initial installation of the glove box was not intended for complete ultraviolet (UV), visible (VIS) and near infrared (NIR) transmission, therefore the LIBS spectrum is truncated in the UV and NIR regions due to the optical transmission of the window port and filters that were installed. The optical collection of the emission from the LIBS plasma will be optimized in the future. However, the preliminary LIBS data acquired is worth reporting due to the uniqueness of the sample and spectral data. The analysis of several actinides in the presence of each other is an important feature of this analysis since traditional methods must chemically separate uranium, plutonium, neptunium, and americium prior to analysis. Due to the historic nature of the sample fuel pellet analyzed, the provided sample composition of 75% UO{sub 2}/20% PuO{sub 2}/3% AmO{sub 2}/2% NpO{sub 2} cannot be confirm without further analytical processing. Uranium, plutonium, and americium emission lines were abundant and easily assigned while neptunium was more difficult to identify. There may be several reasons for this observation, other than knowing the exact sample composition of the fuel pellet. First, the atomic emission wavelength resources for neptunium are limited and such techniques as hollow cathode discharge lamp have different dynamics than the plasma used in LIBS which results in different emission spectra. Secondly, due to the complex sample of four actinide elements, which all have very dense electronic energy levels, there may be reactions and

  2. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  3. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state propertie...

  4. Richland Five-Year 02 R&D Program - Pu-238 program

    Energy Technology Data Exchange (ETDEWEB)

    1968-06-30

    There are three principal facets to the Pu-238 Program which are important to Richland. First, reactor neptunium production rates can be materially enhanced by judicious fuel management plans. Second, significant improvement in production efficiency and costs may be made if the Pu-238 production step (irradiation of Np-237) were sites at Richland. Further, Richland reactors have ample capacity, without reducing power, to irradiate all neptunium from government and commercial reactor sources which has been forecasted well into the 1980`s. Third, a separate Pu-238 production process, that of irradiating Am-241 (obtained from power reactor plutonium returns), offers an attractive and competitive means to materially supplement Pu-238 from the Np-237 route. The first two of these aspects of the Pu-238 Program are being pursued actively, particularly in light of firm and predicted requirements for Pu-238. Technological development for irradiating and processing Am-241 will be performed in the near future.

  5. The production of unknown neutron-rich isotopes in $^{238}$U+$^{238}$U collisions at near-barrier energy

    CERN Document Server

    Zhao, Kai; Zhang, Yingxun; Wang, Ning; Li, Qingfeng; Shen, Caiwan; Wang, Yongjia; Wu, Xizhen

    2016-01-01

    The production cross sections for primary and residual fragments with charge number from $Z$=70 to 120 produced in the collision of $^{238}$U+$^{238}$U at 7.0 MeV/nucleon are calculated by the improved quantum molecular dynamics (ImQMD) model incorporated with the statistical evaporation model (HIVAP code). The calculation results predict that about sixty unknown neutron-rich isotopes from element Ra ($Z$=88) to Db ($Z$=105) can be produced with the production cross sections above the lower bound of $10^{-8}$ mb in this reaction. And almost all of unknown neutron-rich isotopes are emitted at the laboratory angles $\\theta_{lab}\\leq$ 60$^\\circ$. Two cases, i.e. the production of the unknown uranium isotopes with $A\\geq$ 244 and that of rutherfordium with $A\\geq$ 269 are investigated for understanding the production mechanism of unknown neutron-rich isotopes. It is found that for the former case the collision time between two uranium nuclei is shorter and the primary fragments producing the residues have smaller...

  6. Some physico-chemical and radiation properties of plutonium-238 metal prepared by electrochemical amalgamation

    International Nuclear Information System (INIS)

    Pu-238 metal was prepared by electrolytic amalgamation from Pu(III) acetate aqueous solution and by followed by the thermal decomposition of the Pu amalgam. The density, specific heat power, γ-spectra, neutron flux, and corrosion kinetics in dry air at ambient temperature of the prepared 238Pu metal were measured. The neutron flux and γ-spectra from 238Pu metal have been attributed to spontaneous and induced fission and to (α,α'γ), (α,pγ), and (α,nγ) nuclear reactions on light nuclei. The electrochemically prepared 238Pu metal was shown to generate fewer neutrons, produce less gamma radiation, and contains lower 10B, 19F, and 28Si impurities in comparison with biomedical 238PuO2. The increase of neutron flux from the sample due to the reaction 18O(α,nγ) 21Ne was shown to be proportional to the increase of the mass of the 238Pu metal with time due to corrosion in dry air. 238Pu metal corrosion rate maximum and average values (1.1 x 10-2 and 4.7 x 10-3 mg cm-2 h-1, respectively) obtained in dry air were an order of magnitude higher than the rates published for 239Pu under similar experiment conditions. The difference between the 239Pu and 238Pu metal corrosion rate and mechanism is proposed to be due to the greater radiation effects and temperature on the 238Pu surface

  7. National low-level waste management program radionuclide report series, Volume 15: Uranium-238

    Energy Technology Data Exchange (ETDEWEB)

    Adams, J.P.

    1995-09-01

    This report, Volume 15 of the National Low-Level Waste Management Program Radionuclide Report Series, discusses the radiological and chemical characteristics of uranium-238 ({sup 238}U). The purpose of the National Low-Level Waste Management Program Radionuclide Report Series is to provide information to state representatives and developers of low-level radioactive waste disposal facilities about the radiological, chemical, and physical characteristics of selected radionuclides and their behavior in the waste disposal facility environment. This report also includes discussions about waste types and forms in which {sup 238}U can be found, and {sup 238}U behavior in the environment and in the human body.

  8. Neutron Induced Capture and Fission Processes on 238U

    Directory of Open Access Journals (Sweden)

    Oprea Cristiana

    2016-01-01

    Full Text Available Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit – Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present evaluations are necessary in order to obtain the field of neutrons in the design of nuclear reactors and they are compared with experimental data from literature obtained from capture and (n,xn processes.

  9. Neutron Induced Capture and Fission Processes on 238U

    Science.gov (United States)

    Oprea, Cristiana; Oprea, Alexandru

    2016-03-01

    Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit - Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present evaluations are necessary in order to obtain the field of neutrons in the design of nuclear reactors and they are compared with experimental data from literature obtained from capture and (n,xn) processes.

  10. Resonant upscattering effects on 238U absorption rates

    International Nuclear Information System (INIS)

    The new requirements of accuracy in reactor physics calculations justify a review of the current models, like that one adopted in the cross-section processing, for a better evaluation of the keff and the resonant absorption rates. In this context, the aim of this paper is to investigate the effects of the free gas kernel developed by Sanchez on the 238U absorption rates. Homogeneous medium tests point out the increase of the absorption rates in the left wing of the resonances due to the upscattering produced by the new kernel. Heterogeneous tests show that the absorption in the left wing of the resonances is mostly affected by the scattering anisotropy in the laboratory system. (author)

  11. Helium release from 238PuO2 fuel particles

    Science.gov (United States)

    El-Genk, Mohamed S.; Tournier, Jean-Michel

    2000-01-01

    Coated plutonia fuel particles have recently been proposed for potential use in future space exploration missions that employ radioisotope power systems and/or radioisotope heater units (RHUs). The design of this fuel form calls for full retention of the helium generated by the natural radioactive decay of 238Pu, with the aid of a strong zirconium carbide coating. This paper reviews the potential release mechanisms of helium in small-grain (7-40 μm) plutonia pellets currently being used in the General Purpose Heat Source (GPHS) modules and RHUs, during both steady-state and transient heating conditions. The applicability of these mechanisms to large-grain and polycrystalline 238PuO2 fuel kernels is examined and estimates of helium release during a re-entry heating pulse up to 1723 K are presented. These estimates are based on the reported data for fission gas release from granular and monocrystal UO2 fuel particles irradiated at isothermal conditions up to 6.4 at.% burnup and 2030 K. It is concluded that the helium release fraction from large-grain (>=300 μm) plutonia fuel kernels heated up to 1723 K could be less than 7%, compared to ~80% from small-grain (7-40 μm) fuel. The helium release fraction from polycrystalline plutonia kernels fabricated using Sol-Gel techniques could be even lower. Sol-Gel fabrication processes are favored over powder metallurgy, because of their high precision and excellent reproducibility and the absence of a radioactive dust waste stream, significantly reducing the fabrication and post-fabrication clean-up costs. .

  12. Summary of Plutonium-238 Production Alternatives Analysis Final Report

    Energy Technology Data Exchange (ETDEWEB)

    James Werner; Wade E. Bickford; David B. Lord; Chadwick D. Barklay

    2013-03-01

    The Team implemented a two-phase evaluation process. During the first phase, a wide variety of past and new candidate facilities and processing methods were assessed against the criteria established by DOE for this assessment. Any system or system element selected for consideration as an alternative within the project to reestablish domestic production of Pu-238 must meet the following minimum criteria: Any required source material must be readily available in the United States, without requiring the development of reprocessing technologies or investments in systems to separate material from identified sources. It must be cost, schedule, and risk competitive with existing baseline technology. Any identified facilities required to support the concept must be available to the program for the entire project life cycle (notionally 35 years, unless the concept is so novel as to require a shorter duration). It must present a solution that can generate at least 1.5 Kg of Pu-238 oxide per year, for at least 35 years. It must present a low-risk, near-term solution to the National Aeronautics and Space Administration’s urgent mission need. DOE has implemented this requirement by eliminating from project consideration any alternative with key technologies at less than Technology Readiness Level 5. The Team evaluated the options meeting these criteria using a more detailed assessment of the reasonable facility variations and compared them to the preferred option, which consists of target irradiation at the Advanced Test Reactor (ATR) and the High Flux Isotope Reactor (HFIR), target fabrication and chemical separations processing at the ORNL Radiochemical Engineering Development Center, and neptunium 237 storage at the Materials and Fuels Complex at INL. This preferred option is consistent with the Records of Decision from the earlier National Environmental Policy Act (NEPA) documentation

  13. Capability to Recover Plutonium-238 in H-Canyon/HB-Line - 13248

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, Kenneth S. Jr.; Smith, Robert H. Jr.; Goergen, Charles R. [Savannah River Nuclear Solutions, LLC, Savannah River Site, Aiken, SC 29802 (United States)

    2013-07-01

    Plutonium-238 is used in Radioisotope Thermoelectric Generators (RTGs) to generate electrical power and in Radioisotope Heater Units (RHUs) to produce heat for electronics and environmental control for deep space missions. The domestic supply of Pu-238 consists of scrap material from previous mission production or material purchased from Russia. Currently, the United States has no significant production scale operational capability to produce and separate new Pu-238 from irradiated neptunium-237 targets. The Department of Energy - Nuclear Energy is currently evaluating and developing plans to reconstitute the United States capability to produce Pu-238 from irradiated Np-237 targets. The Savannah River Site had previously produced and/or processed all the Pu-238 utilized in Radioisotope Thermoelectric Generators (RTGs) for deep space missions up to and including the majority of the plutonium for the Cassini Mission. The previous full production cycle capabilities included: Np- 237 target fabrication, target irradiation, target dissolution and Np-237 and Pu-238 separation and purification, conversion of Np-237 and Pu-238 to oxide, scrap recovery, and Pu-238 encapsulation. The capability and equipment still exist and could be revitalized or put back into service to recover and purify Pu-238/Np-237 or broken General Purpose Heat Source (GPHS) pellets utilizing existing process equipment in HB-Line Scrap Recovery, and H-Canyon Frame Waste Recovery processes. The conversion of Np-237 and Pu-238 to oxide can be performed in the existing HB-Line Phase-2 and Phase- 3 Processes. Dissolution of irradiated Np-237 target material, and separation and purification of Np-237 and Pu-238 product streams would be possible at production rates of ∼2 kg/month of Pu-238 if the existing H-Canyon Frames Process spare equipment were re-installed. Previously, the primary H-Canyon Frames equipment was removed to be replaced: however, the replacement project was stopped. The spare equipment

  14. CAPABILITY TO RECOVER PLUTONIUM-238 IN H-CANYON/HB-LINE

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, Kenneth S. Jr.; Smith, Robert H. Jr.; Goergen, Charles R.

    2013-01-09

    Plutonium-238 is used in Radioisotope Thermoelectric Generators (RTGs) to generate electrical power and in Radioisotope Heater Units (RHUs) to produce heat for electronics and environmental control for deep space missions. The domestic supply of Pu-238 consists of scrap material from previous mission production or material purchased from Russia. Currently, the United States has no significant production scale operational capability to produce and separate new Pu-238 from irradiated neptunium-237 targets. The Department of Energy - Nuclear Energy is currently evaluating and developing plans to reconstitute the United States capability to produce Pu-238 from irradiated Np-237 targets. The Savannah River Site had previously produced and/or processed all the Pu-238 utilized in Radioisotope Thermoelectric Generators (RTGs) for deep space missions up to and including the majority of the plutonium for the Cassini Mission. The previous full production cycle capabilities included: Np-237 target fabrication, target irradiation, target dissolution and Np-237 and Pu-238 separation and purification, conversion of Np-237 and Pu-238 to oxide, scrap recovery, and Pu-238 encapsulation. The capability and equipment still exist and could be revitalized or put back into service to recover and purify Pu-238/Np-237 or broken General Purpose Heat Source (GPHS) pellets utilizing existing process equipment in HB-Line Scrap Recovery, and H-anyon Frame Waste Recovery processes. The conversion of Np-237 and Pu-238 to oxide can be performed in the existing HB-Line Phase-2 and Phase-3 Processes. Dissolution of irradiated Np-237 target material, and separation and purification of Np-237 and Pu-238 product streams would be possible at production rates of ~ 2 kg/month of Pu-238 if the existing H-Canyon Frames Process spare equipment were re-installed. Previously, the primary H-Canyon Frames equipment was removed to be replaced: however, the replacement project was stopped. The spare equipment is

  15. 49 CFR 238.419 - Truck-to-car-body and truck component attachment.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Truck-to-car-body and truck component attachment. 238.419 Section 238.419 Transportation Other Regulations Relating to Transportation (Continued... attachment. (a) The ultimate strength of the truck-to-car-body attachment for each unit in a train shall...

  16. 49 CFR 238.119 - Rim-stamped straight-plate wheels.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Rim-stamped straight-plate wheels. 238.119 Section... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General Requirements § 238.119 Rim-stamped straight-plate wheels. (a)(1) Except as provided in paragraph (a)(2) of...

  17. 49 CFR 238.409 - Forward end structures of power car cabs.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Forward end structures of power car cabs. 238.409... II Passenger Equipment § 238.409 Forward end structures of power car cabs. This section contains requirements for the forward end structure of the cab of a power car. (A conceptual implementation of this...

  18. 37 CFR 2.38 - Use by predecessor or by related companies.

    Science.gov (United States)

    2010-07-01

    ... related companies. 2.38 Section 2.38 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... Use by predecessor or by related companies. (a) If the first use of the mark was by a predecessor in title or by a related company (sections 5 and 45 of the Act), and the use inures to the benefit of...

  19. 49 CFR 238.105 - Train electronic hardware and software safety.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Train electronic hardware and software safety. 238... and General Requirements § 238.105 Train electronic hardware and software safety. The requirements of this section apply to electronic hardware and software used to control or monitor safety functions...

  20. 49 CFR 238.111 - Pre-revenue service acceptance testing plan.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Pre-revenue service acceptance testing plan. 238... and General Requirements § 238.111 Pre-revenue service acceptance testing plan. (a) Passenger equipment that has previously been used in revenue service in the United States. For passenger...

  1. 48 CFR 552.238-70 - Identification of Electronic Office Equipment Providing Accessibility for the Handicapped.

    Science.gov (United States)

    2010-10-01

    ... PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 552.238-70 Identification of Electronic Office.... “Handicapped individuals” mean qualified individuals with impairments as cited in 29 CFR 1613.702(f) who can... Electronic Office Equipment Providing Accessibility for the Handicapped. 552.238-70 Section...

  2. 238Pu: accumulation, tissue distribution, and excretion in Mayak workers after exposure to plutonium aerosols.

    Science.gov (United States)

    Suslova, Klara G; Sokolova, Alexandra B; Khokhryakov, Viktor V; Miller, Scott C

    2012-03-01

    The alpha spectrometry measurements of specific activity of 238Pu and 239Pu in urine from bioassay examinations of 1,013 workers employed at the radiochemical and plutonium production facilities of the Mayak Production Association and in autopsy specimens of lung, liver, and skeleton from 85 former nuclear workers who died between 1974-2009, are summarized.The accumulation fraction of 238Pu in the body and excreta has not changed with time in workers involved in production of weapons-grade plutonium production (e.g., the plutonium production facility and the former radiochemical facility). The accumulation fraction of 238Pu in individuals exposed to plutonium isotopes at the newer Spent Nuclear Fuel Reprocessing Plant ranged from 0.13% up to 27.5% based on the autopsy data. No statistically significant differences between 238Pu and 239Pu in distribution by the main organs of plutonium deposition were found in the Mayak workers. Based on the bioassay data,the fraction of 238Pu activity in urine is on average 38-69% of the total activity of 238Pu and 239Pu, which correlates with the isotopic composition in workplace air sampled at the Spent Nuclear Fuel Reprocessing Plant. In view of the higher specific activity of 238Pu, the contribution of 238Pu to the total internal dose, particularly in the skeleton and liver, might be expected to continue to increase, and continued surveillance is recommended.

  3. 49 CFR 238.447 - Train operator's controls and power car cab layout.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Train operator's controls and power car cab layout. 238.447 Section 238.447 Transportation Other Regulations Relating to Transportation (Continued... layout. (a) Train operator controls in the power car cab shall be arranged so as to minimize the...

  4. Studying Nuclear Level Densities of 238U in the Nuclear Reactions within the Macroscopic Nuclear Models

    Science.gov (United States)

    Razavi, Rohallah; Rahmatinejad, Azam; Kakavand, Tayeb; Taheri, Fariba; Aghajani, Maghsood; Khooy, Asghar

    2016-02-01

    In this work the nuclear level density parameters of 238U have been extracted in the back-shifted Fermi gas model (BSFGM), as well as the constant temperature model (CTM), through fitting with the recent experimental data on nuclear level densities measured by the Oslo group. The excitation functions for 238U(p,2nα)233Pa, and 238U(p,4n)235Np reactions and the fragment yields for the fragments of the 238U(p,f) reaction have been calculated using obtained level density parameters. The results are compared to their corresponding experimental values. It was found that the extracted excitation functions and the fragment yields in the CTM coincide well with the experimental values in the low-energy region. This finding is according to the claim made by the Oslo group that the extracted level densities of 238U show a constant temperature behaviour.

  5. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    International Nuclear Information System (INIS)

    Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory (LANL) has initiated a development program to recover and purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. Our initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The most notable non-actinide impurity was silicon, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. 234U was by far the largest actinide impurity observed in the feed material because it is the daughter product of 238Pu by alpha decay. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was finely milled, then dissolved in refluxing HNO3/HF and the solution filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glove box environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values

  6. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    Science.gov (United States)

    Schulte, Louis D.; Silver, Gary L.; Avens, Larry R.; Jarvinen, Gordon D.; Espinoza, Jacob; Foltyn, Elizabeth M.; Rinehart, Gary H.

    1997-01-01

    Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory (LANL) has initiated a development program to recover & purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. Our initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The most notable non-actinide impurity was silicon, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. 234U was by far the largest actinide impurity observed in the feed material because it is the daughter product of 238Pu by alpha decay. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was finely milled, then dissolved in refluxing HNO3/HF and the solution filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glove box environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values.

  7. Natural Isotopic Fractionation of 238U/235U in the Water Column of the Black Sea

    Science.gov (United States)

    Romaniello, S. J.; Brennecka, G.; Anbar, A. D.; Colman, A. S.

    2009-12-01

    The natural fractionation of long-lived uranium isotopes (238U, 235U) is being explored as a paleoredox proxy. While uranium behaves conservatively in oxic seawater, it is readily removed to sediments under reducing conditions. Measurements of δ238/235U in black shales and marine sediments deposited under sulfidic conditions suggest that uranium removed in such environments is isotopically heavy. However, this fractionation process has not been directly demonstrated in a present-day marine environment, nor is the specific mechanism of fractionation known. The euxinic water column of the Black Sea provides an ideal laboratory for studying uranium isotope fractionation. Uranium in Black Sea sediments is 0.35-0.84‰ heavy in δ238/235U relative to open ocean seawater (Weyer et al. 2008). We therefore expect that dissolved uranium in the Black Sea water column should be correspondingly light. Furthermore, direct measurements of δ238/235U versus depth could be used in combination with sediment δ238/235U to infer the dominant locations of U removal and constrain specific mechanisms of fractionation. Here we present the first δ238/235U depth profile from the water column of the Black Sea. The measurements were made on a Neptune MC-ICP-MS, using a 236U-233U double spike to correct for instrumental mass bias, following preconcentration and purification with UTEVA resin. With this method, we are able to measure δ238/235U with a 2σ precision of 0.07‰ on 100 ng samples. Our results show that δ238/235U decreases monotonically with depth (Fig. 1). At the surface, δ238/235U values are similar to those in the open ocean. At 2000m, δ238/235U is 0.28‰ lighter than open ocean seawater, while uranium concentrations are depleted by ~44% relative to conservative mixing. As expected, δ238/235U in the water column is always lighter than the underlying sediments, confirming that 238U is preferentially removed to marine sediments under sulfidic conditions. Fig 1. (left) Depth

  8. Elastic and inelastic scattering of neutrons on 238U nucleus

    Directory of Open Access Journals (Sweden)

    Capote R.

    2014-04-01

    Full Text Available Advanced modelling of neutron induced reactions on the 238U nucleus is aimed at improving our knowledge of neutron scattering. Capture and fission channels are well constrained by available experimental data and neutron standard evaluation. A focus of this contribution is on elastic and inelastic scattering cross sections. The employed nuclear reaction model includes – a new rotational-vibrational dispersive optical model potential coupling the low-lying collective bands of vibrational character observed in even-even actinides; – the Engelbrecht-Weidenmüller transformation allowing for inclusion of compound-direct interference effects; – and a multi-humped fission barrier with absorption in the secondary well described within the optical model for fission. Impact of the advanced modelling on elastic and inelastic scattering cross sections including angular distributions and emission spectra is assessed both by comparison with selected microscopic experimental data and integral criticality benchmarks including measured reaction rates (e.g. JEMIMA, FLAPTOP and BIG TEN. Benchmark calculations provided feedback to improve the reaction modelling. Improvement of existing libraries will be discussed.

  9. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  10. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides

    Science.gov (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.

    2015-10-01

    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  11. THE FIRST ISOLATION OF AMERICIUM IN THE FORM OF PURE COMPOUNDS - THE SPECIFIC ALPHA-ACTIVITY AND HALF-LIFE OF Am241

    Energy Technology Data Exchange (ETDEWEB)

    Cunningham, B.B.; Asprey, L.B.

    1950-07-20

    The microgram scale isolation and preparation of pure compounds of americium is described. Data are presented to show that the alpha-half-life of the isotope Am{sup 241} is 490 {+-} 14 years. The absorption spectrum of Am(III) in 1M nitric acid in the range 3500-8000 mu is given. The wave lengths of 10 of the most prominent lines in the copper spark emission spectrum of americium are given to the nearest 0.01 {angstrom}. Evidence is presented to show that the potential for the Am(III)-Am(IV) couple in acid solution is more negative than -2v and that the potential for the Am(II)-Am(III) couple is more positive than +0.9v.

  12. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium

    OpenAIRE

    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray

    2009-01-01

    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  13. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  14. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  15. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  16. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: dam.prieur@gmail.com [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)

    2015-10-15

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  17. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    International Nuclear Information System (INIS)

    Nuclear Materials Technology (NMT) Division has initiated a development program to recover and purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. The initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The notable non-actinide impurities were silicon and phosphorus, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. Among actinide impurities, uranium is of paramount concern because 234U is the daughter of 2238Pu by alpha decay, and is the largest actinide impurity. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was first dissolved in refluxing HNO3/HF and then the solution was filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glovebox environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values

  18. Preconceptual Feasibility Study to Evaluate Alternative Means to Produce Plutonium-238

    Energy Technology Data Exchange (ETDEWEB)

    John D. Bess; Matthew S. Everson

    2013-02-01

    There is currently no large-scale production of 238Pu in the United States. Feasibility studies were performed at the Idaho National Laboratory to assess the capability of developing alternative 238Pu production strategies. Initial investigations indicate potential capability to provision radioisotope-powered systems for future space exploration endeavors. For the short term production of 238Pu, sealed canisters of dilute 237Np solution in nitric acid could be irradiated in the Advanced Test Reactor (ATR). Targets in the large and medium “I” positions of the ATR were irradiated over a simulated period of 306 days and analyzed using MCNP5 and ORIGEN2.2. Approximately 0.5 kg of 238Pu could be produced annually in the ATR with purity greater than 92%. Optimization of the irradiation cycles could further increase the purity to greater than 98%. Whereas the typical purity of space batteries is between 80 to 85%, the higher purity 238Pu produced in the ATR could be blended with existing lower-purity inventory to produce useable material. Development of irradiation methods in the ATR provides the fastest alterative to restart United States 238Pu production. The analysis of 238Pu production in the ATR provides the technical basis for production using TRIGA® (Training, Research, Isotopes, General Atomics) nuclear reactors. Preliminary analyses envisage a production rate of approximately 0.7 kg annually using a single dedicated 5-MW TRIGA reactor with continuous flow loops to achieve high purity product. Two TRIGA reactors represent a robust means of providing at over 1 kg/yr of 238Pu annually using dilute solution targets of 237Np in nitric acid. Further collaboration and optimization of reactor design, radiochemical methods, and systems analyses would further increase annual 238Pu throughput, while reducing the currently evaluated reactor requirements.

  19. 40 CFR 23.8 - Timing of Administrator's action under Uranium Mill Tailings Radiation Control Act of 1978.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Timing of Administrator's action under Uranium Mill Tailings Radiation Control Act of 1978. 23.8 Section 23.8 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL JUDICIAL REVIEW UNDER EPA-ADMINISTERED STATUTES § 23.8 Timing of Administrator's action under Uranium...

  20. 42 CFR 23.8 - What operational requirements apply to an entity to which National Health Service Corps personnel...

    Science.gov (United States)

    2010-10-01

    ... which National Health Service Corps personnel are assigned? 23.8 Section 23.8 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES PERSONNEL NATIONAL HEALTH SERVICE CORPS Assignment of National Health Service Corps Personnel § 23.8 What operational requirements apply to an......

  1. 48 CFR 552.238-79 - Use of Federal Supply Schedule Contracts by Certain Entities-Cooperative Purchasing.

    Science.gov (United States)

    2010-10-01

    ... Schedule Contracts by Certain Entities-Cooperative Purchasing. 552.238-79 Section 552.238-79 Federal... Federal Supply Schedule Contracts by Certain Entities—Cooperative Purchasing (MAY 2004) (a) If an entity... CONTRACT CLAUSES Text of Provisions and Clauses 552.238-79 Use of Federal Supply Schedule Contracts...

  2. Measurement and calculation of 238U fission reaction rates induced by neutrons reflected by carbon material

    International Nuclear Information System (INIS)

    To check the data of carbon material reflecting neutrons, the distribution of 238U fission reaction rates induced by D-T fusion neutrons reflected by carbon material was measured by using the small depleted uranium fission chamber and the capturing detector. For comparison, 238U fission rates without carbon material was measured too. The combined standard uncertainty of 238U fission reaction rate is 5.1%-6.4%. The measured results are consistent with the calculated ones with MCNP/4A code and ENDF/B-IV library data in the range of the error

  3. Experimental Determination of the Antineutrino Spectrum of the Fission Products of $^{238}$U

    CERN Document Server

    Haag, N; Hofmann, M; Oberauer, L; Potzel, W; Schreckenbach, K; Wagner, F M

    2013-01-01

    An experiment was performed at the scientific neutron source FRM II in Garching to determine the cumulative antineutrino spectrum of the fission products of $^{238}$U. This was achieved by irradiating target foils of natural uranium with a thermal and a fast neutron beam and recording the emitted $\\beta$-spectra with a gamma-suppressing electron-telescope. The obtained $\\beta$-spectrum of the fission products of $^{235}$U was normalized to the data of the magnetic spectrometer BILL of $^{235}$U. This method strongly reduces systematic errors in the $^{238}$U measurement. The $\\beta$-spectrum of $^{238}$U was converted into the corresponding antineutrino spectrum. The final $\\bar\

  4. Deposition of air-borne 238Pu near a chemical separation facility

    International Nuclear Information System (INIS)

    Three methods were compared to measure deposition of 238Pu released from a chemical separation facility at the Savannah River Plant, Aiken, SC. The following methods were used: adhesive paper; a collector of rain and dryfall; and soil samples. Excellent agreement among the three methods was found. The measured deposition for the particular source term and meteorological conditions at the Savannah River Plant is described by y proportional to x/sup -1.36/ where y is the pCi of 238Pu deposited per square meter per mC: 238Pu released, and x is distance in meters from the source

  5. Biokinetics of a transuranic (238PU) and a rare earth element (152Eu) in the lobster (Homarus gammarus): transfer mechanisms (accumulation and detoxification) in organs and at the cellular level

    International Nuclear Information System (INIS)

    The work presented here is an experimental investigation of the biokinetics of transfer of a transuranic and a rare earth element (238Pu and 152Eu) in the lobster Homarus gammarus. The study of 238Pu biokinetics forms part of a wider framework of research concerning the transfer of transuranic elements in marine species, while the study of 152Eu is carried out with a view to supporting the analogy between the behaviour of transuranics and rare earths in living organisms. Exactly the same experimental protocol, based on techniques from various disciplines (biology, biochemistry and metrology), was used to Investigate the biokinetics of transfer of these two radionuclides. The Individual lobsters were radiolabelled by means of one-shot or chronic ingestion of spiked meals. As the first approach, the kinetics and transfer mechanisms were studied In whole animal samples and in different organs distinct series of pathways through the different organs were identified in the case of both radionuclides, being mainly linked to digestive processes induced by the meal as well as the transport function of hemo-lymph in this way, the Important role of the digestive gland was picked out, with two of four cellular types displaying a successive involvement In the fixation and then the retention of the studied radionuclides. As a corroborative approach, the digestive gland was subjected to a more detailed investigation with the aim of describing the mechanisms of Incorporation and elucidating transfer processes at the cellular and molecular levels. 238Pu is preferentially partitioned into the cytosol, where it is associated with various constituents such as ferritin (iron-storing protein). 152Eu is more diffusely distributed in the hepato-pancreatic cells, while the lysosomes appear to play a more important role during transfer. The results obtained in this study, both on the macroscopic scale (i.e. the whole animal and different organs) as well as the cellular and molecular levels

  6. Biokinetics of a transuranic ({sup 238}PU) and a rare earth element ({sup 152}Eu) in the lobster (Homarus gammarus): transfer mechanisms (accumulation and detoxification) in organs and at the cellular level; Biocinetiques d'un element transuranien, le {sup 238}PU, et d'une terre rare, le {sup 152}EU, chez le homard homarus gammarus (organes et niveau cellulaire) modalites des transferts (accumulation et detoxication)

    Energy Technology Data Exchange (ETDEWEB)

    Tocquet, N

    1995-07-01

    The work presented here is an experimental investigation of the biokinetics of transfer of a transuranic and a rare earth element ({sup 238}Pu and {sup 152}Eu) in the lobster Homarus gammarus. The study of {sup 238}Pu biokinetics forms part of a wider framework of research concerning the transfer of transuranic elements in marine species, while the study of {sup 152}Eu is carried out with a view to supporting the analogy between the behaviour of transuranics and rare earths in living organisms. Exactly the same experimental protocol, based on techniques from various disciplines (biology, biochemistry and metrology), was used to Investigate the biokinetics of transfer of these two radionuclides. The Individual lobsters were radiolabelled by means of one-shot or chronic ingestion of spiked meals. As the first approach, the kinetics and transfer mechanisms were studied In whole animal samples and in different organs distinct series of pathways through the different organs were identified in the case of both radionuclides, being mainly linked to digestive processes induced by the meal as well as the transport function of hemo-lymph in this way, the Important role of the digestive gland was picked out, with two of four cellular types displaying a successive involvement In the fixation and then the retention of the studied radionuclides. As a corroborative approach, the digestive gland was subjected to a more detailed investigation with the aim of describing the mechanisms of Incorporation and elucidating transfer processes at the cellular and molecular levels. {sup 238}Pu is preferentially partitioned into the cytosol, where it is associated with various constituents such as ferritin (iron-storing protein). {sup 152}Eu is more diffusely distributed in the hepato-pancreatic cells, while the lysosomes appear to play a more important role during transfer. The results obtained in this study, both on the macroscopic scale (i.e. the whole animal and different organs) as well

  7. 10 CFR 72.238 - Issuance of an NRC Certificate of Compliance.

    Science.gov (United States)

    2010-01-01

    ... STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.238 Issuance of an NRC Certificate of Compliance....

  8. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  9. Intramolecular sensitization of americium luminescence in solution: shining light on short-lived forbidden 5f transitions.

    Science.gov (United States)

    Sturzbecher-Hoehne, M; Yang, P; D'Aléo, A; Abergel, R J

    2016-06-14

    The photophysical properties and solution thermodynamics of water soluble trivalent americium (Am(III)) complexes formed with multidentate chromophore-bearing ligands, 3,4,3-LI(1,2-HOPO), Enterobactin, and 5-LIO(Me-3,2-HOPO), were investigated. The three chelators were shown to act as antenna chromophores for Am(III), generating sensitized luminescence emission from the metal upon complexation, with very short lifetimes ranging from 33 to 42 ns and low luminescence quantum yields (10(-3) to 10(-2)%), characteristic of Near Infra-Red emitters in similar systems. The specific emission peak of Am(III) assigned to the (5)D1 → (7)F1 f-f transition was exploited to characterize the high proton-independent stability of the complex formed with the most efficient sensitizer 3,4,3-LI(1,2-HOPO), with a log β110 = 20.4 ± 0.2 value. In addition, the optical and solution thermodynamic features of these Am(III) complexes, combined with density functional theory calculations, were used to probe the influence of electronic structure on coordination properties across the f-element series and to gain insight into ligand field effects.

  10. Nano-cerium vanadate: a novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste.

    Science.gov (United States)

    Banerjee, Chayan; Dudwadkar, Nilesh; Tripathi, Subhash Chandra; Gandhi, Pritam Maniklal; Grover, Vinita; Kaushik, Chetan Prakash; Tyagi, Avesh Kumar

    2014-09-15

    Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides (233)U (4.82 MeV α) and (241)Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr(2+), Ru(3+), Fe(3+), etc., in the uptake process indicated CeVO4 nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  11. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  12. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  13. Recycle of scrap plutonium-238 oxide fuel to support future radioisotope applications

    International Nuclear Information System (INIS)

    The Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory has initiated a development program to recover ampersand purify plutonium-238 oxide from impure feed sources in a glove box environment. A glove box line has been designed and a chemistry flowsheet developed to perform this recovery task at large scale. The initial demonstration effort focused on purification of 238PuO2 fuel by HNO3/HF dissolution, followed by plutonium(III) oxalate precipitation and calcination to an oxide. Decontamination factors for most impurities of concern in the fuel were very good, producing 238PuO2 fuel significantly better in purity than specified by General Purpose Heat Source (GPHS) fuel powder specifications. A sufficient quantity of purified 238PuO2 fuel was recovered from the process to allow fabrication of a GPHS unit for testing. The results are encouraging for recycle of relatively impure plutonium-238 oxide and scrap residue items into fuel for useful applications. The high specific activity of plutonium-238 magnifies the consequences and concerns of radioactive waste generation. This work places an emphasis on development of waste minimization technologies to complement the aqueous processing operation. Results from experiments on neutralized solutions of plutonium-238 resulted in decontamination to about 1 millicurie/L. Combining ultrafiltration treatment with addition of a water-soluble polymer designed to coordinate Pu, allowed solutions to be decontaminated to about 1 microcurie/L. Efforts continue to develop a capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel. copyright 1998 American Institute of Physics

  14. Application of molten salt oxidation for the minimization and recovery of plutonium-238 contaminated wastes

    International Nuclear Information System (INIS)

    Molten salt oxidation (MSO) is proposed as a 238Pu waste treatment technology that should be developed for volume reduction and recovery of 238Pu and as an alternative to the transport and permanent disposal of 238Pu waste to the WIPP repository. In MSO technology, molten sodium carbonate salt at 800--900 C in a reaction vessel acts as a reaction media for wastes. The waste material is destroyed when injected into the molten salt, creating harmless carbon dioxide and steam and a small amount of ash in the spent salt. The spent salt can be treated using aqueous separation methods to reuse the salt and to recover 99.9% of the precious 238Pu that was in the waste. Tests of MSO technology have shown that the volume of combustible TRU waste can be reduced by a factor of at least twenty. Using this factor the present inventory of 574 TRU drums of 238Pu contaminated wastes is reduced to 30 drums. Further 238Pu waste costs of $22 million are avoided from not having to repackage 312 of the 574 drums to a drum total of more than 4,600 drums. MSO combined with aqueous processing of salts will recover approximately 1.7 kilograms of precious 238Pu valued at 4 million dollars (at $2,500/gram). Thus, installation and use of MSO technology at LANL will result in significant cost savings compared to present plans to transport and dispose 238Pu TRU waste to the WIPP site. Using a total net present value cost for the MSO project as $4.09 million over a five-year lifetime, the project can pay for itself after either recovery of 1.6 kg of Pu or through volume reduction of 818 drums or a combination of the two. These savings show a positive return on investment

  15. Analysis of transmission experiments for 238U in the unresolved resonance region

    International Nuclear Information System (INIS)

    From analysis of experimental data on transmission in the region of unresolved resonances, an evaluation of the mean resonance parameters for 238U is obtained. These parameters do not contradict the corresponding evaluations from the region of resolved resonances. On the basis of this evaluation, the group constants for 238U are determined, for the region of unresolved resonances. A comparison is made with data tables

  16. Experimental determination of the antineutrino spectrum of the fission products of {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Nils-Holger

    2013-10-09

    Fission of {sup 238}U contributes about 10 % to the antineutrino emission of a pressurized water reactor. In the present thesis, the beta spectrum of the fission products of {sup 238}U was determined in an experiment at the neutron source FRM II. This beta spectrum was subsequently converted into an antineutrino spectrum. This first measurement of the antineutrino spectrum supports all current and future reactor antineutrino experiments.

  17. Fractionation of 238U/235U by reduction during low temperature uranium mineralisation processes

    Science.gov (United States)

    Murphy, Melissa J.; Stirling, Claudine H.; Kaltenbach, Angela; Turner, Simon P.; Schaefer, Bruce F.

    2014-02-01

    Investigations of ‘stable’ uranium isotope fractionation during low temperature, redox transformations may provide new insights into the usefulness of the 238U/235U isotope system as a tracer of palaeoredox processes. Sandstone-hosted uranium deposits accumulate at an oxidation/reduction interface within an aquifer from the low temperature reduction of soluble U(VI) complexes in groundwaters, forming insoluble U(IV) minerals. This setting provides an ideal environment in which to investigate the effects of redox transformations on 238U/235U fractionation. Here we present the first coupled measurements of 238U/235U isotopic compositions and U concentrations for groundwaters and mineralised sediment samples from the same redox system in the vicinity of the high-grade Pepegoona sandstone-hosted uranium deposit, Australia. The mineralised sediment samples display extremely variable 238U/235U ratios (herein expressed as δUCRM145238, the per-mil deviation from the international NBL standard CRM145). The majority of mineralised sediment samples have δUCRM145238 values between -1.30±0.05 and 0.55±0.12‰, spanning a ca. 2‰ range. However, one sample has an unusually light isotopic composition of -4.13±0.05‰, which suggests a total range of U isotopic variability of up to ca. 5‰, the largest variation found thus far in a single natural redox system. The 238U/235U isotopic signature of the mineralised sediments becomes progressively heavier (enriched in 238U) along the groundwater flow path. The groundwaters show a greater than 2‰ variation in their 238U/235U ratios, ranging from δUCRM145238 values of -2.39±0.07 to -0.71±0.05‰. The majority of the groundwater data exhibit a clear systematic relationship between 238U/235U isotopic composition and U concentration; samples with the lowest U concentrations have the lowest 238U/235U ratios. The preferential incorporation of 238U during reduction of U(VI) to U(IV) and precipitation of uranium minerals leaves

  18. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  19. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level; Etude experimentale des biocinetiques de l`americium-241 chez le homard homarus gammarus. Analyse des mecanismes d`accumulation et de detoxication au niveau subcellulaire

    Energy Technology Data Exchange (ETDEWEB)

    Paquet, F.

    1991-12-01

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref.

  20. Nano-cerium vanadate: A novel inorganic ion exchanger for removal of americium and uranium from simulated aqueous nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Chayan; Dudwadkar, Nilesh [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tripathi, Subhash Chandra, E-mail: sctri001@gmail.com [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Gandhi, Pritam Maniklal [Fuel Reprocessing Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Grover, Vinita [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Kaushik, Chetan Prakash [Chemistry Division, Bhabha Atomic Research Centre, Mumbai 400085 (India); Tyagi, Avesh Kumar, E-mail: aktyagi@barc.gov.in [Waste Management Division, Bhabha Atomic Research Centre, Mumbai 400085 (India)

    2014-09-15

    Highlights: • Template free, low temperature synthesis of CeVO{sub 4} nanopowders. • Thermodynamically and kinetically favourable uptake of Am(III) and U(VI) exhibited. • K{sub d} and ΔG° values for Am(III) and U(VI) uptake in pH 1–6 are reported. • Interdiffusion coefficients and zeta potential values in pH 1–6 are reported. • Possible application in low level aqueous nuclear waste remediation. - Abstract: Cerium vanadate nanopowders were synthesized by a facile low temperature co-precipitation method. The product was characterized by X-ray diffraction and transmission electron microscopy and found to consist of ∼25 nm spherical nanoparticles. The efficiency of these nanopowders for uptake of alpha-emitting radionuclides {sup 233}U (4.82 MeV α) and {sup 241}Am (5.49 MeV α, 60 keV γ) has been investigated. Thermodynamically and kinetically favorable uptake of these radionuclides resulted in their complete removal within 3 h from aqueous acidic feed solutions. The uptake capacity was observed to increase with increase in pH as the zeta potential value decreased with the increase in pH but effect of ionic strength was insignificant. Little influence of the ions like Sr{sup 2+}, Ru{sup 3+}, Fe{sup 3+}, etc., in the uptake process indicated CeVO{sub 4} nanopowders to be amenable for practical applications. The isotherms indicated predominant uptake of the radioactive metal ions in the solid phase of the exchanger at lower feed concentrations and linear Kielland plots with positive slopes indicated favorable exchange of the metal ions with the nanopowder. Performance comparison with the other sorbents reported indicated excellent potential of nano-cerium vanadate for removing americium and uranium from large volumes of aqueous acidic solutions.

  1. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  2. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  3. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea.

    Science.gov (United States)

    Hunt, G J

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f1 values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Carastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 h samples of urine and faeces. Urine samples indicated f1 values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7 x 10(-4) with an arithmetic mean in the range (2-3) x 10(-4), and for americium up to 2.6 x 10(-4) with an arithmetic mean of 1.2 x 10(-4). Limited data based on volunteers eating cockles from the Solway suggest that f1 values for americium may be greater at distance from Sellafield. The measured values compare with 5 x 10(-4) used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f1 value in the region of 0.2, twice the value currently used by ICRP. For 137Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f1 = 1.0. Technetium-99 gave f1 values up to about 0.6, in reasonable conformity with the ICRP value of 0.5.

  4. Transfer across the human gut of environmental plutonium, americium, cobalt, caesium and technetium: studies with cockles (Cerastoderma edule) from the Irish Sea

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, G.J. [CEFAS Laboratory, Lowestoft, Suffolk NR33 0HT (United Kingdom)

    1998-06-01

    Our previous studies have indicated lower values of the gut transfer factor ('f{sub L} values') for plutonium and americium in winkles (Littorina littorea) than adopted by ICRP. The present study was undertaken primarily to investigate whether this observation extends to other species. Samples of cockles (Cerastoderma edule) from Ravenglass, Cumbria were eaten by volunteers who provided 24 samples of urine and faeces. Urine samples indicated f{sub L} values for cockles which were higher than for winkles; for plutonium these ranged overall up to 7x10{sup -4} with an arithmetic mean in the range (2-3)x10{sup -4}, and for americium up to 2.6x10{sup -4} with an arithmetic mean of 1.2x10{sup -4}. Limited data based on volunteers eating cockles from the Solway suggest that f{sub L} values for americium may be greater at distance from Sellafield. The measured values compare with 5x10{sup -4} used by the ICRP for environmental forms of both elements, which would appear to provide adequate protection when calculating doses from Cumbrian cockles. Data for other nuclides were obtained by analysing faecal samples from the volunteers who ate the Ravenglass cockles. Cobalt-60 showed an f{sub L} value in the region of 0.2, twice the value currently used by ICRP. For {sup 137}Cs, variabilities were indicated in the range 0.08 to 0.43, within the ICRP value of f{sub L}=1.0. Technetium-99 gave f{sub L} values up to about 0.6, in reasonable conformity with the ICRP value of 0.5. (author)

  5. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  6. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level; Etude experimentale des biocinetiques de l`americium-241 chez le homard homarus gammarus. Analyse des mecanismes d`accumulation et de detoxication au niveau subcellulaire

    Energy Technology Data Exchange (ETDEWEB)

    Paquet, F.

    1993-01-01

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of {sup 241} Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention.

  7. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  8. Summary of the work of the NEANDC task force on U-238

    International Nuclear Information System (INIS)

    The work of the Nuclear Energy Agency Nuclear Data Committee (NEANDC) Task Force on U-238 is summarised. The Task Force was set up in 1982 to consider two discrepancies in U-238 data - the neutron widths of the resolved resonance above 1.4 keV and the capture cross-section in the resolved and unresolved resonance regions. The work is summarised historically and to put the activities of the Task Force into context the paper starts with a brief description of the methods and data used to determine U-238 resonance parameters. It follows with a description of the state of the data in 1982 and then describes the work of the Task Force in the period up to 1985, the period during which the Task Force found the reasons for the discrepancies. Consideration is then given to the period following 1985 during which resonance analysis on U-238 has been performed and a recommended set of parameters covering the energy range 0-10 keV produced. These are listed in an appendix to the paper and are now included in the U-238 evaluations contained in JEF-2 and ENDF/B-VI. Finally a review is given of the main conclusions of the Task Force followed by a list of work still requiring to be done. (author). 15 figs., 10 tabs., 49 refs., 3 appendix

  9. (234)U/(238)U signatures associated with uranium ore bodies: part 3 Koongarra.

    Science.gov (United States)

    Lowson, Richard T

    2013-04-01

    The Koongarra ore body is an early Proterozoic U ore body in the Alligator Rivers U province, Northern Territory, Australia. It has surface expression with a redox front located ∼30 m below the surface. The (234)U/(238)U activity ratios (AR) for the ground water and the amorphous phase of the solid have been analysed for the ore zone and dispersion halo as a function of depth. The results display a (234)U/(238)U AR signature with depth which may be common to all U ore bodies. The (234)U/(238)U AR is depressed below secular equilibrium in the weathered material above the redox front; rises significantly above secular equilibrium in the vicinity of the redox front; and is followed by a gradual decrease with depth below the redox front. The amplitude of the profile is a function of local conditions. A model is proposed for the signature in which oxidising waters preferentially leach the (234)U sites at the redox front due to preconditioning of the (234)U sites by α recoil during the decay of (23)(8)U to (23)(4)U. Mass balance requires the solid material left behind the redox front to have a (234)U/(238)U AR reduced below 1. Local second order effects may be superimposed on the signature. The signature may have application to calibrating scenarios for nuclear waste repositories, assisting in understanding historical climates, economic evaluation of U ore bodies and U exploration. PMID:23142336

  10. U-238 - Th-230 - Ra-226 disequilibria in volcanics: A new insight into melting conditions

    Science.gov (United States)

    Chabaux, Francois; Allegre, Claude J.

    1994-08-01

    Using new mass spectrometry techniques developed for the analysis of Ra isotopes, we present U-238 - Th-230 - Ra-226 disequilibria data from a variety of volcanic settings, and compare them with previously published data. Two correlations are observed with alkali volcanic data, one between (Th-230/U-238) and (Th-230/Ra-226) and another between the intensity of the disequilibria and the buoyancy flux of the underlying plume. These two correlations prove that partial melting is the major cause of U-Th-Ra fractionations in this volcanic context. The U-238 - Th-230 - Ra-226 disequilibria then place new constraints on some parameters of the classical melting models (batch melting and dynamic melting). The comparison of U-238 - Th-230 - Ra-226 disequilibria in alkali volcanics, carbonatites and subduction zones shows a clear parallel between the disequilibria value and the type of volcanic context. Such a parallel reflects the diversity of the conditions of magma generation, and shows that the U-238 - Th-230 - Ra-226 disequilibria systematics are very dependent on the chemical composition of liquids produced during magmatic processes. A systematic difference is observed between disequilibria in MORB and in alkali volcanics, which could indicate that the melting processes in these two volcanic contexts are very different.

  11. Radiationless transition probabilities in muonic 208Pb, 232Th, and 238U

    International Nuclear Information System (INIS)

    The probabilities for non-radiative (n.r.) excitations Pn.r. in the muonic nuclides 208Pb, 232Th, and 238U have been determined for (μ-, γγ)-measurements by comparing the intensities of muonic X-ray transitions in single and coincidence spectra. The value of Pn.r. (3p→1s), measured for the first time, is about 90% for the actinides 232Th and 238U, but only about 8% for 208Pb. The value of Pn.r. (3d→1s) is found to be 10% for 233Th, 13% for 238U, and about 4% for 208Pb. For 208Pb a vanishing strength of the n.r. decay of the 2p-level is found, while for 232Th and for 238U n.r. strengths of about 20% and 26%, respectively, are observed. By regarding two subcomplexes of the 2p→1s transitions leading to different mean excitation energies the n.r. transition probabilities were found to be different for 238U only, 21.6% and 31.1%, respectively. (orig.)

  12. The interception and retention of 238Pu deposition by orange trees.

    Science.gov (United States)

    Pinder, J E; Adriano, D C; Ciravolo, T G; Doswell, A C; Yehling, D M

    1987-06-01

    Radioisotope thermoelectric generators (RTG) transform the heat produced during the alpha decay of 238Pu into electrical energy for use by deep-space probes, such as the Voyager spacecraft, which have returned images and other data from Jupiter, Saturn and Uranus. Future missions involving RTGs may be launched aboard the space shuttle, and there is a remote possibility that an explosion of liquid-hydrogen and liquid-oxygen fuel could rupture the RTGs and disperse 238Pu into the atmosphere over central Florida. Research was performed to determine the potential transport to man of atmospherically dispersed Pu via contaminated orange fruits. The results indicate that the major contamination of oranges would result from the interception and retention of 238Pu deposition by fruits. The resulting surface contamination could enter human food chains through transfer to internal tissues during peeling or in the reconstituted juices and flavorings made from orange skins. The interception of 238Pu deposition by fruits is especially important because the results indicate no measurable loss of Pu from fruit surfaces through time or with washing. Approximately 1% of the 238Pu deposited onto an orange grove would be harvested in the year following deposition.

  13. Application of a canine 238Pu biokinetics/dosimetry model to human bioassay data.

    Science.gov (United States)

    Hickman, A W; Griffith, W C; Roessler, G S; Guilmette, R A

    1995-03-01

    Associated with the use of 238Pu in thermoelectric power sources for space probes is the potential for human exposure, primarily by inhalation and most likely as 238PuO2. Several models have been developed for assessing the level of intake and predicting the resulting radiation dose following human exposure to 239Pu. However, there are indications that existing models do not adequately describe the disposition and dosimetry of 238Pu following human exposure. In this study, a canine model that accounts for these differences has been adapted for use with human excretion data. The model is based on existing knowledge about organ retention of plutonium. An analysis of the sensitivity of the model to changes in aerosol-associated properties indicated that predictions of urinary excretion are most sensitive to changes in particle solubility and diameter and in the ratio of fragment:particle surface area. Application of the model to urinary excretion data from seven workers exposed to a 238Pu ceramic aerosol gave estimated intakes of 390-8,200 Bq and associated initial pulmonary burdens of 80-1,700 Bq. The resulting 50-y dose commitments to critical organs per Bq of 238Pu intake were estimated to be 0.5 mSv for the thoracic region, 0.2 mSv for the liver, and 1 mSv for the bone surfaces. PMID:7860307

  14. Hematological responses after inhaling {sup 238}PuO{sub 2}: An extrapolation from beagle dogs to humans

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.; Muggenburg, B.A.; Welsh, C.A.; Angerstein, D.A.

    1994-11-01

    The alpha emitter plutonium-238 ({sup 238}Pu), which is produced in uranium-fueled, light-water reactors, is used as a thermoelectric power source for space applications. Inhalation of a mixed oxide form of Pu is the most likely mode of exposure of workers and the general public. Occupational exposures to {sup 238}PuO{sub 2} have occurred in association with the fabrication of radioisotope thermoelectric generators. Organs and tissue at risk for deterministic and stochastic effects of {sup 238}Pu-alpha irradiation include the lung, liver, skeleton, and lymphatic tissue. Little has been reported about the effects of inhaled {sup 238}PuO{sub 2} on peripheral blood cell counts in humans. The purpose of this study was to investigate hematological responses after a single inhalation exposure of Beagle dogs to alpha-emitting {sup 238}PuO{sub 2} particles and to extrapolate results to humans.

  15. Adsorption of Cs-137 and U-238 in semi-arid soils; Adsorcion de Cs-137 y U-238 en suelos semiaridos

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez T, U. O. [Instituto Tecnologico de Toluca, Av. Tecnologico s/n, 52140 Metepec, Estado de Mexico (Mexico); Monroy G, F.; Anguiano A, J. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Fernandez R, E., E-mail: uohtrejo@gmail.com [Universidad Politecnica del Valle de Toluca, Carretera Toluca-Almoloya de Juarez Km. 5.6, Santiaguito Tlalcilalcali, Estado de Mexico (Mexico)

    2013-10-15

    Is of great importance to determine the adsorption properties of the soils where radioactive wastes are stored, fundamentally of the radioisotopes contained in these wastes, with the purpose of knowing like will be their behavior in the event of happening radionuclide migration toward the surrounding means. Therefore, in this work the adsorption properties of {sup 137}Cs{sup +} and {sup 238}UO{sub 2}{sup 2+} in soils coming from the Storage Center of Radioactive Wastes are studied. Was studied the effect of the soil type and the particle size of the soil in the adsorption properties of Cs (I) and U (Vi). 13 soil samples and six different particle sizes were analyzed. The adsorption studies were carried out by the radiotracers technique in static way. The results indicate an important adsorption affinity toward the Cs-137 and a very vulnerable affinity for the {sup 238}UO{sub 2}{sup 2+}. (author)

  16. Fabrication of gamma sources using the neutron-gamma reactions of 238Pu13C

    International Nuclear Information System (INIS)

    A production campaign for 238Pu13C sources with gamma fluence ranging from 2500 to 4500 gamma/s/4π at 6.13 MeV was carried out in 2002 in Atalante. An experimental study was undertaken to prepare the 238PuC mixture, which is the most delicate step. This procedure is described together with the other steps in the source fabrication process: purification of a plutonium oxide batch, preparation of a nitric solution of 238Pu, measurement of the gamma fluence of the PuC mixture before and after insertion into each of the two stainless steel capsules that constitute a PuN2O package, welding of the second envelope followed by leak testing, final measurement of the gamma fluence of the sealed source. This PuC sources fabrication procedure is effective: all the sources include the required gamma activity with an uncertainty on the gamma fluence of less than 10%. (authors)

  17. Transmission Nuclear Resonance Fluorescence Measurements of 238U in Thick Targets

    Energy Technology Data Exchange (ETDEWEB)

    Quiter, Brian J.; Ludewigt, Bernhard A.; Mozin, Vladimir V.; Wilson, Cody; Korbly, Steve

    2010-08-31

    Transmission nuclear resonance fluorescence measurements were made on targets consisting of Pb and depleted U with total areal densities near 86 g/cm2. The 238U content n the targets varied from 0 to 8.5percent (atom fraction). The experiment demonstrates the capability of using transmission measurements as a non-destructive technique to identify and quantify the presence of an isotope in samples with thicknesses comparable to he average thickness of a nuclear fuel assembly. The experimental data also appear to demonstrate the process of notch refilling with a predictable intensity. Comparison of measured spectra to previous backscatter 238U measurements indicates general agreement in observed excited states. Two new 238U excited states and possibly a third state have also been observed.

  18. 238U, 226Ra and 210Pb in some vent waters of the Galapagos spreading center

    International Nuclear Information System (INIS)

    The concentrations of 226Ra, 238U and 210Pb have been measured in waters from the Mussel Bed and the Rose Garden thermal fields at the Galapagos spreading center over a temperature range of approx.2.5--16 0C. The 226Ra-T plots yield slopes of 0.112 and 0.036 dpm/kg 0C for the Mussel Bed and the Rose Garden respectively yielding a global hydrothermal 226Ra flux less than 5% of that required to sustain the oceanic inventory. 238U concentration in waters 0C is the same as that in ambient sea water whereas water hotter than approx.9 0C shows a decreasing trend with temperature to zero 238U at approx.29 0C. 210Pb concentration in Mussel Bed increases with temperature, and extrapolated to approx.350 0C yields a 210Pb concentration considerably less than that expected from 222Rn decay and basalt alteration

  19. 238PuO2 Fuel and Dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Mayo, Douglas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rawool-Sullivan, Mohini [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garner, Scott Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wenz, Tracy R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-01

    238Pu is an ideal material for use as a heat source with its half-life of 87.7 years and copious particle emissions. 238Pu radioisotope thermoelectric generators (RTGs) have found use for pacemakers, Apollo Space missions, Mars rovers, and Voyager spacecraft. In evaluating the dose to personnel and components near a 238Pu-based RTG, a number of additional nuclides and their daughter products must be considered to get an accurate estimate for γ-dose, and the amount of 17O and 18O for the neutron-dose must be considered. This paper looks at the contributing nuclides and their daughter products that add the most to the dose rates.

  20. 238PuO2 Fuel and Dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Mayo, Douglas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rawool-Sullivan, Mohini [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garner, Scott Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wenz, Tracy R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-01

    238Pu is an ideal material for use as a heat source with its half-life of 87.7 years and copius -particle emissions. 238Pu radioisotope thermoelectric generators (RTGs) have found use for pacemakers, Apollo Space missions, Mars rovers, and Voyager spacecraft. In evaluating the dose to personnel and components near a 238Pu-based RTG, a number of additional nuclides and their daughter products must be considered to get an accurate estimate for γ -dose and the amount of 17O and 18O for the neutron-dose must be considered. This paper looks at the contributing nuclides and their daughter products that add the most to the dose rates.

  1. Plutonium-238: an ideal power source for intracorporeal ventricular assist devices?

    Science.gov (United States)

    Tchantchaleishvili, Vakhtang; Bush, Bryan S; Swartz, Michael F; Day, Steven W; Massey, H Todd

    2012-01-01

    Ventricular assist devices emerged as a widely used modality for treatment of end-stage heart failure; however, despite significant advances, external energy supply remains a problem contributing to significant patient morbidity and potential mortality. One potential solution is using the nuclear radioisotope Plutonium-238 as a power source. Given its very high energy density and long half-life, Plutonium-238 could eventually allow a totally intracorporeal ventricular assist system that lasts for the patient's lifetime. Risks, such as leakage and theft identified decades ago, still remain. However, it is possible that newer technologies could be used to overcome the system complexity and unreliability of the previous generations of nuclear-powered mechanical assist systems. Were it not for the remaining safety risks, Plutonium-238 would be an ideal energy source for this purpose.

  2. Standard test method for 238Pu isotopic abundance by alpha spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This test method covers the use of alpha spectrometry for determining the 238Pu isotopic abundance in plutonium samples. It is particularly useful for samples in which the 238Pu content is less than 1 % of the total plutonium content. For such samples, mass spectrometric results are less reliable than those from alpha spectrometry because of interference from any 238U isobar remaining after ion exchange. 1.2 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  3. Application of a canine {sup 238}Pu dosimetry model to human bioassay data

    Energy Technology Data Exchange (ETDEWEB)

    Hickman, A.W. Jr. [Florida Univ., Gainesville, FL (United States)

    1991-08-01

    Associated with the use of 2{sup 238}Pu in thermoelectric power sources for space probes and power supplies for cardiac devices is the potential for human exposure to {sup 238}Pu, primarily by inhalation. In the event of human internal exposure, a means is needed for assessing the level of intake and calculating radiation doses. Several bioassay/dosimetry models have been developed for {sup 239}Pu. However, results from studies with laboratory animals have indicated that the biokinetics, and therefore the descriptive models, of {sup 238}Pu are significantly different from those for {sup 239}Pu. A canine model accounting for these differences has been applied in this work to urinary excretion data from seven humans occupationally exposed to low levels of an insoluble {sup 238}Pu compound. The modified model provides a good description of the urinary excretion kinetics observed in the exposed humans. The modified model was also used to provide estimates of the initial intakes of {sup 238}Pu for the seven individuals; these estimates ranged from 4.5 nCi (170 Bq) to 87 nCi (3200 Bq). Autopsy data on the amount and distribution of {sup 238}Pu retained in the organs may be used in the future to validate or refute both these estimates and the assumptions used to formulate the human model. Modification of the human model to simulate an injection exposure to {sup 239}Pu gave patterns of retention in the organs and urinary excretion comparable to those seen previously in humans; further modification of the model using fecal data (unavailable for the subjects of this study) is indicated.

  4. Development of an Efficient Approach to Perform Neutronics Simulations for Plutonium-238 Production

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, David [ORNL; Ellis, Ronald James [ORNL

    2016-01-01

    Conversion of 238Pu decay heat into usable electricity is imperative to power National Aeronautics and Space Administration (NASA) deep space exploration missions; however, the current stockpile of 238Pu is diminishing and the quality is less than ideal. In response, the US Department of Energy and NASA have undertaken a program to reestablish a domestic 238Pu production program and a technology demonstration sub-project has been initiated. Neutronics simulations for 238Pu production play a vital role in this project because the results guide reactor safety-basis, target design and optimization, and post-irradiation examination activities. A new, efficient neutronics simulation tool written in Python was developed to evaluate, with the highest fidelity possible with approved tools, the time-dependent nuclide evolution and heat deposition rates in 238Pu production targets irradiated in the High Flux Isotope Reactor (HFIR). The Python Activation and Heat Deposition Script (PAHDS) was developed specifically for experiment analysis in HFIR and couples the MCNP5 and SCALE 6.1.3 software quality assured tools to take advantage of an existing high-fidelity MCNP HFIR model, the most up-to-date ORIGEN code, and the most up-to-date nuclear data. Three cycle simulations were performed with PAHDS implementing ENDF/B-VII.0, ENDF/B-VII.1, and the Hybrid Library GPD-Rev0 cross-section libraries. The 238Pu production results were benchmarked against VESTA-obtained results and the impact of various cross-section libraries on the calculated metrics were assessed.

  5. The AS-76 interlaboratory experiment on the alpha spectrometric determination of Pu-238. Pt. 3

    International Nuclear Information System (INIS)

    Four plutonium samples containing 0.2, 0.8, 1.6 and 0.9 Atom% of 238Pu have been prepared for the Interlaboratory Experiment AS-76. Of these, three were input solutions from a reprocessing plant. The fourth sample was from a plutonium product solution. These samples have been characterized by two alpha spectrometry laboratories and two mass spectrometry laboratories to certify the ratio of alpha activities 238Pu/(239Pu + 240Pu) and the isotopic composition, respectively. (orig.) 891 HP/orig. 892 MKO

  6. An isotopic analysis system for plutonium samples enriched in 238Pu

    International Nuclear Information System (INIS)

    We have designed and built a gamma-ray spectrometer system that measures the relative plutonium isotopic abundances of plutonium oxide enriched in 238Pu. The first system installed at Westinghouse Savannah River Company was tested and evaluated on plutonium oxide in stainless steel EP60/61 containers. 238Pu enrichments ranged from 20% to 85%. Results show that 200 grams of plutonium oxide in an EP60.61 container can be measured with ±0.3% precision and better than ±1.0% accuracy in the specific power using a counting time of 50 minutes. 3 refs., 2 figs

  7. Preparation of a 238Pu standard source . II. Source preparation and standardization

    Science.gov (United States)

    Nobuo, Shinohara; Nobuaki, Kohno

    1988-07-01

    A standard source of 238Pu was prepared for calibrating the counting efficiency of alpha-ray detector. The plutonium was electrodeposited on a platinum or tantalum disk using isopropyl alcohol-hydrochloric acid solution as an electrolyte. The absolute activity was certified by isotope dilution alpha-ray spectrometry. Several types of the source, whose areas 238Pu-deposited are from 2.0 to 25.0 mm in diameter, were also prepared by the method. The overall uncertainties of the certified values for the standard sources prepared are estimated to be within 0.15 to 0.25% (1σ).

  8. Gastrointestinal absorption and retention of plutonium-238 and uranium-233 in neonatal swine

    International Nuclear Information System (INIS)

    Newborn swine absorbed as much as one-half of a gavaged dose of 238Pu nitrate within 6 to 12 hr, and another one-fourth of the dose was retained in the stomach for up to 24 hr after intragastric administration. The small intestine accumulated one-third of the dose within 36 hr. Animals gavaged between 5 and 21 days of age absorbed decreasing amounts, especially at 14 and 21 days. Absorption of 233Pu (gavaged as the nitrate) by day-old pigs was similar to that of 238Pu

  9. Absorption and retention of plutonium-238 nitrate and oxide in neonatal swine after inhalation

    International Nuclear Information System (INIS)

    Measurements of retention of plutonium in swine exposed to either 238Pu nitrate or oxide at 1 day of age and killed at 1 hr postexposure indicated that 38% and 52%, respectively, of the administered dose was initially deposited in the lung. Less than one-half that amount remained in the lung after 1 or 2 wk. At 7 days, most of the 238Pu inhaled as the nitrate was retained in the gut. Retention of the oxide in gut at 7 days was about 10% of the inhaled dose

  10. Measurement of resonance self-shielding factors of neutron capture cross section by 238U

    International Nuclear Information System (INIS)

    Resonance self-shielding factors fsub(c) of neutron capture cross section by 238U in the 20-100 keV energy range are measured. The method for determining the fsub(c) factor consists in measuring partial transmission and transmission in the total cross section at different 238U filter thickness. The fsub(c) factor values in the 46.5-100 and 21.5-46.5 keV energy ranges are equal to 0.89+-0.03 and 0.81+-0.04, respectively

  11. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4. (author)

  12. Conceptual designs for a long term 238PuO2 storage vessel

    International Nuclear Information System (INIS)

    This is a report on conceptual designs for a long term, 250 years, storage container for plutonium oxide ([sup 238]PuO[sub 2]). These conceptual designs are based on the use of a quartz filter to release the helium generated during the plutonium decay. In this report a review of filter material selection, design concepts, thermal modeling, and filter performance are discussed

  13. Biokinetics aand dosimetry of inhaled 238PuO2 in the beagle dog: An update

    International Nuclear Information System (INIS)

    The temporal and spatial distributions of 238Pu have been measured during the course of a dose-response study of the biological effects of inhaled 238PuO2 in Beagle dogs. These measurements were done on the dose-response study animals, as well as a separate group of dogs exposed to similar aerosols and killed serially out to 4 y after exposure. The data from this latter group provided the basis for the development of a biokinetic/dosimetric model for 238PuO2 in dogs. Since the publication of this model, several important findings have been made that affected the dosimetric evaluations. The first involved the discovery of significant quantities of natural uranium (U) in the feces samples. The U was measured with the plutonium (Pu), which inflated the values for purported Pu in feces. The second finding involved the addition of Pu biokinetics data from the dose-response dogs, which increased the period of observation from 4 y to 15 y; these later data were not consistent with the earlier model predictions. The purpose of this investigation was (1) to remove the analytical bias in the 238Pu radiochemical data due to the U and (2) to modify the original model of Mewhinney and Diel, taking into account all data from both studies

  14. Spatial distribution of U-238, Ra-226 and Pb-210 at Urgeirica uranium mill tailings

    International Nuclear Information System (INIS)

    The extensive exploitation and treatment of the uranium ore in the Urgeirica mine, Portugal, where exists a chemical treatment plant, led to an accumulation of large amounts of solid wastes (tailings) deposited in piles or dams. The objective of this work is to investigate the extent of the contamination at the oldest dams (more than 40 years old) taking into account the U-238, Ra-226 and Pb-210 distribution at those dams. Tailings core and surface samples were randomly collected at the dams. Tailings samples were dried and the activity in U-238 (through the peaks of Th-234), Ra-226 (through the progenies Pb-214 and Bi-214) and Pb-210 were determined by gamma spectrometry. The results show a big variability (by a factor of 5 to 10) if the U-238, Ra-226 and Pb-210 concentrations at the surface tailings, which indicates a heterogeneity of the radionuclides distribution at the dams area. A good correlation between Ra-226 and U-238 concentrations at the sampling site (dam D2) that presents lower Ra-226 concentrations was obtained. As expected, the most important contribution to the high natural radioactivity at the oldest dams is due to the radium rejected as a waste product from the uranium ore treatment (author)

  15. Metals for the containment of nitric acid solutions of plutonium-238

    International Nuclear Information System (INIS)

    Results of a study of the corrosion of various transition-metal alloys, tantalum, and tantalum/2.5% tungsten are reported. The solvent contained nitric acid, hydrofluoric acid, and ammonium hexanitratocerate. It was designed to imitate the corrosiveness of the nitric acid, hydrofluoric acid mixture used to dissolve 238-plutonium dioxide. (author)

  16. Photo fission cross-section of 232Th, 238U and 237Np

    International Nuclear Information System (INIS)

    In the present work, photo fission cross-section of 232Th, 238U and 237Np evaluated with the help of fission fragment angular distribution measurements by using Bremsstrahlung radiation from 7.4 MeV to 9.0 MeV have been carried out by employing high efficiency SSNTD technique

  17. 48 CFR 552.238-76 - Definition (Federal Supply Schedules)-Recovery Purchasing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Definition (Federal Supply... SERVICES ADMINISTRATION CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 552.238-76 Definition (Federal Supply Schedules)—Recovery Purchasing. As prescribed in...

  18. Gastrointestinal absorption and retention of plutonium-238 in neonatal rats and swine

    International Nuclear Information System (INIS)

    Neonatal rats gavaged with 237Pu or 238Pu retained a substantial quantity in gut mucosa for a week but absorbed only 2.9% of the 237Pu. After 140 days the amount retained fell to half that initially deposited. Newborn swine also retained large amounts in the gut and absorbed about 40% of the dose

  19. 238U spontaneous fission half-life and a new probable radioactivity mode

    International Nuclear Information System (INIS)

    The 238U spontaneous fission half-life is reinvestigated using a special nuclear emulsion technique previously developed in our laboratory. A perfect visualisation of the fission fragments tracks in the absence of alpha particle tracks was obtained with the present method that also avoids the fading of the latent image. Under these conditions, two well defined peaks are observed experimentaly: one corresponding to the well-known range (approx 24 μm) of the 238U fission fragments tracks and the other showing evidence of short range tracks (approx 10 μm). For the 238U spontaneous fission half-life our result is (6.0+-0.4) x1015 y, in good agreement with the values obtained by some other workers using different experimental methods. A systematic theoretical analysis shows that the 238U spontaneous emission of nuclides with mass number between approx 20 e 70 is possible. The Kinetic energies calculated for these nuclides are found to fit the short range tracks observed in our experiment. From the experimental data, we attribute a (2 +- 1) x 1015 y half-life for all modes of emission involved in this process. (Author)

  20. 49 CFR 238.209 - Forward end structure of locomotives, including cab cars and MU locomotives.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Forward end structure of locomotives, including... SAFETY STANDARDS Specific Requirements for Tier I Passenger Equipment § 238.209 Forward end structure of locomotives, including cab cars and MU locomotives. (a)(1) The skin covering the forward-facing end of...

  1. Energy dependence of 238U fission yields investigated in inverse kinematics

    Directory of Open Access Journals (Sweden)

    Veselsky M.

    2010-03-01

    Full Text Available The production cross sections of neutron-rich fission residues produced in reactions induced by a 238U beam impinging onto Pb and Be targets were investigated at the Fragment Separator (FRS at GSI using the inverse kinematic technique. These data allowed us to discuss the optimum energies in fission for producing the most neutron-rich residues.

  2. Radiochemical measurement of mass distribution in 16O+238U reaction at sub-barrier energy

    International Nuclear Information System (INIS)

    In the present, radiochemical study of the mass distribution in 16O+238U has been carried out at sub-barrier energy to investigate the nature of mass distribution in CFF and TF channels. In addition, cross sections of evaporation residues formed in one nucleon transfer/pick-up reactions have also been measured

  3. Study of fusion-fission dynamics in 19F+238U reaction

    Directory of Open Access Journals (Sweden)

    Dubey R.

    2016-01-01

    Full Text Available Mass angle distribution measurements for 19F+238U reaction were carried out around the sub barrier energies. Mass angle correlation has not been observed at above and below the fusion barrier in present reaction. This infer the minimal presence of non compound like events at these bombarding energies range.

  4. /sup 238/Pu fuel form processes quarterly report, April-June 1980

    Energy Technology Data Exchange (ETDEWEB)

    Folger, R. L.

    1980-06-01

    Savannah River Laboratory (SRL) completed the development of a production process to fabricate /sup 238/PuO/sub 2/ fuel forms for the GPHS. The fabrication flowsheet was based on a flowsheet originally developed at Los Alamos National Scientific Laboratory (LANSL). A summary report of the SRL process development effort is presented.

  5. Determination of 235U/238U Ratio on Urine by ICP-MS

    International Nuclear Information System (INIS)

    LLNL Internal Dosimetry Program - The new procedure satisfies the requirement to determine 235U/238U ratio in bioassay urine samples. MDA - The LC and MDA95 for 235U are well below the required detection limit of 0.00035 μg/L. Turn around time - Analysis of 10 samples plus 2 QCs can be completed in one work day (8 hours).

  6. 49 CFR Appendix A to Part 238 - Schedule of Civil Penalties 1

    Science.gov (United States)

    2010-10-01

    ...) Improper grounding or insulation 5,000 7,500 (e)(11) Jumpers or cable connections not in proper condition 2... AND GENERAL REQUIREMENTS 238.103Fire protection plan/fire safety: (a) Failure to use proper materials... for any violation where circumstances warrant. See 49 CFR part 209, appendix A. Failure to observe...

  7. 42 CFR 456.238 - Time limits for final decision and notification of adverse decision.

    Science.gov (United States)

    2010-10-01

    ... Utilization Control: Mental Hospitals Ur Plan: Review of Need for Continued Stay § 456.238 Time limits for....237 within 2 working days after the date of the final decision. UR Plan: Medical Care Evaluation... 42 Public Health 4 2010-10-01 2010-10-01 false Time limits for final decision and notification...

  8. Magmatic Processes at Loihi Seamount Inferred From 226Ra-230Th-234U-238U Disequilibria

    Science.gov (United States)

    Pietruszka, A. J.; Hauri, E. H.; Garcia, M. O.

    2001-12-01

    We have conducted a detailed study of the U-series isotope geochemistry of young tholeiitic, transitional and alkalic Loihi basalts to examine the melt generation process during the preshield stage of a Hawaiian volcano. A previous study (Sims et al. 1999; GCA, v. 63) of two dredged lavas from the deep flanks of Loihi found a higher (230Th/238U) activity ratio in an alkalic basalt (1.07) compared to a tholeiitic basalt (1.04). This difference suggests that the tholeiitic basalt may have formed at a higher rate of mantle upwelling than the alkalic basalt. Our samples were collected from surface lava flows at Loihi's summit and along the volcano's south rift zone by submersible. Analyses were preformed using high-precision plasma ionization mass spectrometry. The samples display a relatively large range in the amount of excess 226Ra (0-13%) that extends to much lower values than observed at Kilauea Volcano (11-12%). The low (226Ra/230Th) ratios of Loihi lavas probably result from post-eruptive decay of 226Ra and imply eruption ages of 0-12 kyr. All of the Loihi samples (including the 1996 lava) have small amounts of excess 234U (0.2-0.8%). The most likely source for (234U/238U)>1 at Loihi is seawater, which has (234U/238U)=1.14. Since all of the samples were fresh, hand-picked glasses, these elevated (234U/238U) ratios may have resulted from the assimilation of a seawater-derived component within Loihi's magmatic plumbing system rather than post-eruptive U addition. The range of (230Th/238U) that we measured is 1.01-1.07, which is larger than the previous range known for Loihi. Mass balance calculations using the measured (234U/238U) ratios suggest that 1-6% of the U in the samples that we analyzed is ultimately derived from seawater. Correcting the 230Th-238U disequilibria of the Loihi lavas for this seawater-derived U results in a narrower range in the amount of excess 230Th (6-9%) with no significant differences between tholeiitic, transitional or alkalic basalts

  9. A phthalate family oxygenase reductase supports terpene alcohol oxidation by CYP238A1 from Pseudomonas putida KT2440.

    Science.gov (United States)

    Bell, Stephen Graham; French, Laura; Rees, Nicholas Huw; Cheng, Sophia Shuyi; Preston, Gail; Wong, Luet-Lok

    2013-01-01

    CYP238A1, one of the two P450 enzymes in the genome of Pseudomonas putida KT2440, has been produced heterologously in Escherichia coli, purified, and found to bind acyclic and cyclic terpene alcohols such as farnesol, nerolidol, linalool, and terpineol. The other P450 enzyme in this organism (gene locus: PP1950) was also produced in E. coli but no substrate has been identified from a limited screen. A phthalate family oxygenase reductase (PFOR) encoded by the PP1957 gene, just downstream of the PP1955 gene for CYP238A1, accepts electrons from the reduced form of both nicotinamide adenine dinucleotide (NADH) and nicotinamide adenine dinucleotide phosphate and is able to support monooxygenase activity of CYP238A1, both in vitro and in E. coli, in which both enzymes are produced. CYP238A1 oxidizes cis- and trans-nerolidol to the 9-hydroxy product, with no evidence of attack at the olefinic double bonds. The NADH turnover rate of 170 nmol(nmol-P450)⁻¹ Min⁻¹ for CYP238A1 with cis-nerolidol as substrate at a PP1957:CYP238A1 concentration ratio of 8:1 suggests that this PFOR could function as the physiological redox partner for CYP238A1. The physiological role of CYP238A1 may be related to the PP1955 gene being part of an island/cluster of inducible genes associated with energy metabolism and response to xenobiotics. PMID:23586988

  10. Large scale production of Pu-238 to 'denature' weapons-grade plutonium. Rev. 0

    International Nuclear Information System (INIS)

    The concept of open-quote denaturing close-quote weapons-grade or reactor-grade plutonium through the addition of Pu-238 has been proposed recently by Dr. Mel Coops of Lawrence Livermore National Laboratory. He indicates that on the order of 2-3 wt.% plutonium-238 (Pu-238) may be sufficient to render the plutonium impractical for weapons use due to excessive heat generation. This would significantly reduce or eliminate proliferation concerns for use of plutonium in commercial nuclear fuels. This report presents a high-level assessment of the potential for producing large quantities of Pu-238 for the purpose of open-quote denaturing close-quote the weapons-grade or reactor-grade plutonium that may be used in commercial reactors as mixed-oxide (MOX) fuels. Pu-238 production can be done by two methods. The traditional method employed in the U.S. was to irradiate targets of neptunium-237 (Np-237), this isotope being produced from neutron capture in U-236. Recycling enriched uranium fuels in the defense production reactor fuel cycle increased the U-236 content, increasing the subsequent yield of Np-237. Production by this method thus involves significant reactor irradiation time, and reprocessing of fuel to recover uranium and Np-237 for fabrication into new fuel and targets, respectively. The second method would be to irradiate targets of Am-241, recovered as a decay product from aged plutonium. This method again would require processing of plutonium or spent fuel to recover Am-241. Either method would require processing of targets after irradiation, and a facility for fabricating targets and processing the plutonium to a final pure oxide form

  11. Experimental study of 238U Doppler reactivity worth in FCA XVI-1 and XVI-2 cores

    International Nuclear Information System (INIS)

    Doppler reactivity worths of natural uranium samples were measured in metallic fueled cores, FCA XVI-1 and XVI-2, using a sample heating technique. In a metallic fueled LMFBR, the neutron spectrum is generally harder than a similar size oxide fueled LMFBR owing to the luck of oxygen. The accuracy of Doppler effect calculation for a harder neutron spectrum was evaluated by comparing C/E values of Doppler reactivity worth in oxide fueled cores and in metallic fueled cores using FCA experiments. It was found that calculation using 70-group constant set JFS-3-J2 underestimates 238U Doppler reactivity worth in metallic fueled cores. An inadequate treatment of resonance parameters of 238U above 50 keV in JENDL-2 is one of the reasons for this underestimation. In JENDL-2 the resonance parameters of 238U above 50 keV are not included, and hence JFS-3-J2 which is processed from JENDL-2 does not have a self-shielding factor table above 40.9 keV of 238U. When the contribution of this energy region for Doppler reactivity worth was corrected using ENDF/B-VI, which includes resonance parameters of 238U up to 149 keV, the JFS-3-J2 based calculation gave 13% higher values for metallic sample experiments and 8% for oxide samples. Even after this correction, the calculation still gave smaller Doppler reactivity worths than the measurements, and the ratios of calculated value to experimental one vary widely from 0.6 to 1.0. (author)

  12. Studying nuclear level densities of {sup 238}U in the nuclear reactions within the macroscopic nuclear models

    Energy Technology Data Exchange (ETDEWEB)

    Razavi, Rohallah; Aghajani, Maghsood; Khooy, Asghar [Imam Hossein Comprehensive Univ., Tehran (Iran, Islamic Republic of). Dept. of Physics; Rahmatinejad, Azam; Taheri, Fariba [Univ. of Zanjan (Iran, Islamic Republic of). Dept. of Physics; Kakavand, Tayeb [Imam Khomeini International Univ., Qazvin (Iran, Islamic Republic of). Dept. of Physics

    2016-05-01

    In this work the nuclear level density parameters of {sup 238}U have been extracted in the back-shifted Fermi gas model (BSFGM), as well as the constant temperature model (CTM), through fitting with the recent experimental data on nuclear level densities measured by the Oslo group. The excitation functions for {sup 238}U(p,2nα){sup 233}Pa, and {sup 238}U(p,4n){sup 235}Np reactions and the fragment yields for the fragments of the {sup 238}U(p,f) reaction have been calculated using obtained level density parameters. The results are compared to their corresponding experimental values. It was found that the extracted excitation functions and the fragment yields in the CTM coincide well with the experimental values in the low-energy region. This finding is according to the claim made by the Oslo group that the extracted level densities of {sup 238}U show a constant temperature behaviour.

  13. 质子与裂变核238U反应的理论计算%Theoretical Calculations for p+238U Reactions

    Institute of Scientific and Technical Information of China (English)

    于洪伟; 蔡崇海; 赵志祥

    2005-01-01

    利用球型光学模型、耦合道理论、核内级联、激子模型、蒸发模型、带宽度涨落修正的Hauser-Feshbach模型,Bohr-Wheeler裂变理论,对入射能量从阈能到200MeV的p+238U各种反应进行了计算,计算结果和实验符合较好.

  14. Inhaled americium dioxide

    International Nuclear Information System (INIS)

    This project includes experiments to determine the effects of Zn-DTPA therapy on the retention, translocation and biological effects of inhaled 241AmO2. Beagle dogs that received inhalation exposure to 241AmO2 developed leukopenia, clincial chemistry changes associated with hepatocellular damage, and were euthanized due to respiratory insufficiency caused by radiation pneumonitis 120 to 131 days after pulmonary deposition of 22 to 65 μCi 241Am. Another group of dogs that received inhalation exposure to 241AmO2 and were treated daily with Zn-DTPA had initial pulmonary deposition of 19 to 26 μCi 241Am. These dogs did not develop respiratory insufficiency, and hematologic and clinical chemistry changes were less severe than in the non-DTPA-treated dogs

  15. 238U, and its decay products, in grasses from an abandoned uranium mine

    Science.gov (United States)

    Childs, Edgar; Maskall, John; Millward, Geoffrey

    2016-04-01

    Bioaccumulation of radioactive contaminants by plants is of concern particularly where the sward is an essential part of the diet of ruminants. The abandoned South Terras uranium mine, south west England, had primary deposits of uraninite (UO2) and pitchblende (U3O8), which contained up to 30% uranium. When the mine was active uranium and radium were extracted but following closure it was abandoned without remediation. Waste rock and gangue, consisting of inefficiently processed minerals, were spread around the site, including a field where ruminants are grazed. Here we report the activity concentrations of 238U, 235U 214,210Pb, and the concentrations of selected metals in the soils, roots and leaves of grasses taken from the contaminated field. Soil samples were collected at the surface, and at 30 cm depth, using an auger along a 10-point transect in the field from the foot of a waste heap. Whole, individual grass plants were removed with a spade, ensuring that their roots were intact. The soils and roots and grass leaves were freeze-dried. Activity concentrations of the radionuclides were determined by gamma spectroscopy, following 30 days incubation for development of secular equilibrium. Dried soils, roots and grasses were also digested in aqua regia and the concentrations of elements determined by ICP techniques. Maximum activity concentrations of 238U, 235U, 214Pb and 210Pb surface soils were 63,300, 4,510, 23,300 and 49,400 Bq kg‑1, respectively. The mean 238U:235U ratio was 11.8 ± 1.8, an order of magnitude lower than the natural value of 138, indicating disequilibrium within the decay chain due to mineral processing. Radionuclides in the roots had 5 times lower concentration and only grass leaves in the vicinity of the waste heap had measureable values. The mean soil to root transfer factor for 238U was 36%, the mean root to leaf was 3% and overall only 0.7% of 238U was transferred from the soil to the leaves. The roots contained 0.8% iron, possibly as

  16. Recovery of Americium-241 from lightning rod by the method of chemical treatment; Recuperacion del Americio-241 provenientes de los pararrayos por el metodo de tratamiento quimico

    Energy Technology Data Exchange (ETDEWEB)

    Cruz, W.H., E-mail: wcruz@ipen.gob.pe [Instituto Peruano de Energia Nuclear (GRRA/IPEN), Lima (Peru). Division de Gestion de Residuos Radiactivos

    2013-07-01

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 ({sup 241}Am), fewer and Radium 226 ({sup 226}Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of {sup 241}Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The {sup 241}Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel {sup 241}Am technique was used electrodeposition. (author)

  17. Partitioning studies in China and the separation of americium and fission product rare earths with dialkyl phosphinic acid and its thio-substituted derivatives

    International Nuclear Information System (INIS)

    Studies on the TRPO extractions process for recovering actinides from highly active waste (HAW) and its application to the pretreatment of Chinese HAW are described. The removal of Sr by di-cyclohexyl 18 crown 6 and the removal of Cs by spherical titanium ferrous hexa-cyanate from acidic waste are also described. Results of the extraction of trivalent americium and fission product rare earths (FPREs) by dialkyl-phosphinic, dialkyl-mono-thio-phosphinic and dialkyl-di-thio-phosphinic acids are reported. Dialkyl-thio-phosphinic acid (commercial product Cyanex 301, alkyl =2, 4, 4-methyl-pentyl) shows very high selectivity towards Am. Using 1M Cyanex 301 -kerosene as extractant, 99.9 % Am can be separated from 0.5M(Pr+Nd)(NO3)3 solution with 3-4 extraction stages and 3-4 scrubbing stages. (authors)

  18. Theoretical and experimental study of the bio-geochemical behaviour of americium 241 in simplified rhizosphere conditions. Application to a calcareous agricultural soil

    International Nuclear Information System (INIS)

    Americium 241, is one of the most radio-toxic contaminant produced during the nuclear fuel cycle. It can be found in all environmental compartments, in particular the soils. The main goals of this study are to identify, quantify and model the effect of the main factors controlling the mobility of 241Am in the rhizosphere and the agricultural soils. The physico-chemical parameters of the soil and of the soil solution, the potential role of microorganisms on the sorption-desorption processes, and the speciation of americium in solution have been more particularly studied. 241Am remobilization has been studied at the laboratory using leaching experiments performed in controlled conditions on reworked calcareous soils artificially contaminated with 241Am. The soil samples have been washed out in different hydrodynamic conditions by solutions with various compositions. The eluted solution has been analyzed (pH, conductivity, ionic composition, Fetot, organic acids, 241Am) and its bacterial biomass content too. The overall results indicate that 241Am remobilization is contrasted and strongly linked with the condition under study (pH, ionic strength, glucose and/or citrate concentration). Therefore, a solution in equilibrium with the soil or containing small exudate concentrations (10-4 M) re-mobilizes only a very small part of the americium fixed on the solid phase. The desorption of 241Am corresponds to a solid/liquid coefficient of partition (Kd) of about 105 L.kg-1. A significant addition of glucose induces an important dissolution of soil carbonates by the indirect action of microorganisms, but does not significantly favor the 241Am remobilization. On the other hand, the presence of strong citrate concentrations (≥ 10-2 M) allows 300 to 10000 time greater re-mobilizations by the complexing of 241Am released after the dissolution of the carrying phases. Finally, the colloidal transport of 241Am has been systematically observed in a limited but significant extend and

  19. Solubility of 238U radionuclide from various types of soil in synthetic gastrointestinal fluids using "US in vitro" digestion method

    Science.gov (United States)

    Rashid, Nur Shahidah Abdul; Sarmani, Sukiman; Majid, Amran Ab.; Mohamed, Faizal; Siong, Khoo Kok

    2015-04-01

    238U radionuclide is a naturally occuring radioactive material that can be found in soil. In this study, the solubility of 238U radionuclide obtained from various types of soil in synthetic gastrointestinal fluids was analysed by "US P in vitro" digestion method. The synthetic gastrointestinal fluids were added to the samples with well-ordered, mixed throughly and incubated according to the human physiology digestive system. The concentration of 238U radionuclide in the solutions extracted from the soil was measured using Induced Coupling Plasma Mass Spectrometer (ICP-MS). The concentration of 238U radionuclide from the soil samples in synthetic gastrointestinal fluids showed different values due to different homogenity of soil types and chemical reaction of 238U radionuclide. In general, the solubility of 238U radionuclide in gastric fluid was higher (0.050 - 0.209 ppm) than gastrointestinal fluids (0.024 - 0.050 ppm). It could be concluded that the US P in vitro digestion method is practicle for estimating the solubility of 238U radionuclide from soil materials and could be useful for monitoring and risk assessment purposes applying to environmental, health and contaminated soil samples.

  20. The inflow of 234U and 238U from the River Odra drainage basin to the Baltic Sea

    Directory of Open Access Journals (Sweden)

    Bogdan Skwarzec

    2010-12-01

    Full Text Available In this study the activity of uranium isotopes 234U and 238U in Odra river water samples, collected from October 2003 to July2004, was measured using alpha spectrometry. The uranium concentrations were different in each of the seasons analysed; the lowest values were recorded in summer. In all seasons, uranium concentrations were the highest in Bystrzyca river waters (from 27.81 ± 0.29Bq m-3 of 234U and 17.82 ± 0.23 Bq m-3 of 238U in spring to 194.76 ± 3.43 Bq m-3 of 234U and 134.88 ± 2.85 Bq m-3 of 238U in summer. The lowest concentrations were noted in the Mała Panew (from 1.33 ± 0.02 Bq m-3 of 234U and 1.06 ± 0.02 Bq m-3 of 238U in spring to 3.52 ± 0.05 Bq m-3 of 234U and 2.59± 0.04 Bq m-3 of 238U in autumn. The uranium radionuclides 234U and 238U in the water samples were not in radioactive equilibrium. The 234U / 238U activity ratios were the highest in Odra water samples collected at Głogów (1.84 in autumn, and the lowest in water from the Noteć (1.03 in winter and spring. The 234U / 238U activity ratio decreases along the main stream of the Odra, owing to changes in the salinity of the river's waters. Annually, 8.19 tons of uranium (126.29 G Bq of 234U and 100.80 G Bq of 238U flow into the Szczecin Lagoon with Odra river waters.

  1. 238U self-indication ratio measurement in the resonance region

    International Nuclear Information System (INIS)

    An accurate representation of the 238U cross-section structures in the resonance region is required to compute the resonance self-shielded effective cross sections used in the calculation of thermal and fast-reactor performance parameters. Several authors have demonstrated the usefulness of self-indication and average transmission measurements to investigate the resonance structure of the 238U cross sections. This paper compares measured self-indication ratios with calculations based on ENDF/B-V, in the resolved energy range from 100 eV to 4 keV. In that energy range the ENDF/B-V evaluation is chiefly based on high resolution transmission measurements. The immediate purpose of the comparison presented is not to generate a new set of improved resonance parameters but to provide an additional test of the adequacy of the ENDF/B-V representation for the calculation of resonance self-shielding

  2. Effect of carbides on erosion resistance of 23-8-N steel

    Indian Academy of Sciences (India)

    Aniruddha A Gadhikar; Ashok Sharma; D B Goel; C P Sharma

    2014-04-01

    Microstructure is one of the most important parameters influencing erosion behaviour of materials. The role of carbides in the matrix is very complicated in controlling the erosion rate of the materials. Conflicting results have been reported in the literature about the effect of carbides on erosion resistance. Carbides are of great importance especially as obstacles against the penetration of erosive particles into the material surface. However, they are susceptible to cracking and causing matrix decohesion which may increase the overall erosion rate. In 23-8-N nitronic steel, carbides present in the form of bands are observed to accelerate the erosion rate. Coarse carbides cause depletion of carbon in the austenite matrix which adversely affects the strain hardening tendency thus causing deterioration in erosion resistance of the bulk material. The dissolution of carbides in the austenitic matrix after solution annealing is observed to improve the erosion resistance of 23-8-N nitronic steel.

  3. Comparison of Yields of neutron rich nuclei in Proton and Photon induced $^{238}$U fission

    CERN Document Server

    Khan, F A; Basu, D N; Farooq, M; Chakrabarti, Alok

    2016-01-01

    A comparative study of fission of actinides specially $^{238}$U, by proton and bremsstrahlung photon is performed. Relative mass distribution of $^{238}$U fission fragments have been explored theoretically for both proton and photon induced fission. The integrated yield along with charge distribution of the products are calculated to find out the neutron richness in comparison to the nuclei produced by r-process in nucleosynthesis. Some r-process nuclei in intermediate mass range for symmetric fission mode are found to be produced almost two order of magnitude more for proton induced fission than photofission, although rest of the neutron rich nuclei in the asymmetric mode are produced in comparable proportion for both the processes.

  4. Exploring the multi-humped fission barrier of 238U via sub-barrier photofission

    CERN Document Server

    Csige, L; Glodariu, T; Gulyás, J; Günther, M M; Habs, D; Karwowski, H J; Krasznahorkay, A; Rich, G C; Sin, M; Stroe, L; Tesileanu, O; Thirolf, P G

    2013-01-01

    The photofission cross-section of 238U was measured at sub-barrier energies as a function of the gamma-ray energy using, for the first time, a monochromatic, high-brilliance, Compton-backscattered gamma-ray beam. The experiment was performed at the High Intensity gamma-ray Source (HIgS) facility at beam energies between E=4.7 MeV and 6.0 MeV and with ~3% energy resolution. Indications of transmission resonances have been observed at gamma-ray beam energies of E=5.1 MeV and 5.6 MeV with moderate amplitudes. The triple-humped fission barrier parameters of 238U have been determined by fitting EMPIRE-3.1 nuclear reaction code calculations to the experimental photofission cross section.

  5. Exploring the multihumped fission barrier of 238U via sub-barrier photofission

    Science.gov (United States)

    Csige, L.; Filipescu, D. M.; Glodariu, T.; Gulyás, J.; Günther, M. M.; Habs, D.; Karwowski, H. J.; Krasznahorkay, A.; Rich, G. C.; Sin, M.; Stroe, L.; Tesileanu, O.; Thirolf, P. G.

    2013-04-01

    The photofission cross section of 238U was measured at sub-barrier energies as a function of the γ-ray energy using a monochromatic, high-brilliance, Compton-backscattered γ-ray beam. The experiment was performed at the High Intensity γ-ray Source (HIγS) facility at beam energies between Eγ=4.7 MeV and 6.0 MeV and with ˜3% energy resolution. Indications of transmission resonances have been observed at γ-ray beam energies of Eγ=5.1 MeV and 5.6 MeV with moderate amplitudes. The triple-humped fission barrier parameters of 238U have been determined by fitting empire-3.1 nuclear reaction code calculations to the experimental photofission cross section.

  6. Analysis of 238Pu and 56Fe Evaluated Data for Use in MYRRHA

    Science.gov (United States)

    Díez, C. J.; Cabellos, O.; Martínez, J. S.; Stankovskiy, A.; Van den Eynde, G.; Schillebeeckx, P.; Heyse, J.

    2014-04-01

    A sensitivity analysis on the multiplication factor, keff, to the cross section data has been carried out for the MYRRHA critical configuration in order to show the most relevant reactions. With these results, a further analysis on the 238Pu and 56Fe cross sections has been performed, comparing the evaluations provided in the JEFF-3.1.2 and ENDF/B-VII.1 libraries for these nuclides. Then, the effect in MYRRHA of the differences between evaluations are analysed, presenting the source of the differences. With these results, recommendations for the 56Fe and 238Pu evaluations are suggested. These calculations have been performed with SCALE6.1 and MCNPX-2.7e.

  7. Certification of a uranium-238 dioxide reference material for neutron dosimetry (EC nuclear reference material 501)

    International Nuclear Information System (INIS)

    Uranium-238 oxide of 99.999% isotopic and 99.98% chemical purity was transformed into dioxide spheres of nominal 0.5 and 1.0 mm diameter by gel precipitation and subsequent calcination under carbon dioxide and under argon containing 5% hydrogen at 1 125 K. The spheres were analysed by thermal ionization mass spectrometry, including isotope dilution, by gravimetry and by potentiometric titration. On the basis of these analyses, the uranium mass fraction was certified at 879.4 ± 2.8 g.kg-1, and the 235U/U - and 238U/U abundances at 10.4 ± 0.5 mg.kg-1 and 999.9896 ± 0.0005 g.kg-1, respectively. The material is intended to be used as a reference material in neutron metrology

  8. Interactions of 238PuO2 heat sources with terrestrial and aquatic environments. Interim summary

    International Nuclear Information System (INIS)

    Observations and some conclusions made of the interactions of 238PuO2 heat sources with terrestrial and aquatic environments may be used in predicting heat source behavior in the event of contact of these heat sources with land or ocean and in assessing the risk to the environment. These studies indicate that plutonium transport from the heat sources is mostly a physical process involving the movement of extremely fine particles rather than the chemical migration of plutonium ions

  9. Measurement of neutron inelastic scattering cross section of {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Miura, Takako; Baba, Mamoru; Ibaraki, Masanobu; Sanami, Toshiya; Win, Than; Hirasawa, Yoshitaka; Matsuyama, Shigeo; Hirakawa, Naohiro [Tohoku Univ., Sendai (Japan)

    1998-03-01

    Neutron scattering from the 0{sup +}, 2{sup +} (1-st) and 4{sup +} (2nd) levels of {sup 238}U was measured for incident energies between 0.4 and 0.85 MeV at the Tohoku University 4.5 MV Dynamitron facility, using the time-of-flight (TOF) method with monoenergetic pulsed neutrons by the {sup 7}Li(p,n) reaction. The results are presented in comparison with other experimental data and evaluated data. (author)

  10. Sensitivity coefficients for the 238U neutron-capture shielded-group cross sections

    International Nuclear Information System (INIS)

    In the unresolved resonance region cross sections are represented with statistical resonance parameters. The average values of these parameters are chosen in order to fit evaluated infinitely dilute group cross sections. The sensitivity of the shielded group cross sections to the choice of mean resonance data has recently been investigated for the case of 235U and 239Pu by Ganesan and by Antsipov et al; similar sensitivity studies for 238U are reported

  11. 238PuO2 fines generation in radioisotopic heat sources

    International Nuclear Information System (INIS)

    Fuel aging studies were performed on the fuel form (plutonium-238 dioxide and yttrium) used in the Milliwatt Generator Radioisotopic Heat Source to determine the possibility of fuel degradation and of the resultant generation of respirable fines. In addition to long-term thermal aging of the fuel, evaluations included the effects of thermal ramping of the aged fuel to 10000C and of impacting thermally hot (4500C) heat sources at 150 m/sec after thermal aging

  12. Estimated discard limits for plutonium-238 recovery processing in the plutonium processing building

    Energy Technology Data Exchange (ETDEWEB)

    Luthy, D.F.; Bond, W.H.

    1975-03-26

    This manual is intended as a basis for plutonium-238 recovery costs and as a guide for removal of plutonium-bearing wastes from the gloveboxes to be safely and economically discarded. Waste materials contaminated with plutonium-238 are generated from in-house production, analytical, process development, recovery and receipts from off-site. The contaminated materials include paper, rags, alpha-box gloves, piping, valves, filters, etc. General categories for all types of plutonium waste have been established by the ERDA and are reflected in this manual. There are numerous processes used in plutonium recovery, such as dissolution, ultrasonic cleaning, ion exchange, etc. One or more of these processes are needed to extract the plutonium-238 from waste materials, purify it and convert it to an oxide acceptable for reuse. This manual is presented in two parts: Part I gives a breakdown and brief explanation of the direct costs for plutonium-238 I recovery, derived from budget data. Direct costs include direct labor (operating personnel), operational materials and supplies, health physics direct labor, calorimetry labor, analytical labor, and engineering direct labor (total costs for Method I). Budgeted costs for labor and material were used in the derivation of discard limits. The data presented is then used to calculate the cost per hour for recovery, as it applies to the three different methods of calculating discard limits referred to, in this manual, as Method I (calculation stated above), Method II and Method III. The cost for Method II is derived by adding to the cost of Method I, payroll related expenses. Method III is then calculated by adding over-head expenses to the total cost of Method II.

  13. An Analysis of 178Pb to 238U Isotopes with the Universal and Yukawa Proximity Potentials

    Science.gov (United States)

    Javadimanesh, E.; Hassanabadi, H.; Zarrinkamar, S.

    2013-07-01

    The alpha particle preformation and the penetration probability by the Yukawa proximity potential in the even-even nuclei from 178Pb to 238U are studied. Using the experimental values of the alpha decay half-lives and the decay energies, we extract the preformation factors and the penetration probabilities. We also calculate the assault frequencies and the decay constants. The obtained results are motivating.

  14. Depth profile of 236U/238U in soil samples in La Palma, Canary Islands

    OpenAIRE

    Srncik, M.; P. Steier; Wallner, G.

    2011-01-01

    The vertical distribution of the 236U/238U isotopic ratio was investigated in soil samples from three different locations on La Palma (one of the seven Canary Islands, Spain). Additionally the 240Pu/239Pu atomic ratio, as it is a well establish tool for the source identification, was determined. The radiochemical procedure consisted of a U separation step by extraction chromatography using UTEVA® Resin (Eichrom Technologies, Inc.). Afterwards Pu was separated from Th and Np by anion exchange ...

  15. Disintegration constant of uranium-238 by spontaneous fission redetermined by glass track method

    International Nuclear Information System (INIS)

    The disintegration constant of U238 by spontaneous fission using glass as fission fragment detector was redetermined. A film of natural uranium (UO3) prepared by chemical methods on the glass lamina was used in a long time experience of exposure (about 16 years). The good conditions of sample preparation and storage allow to observe, after chemical etching, fission fragment tracks. (M.C.K.)

  16. Determination of 235U/238U Ratio on Urine by ICP-MS

    Energy Technology Data Exchange (ETDEWEB)

    Collins, L; Gobaleza, A; Langston, R; Radev, R; Than, C; Wong, C; Wood-Zika, A

    2011-10-19

    LLNL Internal Dosimetry Program - The new procedure satisfies the requirement to determine {sup 235}U/{sup 238}U ratio in bioassay urine samples. MDA - The L{sub C} and MDA{sub 95} for {sup 235}U are well below the required detection limit of 0.00035 {mu}g/L. Turn around time - Analysis of 10 samples plus 2 QCs can be completed in one work day (8 hours).

  17. Prompt γ-rays from the Fast Neutron Induced Fission on 235,238U and 232Th

    Science.gov (United States)

    Lebois, M.; Wilson, J. N.; Halipré, P.; Leniau, B.; Matea, I.; Oberstedt, A.; Oberstedt, S.; Verney, D.

    Preliminary results from the first experiment using the LICORNE neutron source at the IPN Orsay are presented. Prompt fission gamma rays from fast-neutron induced fission of 238U, 232Th and 235U were detected. Thick samples of around 50 g of 238U and 232Th are used for the first part of the experiment. An ionisation chamber containing ∼ 10 mg samples of 238U and 235U to provide a fission trigger is used for the second part of the experiment. Gamma rays have been detected using 17 high efficiency BaF2 detectors and 6 LaBr3 scintillator detectors.

  18. Uranium content and 235U/238U isotopic ratio in dental porcelain powders determined by neutron activation analysis

    International Nuclear Information System (INIS)

    The uranium contents and 235U/238U isotopic ratios in 48 dental porcelain powders of 8 brands marketed in Japan were determined by non-destructive neutron activation analysis. The photopeak counts of 277.6 keV of 239Np formed by the 238U(n,γ)239U (yield to)239Np + β- reaction and at 1.595.2 keV of 140La produced by 235U fission were measured with a Ge(Li) semiconductor detector system to determine the uranium content and 235U/238U isotopic ratio. The results of the analysis are tabulated and their significance discussed. (author)

  19. Studies of positron electron pair production in {sup 238}U + {sup 232}Th

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, I.; Back, B.B.; Betts, R.R. [and others

    1995-08-01

    Following the non-observation of sharp sum-energy lines in our earlier {sup 238}U + {sup 181}Ta measurements, it was decided to pursue measurements of the {sup 238}U + {sup 232}Th system which, in the previously published work, showed the most striking evidence for near-equal-energy back-to-back pairs leading to sharp sum-energy lines. Following the refurbishing of the APEX silicon arrays and extensive tests of the rotating target wheel assembly, a major positron run took place in November 1994. Rolled 1-mg/cm{sub 2} {sup 232}Th targets were bombarded with 5.95-MeV/u {sup 238}U. The target rotation allowed up to 2 pnA of beam to be used without serious deterioration of the targets. Over 300,000 pairs were accumulated, representing an order-of-magnitude improvement in statistics over the previously published results. Preliminary analysis shows no evidence for the sharp lines at a cross section level orders of magnitude below those previously reported. The analysis of these data is currently being completed in preparation for publication.

  20. Validity of the generalized Brink-Axel hypothesis in $^{238}$Np

    CERN Document Server

    Guttormsen, M; Görgen, A; Renstrøm, T; Siem, S; Tornyi, T G; Tveten, G M

    2016-01-01

    We have analyzed primary $\\gamma$-ray spectra of the odd-odd $^{238}$Np nucleus extracted from $^{237}$Np($d,p\\gamma$)$^{238}$Np coincidence data measured at the Oslo Cyclotron Laboratory. The primary $\\gamma$ spectra cover an excitation-energy region of $0 \\leq E_i \\leq 5.4$ MeV, and allowed us to perform a detailed study of the $\\gamma$-ray strength as function of excitation energy. Hence, we could test the validity of the generalized Brink-Axel hypothesis, which, in its strictest form, claims no excitation-energy dependence on the $\\gamma$ strength. In this work, using the available high-quality $^{238}$Np data, we show that the $\\gamma$-ray strength function is to a very large extent independent on the initial and final states. Thus, for the first time, the generalized Brink-Axel hypothesis has been experimentally verified for $\\gamma$ transitions between states in the quasi-continuum region, not only for specific collective resonances, but also for the full strength below the neutron separation energy. B...

  1. Hard X-ray Tail Discovered in the Clocked Burster GS 1826-238

    CERN Document Server

    Rodi, James; Roques, Jean-Pierre

    2015-01-01

    The LMXB NS GS 1826-238 was discovered by Ginga in 1988 September. Due to the presence of quasi-periodicity in the type I X-ray burst rate, the source has been a frequent target of X-ray observations for almost 30 years. Though the bursts were too soft to be detected by INTEGRAL/SPI, the persistent emission from GS 1826-238 was detected over 150 keV during the ~10 years of observations. Spectral analysis found a significant high-energy excess above a Comptonization model that is well fit by a power law, indicating an additional spectral component. Most previously reported spectra with hard tails in LMXB NS have had an electron temperature of a few keV and a hard tail dominating above ~50 keV with an index of \\Gamma ~ 2-3. GS 1826-238 was found to have a markedly different spectrum with $ kT_e \\sim 20 $ keV and a hard tail dominating above ~150 keV with an index of \\Gamma ~ 1.8, more similar to BHXRB. We report on our search for long-term spectral variability over the 25-370 keV energy range and on a compariso...

  2. Distribution of 137Cs, 40K, 238U and 232Th in soils from Northern Venezuela

    International Nuclear Information System (INIS)

    More than one hundred undisturbed soil samples form Northern Venezuela and the islands of Margarita and Los Roques have been analyzed for 137Cs, 40K, 238U and 232Th by γ-ray spectroscopy. The specimens were taken from between 5-10 cm below the earth's surface. Thus, they are valid not only for the 137Cs deposition studies but also for the estimation of the natural γ-ray dose from primordial radionuclides that form the terrestrial component. The concentrations of 40K was directly determined from its 1461 keV γ-ray, while those of 137Cs, 238U and 232Th were performed using a γ-ray from one of their daughter radionuclides: the 661 keV γ-ray of 137mBa for 137Cs, the 1760 keV γ-ray of 214Bi for 238U and the 2620 keV γ-ray of 208Tl for 232Th. Finally, the concentration values were compared with those of global estimates. (author) 15 refs.; 4 figs.; 2 tabs

  3. Radiolysis and corrosion of 238Pu-doped UO2 pellets in chloride brine

    Indian Academy of Sciences (India)

    M Kelm; E Bohnert

    2002-12-01

    Deaerated 5 M NaCl solution is irradiated in the presence of UO2 pellets with a-radiation from 238Pu. Experiments are conducted with 238Pu doped pellets and others with 238Pu dissolved in the brine. The radiolysis products and yields of mobilized U and Pu from the oxidative dissolution of UO2 are determined. Results found for radiolysis products and for the oxidation/dissolution of pellets immersed in Pu containing brine are similar to results for Pu doped pellets, where the radiation chemical processes occur only in the liquid layer of some 10 m thickness adjacent to the pellet. The yield of radiolysis products is comparable to earlier results, that of mobilized U from the pellets is < 1% of the total amount of oxidized species. Thus, the radiation chemical yield (-value) for mobilized hexavalent U is < 0.01 ions/100 eV. In spite of the low radiation yield for the corrosion, the rate of UO2 dissolution is higher than expected for the concentrations of long-lived oxidizing radiolysis compounds found in the solutions.

  4. 232Th and 238U neutron emission cross section calculations and analysis of experimental data

    International Nuclear Information System (INIS)

    In this study, pre-equilibrium neutron-emission spectra produced by (n,xn) reactions on nuclei 232Th and 238U have been calculated. Angle-integrated cross sections in neutron induced reactions on targets 232Th and 238U have been calculated at the bombarding energies up to 18 MeV. We have investigated multiple pre-equilibrium matrix element constant from internal transition for 232Th (n,xn) neutron emission spectra. In the calculations, the geometry dependent hybrid model and the cascade exciton model including the effects of pre-equilibrium have been used. In addition, we have described how multiple pre-equilibrium emissions can be included in the Feshbach-Kerman-Koonin (FKK) fully quantum-mechanical theory. By analyzing (n,xn) reaction on 232Th and 238U, with the incident energy from 2 Me V to 18 Me V, the importance of multiple pre-equilibrium emission can be seen cleady. All calculated results have been compared with experimental data. The obtained results have been discussed and compared with the available experimental data and found agreement with each other

  5. 238U, 226Ra and 210Pb in some vent waters of the Galapagos Spreading Center

    Science.gov (United States)

    Krishnaswami, S.; Turekian, K. K.

    1982-08-01

    The concentrations of 226Ra, 238U and 210Pb have been measured in waters from the Mussel Bed and the Rose Garden thermal fields at the Galapagos spreading center over a temperature range of ˜2.5-16°C. The 226Ra-T plots yield slopes of 0.112 and 0.036 dpm/kg°C for the Mussel Bed and the Rose Garden respectively yielding a global hydrothermal 226Ra flux less than 5% of that required to sustain the oceanic inventory. 238U concentration in waters <9°C is the same as that in ambient sea water whereas water hotter than ˜9°C shows a decreasing trend with temperature to zero 238U at ˜29°C. 210Pb concentration in Mussel Bed increases with temperature, and extrapolated to ˜350°C yields a 210Pb concentration considerably less than that expected from 222Rn decay and basalt alteration.

  6. Helium bubbles at grain boundaries of high-density 238PuO2 shards

    International Nuclear Information System (INIS)

    Hydroxide- and oxalate-base 238PuO2 shards that were sintered to high density at 1200 or 16000C and then aged for 6 months or more exhibited grain-boundary gas bubbles due to agglomeration of alpha-decay helium when heated to 12000C and above. Conditions for bubble formation depended markedly on shard microstructure; large-grained shards with few large residual sintering pores formed gas bubbles at lower temperatures than small-grained shards with many pores. This behavior was especially apparent in oxalate-base 238PuO2, in which small-grained shards resisted bubble formation to above 15000C; small-grained hydroxide-base shards with less internal porosity than oxalate-base shards formed bubbles at lower temperatures. Helium is apparently released from aged 238PuO2 shards at high temperatures by bulk diffusion within grains to the grain boundaries, where bubbles are formed and interconnect into networks which permit helium escape. It is postulated that helium is released by grain boundary diffusion at temperatures below thresholds for grain boundary bubble formation. Small grain size and high residual porosity within grains inhibit the formation of the grain-boundary gas bubbles by reducing the concentration of helium gas at the grain boundaries. (10 fig)

  7. Isotope fractionation of 238U and 235U during biologically-mediated uranium reduction

    Science.gov (United States)

    Stirling, Claudine H.; Andersen, Morten B.; Warthmann, Rolf; Halliday, Alex N.

    2015-08-01

    A series of laboratory-controlled microbial experiments using gram-negative sulphate-reducing bacteria (Desulfovibrio brasiliensis) inoculated with natural uranium were performed to investigate 238U/235U fractionation during bacterially-mediated U reduction. Control experiments, without bacteria to drive U reduction, were conducted in parallel. Paired measurements of 238U/235U and U concentration for both the residual growth medium solution and the accumulated biologically-mediated precipitate were obtained using multiple-collector inductively coupled plasma mass spectrometry (MC-ICPMS). The control experiments show that only minor (<0.1‰), if any 238U/235U fractionation occurs during co-precipitation with calcite. This implies that carbonate sediments are capable of faithfully recording the signature of the global ocean during Earth's major climatic events, including oxygenation and de-oxygenation transitions in the marine environment. The results for the microbial experiments demonstrate that the 238U/235U composition of the unreacted growth medium containing U(VI) is isotopically lighter than the composition of the U(IV)-bearing precipitate as U(VI) is consumed, in agreement with field-based observations of microbially-mediated U reduction. Uranium isotopic shifts of up to 0.8‰ were observed between the liquid and solid phases. These observations can be modelled using a Rayleigh distillation approach describing kinetic uptake in a closed system, which yields a fractionation factor α of 0.99923 ± 0.00004 (ε = -0.77 ± 04‰) for U(VI)-U(IV) reduction mediated by the D. brasiliensis microbe. This fractionation behaviour is consistent with that observed in field-based redox environments, which give rise to similar α values. Competing processes such as U co-precipitation (e.g. adsorption) may act to lower the apparent value for α and possibly play a secondary role both in the microbial experiments of this study and in natural U reduction settings where

  8. Spins of resonances in reactions of neutrons with (238)U and (113)Cd. Doctoral thesis; Spins van resonanties in reacties van neutronen met (238)u en (113)cd

    Energy Technology Data Exchange (ETDEWEB)

    Gunsing, F.

    1994-12-31

    In this thesis experiments are described that have lead to the assignments of spins to a large number of resonances in reactions of epithermal neutrons with the nuclei (238)U and (113)Cd. When a neutron is captured by an atomic nucleus, a compound nucleus is formed which is in a highly excited state with an energy of the order of the neutron binding energy. If the kinetic neutron energy is varied around a state of the compound nucleus, one observes a peak in the cross section. This is called a resonance in the reaction. Dependent on the amount or orbital momentum l that the neutron adds to the system, the resonances are indicated with spectroscopic notations as s- and p-waves for l = 0 and 1 respectively. The purpose of this thesis is to determine the spins of such resonances.

  9. PROPERTIES AND BEHAVIOR OF 238PU RELEVANT TO DECONTAMINATION OF BUILDING 235-F

    Energy Technology Data Exchange (ETDEWEB)

    Duncan, A.; Kane, M.

    2009-11-24

    This report was prepared to document the physical, chemical and radiological properties of plutonium oxide materials that were processed in the Plutonium Fuel Form Facility (PuFF) in building 235-F at the Savannah River Plant (now known as the Savannah River Site) in the late 1970s and early 1980s. An understanding of these properties is needed to support current project planning for the safe and effective decontamination and deactivation (D&D) of PuFF. The PuFF mission was production of heat sources to power Radioisotope Thermoelectric Generators (RTGs) used in space craft. The specification for the PuO{sub 2} used to fabricate the heat sources required that the isotopic content of the plutonium be 83 {+-} 1% Pu-238 due to its high decay heat of 0.57 W/g. The high specific activity of Pu-238 (17.1 Ci/g) due to alpha decay makes this material very difficult to manage. The production process produced micron-sized particles which proved difficult to contain during operations, creating personnel contamination concerns and resulting in the expenditure of significant resources to decontaminate spaces after loss of material containment. This report examines high {sup 238}Pu-content material properties relevant to the D&D of PuFF. These relevant properties are those that contribute to the mobility of the material. Physical properties which produce or maintain small particle size work to increase particle mobility. Early workers with {sup 238}PuO{sub 2} felt that, unlike most small particles, Pu-238 oxide particles would not naturally agglomerate to form larger, less mobile particles. It was thought that the heat generated by the particles would prevent water molecules from binding to the particle surface. Particles covered with bound water tend to agglomerate more easily. However, it is now understood that the self-heating effect is not sufficient to prevent adsorption of water on particle surfaces and thus would not prevent agglomeration of particles. Operational

  10. Analysis of serum anti-Ro52 positive in 238 cases%238例血清抗Ro-52抗体阳性分析

    Institute of Scientific and Technical Information of China (English)

    潘丽; 张园园; 杨宇溪; 李胡焕; 潘宝龙

    2016-01-01

    目的 探讨抗Ro-52抗体在不同疾病中的临床应用价值及意义.方法 采用欧蒙免疫印迹法检测患者血清抗Ro-52抗体,回顾性分析238例阳性结果 构成比及与其他自身抗体的关系.结果 238例阳性结果 中,构成比较高分别为系统性红斑狼疮23.5%,类风湿性关节炎16.8%和干燥综合征16.0%.抗Ro-52常伴随抗SSA、抗SSB及抗RNP出现,主要见于SLE、SS及RA.结论 自身免疫性疾病的起始和发病机制尚不清楚,其诊断和鉴别诊断也较为复杂.抗Ro-52抗体可存在多种疾病,仅能作为患者存在自身免疫疾病可能的提示,并不具备高特异性.但作为高阳性率自身抗体,在联合检测中具有一定的辅助诊断及鉴别诊断价值.

  11. Statistics and analysis of 238 cases of infection in hospital%238例院内感染情况统计与分析

    Institute of Scientific and Technical Information of China (English)

    牛向平; 唐亚娟

    2015-01-01

    目的 了解医院院内感染现状,有效预防和控制医院院内感染的发生和流行,降低院内感染率.方法 对2014年1月~2014年12月院内感染进行回顾性的调查分析.结果 发生院内感染的人数为238例,院内感染率为2.66%,发生院内感染的例次是357例,例次院内感染发生率为3.98%;院内感染的发生与患者的性别、年龄、病原菌分布、抗菌药物的使用等都有关系.结论 加强院内感染的管理,提高手卫生的依从性,坚持目标性检测,合理选择和使用抗菌药物是控制院内感染的关键.%Objective To understand the nosocomial infection status, effective prevention and control of nosocomial infection and epidemic, reduce the nosocomial infection rate.Methods from January December to 2014 in hospital infection were retrospectively investigated and analyzed.Results the incidence of nosocomial infection in 238 cases, the hospital infection rate was 2.66%, nosocomial infection cases is 357 cases, the incidence rate of 3.98% infection cases in Hospital; infection in hospital and patient sex, age, distribution of pathogens, antimicrobial drug use and so on.Conclusion to strengthen the management of nosocomial infections, improve hand hygiene compliance, adhere to the target detection, the reasonable selection and use of antimicrobial agents is the key to control nosocomial infection.

  12. Generation of 238U Covariance Matrices by Using the Integral Data Assimilation Technique of the CONRAD Code

    Directory of Open Access Journals (Sweden)

    Privas E.

    2016-01-01

    Full Text Available A new IAEA Coordinated Research Project (CRP aims to test, validate and improve the IRDF library. Among the isotopes of interest, the modelisation of the 238U capture and fission cross sections represents a challenging task. A new description of the 238U neutrons induced reactions in the fast energy range is within progress in the frame of an IAEA evaluation consortium. The Nuclear Data group of Cadarache participates in this effort utilizing the 238U spectral indices measurements and Post Irradiated Experiments (PIE carried out in the fast reactors MASURCA (CEA Cadarache and PHENIX (CEA Marcoule. Such a collection of experimental results provides reliable integral information on the (n,γ and (n,f cross sections. This paper presents the Integral Data Assimilation (IDA technique of the CONRAD code used to propagate the uncertainties of the integral data on the 238U cross sections of interest for dosimetry applications.

  13. The inflow of uranium 234U and 238U from the Vistula River catchment area to the Baltic Sea

    International Nuclear Information System (INIS)

    In the study, the activities of uranium 234U and 238U in the Vistula River water samples which were collected from November 2002 to October 2003, were measured using alpha spectrometry. In winter, the highest concentration of uranium isotopes and total uranium was in the Vistula River water from Malbork (13.13 ± 0.22 Bq m-3 for 234U, 12.45 ± 0.21 Bq m-3 for 238U and 1.02 ± 0.30 mg m-3 for total uranium), and the lowest was in water from Deblin (1.73 ± 0.07 Bq m-3 for 234U, 1.55 ± 0.07 Bq m-3 for 238U and 0.13 ± 0.09 mg m-3 for total uranium). In analyzed river samples uranium isotopes 234U and 238U are not in the radioactive equilibrium state. The values of 234U/238U activity ratio lie between 1.05-1.70. During spring, the highest concentration of uranium isotopes and total uranium was found in the Vistula River water from Malbork (12.36 ± 0.19 Bq m-3 for 234U, 10.77 ± 0.17 Bq m-3 for 238U and 0.88 ± 0.25 mg m-3 for total uranium), and the lowest was in water taken from Sandomierz (5.77 ± 0.14 Bq m-3 for 234U) and Krakow (4.08 ± 0.11 Bq m-3 for 238U and 0.33 ± 0.18 mg m-3 for total uranium). The values of 234U/238U activity ratio lie between 1.15-1.64. In summer, the highest concentration of uranium isotopes and total uranium was found in the Vistula River water samples taken from Malbork (8.22 ± 0.21 Bq m-3 for 234U, 7.60 ± 0.21 Bq m-3 for 238U and 0.62 ± 0.29 mg m-3 for total uranium), and the lowest was in water from Sandomierz (6.37 ± 0.12 Bq m-3 for 234U) and Krakow (3.56 ± 0.19 Bq m-3 for 238U and 0.29 ± 0.33 mg m-3 for total uranium). The values of 234U/238U activity ratio lie between 1.08-1.95. In autumn the highest concentration of uranium isotopes and total uranium was in the Vistula River water from Malbork (17.80 ± 0.25 Bq m-3 for 234U, 15.12 ± 0.23 Bq m-3 for 238U and 1.23 ± 0.34 mg m-3 for total uranium) and the lowest was in water from Torun (8.15 ± 0.49 Bq m-3 for 234U) and Krakow (6.34 ± 0.47 Bq m-3 for 238U and 0.52 ± 0

  14. Generation of 238U Covariance Matrices by Using the Integral Data Assimilation Technique of the CONRAD Code

    Science.gov (United States)

    Privas, E.; Archier, P.; Bernard, D.; De Saint Jean, C.; Destouche, C.; Leconte, P.; Noguère, G.; Peneliau, Y.; Capote, R.

    2016-02-01

    A new IAEA Coordinated Research Project (CRP) aims to test, validate and improve the IRDF library. Among the isotopes of interest, the modelisation of the 238U capture and fission cross sections represents a challenging task. A new description of the 238U neutrons induced reactions in the fast energy range is within progress in the frame of an IAEA evaluation consortium. The Nuclear Data group of Cadarache participates in this effort utilizing the 238U spectral indices measurements and Post Irradiated Experiments (PIE) carried out in the fast reactors MASURCA (CEA Cadarache) and PHENIX (CEA Marcoule). Such a collection of experimental results provides reliable integral information on the (n,γ) and (n,f) cross sections. This paper presents the Integral Data Assimilation (IDA) technique of the CONRAD code used to propagate the uncertainties of the integral data on the 238U cross sections of interest for dosimetry applications.

  15. The AS-76 interlaboratory experiment on the alpha spectrometric determinaion of Pu-238. Part 3: Preparation and characterization of samples

    International Nuclear Information System (INIS)

    Four plutonium samples containing 0.2, 0.8, 1.6 and 0.9 atom % of 238Pu have been prepared for the Interlaboratory Experiment AS-76. Of these three were input solutions from a reprocessing plant. The fourth sample was from a plutonium product solution. These samples have been characterized by two alpha spectrometry laboratories and two mass spectrometry laboratories to certify the ratio of alpha activities 238Pu/(239Pu + 240Pu) and the isotopic composition, respectively

  16. Absolute fission rate measurement of 238U induced by 14 MeV neutrons penetrated composite material

    International Nuclear Information System (INIS)

    In order to prove the model calculation method and parameter, the 238U absolute fission rate in the case of 14 MeV neutrons penetrating through the special composite material was measured by minitype slab uranium fission chambers. The measuring spots are distributed in the surface of iron ball hull along the different position of equator. The calculated results are compared with the experiment results. The total error of measured 238U absolute fission rate is 6.1%. (author)

  17. Neutron inelastic-scattering cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu

    International Nuclear Information System (INIS)

    Differential-neutron-emission cross sections of 232Th, 233U, 235U, 238U, 239Pu and 240Pu are measured between approx. = 1.0 and 3.5 MeV with the angle and magnitude detail needed to provide angle-integrated emission cross sections to approx. 232Th, 233U, 235U and 238U inelastic-scattering values, poor agreement is observed for 240Pu, and a serious discrepancy exists in the case of 239Pu

  18. Studies on {sup 232}Th and {sup 238}U levels in marine algae collected from the coast of Niigata Prefecture

    Energy Technology Data Exchange (ETDEWEB)

    Kato, Kenji; Tonouchi, Shigemasa; Maruta, Fumiyuki; Ebata, Hidekazu [Niigata Prefectural Inst. of Public Health and Environmental Sciences (Japan)

    2001-12-01

    To evaluate the properties of algae to concentrate radioactive elements, 14 species of algae like Sargassum were collected in the Prefecture and analyzed for their {sup 232}Th and {sup 238}U levels with Yokogawa HP4500 ICP-MS apparatus. The places of collection included those near the water discharge of an atomic power station. Mean {sup 232}Th and {sup 238}U levels were found to be 120 and 260 ng/g dry wt, respectively, and Phaeophyta showed more than several times higher {sup 238}U level than Chlorophyta and Rhodophyta. There was no clear difference in {sup 232}Th levels. No difference between places of collection was observed in Sargassum {sup 232}Th or {sup 238}U level. Adsorption of {sup 232}Th particle to and incorporation of soluble {sup 238}U into algae body were suggested. Mean {sup 232}Th and {sup 238}U radioactivities were found 73 and 510 {mu}Bq/g wet wt, respectively, and the respective annual committed effective doses, 0.2 and 0.3 {mu}Sv, calculated from those values were confirmed to be enough lower than the annual public dose limit, 1 mSv. (K.H.)

  19. Monte Carlo and deterministic simulations of activation ratio experiments for 238U(n,f), 238U(n,g) and 238U(n,2n) in the Big Ten benchmark critical assembly

    Energy Technology Data Exchange (ETDEWEB)

    Descalle, M; Clouse, C; Pruet, J

    2009-07-28

    The authors have compared calculations of critical assembly activation ratios using 3 different Monte Carlo codes and one deterministic code. There is excellent agreement. Discrepancies between the different Monte Carlo codes are the 1-2% level. Notably, the deterministic calculations with 87 groups are also in good agreement with the continuous energy Monte Carlo results. The three codes underestimate the {sup 238}U(n,f) reaction, suggesting that there is room for improvement in the evaluation, or in the evaluations of other reactions influencing the spectrum in BigTen. Until statistical uncertainties are implemented in Mercury, they strongly advise long runs to guarantee sufficient convergence of the flux at high energies, and they strongly encourage comparing Mercury results to a well-developed and documented code such as MCNP5 and/or COG. It may be that ENDL2008 will be available for use in COG within a year. Finally, it may be worthwhile to add a 'standard' reaction rate tally similar to those implemented in COG and MCNP5, if the goal is to expand the central fission and activation ratios simulations to include isotopes that are not part of the specifications for the assembly material composition.

  20. Actinide Oxidation State and O/M Ratio in Hypostoichiometric Uranium-Plutonium-Americium U0.750Pu0.246Am0.004O2-x Mixed Oxides.

    Science.gov (United States)

    Vauchy, Romain; Belin, Renaud C; Robisson, Anne-Charlotte; Lebreton, Florent; Aufore, Laurence; Scheinost, Andreas C; Martin, Philippe M

    2016-03-01

    Innovative americium-bearing uranium-plutonium mixed oxides U1-yPuyO2-x are envisioned as nuclear fuel for sodium-cooled fast neutron reactors (SFRs). The oxygen-to-metal (O/M) ratio, directly related to the oxidation state of cations, affects many of the fuel properties. Thus, a thorough knowledge of its variation with the sintering conditions is essential. The aim of this work is to follow the oxidation state of uranium, plutonium, and americium, and so the O/M ratio, in U0.750Pu0.246Am0.004O2-x samples sintered for 4 h at 2023 K in various Ar + 5% H2 + z vpm H2O (z = ∼15, ∼90, and ∼200) gas mixtures. The O/M ratios were determined by gravimetry, XAS, and XRD and evidenced a partial oxidation of the samples at room temperature. Finally, by comparing XANES and EXAFS results to that of a previous study, we demonstrate that the presence of uranium does not influence the interactions between americium and plutonium and that the differences in the O/M ratio between the investigated conditions is controlled by the reduction of plutonium. We also discuss the role of the homogeneity of cation distribution, as determined by EPMA, on the mechanisms involved in the reduction process. PMID:26907589

  1. Plutonium-238 alpha-decay damage study of the ceramic waste form.

    Energy Technology Data Exchange (ETDEWEB)

    Frank, S M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Barber, T L [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Cummings, D G [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; DiSanto, T [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Esh, D W [U.S. Nuclear Regulatory Commission, Washington, DC 20555-0001; Giglio, J J [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Goff, K M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Johnson, S G [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Kennedy, J R [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Jue, J-F [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Noy, M [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; O' Holleran, T P [U.S. Department of Energy, Idaho National Laboratory, P.O. Box 1625, Idaho Falls, ID 83415; Sinkler, W [UOP LLC, 25 E Algonquin Road, Des Plaines, IL 60017

    2006-03-27

    An accelerated alpha-decay damage study of a glass-bonded sodalite ceramic waste form has recently been completed. The purpose of this study was to investigate the physical and chemical durability of the waste form after significant exposure to alpha decay. This accelerated alpha-decay study was performed by doping the ceramic waste form with {sup 238}Pu which has a much greater specific activity than {sup 239}Pu that is normally present in the waste form. The alpha-decay dose at the end of the four year study was approximately 1 x 10{sup 18} alpha-decays/gram of material. An equivalent time period for a similar dose of {sup 239}Pu would require approximately 1100 years. After four years of exposure to {sup 238}Pu alpha decay, the investigation observed little change to the physical or chemical durability of the ceramic waste form (CWF). Specifically, the {sup 238}Pu-loaded CWF maintained it's physical integrity, namely that the density remained constant and no cracking or phase de-bonding was observed. The materials chemical durability and phase stability also did not change significantly over the duration of the study. The only significant measured change was an increase of the unit-cell lattice parameters of the plutonium oxide and sodalite phases of the material and an increase in the release of salt components and plutonium of the waste form during leaching tests, but, as mentioned, these did not lead to any overall loss of waste form durability. The principal findings from this study are: (1) {sup 238}Pu-loaded CWF is similar in microstructure and phase composition to referenced waste form. (2) Pu was observed primarily as oxide comprised of aggregates of nano crystals with aggregates ranging in size from submicron to twenty microns in diameter. (3) Pu phases were primarily found in the intergranular glassy regions. (4) PuO phase shows expected unit cell volume expansion due to alpha decay damage of approximately 0.7%, and the sodalite phase unit cell

  2. Fluxes of 238U decay series radionuclides in a dicalcium phosphate industrial plant.

    Science.gov (United States)

    Casacuberta, N; Masqué, P; Garcia-Orellana, J

    2011-06-15

    The production of dicalcium phosphate (DCP) is part of the phosphate industry, which has been recently included in the positive list of the NORM industries defined in the revised version of the EU-BSS (Euratom 29/96). The objective of the present work is to study specific concentrations and fluxes of (238,234)U, (230)Th, (226)Ra, (210)Pb and (210)Po at the different stages of the DCP production. Results showed highest activities of (238)U and (210)Pb were found in DCP (1500-2000 Bq kg(-1)); (230)Th and (210)Po were released together with the sludges (1600-2000 Bq kg(-1)) and (226)Ra presented particularly high activities in water (48 × 10(3) Bq m(-3)) and in the reactor scales (115 × 10(3) Bq kg(-1)). Fluxes of radionuclides showed that (238)U outflows were equally distributed between sludges (16 × 10(3) kBq h(-1)) and dicalcium phosphate (20 × 10(3) kBq h(-1)); (230)Th and (210)Po were almost entirely released in the sludges (30 × 10(3)kBq h(-1)) and the greatest (210)Pb outflow was the DCP current (25 × 10(3) kBq h(-1)). (226)Ra was mainly discharged through the water effluent (12 × 10(3) kBq h(-1)). This work highlights the importance of studying the industrial processes involving NORM, as minor changes in the production steps lead to different radionuclide distribution in the process.

  3. Fluxes of {sup 238}U decay series radionuclides in a dicalcium phosphate industrial plant

    Energy Technology Data Exchange (ETDEWEB)

    Casacuberta, N., E-mail: Nuria.Casacuberta@uab.es [Institut de Ciencia i Tecnologia Ambientals - Departament de Fisica, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Masque, P.; Garcia-Orellana, J. [Institut de Ciencia i Tecnologia Ambientals - Departament de Fisica, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain)

    2011-06-15

    The production of dicalcium phosphate (DCP) is part of the phosphate industry, which has been recently included in the positive list of the NORM industries defined in the revised version of the EU-BSS (Euratom 29/96). The objective of the present work is to study specific concentrations and fluxes of {sup 238,234}U, {sup 230}Th, {sup 226}Ra, {sup 210}Pb and {sup 210}Po at the different stages of the DCP production. Results showed highest activities of {sup 238}U and {sup 210}Pb were found in DCP (1500-2000 Bq kg{sup -1}); {sup 230}Th and {sup 210}Po were released together with the sludges (1600-2000 Bq kg{sup -1}) and {sup 226}Ra presented particularly high activities in water (48 x 10{sup 3} Bq m{sup -3}) and in the reactor scales (115 x 10{sup 3} Bq kg{sup -1}). Fluxes of radionuclides showed that {sup 238}U outflows were equally distributed between sludges (16 x 10{sup 3} kBq h{sup -1}) and dicalcium phosphate (20 x 10{sup 3} kBq h{sup -1}); {sup 230}Th and {sup 210}Po were almost entirely released in the sludges (30 x 10{sup 3} kBq h{sup -1}) and the greatest {sup 210}Pb outflow was the DCP current (25 x 10{sup 3} kBq h{sup -1}). {sup 226}Ra was mainly discharged through the water effluent (12 x 10{sup 3} kBq h{sup -1}). This work highlights the importance of studying the industrial processes involving NORM, as minor changes in the production steps lead to different radionuclide distribution in the process.

  4. Direct reduction of 238PuO2 and 239PuO2 to metal

    International Nuclear Information System (INIS)

    The process for reducing 700 g 239PuO2 to metal is a standard procedure at Los Alamos National Laboratory. This process is based on research for reducing 200 g 238PuO2 to metal. This report describes in detail the experiments and development of the 200-g process. The procedure uses calcium metal as the reducing agent in a molten CaCl2 solvent system. The process to convert impure plutonia to high-purity metal by oxide reduction followed by electrorefining is also described

  5. Potential Energy Surfaces of the Even-Even 230-238 U Isotopes

    Directory of Open Access Journals (Sweden)

    Diab S. M.

    2008-07-01

    Full Text Available Nuclear structure of 230 - 238 U isotopes have been studied in the frame work of the in- teracting boson approximation model (IBM-I. The contour plot of the potential energy surfaces, V ( ; , shows that all nuclei are deformed and have rotational char- acters, SU (3 . Levels energy spectra belonging to the gsb , , bands, electromagnetic transition rates B ( E 1 and B ( E 2 , quadrupole moment Q 0 , deformation parameterare 2 and the strength of the electric monopole transitions X ( E 0 =E 2 are calculated. The calculated values are compared with the available theoretical and experimental data and show reasonable agreement.

  6. Evaluation of resonance self-shielding factors for 238U in the unresolved resonance region

    International Nuclear Information System (INIS)

    On the basis of a theoretical model of identical equidistant resonances for the energy dependence of cross-sections in the unresolved resonance region, the authors have parametrized the values of the resonance self-shielding factors and their Doppler increments for 238U. They have proposed a method by which the Doppler increments of the self-shielding factors can be calculated from simple analytical formulae by redetermination of the model parameters. Analysing the experimental data on direct and capture transmissions in the unresolved resonance region, they demonstrate the possibility of describing those data as a whole and of deriving from them the cross-section group functionals. (author)

  7. Multifragmentation for 36Ar+238U treated as statistical dynamic interaction processes

    International Nuclear Information System (INIS)

    The exclusive multifragment multiplicities for the system 36Ar+238U at 35 MeV/nucleon incident energy are calculated using the Boltzmann master equation for the fast cascade, and the Weisskopf-Ewing evaporation model for successive binary decay of the equilibrated residues. These calculated results are consistent with the experimental results of Kim et al. We show that the multiplicity distribution in such a model has a sensitivity to the equilibrated excitation, so that multiplicity could be an observable characteristic of excitation. This in turn may be used to infer time delay for fragment emission (in a model dependent way)

  8. Sensitivity analysis of U238 cross section in thermal nuclear systems

    International Nuclear Information System (INIS)

    A sensitivity analysis system is developed for assessing the implication of uncertainties in nuclear data and related computational methods for light water power reactor. Sensitivies, at equilibrium cycle condition, are carried out for the few group macroscopic cross section of the U238 with respect to their 35 group microscopic absorption cross section using the batch depletion code SENTEAV similar to those calculation methods used in the industry. This investigation indicates that improvements are requested on specific range of energy. These results point out the direction for worth while experimental measurements based on an analysis of costs and economic benefits. (Author)

  9. Clinical Analysis of 238 Cases of Patients With Placental Abruption%238例胎盘早剥的临床分析

    Institute of Scientific and Technical Information of China (English)

    郭海洁

    2015-01-01

    目的:分析探讨胎盘早剥的诱发因素、临床特点、漏诊误诊及处理方法,以期提高诊断率、降低并发症。方法利用回顾性病例分析法,对我院自2003年1月~2012年12月收治的238例胎盘早剥病例进行分析。结果胎盘早剥的发生率是0.53%,其中,有明确诱因者占44%,通过急诊入院者占46.3%。除此之外,胎盘异常、脐带异常、羊水过多和妊娠期高血压也是胎盘早剥的诱发因素。结论胎盘早剥诱因多样、发病隐匿、症状不典型,容易导致B超漏诊,孕妇定期进行体检、预防孕期高血压等对预防和尽早处理胎盘早剥有重要的作用。%Objective To study the inducing factors, clinical features, misdiagnosis and treatment method about placental abruption, in order to improve the diagnostic rate and reduce the complication. Methods Retrospectively analyzed the 238 cases of patients with placental abruption in our hospital from January 2003 to December 2012. Results The incidence of placental abruption was 0.53%, among them, 44% with clear incentive, 63% through emergency admissions. In addition, the placenta, an abnormal umbilical cord, hydramnios and gestational hypertension were also causative factors of placental abruption. Conclusion Placental abruption with diverse causes, concealment and untypical symptoms, easily lead to misdiagnosis by ultrasound. So regular physical examination and prevention of high blood pressure during pregnancy play a key role in early treatment of placental abruption.

  10. Dose assessment of Bremsstrahlung induced by beta isotopes of Uranium-238 series in human tissues

    International Nuclear Information System (INIS)

    In the natural Uranium-238 decay series, pure beta isotopes such as 234Th, 234Pa, 214Pb, 214Bi, 210Pb and 210Bi are released. These beta isotopes having maximum beta energies and it induces the Bremsstrahlung radiation. The Bremsstrahlung component of these beta isotopes has been traditionally ignored in dosimetry calculations. This may be due to a lack of available methods for including this component in the calculations or to the belief that the contribution of this component is negligible compared to that of other emissions. The resulting hazard of Bremsstrahlung radiation may therefore be some of concern, at least theoretically, and should be systematically evaluated. In the present investigation, it has been estimated that the Bremsstrahlung dose of beta isotopes of Uranium-238 series such as 234Th, 234Pa, 214Pb, 214Bi, 210Pb and 210Bi in various body organs (Adrenals, Brain, Breasts, Gallbladder Wall, LLI Wall, Small Intestine, Stomach, ULI Wall, Heart Wall, Kidneys, Liver, Lungs, Muscle, Ovaries, Pancreas, Red Marrow, Bone Surfaces, Skin, Spleen, Testes, Thymus, Thyroid, Urine Bladder Wall, Uterus, Fetus, Placenta and Total Body). We have considered bone and muscle is target organs. These estimated values shows that the Bremsstrahlung radiation absorbed dose contribution from an organ to itself is very small compared to that from the beta source, but contribution to other organs is not always negligible. Hence the component of Bremsstrahlung dose to total dose should be considered in the environmental radioactivity dose calculations. (author)

  11. Total kinetic energy distribution of fission fragments in 6,7Li + 238U reactions

    International Nuclear Information System (INIS)

    The shape and width of fission-fragment (FF) mass and kinetic energy distribution provides a lot of information on the fission reaction mechanism and the structure of the compound nucleus (CN), the fragments as well as the interacting nuclei. The shape of the mass distribution of the fission fragments for the actinides induced by the proton or neutron is known to change with the incident energy. At low energies, it shows a double humped distribution which changes slowly to a single humped distribution as energy increases. However, for a reaction involving a weakly bound projectile (i.e., 6Li + 232Th), a sharp change in the shape of the mass distribution with energy was observed. The sharp increase in the peak to valley ratio (P:V) in the fission-fragment mass distribution in 6Li + 232Th reaction by Itkis et al. and in 6,7Li + 238U reactions by Santra et al. was concluded to be due to the reduced energy transfer to the composite system caused by incomplete fusion (ICF) of alpha or deuteron/triton followed by fissions. Total Kinetic Energy (TKE) distribution of fission fragments is another important observable on which the effect of projectile breakup is not explored yet. In this contribution, the study of breakup/transfer effect on average TKE distribution for 6,7Li + 238U reactions is presented

  12. The dependence of cumulative 238U(n,f) fission yield on incident-neutron energy

    Institute of Scientific and Technical Information of China (English)

    ZHENG Na; ZHONG Chunlai; MA Liyong; CHEN Zhongjing; LI Xiangqing; LIU Tingjin; CHEN Jinxiang; FAN Tieshuan

    2009-01-01

    This work is aim at studying the dependence of fission yields on incident neutron energy,so as to produce evaluated yield sets of the energy dependence.Experimental data at different neutron energies for gas fission products 85m,87,88Kr and 138Xe resulting from the 238U(n,f) reaction are processed using codes AVERAGE for weighed average and ZOTT for simultaneous evaluation.Energy dependence of the cumulative fission product yields on the incident neutron is presented.The evaluated curve of product yield is compared with the results calculated by the TALYS-0.64 code.The present evaluation is consistent with other main libraries in error permission.The fit curve of 87,88Kr can be recommended to predict the unmeasured fission yields.Comparisons of the evaluated energy dependence curves with theoretical calculated results show that the predictions using purely theoretical model for the fission process are not sufficiently accurate and reliable for the calculations of the cumulative fission yields for the 238U(n,f).

  13. Experimental determination of the antineutrino spectrum of the fission products of U238

    International Nuclear Information System (INIS)

    Accurate predictions of the antineutrino spectrum emitted by a nuclear reactor are of paramount importance for current and future reactor neutrino experiments. The antineutrinos are produced in the β - decays of the fission daughters of the four main fuel isotopes 235U, 238U, 239Pu, and 241Pu. One way to calculate the total anti νe - spectrum emitted by a fuel assembly is to experimentally determine the cumulative β-spectra emitted after fission of these four main fuel isotopes and to convert these into the corresponding anti νe-spectra. Three of the four spectra could already be determined in the 1980's, but only recently an experiment at the scientific neutron source FRM II in Garching could be performed to measure the anti νe-spectrum of 238U which contributes 10 % to the total antineutrino output of a standard PWR. With this spectrum, it is now possible to predict the antineutrino output of a reactor without the use of theoretical calculations for the contributing spectra. This talk describes the results of the experiment and discusses the impact on the current analysis of reactor neutrino experiments and the reactor antineutrino anomaly, which may give a hint on the possible existence of light sterile neutrinos.

  14. (238)U and total radioactivity in drinking waters in Van province, Turkey.

    Science.gov (United States)

    Selçuk Zorer, Özlem; Dağ, Beşir

    2014-06-01

    As part of the national survey to evaluate natural radioactivity in the environment, concentration levels of total radioactivity and natural uranium have been analysed in drinking water samples. A survey to study natural radioactivity in drinking waters was carried out in the Van province, East Turkey. Twenty-three samples of drinking water were collected in the Van province and analysed for total α, total β and (238)U activity. The total α and total β activities were counted by using the α/β counter of the multi-detector low background system (PIC MPC-9604), and the (238)U concentrations were determined by inductively coupled plasma-mass spectrometry (Thermo Scientific Element 2). The samples were categorised according to origin: tap, spring or mineral supply. The activity concentrations for total α were found to range from 0.002 to 0.030 Bq L(-1) and for total β from 0.023 to 1.351 Bq L(-1). Uranium concentrations ranging from 0.562 to 14.710 μg L(-1) were observed in drinking waters. Following the World Health Organisation rules, all investigated waters can be used as drinking water.

  15. Submillimeter observations of the J2142-4423 Lya protocluster at z = 2.38

    CERN Document Server

    Beelen, A; Kovács, A; Lagache, G; De Breuck, C; Weiss, A; Menten, K M; Colbert, J W; Dole, H; Siringo, G; Kreysa, E

    2008-01-01

    We present observations aimed at exploring both the nature of Lya emitting nebulae (Lya blobs) at z=2.38 and the way they trace large scale structure (LSS), by exploring their proximity to maximum starbursts through submillimeter emission. Our most important objectives are to make a census of associated submillimeter galaxies (SMGs), check their properties, and look for a possible overdensity in the protocluster J2142-4426 at z=2.38. We used the newly commissioned Large APEX Bolometer Camera (LABoCa) on the Atacama Pathfinder EXperiment (APEX) telescope, in its Science Verification phase, to carry out a deep 10'x10' map at 870 micron, and we performed multiple checks of the quality of data processing and source extraction. Our map, the first published deep image, confirms the capabilities of APEX/LABoCa as the most efficient current equipment for wide and deep submm mapping. Twenty-two sources were securely extracted with 870 micron flux densities in the range 3-21 mJy, rms noise 0.8-2.4 mJy, and far-IR lumin...

  16. Measurements of 234U, 238U and 230Th in excreta of uranium-mill crushermen

    International Nuclear Information System (INIS)

    Uranium and thorium levels in excreta of uranium mill crushermen who are routinely exposed to airborne uranium ore dust were measured. The purpose was to determine whether 230Th was preferentially retained over either 234U or 238U in the body. Urine and fecal samples were obtained from fourteen active crushermen with long histories of exposure to uranium ore dust, plus four retired crushermen and three control individuals for comparison. Radiochemical procedures were used to separate out the uranium and thorium fractions, which were then electroplated on stainless steel discs and assayed by alpha spectrometry. Significantly greater activity levels of 234U and 238U were measured in both urine and fecal samples obtained from uranium mill crushermen, indicating that uranium in the inhaled ore dust was cleared from the body with a shorter biological half-time than the daughter product 230Th. The measurements also indicated that uranium and thorium separate in vivo and have distinctly different metabolic pathways and transfer rates in the body. The appropriateness of current ICRP retention and clearance parameters for 230Th in ore dust is questioned

  17. Role of tumour necrosis factor gene polymorphisms (-308 and -238) in breast cancer susceptibility and severity

    International Nuclear Information System (INIS)

    Genetic polymorphisms in the promoter region of the tumour necrosis factor (TNF) gene can regulate gene expression and have been associated with inflammatory and malignant conditions. We have investigated two polymorphisms in the promoter of the TNF gene (-308 G>A and -238 G>A) for their role in breast cancer susceptibility and severity by means of an allelic association study. Using a case–control study design, breast cancer patients (n = 709) and appropriate age-matched and sex-matched controls obtained from the Breast Screening Unit (n = 498) were genotyped for these TNF polymorphisms, using a high-throughput allelic discrimination method. Allele frequencies for both polymorphisms were similar in both breast cancer cases and controls. However, the -308 polymorphism was found to be associated with vascular invasion in breast tumours (P = 0.024). Comparison with other standard prognostic indices did not show any association for either genotype. We demonstrated no association between the -308G>A polymorphism and the -238G>A polymorphism in the promoter region of TNF and susceptibility to breast cancer, in a large North European population. However, the -308 G>A polymorphism was found to be associated with the presence of vascular invasion in breast tumours

  18. Photofission product yields of 238U and 239Pu with 22-MeV bremsstrahlung

    Science.gov (United States)

    Wen, Xianfei; Yang, Haori

    2016-06-01

    In homeland security and nuclear safeguards applications, non-destructive techniques to identify and quantify special nuclear materials are in great demand. Although nuclear materials naturally emit characteristic radiation (e.g. neutrons, γ-rays), their intensity and energy are normally low. Furthermore, such radiation could be intentionally shielded with ease or buried in high-level background. Active interrogation techniques based on photofission have been identified as effective assay approaches to address this issue. In designing such assay systems, nuclear data, like photofission product yields, plays a crucial role. Although fission yields for neutron-induced reactions have been well studied and readily available in various nuclear databases, data on photofission product yields is rather scarce. This poses a great challenge to the application of photofission techniques. In this work, short-lived high-energy delayed γ-rays from photofission of 238U were measured in between linac pulses. In addition, a list-mode system was developed to measure relatively long-lived delayed γ-rays from photofission of 238U and 239Pu after the irradiation. Time and energy information of each γ-ray event were simultaneously recorded by this system. Cumulative photofission product yields were then determined using the measured delayed γ-ray spectra.

  19. Removal of Pu-238 from aqueous process streams using a polymer filtration process

    Science.gov (United States)

    Jarvinen, Gordon D.; Purdy, Geraldine M.; Rau, Karen C.; Remeroski, M. L.; Reimus, Mary Ann H.; Ramsey, Kevin B.; Foltyn, Elizabeth M.; Smith, Barbara F.; Robison, Thomas W.

    2001-02-01

    A glovebox facility is under construction at Los Alamos that will recover a significant quantity of the impure Pu-238 that exists in scrap and residues from past production operations. The general flowsheet consists of milling, acid dissolution, ion exchange, precipitation, calcination, oxygen isotope exchange, and waste treatment operations. As part of the waste treatment operations we are using polymer filtration to remove Pu-238 to meet facility discharge limits. Polymer filtration (PF) technology uses water-soluble polymers prepared with selective receptor sites to sequester metal ions, organic molecules, and other species from dilute aqueous solutions. The water-soluble polymers have a sufficiently large molecular size that they can be separated and concentrated using ultrafiltration (UF) methods. Water and small, unbound components of the solution pass freely through the UF membrane while the polymer concentrates in the retentate. The permeate stream is ``cleaned'' of the components bound to the polymer and can be used in further processing steps or discharged. The concentrated retentate solution can be treated to give a final waste form or to release the sequestered species from the receptor sites by adjusting the conditions in the retentate solution. The PF technology is part of our work to develop a safe, reliable and cost-effective scrap recovery operation with high process efficiencies, minimal waste generation, and high product purity. .

  20. Natural activities of {sup 238}U, {sup 232}Th and {sup 40}K in building materials

    Energy Technology Data Exchange (ETDEWEB)

    Ibrahim, N. [Department of Physics, University of Malaya, 50603 Kuala Lumpur (Malaysia)

    1999-05-01

    Seven kinds of building materials were analysed for {sup 238}U, {sup 232}Th and {sup 40}K using a direct {gamma}-counting method. The activity concentrations measured for {sup 238}U (30-448 Bq kg{sup -1}) and {sup 40}K (328-7541 Bq kg{sup -1}) were greater than the world average activity for soil (25 and 370 Bq kg{sup -1}, respectively) for all building materials analysed, while the activity concentrations of {sup 232}Th were found to exceed the average of 25 Bq kg{sup -1} (soil) for red-clay brick (51 Bq kg{sup -1}) and ceiling asbestos sheet materials (162 Bq kg{sup -1}). The calculated Ra equivalent activities (Ra{sub eq}) for all materials are higher than the world average value for soil (89 Bq kg{sup -1}). For red-clay brick and ceiling asbestos, the Ra{sub eq} values are found to exceed the limit of 370 Bq kg{sup -1}, equivalent to a {gamma}-dose of 1.5 mSv yr{sup -1}. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  1. The recycling of the actinides neptunium, americium and curium in a fast power reactor to reduce the long term activity in a final store

    International Nuclear Information System (INIS)

    The starting point for the considerations and calculations given in this dissertation is the inevitable production of radioactive materials in the use of nuclear energy, which creates a considerable potential danger in a final store for a very long period. As one possibility of alleviating this problem, a concept for recycling the waste actinides neptunium, americium and curium was proposed. The waste actinides are separated in the reprocessing of burnt-up fuel elements and reach a further irradiation circuit. There they pass through the stages 'manufacture of irradiation elements', 'use in a fast power reactor' and reprocessing of irradiation elements' several times. In each irradiation and subsequent storage, about 17% of the waste actinides are removed by fission or by conversion into nuclides which can be reused as fuel, so that during the life of 40 years of the fast recycling reacor, the waste actinides can be reduced in mass by one half. In order to determine this mass reduction effect, a model calculation was developed, which includes the representation of the neutron physics and thermal properties of the reactor core and the storage and reprocessing of the irradiation elements. (orig./RB)

  2. The estimation of reactions of hematopoietic systems of organisms to the effect, caused by americium and plutonium, of nuclear industry workers

    Energy Technology Data Exchange (ETDEWEB)

    Gasteva, G. N.; Ivanova, T. A.; Gordeeva, A. A.; Suvorova, L. A.; Molokanov, A. A.; Badine, I.

    2004-07-01

    Object of research are the workers having in an organism radioactive substance (Am-241 and Pu-239). The purpose of work was the estimation of reaction hemopoietic systems of an organism on influence of americium and plutonium at workers of the nuclear industry. At the surveyed contingent of persons the determined effects caused by total influence Am-241 and Pu-239 are ascertained; chronic radiation disease with development, besides diffusive a pneumoscleoris and a chronic toxic-chemical radiating bronchitis, reactions of system of blood, jet hepatopathy which frequency accrued with increase doses loadings and essentially did not depend on age. In peripheral blood on the foreground jet changes act: hyperglobulia, the tendency to neutrophilus leukocytosis, monocytosis, increase ESR, decrease (reduction ?/G of factor reflecting weight and processing of defeat bronchus and pulmonary of system. Stable downstroke in number thrombocytes and reticulocytes in peripheral blood, their direct dependence on a doze of an irradiation, reflect hypoplastic a background hemogenesis, caused by long influence incorporatedin a bone and a bone brain of radioactive substances. At cytologic research punctate a bone brain jet changes which are expressed in increase of functional activity erythro-and myelopoiesiscome to light and provide compensatory reaction of peripheral blood. At histologic research of a bone brain and a bone fabric attributes of development atrophic process which is expressed in reduction of volume parenchyma a bone brain (a fatty atrophy) and dysplasia to a bone fabric are observed.

  3. Measurement of the neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu

    International Nuclear Information System (INIS)

    The neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu have been measured from 0.1 eV to 100 keV using the Rensselaer Intense Neutron Spectrometer. Fission areas and widths were determined for several resolved low-energy resonances of /sup 242/Cm and /sup 238/Pu. The fission resonance integrals for /sup 242/Cm and /sup 238/Pu were found to be 12.9 +- 0.7 and 15.9 +- 0.6 b, respectively. The gross structure observed in the unresolved energy region of the /sup 242/Cm and /sup 238/Pu fission cross sections is suggestive of intermediate structure, and is consistent with the second well lying 2 to 3 MeV above the first well. The ENDF/B-V library fission cross section of /sup 238/Pu is, in general, not in good agreement with this measurement and a new evaluation is recommended. This is the first reported fission measurement of /sup 242/Cm in the 0.1-eV through 100-keV energy range

  4. Modeling of Selected Ceramic Processing Parameters Employed in the Fabrication of 238PuO 2 Fuel Pellets

    Science.gov (United States)

    Brockman, R. A.; Kramer, D. P.; Barklay, C. D.; Cairns-Gallimore, D.; Brown, J. L.; Huling, J. C.; Van Pelt, C. E.

    Recent deep space missions utilize the thermal output of the radioisotope plutonium-238 as the fuel in the thermal to electrical power system. Since the application of plutonium in its elemental state has several disadvantages, the fuel employed in these deep space power systems is typically in the oxide form such as plutonium-238 dioxide (238PuO2). As an oxide, the processing of the plutonium dioxide into fuel pellets is performed via "classical" ceramic processing unit operations such as sieving of the powder, pressing, sintering, etc. Modeling of these unit operations can be beneficial in the understanding and control of processing parameters with the goal of further enhancing the desired characteristics of the 238PuO2 fuel pellets. A finite element model has been used to help identify the time-temperature-stress profile within a pellet during a furnace operation taking into account that 238PuO2 itself has a significant thermal output. Results of the modeling efforts will be discussed.

  5. Pre-neutron-emission Mass Distributions for Neutron-induced 238U Fission at Low and Intermediate Energies%中低能中子诱发238U裂变的碎片质量分布

    Institute of Scientific and Technical Information of China (English)

    孙小军; 余呈刚; 王宁

    2012-01-01

    乏燃料中238U含量最多(高达95%),研究中子诱发238U裂变产物的分布特性对乏燃料的循环后处理具有非常重要的意义.本文基于微观和唯象方法的裂变势模型理论,研究入射能量从0.9 MeV-60.0 MeV能区的中子诱发238U裂变反应的发射中子前碎片质量分布,结果表明:在中能区,理论计算结果能很好地重现实验数据,甚至比国际著名的TALYS理论计算的结果要好;在低能区,理论计算结果也较为合理,并分析了与实验数据有所偏差的原因.%238Utof which abundance is almost 95% ,is one of the most important isotopes of the spent nuclear fuel. The study of neutron-induced 238U fission is in favor of the cycle processing of the spent fuel. Based on the microscopic and phenomenological approach,the pre-neutron-emission mass distributions of neutron-induced 238U fission at incident energies from 0. 9 to 60 MeV have been studied with the fission potential theory proposed in previous paper. The calculated results could well reproduce the experimental data,and are even better than that of the famous TALYS code at intermediate energies.The results can also reasonably predict the distributions at the vibrational resonances,and the deviation between the experimental and the theoretical data is also analyzed.

  6. Verification tests on nondestructive assay for 238U content in uranium-contaminated waste drums using gamma method

    International Nuclear Information System (INIS)

    We have proposed a new theory on gamma assay for 238U determination of uranium-contaminated waste drums. According to this theory, regardless of the inhomogeneity of waste matrix density or uranium source distribution, we can accurately determine the amount of 238U contained in drums nondestructively using count rates of gamma rays of two energies(1001keV and 766keV) emitted from 238U progeny nuclide 234mPa. In this paper, we have verified the theory by tests under various waste conditions made by simulated waste drums. We have estimated the relative error to be less than 20%, and the detection limit to be 1.2Bq/g when the specific activity of uranium is 25000Bq/g, in these cases. We have confirmed that this new assay system is efficient for the rational classification of uranium wastes to be disposed of. (author)

  7. Production of $^{237}$U in the $^{238}$U ($\\gamma, n$) photonuclear reaction at the electron accelerator MT-25 microtron

    CERN Document Server

    Sabelnikov, A V; Gustova, M V; Belov, A G; Dmitriev, S N

    2004-01-01

    $^{237}$U was obtained in the $^{238}$U($\\gamma, n$) reaction at the electron accelerator MT-25 microtron of the FLNR of the JINR. The $^{237}$U radiation yield under experimental conditions amounted to 1 kBq/$\\mu $A$\\cdot $h$\\cdot$mg $^{238}$U. Capture of recoil atoms in a solid-solid system was used for isolation of $^{237}$U from the target material. Fluorides of chemical elements from I-III series of the Periodic Table of the Elements were used as $^{237}$U acceptors. The $^{237}$U isolation from radioactive impurities was realized by means of extraction and ion exchange. Specific activity of the $^{237}$U preparation was equal to 49500 kBq/mg $^{238}$U. The radioactive impurity content did not exceed 10$^{-6}$ Bq/Bq. The $^{237}$U chemical yield amounted to 70{\\%}.

  8. 238U, 234U, 226Ra, 210Po concentrations of bottled mineral waters in Italy and their dose contribution

    International Nuclear Information System (INIS)

    Due to the importance of bottled mineral water in human diet with special regard to children in lactation period, a monitoring of natural radioactivity in some bottled mineral waters produced in Italy was performed. Gross alpha and beta activities and 226Ra, 238U, 234U, and 210Po concentrations were measured. Gross alpha and beta activities were determined by standards ISO 9696 and ISO 9697; for 226Ra determination liquid scintillation was used. The 238U and 234U concentrations were determined by alpha spectrometry after their separation from matrix by extraction chromatography and electroplating. 210Po was measured by alpha spectrometry. The results revealed that the concentrations (mBq L-1) of 226Ra, 238U, 234U, and 210Po ranged from -1; for infants (-1

  9. Performance evaluation of indigenous thermal ionization mass spectrometer for determination of 235U/238U atom ratios

    International Nuclear Information System (INIS)

    A magnetic sector based Thermal Ionization Mass Spectrometer (TIMS) designed and developed at Technical Physics Division, B.A.R.C., was evaluated for its performance for the determination of 235U/238U atom ratios in uranium samples. This consisted of evaluating the precision and accuracy on the 235U/238U atom ratios in various isotopic reference materials as well as indigenously generated uranium samples. The results obtained by the indigenous TIMS were also compared with those obtained using a commercially available TIMS system. The internal and external precision were found to be around 0.1% for determining 235U/238U atom ratios close to those of natural uranium ( i.e. 0.00730). (author)

  10. Post-Irradiation Examination of 237Np Targets for 238Pu Production

    Energy Technology Data Exchange (ETDEWEB)

    Morris, Robert Noel [ORNL; Baldwin, Charles A [ORNL; Hobbs, Randy W [ORNL; Schmidlin, Joshua E [ORNL

    2015-01-01

    Oak Ridge National Laboratory is recovering the US 238Pu production capability and the first step in the process has been to evaluate the performance of a 237Np target cermet pellet encased in an aluminum clad. The process proceeded in 3 steps; the first step was to irradiate capsules of single pellets composed of NpO2 and aluminum power to examine their shrinkage and gas release. These pellets were formed by compressing sintered NpO2 and aluminum powder in a die at high pressure followed by sintering in a vacuum furnace. Three temperatures were chosen for sintering the solution precipitated NpO2 power used for pellet fabrication. The second step was to irradiate partial targets composed of 8 pellets in a semi-prototypical arrangement at the two best performing sintering temperatures to determine which temperature gave a pellet that performed the best under the actual planned irradiation conditions. The third step was to irradiate ~50 pellets in an actual target configuration at design irradiation conditions to assess pellet shrinkage and gas release, target heat transfer, and dimensional stability. The higher sintering temperature appeared to offer the best performance after one cycle of irradiation by having the least shrinkage, thus keeping the heat transfer gap between the pellets and clad small minimizing the pellet operating temperature. The final result of the testing was a target that can meet the initial production goals, satisfy the reactor safety requirements, and can be fabricated in production quantities. The current focus of the program is to verify that the target can be remotely dissembled, the pellets dissolved, and the 238Pu recovered. Tests are being conducted to examine these concerns and to compare results to code predictions. Once the performance of the full length targets has been quantified, the pellet 237Np loading will be revisited to determine if it can be

  11. A reactivity hold-down strategy for soluble boron free operation by introducing Pu-238 added fuel

    International Nuclear Information System (INIS)

    A new concept of Pu-238 added fuel is introduced to control the reactivity and power distribution in soluble boron free (SBF) pressurized water reactor (PWR) core. Though extensive use of burnable poison and control rods is inevitable for reactivity suppression in SBF core, it causes the core power distribution control to be so difficult that a practical SBF operation is far distant. In this work, it is confirmed that the excess reactivity can be greatly suppressed by introducing the Pu-238 added fuel. As a result of the conceptual core design of the 600 MWe SBF PWR using Pu-238 added fuel, the core reactivity is well controlled in comparison with the results obtained from the earlier 600 MWe SBF core design works. Especially, the axial power shape control is performed successfully with the aid of simple axial zoning scheme, developed in this study, by using Pu-238 enrichment zoning. The Pu-238 added fuel is also tested for 1300 MWe SBF PWR core design, in which the power distribution control can be more difficult than that of smaller plants if soluble boron control is not available. The results show that the core excess reactivity and the power distribution can be well controlled without using soluble boron even in a large-sized PWR. Hence, one of the difficult control problems arising in SBF core design can be greatly mitigated by introducing the new fuel concept. It is further expected that the Pu-238 added fuel, the simple axial zoning scheme, and the control bank operation strategy introduced in this study are directly applicable to practical SBF core design

  12. Acceptable knowledge summary report for combustible/noncombustible, metallic, and HEPA filter waste resulting from {sup 238}Pu fabrication activities

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, P.S.Z.; Foxx, C.L.

    1998-02-19

    All transuranic (TRU) waste must be sufficiently characterized and certified before it is shipped to the Waste Isolation Pilot Plant (WIPP). The US Environmental Protection Agency (EPA) allows use of acceptable knowledge (AK) for waste characterization. EPA uses the term AK in its guidance document and defines AK and provides guidelines on how acceptable knowledge should be obtained and documented. This AK package has been prepared in accordance with Acceptable Knowledge Documentation (TWCP-QP-1.1-021,R.2). This report covers acceptable knowledge information for five waste streams generated at TA-55 during operations to fabricate various heat sources using feedstock {sup 238}Pu supplied by the Savannah River Site (SRS). The {sup 238}Pu feedstock itself does not contain quantities of RCRA-regulated constituents above regulatory threshold limits, as known from process knowledge at SRS and as confirmed by chemical analysis. No RCRA-regulated chemicals were used during {sup 238}Pu fabrication activities at TA-55, and all {sup 238}Pu activities were physically separated from other plutonium processing activities. Most of the waste generated from the {sup 238}Pu fabrication activities is thus nonmixed waste, including waste streams TA-55-43, 45, and 47. The exceptions are waste streams TA-55-44, which contains discarded lead-lined rubber gloves used in the gloveboxes that contained the {sup 238}Pu material, and TA-55-46, which may contain pieces of discarded lead. These waste streams have been denoted as mixed because of the presence of the lead-containing material.

  13. 239Pu(n,2n) 238Pu cross section inferred from IDA calculations and GEANIE measurements

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H; Ormand, W E; Dietrich, F S

    2000-09-01

    This report presents the latest {sup 239}Pu(n,2n){sup 238}Pu cross sections inferred from calculations performed with the nuclear reaction-modeling code system, IDA, coupled with experimental measurements of partial {gamma}-ray cross sections for incident neutron energies ranging from 5.68 to 17.18 MeV. It is found that the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section peaks at E{sub inc} {approx} 11.4 MeV with a peak value of approximately 326 mb. At E{sub inc} {approx} 14 MeV, the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section is found to be in good agreement with previous radio-chemical measurements by Lockheed. However, the shape of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section differs significantly from previous evaluations of ENDL, ENDF/B-V and ENDF/B-VI. In our calculations, direct, preequilibrium, and compound reactions are included. Also considered in the modeling are fission and {gamma}-cascade processes in addition to particle emission. The main components of physics adopted and the parameters used in our calculations are discussed. Good agreement of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross sections derived separately from IDA and GNASH calculations is shown. The two inferences provide an estimate of variations in the deduced {sup 239}Pu(n,2n){sup 238}Pu cross section originating from modeling.

  14. 238U/235U determinations of some commonly used reference materials and U-bearing accessory minerals (Invited)

    Science.gov (United States)

    Condon, D.; Noble, S.; McLean, N.; Bowring, S. A.

    2009-12-01

    We have determined 238U/235U ratios for a suite of commonly used natural (CRM 112a, SRM 950a, HU-1) and synthetic (IRMM 184 and CRM U500) uranium reference materials in addition to several U-bearing accessory phases (zircon and monazite) by thermal ionisation mass-spectrometry (TIMS) using the IRMM 3636 233U-236U double spike to accurately correct for mass fractionation. The 238U/235U values for the natural uranium reference materials differ, by up to 0.1%, from the widely used ‘consensus’ value (137.88) with all having 238U/235U values less than 137.88. Similarly, initial 238U/235U data from zircon and monazite yield 238U/235U values that are lower than the ‘consensus’ value. The data obtained from U-bearing minerals is used to assess how the uncertainty in the 238U/235U ratio contributes to the systematic discordance observed in 238U/206Pb and 235U/207Pb dates (Mattinson, 2000; Schoene et al., 2006) which has traditionally been wholly attributed to error in the U decay constants. The 238U/235U determinations made on the synthetic reference materials yield results that are considerably more precise and accurate than the certified values (0.02% vs. 0.1% for CRM U500). The calibration of isotopic tracers used for U-daughter geochronology that are partially based upon these reference materials, and the resultant age determinations, will benefit from increased accuracy and precision. Mattinson, J.M., 2000. Revising the “gold standard”—the uranium decay constants of Jaffey et al., 1971. Eos Trans. AGU, Spring Meet. Suppl., Abstract V61A-02. Schoene B., Crowley J.L., Condon D.C., Schmitz M.D., Bowring S.A., 2006, Reassessing the uranium decay constants for geochronology using ID-TIMS U-Pb data. Geochimica et Cosmochimica Acta 70: 426-445

  15. Radioactivity of Natural Nuclides (40K, 238U, 232Th, 226Ra) in Coals from Eastern Yunnan, China

    OpenAIRE

    Xin Wang; Qiyan Feng; Ruoyu Sun; Guijian Liu

    2015-01-01

    The naturally occurring primordial radionuclides in coals might exhibit high radioactivity, and can be exported to the surrounding environment during coal combustion. In this study, nine coal samples were collected from eastern Yunnan coal deposits, China, aiming at characterizing the overall radioactivity of some typical nuclides (i.e., 40K, 238U, 232Th, 226Ra) and assessing their ecological impact. The mean activity concentrations of 238U, 232Th, 40K and 226Ra are 63.86 (17.70–92.30 Bq· kg-...

  16. Neutron Capture Cross Sections and Gamma Emission Spectra from Neutron Capture on 234,236,238U Measured with DANCE

    Science.gov (United States)

    Ullmann, J. L.; Mosby, S.; Bredeweg, T. A.; Couture, A. J.; Haight, R. C.; Jandel, M.; Kawano, T.; O'Donnell, J. M.; Rundberg, R. S.; Vieira, D. J.; Wilhelmy, J. B.; Wu, C.-Y.; Becker, J. A.; Chyzh, A.; Baramsai, B.; Mitchell, G. E.; Krticka, M.

    2014-05-01

    A new measurement of the 238U(n, γ) cross section using a thin 48 mg/cm2 target was made using the DANCE detector at LANSCE over the energy range from 10 eV to 500 keV. The results confirm earlier measurements. Measurements of the gamma-ray emission spectra were also made for 238U(n, γ) as well as 234,236U(n, γ). These measurements help to constrain the radiative strength function used in the cross-section calculations.

  17. Measurement of nuclide cross-sections of spallation residues in 1 A GeV 238U + proton collisions

    International Nuclear Information System (INIS)

    The production of heavy nuclides from the spallation-evaporation reaction of 238U induced by 1 GeV protons was studied in inverse kinematics. The evaporation residues from tungsten to uranium were identified in-flight in mass and atomic number. Their production cross-sections and their momentum distributions were determined. The data are compared with empirical systematics. A comparison with previous results from the spallation of 208Pb and 197Au reveals the strong influence of fission in the spallation of 238U. (orig.)

  18. Charge stripping of U238 ion beam by helium gas stripper

    Science.gov (United States)

    Imao, H.; Okuno, H.; Kuboki, H.; Yokouchi, S.; Fukunishi, N.; Kamigaito, O.; Hasebe, H.; Watanabe, T.; Watanabe, Y.; Kase, M.; Yano, Y.

    2012-12-01

    Development of a nondestructive, efficient electric-charge-stripping method is a key requirement for next-generation high-intensity heavy-ion accelerators such as the RIKEN Radioactive-Isotope Beam Factory. A charge stripper employing a low-Z gas is an important candidate applicable to high-intensity uranium beams for replacing carbon-foil strippers. In this study, a high-beam-transmission charge-stripping system employing helium gas for U238 beams injected at 10.8MeV/u was developed and demonstrated for the first time. The charge-state evolution measured using helium in a thickness range of 0.24-1.83mg/cm2 is compared with theoretical predictions. Energy attenuation and energy spread due to the helium stripper are also investigated.

  19. Effect of storage temperature on self-irradiation damage of 238Pu-substituted zirconolite

    International Nuclear Information System (INIS)

    238Pu-substituted cubic zirconolite (CaPuTi2O7) was stored at ambient temperature, 5750 K, and 8750 K until alpha decay doses of 2.4 to 3.6 x 1025/m3 had been accumulated. The ambient temperature material swelled to a saturation value of 5.5 vol %, and the originally crystalline structure was transformed to one with an amorphous matrix and small domains that had retained their crystallinity. At 5750 K, lesser amounts of swelling (4.1 vol %) and transformation were observed, reflecting concurrent partial recovery. The material held at 8750 K remained crystalline, swelled only 0.4 vol %, and exhibited formation of isolated defect clusters. 5 figures

  20. An evaluation of alternate production methods for Pu-238 general purpose heat source pellets

    Energy Technology Data Exchange (ETDEWEB)

    Mark Borland; Steve Frank

    2009-06-01

    For the past half century, the National Aeronautics and Space Administration (NASA) has used Radioisotope Thermoelectric Generators (RTG) to power deep space satellites. Fabricating heat sources for RTGs, specifically General Purpose Heat Sources (GPHSs), has remained essentially unchanged since their development in the 1970s. Meanwhile, 30 years of technological advancements have been made in the applicable fields of chemistry, manufacturing and control systems. This paper evaluates alternative processes that could be used to produce Pu 238 fueled heat sources. Specifically, this paper discusses the production of the plutonium-oxide granules, which are the input stream to the ceramic pressing and sintering processes. Alternate chemical processes are compared to current methods to determine if alternative fabrication processes could reduce the hazards, especially the production of respirable fines, while producing an equivalent GPHS product.

  1. Tests of the 238U+n evaluation for JEF-2 in the unresolved resonance region

    International Nuclear Information System (INIS)

    During the JEF-2 test phase the new evaluation for 238U+n in the unresolved resonance region (adopted for JEF-2 up to 200 keV, for ENDF/B-VI up to 149 keV) has been checked against recent capture cross section measurements and against thick-sample transmission data and capture self-indication ratios. Effects of the unresolved resonance structure on self-shielding and multiple scattering were treated by Monte Carlo techniques based on resonance statistics and average resonance parameters. It was found that the average cross sections and the average resonance parameters given in the new evaluation permit very satisfactory reproduction of all the test data. The resonance-averaged capture cross sections below 200 keV appear now to be known with roughly 2% uncertainty. (orig.)

  2. Observations of Type i X-Ray Bursts from GS 1826-238 with RXTE

    Science.gov (United States)

    Lewin, Walter

    Type I X-ray bursts are the result of thermonuclear flashes on the surface of accreting neutron stars. The spectral lines which are expected in the X-ray spectra of the bursts will allow for a direct measurement of the gravitational redshift from the surface of the neutron stars (one of the holy grails in physics). XMM-Newton has the potential of detecting such lines. We have been awarded 200 ksec observations with XMM-Newton of the X-ray burster GS 1826-238. During this time we expect to observe ten X-ray bursts and to accumulate about 40,000 high-spectral resolution burst counts with the RGS, and roughly 2 Mcounts with EPIC-PN. We are requesting simultaneous observations with RXTE to obtain essential information about the underlying continuum spectrum.

  3. Charge-stripping system for 238U ion beam with recirculating He gas

    International Nuclear Information System (INIS)

    Recent developments in a charge-stripping system employing high-flow rate He gas circulation (∼200 L/min) for 238U35+ beams injected at 10.8 MeV/u are reported. He gas is confined in a target section and is separated from a vacuum duct using five-stage differentially-pumped sections. To minimize the gas leakage rate via beam apertures, a high-performance differential pumping was required. To avoid huge gas consumption, a clean gas recycling with high-flow rate was simultaneously required. To realize these, we developed multi-stage mechanical booster pump array. The recycling rate of He gas was achieved as more than 99 %. The system performance has been checked with the present maximum beam current up to 13 eμA (∼1 kW beam power). (author)

  4. The hard X-ray shortages prompted by the clock bursts in GS 1826--238

    CERN Document Server

    Long, Ji; YuPeng, Chen; Shuang-Nan, Zhang; Diego, Torres F; Peter, Kretschmar; Jian, Li

    2013-01-01

    We report on a study of GS 1826--238 using all available {\\it RXTE} observations, concentrating on the behavior of the hard X-rays during type-I bursts. We find a hard X-ray shortage at 30--50 keV promoted by the shower of soft X-rays coming from type-I bursts. This shortage happens with a time delay after the peak of the soft flux of 3.6 $\\pm$ 1.2 seconds.The behavior of hard X-rays during bursts indicates cooling and reheating of the corona, during which a large amount of energy is required. We speculate that this energy originates from the feedback of the type-I bursts to the accretion process, resulting in a rapid temporary increase of the accretion rate.

  5. Analysis of (n,2n) cross-section measurements for nuclei up to mass 238

    International Nuclear Information System (INIS)

    All suitable measurements of the energy dependence of (n,2n) cross sections of all isotopes up to mass 238 have been analyzed. The objectives were to display the quality of the measured data for each isotope and to examine the systematic dependence of the (n,2n) cross section upon N, Z, and A. Graphs and tables are presented of the ratio of the asymptotic (n,2n) and nonelastic cross section to the neutron-asymmetry parameter (N--Z)/A. Similar data are presented for the derived nuclear temperature, T, and level-density parameter, α, as a function of N, Z, and A. This analysis of the results of over 145 experiments on 61 isotopes is essentially a complete review of the current status of (n,2n) cross-section measurements

  6. An overview of plutonium-238 decontamination and decommissioning (D and D) projects at Mound

    Energy Technology Data Exchange (ETDEWEB)

    Bond, W.H.; Davis, W.P.; Draper, D.G.; Geichman, J.R.; Harris, J.C.; Jaeger, R.R.; Sohn, R.L.

    1987-01-01

    Mound is currently decontaminating for restricted reuse and/or decommissioning for conditional release four major plutonium-238 contaminated facilities that contained 1700 linear feet of gloveboxes and associated equipment and services. Several thousand linear feet of external underground piping, associated tanks, and contaminated soil are being removed. Two of the facilities contain ongoing operations and will be reused for both radioactive and nonradioactive programs. Two others will be completely demolished and the land area will become available for future DOE building sites. An overview of the successful techniques and equipment used in the decontamination and decommissioning of individual pieces of equipment, gloveboxes, services, laboratories, sections of buildings, entire buildings, and external underground piping, tanks, and soil in a highly populated residential area is described and pictorially presented.

  7. Measurement of capture cross sections of 238U on the filtered keV-neutron beams

    International Nuclear Information System (INIS)

    Capture cross sections for the 238U(n,γ) reaction were measured related to that of the 197Au(n,γ) reaction on the filtered keV-neutron beams at the Dalat reactor using the activation method. Radioactivities of samples after irradiation were measured with HPGe detectors (50 mm2 sensitive area, FWHM = 150 eV for 55Fe and 70 cc volume, FWHM = 2.5 keV at 1332 keV γ-transition of 60Co). The data obtained by the authors were compared with the evaluations in ENDF/B-VI and JEF-2 and also with the results from recent experimental works. (author). 12 refs, 1 fig., 4 tabs

  8. Dose-to-the-population exposure estimates for use of plutonium-238-powered artificial hearts

    International Nuclear Information System (INIS)

    Estimates of dose to the population from 238Pu-powered artificial hearts were developed using a calculational model called REPRIEVE. This model develops the projected user population by incorporating assumptions regarding future heart disease death rates, the fraction dying who would be eligible candidates for artificial hearts, population projections, beginning implant rates, death rates after implant due to natural causes, and deaths caused by device failure. The user population was characterized by age, sex, household description, employment status and occupation. Census data on household descriptions and special surveys in selected cities provided the information necessary to describe persons exposed during both household and public activities. These surveys further defined distance and time of contact factors for these persons. Calculations using a dosemetry computer code defined the relationships between distance and dose. The validity of these calculations has been substantiated by experimental measurements

  9. Dose-to-the-population exposure estimates for use of plutonium-238-powered artificial hearts

    Energy Technology Data Exchange (ETDEWEB)

    McKee, R.W.; Clark, L.L.; Cole, B.M.

    1976-09-01

    Estimates of dose to the population from /sup 238/Pu-powered artificial hearts were developed using a calculational model called REPRIEVE. This model develops the projected user population by incorporating assumptions regarding future heart disease death rates, the fraction dying who would be eligible candidates for artificial hearts, population projections, beginning implant rates, death rates after implant due to natural causes, and deaths caused by device failure. The user population was characterized by age, sex, household description, employment status and occupation. Census data on household descriptions and special surveys in selected cities provided the information necessary to describe persons exposed during both household and public activities. These surveys further defined distance and time of contact factors for these persons. Calculations using a dosemetry computer code defined the relationships between distance and dose. The validity of these calculations has been substantiated by experimental measurements.

  10. Microstructural damage produced by helium release from 238PuO2 pellets

    International Nuclear Information System (INIS)

    Grain separations and larger holes found in 90 percent-dense 238PuO2 pellets heated after aging indicated the pellets did not have sufficient interconnected porosity to release helium without microstructural damage. In contrast, 80 percent-dense pellets showed grain separations due to helium in only a few high-density regions. The damage in the 80 percent-dense pellets became evident after about 6 months aging and increased with increasing aging time. Confinement of the damage to the interiors of the high-density regions suggested a depletion of helium at the edges, possibly caused by grain boundary diffusion in the small-grained oxide at temperatures below thresholds for grain separation. 14 figs

  11. Neutron capture cross section measurements for 238U in the resonance region at GELINA

    Science.gov (United States)

    Kim, H. I.; Paradela, C.; Sirakov, I.; Becker, B.; Capote, R.; Gunsing, F.; Kim, G. N.; Kopecky, S.; Lampoudis, C.; Lee, Y.-O.; Massarczyk, R.; Moens, A.; Moxon, M.; Pronyaev, V. G.; Schillebeeckx, P.; Wynants, R.

    2016-06-01

    Measurements were performed at the time-of-flight facility GELINA to determine the 238U(n, γ) cross section in the resonance region. Experiments were carried out at a 12.5 and 60m measurement station. The total energy detection principle in combination with the pulse height weighting technique was applied using C6D6 liquid scintillators as prompt γ-ray detectors. The energy dependence of the neutron flux was measured with ionisation chambers based on the 10B(n, α) reaction. The data were normalised to the isolated and saturated 238U resonance at 6.67 eV. Special procedures were applied to reduce bias effects due to the weighting function, normalization, dead time and background corrections, and corrections related to the sample properties. The total uncertainty due to the weighting function, normalization, neutron flux and sample characteristics is about 1.5%. Resonance parameters were derived from a simultaneous resonance shape analysis of the GELINA capture data and transmission data obtained previously at a 42m and 150m station of ORELA. The parameters of resonances below 500 eV are in good agreement with those resulting from an evaluation that was adopted in the main data libraries. Between 500 eV and 1200 eV a systematic difference in the neutron width is observed. Average capture cross section data were derived from the experimental capture yield in the energy region between 3.5 keV and 90 keV. The results are in good agreement with an evaluated cross section resulting from a least squares fit to experimental data available in the literature prior to this work. The average cross section data derived in this work were parameterised in terms of average resonance parameters and included in a least squares analysis together with other experimental data reported in the literature.

  12. Studies of positron electron pair production in {sup 238}U + {sup 181}Ta

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, I.; Back, B.B.; Betts, R.R. [and others

    1995-08-01

    Following the completion of APEX in late 1993, a two-week run on the {sup 238}U + {sup 181}Ta system at 6.1 and 6.3 MeV/u with 1 mg/cm{sup 2} targets provided, for the first time, data in which the expected sharp sum-energy lines should appear. Data from previous experiments show evidence for sharp sum-energy lines at 625, 748 and 805 keV, observed at bombarding energies from 5.9 to 6.3 MeV/u. The 625- and 809-keV lines display the characteristics of equal-energy back-to-back emission whereas the 748-keV line shows a rather different behavior. In our measurements, average beam currents of 2-3 pnA from the ATLAS accelerator were used to bombard 1-mg/cm{sup 2} rolled {sup 181}Ta targets, the energy loss in which corresponds to the ranges of bombarding energies over which the sharp sum-energy lines were previously reported. A run at 5.95 MeV/u for {sup 238}U + {sup 181}Ta followed in May 1994. These data were analyzed extensively. Sum-energy spectra measured in coincidence with scattered ions in the range 20{degrees} < {theta} < 68{degrees}. No evidence is found for the sharp sum-energy lines reported previously and, depending on the scenario assumed for the production mechanism and kinematics of the pairs, upper limits on cross sections at the 90% confidence limit range from 10-100 times smaller than the values that can be deduced from the earlier reports. We are in the process of refining the data analysis and simulations of the apparatus in order to finalize these numbers for publication.

  13. 238 U, 232 Th and 40 K in wheat flour samples of Iraq markets

    Directory of Open Access Journals (Sweden)

    A. A.

    2014-09-01

    Full Text Available Introduction. Wheat flour is a nutritious type of food that is widely consumed by various age groups in Iraq. This study investigates the presence of long-lived gamma emitters in different type of wheat flour in Iraqi market. Materials and methods. Uranium ( 238 U, Thorium ( 232 Th and Potassium ( 40 K specific activity in (Bq/kg were measured in (12 different types of wheat flours that are available in Iraqi markets. The gamma spectrometry method with a NaI(Tl detector has been used for radiometric measurements. Also in this study we have calculated the internal hazard index, radium equivalent and absorbed dose rate in all samples. Results and discussion. It is found that the specific activity in wheat flour samples were varied from (1.086±0.0866 Bq/kg to (12.532±2.026 Bq/kg with an average (6.6025 Bq/kg for 238 U, For 232 Th From (0.126±0.066 Bq/kg to (4.298±0.388 Bq/kg with an average (1.9465Bq/kg and for 40 K from (41.842±5.875 Bq/kg to (264.729±3.843 Bq/kg with an average (133.097 Bq/kg. Also, it is found that the radium equivalent and the internal hazard index in wheat flour samples ranged from (3.4031 Bq/kg to (35.1523 Bq/kg with an average (19.6346 Bq/kg and from (0.0091 to (0.1219 with an average (0.0708 respectively. Conclusion. This study prove that the natural radioactivity and radiation hazard indices were lower than the safe.

  14. Assessment of uranium exposure from total activity and 234U:238U activity ratios in urine.

    Science.gov (United States)

    Nicholas, T; Bingham, D

    2011-03-01

    Radiation workers at Atomic Weapons Establishment (AWE) are monitored for uranium exposure by routine bioassay sampling (primarily urine sampling). However, the interpretation of uranium in urine and faecal results in terms of occupational intakes is difficult because of the presence of uranium due to intakes from environmental (dietary) sources. For uranium in urine data obtained using current analytical techniques at AWE, the mean, median and standard deviation of excreted uranium concentrations were 0.006, 0.002 and 0.012 μg per g creatinine, respectively. These values are consistent with what might be expected from local dietary intakes and the knowledge that occupational exposures at AWE are likely to be very low. However, some samples do exceed derived investigation levels (DILs), which have been set up taking account of the likely contribution from environmental sources. We investigate how the activity and isotopic composition of uranium in the diet affects the sensitivity of uranium in urine monitoring for occupational exposures. We conclude that DILs based on both total uranium in urine activity and also (234)U:(238)U ratios are useful given the likely variation in dietary contribution for AWE workers. Assuming a background excretion rate and that the enrichment of the likely exposure is known, it is possible to assess exposures using (234)U:(238)U ratios and/or total uranium activity. The health implications of internalised uranium, enriched to <5-8 % by mass (235)U, centre on its nephrotoxicity; the DILs for bioassay samples at AWE are an order of magnitude below the conservative recommendations made by the literature. PMID:21036806

  15. 238 U, 232 Th and 40 K in wheat flour samples of Iraq markets

    Directory of Open Access Journals (Sweden)

    Ali Abid Abojassim

    2015-05-01

    Full Text Available Introduction. Wheat flour is a nutritious type of food that is widely consumed by various age groups in Iraq. This study investigates the presence of long-lived gamma emitters in different type of wheat flour in Iraqi market. Materials and methods. Uranium (238 U, Thorium (232 Th and Potassium (40 K specific activity in (Bq/kg were measured in (12 different types of wheat flours that are available in Iraqi markets. The gamma spectrometry method with a NaI(Tl detector has been used for radiometric measurements. Also in this study we have calculated the internal hazard index, radium equivalent and absorbed dose rate in all samples. Results and discussion. It is found that the specific activity in wheat flour samples were varied from (1.086±0.0866 Bq/kg to (12.532±2.026 Bq/kg with an average (6.6025 Bq/kg for 238 U, For 232 Th From (0.126±0.066 Bq/kg to (4.298±0.388 Bq/kg with an average (1.9465Bq/kg and for 40 K from (41.842±5.875 Bq/kg to (264.729±3.843 Bq/kg with an average (133.097 Bq/kg. Also, it is found that the radium equivalent and the internal hazard index in wheat flour samples ranged from (3.4031 Bq/kg to (35.1523 Bq/kg with an average (19.6346 Bq/kg and from (0.0091 to (0.1219 with an average (0.0708 respectively. Conclusion. This study prove that the natural radioactivity and radiation hazard indices were lower than the safe.

  16. Application of Energy Window Concept in Doppler Broadening of {sup 238}U Cross Section

    Energy Technology Data Exchange (ETDEWEB)

    Khassnov, Azamat; Choi, Soo Young; Lee, Deok Jung [Ulsan National Institute of Science and Technology, Ulsan (Korea, Republic of)

    2014-10-15

    Currently, the NJOY code is used for construction and Doppler broadening of microscopic cross sections. There exist several methods or formalisms to produce microscopic cross sections and there are also different methods of Doppler broadening. In this paper, Multi-Level Breit-Wigner (MLBW) formalism and the Psi method are used for generation and Doppler broadening of the resonance cross section. Accuracy of the energy window concept applied MLBW (EW MLBW) Doppler broadened cross section was compared with that of the cross section generated by conventional MLBW (Con MLBW) formalism for {sup 2}38U isotope using MATLAB. The conventional method requires Doppler broadening of all resonances, including resonances far from the target energy point, which do not change much with respect to the temperature change. The energy window concept makes Doppler broadening possible with a smaller number of resonances neighboring to the energy point we are interested in, and just adds up 0 K temperature cross sections of other resonances. Multi-level Breit-Wigner formalism and the Doppler broadening method were used to construct microscopic cross sections of {sup 238}U at different temperatures. The energy window concept was applied only for the 1st resonance energy region (4.5∼11.2 eV). The energy window concept demonstrates high competitiveness because the relative differences were less than 0.0016% for all types of cross sections. The advantage of the energy window concept is that the number of resonances broadened for every energy point is significantly reduced, which allows a reduction of computation time by almost 45 % of Doppler broadening time of the cross section generation at temperatures higher than 0 K.

  17. Application of Energy Window Concept in Doppler Broadening of 238U Cross Section

    International Nuclear Information System (INIS)

    Currently, the NJOY code is used for construction and Doppler broadening of microscopic cross sections. There exist several methods or formalisms to produce microscopic cross sections and there are also different methods of Doppler broadening. In this paper, Multi-Level Breit-Wigner (MLBW) formalism and the Psi method are used for generation and Doppler broadening of the resonance cross section. Accuracy of the energy window concept applied MLBW (EW MLBW) Doppler broadened cross section was compared with that of the cross section generated by conventional MLBW (Con MLBW) formalism for 238U isotope using MATLAB. The conventional method requires Doppler broadening of all resonances, including resonances far from the target energy point, which do not change much with respect to the temperature change. The energy window concept makes Doppler broadening possible with a smaller number of resonances neighboring to the energy point we are interested in, and just adds up 0 K temperature cross sections of other resonances. Multi-level Breit-Wigner formalism and the Doppler broadening method were used to construct microscopic cross sections of 238U at different temperatures. The energy window concept was applied only for the 1st resonance energy region (4.5∼11.2 eV). The energy window concept demonstrates high competitiveness because the relative differences were less than 0.0016% for all types of cross sections. The advantage of the energy window concept is that the number of resonances broadened for every energy point is significantly reduced, which allows a reduction of computation time by almost 45 % of Doppler broadening time of the cross section generation at temperatures higher than 0 K

  18. The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium

    Energy Technology Data Exchange (ETDEWEB)

    Ketelaer, Jens

    2010-06-14

    The construction of TRIGA-TRAP and direct high-precision Penning trap mass measurements on rare-earth elements and americium: Nuclear masses are an important quantity to study nuclear structure since they reflect the sum of all nucleonic interactions. Many experimental possibilities exist to precisely measure masses, out of which the Penning trap is the tool to reach the highest precision. Moreover, absolute mass measurements can be performed using carbon, the atomic-mass standard, as a reference. The new double-Penning trap mass spectrometer TRIGA-TRAP has been installed and commissioned within this thesis work, which is the very first experimental setup of this kind located at a nuclear reactor. New technical developments have been carried out such as a reliable non-resonant laser ablation ion source for the production of carbon cluster ions and are still continued, like a non-destructive ion detection technique for single-ion measurements. Neutron-rich fission products will be available by the reactor that are important for nuclear astrophysics, especially the r-process. Prior to the on-line coupling to the reactor, TRIGA-TRAP already performed off-line mass measurements on stable and long-lived isotopes and will continue this program. The main focus within this thesis was on certain rare-earth nuclides in the well-established region of deformation around N {proportional_to} 90. Another field of interest are mass measurements on actinoids to test mass models and to provide direct links to the mass standard. Within this thesis, the mass of {sup 241}Am could be measured directly for the first time. (orig.)

  19. U-238, Th-232, K-40 along the main 3 km adit of the Baksan Neutrino Observatory

    International Nuclear Information System (INIS)

    Results of the U-238, Th-232, K-40 contents in the mountain rock samples along 3 km adit of the Baksan Neutrino Observatory are presented. Recommendations on selection of suitable site for the low-background underground laboratory are given

  20. A dispersive optical model potential for nucleon induced reactions on 238U nucleus with 15 coupled levels

    International Nuclear Information System (INIS)

    A new dispersive coupled-channel optical model potential (OMP) for 238U nucleus is presented. The derived OMP couples almost all 238U excited levels below 1 MeV of excitation energy, including the ground state, octupole, beta, gamma, and non-axial bands. The coupled-channel potential is based on a vibrational-rotational description of the target nucleus structure, where dynamic vibrations are considered as perturbations of the rigid rotor underlying structure. OMP parameters that show a smooth energy dependence and energy independent geometry were determined from fits to the available experimental database (including strength functions and scattering radius) for neutron and proton scattering. The energy range 0.001-200 MeV is covered. Derived high-quality OMP is used to calculate the reaction cross section and corresponding theoretical uncertainties in nucleon-induced reactions on U-238. Theoretical calculations are compared with available results derived from existing experimental data on total cross-sections and angular distributions measurements based on the Wick's limit. Reduction of the uncertainty of the calculated reaction cross-section for neutron-induced reactions on 238U is discussed. (author)

  1. Estimates of helium gas release in 238PuO 2 fuel particles for radioisotope heat sources and heater units

    Science.gov (United States)

    El-Genk, Mohamed S.; Tournier, Jean-Michel

    2000-06-01

    Release data of noble gases (Xe and Kr) from small-grain (7-40 μm), large-grain (⩾300 μm), and monocrystal UO 2 fuel particles, during isothermal irradiation up to 6.4 at.% and 2030 K are reviewed and their applicability to estimate helium release from 238PuO 2 fuel particles (⩾300 μm in diameter) is examined. Coated 238PuO 2 particles have recently been proposed for use in radioisotope power systems and heater units employed in planetary exploration missions. These fuel particles are intentionally sized and designed to prevent any adverse radiological effect and retain the helium gas generated by the radioactive decay of 238Pu, a desired feature for some planetary missions. Results suggest that helium release from large-grain (⩾300 μm) particles of K could be 80% but less than 7% at 1042 K, which is in general agreement with the experiments conducted at Los Alamos National Laboratory more than two decades ago. In these experiments, the helium gas release from small-grain (7-40 μm) 238PuO 2 fuel pellets has been measured during steady-state heating at temperatures up to 1886 K and ramp heating to 1723 K.

  2. Combined 238U/235U and Pb Isotopics of Planetary Core Material: The Absolute Age of the IVA Iron Muonionalusta

    Science.gov (United States)

    Brennecka, G. A.; Amelin, Y.; Kleine, T.

    2016-08-01

    We report a measured 238U/235U for the IVA iron Muonionalusta. This measured value requires an age correction of ~7 Myr to the previously published Pb-Pb age. This has major implications for our understanding of planetary core formation and cooling.

  3. Vertical flux of particulate organic carbon in the central South China Sea estimated from 234Th-238U disequilibria

    Institute of Scientific and Technical Information of China (English)

    MA Hao; ZENG Zhi; HE Jianhua; CHEN Liqi; YIN Mingduan; ZENG Shi; ZENG Wenyi

    2008-01-01

    234Th-238u disequilibria were applied to examine the particle dynamics in the euphotic zone of the central South China Sea during the spring 2002 cruise. The particulate organic carbon (POC), 234Th (including both dissolved and particulate) and 238U in the water column at three stations were determined. The profiles of 234Th/238U activity ratio at the three stations all showed consistent 234Th deficit as compared to 238U in the upper 100 m water column. Based on the profiles of the dissolved and particulate 234Th and a steady state box model, the dissolved 234Th scavenging rates, the particulate 234Th removal rates and their resident times were quantified. It was found that the POC downward export fluxes out of the upper 100 m euphotic zone ranged from 9.40 to 14.78 mmol.m-2.d-1. The results from this study provide new information for our understanding of carbon biogeochemical cycle in the South China Sea.

  4. Field analyses of 238U and 226Ra in two uranium mill tailings piles from Niger using portable HPGe detector

    International Nuclear Information System (INIS)

    The radioactivities of 238U and 226Ra in mill tailings from the U mines of COMINAK and SOMAÏR in Niger were measured and quantified using a portable High-Purity Germanium (HPGe) detector. The 238U and 226Ra activities were measured under field conditions on drilling cores with 600s measurements and without any sample preparation. Field results were compared with those obtained by Inductive Coupled Plasma Atomic Emission Spectroscopy (ICP-AES) and emanometry techniques. This comparison indicates that gamma-ray absorption by such geological samples does not cause significant deviations. This work shows the feasibility of using portable HPGe detector in the field as a preliminary method to observe variations of radionuclides concentration with the aim of identifying samples of interest. The HPGe is particularly useful for samples with strong secular disequilibrium such as mill tailings. - Highlights: • A portable HPGe was used in the field to quantify 238U and 226Ra in mill tailings. • 238U and 226Ra quantification was performed on samples with strong radioactive disequilibrium. • HPGe measurements are compared with results obtained on the same samples by ICP-AES and emanometry. • We show the vertical distributions of U and 226Ra measured in two ∼30 m mill tailings piles. • Portable HPGe can be used directly in the field to observe slight variations of content

  5. 6,6 '-bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo 1,2,4 triazine-3-yl) 2,2 ' bipyridine, an effective extracting agent for the separation of americium(III) and curium(III) from the lanthanides

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and the lanthanides(III) from nitric acid by 6,6'- bis (5,5,8,8-tetramethyl-5,6,7,8-tetra-hydro-benzo[1,2,4]triazine-3-yl)-[2,2'] bipyridine (CyMe4-BTBP) has been studied. Since the extraction kinetics were slow, N,N'-dimethyl-N,N'-di-octyl-2-(2-hexyl-oxy-ethyl)malonamide (DMDOHEMA) was added as a phase transfer reagent. With a mixture of 0.01 M CyMe4-BTBP + 0.25 M DMDOHEMA in n -octanol, extraction equilibrium was reached within 5 min of mixing. At a nitric acid concentration of 1 M, an americium(III) distribution ratio of approx. 10 was achieved. Americium(III)/lanthanide(III) separation factors between 50 (dysprosium) and 1500 (lanthanum) were obtained. Whereas americium(III) and curium(III) were extracted as di-solvates, the stoichiometries of the lanthanide(III) complexes were not identified unambiguously, owing to the presence of DMDOHEMA. In the absence of DMDOHEMA, both americium(III) and europium(III) were extracted as di-solvates. Back-extraction with 0.1 M nitric acid was thermodynamically possible but rather slow. Using a buffered glycolate solution of pH=4, an americium(III) distribution ratio of 0.01 was obtained within 5 min of mixing. There was no evidence of degradation of the extractant, for example, the extraction performance of CyMe4-BTBP during hydrolysis with 1 M nitric acid did not change over a two month contact. (authors)

  6. 238U(n, γ reaction cross section measurement with C6D6 detectors at the n_TOF CERN facility.

    Directory of Open Access Journals (Sweden)

    Mingrone F.

    2014-03-01

    Full Text Available The radiative capture cross section of 238U is very important for the developing of new reactor technologies and the safety of existing ones. Here the preliminary results of the 238U(n,γ cross section measurement performed at n_TOF with C6D6 scintillation detectors are presented, paying particular attention to data reduction and background subtraction.

  7. Impact of the cation distribution homogeneity on the americium oxidation state in the U0.54Pu0.45Am0.01O2-x mixed oxide

    Science.gov (United States)

    Vauchy, Romain; Robisson, Anne-Charlotte; Martin, Philippe M.; Belin, Renaud C.; Aufore, Laurence; Scheinost, Andreas C.; Hodaj, Fiqiri

    2015-01-01

    The impact of the cation distribution homogeneity of the U0.54Pu0.45Am0.01O2-x mixed oxide on the americium oxidation state was studied by coupling X-ray diffraction (XRD), electron probe micro analysis (EPMA) and X-ray absorption spectroscopy (XAS). Oxygen-hypostoichiometric Am-bearing uranium-plutonium mixed oxide pellets were fabricated by two different co-milling based processes in order to obtain different cation distribution homogeneities. The americium was generated from β- decay of 241Pu. The XRD analysis of the obtained compounds did not reveal any structural difference between the samples. EPMA, however, revealed a high homogeneity in the cation distribution for one sample, and substantial heterogeneity of the U-Pu (so Am) distribution for the other. The difference in cation distribution was linked to a difference in Am chemistry as investigated by XAS, with Am being present at mixed +III/+IV oxidation state in the heterogeneous compound, whereas only Am(IV) was observed in the homogeneous compound. Previously reported discrepancies on Am oxidation states can hence be explained by cation distribution homogeneity effects.

  8. Structure of 4He and 4Li and decay of the giant resonances in 238U

    International Nuclear Information System (INIS)

    With the p(α, 3He p)n reaction it has been succeeded for the first time to produce 4Li really. The total cross section of this reaction could be described consistently regarding the sequential decay of states in the α particle, in 4Li, and the p-n final-state interaction for all measured spectra. For the excitation of the low-lying L=1 1- and 2- states in the α(p, p')α and the α(p, n)4Li reaction cross sections were extracted. These values are consistent with predictions from DWBA calculations for a one-particle transition from the s into the p shell. The found values for the resonance energies and the widths for the 2- ground state and the first excited 1- state of 4Li amount to Er = 3.4 MeV, γ2 = 1.0 MeV respectively Er = 5.7 MeV, γ2=1.5 MeV. With the coincident measurement of the 238U(α, α'f) reaction the decay of the giant quadrupole resonance was detected in the fission channel. (orig./HSI)

  9. Unattended Home Labor until Complete Cervical Dilatation Ending with Hospital Delivery: Analysis of 238 Pregnancies

    Directory of Open Access Journals (Sweden)

    Ozlem Gun Eryilmaz

    2013-01-01

    Full Text Available Objectives. Hospital fear and avoidance of the routine hospital obstetrical interventions cause some women with low-risk pregnancies to spend most of the active labor period at home, and subsequently they present to the hospital for delivery. Our aim was to analyze the maternal and neonatal outcomes of pregnancies with a planned hospital birth, yet spending the first stage of labor at home without a health provider and completing the delivery in the hospital setting. Methods. We retrospectively compared 238 pregnancies having home labor plus hospital delivery (study group with 476 pregnancies that had spent the whole labor in the hospital setting, considering various maternal and neonatal outcomes. Results. Cesarean and episiotomy rates were lower (P<0.0001 and P<0.001, resp., but neonatal intensive care unit admissions of the infants were more prevalent (P<0.01 in the study group. Other maternal and neonatal outcomes including neonatal mortality were comparable. Conclusion. Although our preliminary data generally do support the safety of home active labor plus hospital delivery for low-risk pregnancies, the clinical implications of current data warrant further prospective trials.

  10. Production of 238PuO2 heat sources for the Cassini mission

    Science.gov (United States)

    George, Timothy G.; Foltyn, Elizabeth M.

    1998-01-01

    NASA's Cassini mission to Saturn, scheduled to launch in October, 1997, is perhaps the most ambitious interplanetary explorer ever constructed. Electric power for the spacecraft's science instruments and on-board computers will be provided by three radioisotope thermoelectric generators (RTGs) powered by 216 238PuO2-fueled General-Purpose Heat Source (GPHS) capsules. In addition, critical equipment and instruments on the spacecraft and Huygens probe will be warmed by 128 Light-Weight Radioisotope Heater Units (LWRHUs). Fabrication and assembly of the GPHS capsules and LWRHU heat sources was performed at Los Alamos National Laboratory (LANL) between January 1994 and September 1996. During this production campaign, LANL pressed and sintered 315 GPHS fuel pellets and 181 LWRHU pellets. By October 1996, NMT-9 had delivered a total of 235 GPHS capsules to EG&G Mound Applied Technologies (EG&G MAT) in Miamisburg, Ohio. EG&G MAT conditioned the capsules for use, loaded the capsules into the Cassini RTGs, tested the RTGs, and coordinated transportation to Kennedy Space Center (KSC). LANL also fabricated and assembled a total of 180 LWRHUs. The LWRHUs required for the Cassini spacecraft were shipped to KSC in mid-1997.

  11. Derivation of ingestion dose conversion factors for the U-238 decay series

    International Nuclear Information System (INIS)

    Dose conversion factors (DCF's) for the U-238 decay series were derived for use in the assessment of potential doses to man, through several ingestion pathways, by radionuclide deposition from radioactive airborne effluents. The methodology used, although similar to that outlined in the U.S. Nuclear Regulatory Commission's Regulatory Guide 1.109, is complicated by consideration of the ingrowth of decay products. Eight ingestion pathways were considered: (1) fresh vegetables, (2) stored vegetables, (3) milk from cows that eat pasture grass, (4) milk from cows that eat stored feed, (5) goat milk - pasture grass, (6) goat milk - stored feed, (7) beef - pasture grass, and (8) beef - stored feed. Radionuclide deposition was assumed to occur for the entire operational lifetime of the facility. Because the expected operational lifetime may vary from facility to facility, DCF's were calculated for six lifetimes: 10, 15, 20, 25, 30, and 35 years. DCF's were calculated for each of 13 'parent' nuclides in the decay series, with each DCF considering the ingrowth of all subsequent nuclides in the series. The methodology used to derive the DCF's is detailed, and DCF's normalized to a deposition rate of the parent nuclide of 1 μCi m-2 s-1 are reported. (author)

  12. Evaluation of correlating factors between {sup 238}U concentration measured in fine and course atmospheric particles

    Energy Technology Data Exchange (ETDEWEB)

    Peixoto, Claudia Marques; Jacomino, Vanusa Maria Feliciano; Barreto, Alberto Avelar; Dias, Vagner Silva, E-mail: cmp@cdtn.b, E-mail: vmfj@cdtn.b, E-mail: aab@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Dias, Fabiana Ferrari, E-mail: fdias@cnen.gov.b [Brazilian Nuclear Energy Commission (CNEN-/MG), Pocos de Caldas, MG (Brazil). Lab. de Pocos de Caldas (LAPOC)

    2009-07-01

    Air quality is ever more important in function of the enormous proportion of human actions that have affected the environment over the last two centuries. Particulate material is one among many pollutants that can cause great risk to human health and the environment. It can be classified as: Total Suspended Particles (TSP), defined simply as particles with less than 50 mum aerodynamic diameter (one group of these particles can be inhaled and may cause health problems, while others may unfavorably affect the population's quality of life, interfering in environmental conditions and impairing normal community activities); and Inhalable Particles (PM{sub 10}), defined as those particles with less than 10 mum aerodynamic diameter. These particles penetrate the respiratory system and can reach pulmonary alveoli due to their small size, causing serious health damage. The Nuclear Technology Development Center (CDTN) has monitored air quality around its installations since 2000. CDTN's Environmental Monitoring Program (EMP) includes monitoring radioactivity levels contained in atmospheric TSP. In order to optimize its program, CDTN is carrying out a study to estimate the correlation between concentrations of particulate material measured in TSP and those measured in PM{sub 10}, PI{sub 2.5} and PI{sub 1}, as well as determination of activity concentration for each controlled radionuclide in all parts. The objective of this study is to present preliminary results and report {sup 238}U activity concentration results. (author)

  13. High resolution photofission measurements in 238U and 232Th. Final report

    International Nuclear Information System (INIS)

    A novel technique for measuring the photofission cross section with very high photon energy resolution has been developed. The photons are obtained from selected resonances in the (p,γ) reaction on various light nuclei. The photon energy resolution approaches 200 eV in favorable cases. The photon energy spread at each (p,γ) resonance is approx.20 keV on the average. Measurements of the photo-fission cross sections of 232Th and 238U have been carried out in the energy range from 5.8 to 12 MeV. Intermediate structure has been found in both nuclei at excitation energies around 6 MeV. Various properties of this structure, such as average areas of resonances, their spacing, width, and the underlying bakground, as well as the experimental fission probability averaged over the intermediate structure have been found to agree with theoretical predictions based on a double-humped fission barrier. In the case of 232Th, the feature of this barrier, a rather high first hump and a deep secondary well, are quite different from those predicted by current theoretial barrier calculations. 13 refs., 4 figs., 3 tabs

  14. Fabrication of targets for transmutation of americium : synthesis of inertial matrix by sol-gel method. Procedure study on the infiltration of a radioactive solutions

    International Nuclear Information System (INIS)

    addition a new and unexpected phase formed by the reaction of americium with spinel during the high temperature synthesis process has been identified. This new phase could provide a unique menas to stabilise Am in one particular oxidation state. (Author)

  15. Sorption and diffusion of cobalt, nickel, strontium, iodine, cesium and americium in natural fissure surfaces and drill core cups studied by autoradiography, 3

    International Nuclear Information System (INIS)

    This report summarizes the studies on sorption and diffusion of Cs, Sr, Co, Ni, Am and I in common rocks in Finnish bedrock carried out in laboratory experiments. Samples used in these studies were sections of drill cores containing filled and unfilled natural fracture surfaces and drill cores with a diamond drilled longitudinal cavity in the middle of the sample (drill core cups). Samples originated from the two nuclear power plant sites in Finland: tonalite and mica gneiss from Olkiluoto in Eurajoki and rapakivi granite from Haestholmen in Loviisa. The water used in the experiments was synthetic groundwater spiked at a time with one of the radionuclides: Cs-134, Sr-90, Co-60, Ni-63, Am-241 and I-125. Contact times from one week to one year were used to evaluate time dependence of diffusion. An autoradiographic method was used for determination of the penetration depths and diffusion pathways of elements. For determination of diffusion coefficients a quantitative computerized autoradiographic method was used to get the concentration profiles of the radionuclides in the drill cores. Sorption on natural fracture surfaces was more effective than on freshly drilled core samples. Filling materials on natural fracture surfaces, except calcite, increased sorption. The distribution coefficients for drill core cups were about the same as those for unfilled natural fracture surfaces after a contact time of one week and the sorption tendency of radionuclides was: Ka(Cs) > Ka(Co) > Ka(Am) > Ka(Ni) > Ka(Sr) > Ka(I). Radionuclides were observed to penetrate into fissures of the rock matrix and high-capacity minerals. Strontium was found as far as 35 mm in a filled natural fracture surface sample of rapakivi granite after a contact time of one year. The corresponding values were 3.0 mm for cesium, 2.1 mm for cobalt and 2.6 mm for nickel. For americium no diffusion could be observed (a-values for strontium was 6.6 x 10-16-1.1 x 10-13 m2/s, for cesium 4.7 x 10-16-7.2 x 10-15 m2/s

  16. Tectonic and radioactivity impacts of 238U on groundwater-based drinking water at Gosa and Lugbe areas of Abuja, North Central Nigeria

    International Nuclear Information System (INIS)

    Tectonic contribution of activity level of 238U in groundwater-based drinking water in Gosa and Lugbe areas of Abuja was measured using inductively coupled plasma mass spectrometry (ICP-MS). The highest activity level of 2736 µBq L-1 reported in Lugbe borehole, whereas the lowest value of 443 µBq L-1 reported at Gosa borehole. The inhabitants permanently used water from the boreholes for daily consumption. The group receives 5.55 × 10-5 mSv of the annual collective effective dose due to 238U in drinking water. The radiological risks of 238U in the water samples were found to be low, typically in magnitude of 10-7 with cancer mortality value of 1.03 × 10-7 and morbidity value of 1.57 × 10-7. The chemical toxicity risk of 238U in drinking water over a lifetime consumption has a mean value of 4.0 × 10-3 μg kg-1 day-1. It could be that the human risk due to 238U content in groundwater supplies from ingestion may likely be the chemical toxicity of 238U as a heavy metal rather than radiological risk. Significantly, Lugbe subsurface may have developed some fractions of granitic strata that contributed to the distribution of radioactive of 238U in tectonically weak zones. (author)

  17. Solubility of {sup 238}U radionuclide from various types of soil in synthetic gastrointestinal fluids using “US in vitro” digestion method

    Energy Technology Data Exchange (ETDEWEB)

    Rashid, Nur Shahidah Abdul; Sarmani, Sukiman; Majid, Amran Ab.; Mohamed, Faizal; Siong, Khoo Kok, E-mail: khoo@ukm.edu.my [School of Applied Physics, Faculty of Science and Technology, Universiti Kebangsaan Malaysia (UKM), 43600 Bangi, Selangor (Malaysia)

    2015-04-29

    238U radionuclide is a naturally occuring radioactive material that can be found in soil. In this study, the solubility of 238U radionuclide obtained from various types of soil in synthetic gastrointestinal fluids was analysed by “US P in vitro” digestion method. The synthetic gastrointestinal fluids were added to the samples with well-ordered, mixed throughly and incubated according to the human physiology digestive system. The concentration of 238U radionuclide in the solutions extracted from the soil was measured using Induced Coupling Plasma Mass Spectrometer (ICP-MS). The concentration of 238U radionuclide from the soil samples in synthetic gastrointestinal fluids showed different values due to different homogenity of soil types and chemical reaction of 238U radionuclide. In general, the solubility of 238U radionuclide in gastric fluid was higher (0.050 – 0.209 ppm) than gastrointestinal fluids (0.024 – 0.050 ppm). It could be concluded that the US P in vitro digestion method is practicle for estimating the solubility of 238U radionuclide from soil materials and could be useful for monitoring and risk assessment purposes applying to environmental, health and contaminated soil samples.

  18. Time-dependent Hartree-Fock calculations for multinucleon transfer and quasifission processes in $^{64}$Ni+$^{238}$U reaction

    CERN Document Server

    Sekizawa, Kazuyuki

    2016-01-01

    Background: Multinucleon transfer (MNT) and quasifission (QF) processes are dominant processes in low-energy collisions of two heavy nuclei. They are expected to be useful to produce neutron-rich unstable nuclei. Nuclear dynamics leading to these processes depends sensitively on nuclear properties such as deformation and shell structure. Purpose: We elucidate reaction mechanisms of MNT and QF processes involving heavy deformed nuclei, making detailed comparisons between microscopic TDHF calculations and measurements for $^{64}$Ni+$^{238}$U reaction. Methods: Three-dimensional Skyrme-TDHF calculations are performed. Particle-number projection method is used to evaluate MNT cross sections from the TDHF wave function after collision. Results: Fragment masses, total kinetic energy (TKE), scattering angle, contact time, and MNT cross sections are investigated for $^{64}$Ni+$^{238}$U reaction. They show reasonable agreements with measurements. At small impact parameters, collision dynamics depends sensitively on th...

  19. Measurement and analysis of the 238U(n, 2n) reaction rate in depleted uranium/polyethylene shells

    Institute of Scientific and Technical Information of China (English)

    YAN Xiao-Song; LIU Rong; LU Xin-Xin; JIANG Li; WEN Zhong-Wei; HAN Zi-Jie

    2012-01-01

    In order to check the conceptual design of the subcritical blanket in a fnsion-fission hybrid reactor,a depleted uranium/polyethylene simulation device with alternate shells has been established.The measurement of the 238U(n,2n) reaction rate was carried out using an activation technique,by measuring the 208 keV γ rays emitted from 237 U.The self-absorption of depleted uranium foils with different thicknesses was experimentally corrected.The distribution of the 238U(n,2n) reaction rate at 90° to the incident D+ beam was obtained,with uncertainty between 5.3% and 6.0%.The experiment was analyzed using MCNP5 code with the ENDF/BVI library,and the calculated results are all about 5% higher than the measured results.

  20. Comparison of measured and calculated 238U capture self-indication ratios from 4 to 10 keV

    International Nuclear Information System (INIS)

    From 4 keV to 149 keV the 238U cross sections are represented in ENDF/B-V by unresolved-resonance parameters (URP). The purpose of this representation is to enable the calculation of resonance self-protection as a function of temperature and dilution. Since the URPs are not defined unambiguously by the cross-section data, it is important that the unresolved representation be tested with appropriate experiments, such as capture self-indication ratio (SIR) measurements. In this paper we compare 238U capture SIR measurements in the 4- to 10-keV energy range with calculations done with ENDF/B-V and with recently published resolved resonance parameters

  1. Effect of heat treatment on microstructure, mechanical properties and erosion resistance of cast 23-8-N nitronic steel

    International Nuclear Information System (INIS)

    Effects of heat treatment on microstructure, mechanical properties and erosion behavior of cast 23-8-N nitronic steel were studied. A series of heat treatments were carried out in the temperature range of 1180–1240 °C to observe the effect on microstructure. Optimum heat treatment cycle was obtained at 1220 °C for holding time of 150 min, which leads to dissolution of carbides, formation of equiaxed grains and twins. Heat treatment has shown improvement in tensile strength, toughness, impact strength and work hardening capacity, however at the cost of marginal reduction in hardness and yield strength. This resulted in improvement of erosion resistance of cast 23-8-N nitronic steel. The microstructures, fractured surfaces and phases were studied by optical microscopy, field emission scanning electron microscopy (FESEM) and X-ray diffraction (XRD) analysis respectively

  2. Measurement and analysis of the 238U (n, 2n) reaction rate in depleted uranium/polyethylene shells

    International Nuclear Information System (INIS)

    In order to check the conceptual design of the subcritical blanket in a fusion-fission hybrid reactor, a depleted uranium/polyethylene simulation device with alternate shells has been established. The measurement of the 238U (n, 2n) reaction rate was carried out using an activation technique, by measuring the 208 keV γ rays emitted from 237U. The self-absorption of depleted uranium foils with different thicknesses was experimentally corrected. The distribution of the 238U (n, 2n) reaction rate at 90° to the incident D+ beam was obtained, with uncertainty between 5.3% and 6.0%. The experiment was analyzed using MCNP5 code with the ENDF/BVI library, and the calculated results are all about 5% higher than the measured results. (authors)

  3. Report to the 238U discrepancy task force on SIOB fits to the ORNL, CBNM, and JAERI transmission data

    International Nuclear Information System (INIS)

    The computer code SIOB has been used to obtain least-squares simultaneous-sample shape fits to the recent 238U transmission data of ORNL, CBNM, and JAERI over the energy regions 1460 to 1820 eV, 2470 to 2740 eV, and 3820 to 4000 eV. The fits indicate that much of the systematic discrepancy in the published neutron widths from these data arose in the data analysis procedure. Except for the 3820- to 4000-eV JAERI data, the systematic differences in the resulting neutron widths from the present widths are larger than those contained in any existing evaluation. These fits were performed as part of the work for the NEANDC ad hoc 238U Discrepancy Task Force. 20 references

  4. Investigation of the {sup 236}U/{sup 238}U isotope abundance ratio in uranium ores and yellow cake samples

    Energy Technology Data Exchange (ETDEWEB)

    Srncik, M. [Vienna Univ. (Austria). Dept. of Inorganic Chemistry; European Commission, Joint Research Centre, Karlsruhe (Germany). Institute for Transuranium Elements; Mayer, K.; Hrnecek, E.; Wallenius, M.; Varga, Z. [European Commission, Joint Research Centre, Karlsruhe (Germany). Institute for Transuranium Elements; Steier, P. [Vienna Univ. (Austria). VERA Lab.; Wallner, G. [Vienna Univ. (Austria). Dept. of Inorganic Chemistry

    2011-07-01

    Uranium ores and yellow cake samples of known geographic origin were investigated for their n({sup 236}U)/n({sup 238}U) isotope abundance ratio. Samples from four different uranium mines in Australia, Brazil and Canada were selected. Uranium was separated by UTEVA {sup registered} Resin and was measured by Accelerator Mass Spectrometry (AMS) at the Vienna Environmental Research Accelerator (VERA). The measurement of the isotope abundance ratio n({sup 236}U)/n({sup 238}U) will be used to investigate possible correlations between the original mineral (uranium ore) and the intermediate product (yellow cake). Such correlations are useful indicators for nuclear forensic or for non-proliferation purposes. (orig.)

  5. Revisiting the U-238 thermal capture cross section and gamma-raymission probabilities from Np-239 decay

    Energy Technology Data Exchange (ETDEWEB)

    Trkov, A.; Molnar, G.L.; Revay, Zs.; Mughabghab, S.F.; Firestone,R.B.; Pronyaev, V.G.; Nichols, A.L.; Moxon, M.C.

    2005-03-03

    The precise value of the thermal capture cross section of238U is uncertain, and evaluated cross sections from various sourcesdiffer by more than their assigned uncertainties. A number of theoriginal publications have been reviewed to assess the discrepant data,corrections were made for more recent standard cross sections andotherconstants, and one new measurement was analyzed. Due to the strongcorrelations in activation measurements, the gamma-ray emissionprobabilities from the beta decay of 239Np were also analyzed. As aresult of the analysis, a value of 2.683 +- 0.012 barns was derived forthe thermal capture cross section of 238U. A new evaluation of thegamma-ray emission probabilities from 239Np decay was alsoundertaken.

  6. Assessment of 238Pu and 239+240Pu, in marine sediments of the oceans Atlantic and Pacific of Guatemala

    International Nuclear Information System (INIS)

    In this investigation samples of marine sediments were taken from 14 places representatives of the oceans coast of Guatemala. For the assesment of 238Pu and 239+240Pu in sediments a radiochemical method was used to mineralize sediments and by ionic interchange it was separated from other elements, after that an electrodeposition of plutonium was made in metallic discs. The radioactivity of plutonium was measured by alpha spectrometry system and the alpha spectrums were obtained. The levels of plutonium are not higher than other countries that shown contamination. The contamination of isotope of 239+240Pu is higher than 238Pu and the contamination by two isotopes of plutonium is higher in the Atlantic than the Pacific ocean

  7. Evaluation of Aqueous and Powder Processing Techniques for Production of Pu-238-Fueled General Purpose Heat Sources

    Energy Technology Data Exchange (ETDEWEB)

    2008-06-01

    This report evaluates alternative processes that could be used to produce Pu-238 fueled General Purpose Heat Sources (GPHS) for radioisotope thermoelectric generators (RTG). Fabricating GPHSs with the current process has remained essentially unchanged since its development in the 1970s. Meanwhile, 30 years of technological advancements have been made in the fields of chemistry, manufacturing, ceramics, and control systems. At the Department of Energy’s request, alternate manufacturing methods were compared to current methods to determine if alternative fabrication processes could reduce the hazards, especially the production of respirable fines, while producing an equivalent GPHS product. An expert committee performed the evaluation with input from four national laboratories experienced in Pu-238 handling.

  8. Absolute absorption cross-section measurements of ozone in the wavelength region 238-335 nm and the temperature dependence

    Science.gov (United States)

    Yoshino, K.; Freeman, D. E.; Esmond, J. R.; Parkinson, W. H.

    1988-01-01

    The absolute absorption cross-section of ozone has been experimentally determined at the temperatures 195, 228, and 295 K at several discrete wavelengths in the 238-335-nm region. The present results for ozone at 295 K are found to be in agreement with those of Hearn (1961). Absolute cross-section measurements of ozone at 195 K have confirmed previous (Freeman et al., 1984) relative cross-section measurements throughout the 240-335-nm region.

  9. Fission Fragment Angular Distribution measurements of 235U and 238U at CERN n_TOF facility

    Directory of Open Access Journals (Sweden)

    Leal-Cidoncha E.

    2016-01-01

    In order to measure the FFAD of neutron-induced reactions, a fission detection setup based on parallel-plate avalanche counters (PPACs has been developed and successfully used at the CERN-n_TOF facility. In this work, we present the preliminary results on the analysis of new 235U(n,f and 238U(n,f data in the extended energy range up to 200 MeV compared to the existing experimental data.

  10. American Chemical Society--238th National Meeting & Exposition. Novel small molecule therapeutics. 16-20 August 2009, Washington DC, USA.

    Science.gov (United States)

    Rotella, David P

    2009-10-01

    The Novel Small Molecule Therapeutics session of the American Chemical Society 238th National Meeting and Exposition, held in Washington DC, included topics covering new therapeutic developments in CNS, anti-infective, cardiovascular and anti-inflammatory applications. This conference report highlights selected presentations on PAR2 (protease-activated receptor 2) antagonists, adenosine and P2Y receptor agonists and antagonists, antimicrobials and neuroprotective compounds.

  11. Theoretical modeling of traveling wave reactor fed with non-irradiated and pre-irradiated 238U fuels

    International Nuclear Information System (INIS)

    This paper deals with a traveling wave reactor theoretically. The breeding/burning wave is generated by a continuous radial fuel shuffling. Two-dimensional cylindrical core geometry is considered and the fuel is assumed to drift in the radial direction, which corresponds to a continuous radial fuel shuffling in practice. A one-group diffusion equation coupled with a burn-up solution is set up. The burn-up solution is obtained numerically, where the actinide inventories are simplified as functions of neutron fluence only. The uranium-plutonium (U-Pu) conversion cycle with pure 238U or 238U with its irradiation descendants as fresh fuel is considered under conditions of a typical sodium cooled fast reactor with uranium metallic fuel loaded. The asymptotic problems are solved by a time-stepping iteration scheme and the radial stationary wave solution is obtained together with certain eigenvalue keff. As a particular feature of this paper, the 238U pre-irradiated fuel is distributed with different irradiation doses along the axial axis. The purpose of this treatment is to remedy the power shape deformation in the uniform fresh fuel case. The results of both non-irradiated and pre-irradiated fuel, as examples for the inward fuel drifting motion, are compared and discussed. (author)

  12. Investigation of the 238U(d ,p ) surrogate reaction via the simultaneous measurement of γ -decay and fission probabilities

    Science.gov (United States)

    Ducasse, Q.; Jurado, B.; Aïche, M.; Marini, P.; Mathieu, L.; Görgen, A.; Guttormsen, M.; Larsen, A. C.; Tornyi, T.; Wilson, J. N.; Barreau, G.; Boutoux, G.; Czajkowski, S.; Giacoppo, F.; Gunsing, F.; Hagen, T. W.; Lebois, M.; Lei, J.; Méot, V.; Morillon, B.; Moro, A. M.; Renstrøm, T.; Roig, O.; Rose, S. J.; Sérot, O.; Siem, S.; Tsekhanovich, I.; Tveten, G. M.; Wiedeking, M.

    2016-08-01

    We investigated the 238U(d ,p ) reaction as a surrogate for the n +238U reaction. For this purpose we measured for the first time the γ -decay and fission probabilities of *239U simultaneously and compared them to the corresponding neutron-induced data. We present the details of the procedure to infer the decay probabilities, as well as a thorough uncertainty analysis, including parameter correlations. Calculations based on the continuum-discretized coupled-channels method and the distorted-wave Born approximation (DWBA) were used to correct our data from detected protons originating from elastic and inelastic deuteron breakup. In the region where fission and γ emission compete, the corrected fission probability is in agreement with neutron-induced data, whereas the γ -decay probability is much higher than the neutron-induced data. We have performed calculations of the decay probabilities with the statistical model and of the average angular momentum populated in the 238U(d ,p ) reaction with the DWBA to interpret these results.

  13. Investigation of fission properties and evaporation residue measurement in the reactions using 238U target nucleus

    Directory of Open Access Journals (Sweden)

    Saro S.

    2011-10-01

    Full Text Available Fragment mass distributions for fission after full momentum transfer were measured in the reactions of 30Si,34,36 S,31P,40Ar + 238U at bombarding energies around the Coulomb barrier. Mass distributions change significantly as a function of incident beam energy. The asymmetric fission probability increases at sub-barrier energy. The phenomenon is interpreted as an enhanced quasifission probability owing to orientation effects on fusion and/or quasifission. The evaporation residue (ER cross sections were measured in the reactions of 30Si + 238U and 34S + 238U to obtain information on fusion. In the latter reaction, significant suppression of fusion was implied. This suggests that fission events different from compound nucleus are included in the masssymmetric fragments. The results are supported by a model calculation based on a dynamical calculation using Langevin equation, in which the mass distribution for fusion-fission and quasifission fragments are separately determined.

  14. {\\alpha}-accompanied cold ternary fission of $^{238-244}$Pu isotopes in equatorial and collinear configuration

    CERN Document Server

    Santhosh, K P; Priyanka, B

    2015-01-01

    The cold ternary fission of $^{238}$Pu, $^{240}$Pu, $^{242}$Pu and $^{244}$Pu isotopes, with $^{4}$He as light charged particle, in equatorial and collinear configuration has been studied within the Unified ternary fission model (UTFM). The fragment combination $^{100}$Zr+$^{4}$He+$^{134}$Te possessing the near doubly magic nuclei $^{134}$Te (N=82, Z=52) gives the highest yield in the alpha accompanied ternary fission of $^{238}$Pu. For the alpha accompanied ternary fission of $^{240}$Pu, $^{242}$Pu and $^{244}$Pu isotopes, the highest yield was found for the fragment combination with doubly magic nuclei $^{132}$Sn (N=82, Z=50) as the heavier fragment. The deformation and orientation of fragments have also been taken into account for the alpha accompanied ternary fission of $^{238-244}$Pu isotopes, and it has been found that in addition to closed shell effect, ground state deformation also plays an important role in determining the isotopic yield in the ternary fission process. The emission probability and ki...

  15. Alpha Spectrometry for Determination of 238U, 235U, 234U, 232Th and 230Th in Soil Sample

    International Nuclear Information System (INIS)

    Monitoring of radioactivity in soil around the nuclear power plant is important. In this study, the radioactivity of uranium and thorium isotopes in soil (NIST SRM 2709a) is analyzed by alpha spectrometry. Alpha spectrometry is a powerful analytical tool for the identification and assay of the alpha-emitting sources primarily due to its high counting efficiency, high sensitivity and low price. Another aim of this study is to present the extent of disequilibrium of 238U/234U and 238U/230Th. The soil sample was decomposed by a fusion technique, and the source for the alpha spectrometry was prepared by electrodeposition of an alpha-emitting nuclides onto a metallic substrate. In this work, uranium and thorium isotopes were chemically separated from a soil sample (NIST SRM 2709a) using chromatographic columns, and electrodeposited on a stainless steel disc to measure the radioactivity concentration of the isotopes with an alpha spectrometer. The ratio of 238U/234U for the soil sample was ca. 1 which is considered to be in secular equilibrium

  16. Performance analysis of coated 238PuO2 fuel particles compact for radioisotope heater units

    Science.gov (United States)

    Tournier, Jean-Michel; El-Genk, Mohamed S.

    2000-01-01

    A fuel form consisting of coated plutonia fuel particles dispersed in a graphite matrix is being investigated for use in Radioisotope Heater Units (RHUs). The fuel particles consist of a 238PuO2 kernel (300-1200 μm in diameter), a 5-μm PyC inner coating and a ZrC outer coating (>=10 μm). The latter, an extremely strong material at high temperatures, serves as a pressure vessel for maintaining the integrity of the fuel particle and containing the helium generated by radioactive decay. Parametric analyses compared the thermal powers of the coated particle fuel compact (CPFC) RHU and LWRHU. Both utilize Fine-Weave Pierced Fabric (FWPF) aeroshell and PyC insulation sleeves. During normal operation, the fuel temperature is ~800 K, but could reach as much as 1723 K during an accidental re-entry heating. Assuming full helium release, a single-size particle (500 μm) fuel compact would maintain its integrity at a temperature of 1723 K, after 10 years storage time before launch. When replacing the LWRHU fuel pellet, Pt-alloy clad and inner PyC insulation sleeve with CPFC, the calculated thermal power of the CPFC-RHU is 1.5, 2.3 and 2.4 times that of LWRHU, for 100%, 10%, and 5% helium release, respectively, with little change in total mass. A fuel compact using binary-size particles (300 and 1200 μm diameters) would deliver 15% more thermal power. A one-dimensional, transient thermal analysis of the CPFC-RHU showed that during accidental re-entry the maximum fuel temperature in the CPFC would be 1734 K. .

  17. Production of unknown neutron-rich isotopes in 238U collisions at near-barrier energy

    Science.gov (United States)

    Zhao, Kai; Li, Zhuxia; Zhang, Yingxun; Wang, Ning; Li, Qingfeng; Shen, Caiwan; Wang, Yongjia; Wu, Xizhen

    2016-08-01

    The production cross sections for primary and residual fragments with charge number from Z =70 to 120 produced in the collision of 238U at 7.0 MeV/nucleon are calculated by the improved quantum molecular dynamics (ImQMD) model incorporated with the statistical evaporation model (hivap code). The calculation results predict that about 60 unknown neutron-rich isotopes from elements Ra (Z =88 ) to Db (Z =105 ) can be produced with the production cross sections above the lower bound of 10-8 mb in this reaction. And almost all of the unknown neutron-rich isotopes are emitted at the laboratory angles θlab≤60°. Two cases, i.e., the production of the unknown uranium isotopes with A ≥244 and that of rutherfordium with A ≥269 , are investigated to understand the production mechanism of unknown neutron-rich isotopes. It is found that for the former case the collision time between two uranium nuclei is shorter and the primary fragments producing the residues have smaller excitation energies of ≤30 MeV and the outgoing angles of those residues cover a range of 30°-60°. For the latter case, a longer collision time is needed for a large number of nucleons being transferred and thus it results in higher excitation energies and smaller outgoing angles of primary fragments, and eventually results in a very small production cross section for the residues of Rf with A ≥269 which have a small interval of outgoing angles of θlab=40°-50°.

  18. Electromagnetic dissociation of 238U in heavy-ion collisions at 120 MeV/A

    International Nuclear Information System (INIS)

    This thesis describes a measurement of the heavy-ion induced electromagnetic dissociation of a 120 MeV/A 238U beam incident on five targets: 9Be, 27Al, natCu, natAg, and natU. Electromagnetic dissociation at this beam energy is essentially a two step process involving the excitation of a giant resonance followed by particle decay. At 120 MeV/A there is predicted to be a significant contribution of the giant quadrupole resonance to the EMD cross sections. The specific exit channel which was looked at was projectile fission. The two fission fragments were detected in coincidence by an array of solid-state ΔE-E detectors, allowing the changes of the fragments to be determined to within ± .5 units. The events were sorted on the basis of the sums of the fragments' charges, acceptance corrections were applied, and total cross sections for the most peripheral events were determined. Electromagnetic fission at the beam energy of this experiment always leads to a true charge sum of 92. Due to the imperfect resolution of the detectors, charge sums of 91 and 93 were included in order to account for all of the electromagnetic fission events. The experimentally observed cross sections are due to nuclear interaction processes as well as electromagnetic processes. Under the conditions of this experiment, the cross sections for the beryllium target are almost entirely due to nuclear processes. The nuclear cross sections for the other four targets were determined by extrapolation from the beryllium data using a geometrical scaling model. After subtraction of the nuclear cross sections, the resulting electromagnetic cross sections are compared to theoretical calculations based on the equivalent photon approximation. Systematic uncertainties are discussed and suggestions for improving the experiment are given

  19. 武汉市空气中~(238)U、~(226)Ra、~(232)Th放射性浓度估算

    Institute of Scientific and Technical Information of China (English)

    施锦华; 陈昌华

    1989-01-01

    本文报道武汉市空气中~(238)U、~(226)Ra、~(232)Th 放射性浓度的估算结果。空气中~(238)U、~(226)Ra、~(232)Th 的放射性浓度是根据地面空气中铀、镭、钍的主要天然来源是土壤粒子的再悬浮的假定,通过调查测量武汉市土壤中天然放射性核素含量和空气中含尘量,经计算后确定的。我们于1984年4—10月在武汉地区采集了60个土壤样品,调查测量了土壤中天然放射性核素含量,并根据在1981—1985年间采集的7346个空气粉尘样品测得的空气中含尘量,估算出武汉市空气中~(238)U、~(226)Ra 和~(232)Th 放射性浓度的五年平均值分别为24.0、18.9和28.7nBq/L。五年中以1983年的平均值最高,分别为30.4、23.9和36.2nBq/L。以1984和1985年的数据为例,空气中~(238)U、(226)Ra、~(232)Th 放射性浓度呈明显的季节性变化,两年中均以冬季为最高,夏季最低。在武汉市六个城区中,空气中~(238)U、~(226)Ra、~(232)Th 的放射性浓度,以青山区最高,武昌区最低。

  20. The metrological activity determination of 238 U and 230 Th by gamma spectrometry to industrial fuel-cycle application

    International Nuclear Information System (INIS)

    This work describes the difficulty for determining the activity of 238 U and 230 Th using gamma spectrometry due to the low gamma-ray emission probabilities of 92 and 67 keV, and, mainly, the associated high uncertainties about 13 and 11%, respectively. 230 Th is a 238 U daughter and it is product from uranium mills and refineries. 230 Th decays to 226 Ra and this decay has to be measured because these radionuclides are not in secular equilibrium with their daughter products, besides the gamma-energies have high uncertainties in the emission probabilities. These radionuclides, mostly 238 U, are important in the nuclear fuel-cycle, since the mining of uranium ore, where the nominal isotopic content of natural uranium is 99.27% of 238 U, until the irradiated fuel reprocessing, where this isotope, a fertile material, is recovered to be used again. The uranium and thorium are considered safeguarded nuclear materials and the metrology tries to calibrate and standardize these materials to improve the activity determination techniques applied in different fuel-cycle scopes. The essential characteristics of the safeguarded materials are low gamma energies (less than 100 keV) and emission probabilities but with high uncertainties. In this way, the metrology can contribute to homeland security defense against illicit nuclear trafficking with the identification and quantification of the safeguarded radionuclides such as uranium and thorium, using specific gamma window energy and high resolution planar or coaxial germanium detector. The efficiency curve is obtained from the reference source spectrum considering the photopeak areas corresponding the standard activities. This curve depends on radiation energy, sample geometry, photon attenuation (sample absorption and material absorption between sample-detector), dead time and sample-detector position. The metrological activity determinations of 238 U solid sources, and of 230 Th, in solution (5 ml flask), were performed using

  1. Americium behaviour in plastic vessels

    Energy Technology Data Exchange (ETDEWEB)

    Legarda, F.; Herranz, M. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Idoeta, R., E-mail: raquel.idoeta@ehu.e [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain); Abelairas, A. [Departamento de Ingenieria Nuclear y Mecanica de Fluidos, Escuela Tecnica Superior de Ingenieria de Bilbao, Universidad del Pais Vasco (UPV/EHU), Alameda de Urquijo s/n, 48013 Bilbao (Spain)

    2010-07-15

    The adsorption of {sup 241}Am dissolved in water in different plastic storage vessels was determined. Three different plastics were investigated with natural and distilled waters and the retention of {sup 241}Am by these plastics was studied. The same was done by varying vessel agitation time, vessel agitation speed, surface/volume ratio of water in the vessels and water pH. Adsorptions were measured to be between 0% and 70%. The adsorption of {sup 241}Am is minimized with no water agitation, with PET or PVC plastics, and by water acidification.

  2. On uncertainties and fluctuations of averaged neutron cross sections in unresolved resonance energy region for 235U, 238U, 239Pu

    International Nuclear Information System (INIS)

    This paper analyses the reasons for the differences which exist between group-averaged evaluated cross-section data from different evaluated data files for U235, U238 and Pu239 in the unresolved resonance energy region. (author)

  3. Dietary 232Th and 238U intakes for Japanese as obtained in a market basket study and contributions of imported foods to internal doses

    International Nuclear Information System (INIS)

    Thorium-232 and 238U contents in four food groups were measured by inductively coupled plasma mass spectrometry (ICP-MS). Daily intakes of 232Th and 238U for Japanese were estimated to 2.22 mBq and 15.5 mBq per person, respectively. Furthermore, preliminary estimations were made for the effects of imported foods on internal exposures for Japanese. (author). 16 refs., 1 fig., 3 tabs

  4. Effects on elevating cancer risk in population exposed to natural radionuclide 226Ra if parent radionuclide 238U is entered the body by inhalation or ingestion

    International Nuclear Information System (INIS)

    People have always been exposed to ionizing radiation originating from natural radionuclides including 238U, 40K, 232Th that exist in earths crust. Although received doses are small, due to the fact that threshold does not exist, there is a certain risk of developing cancer. Purpose of this study was to measure 238U concentrations in soil of Bela Crkva territory. Based on these measurements, risks of developing cancers are calculated using Monte Carlo method.(author)

  5. Estimation of radiation doses to member of the public in northern corridor of India from intake of naturally occurring radionuclide (238U) in drinking water

    International Nuclear Information System (INIS)

    In the present paper radiological quality in drinking water collected from northern corridor of India has been evaluated on the basis of 238U activity. Places considered under present study are distinctive for their geological point of view. Adsorptive stripping voltammetric (AdSV) technique has been used to estimate the total uranium content of water samples and then converted to 238U activity concentration using specific activity of 238U (12.356 mBq μg-1 of 238U) and used accordingly. The uranium concentration in water samples varies in a wide range from 0.15-251 μg L-1. These values are compared with safe limit values recommended for drinking water by WHO and USEPA. Most of the water samples are found to have uranium concentration below the safe limit of 30 μg L-1 (USEPA, 2003). Annual committed effective doses due to 238U was evaluated for the adult member of the public through the ingestion of the drinking water samples studied and compared with the reference level of the committed effective dose (100 μSv yr-1 recommended by the WHO. The dose due to 238U for all analysed samples of drinking water are in the range of 0.06-18.74 μSv yr-1 and found to be well below the reference level recommended by the WHO. (author)

  6. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation; Accion EURADOS para la determinacion de americio en craneo mediante medidas in-vivo y simulacion Monte Carlo

    Energy Technology Data Exchange (ETDEWEB)

    Lopez Ponte, M. A.; Navarro Amaro, J. F.; Perez Lopez, B.; Navarro Bravo, T.; Nogueira, P.; Vrba, T.

    2013-07-01

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  7. Cloning, Bioinformatics and Expression Analysis of sHSP23.8 Gene in Hevea brasiliensis%巴西橡胶树sHSP23.8基因的克隆、生物信息学及表达分析

    Institute of Scientific and Technical Information of China (English)

    李德军; 郭会娜; 邓治; 刘辉; 陈江淑; 姜达; 夏立琼; 夏志辉

    2015-01-01

    In this study, a full-length cDNA sequence of a small heat shock protein (sHSP) gene was cloned from Hevea brasiliensis with the RACE method. The full-length cDNA of HbsHSP23.8 was 1 002 bp in size with a 645 bp open reading frame, encoding a deduced polypeptide of 214 amino acids. The deduced protein showed high identity to plant sHSP23.8 proteins, therefore we named this genes as HbsHSP23.8. Bioinformatic analyses indicated that HbsHSP23.8 contained a conserved alpha-crystallin domains (ACD) domain, and was likely located in chloroplast. 19 phosphorylation sites were predicted within HbsHSP23.8, and the secondary structure of HbsHSP23.8 containedα-helix,β-turn, extended strand and random coil. Real time RT-PCR analysis indicated that HbsHSP23.8 was expressed in latex, barks, leaves, barks, male lfowers, female lfowers and an-thers. With the development of leaves, the HbsHSP23.8 expression showed a signiifcant change. In addition, the expression of HbsHSP23.8 was regulated by NaCl, drought, low temperature, ET and JA treatments, suggesting that HbsHSP23.8 might play important roles in stresses responses as well as ET and JA signals in rubber tree.%本文采用RACE技术,从巴西橡胶树中克隆到一个小热激蛋白基因。该基因全长cDNA为1002 bp,最长开放阅读框645 bp,预测编码蛋白包含214个氨基酸残基,与植物sHSP23.8蛋白具高度相似,将该基因命名为HbsHSP23.8。生物信息学分析显示, HbsHSP23.8具有α-晶体蛋白保守结构域,可能定位在叶绿体, HbsHSP23.8蛋白中预测到19个磷酸化位点。二级结构预测结果显示HbsHSP23.8由α螺旋、β转角、延伸链和随机卷曲组成。实时定量RT-PCR分析结果表明, HbsHSP23.8在巴西橡胶树胶乳、叶片、树皮、雄花、雌花、花药中均有表达。在橡胶树叶片不同发育时期, HbsHSP23.8表达存在明显变化。此外, HbsHSP23.8表达受高盐、干旱、低温、乙烯和茉莉酸处理调控,表明HbsHSP23.8可能

  8. Sequential isotopic determination of plutonium, thorium, americium and uranium in the air filter and drinking water samples around the WIPP site

    International Nuclear Information System (INIS)

    The simultaneous determination of actinides in air filter and water samples around the WIPP site have been demonstrated. The analytical method is based on the selective separation and purification by anion exchange and Eichrome-TEVA, TRU and DGA-resin followed by determination of actinides by alpha spectrometry. Counting sources for alpha spectrometric measurements were prepared by microcoprecipitation on neodymium fluoride (NdF3). Radiochemical yields were determined using 242Pu, 229Th, 243Am and 232U as tracers. The validation of the method is performed through the analysis of reference materials or participating in laboratory intercomparison programs. The plutonium concentrations in aerosols varied seasonally, being highest in spring and summer due to the spring-time enhanced wind-storm transportation of radioactive aerosols from the stratosphere to the troposphere. The 238Pu/239+240Pu activity ratio in the aerosol samples is typically close to that of global fallout from historic above-ground nuclear weapons testing. The results presented here indicate that the source of plutonium in the WIPP environment results mainly from global nuclear fallout and there is no evidence of increases in radiological contaminants in the region that could be attributed to releases from the WIPP. (author)

  9. 1.4MeV-5MeV中子诱发238U裂变产额测量%Fission Product Yield Measurement of 238 U Induced by 1.4-5 MeV Neutrons

    Institute of Scientific and Technical Information of China (English)

    李映映; 肖军; 王攀; 李子越; 汪超; 罗小兵

    2016-01-01

    238 U fission yield measurement has a significant meaning in nuclear data measurement .This thesis a-dopts1.4 MeV-5 MeV mono -energetic neutrons generated by 2.5 MeV proton electrostatic accelerator to stimulate 238U fission, and then measures the yield of fission product nuclide 135I、133I、105Ru and 91Sr through measuring fission product radioactivity .Neutron flux during irradiation process is determined by activation meth-od .Subsequently , this thesis analyzes multiple components influencing experiment measurement , including cor-rection on neutron′s multiple scattering and self -shielding effect in target head and sample on the basis of MC-NPX program as well as correction on sample′s self-absorption of γ-ray.Typical deviation of yield data is concluded as 3.5%.Finally, this thesis compares measurement consequences with existing fission yield data .%238 U裂变产额测量工作在核数据测量中有着重要意义,本工作利用2.5MeV质子静电加速器产生的1.4MeV-5MeV单能中子诱发238 U裂变,通过对裂变产物放射性的测量对裂变产物核素135 I、133 I、105 Ru和91 Sr的产额进行了测定。照射过程中中子通量用活化法确定。分析了影响实验测量的多个因素,包括用MCNPX程序对中子在靶头及样品中的多次散射和自屏蔽效应进行了修正,对γ射线在样品中的自吸收进行修正等。得到产额数据典型误差为3.5%,最后把测量结果与已有的裂变产额数据进行比对。

  10. Influences of parameter uncertainties within the ICRP-66 respiratory tract model: regional tissue doses for 239PuO2 and 238UO2/238U3O8.

    Science.gov (United States)

    Farfán, Eduardo B; Huston, Thomas E; Bolch, W Emmett; Vernetson, William G; Bolch, Wesley E

    2003-04-01

    This paper extends an examination of the influence of parameter uncertainties on regional doses to respiratory tract tissues for short-ranged alpha particles using the ICRP-66 respiratory tract model. Previous papers examined uncertainties in the deposition and clearance aspects of the model. The critical parameters examined in this study included target tissue depths, thicknesses, and masses, particularly within the thoracic or lung regions of the respiratory tract. Probability density functions were assigned for the parameters based on published data. The probabilistic computer code LUDUC (Lung Dose Uncertainty Code) was used to assess regional and total lung doses from inhaled aerosols of 239PuO2 and 238UO2/238U3O8. Dose uncertainty was noted to depend on the particle aerodynamic diameter. Additionally, dose distributions were found to follow a lognormal distribution pattern. For 239PuO2 and 238UO2/238U3O8, this study showed that the uncertainty in lung dose increases by factors of approximately 50 and approximately 70 for plutonium and uranium oxides, respectively, over the particle size range from 0.1 to 20 microm. For typical exposure scenarios involving both radionuclides, the ratio of the 95% dose fractile to the 5% dose fractile ranged from approximately 8-10 (corresponding to a geometric standard deviation, or GSD, of about 1.7-2) for particle diameters of 0.1 to 1 microm. This ratio increased to about 370 for plutonium oxide (GSD approximately 4.5) and to about 600 for uranium oxide (GSD approximately 5) as the particle diameter approached 20 microm. However, thoracic tissue doses were quite low at larger particle sizes because most of the deposition occurred in the extrathoracic airways. For 239PuO2, median doses from LUDUC were found be in general agreement with those for Reference Man (via deterministic LUDEP 2.0 calculations) in the particle range of 0.1 to 5 microm. However, median doses to the basal cell nuclei of the bronchial airways (BB

  11. Critical and shielding parametric studies with the Monte Carlo code TRIPOLI to identify the key points to take into account during the transportation of blanket assemblies with high ratio of americium

    International Nuclear Information System (INIS)

    In the framework of French research program on Generation IV sodium cooled fast reactor, one possible option consists in burning minor actinides in this kind of Advanced Sodium Technological Reactor. Two types of transmutation mode are studied in the world : the homogeneous mode of transmutation where actinides are scattered with very low enrichment ratio in fissile assemblies and the heterogeneous mode where fissile core is surrounded by blanket assemblies filled with minor actinides with ratio of incorporated actinides up to 20%. Depending on which element is considered to be burnt and on its content, these minor actinides contents imply constraints on assemblies' transportation between Nuclear Power Plants and fuel cycle facilities. In this study, we present some academic studies in order to identify some key constraints linked to the residual power and neutron/gamma load of such kind of blanket assemblies. To simplify the approach, we considered a modeling of a 'model cask' dedicated to the transportation of a unique irradiated blanket assembly loaded with 20% of Americium and basically inspired from an existent cask designed initially for the damaged fissile Superphenix assembly transport. Thermal calculations performed with EDF-SYRTHES code have shown that due to thermal limitations on cladding temperature, the decay time to be considered before transportation is 20 years. This study is based on explicit 3D representations of the cask and the contained blanket assembly with the Monte Carlo code TRIPOLI/JEFF3.1.1 library and concludes that after such a decay time, the transportation of a unique Americium radial blanket is feasible only if the design of our model cask is modified in order to comply with the dose limitation criterion. (author)

  12. Experimental Cross Sections for Reactions of Heavy Ions and 208Pb, 209Bi, 238U, and 248Cm Targets

    Energy Technology Data Exchange (ETDEWEB)

    Patin, Joshua B.

    2002-05-24

    The study of the reactions between heavy ions and {sup 208}Pb, {sup 209}Bi, {sup 238}U, and {sup 248} Cm targets was performed to look at the differences between the cross sections of hot and cold fusion reactions. Experimental cross sections were compared with predictions from statistical computer codes to evaluate the effectiveness of the computer code in predicting production cross sections. Hot fusion reactions were studied with the MG system, catcher foil techniques and the Berkeley Gas-filled Separator (BGS). 3n- and 4n-exit channel production cross sections were obtained for the {sup 238}U({sup 18}O,xn){sup 256-x}Fm, {sup 238}U({sup 22}Ne,xn){sup 260-x}No, and {sup 248}Cm({sup 15}N,xn){sup 263-x}Lr reactions and are similar to previous experimental results. The experimental cross sections were accurately modeled by the predictions of the HIVAP code using the Reisdorf and Schaedel parameters and are consistent with the existing systematics of 4n exit channel reaction products. Cold fusion reactions were examined using the BGS. The {sup 208}Pb({sup 48}Ca,xn){sup 256-x}No, {sup 208}Pb({sup 50}Ti,xn){sup 258-x}Rf, {sup 208}Pb({sup 51}V,xn){sup 259-x}Db, {sup 209}Bi({sup 50}Ti,xn){sup 259-x}Db, and {sup 209}Bi({sup 51}V,xn){sup 260-x}Sg reactions were studied. The experimental production cross sections are in agreement with the results observed in previous experiments. It was necessary to slightly alter the Reisdorf and Schaedel parameters for use in the HIVAP code in order to more accurately model the experimental data. The cold fusion experimental results are in agreement with current 1n- and 2n-exit channel systematics.

  13. Multi-modal calculations of prompt fission neutrons from 238U(n, f) at low induced energy

    Institute of Scientific and Technical Information of China (English)

    ZHENG Na; ZHONG Chun-Lai; FAN Tie-Shuan

    2011-01-01

    Properties of prompt fission neutrons from 238U(n,f) are calculated for incident neutron energies below 6 MeV using the multi-modal model,including the prompt fission neutron spectrum,the average prompt fission neutron multiplicity,and the prompt fission neutron multiplicity as a function of the fission fragment mass v(A) (usually named “sawtooth” data) The three most dominant fission modes are taken into account.The model parameters are determined on the basis of experimental fission fragment data.The predicted results are in good agreement with the experimental data.

  14. Determination of 238Pu and 239+240Pu in soils of different agricultural regions of Guatemala

    International Nuclear Information System (INIS)

    This study allowed to determine the concentration of radioactivity alpha, due to contamination for plutonium in cultivated soils of different regions of Guatemala. They were carried out samplings for convenience in cultivated soils of 15 departments of the republic, determined in each soils sample, the activity concentration for plutonium 238Plutonium and 239+240Plutonium expressed in mili-becquerel by kilogram (mBq/Kg), which has been caused from all over the world by the different provoked liberations or accidents of radioactive particles to the atmosphere

  15. 238例淋巴结病变针吸细胞学诊断分析

    Institute of Scientific and Technical Information of China (English)

    季晓华

    2004-01-01

    淋巴结病变的细针吸取细胞学检查(fine needle aspiration biopsy cytology,FNAC)较病理活检简便易行。省时。病人痛苦小。本文收集本院及一附院1993~2004年所作的淋巴结病变FNAC238例。分析其细胞学检查的结果,并与同期有病理活检诊断结果的116例进行了组织学诊断对比。

  16. Gamma Emission Spectra from Neutron Resonances in 234,236,238U Measured Using the Dance Detector at Lansce

    Science.gov (United States)

    Ullmann, J. L.; Bredeweg, T. A.; Couture, A. J.; Haight, R. C.; Jandel, M.; Kawano, T.; Keksis, A. L.; O'Donnell, J. M.; Rundberg, R. S.; Vieira, D. J.; Wouters, J. M.; Wilhelmy, J. B.; Wu, C. Y.; Becker, J. A.; Chyzh, A.; Baramsai, B.; Mitchell, G. E.; Krticka, M.

    2013-03-01

    An accurate knowledge of the radiative strength function and level density is needed to calculate of neutron-capture cross sections. An additional constraint on these quantities is provided by measurements of γ-ray emission spectra following capture. We present γ-emission spectra from several neutron resonances in 234,236,238U, measured using the DANCE detector at LANSCE. The measurements are compared to preliminary calculations of the cascade. It is observed that the generalized Lorentzian form of the E1 strength function cannot reproduce the shape of the emission spectra, but a better description is made by adding low-lying M1 Lorentzian strength.

  17. 238U, 232TH, AND 222RN concentration measured in various traditional medicinal plant preparation using nuclear track detectors

    International Nuclear Information System (INIS)

    Full text: 238U, 232Th, 222Rn concentrations were measured inside traditional medicinal plants preparations widely used by patients in classic and modern phyto therapy by using a technique based on the use of solid state nuclear track detectors. The intakes of these radionuclides have been determined for adult patients from the ingestion of the studied medical preparations. The influence of mass intake as well as pollution on the contents of the considered radionuclides was investigated. The resulting radiation doses to adult patients from the ingestion of the traditional medical preparations were evaluated.

  18. Transfer of 210Po, 210Pb and 238U from some medicinal plants to their essential oils

    International Nuclear Information System (INIS)

    Essential oils were extracted from 35 medicinal plants used by Syrians, organic compounds were determined in these oils and concentrations of 210Po 210Pb and 238U were determined in the original plants and in the essential oils. The results showed that the highest activity concentrations of 210Po and 210Pb were found in leaves with large surfaces and in Sage were as high as 73.5 Bq kg−1 and 73.2 Bq kg−1, respectively. The activity concentration of 238U was as high as 4.26 Bq kg−1 in Aloe. On the other hand, activity concentrations of 210Po ranged between 0.2 and 71.1 Bq kg−1 in extracted essential oils for Rosemary and False yellowhead, respectively. The activity concentration of 210Pb reached 63.7 Bq kg−1 in Aloe oil. The activity concentrations of 238U were very low in all extracted oils; the highest value was 0.31 Bq kg−1 in peel of Orange oil. The transfer of 210Po and 210Pb from plant to its oil was the highest for Eugenia; 7.1% and 5.5% for 210Po and 210Pb, respectively. A linear relationship was found between the transfer factor of radionuclides from plant to its essential oil and the chemical content of this oil. - Highlights: • Natural radionuclides 210Po, 210Pb and 238U were determined in 35 medicinal plants and their essential oils. • The highest activity concentration of 210Po and 210Pb were 73.5 Bq kg−1 and 73.2 Bq kg−1 in Sage, respectively. • The transfer of 210Po and 210Pb from Eugenia plant to its oil was the highest amongst other plants. • The data obtained in this study can be considered the first reported data for medicinal plants and their oils in Syria

  19. Effect of U-238 and U-235 cross sections on nuclear characteristics of fast and thermal reactors

    Energy Technology Data Exchange (ETDEWEB)

    Akie, Hiroshi; Takano, Hideki [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kaneko, Kunio

    1997-03-01

    Benchmark calculation has been made for fast and thermal reactors by using ENDF/B-VI release 2(ENDF/B-VI.2) and JENDL-3.2 nuclear data. Effective multiplication factors (k{sub eff}s) calculated for fast reactors calculated with ENDF/B-VI.2 becomes about 1% larger than the results with JENDL-3.2. The difference in k{sub eff} is caused mainly from the difference in inelastic scattering cross section of U-238. In all thermal benchmark cores, ENDF/B-VI.2 gives smaller multiplication factors than JENDL-3.2. In U-235 cores, the difference is about 0.3%dk and it becomes about 0.6% in TCA U cores. The difference in U-238 data is also important in thermal reactors, while there are found 0.1-0.3% different v values of U isotopes in thermal energy between ENDF/B-VI.2 and JENDL-3.2. (author)

  20. The inflow of 238Pu and 239+240Pu from the Vistula River catchment area to the Baltic Sea

    International Nuclear Information System (INIS)

    The aim of the work was to estimate plutonium inflow from the Vistula River's catchments area to the Baltic Sea. There were differences in plutonium activities depending on season and sampling site. The highest activities of 238Pu and 239+240Pu were transported from the Vistula River watershed to the Baltic Sea in spring and the lowest in summer. Annually, the southern Baltic Sea is enriched via the Vistula River with 10.3 MBq of 238Pu and 89.0 MBq of 239+240Pu. The enhanced concentration of plutonium in water from the Vistula River is the result of its runoff from the Vistula drainage area, mostly from snowmelt, enhanced rainfalls and leached materials from river bed. - Highlights: → We estimated plutonium inflow from the Vistula River catchment area to the Baltic Sea. → We found differences in Pu activities depending on season and sampling site. → The highest amount of 239 + 240Pu was transported in spring and the lowest in summer. → Annually, the southern Baltic Sea is enriched with 89.0 MBq of 239 + 240Pu. → Enhanced Pu amount in water came from snowmelt, rainfalls and leached materials.

  1. Determination of specific concentrations of {sup 40}K, {sup 238}U and {sup 232}Th in mineral fertilizer samples

    Energy Technology Data Exchange (ETDEWEB)

    Garcez, Ricardo W.D.; Lopes, Jose M.; Silva, Ademir X., E-mail: r.w.o.g@fisica.if.uff.br, E-mail: ademir@nuclear.ufrj.br [Coordenacao dos Programas de Pos-Graduacao em Engenharia (COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Programa de Engenharia Nuclear; Domingues, Alessandro M.; Lima, Marco F. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil)

    2015-07-01

    The use of fertilizer is an established practice worldwide to promote agricultural productivity increased without increasing the planted area, resulting in native forests protection and increase of the food availability. Some kinds of fertilizer have in their chemical composition some radionuclides due the origin of its feedstock, such as {sup 238}U, the {sup 232}Th, and their descendants, beyond {sup 40}K. Knowledge of the radioactivity levels in the environment is great importance to know the gamma radiation dose that the human being is exposed. For identification and quantitation of radionuclides, it was used gamma spectrometry where HPGe detector was used to obtain the spectra, and LabSOCS software for calculating the detection efficiency for each energy. The values of {sup 232}Th specific concentrations ranged from 4.1 to 368.1 Bq.Kg{sup -1}, the values of {sup 238}U specific concentrations ranged from 16.0 to 647.7 Bq.Kg{sup -1} and {sup 40}K specific concentrations ranged from 19.1 to 12713 Bq.Kg{sup -1}. Concentrations of values are consistent with those found in literature. (author)

  2. Origin and geochemical behavior of uranium in marine sediments. Utilization of the 234U/238U ratio in marine geochemistry

    International Nuclear Information System (INIS)

    The first part of this thesis presents the current situation of knowledge of uranium in marine environment. The second part describes the methods of analysis as well as the material support of the study, i.e., the sediments and marine deposits investigated. The third part is dedicated to the study of uranium mobility in marine sediments characterized by detrital terrigenous composition (pelagic clays). This approach allowed quantifying the entering and leaving flux of uranium after the sediment settling and, to discuss, on this basis, the consequences on the uranium oceanic balance. In the third part the origin and behavior of uranium in zones of high surface productivity is studied. The uranium enrichments observed in the hemi-pelagic sediments of the EUMELI (J.G.O.F.S.-France) programme will constitute a material of study adequate for measuring the variations in the 234U/238U ratio in solid phase, in response to the oxido-reducing characteristics of the sediment. Thus establishing the origin of the trapped uranium has been possible. Also, the nature of the sedimentary phases related to uranium in bio-genetic sediments in the Austral Ocean was determined. Thus a relationship between the variations in the 234U/238 and the diagenetic transformations was possible to establish. Finally in the fifth part a study of the behavior of uranium in a polymetallic shell characteristic for deposits of hydrogenized origin

  3. Fission Fragment Angular Distribution measurements of 235U and 238U at CERN n_TOF facility

    Science.gov (United States)

    Leal-Cidoncha, E.; Durán, I.; Paradela, C.; Tarrío, D.; Leong, L. S.; Tassan-Got, L.; Audouin, L.; Altstadt, S.; Andrzejewski, J.; Barbagallo, M.; Bécares, V.; Bečvář, F.; Belloni, F.; Berthoumieux, E.; Billowes, J.; Boccone, V.; Bosnar, D.; Brugger, M.; Calviani, M.; Calviño, F.; Cano-Ott, D.; Carrapiço, C.; Cerutti, F.; Chiaveri, E.; Chin, M.; Colonna, N.; Cortés, G.; Cortés-Giraldo, M. A.; Diakaki, M.; Domingo-Pardo, C.; Dressler, R.; Dzysiuk, N.; Eleftheriadis, C.; Ferrari, A.; Fraval, K.; Ganesan, S.; García, A. R.; Giubrone, G.; Gómez-Hornillos, M. B.; Gonçalves, I. F.; González-Romero, E.; Griesmayer, E.; Guerrero, C.; Gunsing, F.; Gurusamy, P.; Hernández-Prieto, A.; Jenkins, D. G.; Jericha, E.; Kadi, Y.; Käppeler, F.; Karadimos, D.; Kivel, N.; Koehler, P.; Kokkoris, M.; Krtička, M.; Kroll, J.; Lampoudis, C.; Langer, C.; Lederer, C.; Leeb, H.; Lo Meo, S.; Losito, R.; Mallick, A.; Manousos, A.; Marganiec, J.; Martínez, T.; Massimi, C.; Mastinu, P. F.; Mastromarco, M.; Meaze, M.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Mirea, M.; Mondelaers, W.; Pavlik, A.; Perkowski, J.; Plompen, A.; Praena, J.; Quesada, J. M.; Rauscher, T.; Reifarth, R.; Riego, A.; Robles, M. S.; Roman, F.; Rubbia, C.; Sabaté-Gilarte, M.; Sarmento, R.; Saxena, A.; Schillebeeckx, P.; Schmidt, S.; Schumann, D.; Tagliente, G.; Tain, J. L.; Tsinganis, A.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Versaci, R.; Vermeulen, M. J.; Vlachoudis, V.; Vlastou, R.; Wallner, A.; Ware, T.; Weigand, M.; Weiß, C.; Wright, T.; Žugec, P.

    2016-03-01

    Neutron-induced fission cross sections of 238U and 235U are used as standards in the fast neutron region up to 200 MeV. A high accuracy of the standards is relevant to experimentally determine other neutron reaction cross sections. Therefore, the detection effciency should be corrected by using the angular distribution of the fission fragments (FFAD), which are barely known above 20 MeV. In addition, the angular distribution of the fragments produced in the fission of highly excited and deformed nuclei is an important observable to investigate the nuclear fission process. In order to measure the FFAD of neutron-induced reactions, a fission detection setup based on parallel-plate avalanche counters (PPACs) has been developed and successfully used at the CERN-n_TOF facility. In this work, we present the preliminary results on the analysis of new 235U(n,f) and 238U(n,f) data in the extended energy range up to 200 MeV compared to the existing experimental data.

  4. E1 transition probabilities from K/sup π/ = 0- and K/sup π/ = 1- states of 238Pu

    International Nuclear Information System (INIS)

    Levels of 238Pu were studied in the β- decay of 238Np and the α decay of 242Cm. Thirteen γ-ray transitions were observed for the first time, and additional information about multipolarities and mixing ratios was obtained. An analysis of the γ-ray branching ratios gives a measure of the E1 transition probabilities between octupole-vibrational states and the ground-state band, corresponding to F/sub W/ = 4.3 x 104 for ΔK = 1 transitions and F/sub W/ = 1.5 x 104 for ΔK = 0. The latter transitions are three orders of magnitude faster than those that occur in the isotone 236U, for which F/sub W/(ΔK = 0) = 2.2 x 107, from a direct measurement of the half-life of the 0,1- state. Estimates of the hindrance factors for E1 transitions from octupole states in other heavy nuclei are given, and the validity of the calculations on which they are based is discussed

  5. Primordial radioactivity ((238)U, (232)Th and (40)K) measurements for soils of Ludhiana district of Punjab, India.

    Science.gov (United States)

    Badhan, K; Mehra, R

    2012-11-01

    The aim of the present work was to study the activity concentration and absorbed gamma dose rates due to primordial radionuclides ((238)U, (232)Th and (40)K) for the soil of different villages of Ludhiana district of Punjab, India using a high-purity germanium detector based on high resolution gamma-ray spectrometry. The average activity concentrations of (238)U, (232)Th and (40)K in the soil samples have been found to be 28.58, 50.95 and 569.59 Bq kg(-1), respectively, which gives the total gamma dose rate contribution of 68.50 nGy h(-1). To evaluate the radiological hazard of the natural radioactivity, the radium equivalent activity, the external hazard index, the absorbed dose rate and the effective dose rate have been calculated. The calculated radium equivalent activity values are on the lower side of the recommended safe limit value of 370 Bq kg(-1) by Organization of Economic and Control Department. The calculated value of external health hazard index is lower than unity. PMID:22899219

  6. Resolved-resonance neutron widths from a consistent reanalysis of the most recent 238U transmission data

    International Nuclear Information System (INIS)

    The 238U neutron differential capture cross sections are one of the most important nuclear data for reactor physics calculations. Nevertheless, differential data have persistently over-predicted the ratio of the 238U capture rate relative to the 239Pu fission rate in fast-reactor spectra as measured by integral experiments. One of the possible ways of perhaps reducing this discrepancy is to extend the theoretically sound resolved-resonance range upwards in energy from the present 4 to 10 keV. One of the major obstacles to such an extension is the published discrepancies among the resolved-resonance region neutron widths from 1 to 4 keV from the three most recent transmission measurements and analysis: the 1978 results of Olsen from Oak Ridge National Laboratory (ORNL); the 1975 results of Poortmans from the Central Bureau of Nuclear Measurements (CBNM) in Belgium; and the 1975 results of Nakajima from the Japan Atomic Energy Research Institute (JAERI). In this paper, the results of a detailed reanalysis of the three recent transmission measurements over three narrow energy regions are reported: region 1, 3820 to 4000 eV, six large resonances; region 2, 2470 to 2740 eV, ten large resonances; and region 3, 1460 to 1820 eV, twelve large resonances

  7. Measurements of /sup 234/U, /sup 238/U and /sup 230/Th in excreta of uranium-mill crushermen

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, D.R.; Jackson, P.O.; Brodacynski, G.G.; Scherpelz, R.I.

    1982-07-01

    Uranium and thorium levels in excreta of uranium mill crushermen who are routinely exposed to airborne uranium ore dust were measured. The purpose was to determine whether /sup 230/Th was preferentially retained over either /sup 234/U or /sup 238/U in the body. Urine and fecal samples were obtained from fourteen active crushermen with long histories of exposure to uranium ore dust, plus four retired crushermen and three control individuals for comparison. Radiochemical procedures were used to separate out the uranium and thorium fractions, which were then electroplated on stainless steel discs and assayed by alpha spectrometry. Significantly greater activity levels of /sup 234/U and /sup 238/U were measured in both urine and fecal samples obtained from uranium mill crushermen, indicating that uranium in the inhaled ore dust was cleared from the body with a shorter biological half-time than the daughter product /sup 230/Th. The measurements also indicated that uranium and thorium separate in vivo and have distinctly different metabolic pathways and transfer rates in the body. The appropriateness of current ICRP retention and clearance parameters for /sup 230/Th in ore dust is questioned.

  8. Erosion behaviour of WC-10Co-4Cr coating on 23-8-N nitronic steel by HVOF thermal spraying

    Science.gov (United States)

    kumar, Avnish; Sharma, Ashok; Goel, S. K.

    2016-05-01

    WC-10Co-4Cr coating was deposited by high-velocity oxy-fuel (HVOF) process on cast and solution treated (1220 °C/150 min) 23-8-N nitronic steel substrates. Solution treated substrate has shown higher toughness, ductility and impact energy with a marginal reduction in hardness as compared to cast substrate. This influence the coating deposition efficiency and erosion behaviour. Erosion resistance of coatings was evaluated by air jet erosion tester on two different impact angles (30° and 90°). Phases, microstructure and eroded surface of the coating were characterised by X-ray diffraction (XRD) analysis and field-emission scanning electron microscopy (FESEM) respectively. It is observed that coating on solution treated substrate was superior to cast substrate. The reason being that coating has dense and well-bonded structure with low porosity, less decarburization and inter-splat oxidation. Higher erosion resistance of coated solution treated 23-8-N nitronic steel was attributed to combination of high fracture toughness and hardness of coating including optimum mechanical properties of the substrate. FESEM analysis reveals that erosion response of WC-10Co-4Cr coating also dependent on the relative size of the impact crater with respect to the WC grain size. Coating is removed by combined mode of ductile and brittle erosion.

  9. Trace metal cycling and 238U/235U in New Zealand's fjords: Implications for reconstructing global paleoredox conditions in organic-rich sediments

    Science.gov (United States)

    Hinojosa, Jessica L.; Stirling, Claudine H.; Reid, Malcolm R.; Moy, Christopher M.; Wilson, Gary S.

    2016-04-01

    Reconstructing the history of ocean oxygenation provides insight into links between ocean anoxia, biogeochemical cycles, and climate. Certain redox-sensitive elements respond to changes in marine oxygen content through phase shifts and concomitant isotopic fractionation, providing new diagnostic proxies of past ocean hypoxia. Here we explore the behavior and inter-dependence of a suite of commonly utilized redox-sensitive trace metals (U, Mo, Fe, and Mn) and the emerging "stable" isotope system of U (238U/235U, or δ238U) in New Zealand fjords. These semi-restricted basins have chemical conditions spanning the complete redox spectrum from fully oxygenated to suboxic to intermittently anoxic/euxinic. In the anoxic water column, U and Mo concentrations decrease, while Fe and Mn concentrations increase. Similarly, signals of past euxinic conditions can be found by U, Mo, Fe, and Mn enrichment in the underlying sediments. The expected U isotopic shift toward a lower δ238U in the anoxic water column due to U(VI)-U(IV) reduction is not observed; instead, water column δ238U profiles are consistent in fjords of all oxygen content, falling within previously reported ranges for open ocean seawater (δ238U = -0.42 ± 0.07‰). Additionally, surface sediment δ238U results show evidence for competing U isotope fractionation processes. One site indicates increased export of 238U from seawater to the underlying sediments (fractionation between aqueous seawater U and particulate sediment U, or ΔU(aq)-U(solid) = -0.25‰), consistent with redox-driven fractionation. Another site suggests potential U(VI) adsorption-driven fractionation, reflecting increased export of 235U from seawater to sediments (ΔU(aq)-U(solid) = 0.25‰). We discuss several potential factors that could alter δ238U in waters and sediments beyond redox-driven shifts, including adsorption to organic matter in waters of high primary productivity, reaction rates for competing processes of U adsorption and

  10. Redundant 230Th/ 234U/ 238U, 231Pa/ 235U and 14C dating of fossil corals for accurate radiocarbon age calibration

    Science.gov (United States)

    Chiu, Tzu-Chien; Fairbanks, Richard G.; Mortlock, Richard A.; Cao, Li; Fairbanks, Todd W.; Bloom, Arthur L.

    2006-09-01

    230Th/ 234U/ 238U dating of fossil corals by mass spectrometry is remarkably precise, but some samples exposed to freshwater over thousands of years may gain and/or lose uranium and/or thorium and consequently yield inaccurate ages. Although a δ 234U initial value equivalent to modern seawater and modern corals has been an effective quality control criterion, for samples exposed to freshwater but having δ 234U initial values indistinguishable from modern seawater and modern corals, there remains a need for additional age validation in the most demanding applications such as the 14C calibration (Fairbanks et al., 2005. Radiocarbon calibration curve spanning 0 to 50,000 years BP based on paired 230Th/ 234U/ 238U and 14C dates on pristine corals. Quaternary Science Reviews 24(16-17), 1781-1796). In this paper we enhance screening criteria for fossil corals older than 30,000 years BP in the Fairbanks0805 radiocarbon calibration data set (Fairbanks et al., 2005) by measuring redundant 230Th/ 234U/ 238U and 231Pa/ 235U dates via multi-collector magnetic sector inductively coupled plasma mass spectrometry (MC-MS-ICPMS) using techniques described in Mortlock et al. (2005. 230Th/ 234U/ 238U and 231Pa/ 235U ages from a single fossil coral fragment by multi-collector magnetic-sector inductively coupled plasma mass spectrometry. Geochimica et Cosmochimica Acta 69(3), 649-657.). In our present study, we regard paired 231Pa/ 235U and 230Th/ 234U/ 238U ages concordant when the 231Pa/ 235U age (±2 σ) overlaps with the associated 230Th/ 234U/ 238U age (±2 σ). Out of a representative set of 11 Fairbanks0805 (Fairbanks et al., 2005) radiocarbon calibration coral samples re-measured in this study, nine passed this rigorous check on the accuracy of their 230Th/ 234U/ 238U ages. The concordancy observed between 230Th/ 234U/ 238U and 231Pa/ 235U dates provides convincing evidence to support closed system behavior of these fossil corals and validation of their 230Th/ 234U/ 238U

  11. Towards A Modern Calibration Of The 238U/235U Paleoredox Proxy: Apparent Uranium Isotope Fractionation Factor During U(VI)-U(IV) Reduction In The Black Sea

    Science.gov (United States)

    Rolison, J. M.; Stirling, C. H.; Middag, R.; Rijkenberg, M. J. A.; De Baar, H. J. W.

    2015-12-01

    The isotopic compositions of redox-sensitive metals, including uranium (U), in marine sediments have recently emerged as powerful diagnostic tracers of the redox state of the ancient ocean-atmosphere system. Interpretation of sedimentary isotopic information requires a thorough understating of the environmental controls on isotopic fractionation in modern anoxic environments before being applied to the paleo-record. In this study, the relationship between ocean anoxia and the isotopic fractionation of U was investigated in the water column and sediments of the Black Sea. The Black Sea is the world's largest anoxic basin and significant removal of U from the water column and high U accumulation rates in modern underlying sediments have been documented. Removal of U from the water column occurs during the redox transition of soluble U(VI) to relatively insoluble U(IV). The primary results of this study are two-fold. First, significant 238U/235U fractionation was observed in the water column of the Black Sea, suggesting the reduction of U induces 238U/235U fractionation with the preferential removal of 238U from the aqueous phase. Second, the 238U/235U of underlying sediments is related to the water column through the isotope fractionation factor of the reduction reaction but is influenced by mass transport processes. These results provide important constraints on the use of 238U/235U as a proxy of the redox state of ancient oceans.

  12. Tumor Necrosis Factor-Alpha Gene Promoter −308G/A and −238G/A Polymorphisms in Mexican Patients with Type 2 Diabetes Mellitus

    Directory of Open Access Journals (Sweden)

    Juan Manuel Guzmán-Flores

    2011-01-01

    Full Text Available The association between some Tumor necrosis factor-alpha (TNF-α promoter polymorphisms and Type 2 diabetes mellitus (T2DM remains controversial. Ethnic differences may play a role in these conflicting results. The aim of this study was to investigate the association between −308G/A and −238G/A polymorphisms located in the promoter region of the TNF-α gene and T2DM in Mexican mestizo patients. Nine hundred four individuals (259 patients with T2DM and 645 controls were genotyped for the −308G/A and −238G/A polymorphisms by PCR—RFLP. We found that the −238A allele increased the risk of developing T2DM in Mexican patients (OR = 1.57, 95% CI: 1.07–2.29; p = 0.018. Moreover, we found that the frequency of the GA haplotype (created by the −308G and −238A alleles was significantly increased in patients with T2DM when compared with controls (OR = 1.56, 95% CI: 1.05–2.31; p = 0.026. Our results suggest that the −238G/A polymorphism and a specific haplotype (GA are genetic risk factors for the development of T2DM in Mexican population.

  13. BetaScintTM fiber-optic sensor for detecting strontium-90 and uranium-238 in soil. Innovative technology summary report

    International Nuclear Information System (INIS)

    Accurate measurements of radioactivity in soils contaminated with Strontium-90 (Sr-90) or Uranium-238 (U-238) are essential for many DOE site remediation programs. These crucial measurements determine if excavation and soil removal is necessary, where remediation efforts should be focused, and/or if a site has reached closure. Measuring soil contamination by standard EPA laboratory methods typically takes a week (accelerated analytical test turnaround) or a month (standard analytical test turnaround). The time delay extends to operations involving heavy excavation equipment and associated personnel which are the main costs of remediation. This report describes an application of the BetaScint trademark fiber-optic sensor that measures Sr-90 or U-238 contamination in soil samples on site in about 20 minutes, at a much lower cost than time-consuming laboratory methods, to greatly facilitate remediation. This report describes the technology, its performance, its uses, cost, regulatory and policy issues, and lessons learned

  14. FOLLOW-UP INVESTIGATION AND COUNTERMEASURES TO LOVE AFFAIR OF 238 UNIVERSITER GRADUATES%238名大学毕业生恋爱情况追踪调查与对策

    Institute of Scientific and Technical Information of China (English)

    李俭莉

    2011-01-01

    [ Objective] To understand the development of university graduates in love affair and its influencing factor,and to provide health education and reference for love affair among university students. [ Methods] By questionnaire investigation and in-depth interview, and we investigated the university students in grade four of different specialties in Neijiang Normal school, and followed up the love affair situation and its influencing factors. [Resutts] Among 238 university, the (marriage) rate of love affair was 33.6%, the lover of university students were mainly their classmates or alumnus, and accounted for 69.7%. Among 238 respondents, 79.4% had pre-marital sex, there was no significant difference in the incidence of premarital sex of marriage group and broken up group. After graduating from university, whether there was fixed work had influence on the marriage of college students, and the males graduates were lack of confidence in the establisbment of marriage and family, and their big psychological stress was higher than that of fematles [Conclusion] Carrying out health education of love and marriagefor the umversity students, it is advantageous in instructing university student reasonable heterosexual contacts, sensible to fall in love, seriously mate choice, and get married in a responsible manner.%[目的]了解大学毕业生的恋爱发展情况及其影响因素,为有针对性地对大学生们进行婚恋教育提供依据.[方法]采用问卷调查法及访谈法,对内江师范学院不同专业处于恋爱中的大四学生,跟踪调查其恋爱的发展情况及影响因素.[结果]238名大学毕业生恋爱结婚率为33.6%,大学毕业生的恋爱对象主要是中学和大学的同学或校友,共占69.7%.238名被调查者中有79.4%发生过婚前性行为,结婚组与分手组的婚前性行为的发生率无统计学差异.大学生们毕业后有无相对固定的工作对男女大学生的婚姻影响是有差异的,男毕业生对

  15. NPM-ALK mediates phosphorylation of MSH2 at tyrosine 238, creating a functional deficiency in MSH2 and the loss of mismatch repair.

    Science.gov (United States)

    Bone, K M; Wang, P; Wu, F; Wu, C; Li, L; Bacani, J T; Andrew, S E; Lai, R

    2015-05-15

    The vast majority of anaplastic lymphoma kinase-positive anaplastic large cell lymphoma (ALK+ALCL) tumors express the characteristic oncogenic fusion protein NPM-ALK, which mediates tumorigenesis by exerting its constitutive tyrosine kinase activity on various substrates. We recently identified MSH2, a protein central to DNA mismatch repair (MMR), as a novel binding partner and phosphorylation substrate of NPM-ALK. Here, using liquid chromatography-mass spectrometry, we report for the first time that MSH2 is phosphorylated by NPM-ALK at a specific residue, tyrosine 238. Using GP293 cells transfected with NPM-ALK, we confirmed that the MSH2(Y238F) mutant is not tyrosine phosphorylated. Furthermore, transfection of MSH2(Y238F) into these cells substantially decreased the tyrosine phosphorylation of endogenous MSH2. Importantly, gene transfection of MSH2(Y238F) abrogated the binding of NPM-ALK with endogenous MSH2, re-established the dimerization of MSH2:MSH6 and restored the sensitivity to DNA mismatch-inducing drugs, indicative of MMR return. Parallel findings were observed in two ALK+ALCL cell lines, Karpas 299 and SUP-M2. In addition, we found that enforced expression of MSH2(Y238F) into ALK+ALCL cells alone was sufficient to induce spontaneous apoptosis. In conclusion, our findings have identified NPM-ALK-induced phosphorylation of MSH2 at Y238 as a crucial event in suppressing MMR. Our studies have provided novel insights into the mechanism by which oncogenic tyrosine kinases disrupt MMR.

  16. Application of 234U/238U isotope ratio data for the study of geochemical problems associated with local water sources from Aguas da Prata (SP, Brazil)

    International Nuclear Information System (INIS)

    The uranium-238, uranium-234 and radon content of spring waters of Aguas da Prata (SP) - Platina, Paiol, Villela, Sao Bento, Prata-Radioativa, Prata-Nova, Boi, Vitoria and Prata-Antiga - was found; the activity ratio AR (234U/238U) was applied to the geochemistry of local water sources. The uranium analysis procedure consisted of the following steps: adition of 232U-228Th spike to the samples, coprecipitation with iron, iron extraction with organic solvent, separation on anion-exchange resin, extraction with TTA, deposition on stainless steel disc and determination of uranium content by alpha spectrometry. The uranium-238 content changed from 0,10 to 11,56 ppb (average value = 2,3 ppb). The higher values were observed for the waters circulating through sandstones and the lower through volcanic rocks. The inverse correlation (r sub(s) =-0,76) between pH and uranium-238 content confirmed the contribution of this factor on its solubility. The significative correlation r sub(s) = 0,76 between dissolved oxygen and uranium-238 content also confirmed the higher uranium on the more oxidizing zones. The AR changed from 2,84 to 11,68 (average value = 6). These values defined the regional aquifer systems as mineralized in uranium. The higher AR were observed for the deep groundwaters and the lower for the shallow one. Because the 238U→234Th decay, the 234Th ejection to the solution was confirmed as the most important factor responsible for the extreme observed isotopic fractionation. (Author)

  17. The transfer of uranium isotopes 234U and 238U to the waters interacting with carbonates from Mendip Hills area (England)

    International Nuclear Information System (INIS)

    Laboratory time-scale experiments were conducted on limestone and dolomite gravels from the Mendip Hills area, England, with the purpose of evaluating the release of 238U and 234U to different aqueous solutions. The 234U/238U activity ratio (AR) lab data were reliable to interpret the field data. The obtained values do not indicate a reduction in the amount of dissolved U and an increase in the AR of the remaining dissolved U as commonly observed for groundwater systems close to redox boundaries

  18. The novel complex allele [A238V;F508del] of the CFTR gene: clinical phenotype and possible implications for cystic fibrosis etiological therapies.

    Science.gov (United States)

    Diana, Anna; Polizzi, Angela Maria; Santostasi, Teresa; Ratclif, Luigi; Pantaleo, Maria Giuseppina; Leonetti, Giuseppina; Iusco, Danila Rosa; Gallo, Crescenzio; Conese, Massimo; Manca, Antonio

    2016-06-01

    Few mutations in cis have been annotated for F508del homozygous patients. Southern Italy patients who at a first analysis appeared homozygous for the F508del mutation (n=63) or compound heterozygous for the F508del and another mutation in the cystic fibrosis transmembrane conductance regulator gene (n=155) were searched for the A238V mutation in exon 6. The allelic frequency of the complex allele [A238V;F508del] was 0.04. When the whole data set was used (comprised also of 56 F508del/F508del and 34 F508del/other mutation controls), no differences reached the statistical significance in the clinical parameters, except chloride concentrations which were lower in [A238V;F508del]/other mutation compared with F508del/other mutation (P=0.03). The two study groups presented less complications than the control groups. Within the minimal data set (34 F508del/F508del, 27 F508del/other mutation, 4 [A238V;F508del]/F508del cases and 5 [A238V;F508del]/other mutation cases); that is, presenting all the variables in each patient, forced expiratory volume in 1 s and forced vital capacity presented a trend to lower levels in the study groups in comparison with the F508del/F508del group, and C-reactive protein approximated statistically significant higher levels in the [A238V;F508del]/other mutation as compared with F508del/F508del patients (P=0.09). The analysis of statistical dependence among the variables showed a significant anticorrelation between chloride and body mass index in the [A238V;F508del]/other mutation group. In conclusion, the complex allele [A238V;F508del] seems to be associated with less general complications than in the control groups, on the other hand possibly giving a worse pulmonary phenotype and higher systemic/local inflammatory response. These findings have implications for the correct recruitment and clinical response of F508del patients in the clinical trials testing the new etiological drugs for cystic fibrosis. PMID:26911355

  19. Radioactivity of 238U, 232Th, 40K, and 137Cs and assessment of depleted uranium in soil of the Musandam Peninsula, Sultanate of Oman

    OpenAIRE

    SALEH, Ibrahim Hindawy

    2012-01-01

    238U, 232Th, 40K, and 137Cs radioactivities were determined in soil samples collected from the Musandam Peninsula, Sultanate of Oman, using a high resolution gamma-ray spectroscopy system. In addition, total uranium was measured in selected soil samples by inductively coupled plasma optical emission spectroscopy (ICP-OES). The averages of radioactivity levels in the soil for 238U, 232Th, and 40K were 14.42 Bq kg-1, 9.95 Bq kg-1, 158.21 Bq kg-1, and 2770 Bq m-2 for 137Cs, respectively...

  20. Alpha and Conversion Electron Spectroscopy of 238, 239Pu and 241Am and Alpha-Conversion Electron Coincidence Measurements

    Energy Technology Data Exchange (ETDEWEB)

    Dion, Michael P.; Miller, Brian W.; Warren, Glen A.

    2016-05-17

    A technique to determine the isotopics of a mixed actinide sample has been proposed by measuring the coincidence of the alpha particle during radioactive decay with the conversion electron (or Auger) emitted during the relaxation of the daughter isotope. This presents a unique signature to allow the deconvolution of isotopes that possess overlapping alpha particle energy. The work presented here are results of conversion electron spectroscopy of 241Am, 238Pu and 239Pu using a dual-stage peltier-cooled 25 mm2 silicon drift detector. A passivated ion implanted planar silicon detector provided measurements of alpha spectroscopy. The conversion electron spectra were evaluated from 20–55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information to aid in the coincident measurement approach.