WorldWideScience

Sample records for americium 238

  1. Safe handling of kilogram amounts of fuel-grade plutonium and of gram amounts of plutonium-238, americium-241 and curium-244

    International Nuclear Information System (INIS)

    During the past 10 years about 600 glove-boxes have been installed at the Institute for Transuranium Elements at Karlsruhe. About 80% of these glove-boxes have been designed and equipped for handling 100-g to 1-kg amounts of 239Pu containing 8-12% 240Pu (low-exposure plutonium). A small proportion of the glove-boxes is equipped with additional shielding in the form of lead sheet or lead glass for work with recycled plutonium. In these glove-boxes gram-amounts of 241Am have also been handled for preparation of Al-Am targets using tongs and additional shielding inside the glove-boxes themselves. Water- and lead-shielded glove-boxes equipped with telemanipulators have been installed for routine work with gram-amounts of 241Am, 243Am and 244Cm. A prediction of the expected radiation dose for the personnel is difficult and only valid for a preparation procedure with well-defined preparation steps, owing to the fact that gamma dose-rates depend strongly upon proximity and source seize. Gamma radiation dose measurements during non-routine work for 241Am target preparation showed that handling of gram amounts leads to a rather high irradiation dose for the personnel, despite lead or steel glove-box shielding and shielding within the glove-boxes. A direct glove-hand to americium contact must be avoided. For all glove-handling of materials with gamma radiation an irradiation control of the forearms of the personnel by, for example, thermoluminescence dosimeters is necessary. Routine handling of americium and curium should be executed with master-slave equipment behind neutron and gamma shielding. (author)

  2. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    The authors describe a method for the electrochemical preparation of an americium amalgam from americium dioxide and americium 241 and 243 for use in determining the physicochemical properties of the alloy. Moessbauer spectra were made using neptunium dioxide, in the neptunium 237 form, as an absorber. Results show that electrolysis produces a homogeneous amalgam that gives an unoxidized product on vacuum distillation at 200 degrees C

  3. Americium recovery from reduction residues

    Science.gov (United States)

    Conner, W.V.; Proctor, S.G.

    1973-12-25

    A process for separation and recovery of americium values from container or bomb'' reduction residues comprising dissolving the residues in a suitable acid, adjusting the hydrogen ion concentration to a desired level by adding a base, precipitating the americium as americium oxalate by adding oxalic acid, digesting the solution, separating the precipitate, and thereafter calcining the americium oxalate precipitate to form americium oxide. (Official Gazette)

  4. Preparation of americium amalgam

    International Nuclear Information System (INIS)

    Using the method of NGR-spectroscopy with the aid of 241Am isotope chemical state of transuranium elements in the volume and on the surface of amalgams is studied. Amalgam preparation was realized in a simplified electrolytic cell. It is shown that in the process of amalgam preparation the first order of reaction as to actinide is observed; americium is distributed gradually over the volume and it is partially sorbed by the surface of glass capillary. NGR spectrum of dry residue after mercury distillation at 200 deg C points to the presence of americium-mercury intermetal compounds

  5. Chemistry of americium

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1976-01-01

    Essential features of the descriptive chemistry of americium are reviewed. Chapter titles are: discovery, atomic and nuclear properties, collateral reading, production and uses, chemistry in aqueous solution, metal, alloys, and compounds, and, recovery, separation, purification. Author and subject indexes are included. (JCB)

  6. Americium-241 - ED 4308

    International Nuclear Information System (INIS)

    This sheet presents the characteristics of Americium-241, its origin, and its radio-physical and biological properties. It briefly describes its use in nuclear medicine. It indicates its dosimetric parameters for external exposure, cutaneous contamination, and internal exposure due to acute contamination or to chronic contamination. It indicates and comments the various exposure control techniques: ambient dose rate measurement, surface contamination measurement, atmosphere contamination. It addresses the means of protection: premise design, protection against external exposure and against internal exposure. It describes how areas are delimited and controlled within the premises: regulatory areas, controls to be performed. It addresses the personnel classification, training and medical survey. It addresses the issue of wastes and effluents. It briefly recalls the administrative procedures related to the authorization and declaration of possession and use of sealed and unsealed sources. It indicates regulatory aspects related to the road transport of Americium-241, describes what is to be done in case of incident or accident (for the different types of contamination or exposure)

  7. The Biokinetic Model of Americium

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    To improve in vivo measurements for detecting internal exposure from transuranium radio nuclides, such as neptunium, plutonium, americium, the bioknetic model was studied. According to ICRP report (1993, 1995, 1997) and other research, the

  8. Americium product solidification and disposal

    International Nuclear Information System (INIS)

    The americium product from the TRUEX processing plant needs to be converted into a form suitable for ultimate disposal. An evaluation of the disposal based on safety, number of process steps, demonstrated operability of the processes, production of low-level alpha waste streams, and simplicity of maintenance with low radiation exposures to personnel during maintenance, has been made. The best process is to load the americium on a cation exchange resin followed by calcination or oxidation of the resin after loading

  9. Distribution of uranium, americium and plutonium in the biomass of freshwater macrophytes

    Energy Technology Data Exchange (ETDEWEB)

    Zotina, T.A.; Kalacheva, G.S.; Bolsunovsky, A.YA. [Institute of Biophysics SB RAS, Akademgorodok, Krasnoyarsk (Russian Federation)

    2010-07-01

    Accumulation of uranium ({sup 238}U), americium ({sup 241}Am) and plutonium ({sup 242}Pu) and their distribution in cell compartments and biochemical components of the biomass of aquatic plants Elodea canadensis, Ceratophyllum demersum, Myrioplyllum spicatum and aquatic moss Fontinalis antipyretica have been investigated in laboratory batch experiments. Isotopes of uranium, americium and plutonium taken up from the water by Elodea canadensis apical shoots were mainly absorbed by cell walls, plasmalemma and organelles. A small portion of isotopes (about 6-13 %) could be dissolved in cytoplasm. The major portion (76-92 %) of americium was bound to cell wall cellulose-like polysaccharides of Elodea canadensis, Myriophyllum spicatum, Ceratophyllum demersum and Fontinalis antipyretica, 8-23 % of americium activity was registered in the fraction of proteins and carbohydrates, and just a small portion (< 1%) in lipid fraction. The distribution of plutonium in the biomass fraction of Elodea was similar to that of americium. Hence, americium and plutonium had the highest affinity to cellulose-like polysaccharides in Elodea biomass. Distribution of uranium in the biomass of Elodea differed essentially from that of transuranium elements: a considerable portion of uranium was recorded in the fraction of protein and carbohydrates (51 %). From our data we can assume that uranium has higher affinity to carbohydrates than proteins. (authors)

  10. Science and Technology for Americium Transmutation

    International Nuclear Information System (INIS)

    Americium could be seen as the most troublesome element that is present in nuclear fuel. This thesis offers different points of view on the possibility of americium transmutation. The first point of view elaborates simulations of americium-bearing facilities, namely nuclear data, a popular computational code and modeling techniques. The second point of view is focused on practical usage of the simulations to examine upper limit of americium in a specific reactor

  11. WEB 238 courses/snaptutorial

    OpenAIRE

    Kat Martin

    2015-01-01

    For more classes visit www.snaptutorial.com   WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs  

  12. WEB 238 Courses Tutorial / indigohelp

    OpenAIRE

    neha

    2015-01-01

    WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs  

  13. Transmutation of Americium in Fast Neutron Facilities

    OpenAIRE

    Zhang, Youpeng

    2011-01-01

    In this thesis, the feasibility to use a medium sized sodium cooled fast reactor fully loaded with MOX fuel for efficient transmutation of americium is investigated by simulating the safety performance of a BN600-type fast reactor loaded with different fractions of americium in the fuel, using the safety parameters obtained with the SERPENT Monte Carlo code. The focus is on americium mainly due to its long-term contribution to the radiotoxicity of spent nuclear fuel and its deterioration on c...

  14. Plutonium and americium in sediments of Lithuanian lakes

    International Nuclear Information System (INIS)

    The assessment of contribution of the global and the Chernobyl NPP (Nuclear Power Plant) accident plutonium and americium to plutonium pollution in sediments of Lithuanian lakes is presented. Theoretical evaluation of activity ratios of 238Pu/239+240Pu and 241Pu/239+240Pu in the reactor of unit 4 of the Chernobyl NPP before the accident was performed by means of the ORIGEN-ARP code from the SCALE 4.4A program package. Non-uniform distribution of radionuclides in depositions on the Lithuanian territory after nuclear weapon tests and the Chernobyl NPP accident is experimentally observed by measuring the lake sediment pollution with actinides. The activity concentration of sediments polluted with plutonium ranges from 2.0 ± 0.5 Bq/kg d.w. (dry weight) in Lake Asavelis to 14 ± 2 Bq/kg d.w. in Lake Juodis. The ratio of activity concentrations of plutonium isotopes 238Pu/239+240Pu measured by α-spectrometry in the 10-cm-thick upper layer of bottom sediment varies from 0.03 in Lake Juodis to 0.3 in Lake Zuvintas. The analysis of the ratio values shows that the deposition of the Chernobyl origin plutonium is prevailing in southern and south-western regions of Lithuania. Plutonium of nuclear weapon tests origin in sediments of lakes is observed on the whole territory of Lithuania, and it is especially distinct in central Lithuania. The americium activity due to 241Pu decay after the Chernobyl NPP accident and global depositions in bottom sediments of Lithuanian lakes has been evaluated to be from 0.9 to 5.7 Bq/kg. (author)

  15. Determination of specific activity of americium and plutonium in selected environmental samples

    International Nuclear Information System (INIS)

    The aim of this work was development of method for determination of americium and plutonium in environmental samples. Developed method was evaluated on soil samples and after they was applied on selected samples of fishes (smoked mackerel, herring and fillet from Alaska hake). The method for separation of americium is based on liquid separation with Aliquate-336, precipitation with oxalic acid and using of chromatographic material TRU-SpecTM.The intervals of radiochemical yields were from 13.0% to 80.9% for plutonium-236 and from 10.5% to 100% for americium-241. Determined specific activities of plutonium-239,240 were from (2.3 ± 1.4) mBq/kg to (82 ± 29) mBq/kg, the specific activities of plutonium-238 were from (14.2 ± 3.7) mBq/kg to (708 ± 86) mBq/kg. The specific activities of americium-241 were from (1.4 ± 0.9) mBq/kg to (3360 ± 210) mBq/kg. The fishes from Baltic Sea as well as from North Sea show highest specific activities then fresh-water fishes from Slovakia. Therefore the monitoring of alpha radionuclides in foods imported from territories with nuclear testing is recommended

  16. Production of americium isotopes in France

    International Nuclear Information System (INIS)

    The program of productions of americium 241 and 243 isotopes is based respectively on the retreatment of aged plutonium alloys or plutonium dioxide and on the treatment of plutonium targets irradiated either in CELESTIN reactors for Pu-Al alloys or OSIRIS reactor for plutonium 242 dioxide. All the operations, including americium final purifications, are carried out in hot cells equipped with remote manipulators. The chemical processes are based on the use of extraction chromatography with hydrophobic SiO2 impregnated with extracting agents. Plutonium targets and aged plutonium alloys are dissolved in nitric acid using conventional techniques while plutonium dioxide dissolutions are performed routine at 300 grams scale with electrogenerated silver II in 4M HNO3 at room temperature. The separation between plutonium and americium is performed by extraction of Pu(IV) either on TBP/SiO2 or TOAHNO3/SiO2 column. Americium recovery from waste streams rid of plutonium is realized by chromatographic extraction of Am(III) using mainly TBP and episodically DHDECMP as extractant. The final purification of both americium isotopes uses the selective extraction of Am(VI) on HDDiBMP/SiO2 column at 60 grams scale. Using the overall process a total amount of 1000 grams of americium 241 and 100 grams of americium 243 has been produced nowadays and the AmO2 final product indicates a purity better than 98.5%

  17. Study of americium sorption by humic acids

    International Nuclear Information System (INIS)

    The results of investigation of influence of the cation content and acidity of soil solution on americium sorption by the humic acids have been shown. The most influence on the interphase distribution coefficient in the system 'humic acid - model soil solution' is caused by the presence of the iron (III), calcium ions and acidity of the solution. The increase of the sodium ions concentration in the solution makes an insignificant impact on the americium sorption. (Authors)

  18. Upper Limits to Americium Concentration in Medium Size Sodium Cooled Fast Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.P.; Wallenius, J. [Royal Institute of Technology (KTH), AlbaNova University Centre, S-106 91, Stockholm (Sweden)

    2009-06-15

    The fastest way to realize transmutation of minor actinides would be using existing reactor types, adding some proper modifications to allow for insertion of MA in the fuel. According to calculations by Fazio and co-workers, the consumption rate of TRU in a low conversion ratio fast reactor may reach 70-75 % of that of an ADS with uranium free fuel [1]. However, americium introduction brings a negative influence on several safety parameters such as {beta}{sub eff}, Doppler coefficient, coolant temperature coefficient and void worth. Therefore the upper limit of americium that can be included into the fuel needs to be carefully evaluated. In this paper, fast reactor fuels with various minor actinide fractions are loaded into a SAS4A model of the semi-commercial BN600 reactor. Unprotected loss of flow (ULOF) and transient over power (UTOP) accidents are modelled using safety parameters obtained from Monte Carlo simulations as well as from the deterministic calculations published by Fazio et al. Applying the latter parameters (obtained with VARI3D), the upper limit to MA concentration in the fuel of a medium sized SFR of BN-600 type appears at 12%, corresponding to 8% of americium. We note however that the Doppler constants displayed by Fazio et al for MA concentrations above 10% have a considerably larger magnitude than those obtained with MCNP. Applying the safety parameters obtained with Monte Carlo simulations and updated nuclear data evaluations, we find that the upper limit to the americium concentration allowing to survive a ULOF is about half of that inferred by the use of parameters from VARI-3D. Since such a difference has a major impact on the predicted americium transmutation capability of SFR, it is of high priority to analyse the reasons for the apparent discrepancies. We note here that the major contribution to the Doppler feedback comes from capture resonance in U-238 and Pu-240 residing below the sodium scattering resonance located at 3 keV, and that

  19. Spectrochemical analysis of curium and americium samples

    International Nuclear Information System (INIS)

    Spectrochemical procedures have been developed to determine impurities in americium and curium samples. The simultaneous separation of many impurity elements from the base material (americium and curium) is carried out with extraction and extraction-chromatographic methods using di-2-ethylhexylphosphoric acid. It is shown that part of the elements are separated with extraction or sorption of americium and curium; the other part with the Talspeak process. Two fractions in the extraction chromatography and three fractions in the extraction separation of americium and curium, containing impurities, are analyzed separately by a.c. or d.c. arc spectrography. To increase the sensitivity of the spectrographic analysis and accelerate the burn-up of impurities from the crater of the carbon electrode bismuth fluoride and sodium chloride were used as chemically active substances. The extraction of impurities from weighed quantities of americium and curium samples of 5 to 10 mg permits the lower limit of determined impurity concentrations to be extended to 1 x 10-4 to 5 x 10-3% m/m. (author)

  20. Aqueous Chloride Operations Overview: Plutonium and Americium Purification/Recovery

    Energy Technology Data Exchange (ETDEWEB)

    Kimball, David Bryan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Skidmore, Bradley Evan [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-22

    Acqueous Chloride mission is to recover plutonium and americium from pyrochemical residues (undesirable form for utilization and storage) and generate plutonium oxide and americium oxide. Plutonium oxide is recycled into Pu metal production flowsheet. It is suitable for storage. Americium oxide is a valuable product, sold through the DOE-OS isotope sales program.

  1. Pyrochemical technology of plutonium and americium preparation and purification

    International Nuclear Information System (INIS)

    Pyrochemical tecnology of metallic plutonium and americium preparation and purification is considered. Investigations into plutonium dioxide reduction up to metal; plutonium electrolytic refining in molten salts; plutonium extraction from the molten salts and preparation of americium dioxide and metallic americium from its tetrafluoride are described

  2. Formation of americium and europium humate complexes

    International Nuclear Information System (INIS)

    Binding constants of americium and europium with a humic acid were determined to study if complex formation of trivalent actinide-humates affects dissolved species of the actinides in hydrosphere. The purified humic acid was characterized by means of UV-vis, IR, and pH titration, indicating high carboxylate capacity and low aromaticity. Binding constants of americium and europium humates were determined at pH 4.6 and 6.0 by solvent extraction using 241Am or 152Eu as a tracer. The binding constants for americium-humate obtained preliminarily suggest that complexes with humic acid are not negligible in speciation of trivalent actinides in hydrosphere. The obtained binding constants were nearly identical with those determined previously by the same procedures, but with humic acids of different origin and compositions. (author)

  3. Preparation of americium source for smoke detector

    International Nuclear Information System (INIS)

    This report describes the method developed for the preparation of 241Am source for smoke detector. Americium was electrodeposited from iso-propyl alcohol medium on silver backing. Thin layer of gold (few hundred micro gram thick) was plated on the americium source to make it safe for handling. The thickness of plated gold was such that the alpha radiations from the 241Am source could escape out of the gold layer and cause ionisation in the surrounding air. The performance of the prepared sources were checked in a smoke detector and was found to be satisfactory and comparable to the imported sources. (author). 1 refs., 2 figs., 1 tab

  4. Recovery of americium-241 from raffinates of plutonium purification columns

    International Nuclear Information System (INIS)

    Recovery and purification of americium from ion exchange raffinates generated during purification of aged plutonium is described. The method consists of the following stages: (i) co-precipitation of americium with kilogramme quantities of rare earth oxalates, (ii) destruction of oxalate and removal of residual plutonium from nitric acid medium using anion exchange process, (iii) preliminary separation of americium making use of its preferential uptake on an anion exchange column from thiocyanate medium and (iv) extraction of americium and remaining rare earths into di-(2-ethyl hexyl) phosphoric acid followed by preferential back washing of americium by lactic acid medium containing DTPA. (author)

  5. Contemporary state of plutonium and americium in the soils of Palesse state radiation-ecological reserve

    International Nuclear Information System (INIS)

    Full text: At present, the most important alpha-emitting radionuclides of Chernobyl origin are Pu 238, Pu 239, Pu 240 and Am 241. They are classified as the most dangerous group of radionuclides in view of the long half-lives and high radiotoxicity. The main part of alpha-emitted radionuclides is located within the Palesse State Radiation-Ecological Reserve. One of the most important factors determining the radioecological situation in the contaminated ecosystems is the physicochemical forms of radionuclides in a soil medium. Radionuclide species determine the radionuclide entrance into the soil solutions, their redistribution in soil profiles and the 'soil - plant' and the 'soil - surface, ground or underground water' systems as well as spreading beyond the contaminated area. The present work is devoted to investigation of state and migration ability of plutonium and americium in soils of the Palesse state radiation-ecological reserve after more than 20 years from the Chernobyl accident. The objects of investigation were mineral and organic soils sampled in 2008 with the step of 5 cm to the depth of 25-30 cm. The forms of plutonium and americium distinguishing by association with the different components of soil and by potential for migration in the soil medium were studied using the method of sequential selective extraction according to the modified Tessier scheme. Activities of Pu 238, Pu 239, Pu 240 and Am 241 in the samples were determined by the method of radiochemical analysis with alpha-spectrometer radionuclide identification. The dominant part of plutonium and americium in the soils is in immobile forms. Nowadays, radionuclide portions in water soluble and reversibly bound forms do not exceed 9.4 % of radionuclide content in the soil. In mineral soil samples, the radionuclide portions in these fractions exceed the corresponding portions in organic ones. In both mineral and organic soils, the portions of mobile americium are higher than plutonium. The

  6. WEB 238 UOP Tutorial Course/Uoptutorial

    OpenAIRE

    anemone222

    2015-01-01

    For More Course Tutorials Visit www.uoptutorial.com     WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs   WEB 238 Week 5DQs  

  7. 1976 Hanford americium exposure incident: psychological aspects

    International Nuclear Information System (INIS)

    Accidents involving exposure to radiation or radioactive materials may involve an unusual degree of emotional trauma. Methods that may be employed in dealing with such trauma are discussed in relation to a specific accident in which a radiation worker was injured and seriously contaminated with americium-241

  8. Americium separations from high salt solutions

    International Nuclear Information System (INIS)

    Americium (III) exhibits an unexpectedly high affinity for anion-exchange material from the high-salt evaporator bottoms solutions--an effect which has not been duplicated using simple salt solutions. Similar behavior is observed for its lanthanide homologue, Nd(III), in complex evaporator bottoms surrogate solutions. There appears to be no single controlling factor--acid concentration, total nitrate concentration or solution ionic strength--which accounts for the approximately 2-fold increase in retention of the trivalent ions from complex solutions relative to simple solutions. Calculation of species activities (i.e., water, proton and nitrate) in such concentrated mixed salt solutions is difficult and of questionable accuracy, but it is likely that the answer to forcing formation of anionic nitrate complexes of americium lies in the relative activities of water and nitrate. From a practical viewpoint, the modest americium removal needs (ca. 50--75%) from nitric acid evaporator bottoms allow sufficient latitude for the use of non-optimized conditions such as running existing columns filled with older, well-used Reillex HPQ. Newer materials, such as HPQ-100 and the experimental bifunctional resins, which exhibit higher distribution coefficients, would allow for either increased Am removal or the use of smaller columns. It is also of interest that one of the experimental neutral-donor solid-support extractants, DHDECMP, exhibits a similarly high level of americium (total alpha) removal from EV bottoms and is much less sensitive to total acid content than commercially-available material

  9. Decontaminaion of metals containing plutonium and americium

    International Nuclear Information System (INIS)

    Melt-slagging (melt-refining) techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7 x 106 were measured with boro-silicate slag and of 3 x 106 with calcium, magnesium silicate slag. Decontamination of metals containing as much as 14,000 ppM plutonium appears to be as efficient as for metals with plutonium levels of 400 ppM. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. The second extraction is effective with either resistance-furnace melting or electric-arc melting. Slag adhering to the metal ingots and in defects within the ingots is in the important contributors to plutonium retained in processed metals. If these sources of plutonium are controlled, the melt-refining process can be used on a large scale to convert highly contaminated metals to homogeneous and compact forms with very low concentrations of plutonium and americium. A conceptual design of a melt-refining process to decontaminate plutonium- and americium-contaminated metals is described. The process includes single-stage refining of contaminated metals to produce a metal product which would have less than 10 nCi/g of TRU-element contamination. Two plant sizes were considered. The smaller conceptual plant processes 77 kg of metal per 8-h period and may be portable.The larger one processes 140 kg of metal per 8-h period, is stationary, and may be near te maximum size that is practical for a metal decontamination process

  10. Status of Americium-241 recovery at Rocky Flats Plant

    International Nuclear Information System (INIS)

    This paper is presented in two parts: Part I, Molten Salt Extraction of Americium from Molten Plutonium Metal, and Part II, Aqueous Recovery of Americium from Extraction Salts. The Rocky Flats recovery process used for waste salts includes (1) dilute hydrochloric acid dissolution of residues; (2) cation exchange to convert from the chloride to the nitrate system and to remove gross amounts of monovalent impurities; (3) anion exchange separation of plutonium; (4) oxalate precipitation of americium; and (5) calcination of the oxalate at 6000C to yield americium oxide. The aqueous process portion describes attempts to improve the recovery of americium. The first part deals with modifications to the cation exchange step; the second describes development of a solvent extractions process that will recovery americium from residues containing aluminium as well as other common impurities. Results of laboratory work are described. 3 figures, 6 tables. (DP)

  11. Plutonium and americium in soil organic matter

    International Nuclear Information System (INIS)

    A gley soil from west Cumbria, with specific activities in its surface horizon of 5-10 kBq kg-1239,240Pu and comparable 241Am levels, has been used as a source of actinide-enriched organic fractions. Humic and fulvic acids were isolated by conventional alkali extraction and investigated by gel filtration, treatment with organic solvents and differential flocculation procedures. All these techniques are capable of resolving the organics into two or more fractions, with specific activities up to 80 kBq kg-239,240Pu. There is evidence for differentiation of plutonium and americium, with americium being concentrated, to some extent, in the lower molecular weight fractions from gel filtration. (author)

  12. WEB 238 Course tutorial/uophelp

    OpenAIRE

    ZCF

    2015-01-01

    WEB 238 Entire Course For more course tutorials visit www.uophelp.com     WEB 238 Week 2 JavaScript Events WEB 238 Week 3 Cookies WEB 238 Week 4 Dynamic HTML WEB 238 Week 5 Web Programming Languages WEB 238 Week 1 DQs WEB 238 Week 2DQs WEB 238 Week 3DQs WEB 238 Week 4DQs WEB 238 Week 5DQs

  13. Incentives for transmutation of americium in thermal reactors

    International Nuclear Information System (INIS)

    This report describes possible benefits when americium is irradiated in a thermal reactor. If all plutonium is partitioned from spent fuel, americium is the main contributor to the radiotoxicity of spent fuel upto several thousands of years of storage. It is shown that americium can be transmuted to other nuclides upon irradiation in a thermal reactor, leading to a 50% reduction of the radiotoxicity of neptunium, which can be an important contributor to the dose due to leakage of nuclides after one million years of storage. The radiotoxicity of americium can be reduced considerably after irradiation for 3 to 6 years in a thermal reactor with thermal neutron flux of 1014 cm-2s-1. The strongly α and neutron emitting transmutation products can most probably not be recycled again, so a transmutation process is suggested in which americium is irradiated for 3 to 6 years and then put to final storage. It is shown that the radiotoxicity of the transmuation products after a storage time of about one hundred years can be considerably reduced compared to the radiotoxicity of the initial americium. The same holds for the α activity and heat emission of the transmutation products. Because plutonium in spent fuel contributes for about 80% to the radiotoxicity upto 105 years of storage, recycling and transmutation of plutonium has first priority. Transmutation of americium is only meaningful when the radiotoxicity of plutonium is reduced far below the radiotoxicity of americium. (orig.)

  14. Americium transfer studies using hollow fiber/extractant membranes

    International Nuclear Information System (INIS)

    Americium can be removed from low acid/high nitrate feeds using hollow fiber membrane modules. Americium can be concentrated in the stripping solution. (Maximum observed concentration was a factor of 3.1). Accurel hollow fibers are less prone to leakage problems

  15. Electronic structure of compressed americium metal

    Czech Academy of Sciences Publication Activity Database

    Kolorenč, Jindřich; Shick, Alexander; Caciuffo, R.

    Cambridge: Cambridge University Press,, 2012 - (Anderson, D.; Boot, C.; Burns, P.), s. 177-182. (Materials Research Society Symposium Proceedings. 1444). ISBN 978-1-60511-421-7. ISSN 0272-9172. [2012 MRS Spring Meeting. Sacramento (CA), 09.04.2012-13.04.2012] R&D Projects: GA ČR(CZ) GAP204/10/0330; GA AV ČR IAA100100912 Institutional research plan: CEZ:AV0Z10100520 Keywords : americium * X-ray spectroscopy * LDA+DMFT Subject RIV: BM - Solid Matter Physics ; Magnetism http://journals.cambridge.org/article_S1946427412009463

  16. Plutonium and americium concentrations and vertical profiles in some Italian mosses used as bioindicators

    International Nuclear Information System (INIS)

    We have examined the uptake of actinide elements Am and Pu by different species of lichen and moss collected in two locations (Urbino, Central Italy; Alps region, North-east Italy). Plutonium and americium were separated and determined by extraction chromatography, electrodeposition and alpha-spectrometry. This paper summarizes our results with a special emphasis on the vertical profiles of these actinides in two different species of mosses. Several 1-2 cm depth sections were obtained and dated by 210Pb method. A typical peak for 239,240Pu and 241Am was found in the very old moss species ('Sphagnum Compactum') at a depth corresponding to the period 1960-1970 which was the period characterized by the maximum nuclear weapon tests. In a younger moss species ('Neckeria Crispa') no peak was observed and the regression curves showed that Am is more mobile than 239,240Pu and 238Pu. (author)

  17. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms; Oxydation de l'americium par voie electrochimique: etude des mecanismes

    Energy Technology Data Exchange (ETDEWEB)

    Picart, S.; Chartier, D.; Donnet, L.; Adnet, J.M. [CEA Valrho, (DCC/DRRV/SPHA), 30 - Marcoule (France)

    2000-07-01

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with {sup 18}O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO{sub 2}{sup +}. This cation reacts with silver (Il) to give

  18. Plutonium and americium in Arctic waters, the North Sea and Scottish and Irish coastal zones (in Fucus, Mytilus and Patella)

    International Nuclear Information System (INIS)

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were collected from the Irish coast in 1983. Fallout is found to dominate as a source of 239+240Pu north of latitude 650N, while for 238Pu a substantial fraction originates from European nuclear fuel reprocessing facilities. The 238Pu/239+240Pu isotope ratio provides clear evidence of the transport of effluent plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11-15 months in Scottish waters and, tentatively, 1.5-3 y during transport from the North Channel (north of the Irish Sea) to Spitsbergen. 241Am found in Arctic waters probably originates from the decay of fallout 241Pu and, like Pu, tentatively has a residence time of the order of several years. Americium from Sellafield has an estimated mean residence time of 4-6 months in Scottish waters. (author)

  19. Modelling of americium stripping in the EXAm process

    International Nuclear Information System (INIS)

    The EXAm process aims at recovering americium alone contained in the PUREX raffinate. The americium stripping model has been revised to take into account a change of stripping aqueous phase and up-to-date experimental results conducted within DRCP to improve knowledge about complexes. This work represents a first approximation at modelling americium stripping. The modelling work has led to synthesize the knowledge on chemical phenomenology and adopt assumptions that best reflect experimental results. The modelling has been implemented in PAREX code in order to simulate this step to prepare and understand tests to be carried out in mixer settlers. (authors)

  20. Higher Americium Oxidation State Research Roadmap

    Energy Technology Data Exchange (ETDEWEB)

    Mincher, Bruce J. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Law, Jack D. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Goff, George S. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Moyer, Bruce A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lumetta, Gregg J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Shehee, Thomas C. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL); Hobbs, David T. [Savannah River Site (SRS), Aiken, SC (United States). Savannah River National Lab. (SRNL)

    2015-12-18

    The partitioning of hexavalent Am from dissolved nuclear fuel requires the ability to efficiently oxidize Am(III) to Am(VI) and to maintain that oxidation state for a length of time sufficient to perform the separation. Several oxidants have been, or are being developed. Chemical oxidants include Ag-catalyzed ozone, Ag-catalyzed peroxydisulfate, Cu(III) periodate, and sodium bismuthate. Hexavalent americium has also now successfully been prepared by electrolysis, using functionalized electrodes. So-called auto-reduction rates of Am(VI) are sufficiently slow to allow for separations. However, for separations based on solvent extraction or ion exchange using organic resins, the high valence state must be maintained under the reducing conditions of the organic phase contact, and a holding oxidant is probably necessary. Until now, only Cu(III) periodate and sodium bismuthate oxidation have been successfully combined with solvent extraction separations. Bismuthate oxidation provided the higher DAm, since it acts as its own holding oxidant, and a successful hot test using centrifugal contactors was performed. For the other oxidants, Ag-catalyzed peroxydisulfate will not oxidize americium in nitric acid concentrations above 0.3 M, and it is not being further investigated. Peroxydisulfate in the absence of Ag catalysis is being used to prepare Am(V) in ion exchange work, discussed below. Preliminary work with Ag-catalyzed ozone has been unsuccessful for extractions of Am(VI) from 6.5 M HNO3, and only one attempt at extraction, also from 6.5 M HNO3, using the electrolytic oxidation has been attempted. However, this high acid concentration was based on the highest Am extraction efficiency using the bismuthate oxidant; which is only sparingly soluble, and thus the oxidation yield is based on bismuthate solubility. Lower acid concentrations may be sufficient with alternative oxidants and work with Ag-ozone, Cu(III) and electrolysis is on-going. Two non

  1. Mixed chelation therapy for removal of plutonium and americium

    International Nuclear Information System (INIS)

    Iron-binding compounds, 2,3-dihydroxybenzoic acid (DHBA), 2-hydroxybenzoic acid (HBA), and 2-(acetyloxy)benzoic acid (ABA), were tested for their ability to remove americium and plutonium from rats following intraperitioneal injection of the radionuclides as citrates (pH 5). Treatments, 2 mmol/kg, were given on days 3, 6, 10, 12 and 14 following the actinide injection. DHBA and HBA caused about a 20% decrease in liver retention of americium compared to the control value, and DHB caused a similar effect for plutonium. The above agents, co-administered with 0.5 mmol polyaminopolycarboxylic acid (PAPCA)-type chelons, did not change tissue retention of americium and plutonium from that due to the PAPCAs alone. Administration of americium and plutonium to the same rats is useful for studying removal agents since the two actinides behave independently in their biological disposition and response to removal

  2. Plutonium and Americium Geochemistry at Hanford: A Site Wide Review

    Energy Technology Data Exchange (ETDEWEB)

    Cantrell, Kirk J.; Felmy, Andrew R.

    2012-08-23

    This report was produced to provide a systematic review of the state-of-knowledge of plutonium and americium geochemistry at the Hanford Site. The report integrates existing knowledge of the subsurface migration behavior of plutonium and americium at the Hanford Site with available information in the scientific literature regarding the geochemistry of plutonium and americium in systems that are environmentally relevant to the Hanford Site. As a part of the report, key research needs are identified and prioritized, with the ultimate goal of developing a science-based capability to quantitatively assess risk at sites contaminated with plutonium and americium at the Hanford Site and the impact of remediation technologies and closure strategies.

  3. Americium/Curium Disposition Life Cycle Planning Study

    International Nuclear Information System (INIS)

    At the request of the Department of Energy Savannah River Office (DOE- SR), Westinghouse Savannah River Company (WSRC) evaluated concepts to complete disposition of Americium and Curium (Am/Cm) bearing materials currently located at the Savannah River Site (SRS)

  4. Gamma-sources on the basis of metallic americium-241

    International Nuclear Information System (INIS)

    A batch of gamma-radiation sources has been manufactured from metallic americium-241 of isotopic purity, its activity varying from 0.08 to 0.93 GBq. The cores of the sources are high-purity americium metal condensate on a tantalum or stainless steel substrate prepared by thermal decomposition of 241Pu-241Am alloy in a high vacuum. 7 refs., 1 tab

  5. Pyrochemical investigations into recovering plutonium from americium extraction salt residues

    International Nuclear Information System (INIS)

    Progress into developing a pyrochemical technique for separating and recovering plutonium from spent americium extraction waste salts has concentrated on selective chemical reduction with lanthanum metal and calcium metal and on the solvent extraction of americium with calcium metal. Both techniques are effective for recovering plutonium from the waste salt, although neither appears suitable as a separation technique for recycling a plutonium stream back to mainline purification processes. 17 refs., 13 figs., 2 tabs

  6. 1976 Hanford americium-exposure incident: external decontamination procedures

    International Nuclear Information System (INIS)

    An accident resulted in the deposition on an injured workman's skin surfaces, in acid-burned areas and in lacerations, of something in excess of 6 mCi americium-241. The external decontamination procedures used, the change in americium content of the skin during the course of treatment, and some of the unusual problems encountered from the extrusion of foreign material and flaking of skin and scar tissue are described

  7. Standardization of 238Pu

    International Nuclear Information System (INIS)

    An ion-implanted Si-detector and NaI(Tl) scintillation detector were employed for the standardization of 238Pu using the coincidence method. The low-energy discrimination method was applied to the degraded alpha spectrum for the efficiency variation, and an energy gate was provided for the X-rays between 7 and 35 keV. Two signals were compared to check their coincidence and counted if they were coincident. Three counts of alphas, X-rays and their coincidences were corrected for their dead times and/or the accidental coincidences between them before being extrapolated to the zero discrimination level of alphas. The resultant specific radioactivity is compared with that of the liquid scintillation counting method, and its evaluated uncertainty is given item by item. The impurity checks of the original solution source were described in brief too

  8. 238Pu based energy micro-generation sources for medical applications

    International Nuclear Information System (INIS)

    Pace-makers are frequently implanted in the human body. The existing apparatus are, actually, equipped with chemical piles with a lifetime of about 15 months. The use of 238Pu will provide a pace-maker with an autonomy of 10 years at least. Principal problems of security due to the use of plutonium are considered. It is advisable to improve the properties of pure plutonium by small additions of elements such as cerium, scandium, indium, gallium or americium. A number of the most important properties for a pace-maker source are presented. Finally, the fabrication and canning of the source are surveyed. (author)

  9. Electrochemical oxidation of americium in nitric medium: study of reaction mechanisms

    International Nuclear Information System (INIS)

    One alternative selected by the CEA for partitioning minor actinides from aqueous solutions containing fission products is the selective extraction of oxidized americium. This is the SESAME process (Selective Extraction and Separation of Americium by Means of Electrolysis) aimed to convert americium to oxidation state (VI) and then extract it with a specific extractant of high valences. This paper presents the study of the electrochemical oxidation of americium in nitric medium which represents an important stage of the process. The reaction can be divided into two main steps: oxidation of americium (III) to americium (IV), and then of americium (IV) to americium (VI). For the first oxidation step, a ligand L is needed to stabilize the intermediate species americium (IV) which disproportionates in its free form into americium (III) and (V). Phospho-tungstate or silico-tungstate are appropriate ligands because they are stable in concentrated nitric acid and show a great affinity for metallic cations at oxidation state (IV) (Table 1 lists the stability constants of americium (IV) complexes). The presence of the lacunary poly-anion lowers the potential of the americium (IV) / americium (Ill) redox pair (see Figure 5 for the diagram of the apparent formal potential of americium versus ligand concentration). This makes it thermodynamically possible to oxidize americium (III) into americium (IV) at the anode of an electrolyzer in nitric acid. For the second oxidation step, a strong oxidant redox mediator, like silver (II), is needed to convert complexed americium at oxidation state (IV) to oxidation state (V). The AmVL complex is then hydrolyzed to yield americyle (V) aqua ion. A spectroscopic Raman study with 18O labeled species showed that the oxygen atoms of the americyle moiety came from water. This indicates that water hydrolyzes the americium (V) complex to produce americyle (V) aqua ion, AmO2+. This cation reacts with silver (Il) to give americyle (VI) ion. Figure

  10. Complexation of americium with humic acid

    International Nuclear Information System (INIS)

    As a part of the interlaboratory comparison exercise for the complexation of humic acid and colloid generation (COCO-Club activities) in the CEC project MIRAGE-II, the complexation of americium with humic acid has been studied in our laboratory. Two humic acids were used for the study: Aldrich-HA(H+) which is a reference humic acid of the COCO-Club and Bradford-HA(H+) from Lake Bradford, Florida. A wide concentration range of humic acid and different ratios of Am to humic acid have been investigated between pH 5 and 6 with the ionic strength of 0.1 M and 1.0 M. The complexation has been studied by UV-spectroscopy, Laser-induced Photoacoustic Spectroscopy (LPAS) and ultrafiltration. LPAS is used for the submicromolar concentration range where the sensitivity of UV spectroscopy is not accessible. Ultrafiltration is used for low Am to humic acid ratios where both spectroscopic methods are not applicable. Varying the humic acid concentration over three orders of magnitude, only a 1:1 type of binding is observed. No significant variation of the stability constant is found in the investigated range of pH and ionic strength. However, the precipitation tendency and the loading capacity of humic acid are found to depend sensitively on pH and ionic strength. The complexation study provides a deep insight into the influence of humic acid on the migration behaviour of fission products and actinides in the geosphere. (orig.)

  11. Analysis of BWR lattices to recycle americium

    International Nuclear Information System (INIS)

    This study was carried out to assess the ability to eliminate meaningful quantities of americium in a primarily thermal neutron flux by 'spiking' modern BWR fuel with this minor actinide (MA). The studies carried out so far include the simulation of modern 10 x 10 BWR lattices employing the Westinghouse lattice physics code PHOENIX-4 alongside validation studies using MCNP5 models of the same lattices that were spatially depleted via the MONTEBURNS code coupling to ORIGEN. When considering the total inventory of minor actinides in Am-spiked pins, excluding isotopes of uranium and plutonium, the results indicate that a reduction of approximately 50% or more in the total mass inventory of these minor actinides is viable within the selected pins. Therefore, these preliminary results have encouraged the extension of this work to the development of improved lattice designs to help optimize the transmutation rates as well as absolute MA inventory reductions. The ultimate goal being to design batches of these advanced BWR bundles alongside multi-cycle core reload strategies. (authors)

  12. Applicability of insoluble tannin to treatment of waste containing americium

    International Nuclear Information System (INIS)

    The applicability of insoluble tannin adsorbent to the treatment of aqueous waste contaminated with americium has been investigated. Insoluble tannin is considered highly applicable because it consists of only carbon, hydrogen and oxygen and so its volume can be easily reduced by incineration. This report describes measurements of the americium distribution coefficient in low concentration nitric acid. The americium distribution coefficients were found to decrease with increasing concentration of nitric acid and sodium nitrate, and with increasing temperature. At 25 C in 2.0 x 10-3 M HNO3, the distribution coefficient was found to be 2000 ml g-1. The adsorption capacity was determined by column experiments using europium as a simulant of americium, and found to be 7 x 10-3 mmol g-1-dried tannin in 0.01 M HNO3 at 25 C, which corresponds to approximately 1.7 mg-241Am/g-adsorbent(dried). The prospect of applying the adsorbent to the treatment of aqueous waste contaminated with americium appears promising. (orig.)

  13. A TRUEX-based separation of americium from the lanthanides

    Energy Technology Data Exchange (ETDEWEB)

    Bruce J. Mincher; Nicholas C. Schmitt; Mary E. Case

    2011-03-01

    Abstract: The inextractability of the actinide AnO2+ ions in the TRUEX process suggests the possibility of a separation of americium from the lanthanides using oxidation to Am(V). The only current method for the direct oxidation of americium to Am(V) in strongly acidic media is with sodium bismuthate. We prepared Am(V) over a wide range of nitric acid concentrations and investigated its solvent extraction behavior for comparison to europium. While a separation is achievable in principal, the presence of macro amounts of cerium competes for the sparingly soluble oxidant and the oxidant itself competes for CMPO complexation. These factors conspire to reduce the Eu/Am separation factor from ~40 using tracer solutions to ~5 for extractions from first cycle raffinate simulant solution. To separate pentavalent americium directly from the lanthanides using the TRUEX process, an alternative oxidizing agent will be necessary.

  14. Salvage of plutonium-and americium-contaminated metals

    International Nuclear Information System (INIS)

    Melt-slagging techniques were evaluated as a decontamination and consolidation step for metals contaminated with oxides of plutonium and americium. Experiments were performed in which mild steel, stainless steel, and nickel metals contaminated with oxides of plutonium and americium were melted in the presence of silicate slags of various compositions. The metal products were low in contamination, with the plutonium and americium strongly fractionated to the slags. Partition coefficients (plutonium in slag/plutonium in steel) of 7*10/sup 6/ with borosilicate slag and 3*10/sup 6/ for calcium, magnesium silicate slag were measured. Decontamination of metals containing as much as 14,000 p.p.m. plutonium appears to be as efficient as that of metals with plutonium levels of 400 p.p.m. Staged extraction, that is, a remelting of processed metal with clean slag, results in further decontamination of the metal. 10 refs

  15. Uptake of americium-241 by algae and bacteria

    International Nuclear Information System (INIS)

    The uptake of americium by three algae, scenedesmus obliquus, selenastrum capricomutum and chlorella pyrenosdosa and a bacterium aeromonas hydrophila was studied. Live and fixed cells of each algal species and live bacterial cells were used. it is shown that algae and bacteria concentrate americium 241 to a high degree which makes them important links in the biomagnification phenomenon which may ultimately lead to a human hazard and be potentially important in recycling Am 241 in the water column and mobilization from sediments. Chemical fixation of algal cells caused increased uptake which indicated that uptake is by passive diffusion and probably due to chemical alteration of surface binding sites. (U.K.)

  16. Americium incineration by recycling in target rods using coated particles

    International Nuclear Information System (INIS)

    This paper proposes a type of target rod based on the use of coated particles, for an efficient incineration of americium in nuclear reactors. The analysis takes advantage of the experience gained in the past from long duration irradiation without damage of coated particles with plutonium oxide kernels. A conservative theoretical evaluation of the gas pressure inside the coated particles at the end of irradiation allows comparing the well known conditions of the plutonium oxide particles which were successfully irradiated to high burn-up, with a preliminary design of americium oxide particles. (authors)

  17. Plutonium and americium in fish, shellfish and seaweed in the Irish environment and their contribution to dose

    International Nuclear Information System (INIS)

    Plutonium and americium activity concentrations in fish and shellfish landed in Ireland in the period 1988 to 1997 are presented. Activity concentrations in fish are low and often below detection limits, while those in mussels and oysters sampled on the northeast coast show no significant signs of decline. The estimated doses to hypothetical typical and heavy seafood consumers remain below 1 μSv yr-1 (committed effective dose).Plutonium activity concentrations measured in Fucus vesiculosus around the Irish coastline have not fallen appreciably in the ten year period between 1986 and 1996. Furthermore, the mean 238Pu/239,240Pu ratio of 0.17±0.05 in Fucus vesiculosus from the west coast of Ireland demonstrates the increasing significance of Sellafield-derived plutonium in those waters. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  18. 1976 Hanford americium exposure incident: overview and perspective

    International Nuclear Information System (INIS)

    Salient features of the 1976 Hanford americium exposure incident are discussed. Comparisons are made with previous human and animal exposure data, and conclusions drawn relative to the injured workman, to health physics practices, and to the adequacy of current exposure limits

  19. Economical Production of Pu-238

    Energy Technology Data Exchange (ETDEWEB)

    Steven D. Howe; Douglas Crawford; Jorge Navarro; Terry Ring

    2013-02-01

    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238. The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100 M to get to production levels. The Center for Space Nuclear Research has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. The new process will also produce dramatically less waste. Potentially, the front end costs could be provided by private industry such that the government only had to pay for the product produced. Under a NASA Phase I NIAC grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce at least 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. In addition, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  20. Americium retention by the smectite hectorite

    International Nuclear Information System (INIS)

    Document available in extended abstract form only. Clay minerals may play an important role in a high level nuclear waste disposal site. Smectites may be major components of backfill material used to enhance the retention properties of engineered barriers. Furthermore, they have also been detected in the alteration layer of nuclear waste glass corroded in laboratory experiments. For example, the smectite hectorite (Na0.33[Mg2.67Li0.33Si4O10(OH)2]) was identified as phase forming upon waste matrix dissolution and subsequent reprecipitation. Smectites are known to be highly reactive with respect to cations in aqueous systems. Several distinct molecular scale binding mechanisms may operate, but the most effective retention may occur by incorporation in the bulk structure, especially if a (meta)stable solid solution forms. Investigations showed the possibility to incorporate Lu(III) in a clay-like octahedral site in hectorite by coprecipitation. Furthermore, luminescence studies on hectorite synthesized in the presence of Cm(III) or Eu(III) were consistent with an incorporation in the bulk structure. However, structural data such as coordination numbers and bond lengths are still missing for the actinides. In the present study, Am(III) was coprecipitated with and adsorbed on hectorite to decipher the actual retention mechanism(s). Hectorite was synthesized in the presence of Am(III) (sample AmCopHec) from an Am-containing brucite precursor phase. Briefly, brucite was freshly precipitated in the presence of Am(III) (Am:Mg molar ratio of 1:1175) and washed. The resulting sol was aged in a tightly closed vessel in the presence of LiF and silica sol for several days at 90 C. Separately, an Am-containing brucite phase (sample AmCopBru) was prepared under identical conditions as described above, and the americium aqua ions were adsorbed on hectorite (m/V = 2 g/L, [Am(III)]tot = 105 μmol/L, 0.5 mol/L NaClO4, pH = 6.4(1), sample AmSorbHec) and used as reference samples. X

  1. Characterization of uranium, plutonium, neptunium, and americium in HLW supernate for LLW certification

    International Nuclear Information System (INIS)

    The 1S Manual requires that High Level Waste (HLW) implement a waste certification program prior to sending waste packages to the E-Area vaults. To support the waste certification plan, the HLW supernate inventory of uranium, plutonium, neptunium and americium have been characterized. This characterization is based on the chemical, isotopic and radiological properties of these elements in HLW supernate. This report uses process knowledge, solubility data, isotopic inventory data and sample data to determine if any isotopes of the aforementioned elements will exceed the minimum reportable quantity (MRQ) for waste packages contaminated with HLW supernate. If the MRQ can be exceeded for a particular nuclide, then a method for estimating the waste package content is provided. Waste packages contaminated from HLW supernate do not contain sufficient U-233, U-234, U-235, U-236, U-238, Pu-239, Pu-240, Pu-241, Pu-242 or Am-241 to warrant separate reporting on the shipping manifest. Calculations show that, on average, more than 100 gallons of supernate is required to exceed the PAC (package acceptance criteria) for each of these nuclides. Thus it is highly unlikely that the PAC would be exceeded for these nuclides and unlikely that the MRQ would be exceeded. These nuclides should be manifested as zero for waste packages contaminated with HLW supernate. The only actinide isotopes that may exceed the MRQ are Np-237 and Pu-238. The recommended method to calculate the amount of these two isotopes in waste packages contaminated with HLW supernate is to ratio them to the measured Cs-137 activity

  2. Synthesis and characterization of uranium-americium mixed oxides

    International Nuclear Information System (INIS)

    Americium isotopes represent a significant part of high-level and long-lived nuclear waste in spent fuels. Among the envisaged reprocessing scenarios, their transmutation in fast neutron reactors using uranium-americium mixed-oxide pellets (U1-xAmxO2±δ) is a promising option which would help decrease the ecological footprint of ultimate waste repository sites. In this context, this thesis is dedicated to the study of such compounds over a wide range of americium contents (7.5 at.% ≤ Am/(U+Am) ≤ 70 at.%), with an emphasis on their fabrication from single-oxide precursors and the assessment of their structural and thermodynamic stabilities, also taking self-irradiation effects into account. Results highlight the main influence of americium reduction to Am(+III), not only on the mechanisms of solid-state formation of the U1-xAmxO2±δ solid solution, but also on the stabilization of oxidized uranium cations and the formation of defects in the oxygen sublattice such as vacancies and cub-octahedral clusters. In addition, the data acquired concerning the stability of U1-xAmxO2±δ compounds (existence of a miscibility gap, vaporization behavior) were compared to calculations based on new thermodynamic modelling of the U-Am-O ternary system. Finally, α-self-irradiation-induced structural effects on U1-xAmxO2±δ compounds were analyzed using XRD, XAS and TEM, allowing the influence of americium content on the structural swelling to be studied as well as the description of the evolution of radiation-induced structural defects. (author)

  3. Reduction Rates for Higher Americium Oxidation States in Nitric Acid

    Energy Technology Data Exchange (ETDEWEB)

    Grimes, Travis Shane [Idaho National Lab. (INL), Idaho Falls, ID (United States); Mincher, Bruce Jay [Idaho National Lab. (INL), Idaho Falls, ID (United States); Schmitt, Nicholas C [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-09-30

    The stability of hexavalent americium was measured using multiple americium concentrations and nitric acid concentrations after contact with the strong oxidant sodium bismuthate. Contrary to our hypotheses Am(VI) was not reduced faster at higher americium concentrations, and the reduction was only zero-order at short time scales. Attempts to model the reduction kinetics using zero order kinetic models showed Am(VI) reduction in nitric acid is more complex than the autoreduction processes reported by others in perchloric acid. The classical zero-order reduction of Am(VI) was found here only for short times on the order of a few hours. We did show that the rate of Am(V) production was less than the rate of Am(VI) reduction, indicating that some Am(VI) undergoes two electron-reduction to Am(IV). We also monitored the Am(VI) reduction in contact with the organic diluent dodecane. A direct comparison of these results with those in the absence of the organic diluent showed the reduction rates for Am(VI) were not statistically different for both systems. Additional americium oxidations conducted in the presence of Ce(IV)/Ce(III) ions showed that Am(VI) is reduced without the typical growth of Am(V) observed in the systems sans Ce ion. This was an interesting result which suggests a potential new reduction/oxidation pathway for Am in the presence of Ce; however, these results were very preliminary, and will require additional experiments to understand the mechanism by which this occurs. Overall, these studies have shown that hexavalent americium is fundamentally stable enough in nitric acid to run a separations process. However, the complicated nature of the reduction pathways based on the system components is far from being rigorously understood.

  4. 16 CFR 238.2 - Initial offer.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Initial offer. 238.2 Section 238.2... § 238.2 Initial offer. (a) No statement or illustration should be used in any advertisement which..., or origin of the product offered, or which may otherwise misrepresent the product in such a...

  5. 47 CFR 90.238 - Telemetry operations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Telemetry operations. 90.238 Section 90.238... MOBILE RADIO SERVICES Non-Voice and Other Specialized Operations § 90.238 Telemetry operations. The use of telemetry is authorized under this part on the following frequencies. (a) 72-76 MHz (in...

  6. 46 CFR 153.238 - Required materials.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 5 2010-10-01 2010-10-01 false Required materials. 153.238 Section 153.238 Shipping... BULK LIQUID, LIQUEFIED GAS, OR COMPRESSED GAS HAZARDOUS MATERIALS Design and Equipment Cargo Containment Systems § 153.238 Required materials. When one of the following paragraphs of this section...

  7. 40 CFR 238.30 - Requirement.

    Science.gov (United States)

    2010-07-01

    ...) and 1 CFR part 51. Copies are available from the American Society of Testing and Materials, 1916 Race... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirement. 238.30 Section 238.30... CARRIERS Requirement § 238.30 Requirement. (a) No processor or person shall manufacture or import, in...

  8. 49 CFR 238.231 - Brake system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Brake system. 238.231 Section 238.231... Equipment § 238.231 Brake system. Except as otherwise provided in this section, on or after September 9... train's primary brake system shall be capable of stopping the train with a service application from...

  9. 49 CFR 238.227 - Suspension system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Suspension system. 238.227 Section 238.227 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Equipment § 238.227 Suspension system. On or after November 8, 1999— (a) All passenger equipment...

  10. 49 CFR 238.225 - Electrical system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electrical system. 238.225 Section 238.225... Equipment § 238.225 Electrical system. All passenger equipment shall comply with the following: (a... derated for grouping and for operating temperature. (b) Main battery system. (1) The main...

  11. 49 CFR 238.427 - Suspension system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Suspension system. 238.427 Section 238.427... Equipment § 238.427 Suspension system. (a) General requirements. (1) Suspension systems shall be designed to... equipment. (2) Passenger equipment shall meet the safety performance standards for suspension...

  12. 49 CFR 238.425 - Electrical system.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electrical system. 238.425 Section 238.425... Equipment § 238.425 Electrical system. (a) Circuit protection. (1) The main propulsion power line shall be.... (b) Main battery system. (1) The main batteries shall be isolated from the cab and passenger...

  13. 33 CFR 238.3 - References.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false References. 238.3 Section 238.3 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE WATER RESOURCES POLICIES AND AUTHORITIES: FLOOD DAMAGE REDUCTION MEASURES IN URBAN AREAS § 238.3 References....

  14. 16 CFR 238.1 - Bait advertisement.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Bait advertisement. 238.1 Section 238.1 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES AGAINST BAIT ADVERTISING § 238.1 Bait advertisement. No advertisement containing an offer to sell a product should be published when the offer is not a bona fide...

  15. Liquid-liquid extraction separation and determination of plutonium and americium

    International Nuclear Information System (INIS)

    A procedure is described for the determination of plutonium and americium after their initial separation on barium sulfate. The barium sulfate is dissolved in perchloric acid and the antinides and lanthanides are extracted into bis(2-ethylhexyl)phosphoric acid (HDEHP). Americium along with other tervalent actinides and lanthanides is stripped from HDEHP with nitric acid. The lanthanides are removed on a column of HDEHP supported on Teflon powder, and the americium and other tervalent actinides are electrodeposited for their determination by α spectrometry. The plutonium is stripped with nitric acid after reduction to the tervalent state with 2,5-di-tert-butylhydroquinone and electrodeposited for α spectrometry. Decontamination factors for plutonium and americium from each other and from other α emitters are 104 to 105. Two hours are required for the liquid-liquid extraction separations of plutonium and americium from eight samples. Recoveries of americium and plutonium through the HDEHP separatons are 99% and 95%, respectively

  16. Calculational study on irradiation of americium fuel samples in the Petten High Flux Reactor

    International Nuclear Information System (INIS)

    A calculational study on the irradiation of americium samples in the Petten High Flux Reactor (HFR) has been performed. This has been done in the framework of the international EFTTRA cooperation. For several reasons the americium in the samples is supposed to be diluted with a neutron inert matrix, but the main reason is to limit the power density in the sample. The low americium nuclide density in the sample (10 weight % americium oxide) leads to a low radial dependence of the burnup. Three different calculational methods have been used to calculate the burnup in the americium sample: Two-dimensional calculations with WIMS-6, one-dimensional calculations with WIMS-6, and one-dimensional calculations with SCALE. The results of the different methods agree fairly well. It is concluded that the radiotoxicity of the americium sample can be reduced upon irradiation in our scenario. This is especially the case for the radiotoxicity between 100 and 1000 years after storage. (orig.)

  17. Neptunium and americium control for international non-proliferation regime

    International Nuclear Information System (INIS)

    It was decided in the IAEA Board of Governors Meeting held in Sept. 1999 that Neptunium and Americium could be diverted for manufacturing nuclear weapon or explosives, so that appropriate measures should be taken for the prevention of proliferation of these materials. It is expected to take relatively long time for settling down the aligned system dealing with the above materials because the present regulatory statement was prepared on the basis of voluntary offers from the States concerned. The necessity of preventive measures is being convinced among Member States, but it would not be easy to take voluntary participation in detail because of their respective interests. It is expected that this paper could contribute to the effective response as to the international commitments as well as for protecting the domestic nuclear industry and R and D area through analysis on the IAEA's approach on Neptunium and Americium

  18. Thermophysical properties of americium-containing barium plutonate

    International Nuclear Information System (INIS)

    Polycrystalline specimens of americium-containing barium plutonate have been prepared by mixing the appropriate amounts of (Pu0.91Am0.09)O2 and BaCO3 powders followed by reacting and sintering at 1600 K under the flowing gas atmosphere of dry-air. The sintered specimens had a single phase of orthorhombic perovskite structure and were crack-free. Elastic moduli were determined from longitudinal and shear sound velocities. Debye temperature was also determined from sound velocities and lattice parameter measurements. Thermal conductivity was calculated from measured density at room temperature, literature values of heat capacity and thermal diffusivity measured by laser flash method in vacuum. Thermal conductivity of americium-containing barium plutonate was roughly independent of temperature and registered almost the same magnitude as that of BaPuO3 and BaUO3. (author)

  19. 1976 Hanford americium-exposure incident: decontamination and treatment facility

    International Nuclear Information System (INIS)

    An injured worker, contaminated with over 6 mCi of americium-241, required special treatment and housing for 4 months. This paper is a description of the design and management of the facility in which most of the treatment and housing occurred. The problems associated with contamination control, waste handling, supplies, and radiological concerns during the two-stage transfer of the patient from a controlled situation to his normal living environment are discussed in detail

  20. Recycling heterogeneous americium targets in a boiling water reactor

    International Nuclear Information System (INIS)

    One of the limiting contributors to the heat load constraint for a long term spent fuel repository is the decay of americium-241. A possible option to reduce the heat load produced by Am-241 is to eliminate it via transmutation in a light water reactor thermal neutron environment, in particular, by taking advantage of the large thermal fission cross section of Am-242 and Am-242m. In this study we employ lattice loading optimization techniques to define the loadings and arrangements of fuel pins with blended americium and uranium oxide in boiling water reactor bundles, specifically, by defining the incineration of pre-loaded americium as an objective function to maximize americium transmutation. Subsequently, the viability of these optimized lattices is tested by assembling them into bundles with Am-spiked fuel pins and by loading these bundles into realistic three-dimensional BWR core-wide simulations that model multiple reload cycles and observe standard operational constraints. These simulations are possible via our collaboration with the Westinghouse Electric Co. which facilitates the use of industrial-caliber design tools such as the PHOENIX-4/POLCA-7 sequence and the Core Master 2 GUI work environment for fuel management. The resulting analysis confirms the ability to axially uniformly eliminating roughly 90% of the pre-loaded inventory of recycled Am-241 in BWR bundles with heterogeneous target pins. This high level of incineration was achieved within three to four 18-month operational cycles, which is equivalent to a typical in-core residence time of a BWR bundle.

  1. Ingestion Pathway Transfer Factors for Plutonium and Americium

    Energy Technology Data Exchange (ETDEWEB)

    Blanchard, A.

    1999-07-28

    Overall transfer factors for major ingestion pathways are derived for plutonium and americium. These transfer factors relate the radionuclide concentration in a given foodstuff to deposition on the soil. Equations describing basic relationships consistent with Regulatory Guide 1.109 are followed. Updated values and coefficients from IAEA Technical Reports Series No. 364 are used when a available. Preference is given to using factors specific to the Savannah River Site.

  2. Uptake of americium-241 by plants from contaminated Chernobyl exclusive zone test site soils

    International Nuclear Information System (INIS)

    Americium-241 was found to accumulate in soils and biological objects of the environment. Its concentration has increased many times after the Chernobyl disaster and can be expected to increase about 40 times in the future. This research concentrated on the contaminated exclusive Chernobyl zone polluted by trace radionuclides, their behavior and accumulation by various plant species. Special attention is devoted to the bioavailability of 241Am to the plants Galium rivale, G. tinctorium, G. aparine, G. intermedium, Berteroa incana, Artemisia absinthium, A. vulgaris, Centaurea borysthenica, C. arenaria, Cirsium arvense, Succissa pratensis, Solidago virgaurea, Linaria vulgaris, Lepidium ruderale, Stenactis annua, Veronica maxima, Verbascum lychnitis, Euphorbia cyparissias, Genista tinctoria, Erigeron canadensis, Oenothera biennis, Betula pendula and Quercus robur, which were collected from the Chernobyl, Kopachi, and Yanov districts. The plant samples of Oenothera biennis, Betula pendula and Quercus robur were collected from the Yanov district, where the soil contamination by 241Am and 137Cs was at the level of 660 and 27 MBq/m2, respectively. Gamma spectroscopy and radiochemical methods were used to estimate the activity concentration of 137Cs, 90Sr, 238Pu, 239+240Pu, 241Am. The radionuclides were measured in the dry green mass of the plant samples and in the dry soils. The contamination of the Oenothera biennis, Betula pendula and Quercus robur samples by 137Cs was (5.8±1,5)x106, (7.4±1.1)x105, and (2.6±0.2)x106 Bq/kg dry mass, respectively, and contamination by 241Am was 47±5, 45±3 and 3.2±0.2 Bq/kg, respectively. The soil-to-plant transfer ratio for 137Cs ranged lay within the interval of 0.2 to 0.03 Bq/kg : Bq/m2, the the transfer ratio for 241Am did not exceed 7x10-5 Bq/kg : Bq/m2. The coefficient of the relative contents of the 241Am/239+240Pu radionuclides in the various plant samples varied from 3.2 to 8.3, while for soil from the Yanov district this

  3. Gut uptake factors for plutonium, americium and curium

    International Nuclear Information System (INIS)

    Data on estimates of the absorption of plutonium, americium and curium from the human gut based on measurements of uptake in other mammalian species are reviewed. It is proposed that for all adult members of the public ingesting low concentrations of plutonium in food and water, 0.05% would be an appropriate value of absorption except when the conditions of exposure are known and a lower value can be justified. For dietary intakes of americium and curium, the available data do not warrant a change from the ICRP value of 0.05%. For newborn children ingesting americium, curium and soluble forms of plutonium, a value of 1% absorption is proposed for the first 3 months of life during which the infant is maintained on a milk diet. It is proposed that a value of 0.5% should be used for the first year of life to take account of the gradual maturation of the gut. In considering the ingestion of insoluble oxides of plutonium by infants, it is proposed that absorption is taken as 0.1% for the first 3 months and 0.05% for the first year. (author)

  4. Environmental aspects of the transuranics: a selected, annotated bibliography. [Pu-238, Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Ensminger, J.T.; Martin, F.M.; Fore, C.S. (comps.)

    1977-03-01

    This eighth published bibliography of 427 references is compiled from the Nevada Applied Ecology Information Center's Data Base on the Environmental Aspects of the Transuranics. The data base was built to provide information support to the Nevada Applied Ecology Group (NAEG) of ERDA's Nevada Operations Office. The general scope covers environmental aspects of uranium and the transuranic elements, with emphasis on plutonium. This bibliography highlights literature on plutonium 238 and 239 and americium in the critical organs of man and animals. Supporting information on ecology of the Nevada Test Site and reviews and summarizing literature on other radionuclides have been included at the request of the NAEG. The references are arranged by subject category with leading authors appearing alphabetically in each category. Indexes are provided for author(s), geographic location, keyword(s), taxon, title, and publication description.

  5. Dicty_cDB: SLA238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA238 (Link to dictyBase) - - - Contig-U16382-1 SLA238Z (Link... to Original site) - - SLA238Z 648 - - - - Show SLA238 Library SL (Link to library) Clone ID SLA238 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/SL/SLA2-B/SLA238Q.Seq.d/ Representative seq. ID SLA23...8Z (Link to Original site) Representative DNA sequence >SLA238 (SLA238Q) /CSM/SL/SLA2-B/SLA238Q.Seq.d/ XXXXX...ATATTTAAAT GTATAATAATAATAAAATATAATTATTTTTAATGGTTGTTGATCTTTATCCGACTATC sequence update 1997. 5. 7 Translated

  6. Airborne plutonium-239 and americium-241 concentrations measured from the 125-meter Hanford Meteorological Tower

    International Nuclear Information System (INIS)

    Airborne plutonium-239 and americium-241 concentrations and fluxes were measured at six heights from 1.9 to 122 m on the Hanford meteorological tower. The data show that plutonium-239 was transported on nonrespirable and small particles at all heights. Airborne americium-241 concentrations on small particles were maximum at the 91 m height

  7. Identification of new isotope 238Th

    International Nuclear Information System (INIS)

    Unreported heavy neutron-rich nuclide 238Th has been produced via a multinucleon transfer reaction by 60 MeV/u 18O ions bombardment of natural uranium. Thorium was radiochemically separated from the mixture of uranium and reaction products. 238Pa as a daughter nucleus of 238Th has been identified according to the growth and decay of 238Pa γ rays which has been observed. The half-life of 238Th was determined to be (9.4 +- 2.0) min. At the same time, a new γ ray of (89.0 +- 0.3) keV with T1/2 = (8.9±1.5) min was found in the γ spectrum gated with the Kα1 X ray of Pa and assigned to 238Th decay based on the measurements of its transition energy and the half-life

  8. Effect of 241-americium on bone marrow stroma

    International Nuclear Information System (INIS)

    The regulation of haemopoiesis occurs via complex interactions between the stroma and the haemopoietic cells. An attempt to further clarifying the mechanisms and the exact role of the stroma in the regulation was made in a study. Results revealed that the murine bone marrow stromal cells are highly radiosensitive after injection with 241-americium and can thus be considered as a target population after internal contamination. In addition, observations are made which may be important for risk estimation for the developing animal and during pregnancy. Contamination in utero and by lactation shows persistent damage up to 1 year after contamination at an average annual dose of 5 cGy. (author)

  9. Recovery of americium-241 from aged plutonium metal

    International Nuclear Information System (INIS)

    After separation and purification, both actinides were precipitated as oxalates and calcined. A large-scale process was developed using dissolution, separation, purification, precipitation, and calcination. Efforts were made to control corrosion, to avoid product contamination, to keep the volume of process and waste solutions manageable, and to denitrate solutions with formic acid. The Multipurpose Processing Facility (MPPF), designed for recovery of transplutonium isotopes, was used for the first time for the precipitation and calcination of americium. Also, for the first time,, large-scale formic acid denitration was performed in a canyon vessel at SRP

  10. Preferential decorporation of americium by pulmonary administration of DTPA dry powder after inhalation of aged PuO2 containing americium in rats

    International Nuclear Information System (INIS)

    After inhalation of plutonium oxides containing various percentages of americium in rats, we identified an acellular transient pulmonary compartment, the epithelial lining fluid (ELF), in which a fraction of actinide oxides dissolve prior to absorption and subsequent extrapulmonary deposit. Chelation therapy is usually considered to be poorly efficient after inhalation of actinide oxides. However, in the present study, prompt pulmonary administration of diethylenetriaminepentaacetic acid (DTPA) as a dry powder led to a decrease in actinide content in ELF together with a limitation of bone and liver deposits. Because americium is more soluble than plutonium, higher amounts of americium were found in ELF, extrapulmonary tissues and urine. Our results also demonstrated that the higher efficacy of DTPA on americium compared to plutonium in ELF induced a preferential inhibition of extrapulmonary deposit and a greater urinary excretion of americium compared to plutonium. All together, our data justify the use of an early and local DTPA treatment after inhalation of plutonium oxide aerosols in which americium can be in high proportion such as in aged compounds. (authors)

  11. Analytical performance of radiochemical method for americium determination in urine

    International Nuclear Information System (INIS)

    This paper presents an analytical method developed and adapted for separation and analysis of Plutonium (Pu) isotopes and Americium (Am) in urine samples. The proposed method will attend the demand of internal exposure monitoring program for workers involved mainly with dismantling rods and radioactive smoke detectors. In this experimental procedure four steps are involved as preparation of samples, sequential radiochemical separation, preparation of the source for electroplating and quantification by alpha spectrometry. In the first stage of radiochemical separation, plutonium is conventionally isolated employing the anion exchange technique. Americium isolation is achieved sequentially by chromatographic extraction (Tru.spec column) from the load and rinse solutions coming from the anion exchange column. The 243Am tracer is added into the sample as chemical yield monitors and to correct the results improving the precision and accuracy. The mean recovery obtained is 60%, and the detection limit for 24h urine sample is 1.0 mBq L-1 in accordance with the literature. Based in the preliminary results, the method is appropriate to be used in monitoring programme of workers with a potential risk of internal contamination. (author)

  12. Placental transfer of americium and plutonium in mice

    International Nuclear Information System (INIS)

    Actinide element release to the environment and subsequent transfer through food chains to pregnant women may present a radiation hazard to fetuses in utero. To measure americium incorporation, four groups of pregnant mice were intravenously dosed with four concentrations of 243Am citrate in late pregnancy. Concentrations of 243Am in fetuses, placentas, and maternal femur, liver, carcass and pelt were determined 48 hr after injection. Doses were chosen so that the number of atoms of 243Am in each injected dose was equal to the number of atoms of 239Pu used in an earlier study of transplacental movement. Results indicate that, atom for atom, americium is incorporated into fetal tissue in lesser amounts (10-25 times) than is plutonium when intravenously administered to pregnant mice in equal atom amounts. Tissue analyses indicated that, at low dose levels, the average fraction of the dose incorporated into the fetuses decreased as the dose to the pregnant mouse was increased. A similar pattern was noted for placentas and maternal femurs. Data indicate that one must make extrapolations from low dose data only to make reasonable and realistic estimates of the transplacental movement and fetal incorporation of environmental levels of actinide elements in man and other species. (author)

  13. Development of separation techniques of americium from reprocessing solution

    International Nuclear Information System (INIS)

    Americium(Am) and neptunium(Np) finally transfer to the waste stream in the current PUREX reprocessing process. As an option, some methods have been developed to recover Am and Np from the waste stream to decrease long-term toxicity of the high level waste. The most stable valence state of Am is III, but TBP (tri-n-butyl phosphate) which is an extractant used in the PUREX reprocessing does not extract Am(III). Therefore, some special extractants have been developed to recover Am(III). However, they also extract rare-earth elements(REs), which necessitates the separation process for Am from REs. We have been developing a separation process which consists of valence control of Am to the VI state and its extraction with TBP. This process allows Am recovery from reprocessing solution and Am separation from REs simultaneously. Americium(III) is oxidized to Am(VI) by electrochemical oxidation and chemical oxidation using peroxodisulfate ammonium and silver nitrate. The latter was adopted here because the chemical oxidation reaction proceeds faster than the electrochemical method. Reaction mechanisms of oxidation and extraction were investigated. Based on the mechanisms, we found that extraction efficiency could be improved and waste generation could be minimized. (author)

  14. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Rudisill, T.S.

    1999-08-11

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  15. Solubility of Plutonium (IV) Oxalate During Americium/Curium Pretreatment

    International Nuclear Information System (INIS)

    Approximately 15,000 L of solution containing isotopes of americium and curium (Am/Cm) will undergo stabilization by vitrification at the Savannah River Site (SRS). Prior to vitrification, an in-tank pretreatment will be used to remove metal impurities from the solution using an oxalate precipitation process. Material balance calculations for this process, based on solubility data in pure nitric acid, predict approximately 80 percent of the plutonium in the solution will be lost to waste. Due to the uncertainty associated with the plutonium losses during processing, solubility experiments were performed to measure the recovery of plutonium during pretreatment and a subsequent precipitation process to prepare a slurry feed for a batch melter. A good estimate of the plutonium content of the glass is required for planning the shipment of the vitrified Am/Cm product to Oak Ridge National Laboratory (ORNL).The plutonium solubility in the oxalate precipitation supernate during pretreatment was 10 mg/mL at 35 degrees C. In two subsequent washes with a 0.25M oxalic acid/0.5M nitric acid solution, the solubility dropped to less than 5 mg/mL. During the precipitation and washing steps, lanthanide fission products in the solution were mostly insoluble. Uranium, and alkali, alkaline earth, and transition metal impurities were soluble as expected. An elemental material balance for plutonium showed that greater than 94 percent of the plutonium was recovered in the dissolved precipitate. The recovery of the lanthanide elements was generally 94 percent or higher except for the more soluble lanthanum. The recovery of soluble metal impurities from the precipitate slurry ranged from 15 to 22 percent. Theoretically, 16 percent of the soluble oxalates should have been present in the dissolved slurry based on the dilution effects and volumes of supernate and wash solutions removed. A trace level material balance showed greater than 97 percent recovery of americium-241 (from the beta dec

  16. Americium Transmutation Feasibility When Used as Burnable Absorbers - 12392

    International Nuclear Information System (INIS)

    The use of plutonium in Mixed Oxide (MOX) fuel in traditional Pressurized Water Reactor (PWR) assemblies leads to greater americium production which is not addressed in MOX recycling. The transuranic nuclides (TRU) contribute the most to the radiotoxicity of nuclear waste and a reduction of the TRU stockpile would greatly reduce the overall radiotoxicity of what must be managed. Am-241 is a TRU of particular concern because it is the dominant contributor of total radiotoxicity for the first 1000 years in a repository. This research explored the feasibility of transmuting Am-241 by using varying amounts in MOX rods being used in place of burnable absorbers and evaluated with respect to the impact on incineration and transmutation of transuranics in MOX fuel as well as the impact on safety. This research concludes that the addition of americium to a non-uniform fuel assembly is a viable method of transmuting Am-241, holding down excess reactivity in the core while serving as a burnable poison, as well as reducing the radiotoxicity of high level waste that must be managed. The use of Am/MOX hybrid fuel assemblies to transmute americium was researched using multiple computer codes. Am-241 was shown in this study to be able to hold down excess reactivity at the beginning of cycle and shape the power distribution in the core with assemblies of varying americium content loaded in a pattern similar to the traditional use of assemblies with varying amounts of burnable absorbers. The feasibility, safety, and utility of using americium to create an Am/MOX hybrid non-uniform core were also evaluated. The core remained critical to a burnup of 22,000 MWD/MTM. The power coefficient of reactivity as well as the temperature and power defects were sufficiently negative to provide a prompt feedback mechanism in case of a transient and prevent a power excursion, thus ensuring inherent safety and protection of the core. As shown here as well as many other studies, this non

  17. 49 CFR 238.429 - Safety appliances.

    Science.gov (United States)

    2010-10-01

    ... strength. (2) All safety appliances shall be securely fastened to the car body structure with mechanical... 49 Transportation 4 2010-10-01 2010-10-01 false Safety appliances. 238.429 Section 238.429..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Specific Requirements for Tier II...

  18. MGA Analysis on Elevated 238 Pu Samples

    Science.gov (United States)

    Wang, T. F.; Moody, K. J.; Raschke, K. E.; Ruhter, W. D.

    2002-10-01

    Plutonium gamma-ray data analysis, in the 100-keV region, using MGA has been improved to overcome the original maximum limit of 2% 238Pu relative plutonium content in a sample in order to perform an analysis. MGA analysis results of elevated 238Pu samples are compared to the results from mass spectrometry.

  19. 33 CFR 238.9 - Local cooperation.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Local cooperation. 238.9 Section 238.9 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF... Local cooperation. (a) Cost sharing and other provisions of local cooperation shall be in...

  20. 49 CFR 238.103 - Fire safety.

    Science.gov (United States)

    2010-10-01

    ..., 1999 (see 49 CFR parts 200-399, revised as of October 1, 1999), if prior to June 25, 2002 the material... 49 Transportation 4 2010-10-01 2010-10-01 false Fire safety. 238.103 Section 238.103..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General...

  1. The Doppler effect measurement on 238U

    International Nuclear Information System (INIS)

    The UO2 sample was irradiated in the RB zero power reactor in order to determine the Doppler effect on the 238 U by measuring the change in the 238 capture cross section with temperature. The measurement was meant to verify the indigenous developed computer codes and nuclear data library

  2. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    Energy Technology Data Exchange (ETDEWEB)

    Noronha, Donald M.; Pius, Illipparambil C.; Chaudhury, Satyajeet [Bhabha Atomic Research Centre, Mumbai (India). Fuel Chemistry Div.

    2015-07-01

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the K{sub d} value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  3. Removal of americium from effluent generated during the purification of plutonium by anion exchange

    International Nuclear Information System (INIS)

    Studies have been carried out on removal of americium from the effluent generated during anion exchange purification of plutonium. Americium 241, generated by the beta decay of Plutonium-241, is the major source of a activity in this highly acidic effluent and its removal would render the waste easily disposable. A simple and effective co-precipitation method, using thorium oxalate has been investigated for the treatment of this alpha active aqueous waste. Experiments have been carried out to identify optimum conditions to obtain high percentage co-precipitation with minimum amount of co-precipitant. Efforts were carried out to correlate the optimum conditions of co-precipitation of americium obtained in these experiments with solubility of thorium oxalate and americium oxalate calculated from solubility products of these compounds, stability constants of thorium and americium oxalate complexes taken from literature. The saturation capacity of thorium oxalate for Am(III) was also calculated by analyzing the Kd value data using Langmuir adsorption equation. The strong tendency of americium to get co-precipitated and the high capacity exhibited by thorium oxalate for the uptake of americium indicate feasibility of using this method for the treatment of anion exchange effluent.

  4. Selective leaching studies of deep-sea sediments loaded with americium, neptunium and plutonium

    International Nuclear Information System (INIS)

    A series of selective leaching experiments were undertaken to investigate the solid phase speciation and distribution of americium, neptunium and plutonium which had been experimentally loaded onto different marine sediment types. The chemical leaches employed showed rather poor selectivity but certain trends were evident. Adsorption was not by ion exchange. Americium showed a preferential affinity for carbonate and plutonium for organic matter. Neptunium appeared to have no preferential affinities. Americium was sorbed by acetic acid residues (CaCO3 removed) and by unleached carbonate-rich sediments with equal efficiency. This indicates that it is able to diversify its solid phase affinity/distribution depending upon which solid phases are available. (author)

  5. Routine radiochemical method for the determination of 90Sr, 238Pu, 239+240Pu, 241Am and 244Cm in environmental samples

    International Nuclear Information System (INIS)

    Routine analytical procedures have been developed for the reliable simultaneous determination of 90Sr, 238Pu, 239+240Pu, 241Am and 242-244Cm, Chernobyl derived radioisotopes and fallout after nuclear weapon tests in a wide range of environmental samples: soil (100-200 g), sediments, aerosols, water and vegetation. This procedure has been applied to thousands of soil and sediment samples and hundreds of biological and water samples taken in the exclusive zone of Chernobyl NPP and different regions of Ukraine from 1989 to the present. After the sample has been properly prepared and isotopic tracers added, plutonium, americium and curium are precipitated with calcium oxalate and then lanthanum fluoride. Plutonium is separated from americium and curium by anion-exchange. Americium and curium are separated from rare earths by cation-exchange with gradient elute α-hydroxy-iso-butyric acid. During projects by AQCS IAEA 'Evaluation of Methods for 90Sr in a Mineral Matrix' and 'Proficiency Test for 239Pu, 241Pu and 241Am Measurement in a Mineral Matrix' accuracy and precision for 90Sr, 239Pu and 241Am by present procedure was evaluated. Advantages, difficulties and limitations of the method are discussed. (author)

  6. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Routine counting methods and ICP-MS are unable to directly measure the new US Department of Energy (DOE) regulatory level for discharge waters containing alpha-emitting radionuclides of 30 pCi/L total alpha or the 0.05 pCi/L regulatory level for Pu or Am activity required for surface waters at the Rocky Flats site by the State of Colorado. This inability indicates the need to develop rapid, reliable, and robust analytical techniques for measuring actinide metal ions, particularly americium and plutonium. Selective separation or preconcentration techniques would aid in this effort. Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4

  7. Solubility of americium collected on an aerosol filter

    International Nuclear Information System (INIS)

    Kinetics of dissolution of undefined americium aerosol in simulated serum ultrafiltrate was studied. 241Am was present in aerosol collected at a workplace, where an intake of 241Am had occurred formerly. Dissolution experiments in four parts of an aerosol filter were carried out either in ambient air or under CO2 and pH was kept within physiological range. Two?phase kinetics was found in both cases with dissolution half?times for rapid and slow phases ranging from 0.16 to 0.23 d and from 150 to 500 d, respectively. Regardless data dispersion, found half?times justify use of class M model in intake assessment. (author)

  8. The 1976 Hanford Americium Accident: Then and Now

    Energy Technology Data Exchange (ETDEWEB)

    Carbaugh, Eugene H.

    2013-10-02

    The 1976 chemical explosion of an 241Am ion exchange column at a Hanford Site waste management facility resulted in the extreme contamination of a worker with 241Am, nitric acid and debris. The worker underwent medical treatment for acid burns, as well as wound debridement, extensive personal skin decontamination and long-term DTPA chelation therapy for decorporation of americium-241. Because of the contamination levels and prolonged decontamination efforts, care was provided for the first three months at the unique Emergency Decontamination Facility with gradual transition to the patient’s home occurring over another two months. The medical treatment, management, and dosimetry of the patient have been well documented in numerous reports and journal articles. The lessons learned with regard to patient treatment and effectiveness of therapy still form the underlying philosophy of treatment for contaminated injuries. Changes in infrastructure and facilities as well as societal expectations make for interesting speculation as to how responses might differ today.

  9. Separation of americium from curium by oxidation and ion exchange.

    Science.gov (United States)

    Burns, Jonathan D; Shehee, Thomas C; Clearfield, Abraham; Hobbs, David T

    2012-08-21

    Nuclear energy has the potential to be a clean alternative to fossil fuels, but in order for it to play a major role in the US, many questions about the back end of the fuel cycle must be addressed. One of these questions is the difficult separation of americium from curium. Here, we report the oxidation of Am in two systems, perchloric acid and nitric acid and the affect of changing the acid has on the oxidation. K(d) values were observed and a direct separation factor was calculated and was seen to be as high as 20 for four metal(IV) pillared phosphate phosphonate inorganic organic hybrid ion exchange materials. These ion exchangers are characterized by very low selectivity for cations with low charge but extremely high uptake of ions of high charge. PMID:22827724

  10. Monte Carlo modeling of spallation targets containing uranium and americium

    International Nuclear Information System (INIS)

    Neutron production and transport in spallation targets made of uranium and americium are studied with a Geant4-based code MCADS (Monte Carlo model for Accelerator Driven Systems). A good agreement of MCADS results with experimental data on neutron- and proton-induced reactions on 241Am and 243Am nuclei allows to use this model for simulations with extended Am targets. It was demonstrated that MCADS model can be used for calculating the values of critical mass for 233,235U, 237Np, 239Pu and 241Am. Several geometry options and material compositions (U, U + Am, Am, Am2O3) are considered for spallation targets to be used in Accelerator Driven Systems. All considered options operate as deep subcritical targets having neutron multiplication factor of k∼0.5. It is found that more than 4 kg of Am can be burned in one spallation target during the first year of operation

  11. Pretreatment of americium/curium solutions for vitrification

    International Nuclear Information System (INIS)

    Vitrification will be used to stabilize an americium/curium (Am/Cm) solution presently stored in F-Canyon for eventual transport to the heavy isotope programs at Oak Ridge National Laboratory. Prior to vitrification, an in-tank oxalate precipitation and a series of oxalic/nitric acid washes will be used to separate these elements and lanthanide fission products from the bulk of the uranium and metal impurities present in the solution. Pretreatment development experiments were performed to understand the behavior of the lanthanides and the metal impurities during the oxalate precipitation and properties of the precipitate slurry. The results of these experiments will be used to refine the target glass composition allowing optimization of the primary processing parameters and design of the solution transfer equipment

  12. Dicty_cDB: SSI238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSI238 (Link to dictyBase) - G00811 DDB0185146 Contig-U10256-1 SSI...238Z (Link to Original site) - - SSI238Z 724 - - - - Show SSI238 Library SS (Link to library) Clone ID SSI...riginal site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSI2-B/SSI238Q.Seq.d/ ...Representative seq. ID SSI238Z (Link to Original site) Representative DNA sequence >SSI238 (SSI238Q) /CSM/SS/SSI2-B/SSI...(All Frames) Frame A: ---hyhlctir*fiiifqissilcikyysnik*kwpqpked*teknhl*f*vknklln*

  13. Kinetic parameters of transformation of americium and plutonium physicochemical forms in podsol soils

    International Nuclear Information System (INIS)

    Kinetic parameters of transformation of americium and plutonium physicochemical forms have been estimated and the prognosis of fixing and remobilization of these nuclides in podsol soils have been made on that basis in the work. (authors)

  14. Calibration procedures for in vivo sodium iodide spectrometry of plutonium and americium in the human lung

    International Nuclear Information System (INIS)

    This paper describes the calibration techniques and associated error analysis for the in vivo measurement by NaI spectrometry of heavy elements in the lung, specifically plutonium and americium. A very brief description of the instrumentation system is included

  15. Relativistic density functional theory modeling of plutonium and americium higher oxide molecules

    Science.gov (United States)

    Zaitsevskii, Andréi; Mosyagin, Nikolai S.; Titov, Anatoly V.; Kiselev, Yuri M.

    2013-07-01

    The results of electronic structure modeling of plutonium and americium higher oxide molecules (actinide oxidation states VI through VIII) by two-component relativistic density functional theory are presented. Ground-state equilibrium molecular structures, main features of charge distributions, and energetics of AnO3, AnO4, An2On (An=Pu, Am), and PuAmOn, n = 6-8, are determined. In all cases, molecular geometries of americium and mixed plutonium-americium oxides are similar to those of the corresponding plutonium compounds, though chemical bonding in americium oxides is markedly weaker. Relatively high stability of the mixed heptoxide PuAmO7 is noticed; the Pu(VIII) and especially Am(VIII) oxides are expected to be unstable.

  16. Medical grade 238Pu from 241Am: progress report

    International Nuclear Information System (INIS)

    Shielding requirements for fabrication of americium targets were evaluated, a preliminary flowsheet for processing the irradiated Am targets was developed, and the AMRAD computer program, which models the irradiation cycle, was improved

  17. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and 90Sr body-burden in general public

    International Nuclear Information System (INIS)

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as 90Sr, 239+240Pu, 238Pu, 241Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of 238Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and 90Sr in-body contamination studies in general public. - Highlights: → Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. → Proposed way of sampling is not causing ethic doubts. → It is a convenient way of collecting human bone samples from global population. → The applied analytical radiochemical procedure for bone matrix is described in details. → The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  18. Human bones obtained from routine joint replacement surgery as a tool for studies of plutonium, americium and {sup 90}Sr body-burden in general public

    Energy Technology Data Exchange (ETDEWEB)

    Mietelski, Jerzy W., E-mail: jerzy.mietelski@ifj.edu.pl [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Edward B. [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Department of Physical Therapy Basics, Faculty of Physical Therapy, Administration College, Bielsko-Biala (Poland); Tomankiewicz, Ewa [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland); Golec, Joanna [Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Nowak, Sebastian [Traumatology and Orthopaedic Clinic, 5th Military Clinical Hospital and Polyclinic, Independent Public Healthcare Facility, Wroclawska 1-3, 30-901 Cracow (Poland); Orthopaedic Rehabilitation Department, Chair of Clinical Rehabilitation, Faculty of Motor of the Bronislaw Czech' s Academy of Physical Education, Cracow (Poland); Szczygiel, Elzbieta [Physical Therapy Department, Institute of Physical Therapy, Faculty of Heath Science, Jagiellonian University, Medical College, Cracow (Poland); Brudecki, Kamil [Henryk Niewodniczanski Institute of Nuclear Physics, Polish Academy of Sciences, Radzikowskiego 152, 31-342 Cracow (Poland)

    2011-06-15

    The paper presents a new sampling method for studying in-body radioactive contamination by bone-seeking radionuclides such as {sup 90}Sr, {sup 239+240}Pu, {sup 238}Pu, {sup 241}Am and selected gamma-emitters, in human bones. The presented results were obtained for samples retrieved from routine surgeries, namely knee or hip joints replacements with implants, performed on individuals from Southern Poland. This allowed to collect representative sets of general public samples. The applied analytical radiochemical procedure for bone matrix is described in details. Due to low concentrations of {sup 238}Pu the ratio of Pu isotopes which might be used for Pu source identification is obtained only as upper limits other then global fallout (for example Chernobyl) origin of Pu. Calculated concentrations of radioisotopes are comparable to the existing data from post-mortem studies on human bones retrieved from autopsy or exhumations. Human bones removed during knee or hip joint surgery provide a simple and ethical way for obtaining samples for plutonium, americium and {sup 90}Sr in-body contamination studies in general public. - Highlights: > Surgery for joint replacement as novel sampling method for studying in-body radioactive contamination. > Proposed way of sampling is not causing ethic doubts. > It is a convenient way of collecting human bone samples from global population. > The applied analytical radiochemical procedure for bone matrix is described in details. > The opposite patient age correlations trends were found for 90Sr (negative) and Pu, Am (positive).

  19. Separation of curium and americium microquantities by chromatographic method with introduction of separating ions. 2. Effect of cadmium ion quantity and method of it introduction in the system on efficiency of curium and americium separation

    International Nuclear Information System (INIS)

    Effect of fractionating cadmium ion and a method of it introduction in the system on efficiency of separation of curium and americium with the use of NTA solutions as an eluent is investigated. It is established that in contrast to mutual sorption of curium, americium and cadmium their selective sorption contributes more complete separation of curium and americium. It is shown that growth of quantity of introduced cadmium increased efficiency of separation. Elution rate not products effect on separation process

  20. Americium, plutonium and uranium contamination and speciation in well waters, streams and atomic lakes in the Sarzhal region of the Semipalatinsk Nuclear Test Site, Kazakhstan

    International Nuclear Information System (INIS)

    New data are reported on the concentrations, isotopic composition and speciation of americium, plutonium and uranium in surface and ground waters in the Sarzhal region of the Semipalatinsk Test Site, and an adjacent area including the settlement of Sarzhal. The data relate to filtered water and suspended particulate from (a) streams originating in the Degelen Mountains, (b) the Tel'kem 1 and Tel'kem 2 atomic craters, and (c) wells on farms located within the study area and at Sarzhal. The measurements show that 241Am, 239,240Pu and 238U concentrations in well waters within the study area are in the range 0.04-87 mBq dm-3, 0.7-99 mBq dm-3, and 74-213 mBq dm-3, respectively, and for 241Am and 239,240Pu are elevated above the levels expected solely on the basis of global fallout. Concentrations in streams sourced in the Degelen Mountains are similar, while concentrations in the two water-filled atomic craters are somewhat higher. Suspended particulate concentrations in well waters vary considerably, though median values are very low, at 0.01 mBq dm-3, 0.08 mBq dm-3 and 0.32 mBq dm-3 for 241Am, 239,240Pu and 238U, respectively. The 235U/238U isotopic ratio in almost all well and stream waters is slightly elevated above the 'best estimate' value for natural uranium worldwide, suggesting that some of the uranium in these waters is of test-site provenance. Redox analysis shows that on average most of the plutonium present in the microfiltered fraction of these waters is in a chemically reduced form (mean 69%; 95% confidence interval 53-85%). In the case of the atomic craters, the proportion is even higher. As expected, all of the americium present appears to be in a reduced form. Calculations suggest that annual committed effective doses to individual adults arising from the daily ingestion of these well waters are in the range 11-42 μSv (mean 21 μSv). Presently, the ground water feeding these wells would not appear to be contaminated with radioactivity from past

  1. Americium(3) solvent extraction by oxides of dialkyl(diaryl)[dialkylcarbamoylmethyl]phosphines (CMPO) from perchloric acid solutions

    International Nuclear Information System (INIS)

    Extraction of americium(3) from perchloric acid solutions by CMPO was investigated. It is shown that americium(3) is much more effectively extracted from perchloric acid solutions, than from nitric acid ones, and increase in americium distribution coefficient depends considerably on reagent nature. As a consequence, anomalous aryl effect increases significantly in perchloric acid solutions. The value of anomalous aryl effect depends directly on stoichiometry of extracted complexes in nitric acid and perchloric acid media. Conditions for extractional concentration of americium up to the 100-fold one with small reagent consumption were suggested

  2. On an investigation of the dynamics of ternary fission for the system 238U + 238U

    International Nuclear Information System (INIS)

    With the three center model we have studied the dynamics of ternary fission for the system 238U + 238U by solving the one-dimensional collective Schroedinger equation with the potential energy surface given by the liquid-drop model and the mass parameters given by the Werner-Wheeler method

  3. Redefining design criteria for Pu-238 gloveboxes

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, S.V.

    1998-12-31

    Enclosures for confinement of special nuclear materials (SNM) have evolved into the design of gloveboxes. During the early stages of glovebox technology, established practices and process operation requirements defined design criteria. Proven boxes that performed and met or exceeded process requirements in one group or area, often could not be duplicated in other areas or processes, and till achieve the same success. Changes in materials, fabrication and installation methods often only met immediate design criteria. Standardization of design criteria took a big step during creation of ``Special-Nuclear Materials R and D Laboratory Project, Glovebox standards``. The standards defined design criteria for every type of process equipment in its most general form. Los Alamos National Laboratory (LANL) then and now has had great success with Pu-238 processing. However with ever changing Environment Safety and Health (ES and H) requirements and Ta-55 Facility Configuration Management, current design criteria are forced to explore alternative methods of glovebox design fabrication and installation. Pu-238 fuel processing operations in the Power Source Technologies Group have pushed the limitations of current design criteria. More than half of Pu-238 gloveboxes are being retrofitted or replaced to perform the specific fuel process operations. Pu-238 glovebox design criteria are headed toward process designed single use glovebox and supporting line gloveboxes. Gloveboxes that will house equipment and processes will support TA-55 Pu-238 fuel processing needs into the next century and extend glovebox expected design life.

  4. Extraction of Americium(III) by diglycolamides in ionic liquids

    International Nuclear Information System (INIS)

    In the present work, the extraction behavior of Am(lII) in the three isomeric DGAs, TODGA, DEHDODGA and TEHDGA in two ionic liquids, 1-butyl-3-methylimidazolium bis(triflouromethane sulphonyl)imide (C4mimNTf2) and 1-butyl-1-methylpyrrolidinium bis(triflouromethanesulphonyl)imide (C4mpyNTf2) is compared. The distribution ratio of americium was determined at various acidities ranging from 1M to 8M. The distribution values were found to decrease with increase in aqueous phase acidity upto 3M. The DAm values then marginally increased with increase of acidity from 3 to 4M followed by a decrease in distribution values. The distribution ratio obtained for various DGAs followed the order TEHDGA < TODGA < DEHDODGA at aqueous phase acidities ranging from 1-4 M. When the aqueous nitric acid concentration was higher than 4M, the distribution values followed the order DEHDODGA < TEHDGA < TODGA. The anomalous behaviour of unsymmetrical diglycolamide in ionic liquid medium was investigated by IR spectroscopy. The study revealed that the unprotonated fraction of DGA (i.e. the free DGA) increased in the order TEHDGA < TODGA < DEHDODGA, which seems to be responsible for the observed anomalous extraction trend in DEHDODGA in ionic liquid medium

  5. Extraction of americium and europium by CMPO-substituted adamantylcalixarenes

    International Nuclear Information System (INIS)

    Eight p-adamantylcalix[4]arene derivatives, bearing four CMPO-like functions [-(CH2)n-NH-C(O)-CH2-P(O)Ph2] at the wide (4a,b, n = 0, 1) or narrow (5a-c and 6a-c, n = 2-4) rims were synthesized for the first time. Studies of the extraction of americium(III) and europium(III) from 3 M HNO3 solutions to organic phases (dichloromethane, m-nitro-trifluoromethylbenzene) showed: (i) The extraction ability for all the adamantylcalixarene ligands is much better than for their monomeric analogues -N-(1-adamantyl)-, N-(1-adamantylmethyl)- and N,N-(dibutyl)carbamoylmethyldiphenylphosphine oxides 7a, 7b, 8; (ii) The extraction percentage increases strongly with increasing length of the spacer for all types of ligands 4-6, and best extraction results were found for 4b (n = 1) and 5c (n = 4); (iii) The separation coefficient DAm/DEu for the investigated compounds did not exceed 2, which is close to the narrow rim CMPO calixarenes, studied earlier; (iv) Variation of the spacer length between CMPO groups attached to the 1,3- and 2,4-positions of the calixarene platform in 6 did not lead to appreciably improved extractants, neither with respect to the extraction abilities (D) nor to the selectivities (DAm/DEu). (orig.)

  6. Effect of americium-241 on luminous bacteria. Role of peroxides

    Energy Technology Data Exchange (ETDEWEB)

    Alexandrova, M., E-mail: maka-alexandrova@rambler.r [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Rozhko, T. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Vydryakova, G. [Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation); Kudryasheva, N. [Siberian Federal University, Svobodny 79, 660041 Krasnoyarsk (Russian Federation); Institute of Biophysics SB RAS, Akademgorodok 50, 660036 Krasnoyarsk (Russian Federation)

    2011-04-15

    The effect of americium-241 ({sup 241}Am), an alpha-emitting radionuclide of high specific activity, on luminous bacteria Photobacterium phosphoreum was studied. Traces of {sup 241}Am in nutrient media (0.16-6.67 kBq/L) suppressed the growth of bacteria, but enhanced luminescence intensity and quantum yield at room temperature. Lower temperature (4 {sup o}C) increased the time of bacterial luminescence and revealed a stage of bioluminescence inhibition after 150 h of bioluminescence registration start. The role of conditions of exposure the bacterial cells to the {sup 241}Am is discussed. The effect of {sup 241}Am on luminous bacteria was attributed to peroxide compounds generated in water solutions as secondary products of radioactive decay. Increase of peroxide concentration in {sup 241}Am solutions was demonstrated; and the similarity of {sup 241}Am and hydrogen peroxide effects on bacterial luminescence was revealed. The study provides a scientific basis for elaboration of bioluminescence-based assay to monitor radiotoxicity of alpha-emitting radionuclides in aquatic solutions. - Highlights: {yields} Am-241 in water solutions (A = 0.16-6.7 kBq/L) suppresses bacterial growth.{yields} Am-241 (A = 0.16-6.7 kBq/L) stimulate bacterial luminescence. {yields} Peroxides, secondary radiolysis products, cause increase of bacterial luminescence.

  7. Plutonium-238 as a heat source for the artificial heart

    International Nuclear Information System (INIS)

    A total artificial heart system powered for 10 years or more by a 238Pu heat source appears feasible in the near future. However, hypothetical risks and injury and apparent misunderstanding surround the application 238Pu. The consequences of 238Pu already released to the environment, the modes of human uptake of 238Pu and biological responses, the criticality aspects of 238Pu and the magnitude and effects of operational radiation exposures upon the recipient of a 238Pu heat source and the recipient's personal contacts is studied

  8. 33 CFR 238.5 - Comprehensive planning.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Comprehensive planning. 238.5... Comprehensive planning. Coordinated comprehensive planning at the regional or river basin level, or for an urban.... This planning is particularly important in areas where significant portions of a watershed are...

  9. Separation and determination of americium in low-level alkaline waste of NPP origin

    Science.gov (United States)

    Todorov, B.; Djingova, R.; Nikiforova, A.

    2006-01-01

    The aim of this work is to develop a short and cost-saving procedure for the determination of 241Am in sludge sample of the alkaline low-level radioactive waste (LL LRAW) collected from Nuclear Power Plant “Kozloduy”. The determination of americium was a part of a complex analytical approach, where group actinide separation was achieved. An anion exchange was used for separation of americium from uranium, plutonium and iron. For the separation of americium extraction with diethylhexyl phosphoric acid (DEHPA) was studied. The final radioactive samples were prepared by micro co-precipitation with NdF3, counted by alpha and gamma spectrometry. The procedure takes 2 hours. The recovery yield of the procedure amounts to (95 ± 1.5)% and the detection limit is 53 mBq/kg 241Am (t=150 000 s). The analytical procedure was applied for actual liquid wastes and results were compared to standard procedure.

  10. Americium 241 in vegetation of natural biocenoses and agrocenoses on Belarus territories contaminated with Chernobyl fall-out

    International Nuclear Information System (INIS)

    As a result of beta-decay of plutonium 241 the content of americium 241 increases progressively in soils, contaminated with Chernobyl trans uranium elements. Americium 241 displayed higher (0,5 - 1,5-fold) biological mobility than isotopes of plutonium 239, 240. Activity of americium 241 in surface phyto mass of wild and cultural plants varies from 0,04 to 5,9 Bq/kg of dry weight. Americium 241 contribution to the total trans uranium elements contamination of plants made up 60 - 80% in 1996 - 1998. Investigation of trials from the areas adjacent to the 30-km zone showed that mobility of americium 241 and plutonium was 5 - 15 times as high as in the zone

  11. Isotopic and elemental composition of plutonium/americium oxides influence pulmonary and extra-pulmonary distribution after inhalation in rats

    International Nuclear Information System (INIS)

    The biodistribution of plutonium and americium has been studied in a rat model after inhalation of two PuO2 powders in lungs and extra-pulmonary organs from 3 d to 3 mo. The main difference between the two powders was the content of americium (approximately 46% and 4.5% of total alpha activity). The PuO2 with a higher proportion of americium shows an accelerated transfer of activity from lungs to blood as compared to PuO2 with the lower americium content, illustrated by increased urinary excretion and higher bone and liver actinide retention. The total alpha activity measured reflects mostly the americium biological behavior. The activity contained in epithelial lining fluid, recovered in the acellular phase of broncho-alveolar lavages, mainly contains americium, whereas plutonium remains trapped in macrophages. Epithelial lining fluid could represent a transitional pulmonary compartment prior to translocation of actinides to the blood and subsequent deposition in extra-pulmonary retention organs. In addition, differential behaviors of plutonium and americium are also observed between the PuO2 powders with a higher dissolution rate for both plutonium and americium being obtained for the PuO2 with the highest americium content. Our results indicate that the biological behavior of plutonium and americium after translocation into blood differ two-fold: (1) for the two actinides for the same PuO2 aerosol, and (2) for the same actinide from the two different aerosols. These results highlight the importance of considering the specific behavior of each contaminant after accidental pulmonary intake when assessing extra-pulmonary deposits from the level of activity excreted in urine or for therapeutic strategy decisions. (authors)

  12. Determination of trace concentration of uranium in americium oxide samples by ICP-AES

    International Nuclear Information System (INIS)

    A solvent extraction method has been developed for the determination of uranium (200-2000 ppm) in americium oxide samples. The method involves the quantitative separation of uranium from americium matrix using mixed solvent comprising 1.1M tri-n-butyl phosphate (TBP) +1% trialkyl phosphine oxide (TRPO) + 0.3 M tertiary butyl hydroquinone (TBHQ) in n-dodecane. Uranium from the organic is stripped into the aqueous phase with 0.8 M oxalic acid and determined by ICP-AES. The reliability of the method was ascertained by analytical recovery, which is found to be nearly 100%. (author)

  13. 43 CFR 23.8 - Approval of mining plan.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Approval of mining plan. 23.8 Section 23.8 Public Lands: Interior Office of the Secretary of the Interior SURFACE EXPLORATION, MINING AND RECLAMATION OF LANDS § 23.8 Approval of mining plan. (a) Before surface mining operations may commence...

  14. 49 CFR 238.319 - Running brake test.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Running brake test. 238.319 Section 238.319... Requirements for Tier I Passenger Equipment § 238.319 Running brake test. (a) As soon as conditions safely permit, a running brake test shall be performed on each passenger train after the train has received,...

  15. 16 CFR 238.0 - Bait advertising defined. 1

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Bait advertising defined. 1 238.0 Section 238.0 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES AGAINST BAIT ADVERTISING § 238.0 Bait advertising defined. 1 1 For the purpose of this part...

  16. 49 CFR 238.321 - Out-of-service credit.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Out-of-service credit. 238.321 Section 238.321... Requirements for Tier I Passenger Equipment § 238.321 Out-of-service credit. When a passenger car is out of... out-of-service credit....

  17. 49 CFR 238.403 - Crash energy management.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Crash energy management. 238.403 Section 238.403... Equipment § 238.403 Crash energy management. (a) Each power car and trailer car shall be designed with a crash energy management system to dissipate kinetic energy during a collision. The crash...

  18. Adsorption-desorption characteristics of plutonium and americium with sediment particles in the estuarine environment: studies using plutonium-237 and americium-241

    International Nuclear Information System (INIS)

    The particle formation of plutonium and americium, their adsorption onto fresh water sediments and the desorption from the sediments in sea water were studied in the Laboratory under simulated river-estuary conditions, using γ-emitting plutonium-237 and americium-241. The results of the experiments show that the particle formation of plutonium depends on its valence states, on pH and on the salinity of the medium. For river water at pH4, some 25%, 20% and 30% of the added 237Pu was in particulate form, larger than 0.45 μm, for Pu (III), Pu (IV) and Pu (VI), respectively, while 65%, 90% and 50% of the respective valence states was associated with particles at pH 8. In sea water the general pattern remains similar, although Pu (VI) is more soluble in sea water owing to higher ligand concentrations for carbonate and bicarbonate complexes. The pH-dependency of particle formation of Am (III) is more steep than that of plutonium and seems to be influenced by colloidal substances occurring in the experimental media. The adsorption-desorption characteristics of plutonium and americium with the sediment in river water as well as sea water reflect the characteristics of their particle formation, being dependent upon such properties as valence states, the pH and salinity of the medium. A sewage effluent added to the media has small but measurable effects on the adsorption-desorption processes of plutonium. (author)

  19. Pu-238 Supply Program Project Execution Plan

    International Nuclear Information System (INIS)

    This Pu-238 Supply Program Project Execution Plan (PEP) summarizes critical information and processes necessary to manage the program. The PEP is the primary agreement regarding planning and objectives between The Department of Energy Office of Nuclear Energy (DOE NE-75), Oak Ridge National Laboratory Site Office (OSO) and the Oak Ridge National Laboratory (ORNL). The acquisition executive (AE) will approve the PEP. The PEP is a living document that will be reviewed and revised periodically until the project is complete. The purpose of the project is to reestablish the capability to produce plutonium-238 (Pu-238) domestically. This capability consists primarily of procedures, processes, and design information, not capital assets. As such, the project is not subject to the requirements of DOE O 413.3B, but it will be managed using the project management principles and best practices defined there. It is likely that some capital asset will need to be acquired to complete tasks within the project. As these are identified, project controls and related processes will be updated as necessary. Because the project at its initiation was envisioned to require significant capital assets, Critical Decision 0 (CD-0) was conducted in accordance with DOE O 413.3B, and the mission need was approved on December 9, 2003, by William Magwood IV, director of the Office of Nuclear Energy (NE), Science and Technology, DOE. No date was provided for project start-up at that time. This PEP is consistent with the strategy described in the June 2010 report to Congress, Start-up Plan for Plutonium-238 Production for Radioisotope Power Systems.

  20. FIND: Standard Safety Analysis Report (GESSAR-238)

    International Nuclear Information System (INIS)

    This index is presented as a guide to microfiche items in Docket STN-50447, which was assigned to the BWR/6 STANDARD SAFETY ANALYSIS REPORT (GESSAR-238) submitted by General Electric Company, San Jose, California. The report describes and analyzes a standard BWR/6 boiling water reactor with a Mark III containment system designed for initial operation at approximately 3579 MW(t) with a net electrical output of approximately 1220 megawatts

  1. 238U + n resolved resonance energies

    International Nuclear Information System (INIS)

    Neutron transmission measurements from 100 eV to 170 keV at 150 m through four 238U samples are reported. The energy calibration is described, and the resultant 233U resolved resonance energies are found to be intermediate between those from other workers. In addition, some energies for sharp resonances in 23Na, 27Al, 32S, and 206Pb are given

  2. Impact of ionic liquids on europium and americium extraction by an upper rim phosphorylated calixarene

    International Nuclear Information System (INIS)

    The solvent extraction of europium and americium using the calixarene 5,11,17,23-tetrakis[dipropylphosphinylmethyl] 25,26,27,28-tetrapropoxycalix[4]arene (conical conformation) in the presence of ionic liquids with different natures was studied. It was shown that upper rim phosphorylated calixarene is able to extract europium and americium from nitric acid to dichloroethane by forming a 1:1 complex without the addition of ionic liquids. The distribution coefficients of americium are higher than those of europium in this case, but the isolation degrees of both elements are insufficient for this system to be useful in extraction technologies. The addition of the ionic liquid trihexyl(tetradecyl)phosphonium hexafluorophosphate increases the europium distribution coefficient by values ranging from twofold to more than two orders of magnitude at ionic liquid concentrations of 1 and 50 %, respectively. The values of the distribution coefficients for americium are increased by approximately 25-fold after a 50 % addition of the ionic liquid. (author)

  3. Understanding the Chemistry of Uncommon Americium Oxidation States for Application to Actinide/Lanthanide Separations

    Energy Technology Data Exchange (ETDEWEB)

    Leigh Martin; Bruce J. Mincher; Nicholas C. Schmitt

    2007-09-01

    A spectroscopic study of the stability of Am(V) and Am(VI) produced by oxidizing Am(III) with sodium bismuthate is presented, varying the initial americium concentration, temperature and length of the oxidation was seen to have profound effects on the resultant solutions.

  4. Speciation and bioavailability of plutonium and americium in the Irish Sea and other marine ecosystems

    International Nuclear Information System (INIS)

    Since the late 1960s, the Irish Sea has become a repository for a variety of radio-elements originating mainly in discharges from the British Nuclear Fuels (BNF) plc. Sellafield reprocessing complex located on the Cumbrian coast. In particular, transuranium nuclides such as plutonium, americium and curium (the main constituents of the α-emitting discharges) have become incorporated into every marine compartment by a variety of mechanisms, many of which are not well understood. Although extensive studies have been carried out in the near-field (eastern Irish Sea, especially in the vicinity of the discharge point and collateral muddy sediments), comparatively little had been done to assess the long-term behaviour and bioavailability of plutonium and americium in the far-field, e.g., the western Irish Sea, prior to the present study. In this dissertation, the results of an extensive research programme, undertaken in order to improve and refine our understanding of the behaviour of plutonium and americium in the marine environment, are presented. Specifically, the thesis details the results of (and conclusions deduced from) a series of experiments in which the physical and chemical speciation, colloidal association, mobility and bioavailability of plutonium and americium were examined in diverse environments including the Irish Sea and the Mediterranean. (author)

  5. Evaluation of the readsorption of plutonium and americium in dynamic fractionations of environmental solid samples

    DEFF Research Database (Denmark)

    Petersen, Roongrat; Hou, Xiaolin; Hansen, Elo Harald

    2008-01-01

    extractions. The degree of readsorption in dynamic and conventional batch extraction systems are compared and evaluated by using a double-spiking technique. A high degree of readsorption of plutonium and americium (>75%) was observed in both systems, and they also exhibited similar distribution patterns...

  6. Extraction chromatographic recovery of americium from acidic raffinate solutions using CMPO adsorbed on Chromosorb-102

    International Nuclear Information System (INIS)

    Microgram amounts of americium have been separated and purified from large amounts of uranium present in effluent solutions resulting from the anion-exchange columns during the purification and recovery of plutonium by using TBP extraction followed by extraction chromatography using CMPO adsorbed on Chromosorb-102. (author). 4 refs., 1 tab

  7. Cesium-137 and americium-241 distribution by granulometric fractions of soil at Azgir test site grounds

    International Nuclear Information System (INIS)

    In measurements of radionuclide specific content in surface soil layer of contaminated territories it is important to determine in what agglomerations of soil particles there is the highest radionuclide concentration. For this purpose granulometric composition of soil at Azgir test site was studied and cesium-137 and americium-241 distribution by soil fractions was researched. (author)

  8. Development of analytical methods for the separation of plutonium, americium, curium and neptunium from environmental samples

    OpenAIRE

    Salminen, Susanna

    2009-01-01

    In this work, separation methods have been developed for the analysis of anthropogenic transuranium elements plutonium, americium, curium and neptunium from environmental samples contaminated by global nuclear weapons testing and the Chernobyl accident. The analytical methods utilized in this study are based on extraction chromatography. Highly varying atmospheric plutonium isotope concentrations and activity ratios were found at both Kurchatov (Kazakhstan), near the former Semipalatinsk...

  9. Application of hollow fiber supported liquid membrane for the separation of americium from the analytical waste

    International Nuclear Information System (INIS)

    Americium from analytical solid waste containing U and metallic impurities was separated using hollow fiber supported liquid membrane (HFSLM) technique impregnated with DHOA-TODGA from nitric acid medium. An aliquot of 5 g of the solid waste containing Am (19.95 mg) as minor actinide and of U (2,588 mg), Fe (1,360 mg), Ca (1,810 mg) and Na (3,130 mg) as major impurities was processed. The feed solution obtained after the dissolution of the residue in ∼4 M HNO3 was passed through HFSLM module. In the first stage using 1 M DHOA-dodecane was used for the separation of Am from other impurities. Though, majority of the elements were separated in this cycle, Ca was co extracted along with the americium. CMPO extraction chromatographic technique was used for further separation of americium from Ca. Significant decontamination factors were achieved in this three step separation process with respect to U, Fe, Na and Ca with ∼77 % recovery of americium. (author)

  10. Determination of α-emitters (plutonium, americium, curium ...) in feces and urine ashes

    International Nuclear Information System (INIS)

    A description is given of the methods used to determine a number of radionuclides to be found in feces and urine, and obtain samples thin enough for counting and α-spectrometry. These methods can be applied to plutonium, americium and curium especially

  11. Effect of bone-status on retention and distribution of americium-241 in bones of small rodents

    International Nuclear Information System (INIS)

    Forced physical exercise before and after application of americium-241 resulted in only small changes in bone-structure and behaviour of the radionuclide in bone. Feeding of a low phosphorus or low calcium diet resulted in an increased excretion of americium from bone, whereby Zn-DTPA as chelating agent removed an additional fraction of the radionuclide from bone. Low calcium diet and simultaneous continuous infusion of pharmacological doses of vitamin D-hormones didn't increase the excretion of americium more than the low calcium diet alone. (orig.)

  12. Search for surviving actinides and superheavy nuclei in damped collisions of 238U with 238U and 248Cm

    International Nuclear Information System (INIS)

    In the present talk aspects of the reaction mechanism related to the survival probability of the heaviest fragments in 238U + 238U collisions are discussed first. This is followed by a description of the experiments that have been performed to search for surviving superheavy fragments in the 238U + 238U reaction and by a presentation of the results obtained so far. In a third section our recent first attempts with the 238U + 248Cm reaction are described and preliminary results are discussed. (orig.)

  13. Results of 90Sr and 239+240Pu, 238Pu, 241Am measurements in some samples of mushrooms and forest soil from Poland

    International Nuclear Information System (INIS)

    Strontium-90, plutonium and americium activity concentrations in a few samples of forest soils, some species of mushrooms and fern leaves were determined. These results are compared with caesium activity concentrations in the same materials obtained in a previous work. Radiochemical procedures are described. The origin of the contamination (Chernobyl accident or nuclear test explosion release) is discussed. The 90Sr activity concentration ranges from 0.6 Bq/kg (mushroom samples) to 48.4 Bq/kg (fern leaves). For 239+240Pu, it ranges from not detected above background (mushrooms, fern) to 10.8 Bq/kg (humus layer of forest soil). The maximum concentration of 241Am is found to be 2.4 Bq/kg (humus sample) and for 238Pu it is 0.85 Bq/kg (also in the humus sample). (author). 12 refs, 9 figs, 7 tabs

  14. 90Sr and 239+240Pu 238Pu 241Am in some samples of mushrooms and forest soil from Poland

    International Nuclear Information System (INIS)

    Strontium-90, plutonium and americium activity concentrations in a few samples of forest soils, some species of mushrooms and fern leaves have been determined. These results are compared with cesium activity concentrations in the same materials obtained in a previous work. Radiochemical procedures are described. The origin of the contamination (Chernobyl accident or nuclear test explosion release) is discussed. The 90Sr activity concentration ranges from 0.6 Bq/kg (mushroom samples) to 48.4 Bq/kg (fern leaves). For 239+240Pu, it ranges from not detected above background (mushrooms, fern) to 10.8 Bq/kg (humus layer of forest soil). The maximum concentration of 241Am is found to be 2.4 Bq/kg (humus sample) and for 238Pu it is 0.85 Bq/kg (also in the humus sample). (author) 16 refs.; 7 figs.; 3 tabs

  15. Transmutation of 129I, 237Np, 238Pu, 239Pu, and 241Am using neutrons produced in target-blanket system `Energy plus Transmutation' by relativistic protons

    Indian Academy of Sciences (India)

    J Adam; K Katovsky; A Balabekyan; V G Kalinnikov; M I Krivopustov; H Kumawat; A A Solnyshkin; V I Stegailov; S G Stetsenko; V M Tsoupko-Sitnikov; W Westmeier

    2007-02-01

    Target-blanket facility `Energy + Transmutation' was irradiated by proton beam extracted from the Nuclotron Accelerator in Laboratory of High Energies of Joint Institute for Nuclear Research in Dubna, Russia. Neutrons generated by the spallation reactions of 0.7, 1.0, 1.5 and 2 GeV protons and lead target interact with subcritical uranium blanket. In the neutron field outside the blanket, radioactive iodine, neptunium, plutonium and americium samples were irradiated and transmutation reaction yields (residual nuclei production yields) have been determined using -spectroscopy. Neutron field's energy distribution has also been studied using a set of threshold detectors. Results of transmutation studies of 129I, 237Np, 238Pu, 239Pu and 241Am are presented.

  16. Interaction and diffusion transport of americium in soils

    International Nuclear Information System (INIS)

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of 241Am in soils. The 241Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (Kd) and desorption percentage. Kd (Am) values ranged from 103 to 105 L kg-1 and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in 241Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between Kd (Am) values and a soil property was not found, the main properties affecting 241Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption capacity was observed in all soils due to the dissolution of soil

  17. Interaction and diffusion transport of americium in soils

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez-Guinart, Oriol; Rigol, Anna; Vidal, Miquel [Analytical Chemistry department, Faculty of Chemistry, University of Barcelona, Marti i Franques 1-11, 08028, Barcelona (Spain)

    2014-07-01

    The final disposal of High Level Radioactive Wastes (HLRW) is based on its long-term storage in underground facilities located in geological stable sites with a multi-barrier system, the so called Deep Geological Repositories (DGR), that will keep HLRW confined for >10.000 years. After this period of time, leachates rich in long-live radioisotopes might escape from DGR and start to transport towards the biosphere. There is still a lack of information concerning the interaction and transport in soils of some radionuclides present in HLRW, especially for radionuclides that present a high sorption, such as americium (Am). Having reliable information about the mobility of radionuclides in soils is crucial in order to develop risk assessment models and to take proper decisions in case of soil contamination. The aim of the present work was, by means of laboratory scale experiments, to study the interaction and, for first time, to evaluate the diffusion transport of {sup 241}Am in soils. The {sup 241}Am interaction in soils was assessed by applying sorption batch assays to 20 soil samples with contrasted edaphic properties which allowed us to quantify the solid-liquid distribution coefficient (K{sub d}) and desorption percentage. K{sub d} (Am) values ranged from 10{sup 3} to 10{sup 5} L kg{sup -1} and desorption percentages were always less than 2% which denoted a high capacity of the soil to incorporate the Am and a low reversibility of the sorption process. The influence of soil properties in {sup 241}Am interaction was studied by means of multiple linear and multivariate regressions. Although a single correlation between K{sub d} (Am) values and a soil property was not found, the main properties affecting {sup 241}Am interaction in soils were soil pH, carbonate and organic matter contents in the soil. Finally, additional batch assays at different controlled pH were done to study Am sorption as a function of the contact solution pH. A variation of the Am sorption

  18. Extraction and chromatographic separation and concentration of plutonium and americium from natural matrices. Author-review of dissertation submitted for fulfillment of the scientific degree 'Philosophiae doctor' (PhD.)

    International Nuclear Information System (INIS)

    We followed the optimization of separation progress of americium (241Am) from environmental samples - soil from surroundings nuclear power plant Jaslovske Bohunice, in our work. Selection and optimization of separation progresses had to verify the condition for preparation of samples on spectral measurement with coprecipitation of americium or plutonium with NdF3 (undesirable presence of calcium, magnesium, lanthanides) and condition of spectral purity (spectral overlapping 228Th, 238Pu, 241Am and 222Rn of energy). Very important step was the realization of existing goal and learn suitable isolation techniques of plutonium. We are choosing technique separation of plutonium base upon amine liquid extraction, for a digest consider qualitative quantitative factor of separation. Extraction reagent has been Aliquat-336, which extracts nitric complex of plutonium [Pu(NO3)62-] from 7-8 M solution HNO3. Use method separate off quantitative the plutonium, thorium and uranium from americium. Background sample formed the sample of soil from surroundings Velke Kostolany. Real samples were sampling from surroundings of pollute river Dudvah. Average value mass activities of 239,240Pu in the background sample had value 0.28 ± 0.10 Bq · kg-1. Value mass activities of 239,240Pu in sample from surroundings river Dudvah were in the range (0,6 - 39.4) Bq · kg-1. Methodical side separation of americium we step by step by using ion exchange methods, liquid extraction with extraction reagent TOPO, or combination of them and extraction chromatography with TOPO. We find out: (a) on exchange procedure are suitable on obtainable basis extract tracer of radionuclide, also is very up to time. Optimal method was indicate techniques using the formation of rhodanide complex of americium, with following adsorption on stark acidity anionic exchanger (lanthanides were non-absorbing); (b) t liquid extraction formed emulsion, the third phase on the interface of phases. If we treat the molar of

  19. PLUTONIUM-238 PRODUCTION TARGET DESIGN STUDIES

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Christopher J [ORNL; Wham, Robert M [ORNL; Hobbs, Randall W [ORNL; Owens, R Steven [ORNL; Chandler, David [ORNL; Freels, James D [ORNL; Maldonado, G Ivan [ORNL

    2014-01-01

    A new supply chain is planned for plutonium-238 using existing reactors at the Oak Ridge National Laboratory (ORNL) and Idaho National Laboratory (INL) and existing chemical recovery facilities at ORNL. Validation and testing activities for new irradiation target designs have been conducted in three phases over a 2 year period to provide data for scale-up to production. Target design, qualification, target fabrication, and irradiation of fully-loaded targets have been accomplished. Data from post-irradiation examination (PIE) supports safety analysis and irradiation of future target designs.

  20. SKIN DOSIMETRY IN CONDITIONS OF ITS CONSTANT SURFACE CONTAMINATION WITH SOLUTIONS OF PLUTONIUM-239 AND AMERICIUM-241

    Directory of Open Access Journals (Sweden)

    E. B. Ershov

    2012-01-01

    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  1. Metabolism of americium-241 in man: an unusual case of internal contamination of a child and his father

    International Nuclear Information System (INIS)

    The metabolism of americium-241 was studied during an 8-yr period of an adult male and his son who, at the ages of 50 and 4, respectively, were accidentally and unknowingly contaminated within their home by means of inhalation. Chelation therapy with Na3(Ca-DTPA) was more effective in enhancing the removal of americium-241 from the child than from his father

  2. Influence of biofilms on migration of uranium, americium and europium in the environment; Einfluss von Biofilmen auf das Migrationsverhalten von Uran, Americium und Europium in der Umwelt

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Nils; Zirnstein, Isabel; Arnold, Thuro

    2015-07-01

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  3. Liquid-liquid extraction separation and sequential determination of plutonium and americium in environmental samples by alpha-spectrometry

    International Nuclear Information System (INIS)

    A procedure is described by which plutonium and americium can be determined in environmental samples. The sample is leached with nitric acid and hydrogen peroxide, and the two elements are co-precipitated with ferric hydroxide and calcium oxalate. The calcium oxalate is incinerated at 4500 and the ash is dissolved in nitric acid. Plutonium is extracted with tri-n-octylamine solution in xylene from 4M nitric acid and stripped with ammonium iodide/hydrochloric acid. Americium is extracted with thenoyltrifluoroacetone solution in xylene at pH 4 together with rare-earth elements and stripped with 1M nitric acid. Americium and the rare-earth elements thus separated are sorbed on Dowex 1 x 4 resin from 1M nitric acid in 93% methanol, the rare-earth elements are eluted with 0.1M hydrochloric acid/0.5M ammonium thiocyanate/80% methanol and the americium is finally eluted with 1.5M hydrochloric acid in 86% methanol. Plutonium and americium in each fraction are electro-deposited and determined by alpha-spectrometry. Overall average recoveries are 81% for plutonium and 59% for americium. (author)

  4. Delayed neutron yield of 238U and 241Pu

    International Nuclear Information System (INIS)

    The total delayed neutron yield for 238U and 241Pu were observed as a function of the incident neutron energy. The measurements extend from 2.5 to 5 MeV for 238U and from 0.15 to 5 MeV for 241Pu. The average ratio of the 241Pu delayed neutron yield to that of 238U is 0.292 +- 0.022

  5. 49 CFR 238.311 - Single car test.

    Science.gov (United States)

    2010-10-01

    ... Director of the Federal Register in accordance with 5 U.S.C. 552(a) and 1 CFR part 51. You may obtain a... 49 Transportation 4 2010-10-01 2010-10-01 false Single car test. 238.311 Section 238.311... Requirements for Tier I Passenger Equipment § 238.311 Single car test. (a) Except for self-propelled...

  6. 238Pu surface contamination of MHW impact shell assembly

    International Nuclear Information System (INIS)

    238PuO2 contamination of the grit blasted surface of the primary impact shell assembly (PISA) of the multi-hundred watt isotopic heat source was measured. The study determined the amount and distribution of the 238PuO2 and characterization of its behavior during aging at 13500C. The results concluded that normal decontamination effectively removes the superficial 238PuO2 but does not extract the 238PuO2 which is deep within the grit blasted structure. Subsequent heating results in migration of microcurie amounts of plutonium out of the grit blasted structure

  7. Electrodeposition of americium on a liquid cadmium cathode from a molten salt bath

    International Nuclear Information System (INIS)

    A high-activity experiment involving the electrode position of americium on a liquid cadmium cathode from a LiCl-KCl eutectic with about 3 g of AmO2 was conducted in a shielded cell in the ATALANTE complex. After describing the electrolyzer and the experimental conditions, the authors discuss the preparation of the LiCl-KCl-AmCl3 solution and briefly review its electrochemical properties. It was clearly confirmed that Am(III) reduction on an inert solid cathode occurs in two steps forming Am(II) before Am(0), whereas only one reduction step was observed on liquid cadmium. The main results of this study concern americium electrode position on the liquid cadmium cathode (recovery yields, current densities, problems encountered). The solvent properties of cadmium for actinide/lanthanide separation are discussed. (authors)

  8. Experimental Insight into the Radiation Resistance of Zirconia-Based Americium Ceramics

    International Nuclear Information System (INIS)

    Our works shows that the americium pyrochlore 241Am2Zr2O7 undergoes a phase transition to a defect-fluorite structure along with an unusual volume contraction when subjected to internal radiation from α-emitting actinides. Disorder relaxation proceeds through the simultaneous formation of cation anti sites and oxygen Frenkel pairs. X-ray absorption spectroscopy at the Am-LII and the Zr-K edges reveals that Am-O polyhedra show an increasing disorder with increasing exposure. In contrast, the Zr-O polyhedral units remain highly ordered, while rotating along edges and corners, thereby reducing the structural strain imposed by the growing disorder around americium. We believe it is this particular property of the compound that provides the remarkable resistance to radiation (≥9.4 * 1018) α-decay events g-1 or 0.80 dpa). (authors)

  9. Influence of some organic additives on the extractive separation of americium(III) by sulfoxides

    International Nuclear Information System (INIS)

    The solvent extraction behavior of americium(III) from aqueous nitrate media by two long-chain aliphatic sulfoxides has been examined systematically in the presence of several water-miscible organic solvents to study their possible synergistic effect on metal ion extraction. Methanol, ethanol, n- and isopropanol, n-butanol, dioxane, acetone, as well as acetonitrile, were employed as the organic component of the mixed (polar) phase. These additives affected the extraction to varying degrees. Extractability of Am increased 5 to 10-fold with increasing concentration of some of these additives, with the maximum enhancement being observed in the presence of acetone or acetonitrile. However, alcohols are generally very poor in this respect. Possible reasons for such behavior are briefly discussed. The distribution of several common contaminants was also investigated at the optimum condition for americium extraction

  10. Transmutation of americium and curium incorporated in zirconia-based host materials

    International Nuclear Information System (INIS)

    Presented are studies involving the incorporation of americium and curium in zirconia-based materials. First explored was the pseudo ternary system AmO2-ZrO2-Y2O3. It was determined that selected Y-CSZ materials can incorporate significant quantities of americium oxide and remain cubic single-phase. The cell parameters of these fluorite-type products were established to be linear with the AmO2 content. The Cm2O3-ZrO2 system was also investigated. It was found that at 25 mol% of CmO1.5, the Cm(III) stabilized zirconia in its cubic form (a = 5.21 ±0.01 Angstrom). At higher and lower concentrations, diphasic materials were encountered. At 50 mol% of CmO1.5, a pyrochlore oxide - Cm2Zr2O7 - is formed (a = 10.63 ±0.02 Angstrom). (author)

  11. Americium and samarium determination in aqueous solutions after separation by cation-exchange

    International Nuclear Information System (INIS)

    The concentration of trivalent americium and samarium in aqueous samples has been determined by means of alpha-radiometry and UV-Vis photometry, respectively, after chemical separation and pre-concentration of the elements by cation-exchange using Chelex-100 resin. Method calibration was performed using americium (241Am) and samarium standard solutions and resulted in a high chemical recovery for cation-exchange. Regarding, the effect of physicochemical parameters (e.g. pH, salinity, competitive cations and colloidal species) on the separation recovery of the trivalent elements from aqueous solutions by cation-exchange has also been investigated. The investigation was performed to evaluate the applicability of cation-exchange as separation and pre-concentration method prior to the quantitative analysis of trivalent f-elements in water samples, and has shown that the method could be successfully applied to waters with relatively low dissolved solid content. (author)

  12. Analysis of americium-beryllium neutron source composition using the FRAM code

    Energy Technology Data Exchange (ETDEWEB)

    Hypes, P. A. (Philip A.); Bracken, D. S. (David S.); Sampson, Thomas E.; Taylor, W. A. (Wayne A.)

    2002-01-01

    The FRAM code was originally developed to analyze high-resolution gamma spectra from plutonium items. Its capabilities have since been expanded to include analysis of uranium spectra. The flexibility of the software also enables a capable spectroscopist to use FRAM to analyze spectra in which neither plutonium nor uranium is present in significant amounts. This paper documents the use of FRAM to determine the {sup 239}Pu/{sup 241}Am, {sup 243}Am/{sup 241}Am, {sup 237}Np/{sup 241}Am, and {sup 239}Np/{sup 241}Am ratios in americium-beryllium neutron sources. The effective specific power of each neutron source was calculated from the ratios determined by FRAM in order to determine the americium mass of each of these neutron sources using calorimetric assay. We will also discuss the use of FRAM for the general case of isotopic analysis of nonplutonium, nonuranium items.

  13. Influence of environmental factors on the gastrointestinal absorption of plutonium and americium

    International Nuclear Information System (INIS)

    The absorption of plutonium and americium from the gastrointestinal tract was studied, using adult hamsters and rabbits. Both actinides were administered as inorganic compounds, as organic complexes with naturally occurring chelating agents, and in a biologically incorporated form in liver tissues. The absorption of the tetravalent and hexavalent forms of plutonium were compared and the effect of protracted administration at very low concentrations was investigated. In addition, plutonium uptake from contaminated sediments and grass, collected near a nuclear-fuel reprocessing plant, was measured. The results of these studies suggest that chronic exposure of man to plutonium and americium in food and water will not lead to any substantial increase in their gastrointestinal absorption above the values currently recommended by the International Commission on Radiological Protection to define the occupational exposure of workers

  14. Standard test method for quantitative determination of americium 241 in plutonium by Gamma-Ray spectrometry

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1994-01-01

    1.1 This test method covers the quantitative determination of americium 241 by gamma-ray spectrometry in plutonium nitrate solution samples that do not contain significant amounts of radioactive fission products or other high specific activity gamma-ray emitters. 1.2 This test method can be used to determine the americium 241 in samples of plutonium metal, oxide and other solid forms, when the solid is appropriately sampled and dissolved. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  15. Fabrication of neptunium, plutonium, americium and curium metals for fuel research

    International Nuclear Information System (INIS)

    The techniques for the fabrication of actinide metals; neptunium, americium and curium called as minor actinides, and plutonium, are surveied in a viewpoint of the preparation of starting materials for fuel property measurements. In this report, the processes of the conversion to metals, purification et al. are reviewed. The concept related to the apparatus design is also proposed and the considerable subjects are discussed. (author)

  16. Final Radiological Assessment of External Exposure for CLEAR-Line Americium Recovery Operations

    Energy Technology Data Exchange (ETDEWEB)

    Davis, Adam C. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Belooussova, Olga N. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Hetrick, Lucas Duane [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-11-12

    Los Alamos National Laboratory is currently planning to implement an americium recovery program. The americium, ordinarily isotopically pure 241Am, would be extracted from existing Pu materials, converted to an oxide and shipped to support fabrication of americium oxide-beryllium neutron sources. These operations would occur in the currently proposed Chloride Extraction and Actinide Recovery (CLEAR) line of glove boxes. This glove box line would be collocated with the currently-operational Experimental Chloride Extraction Line (EXCEL). The focus of this document is to provide an in-depth assessment of the currently planned radiation protection measures and to determine whether or not further design work is required to satisfy design-goal and ALARA requirements. Further, this document presents a history of americium recovery operations in the Department of Energy and high-level descriptions of the CLEAR line operations to provide a basis of comparison. Under the working assumptions adopted by this study, it was found that the evaluated design appears to mitigate doses to a level that satisfies the ALARA-in-design requirements of 10 CFR 835 as implemented by the Los Alamos National Laboratory procedure P121. The analyses indicate that extremity doses would also meet design requirements. Dose-rate calculations were performed using the radiation transport code MCNP5 and doses were estimated using a time-motion study developed in consort with the subject matter expert. A copy of this report and all supporting documentation are located on the Radiological Engineering server at Y:\\Rad Engineering\\2013 PROJECTS\\TA-55 Clear Line.

  17. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    International Nuclear Information System (INIS)

    Highlights: • Dust free process for (U,Am)O2 transmutation target fabrication. • Synthesis of U0.9Am0.1O2 mixed oxide microspheres from ion exchange resin. • Fabrication of dense U0.9Am0.1O2 pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U0.9Am0.1O2±δ is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U0.9Am0.1O2±δ. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials

  18. Influence of dissolved organic substances in groundwater on sorption behavior of americium and neptunium

    International Nuclear Information System (INIS)

    Groundwaters typically contain dissolved organic carbon consisting largely of high molecular weight compounds of humic and fulvic acids. To evaluate whether these dissolved organic substances can enhance the tranport of radionuclides through the groundwater system, experiments were conducted to examine the sorption of americium and neptunium onto crushed basalt in the presence of dissolved humic- and fulvic-acid organic carbon introduced into synthetic groundwater. The partitioning experiments with synthetic groundwater show that increasing the concentration of either humic or fulvic acid in the water has a significant inhibiting effect on sorption of both americium and neptunium. At 220C, adsorption of these radionuclides, as measured by distribution ratios (the ratio of nuclide sorbed onto the solid to nuclide in solution at the end of the experiment), decreased by 25% to 50% by addition of as little as 1 mg/L dissolved organic carbon and by one to two orders of magnitude by addition of 100 to 200 mg/L dissolved organic carbon. Distribution ratios measured in solutions reacted at 900C similarly decreased with the addition of dissolved organic carbon but generally ranged from one to two orders of magnitude higher than those determined in the 220C experiment. These results suggest that organic carbon dissolved in deep groundwaters may significantly enhance the mobility of radionuclides of americium and neptunium. 23 references, 5 figures, 11 tables

  19. Bidentate organophosphorus extraction of americium and plutonium from Hanford Plutonium Reclamation Facility waste

    Energy Technology Data Exchange (ETDEWEB)

    Schulz, W.W.

    1974-09-01

    Applicability of bidentate organiphosphorus reagents to recovery of americium and plutonium from Hanford's Plutonium Reclamation Facility acid (approx. 2M HNO/sub 3/) waste stream (CAW solution) was studied. A solvent extraction process which employs a 30% DHDECMP (dihexyl-N, N-diethylcarbamylmethylene phosphonate)-CCl/sub 4/ extractant was devised and successfully tested in mixer-settler runs with actual CAW solution. Substitution of DHDECMP for DBBP eliminates the need to perform careful neutralization of unbuffered CAW soluton and increases overall americium recovery from the present 60 to 80% level to greater than or equal to 90%. Disadvantages to such substitution include the high cost (approx. $50/liter) of DHDECMP and the need to purify it (by acid (6M HCl) hydrolysis and alkaline washing) from small amounts of an unidentified impurity which prevents stripping of americium with dilute HNO/sub 3/. Distribution data obtained in this study confirm Siddall's earlier contention that bidentate organophosphorus regents can be used to remove actinides from concentrated high-level Purex process acid waste; a conceptual flowsheet for such an extraction process is given.

  20. Selective recovery of americium alone from PUREX or COEXTM raffinate by the EXAm process

    International Nuclear Information System (INIS)

    Americium is the main contributor to the long-term radiotoxicity and to the heat generation of glasses used for the HLW conditioning. To decrease both impact on the ultimate waste and to avoid the difficult recycling of curium, the CEA has developed the EXAm process for the the separation and the recovery of the sole americium directly from PUREX or COEXTM raffinates. The principle of the EXAm process is to extract americium and light lanthanides from high nitric acid media, leaving curium and heavy lanthanides in the raffinate. A water-soluble amide molecule, TEDGA, is added in aqueous phase to increase Am/Cm and Am/heavy lanthanides selectivity, because of the preferential complexation of curium and heavy lanthanides by this diglycolamide. Many experimental data have been acquired mainly at the extraction-scrubbing step (Am/Cm separation) and were used for the development of a phenomenological model implemented in the PAREX process simulation code. The scientific feasibility demonstration of the EXAm process was then performed on a genuine PUREX raffinate in Atalante CBP hot cell in 2010. (author)

  1. Uptake and effects of americium-241 on a brackish-water amphipod

    International Nuclear Information System (INIS)

    The present paper reports the results of experimental work undertaken using the brackish-water amphipod Gammarus duebeni duebeni and the transuranium nuclide americium-241. Data on the accumulation of this actinide showed that the larger fraction of the total body burden is associated with the exoskeleton. It was found that the body burden remained constant in the range pH 8.0-6.5 even though the water concentration changed markedly. It would thus appear that the concept of a concentration factor should be re-examined and it is proposed that a factor should be defined in terms of environmental and chemical parameters which represent the bioavailable fraction of the actinide. The effect of americium on survival and moulting was studied at two activity concentrations; the dose rates and absorbed doses under the experimental conditions employed have been estimated. The differences in survival rates between the control and irradiated groups were statistically analyzed and the significant difference at the higher concentration is believed to be due to a synergism between physiological stress and radiotoxicity of americium rather than the chemical toxicity of the element. (orig.)

  2. Study on the formation of the composite system of 238U+238U

    Institute of Scientific and Technical Information of China (English)

    WU Xi-Zhen; TIAN Jun-Long; ZHAO Kai; ZHANG Ying-Xun; LI Zhu-Xia

    2009-01-01

    Strongly damped reactions of 238U+238U, at Ecm = 680-1880 MeV have been studied based on the improved quantum molecular dynamics model. We find that at a certain energy region the entrance channel potential is weakly repulsive and the dissipation is very strong after touching configuration, these two effects make the time delay of re-separation for colliding system. The single particle potential well of the transiently formed composite system has Coulomb barrier about 15-20 MeV high at the surface, which makes the excited unbound protons being still embedded in the potential well and moving in a common mono-single particle potential for a period of time and thus restrains from quick decay of the composite system.

  3. Dynamical Effects of Orientations on reaction 238U+238U near Coulomb Barrier

    International Nuclear Information System (INIS)

    The dynamical effects of three orientations (nose-nose, nose-side, and side-side) on reaction 238U+238U have been investigated by using Improved Quantum Molecular Dynamics(ImQMD) model. Due to Coulomb repulsive interaction, the change of the deformations or orientations of colliding nuclei is found even before touching configuration, especially for nose-nose. The average lifetime of the giant system and the probability producing super-heavy fragments (SHF) with Z>110 are found to be dependent on the orientations of two nuclei. At the time of 1000fm/c after re-separation of giant system, side-side orientation provide a larger probability of producing SHF than nose-nose case. And the maximum value of the probability locates a smaller incident energy for side-side orientation compared with nose-nose.

  4. Nuclear alignment: classical dynamic model for 238U- 238U system

    International Nuclear Information System (INIS)

    Dynamical properties of 238U- 238U system at the classical turning point, specifically the distance of closest approach, the relative orientations of the nuclei and deformations have been studied at sub-coulomb energy of Elab = 6.07 MeV/nucleon using a classical dynamical model with a variable moment of inertia. Probability of favorable alignment for anomalous positron-electron pair emission through vacuum decay is calculated. The calculated small favorable alignment probability value of 0.116 is found to be enhanced by about 16% in comparison with the results of a similar study using a fixed moment of inertia as well as the results from a semiquantal calculation reported earlier. (author)

  5. About the reaction between uranium-americium mixed oxides and sodium

    International Nuclear Information System (INIS)

    The recycling and fission of the highly toxic minor actinides neptunium and americium is only possible in a liquid metal cooled fast breeder reactor, for nuclear physical reasons. The present work is part of a research program dealing with the fuel-coolant interaction. Fuel pellets with equal parts of americium and uranium and varying oxygen-metal ratio were investigated. A behaviour comparable to that of uranium-plutonium mixed oxides was suggested as a first approach. The reaction of sodium with (U0.5Am0.5)O2-x results in a complete desintegration of the sintered pellet whereas (U, Pu)O2-x pellets show a small increase in volume. A first explanation of the strong reaction of uranium-americium mixed oxides compared to (U, Pu)O2-x or (U, Np)O2-x could be provided by the less negative oxygen potential of the former. Ternary and polynary oxides which are possible products of the fuel-coolant reaction were prepared and characterised by X-ray diffraction. Their oxygen potentials were measured using a solid state e.m.f. cell. Neither Na2AmO3 nor Na3AmO4 can coexist with sodium metal. The measured ΔGO2 values of the Am(IV) and Am (V)-compounds are much higher than those of the sodium uranates(VI) or sodium neptunates(VI). Only Na2O seems to be likely as product of the fuel-coolant interactions. It could be determined in reacted samples by X-ray diffraction. The relatively high oxygen potentials of (U0.5Am0.5)O2-x that are responsible for the reaction could be explained by a binding model which is based on an americium valency state of + 3 and U5+. The existence of both valency states could be proved by XPS measurements. Due to the similar behaviour of neptunium and uranium the problems that are expected for the recycling of Np are much smaller than for americium

  6. Containment of nitric acid solutions of Plutonium-238

    Science.gov (United States)

    Reimus, M. A. H.; Silver, G. L.; Pansoy-Hjelvik, L.; Ramsey, K. B.

    1999-01-01

    The corrosion of various metals that could be used to contain nitric acid solutions of Pu-238 has been studied. Tantalum and tantalum/2.5% tungsten resisted the test solvent better than 304L stainless steel and several INCONEL alloys. The solvent used to imitate nitric acid solutions of Pu-238 contained 70% nitric acid, hydrofluoric acid, and ammonium hexanitratocerate.

  7. Dicty_cDB: SFL238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFL238 (Link to dictyBase) - - - Contig-U16463-1 SFL238P (Link to Original ... r preparing catalase using the genetic engineering technology . 86 1e-31 4 AX536932 |AX536932.1 Sequence 533 from ...

  8. Dicty_cDB: SFJ238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SF (Link to library) SFJ238 (Link to dictyBase) - - - Contig-U12087-1 SFJ238Z (Link to Original ... CP000901_1027( CP000901 |pid:none) Yersinia pestis Angola , complet... 34 3.4 BC167318_1( BC167318 |pid:none) ...

  9. MGA Analysis on Elevated {sup 238}Pu Samples

    Energy Technology Data Exchange (ETDEWEB)

    Wang, T F; Moody, K J; Raschke, K E; Ruhter, W D

    2002-03-28

    Plutonium gamma-ray data analysis, in the 100-keV region, using MGA has been improved to overcome the original maximum limit of 2% {sup 238}Pu relative plutonium content in a sample in order perform an analysis. MGA analysis results of elevated {sup 238}Pu samples are compared to the results from mass spectrometry.

  10. 49 CFR 238.413 - End structures of trailer cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false End structures of trailer cars. 238.413 Section... II Passenger Equipment § 238.413 End structures of trailer cars. (a) Except as provided in paragraph (b) of this section, the end structure of a trailer car shall be designed to include the...

  11. 49 CFR 238.233 - Interior fittings and surfaces.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Interior fittings and surfaces. 238.233 Section... I Passenger Equipment § 238.233 Interior fittings and surfaces. (a) Each seat in a passenger car... determined by the railroad: (1) Longitudinal: 8g; (2) Vertical: 4g; and (3) Lateral: 4g. (c) Other...

  12. 49 CFR 238.435 - Interior fittings and surfaces.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Interior fittings and surfaces. 238.435 Section... II Passenger Equipment § 238.435 Interior fittings and surfaces. (a) Each seat back and seat.... (d)(1) Other interior fittings shall be attached to the passenger car body with sufficient...

  13. New heavy neutron—rich isotope 238Th

    Institute of Scientific and Technical Information of China (English)

    XUYanbing; YUANShuanggui; 等

    1999-01-01

    A new nuclide 238Th has been produced via multinucleon transfer reaction by 60MeV/u 18O ion irradiation of the natural uranium.The thorium was radiochemically separated from the mixture of uranium and reaction products.The activity of thorium was mneasured by using an HPGe detector and a planar HPGe detector.The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa.The half-life of 238Th was determined to be 9.4±2.0min .Inaddition a new γ-ray of 89.0±0.3keV with T1/2=8.9±1.5min was found in the γ spectrum gated with X-rays of Pa and assigned to 238Th β- decay based on measurements of transition energy and half life.

  14. A new heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new nuclide 238Th has been produced via multinucleon transfer reaction induced by 60 MeV/u 18O ion irradiation of natural uranium. The thorium was radiochemically separated from the mixture of uranium and its reaction products. The activity of thorium was measured by using a HPGe detector and a planar HPGe detector. The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa. The half-life of 238Th was determined to be (9.4 +- 2.0) min. In addition a new (89.0 +- 0.3) keV γ-ray with T1/2 = (8.9 +- 1.5) min was observed and assigned to 238Th decay based on the measurement of transition energy and half life

  15. 238U issues resolved and unresolved

    International Nuclear Information System (INIS)

    The interaction of 1 eV to 20 MeV neutrons with 238U is discussed. In the region from 1.5 to 4 keV there are differences of the order of 15% between the values of the neutron widths of the main resonances reported by several experimenters or obtained by different evaluators. Above a 4 keV there are only sparse results of resonance analysis and most evaluations adopt a statistical treatment of the resonance structure. However, an inspection of good resolution data suggests that the energy and neutron width of the most prominent resonances could be determined with reasonable accuracy at least up to 10 keV. Some factors affecting the determination of the average properties of the resonance parameters are discussed. Above the inelastic-scattering threshold, energy-averaged neutron total, scattering, capture and fission cross sections are reviewed in a unified manner integrating measurement, calculation and evaluation. (n;n') and (n;2n') energy-transfer mechanisms are addressed. Particular attention is given to neutron capture, stressing precisions consistent with applied need. Fission properties are discussed including: prompt and delayed fission-neutron spectra and nubar, and fission-product yields. (Auth.)

  16. Determination of Doppler Effect on nuclear resonances of uranium-238

    International Nuclear Information System (INIS)

    This paper deals with theoretical and experimental study of Doppler effect on 238U resonances. The chosen experimental method was based on measuring gamma activities of irradiated UO2 samples with natural uranium since this activity depends on the total absorption in 238U dependent on the temperature of the sample. Special electrical heater was used for heating the samples irradiated in the core of RB reactor. Due to significant perturbation of neutron flux caused by the presence of the heater it was necessary to develop a model for calculation of Doppler effect on 238U in the used sample. Scintillation NaI(Tl) detector was used for gamma activity measurements

  17. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    Energy Technology Data Exchange (ETDEWEB)

    Fedosseev, A.M.; Grigoriev, M.S.; Budantseva, N.A. [A.N. Frumkin Institute of Physical Chemistry and Electrochemistry, Moscow (Russian Federation); Guillaumont, D.; Den Auwer, Ch.; Moisy, Ph. [CEA Marcoule, Nuclear Energy Division, RadioChemistry and Processes Department, 30 (France); Le Naour, C.; Simoni, E. [CNRS, University Paris-11 Orsay, IPN, 91 - Orsay (France)

    2010-06-15

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH{sub 3}){sub 6}][M(NTA){sub 2}(H{sub 2}O)].8H{sub 2}O with M Nd, Yb and Am, and [Co(NH{sub 3}){sub 6}]{sub 2}K[M{sub 3}(Cit){sub 4}(H{sub 2}O){sub 3}].18H{sub 2}O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  18. Americium(3) coordination chemistry: An unexplored diversity of structure and bonding

    International Nuclear Information System (INIS)

    The comparison of the physicochemical behavior of the actinides with that of the lanthanides can be justified by the analogy of their electronic structure, as each of the series is made up of elements corresponding to the filling of a given (n)f atomic shell. However relatively few points of comparison are available, given the lack of available structure for trans-plutonium(III) elements and the additional difficulty of stabilizing coordination complexes of uranium(III) to plutonium(III). This contribution is a focal point of trans-plutonium(III) chemistry and, more specifically, of some americium compounds that have been recently synthesized, all related with hard acid oxygen donor ligands that may be involved in the reprocessing chain of nuclear fuel. After a brief review of the solid hydrates and aquo species for the lanthanide and actinide families, we discuss two types of ligands that have in common three carboxylic groups, namely the amino-tri-acetic acid and the citric acid anions. The additional roles of the nitrogen atom for the first one and of the hydroxy function for the second one are discussed. Accordingly, five new complexes with either americium or lanthanides elements are described: [Co(NH3)6][M(NTA)2(H2O)].8H2O with M Nd, Yb and Am, and [Co(NH3)6]2K[M3(Cit)4(H2O)3].18H2O with Nd and Am cations. In all cases the americium complexes are isostructural with their lanthanide equivalents. (authors)

  19. Speciation of americium in seawater and accumulation in the marine sponge Aplysina cavernicola.

    Science.gov (United States)

    Maloubier, Melody; Michel, Hervé; Solari, Pier Lorenzo; Moisy, Philippe; Tribalat, Marie-Aude; Oberhaensli, François R; Dechraoui Bottein, Marie Yasmine; Thomas, Olivier P; Monfort, Marguerite; Moulin, Christophe; Den Auwer, Christophe

    2015-12-21

    The fate of radionuclides in the environment is a cause of great concern for modern society, seen especially in 2011 after the Fukushima accident. Among the environmental compartments, seawater covers most of the earth's surface and may be directly or indirectly impacted. The interaction between radionuclides and the marine compartment is therefore essential for better understanding the transfer mechanisms from the hydrosphere to the biosphere. This information allows for the evaluation of the impact on humans via our interaction with the biotope that has been largely undocumented up to now. In this report, we attempt to make a link between the speciation of heavy elements in natural seawater and their uptake by a model marine organism. More specifically, because the interaction of actinides with marine invertebrates has been poorly studied, the accumulation in a representative member of the Mediterranean coralligenous habitat, the sponge Aplysina cavernicola, was investigated and its uptake curve exposed to a radiotracer (241)Am was estimated using a high-purity Ge gamma spectrometer. But in order to go beyond the phenomenological accumulation rate, the speciation of americium(III) in seawater must be assessed. The speciation of (241)Am (and natural europium as its chemically stable surrogate) in seawater was determined using a combination of different techniques: Time-Resolved Laser-Induced Fluorescence (TRLIF), Extended X-ray Absorption Fine Structure (EXAFS) at the LIII edge, Attenuated Total Reflectance Fourier Transform Infrared (ATR-FTIR) spectroscopy and Scanning Electron Microscopy (SEM) and the resulting data were compared with the speciation modeling. In seawater, the americium(III) complex (as well as the corresponding europium complex, although with conformational differences) was identified as a ternary sodium biscarbonato complex, whose formula can be tentatively written as NaAm(CO3)2·nH2O. It is therefore this chemical form of americium that is

  20. Fabrication of uranium–americium mixed oxide pellet from microsphere precursors: Application of CRMP process

    Energy Technology Data Exchange (ETDEWEB)

    Remy, E. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Picart, S., E-mail: sebastien.picart@cea.fr [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Delahaye, T. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Jobelin, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Lebreton, F.; Horlait, D. [Fuel Cycle Technology Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Bisel, I. [Radiochemistry and Processes Department, CEA, Nuclear Energy Division, F-30207 Bagnols-sur-Cèze (France); Blanchart, P. [Heterogeneous Materials Research Group, Centre Européen de la Céramique, F-87068 Limoges (France); Ayral, A. [Institut Européen des Membranes, CNRS-ENSCM-UM2, CC47, University Montpellier 2, F-34095 Montpellier cedex 5 (France)

    2014-10-15

    Highlights: • Dust free process for (U,Am)O{sub 2} transmutation target fabrication. • Synthesis of U{sub 0.9}Am{sub 0.1}O{sub 2} mixed oxide microspheres from ion exchange resin. • Fabrication of dense U{sub 0.9}Am{sub 0.1}O{sub 2} pellet with 95% TD from mixed oxide microspheres. - Abstract: Mixed uranium–americium oxides are one of the materials envisaged for Americium Bearing Blankets dedicated to transmutation in fast neutron reactors. Recently, several processes have been developed in order to validate fabrication flowchart in terms of material specifications such as density and homogeneity but also to suggest simplifications for lowering industrial costs and hazards linked to dust generation of highly contaminating and irradiating compounds. This study deals with the application of an innovative route using mixed oxide microspheres obtained from metal loaded resin bead calcination, called Calcined Resin Microsphere Pelletization (CRMP). The synthesis of mixed oxide microsphere precursor of U{sub 0.9}Am{sub 0.1}O{sub 2±δ} is described as well as its characterisation. The use of this free-flowing precursor allows the pressing and sintering of one pellet of U{sub 0.9}Am{sub 0.1}O{sub 2±δ}. The ceramic obtained was characterised and results showed that its microstructure is dense and homogeneous and its density attains 95% of the theoretical density. This study validates the scientific feasibility of the CRMP process applied to the fabrication of uranium and americium-containing materials.

  1. Americium characterization by X-ray fluorescence and absorption spectroscopy in plutonium uranium mixed oxide

    International Nuclear Information System (INIS)

    Plutonium uranium mixed oxide (MOX) fuels are currently used in nuclear reactors. The actinides in these fuels need to be analyzed after irradiation for assessing their behaviour with regard to their environment and the coolant. In this work the study of the atomic structure and next-neighbour environment of Am in the (Pu,U)O2 lattice in an irradiated (60 MW d kg−1) MOX sample was performed employing micro-X-ray fluorescence (µ-XRF) and micro-X-ray absorption fine structure (µ-XAFS) spectroscopy. The chemical bonds, valences and stoichiometry of Am (∼0.66 wt%) are determined from the experimental data gained for the irradiated fuel material examined in its peripheral zone (rim) of the fuel. In the irradiated sample Am builds up as Am3+ species within an [AmO8]13− coordination environment (e.g. >90%) and no (III XAFS spectra recorded for the irradiated MOX sub-sample in the rim zone for a 300 μm×300 μm beam size area investigated over six scans of 4 h. The records remain constant during multi-scan. The analysis of the XAFS signal shows that Am is found as trivalent in the UO2 matrix. This analytical work shall open the door of very challenging analysis (speciation of fission product and actinides) in irradiated nuclear fuels. - Highlights: • Americium was characterized by microX-ray absorption spectroscopy in irradiated MOX fuel. • The americium redox state as determined from XAS data of irradiated fuel material was Am(III). • In the sample, the Am3+ face an AmO813− coordination environment in the (Pu,U)O2 matrix. • The americium dioxide is reduced by the uranium dioxide matrix

  2. Recovery of Americium-241 from lightning rod by the method of chemical treatment

    International Nuclear Information System (INIS)

    About 95% of the lightning rods installed in the Peruvian territory have set in their structures, pose small amounts of radioactive sources such as Americium-241 (241Am), fewer and Radium 226 (226Ra) these are alpha emitters and have a half life of 432 years and 1600 years respectively. In this paper describes the recovery of radioactive sources of 241Am radioactive lightning rods using the conventional chemical treatment method using agents and acids to break down the slides. The 241Am recovered was as excitation source and alpha particle generator for analysing samples by X Ray Fluorescence, for fixing the stainless steel 241Am technique was used electrodeposition. (author)

  3. Report of scouting study on precipitation of strontium, plutonium, and americium from Hanford complexant concentrate waste

    International Nuclear Information System (INIS)

    A laboratory scouting test was conducted of precipitation methods for reducing the solubility of radionuclides in complexant concentrate (CC) waste solution. The results show that addition of strontium nitrate solution is effective in reducing the liquid phase activity of 90Sr (Strontium) in CC waste from tank 107-AN by 94% when the total strontium concentration is adjusted to 0.1 M. Addition of ferric nitrate solution effective in reducing the 241Am (Americium) activity in CC waste by 96% under the conditions described in the report. Ferric nitrate was also marginally effective in reducing the solubility of 239/240Pu (Plutonium) in CC waste

  4. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning;

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north...

  5. Americium and curium heterogeneous transmutation in moderated S/ A in the framework of CNE scenarios studies

    International Nuclear Information System (INIS)

    This paper presents the transmutation of Americium and Curium in a heterogeneous mode in the framework of the 1991 French Law concerning waste management. Two scenarios with moderated targets are presented: a 100% frit reactor (EFR) scenario multi-recycling Pu+Np with targets of Am+Cm placed in core and a mixed PWR (UOX fuel) and fast reactor (50% of EFR) multi-recycling Pu+Np and containing targets in core and in the blanket region. The design of the target is based on classical fast fuel S/A technology (pins, spacer wires,...) and should reach the goal of 90% fission rate. (authors)

  6. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids.

    Science.gov (United States)

    Dittrich, Timothy Mark; Boukhalfa, Hakim; Ware, Stuart Douglas; Reimus, Paul William

    2015-10-01

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater-bentonite-fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L(-1)) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10(-10) M (241)Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (k(f)) of 0.01-0.02 h(-1). Am recoveries in each column were 55-60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h(-1) in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance scales because

  7. Purification of used scintillation liquids containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    In Sweden, alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. Therefore, in this work, a method for a purification of alpha active scintillation cocktails was developed. Until today (March, 2013) more than 20 L of scintillation liquids have successfully been purified from americium and plutonium. The products of the process are a solid fraction that can be sent to final storage and a practically non-radioactive liquid fraction that can be sent to municipal incineration. (author)

  8. Comparison of acid leachate and fusion methods to determine plutonium and americium in environmental samples

    International Nuclear Information System (INIS)

    The Analytical Chemistry Laboratory at Argonne National Laboratory performs radiochemical analyses for a wide variety of sites within the Department of Energy complex. Since the chemical history of the samples may vary drastically from site to site, the effectiveness of any analytical technique may also vary. This study compares a potassium fluoride-pyrosulfate fusion technique with an acid leachate method. Both normal and high-fired soils and vegetation samples were analyzed for both americium and plutonium. Results show both methods work well, except for plutonium in high-fired soils. Here the fusion method provides higher accuracy

  9. Plutonium and americium in arctic waters, the North Sea and Scottish and Irish coastal zones

    DEFF Research Database (Denmark)

    Hallstadius, L.; Aarkrog, Asker; Dahlgaard, Henning; Holm, E.; Boelskifte, S.; Duniec, S.; Persson, B.

    1986-01-01

    Plutonium and americium have been measured in surface waters of the Greenland and Barents Seas and in the northern North Sea from 1980 through 1984. Measurements in water and biota, Fucus, Mytilus and Patella, were carried out in North-English and Scottish waters in 1982 and Fucus samples were...... plutonium from the latter to Spitsbergen waters. Fallout plutonium in Arctic waters has a residence time of the order of several years, while for Pu from Sellafield we estimate mean residence times of 11–15 months in Scottish waters and, tentatively, 1·5-3 y during transport from the North Channel (north of...

  10. Influence of biofilms on migration of uranium, americium and europium in the environment

    International Nuclear Information System (INIS)

    The report on the influence of biofilms on migration of uranium, americium and europium in the environment deals with the contamination problems of uranium mines such as SDAG WISMUT in Saxonia and Thuringia. In mine waters microorganisms form a complex microbiological biocoenosis in spite of low pH values and high heavy metal concentrations including high uranium concentrations. The analyses used microbiological methods like confocal laser scanning microscopy and molecular-biological techniques. The interactions of microorganism with fluorescent radioactive heavy metal ions were performed with TRLFS (time resolved laser-induced fluorescence spectroscopy).

  11. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code is developed to predict the extraction behavior of americium and lanthanides in the TRUEX (TRansUranium EXtraction)process. This code gives the concentration profiles of the components at steady state. The stage efficiency is included in this code as a parameter in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated concentration profiles are compared with the experimental results. The efficiency value for the mixer-settlers, which gives good agreement between the calculated and the experimental profiles, is evaluated. (author)

  12. Numerical simulation for concentration profiles of americium and lanthanides in the CMPO-TBP solvent extraction system

    International Nuclear Information System (INIS)

    A numerical simulation code for the TRUEX (TRansUranium EXtraction) process is developed to predict the extraction behavior of americium and lanthanides. This code gives the concentrations of the components at the steady state of the TRUEX process. The stage efficiency is applied to this code in order to simulate the extraction behavior of the components accurately. Concentration profiles of americium and typical lanthanides in some counter current experiments are calculated by means of the present code. The calculated profiles are compared with the experimental ones. The efficiency value for the mixer-settlers, which gives the best agreement between the two profiles, is investigated

  13. Study of the extraction and the purification of americium and trivalent actinides contained in effluents with supported liquid membranes

    International Nuclear Information System (INIS)

    The supported liquid membrane technique is studied and developed for americium recovery from uranium or plutonium matrices and decontamination of liquid radioactive wastes. First tests on uranium-nickel solutions with a flat membrane showed the easiness of the operation and the efficiency of the process. Acid-resistant (10 N), interchangeable elements with hollow fibers, are developed and also a computerized automatic device. The different tests on americium solutions demonstrate the feasibility and the reliability of the system. Influence of various parameters on transfer kinetics is investigated

  14. Experimental and in situ investigations on americium, curium and plutonium behaviour in marine benthic species: transfer from water or sediments

    International Nuclear Information System (INIS)

    The tranfer of transuranic elements -americium, curium and plutonium- from the sediments containing them to some marine benthic species (endofauna and epifauna) was studied with a twofold approach - laboratory and in-situ investigation. The experimental investigations, divided into three parts, made it possible to specify concentration factors (F.C.), transfer factors (F.T.) and to understand the process involved for 5 benthic species. The result were refined by an in-situ study that brought new data on the marine distribution of the transuranic elements released by the La Hague plant. Finally, the localization of americium and plutonium in the tissues and cells of these species was determined by autoradiography

  15. 7 CFR 1280.238 - OMB Control Numbers.

    Science.gov (United States)

    2010-01-01

    ... AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE LAMB PROMOTION, RESEARCH, AND INFORMATION ORDER Lamb Promotion, Research, and Information Order Miscellaneous § 1280.238 OMB Control Numbers... control number for the nominee background form is 0505-0001....

  16. Neutron Capture and Fission Measurement on ^238Pu at DANCE

    Science.gov (United States)

    Chyzh, Andrii; Wu, Ching-Yen; Kwan, Elaine; Henderson, Roger; Gostic, Jolie; Couture, Aaron; Young, Hye; Ullmann, John; O'Donnell, John; Jandel, Marian; Haight, Robert; Bredeweg, Todd

    2012-10-01

    Neutron capture and fission reactions on actinides are important in nuclear engineering and physics. DANCE (Detector for Advanced Neutron Capture Measurement, LANL) combined with PPAC (avalanche technique based fission tagging detector, LLNL) were used to study the neutron capture reactions in ^238Pu. Because of extreme spontaneous α-radioactivity in ^238Pu and associated safety issues, 3 separate experiments were performed in 2010-2012. The 1st measurement was done without fission tagging on a 396-μg thick target. The 2nd one was with PPAC on the same target. The 3rd final measurement was done on a thin target with a mass of 40 μg in order to reduce α-background load on PPAC. This was the first such measurement in a laboratory environment. The absolute ^238Pu(n,γ) cross section is presented together with the prompt γ-ray multiplicity in the ^238Pu(n,f) reaction.

  17. New heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new nuclide 238Th has been produced via multinucleon transfer reaction by 60 MeV/u 18O ion irradiation of the natural uranium. The thorium was radiochemically separated from the mixture of uranium and reaction products. The activity of thorium was measured by using an HPGe detector and a planar HPGe detector. The 238Th has been identified for the first time by measuring the growth and decay of the γ-rays from its daughter 238Pa. The half-life of 238Th was determined to be 9.4 +- 2.0 min. In addition, a new γ-ray of 89.0 +- 0.3 keV with T1/2 = 8/.9 +- 1.5 min was found in the γ spectrum gated with X-rays of Pa and assigned to 239Th β-decay based on measurements of transition energy and half life

  18. Separation and identification of a new isotope 238Th

    International Nuclear Information System (INIS)

    Natural uranium targets are irradiated with 60 MeV/u 18O ions. A new heavy neutron-rich isotope 238Th is produced by the multinucleon transfer reaction. Thorium is radiochemically separated from the uranium and mixture of reaction products. The γ singles spectra tine sequence spectra are measured by using a HPGe detector. Based on the observation of the growth and decay for the 1060.5 keV γ-ray of 238Pa, a daughter of 238Th in measuring of γ-spectra for the separated thorium fraction, a new neutron-rich isotope 238Th is identified at the first time. Its half-life is 9.4 +- 2.0 min

  19. Containment of nitric acid solutions of Plutonium-238

    International Nuclear Information System (INIS)

    The corrosion of various metals that could be used to contain nitric acid solutions of Pu-238 has been studied. Tantalum and tantalum/2.5% tungsten resisted the test solvent better than 304L stainless steel and several INCONEL alloys. The solvent used to imitate nitric acid solutions of Pu-238 contained 70% nitric acid, hydrofluoric acid, and ammonium hexanitratocerate. copyright 1999 American Institute of Physics

  20. Vitrification of F-area americium/curium: feasibility study and preliminary process recommendation

    International Nuclear Information System (INIS)

    Work was performed to identify a process to vitrify the contents of F- canyon Tank 17.1. Tank 17.1 contains the majority of americium (Am) and curium (Cm) contained in the DOE Complex. Oak Ridge National Laboratory (ORNL) has made a formal request for this material as fuel for production of Cf252 and other transplutonium actinides. The Am and Cm (and associated lanthanide fission products) are currently in nitric acid solution. Transportation of the intensely radioactive Am/Cm in liquid form is not considered possible. As a result, the material will either be solidified and shipped to ORNL or discarded to the Tank Farm. Nuclear Materials Processing Technology (NMPT), therefore, requested Defense Waste Processing Technology (DWPT) to determine if the Tank 17.1 material could be vitrified, and if it was vitrified could the americium and curium be successfully recovered. Research was performed to determine if the Tank 17.1 contents could indeed be mixed with glass formers and vitrified. Additional studies identified critical process parameters such as heat loading, melter requirements, off-gas evolution, etc. Discussions with NMPT personnel were initiated to determine existing facilities where this work could be accomplished safely. A process has been identified which will convert the Am/Cm material into approximately 300kg of glass

  1. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    International Nuclear Information System (INIS)

    A dual isotope method has been used to study the transfer of 137Cs, 239/240Pu and 241Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10-5 - 10-4, with mean values of 7 x 10-5 and 4 x 10-5 obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10-4 recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  2. Transfer of radiocaesium, plutonium and americium to sheep after ingestion of contaminated soil

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, A.I.; Weekes, T.E.C. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Biological and Nutritional Sciences; Rimmer, D.L. [Newcastle upon Tyne Univ. (United Kingdom). Dept. of Agricultural and Environmental Science; Green, N.; Wilkins, B.T. [National Radiological Protection Board, Chilton (United Kingdom)

    1997-12-31

    A dual isotope method has been used to study the transfer of {sup 137}Cs, {sup 239/240}Pu and {sup 241}Am to sheep following ingestion of contaminated soil. Two soils were used; an alluvial gley contaminated by Sellafield discharges, and an organic soil, artificially contaminated in a lysimeter. Values of the true absorption coefficient of radiocaesium of 0.19 +/- 0.03 and 0.03 +/- 0.01 respectively were obtained for these soils. This implies an availability factor for soil-associated radiocaesium of up to about 20 pc compared to radiocaesium ingested in soluble form. The absorption of plutonium and americium was not significantly different for the two soils tested. Absorption of both plutonium and americium was in the range 10{sup -5} - 10{sup -4}, with mean values of 7 x 10{sup -5} and 4 x 10{sup -5} obtained respectively. These values imply availability factors of around 10 pc, compared to the value of 5 x 10{sup -4} recommended by ICRP for plutonium ingested in a comparatively available form. These results are compared with estimates of availability made using an in-vitro approach

  3. Americium and europium extraction from carbonate solutions by 1-phenyl-3-methyl-4-benzoylpyrazolone -5

    International Nuclear Information System (INIS)

    Trivalent TPEs and REEs are extractable from carbonate solutions by 1-pheny-3-methyl-4-benzoylpyrazolone-5 (PMBP). The effect of concentration of KHCO3 and K2CO3, extractant, metal, and other factors on the extent of extraction of the elements has been clarified. The kinetics of extraction of the elements from carbonate solutions has been studied. It has been shown that in the KHCO3 concentration range 0.2-2.0 M americium and europium are extracted by PMBP solutions in different diluents with distribution coefficients lying within n x 102-n x 103. From K2CO3 solutions the elements are extracted better by PMBP solutions in methyl isobutyl ketone (MIBK). It has been shown that metal concentration in the range 1x10-5. 5x10-3 g-ion x liter-1 does not affect extraction (log E = 3). Extracts based on PMBP with a metal content higher than 5x10-3g-ion x liter-1 were obtained by absolute concentrating method and were used for the study of 13C NMR spectra. The composition of thecompounds extracted by PMBP from carbonate solutions was determined by 13C NMR spectroscopy and extraction. The conditions of europium and americium reextraction from extracts based on PMBP by complexones, their mixtures with alkalis and other substances were studied. The scopes for using the system PMBP-carbonate solutions to separate and concentrate TPEs and REEs has been examined

  4. Evaluation of americium-241 toxicity influence on the microbial growth of organic wastes

    International Nuclear Information System (INIS)

    Available in abstract form only. Full text of publication follows: Since the licenses for using radioactive sources in radioactive lightning rods were lifted by the Brazilian national nuclear authority, in 1989, the radioactive devices have been replaced by Franklin type and collected as radioactive waste. However, only 20 percent of the estimated total number of installed rods was delivered to Brazilian Nuclear Commission. This situation causes concern, due to, first, the possibility of the rods being disposed as domestic waste, and second, the americium, the most commonly employed radionuclide, is classified as a high-toxicity element. In the present study, Am-241 migration experiments were performed by a lysimeter system, in order to evaluate the risk of contamination caused by radioactive lightning rods disposed as a common solid waste. Besides the risk evaluation, it is important to know the mechanism of the Am-241 release or retention in waste as well as its influence in the waste decomposition processes. Many factors are involved, but microorganisms present in the waste play an important role in its degradation, which control the physical and chemical processes. The objective of this work was to evaluate the Am-241 influence on the microbial population by counting number of cells in lysimeters leachate. Preliminary results suggest that americium may influence significantly the bacteria growth in organic waste, evidenced by culture under aerobiosis and an-aerobiosis and the antimicrobial resistance test. (authors)

  5. Contribution to the prediction of americium, plutonium and neptunium behaviour in the geosphere: chemical data

    International Nuclear Information System (INIS)

    An exhaustive bibliographic review on hydrolysis of americium gives the stability constants, at zero ionic strength. No evidence of Am(OH)4- formation was found by solubility studies up to pH 2 (CO3)3 characterised by its X-ray diffraction pattern is studied at a high ionic strength. All the published results on Am in carbonate media are reinterpreted using these stability constants (Am-OH-CO3 complexes are not needed). No evidence of Am(CO3)45- formation was found by spectrophotometry up to 3M. Literature results are used to determine the formal redox potentials at pH = 9.4 and to calculate the formation constants, at zero ionic strength. The formation of complexes between americium and humic materials (purified fulvic and humic acids) has been studied by a spectrophotometric technique. The results are interpreted by the formation of a 1:1 complexe. Solubility of the solid PuO2(CO3) is measured in bicarbonate media at high ionic strength, to obtain the solubility product and formation constants of the PuO2(CO3)i2-2i complexes

  6. EURADOS intercomparison on measurements and Monte Carlo modelling for the assessment of Americium in a USTUR leg phantom

    International Nuclear Information System (INIS)

    A collaboration of the EURADOS working group on 'Internal Dosimetry' and the United States Transuranium and Uranium Registries (USTUR) has taken place to carry out an intercomparison on measurements and Monte Carlo modelling determining americium deposited in the bone of a USTUR leg phantom. Preliminary results and conclusions of this intercomparison exercise are presented here. (authors)

  7. An economic analysis of a light and heavy water moderated reactor synergy: burning americium using recycled uranium

    International Nuclear Information System (INIS)

    An economic analysis is presented for a proposed synergistic system between 2 nuclear utilities, one operating light water reactors (LWR) and another running a fleet of heavy water moderated reactors (HWR). Americium is partitioned from LWR spent nuclear fuel (SNF) to be transmuted in HWRs, with a consequent averted disposal cost to the LWR operator. In return, reprocessed uranium (RU) is supplied to the HWRs in sufficient quantities to support their operation both as power generators and americium burners. Two simplifying assumptions have been made. First, the economic value of RU is a linear function of the cost of fresh natural uranium (NU), and secondly, plutonium recycling for a third utility running a mixed oxide (MOX) fuelled reactor fleet has been already taking place, so that the extra cost of americium recycling is manageable. We conclude that, in order for this scenario to be economically attractive to the LWR operator, the averted disposal cost due to partitioning americium from LWR spent fuel must exceed 214 dollars per kg, comparable to estimates of the permanent disposal cost of the high level waste (HLW) from reprocessing spent LWR fuel. (authors)

  8. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, C H; Barney, G S

    1983-03-01

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO/sub 2/, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO/sub 2/ decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition.

  9. Effects of Hanford high-level waste components on sorption of cobalt, strontium, neptunium, plutonium, and americium on Hanford sediments

    International Nuclear Information System (INIS)

    To judge the feasibility of continued storage of high-level waste solutions in existing tanks, effects of chemical waste components on the sorption of hazardous radioelements were determined. Experiments identified the effects of 12 Hanford high-level waste-solution components on the sorption of cobalt, strontium, neptunium, plutonium, and americium on 3 Hanford 200 Area sediments. The degree of sorption of strontium, neptunium, plutonium, and americium on two Hanford sediments was then quantified in terms of the concentrations of the influential waste components. Preliminary information on the influence of the waste components on radioelement solubility was gathered. Of the 12 Hanford waste-solution components studied, the most influential on radioelement sorption were NaOH, NaAlO2, HEDTA, and EDTA. The chelating complexants, HEDTA and EDTA, generally decreased sorption by complexation of the radioelement metal ions. The components NaOH and NaAlO2 decreased neptunium and plutonium sorption and increased cobalt sorption. Americium sorption was increased by NaOH. The three Hanford sediments' radioelement sorption behaviors were similar, implying that their sorption reactions were also similar. Sorption prediction equations were generated for strontium, neptunium, plutonium, and americium sorption reactions on two Hanford sediments. The equations yielded values of the distribution coefficient, K/sub d/, as quadratic functions of waste-component concentrations and showed that postulated radioelement migration rates through Hanford sediment could change by factors of 13 to 40 by changes in Hanford waste composition

  10. Anomalous aryl strengthening of americium and europium complexes during extraction by alkylenediphosphine dioxides from perchloric acid media

    International Nuclear Information System (INIS)

    Extraction of americium and europium from perchlorate environments by solutions of three types of methylenediphosphine dioxides, namely (C6H5)P(O)(CH2)sub(n)(O)P(C6H5)2, (C6H5)2P(O)CH2(O)P(C8H17)2 and (C8H17)2P(O)(CH2)sub(n)(O)P(C8H17)2 has been studied (n is 1 or 2 ) The diluents used have been dichlorethane and chloroform. In perchlorate environments the distribuiton coefficients of americium and europium have proved to be by about 3 orders of magnitude higher than in nitric acid environments, i.e. in perchlorate media the complexes are far more stable. Separation coefficients of americium and REE in perchloric acid soutions are much higher than in nitrate environments. The average value of Am/Eu separation coeffecient at 1-5 M acidity was about 6 (with dichlorethane as diluent) or about 7 (with chloroform as diluent). The complexes essentially exist as trisolvated. Americium complexes display anomalous stability increase upon being diluted: by about 2 orders of magnitude with dichlorethane and by up to 3 orders of magnitude with chloroform used as diluent

  11. Investigations of neutron characteristics for salt blanket models; integral fission cross section measurements of neptunium, plutonium, americium and curium isotopes

    International Nuclear Information System (INIS)

    Neutron characteristics of salt blanket micromodels containing eutectic mixtures of sodium, zirconium, and uranium fluorides were measured on FKBN-2M, BIGR and MAKET facilities. The effective fission cross sections of neptunium, plutonium, americium, and curium isotopes were measured on the neutron spectra formed by micromodels. (author)

  12. The distribution of plutonium-239 and americium-241 in the Syrian hamster following its intravenous administration as citrate

    International Nuclear Information System (INIS)

    Actinide distribution in various tissues and the skeleton of hamsters by liquid scintillation counting or isotope dilution. For plutonium 57% of activity was concentrated in the skeleton and more than 90% in the liver and skeleton after seven days. For americium the liver retained more than 50% of total activity and 25% was excreted in urine within seven days. (U.K.)

  13. Economical Production of Pu-238: NIAC Phase I Final Report

    Science.gov (United States)

    Howe, Steven D.; Crawford, Douglas; Navarro, Jorge; O'Brien, Robert C.; Katalenich, Jeff; Ring, Terry

    2016-01-01

    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238 (Pu-238). The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100M to get to production levels. The Center for Space Nuclear Research (CSNR) has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. Potentially, the front end capital costs could be provided by private industry such that the government only had to pay for the product produced. In the Phase I NIAC (NASA Innovative Advanced Concepts) grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. Finally, as the study progressed, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  14. Combined procedure using radiochemical separation of plutonium, americium and uranium radionuclides for alpha-spectrometry

    International Nuclear Information System (INIS)

    Radiochemical separation of Pu, Am and U was tested from synthetic solutions and evaporator concentrate samples from nuclear power plants for isolation of each of them for alpha-spectrometry analysis. The separation was performed by anion-exchange chromatography, extraction chromatography, using TRU resin, and precipitation techniques. The aim of the study was to develop a sensitive analytical procedure for the sequential determination of 242Pu, 238Pu, 239+240Pu, 241Am and 235,238U in radioactive wastes. 238Pu, 242Pu, 243Am and 232U were used as tracers. The measurements of α emitting radionuclides were performed by semiconductor detector that is used especially when spectrometric information is needed. For synthetic solutions the chemical recovery was based on associated iron concentration and was about 93%. (author)

  15. Application of ion-exchange chromatography to eliminate the curium from americium by his determination by the method of liquid scintillation spectrometry

    International Nuclear Information System (INIS)

    The aim of this work is to eliminate curium in determining of americium by the method of liquid scintillation spectrometry. The paper introduces a method that has been done to eliminate curium from americium by determining of americium with liquid scintillation spectrometry method. In the research we used ion-exchange chromatography and ion-exchange sorbents DOWEX. We also observed the effect of geometry organization of column on the separation course. Resources for alpha spectrometry were prepared by micro-precipitation with neodymium chloride. High radiochemical yields were achieved, but separation did not take place according to a pre-separation scheme. (authors)

  16. Observation of the new heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new nuclide 238Th was produced via multinucleon transfer reaction by 60 MeV/u 18O ion irradiation of the natural uranium. The thorium was radiochemically separated from the mixture of uranium and reaction products. The growth and decay of 238Pa gamma rays was observed, identifying the 238Pa parent as 238Th. The half-life of 238Th was determined to be 9.4±2.0 min

  17. Interception and retention of 238Pu deposition by orange trees

    International Nuclear Information System (INIS)

    Radioisotope thermoelectric generators (RTG) transform the heat produced during the alpha decay of 238Pu into electrical energy for use by deep-space probes, such as the Voyager spacecraft, which have returned images and other data from Jupiter, Saturn and Uranus. Future missions involving RTGs may be launched aboard the space shuttle, and there is a remote possibility that an explosion of liquid-hydrogen and liquid-oxygen fuel could rupture the RTGs and disperse 238Pu into the atmosphere over central Florida. Research was performed to determine the potential transport to man of atmospherically dispersed Pu via contaminated orange fruits. The results indicate that the major contamination of oranges would result from the interception and retention of 238Pu deposition by fruits. The resulting surface contamination could enter human food chains through transfer to internal tissues during peeling or in the reconstituted juices and flavorings made from orange skins. The interception of 238Pu deposition by fruits is especially important because the results indicate no measurable loss of Pu from fruit surfaces through time or with washing. Approximately 1% of the 238Pu deposited onto an orange grove would be harvested in the year following deposition

  18. Neutron Capture Cross Section Measurement on 238Pu at DANCE

    International Nuclear Information System (INIS)

    The proposed neutron capture measurement for 238Pu was carried out in Nov-Dec, 2010, using the DANCE array at LANSCE, LANL. The total beam-on-target time is about 14 days plus additional 5 days for the background measurement. The target was prepared at LLNL with the new electrplating cell capable of plating the 238Pu isotope simultaneously on both sides of the 3-(micro)m thick Ti backing foil. A total mass of 395 (micro)g with an activity of 6.8 mCi was deposited onto the area of 7 mm in diameter. The 238Pu sample was enriched to 99.35%. The target was covered by 1.4 (micro)m double-side aluminized mylar and then inserted into a specially designed vacuum-tight container, shown in Fig. 1, for the 238Pu containment. The container was tested for leaks in the vacuum chamber at LLNL. An identical container without 238Pu was made as well and used as a blank for the background measurement.

  19. Neutron Capture Cross Section Measurement on $^{238}$Pu at DANCE

    Energy Technology Data Exchange (ETDEWEB)

    Chyzh, A; Wu, C Y

    2011-02-14

    The proposed neutron capture measurement for {sup 238}Pu was carried out in Nov-Dec, 2010, using the DANCE array at LANSCE, LANL. The total beam-on-target time is about 14 days plus additional 5 days for the background measurement. The target was prepared at LLNL with the new electrplating cell capable of plating the {sup 238}Pu isotope simultaneously on both sides of the 3-{micro}m thick Ti backing foil. A total mass of 395 {micro}g with an activity of 6.8 mCi was deposited onto the area of 7 mm in diameter. The {sup 238}Pu sample was enriched to 99.35%. The target was covered by 1.4 {micro}m double-side aluminized mylar and then inserted into a specially designed vacuum-tight container, shown in Fig. 1, for the {sup 238}Pu containment. The container was tested for leaks in the vacuum chamber at LLNL. An identical container without {sup 238}Pu was made as well and used as a blank for the background measurement.

  20. Simultaneous evaluation for (n,f) cross section of 235U, 239Pu, 238U and (n,γ) cross sections of 238U

    International Nuclear Information System (INIS)

    The fission cross sections for 235U, 238U, 239Pu, the capture cross sections for 238U and the ratios for 239Pu(n,f)/235U(n,f), 238U(m,f)/235U(n,f), 238U(n,γ)/235U(n,f) were firstly evaluated respectively. The experimental data were collected, analysed, selected and corrected. The data were fitted with spline fit program

  1. Purification of scintillation cocktails containing the alpha emitters americium and plutonium

    International Nuclear Information System (INIS)

    One efficient way of measuring alpha emitters is by the usage of liquid scintillation counting (LSC). A liquid sample is placed in a vial containing a scintillation cocktail. The alpha particles excite electrons in the surrounding liquid, and when they are de-excited photons are emitted. The photons are detected and the activity can be quantified. LSC has a high efficiency for alpha radiation and is therefore a fast and easy way for measuring alpha emitting samples. One drawback is that it does not differentiate very well between alpha energies; measurements of for example curium and plutonium simultaneously are impossible and demand other techniques. Another drawback is the production of a liquid alpha active waste. In Sweden alpha radioactive waste liquids with an activity over some kBq per waste container cannot be sent for final storage. If, however, the activity of the liquids could be reduced by precipitation of the actinides, it would be possible to send away the liquid samples to municipal incineration. In this work a method for a purification of alpha active scintillation cocktails was developed. The method was first tried on a lab scale, and then scaled up. Until today (March, 2013) more than 20 liters of scintillation liquids have successfully been purified from americium and plutonium at Chalmers University of Technology in Sweden. The four scintillation cocktails used were Emulsifier Safe®, Hionic-Fluor®, Ultima Gold AB® and Ultima Gold XR®. The scintillation cocktails could all be purified from americium with higher yield than 95%. The yield was kept when the liquids were mixed. Also plutonium could be precipitated with a yield over 95% in all cocktails except in Hionic-Fluor® (>55%). However, that liquid in particular could be purified (>95%) by mixing it with the three other cocktails. Up-scaling was performed to a batch size of 6-8 L of scintillation cocktail. In neither the americium nor the plutonium system, adverse effects of increasing the

  2. Technology and fabrication of plutonium-238 radionuclide heat sources

    Science.gov (United States)

    Malikh, Y. A.; Aldoshin, A. I.; Danilkin, E. A.

    1996-03-01

    This paper outlines a brief technical description of the facility for production of plutonium-238 and fabrication of Radionuclide Heat Sources (RHS) containing Pu-238. Technical capabilities of the RHS fabrication facility are presented. The results of development of the RHS design for sea application are discussed. RHS fuel pellet comprises the tantalum shell with an annular slot intended for release of radiogenic helium and the Pu-238 dioxide core with reinforcing elements inside which contact with the shell. RHS is a double encapsulation consisting of the inner ``power'' capsule and the outer corrosion-resistant capsule. The chromium-nickel-molybdenum XH65MB alloy which is equivalent to Hastelloy-C alloy has been selected as a material for both capsules. Upon expiration of working life, RHS design is capable of withstanding the internal pressure of radiogenic helium at 1073 K within 30 minutes and the external hydrostatic pressure of 100 MPa at normal temperature.

  3. Plutonium-236 traces determination in plutonium-238 by α spectrometry

    International Nuclear Information System (INIS)

    Two methods are described in this report for the determination of plutonium-236 traces in plutonium-238 by a spectrometry using semi-conductor detectors. The first method involves a direct comparison of the areas under the peaks of the α spectra of plutonium-236 and plutonium-238. The electrolytic preparation of the sources is carried out after preliminary purification of the plutonium. The second method makes it possible to determine the 236Pu/238Pu ratio by comparing the areas of the α peaks of uranium-232 and uranium-234, which are the decay products of the two plutonium isotopes respectively. The uranium in the source, also deposited by electrolysis, is separated from a 1 mg amount of plutonium either by a T.L.A. extraction, or by the use of ion-exchange resins. The report ends with a discussion of the results obtained with plutonium of two different origins. (authors)

  4. Mass distribution in 238U(32S, f) reaction

    International Nuclear Information System (INIS)

    Nuclear fission is a complex process involving large scale collective rearrangement of nuclear matter. Detailed fission fragment mass distribution studies are important to understand the interplay of the structure and dynamics in the fission process. Conventional methods to study fission fragment mass distribution (by measuring the energy and/or the time of flight of the correlated fission fragments) are limited to a mass resolution of 4-5 units. We have carried out fission fragment mass distribution studies for 238U(32S, f) and 238U(12C,f) systems. In this paper, we report the isotopic yield distribution and the fragment mass distribution for the 238U(32S,f) reaction at incident energies 220 MeV and 185 MeV

  5. Imitators of plutonium and americium in a mixed uranium- plutonium nitride fuel

    Science.gov (United States)

    Nikitin, S. N.; Shornikov, D. P.; Tarasov, B. A.; Baranov, V. G.; Burlakova, M. A.

    2016-04-01

    Uranium nitride and mix uranium nitride (U-Pu)N is most popular nuclear fuel for Russian Fast Breeder Reactor. The works in hot cells associated with the radiation exposure of personnel and methodological difficulties. To know the main physical-chemical properties of uranium-plutonium nitride it necessary research to hot cells. In this paper, based on an assessment of physicochemical and thermodynamic properties of selected simulators Pu and Am. Analogues of Pu is are Ce and Y, and analogues Am - Dy. The technique of obtaining a model nitride fuel based on lanthanides nitrides and UN. Hydrogenation-dehydrogenation- nitration method of derived powders nitrides uranium, cerium, yttrium and dysprosium, held their mixing, pressing and sintering, the samples obtained model nitride fuel with plutonium and americium imitation. According to the results of structural studies have shown that all the samples are solid solution nitrides rare earth (REE) elements in UN.

  6. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed. 16 refs., 6 figs

  7. Recovery of plutonium and americium from chloride salt wastes by solvent extraction

    International Nuclear Information System (INIS)

    Plutonium and americium can be recovered from aqueous waste solutions containing a mixture of HCl and chloride salt wastes by the coupling of two solvent extraction systems: tributyl phosphate (TBP) in tetrachloroethylene (TCE) and octyl(phenyl)-N,N-diisobutyl-carbamoylmethylphosphine oxide (CMPO) in TCE. In the flowsheet developed, the salt wastes are dissolved in HCl, the Pu(III) is oxidized to the IV state with NaClO2 and recovered in the TBP-TCE cycle, and the Am is then removed from the resultant raffinate by the CMPO-TCE cycle. The consequences of the feed solution composition and extraction behavior of these species on the process flowsheet design, the Pu-product purity, and the decontamination of the aqueous raffinate from transuranic elements are discussed

  8. The uptake of plutonium-239, 240, americium-241, strontium-90 into plants

    International Nuclear Information System (INIS)

    This report describes the results of measurements on the uptake of plutonium, americium, strontium-90 and caesium-137 into peas, beet, oats, sweet corn, tomatoes and vegetable marrow grown in tubs containing radioactively-contaminated silts. The silts had been taken from an area of West Cumbria commonly referred to as the Ravenglass estuary. The experiments are categorised as being carried out under non-standard conditions because of the manner in which the radioactivity came to be incorporated into the growth medium. The growth medium was representative of conditions which could arise when the estuarine silt moves inland under the influence of wind and tide and mixes with the adjacent farm land. The silt had been contaminated by radioactive effluents from the nuclear fuels reprocessing plant at Sellafield and this contamination had been brought about by natural means. (Auth.)

  9. Mutual separation of americium(III) and europium(III) using glycolamic acid and thioglycolamic acid

    International Nuclear Information System (INIS)

    The extractants, bis(2-ethylhexyl)diglycolamicacid (HDEHDGA) and bis(2-ethylhexy)thiodiglycolamic acid (HDEHSDGA) were synthesized and characterized by 1H and 13C NMR, mass and IR spectroscopy. The extraction behaviour of (152+154)Eu(III) and 241Am(III) from nitric acid medium by a solution of HDEHDGA (or HDEHSDGA) in n-dodecane (n-DD) was studied for the mutual separation of actinides and lanthanides. The effect of various parameters such as the pH, concentrations of HDEHDGA, HDEHSDGA, sodium nitrate, N,N,N',N'-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) and diethylenetriaminepentaacetic acid (DTPA) on the separation factor (SF) of americium(III) over europium(III) and vice versa was studied, and the conditions needed for the preferential separation were optimised. The results show that HDEHDGA exhibits higher extraction for (152+154)Eu(III) and HDEHSDGA shows the superior selectivity for 241Am(III). (orig.)

  10. Laboratory investigation of the role of desorption kinetics on americium transport associated with bentonite colloids

    International Nuclear Information System (INIS)

    Understanding the parameters that control colloid-mediated transport of radionuclides is important for the safe disposal of used nuclear fuel. We report an experimental and reactive transport modeling examination of americium transport in a groundwater–bentonite–fracture fill material system. A series of batch sorption and column transport experiments were conducted to determine the role of desorption kinetics from bentonite colloids in the transport of americium through fracture materials. We used fracture fill material from a shear zone in altered granodiorite collected from the Grimsel Test Site (GTS) in Switzerland and colloidal suspensions generated from FEBEX bentonite, a potential repository backfill material. The colloidal suspension (100 mg L−1) was prepared in synthetic groundwater that matched the natural water chemistry at GTS and was spiked with 5.5 × 10−10 M 241Am. Batch characterizations indicated that 97% of the americium in the stock suspension was adsorbed to the colloids. Breakthrough experiments conducted by injecting the americium colloidal suspension through three identical columns in series, each with mean residence times of 6 h, show that more than 95% of the bentonite colloids were transported through each of the columns, with modeled colloid filtration rates (kf) of 0.01–0.02 h−1. Am recoveries in each column were 55–60%, and Am desorption rate constants from the colloids, determined from 1-D transport modeling, were 0.96, 0.98, and 0.91 h−1 in the three columns, respectively. The consistency in Am recoveries and desorption rate constants in each column indicates that the Am was not associated with binding sites of widely-varying strengths on the colloids, as one binding site with fast kinetics represented the system accurately for all three sequential columns. Our data suggest that colloid-mediated transport of Am in a bentonite-fracture fill material system is unlikely to result in transport over long distance

  11. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    International Nuclear Information System (INIS)

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and 241Am was low, with specific activity in the tissues 241Am occurred and 241Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author)

  12. A thermodynamic study of actinide oxide targets/fuels for americium transmutation

    International Nuclear Information System (INIS)

    A thermodynamic study was performed on the systems Am-O, AmOx-MgO, AmOx-MgAl2O4, Pu-Mg-O and U-Mg-O. Both experimental work (X-ray analyses, oxygen potential measurements etc.) and calculations on the phase diagrams involved were made. The reaction between americium oxide and spinel is expected to form the compound AmAlO3. Isothermal sections have been calculated for AmOx-(MgO, Al2O3), Pu-Mg-O and U-Mg-O at 2000 K using the software package ''Thermo-Calc''. Thermodynamic equilibrium data were used to predict the behaviour of actinide oxides in a reactor. The implication of the results for the technological application is discussed, with emphasis on the effects of the high oxygen potential of AmO2 as compared to the conventional fuel, i.e. UO2. (author)

  13. EURADOS action for determination of americium in skull measures in vivo and Monte Carlo simulation

    International Nuclear Information System (INIS)

    From the Group of WG7 internal dosimetry of the EURADOS Organization (European Radiation Dosimetry group, e.V.) which It coordinates CIEMAT, international action for the vivo measurement of americium has been conducted in three mannequins type skull with detectors of Germanium by gamma spectrometry and simulation by Monte Carlo methods. Such action has been raised as two separate exercises, with the participation of institutions in Europe, America and Asia. Other actions similar precede this vivo intercomparison of measurement and modeling Monte Carlo1. The preliminary results and associated findings are presented in this work. The laboratory of the body radioactivity (CRC) of service counter of dosimetry staff internal (DPI) of the CIEMAT, it has been one of the participants in vivo measures exercise. On the other hand part, the Group of numerical dosimetry of CIEMAT is participant of the Monte Carlo2 simulation exercise. (Author)

  14. Ab initio modelling of the behaviour of helium in americium and plutonium oxides

    International Nuclear Information System (INIS)

    By means of an ab initio plane wave pseudo potential method, plutonium dioxide and americium dioxide are modelled, and the behaviour of helium in both these materials is studied. We first show that a pseudo potential approach in the Generalized Gradient Approximation (GGA) can satisfactorily describe the cohesive properties of PuO2 and AmO2. We then calculate the formation energies of point defects (vacancies and interstitials), as well as the incorporation and solution energies of helium in PuO2 and AmO2. The results are discussed according to the incorporation site of the gas atom in the lattice and to the stoichiometry of PuO2±x and AmO2±x. (authors)

  15. Removal of plutonium and americium from hydrochloric acid waste stream using extraction chromatography

    International Nuclear Information System (INIS)

    Extraction chromatography is under development as a method to lower actinide activity levels in hydrochloric acid (HCl) effluent streams. Successful application of this technique would allow recycle of the largest portion of HCl, while lowering the quantity and improving the form of solid waste generated. The extraction of plutonium and americium from HCl solutions was examined for several commercial and similar laboratory-produced resins coated with n-octyl(phenyl)-N,N-diisobutylcarbamoylmethyphosphine oxide (CMPO) and either tributyl phosphate (TBP), or diamyl amylphosphonate (DAAP). Distribution coefficients for Pu and Am were measured by contact studies in hydrochloric acid solutions over the range of 0.1 - 10.0 N HCl, whole varying REDOX conditions, actinide loading levels, and contact time intervals. Significant differences in the actinide distribution coefficients, and in the kinetics of actinide removal were observed as a function of resin formulation. The usefulness of these resins for actinide removal from HCl effluent streams is discussed

  16. Complex formation of trivalent americium with salicylic acid at very low concentrations

    International Nuclear Information System (INIS)

    For the first time, the complexation of americium(III) with salicylic acid was studied at trace metal concentrations using a 2.0 m Long Path Flow Cell for UV-vis spectroscopy. The detection limit of Am(III) in aqueous solution at pH 3.0 was found to be 5 x 10-9 M. Two Am(III)-salicylate complexes were formed at pH 5.0 in 0.1 M NaClO4, indicated by a clear red shift of the absorption maximum. The absorption spectra obtained from spectrophotometric titration were analyzed by means of factor analysis and complex stabilities were calculated to be log β110 = 2.56 ± 0.08 and log β120 = 3.93 ± 0.19. (author)

  17. Standard practice for The separation of americium from plutonium by ion exchange

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2001-01-01

    1.1 This practice describes the use of an ion exchange technique to separate plutonium from solutions containing low concentrations of americium prior to measurement of the 241Am by gamma counting. 1.2 This practice covers the removal of plutonium, but not all the other radioactive isotopes that may interfere in the determination of 241Am. 1.3 This practice can be used when 241Am is to be determined in samples in which the plutonium is in the form of metal, oxide, or other solid provided that the solid is appropriately sampled and dissolved (See Test Methods C758, C759, and C1168). 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  18. Transportability Class of Americium in K Basin Sludge under Ambient and Hydrothermal Processing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    Delegard, Calvin H.; Schmitt, Bruce E.; Schmidt, Andrew J.

    2006-08-01

    This report establishes the technical bases for using a ''slow uptake'' instead of a ''moderate uptake'' transportability class for americium-241 (241Am) for the K Basin Sludge Treatment Project (STP) dose consequence analysis. Slow uptake classes are used for most uranium and plutonium oxides. A moderate uptake class has been used in prior STP analyses for 241Am based on the properties of separated 241Am and its associated oxide. However, when 241Am exists as an ingrown progeny (and as a small mass fraction) within plutonium mixtures, it is appropriate to assign transportability factors of the predominant plutonium mixtures (typically slow) to the Am241. It is argued that the transportability factor for 241Am in sludge likewise should be slow because it exists as a small mass fraction as the ingrown progeny within the uranium oxide in sludge. In this report, the transportability class assignment for 241Am is underpinned with radiochemical characterization data on K Basin sludge and with studies conducted with other irradiated fuel exposed to elevated temperatures and conditions similar to the STP. Key findings and conclusions from evaluation of the characterization data and published literature are summarized here. Plutonium and 241Am make up very small fractions of the uranium within the K Basin sludge matrix. Plutonium is present at about 1 atom per 500 atoms of uranium and 241Am at about 1 atom per 19000 of uranium. Plutonium and americium are found to remain with uranium in the solid phase in all of the {approx}60 samples taken and analyzed from various sources of K Basin sludge. The uranium-specific concentrations of plutonium and americium also remain approximately constant over a uranium concentration range (in the dry sludge solids) from 0.2 to 94 wt%, a factor of {approx}460. This invariability demonstrates that 241Am does not partition from the uranium or plutonium fraction for any characterized sludge matrix. Most

  19. Toxicity of inhaled 238PuO2 II

    International Nuclear Information System (INIS)

    Studies are in progress to determine dose-response relationships for inhaled 238PuO2. Beagle dogs were given a single, brief, nose-only inhalation exposure to aerosols of monodisperse particles of 238PuO2. Aerosols of two sizes were used, 1.5 μm aerodynamic diameter (AD) and 3.0 μm AD. Dogs were exposed to achieve initial lung burdens of 0.56, 0.28, 0.14, 0.07, 0.03 or 0.01 μCi 238PuO2/kg body weight. Twelve dogs were exposed at each activity level to each aerosol particle size. The local dose around each 3.0 μm AD particle was 10 times higher than the local dose around 1.5 μm AD particles, but the dose averaged over the whole lung was the same at each activity level for both particle sizes. The lung retention of 238Pu was divided into two phases of clearance. During the first 100 days after exposure, the average retention half-time for 238Pu in the lung was 310 days. When the solubility changed due to particle breakup, the retention half-time decreased to 180 days during the period from 1OO to 1,500 days after exposure. The first biological effects observed were lymphopenia and neutropenia in peripheral blood. To date, 28 Beagle dogs have died at times from 536 to 1683 days after exposure. Initial lung burdens for the dead dogs ranged from 0.18 to 2.2 μCi 238Pu/kg body weight. Nine died with radiation pneumonitis and pulmonary fibrosis, 10 died with lung tumors and 19 dogs died with bone tumors. There are 116 exposed and 22 control dogs surviving and under observation. Current patterns of dose versus response are discussed. (author)

  20. 40 CFR 52.238 - Commitment to undertake rulemaking.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Commitment to undertake rulemaking. 52... (CONTINUED) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS California § 52.238 Commitment to undertake rulemaking. (a) The Administrator shall undertake rulemaking, after the South Coast mobile source...

  1. Characterization of Pu-238 Heat Source Granule Containment

    Energy Technology Data Exchange (ETDEWEB)

    Richardson, Paul Dean II [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Sanchez, Joey Leo [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wall, Angelique Dinorah [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Chavarria, Rene [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-02-11

    The Milliwatt Radioisotopic Themoelectric Generator (RTG) provides power for permissive-action links. Essentially these are nuclear batteries that convert thermal energy to electrical energy using a doped silicon-germanium thermopile. The thermal energy is provided by a heat source made of 238Pu, in the form of 238PuO2 granules. The granules are contained by 3 layers of encapsulation. A thin T-111 liner surrounds the 238PuO2 granules and protects the second layer (strength member) from exposure to the fuel granules. An outer layer of Hastalloy-C protects the T-111 from oxygen embrittlement. The T-111 strength member is considered the critical component in this 238PuO2 containment system. Any compromise in the strength member seen during destructive testing required by the RTG surveillance program is characterized. The T-111 strength member is characterized through Scanning Electron Microscopy (SEM), and Metallography. SEM is used in the Secondary Electron mode to reveal possible grain boundary deformation and/or cracking in the region of the strength member weld. Deformation and cracking uncovered by SEM are further characterized by Metallography. Metallography sections are mounted and polished, observed using optical microscopy, then documented in the form of microphotographs. SEM mat further be used to examine polished Metallography mounts to characterize elements using the SEM mode of Energy Dispersive X-ray spectroscopy (EDS).

  2. Structure effects in 238U-induced dissipative collisions

    International Nuclear Information System (INIS)

    A high resolution kinematic coincidence set-up using position sensitive gas detectors was developed to study 238U - induced reactions on 110Pd and 124Sn targets between 5.70 and 6.02 MeV/u bombarding energies. Nuclear structure effects were observed in the distribution of binary reaction products possibly caused by enhanced multinucleon transfer matrix elements. (orig.)

  3. 49 CFR 238.407 - Anti-climbing mechanism.

    Science.gov (United States)

    2010-10-01

    ... power car constructed with a crash energy management design is permitted to crush in a controlled manner... Equipment § 238.407 Anti-climbing mechanism. (a) Each power car shall have an anti-climbing mechanism at its... yielding. (c) The forward coupler of a power car shall be attached to the car body to resist a...

  4. 33 CFR 238.7 - Decision criteria for participation.

    Science.gov (United States)

    2010-07-01

    ... alternative. Water damage associated with inadequate carrying capacity of man-made structures should be..., natural storage (wetlands) or detention basins or diversions with limited capacity. Other conditions could... in § 238.4(b) and must be justified based on Corps of Engineers evaluation procedures in use at...

  5. Pu-238 fuel form activities, January 1-31, 1981

    Energy Technology Data Exchange (ETDEWEB)

    1981-02-01

    This monthly report for /sup 238/Pu Fuel Form Activities has two main sections: SRP-PuFF facility and SRL Fuel Form Activities. The program status, budget information, and milestone schedules are discussed in each main section. The Work Breakdown Structure (WBS) for this program is shown. Only one monthly report per year is processed for EDB.

  6. 49 CFR 238.21 - Special approval procedure.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS General § 238.21 Special approval procedure.... (Requests for approval of programs for the inspection, testing, and maintenance of Tier II passenger... designated representatives of its employees, together with a list of the names and addresses of the...

  7. Precise measurement and calculation of 238U neutron transmissions

    International Nuclear Information System (INIS)

    The total neutron cross section of 238U has been measured above 0.5 eV in precise transmission experiments and results are compared with ENDF/B-IV. Emphasis has been on measuring transmissions through thick samples in order to obtain accurate total cross sections in the potential-resonance interference regions between resonances. 4 figures, 1 table

  8. 42 CFR 455.238 - Conflict of interest.

    Science.gov (United States)

    2010-10-01

    ... guidance, found under 48 CFR subpart 9.5. (2) The standards and requirements that are contained in each... 5 CFR 2635.203(b)), payment of expenses, offer of employment, or any other thing of value from any... 42 Public Health 4 2010-10-01 2010-10-01 false Conflict of interest. 455.238 Section...

  9. Flux of 238U and 232Th in Changjiang estuary

    International Nuclear Information System (INIS)

    The study of fluxes of the U, Th of Changjiang River into the East China Sea and its adjacent waters is basic work to understanding of U, Th tracer theirselves and their corresponding biogeochemical cycles process in estuaries, coastal. By sampling in the Xuliujing (i.e. the interface between fresh water and sea water) every month, 200 L water was filtered through 0.45μm fabric cartridge to collect particle nuclides. The dissolved nuclides were co-precipitated using Fe(OH)3 and MnO2. The range of 238U activity in water is 2.30-10.32 Bq·m-3, with an average of 5.48±1.19 Bq·m-3; the activity of 232Th is 1.08-2.32 Bq·m-3, with an average of 1.75±0.29 Bq·m-3. Changjiang River conveyed 238U 4.06 x 1012Bq, 232Th 1.54 x 1012 Bq into the estuary every year. Further study of the seasonal variations 238U, 232Th input to the sea, indicating that: the activity of 238U and Changjiang River estuary water flux have a certain degree of negative correlation (R2=0.65, n=12); the main source of 232Th is the weathering of the river. The activity of 232Th is large on the spring and autumn because of strong weathering in Changjiang Basin comparison with other seasons. Compared with the other estuaries in the world, the flux of 238U and 232Th of the Changjiang River estuary is large because of its large fluxes of sediments and runoff in the world. (authors)

  10. Determination of {sup 238}Pu, {sup 239+240}Pu, {sup 241}Pu and {sup 241}Am in radioactive waste from IPEN reactor

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca; Taddei, Maria Helena T.; Cheberle, Sandra M.; Ferreira, Marcelo T., E-mail: bgeraldo@cnen.gov.b, E-mail: mhtaddei@cnen.gov.b, E-mail: scsantos@cnen.gov.b, E-mail: ferreira@cnen.gov.b [Brazilian Nuclear Energy Commission (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Lab. of Pocos de Caldas; Marumo, Julio T., E-mail: jtmarumo@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Ion exchange resin is a common type of radioactive waste arising from treatment of coolant water of the main circuit of research and nuclear power reactors. This waste contains high concentrations of fission and activation products. The management of this waste includes its characterization in order to determine and quantify specific radionuclides including those known as difficult-to-measure radionuclides (RDM). The analysis of RDMs generally involves expensive and time-consuming complex radiochemical analysis for purification and separation of the radionuclides. The objective of this work is to show an easy methodology for quantifying plutonium and americium isotopes in spent ion exchange resin, used for purification of the cooling water of the IEA-R1 reactor located at the Nuclear and Energy Research Institute, IPEN-CNEN/SP. The resins were destroyed by acid digestion, followed by purification and separation of the Pu and Am isotopes with anionic and chromatographic resins. {sup 238}Pu, {sup 239}+{sup 24}'0Pu, and {sup 24}'1Am isotopes were analyzed in an alpha spectrometer equipped with surface barrier detectors. {sup 241}Pu isotope was analyzed by liquid scintillation counting. Chemical recovery yield ranged from 73 to 98% for Pu and 77 to 98% for Am, demonstrating that the methodology is suitable for identification and quantification of the isotopes studied in spent resins. (author)

  11. Sequential leaching extraction of 239,240Pu, 238Pu, 241Pu, 237Np and 241Am from a mud sample: An intercomparison study

    International Nuclear Information System (INIS)

    The transuranics content of a mud sample taken from a nuclear waste storage container was analysed employing two different sequential extraction methods. The following fractions were isolated: (1)Water soluble (2) Readily available (3) Carbonate bound and specifically adsorbed (4) Organically bound (5) Oxide and hydroxides bound and (6) residual. Both methods differ in the reagents employed, the extraction sequence applied as well as the temperature and means of extraction. The 239,240Pu, 238Pu, 237Np and 241Am extracted in each phase were determined using standard radiochemical procedures. 241Pu was analysed through the 241Am in-growth on just one old disk of the residual fraction containing plutonium. Plutonium was mainly associated to organic-oxides fractions (89-92 %). The percentage extracted in each fraction depended on the method and the extraction sequence used. The soluble fraction of plutonium was less than 13%. Neptunium seemed to be the more soluble than the other transuranics (27%) and the americium showed a tendency to be associated to carbonates (30%). (author)

  12. Sequential determination of natural (232Th, 238U) and anthropogenic (137Cs, 90Sr, 241Am, 239+240Pu) radionuclides in environmental matrix

    International Nuclear Information System (INIS)

    A new sequential method for the determination of both natural (U, Th) and anthropogenic (Sr, Cs, Pu, Am) radionuclides has been developed for application to soil and sediment samples. The procedure was optimised using a reference sediment (IAEA-368) and reference soils (IAEA-375 and IAEA-326). Reference materials were first digested using acids (leaching), 'total' acids on hot plate, and acids in microwave in order to compare the different digestion technique. Then, the separation and purification were made by anion exchange resin and selective extraction chromatography: Transuranic (TRU) and Strontium (SR) resins. Natural and anthropogenic alpha radionuclides were separated by Uranium and Tetravalent Actinide (UTEVA) resin, considering different acid elution medium. Finally, alpha and gamma semiconductor spectrometer and liquid scintillation spectrometer were used to measure radionuclide activities. The results obtained for strontium-90, cesium-137, thorium-232, uranium- 238, plutonium-239+240 and americium-241 isotopes by the proposed method for the reference materials provided excellent agreement with the recommended values and good chemical recoveries. (authors)

  13. Separation by sequential chromatography of americium, plutonium and neptunium elements: application to the study of trans-uranian elements migration in a European lacustrine system

    International Nuclear Information System (INIS)

    The nuclear tests carried out in the atmosphere in the Sixties, the accidents and in particular that to the power station of Chernobyl in 1986, were at the origin of the dispersion of a significant quantity of transuranic elements and fission products. The study of a lake system, such that of the Blelham Tarn in Great Britain, presented in this memory, can bring interesting answers to the problems of management of the environment. The determination of the radionuclides in sediment cores made it possible not only to establish the history of the depositions and consequently the origin of the radionuclides, but also to evaluate the various transfers which took place according to the parameters of the site and the properties of the elements. The studied transuranic elements are plutonium 238, 239-240, americium 241 and neptunium 237. Alpha emitting radionuclides, their determination requires complex radiochemical separations. A method was worked out to successively separate the three radioelements by using a same chromatographic column. Cesium 137 is the studied fission product, its determination is done by direct Gamma spectrometry. Lead 210, natural radionuclide, whose atmospheric flow can be supposed constant. makes it possible to obtain a chronology of the various events. The detailed vertical study of sediment cores showed that the accumulation mode of the studied elements is the same one and that the methods of dating converge. The cesium, more mobile than transuranic elements in the atmosphere, was detected in the 1963 and 1986 fallout whereas an activity out of transuranic elements appears only for the 1963 fallout. The activity of the 1963 cesium fallout is of the same order of magnitude as that of 1986. The calculation of the diffusion coefficients of the elements in the sediments shows an increased migration of cesium compared to transuranic elements. An inventory on the whole of the lake made it possible to note that the atmospheric fallout constitute the

  14. An electrochemical oxidation process of Am (III) into Am (VI) used to separate the americium of spent fuels reprocessing solutions

    International Nuclear Information System (INIS)

    The aim of this invention is to oxidize by an electrochemical process Am (III) to Am (VI). This process can be used to separate the americium of spent fuels reprocessing solutions. The method consists to add to the aqueous nitric solution containing Am (III) an heteropolyanion able to complex the americium (as for instance the potassium tungstophosphate) and the Ag (II) ion. The Ag (II) ion oxidizes the Am (III) and is reduced into an Ag (I) ion. It is then regenerated by the electrolysis of the solution. After the oxidation of Am (III) into Am (VI), this last ion can be extracted by an adapted organic solvent. With this electrochemical method a yield of 100% Am (VI) is obtained in half a hour. (O.M.). 5 refs., 5 figs., 2 tabs

  15. Separation of oxidized americium from lanthanides by use of pillared metal(IV) phosphate-phosphonate hybrid materials

    International Nuclear Information System (INIS)

    Closing the nuclear fuel cycle in the US poses many challenges, one of which is found in the waste streams, which contain both trivalent lanthanides and actinides. The separation of americium from the raffinate will dramatically reduce the long-term radiotoxicity of the waste. The sorption of americium in both the tri- and pentavalent oxidation states was observed for four M(IV) phosphate-phosphonate ion exchange materials in nitric acid at pH 2. High selectivity was observed for reduced Am(III) with Kd values ca. 6 x 105 mL/g, while the Kd values for Am(V) were much lower. A new method of synthesizing and stabilizing AmO2+ to yield a lifetime of at least 24 h in acidic media using a combination of sodium persulfate and calcium hypochlorite will be described.

  16. Effects of impurities on the size and form of crystals of thorium and americium oxalates and oxides

    International Nuclear Information System (INIS)

    The influence of impurity salts and certain surfactants on the shape and size of thorium and americium oxalate crystals, as well as crystals of their dioxides, prepared at thermolysis of oxalate precipitates, has been investigated. It is shown that during thorium oxalate deposition from solutions, containing 0.8 mol/l thorium and 2 mol/l nitric acid at 96 deg C in the presence of ammonium salts or surfactants larger and monodisperse crystals are grown than in the absence of the above-mentioned substances. Addition of ammonium nitrate in the amount of 0.6 mol/l to solution containing 7.6x10-3 mol/l of americium dioxide particles coincides with the shape of oxalate crystals but their size is reduced by (20-25)% as compared with the initial ones

  17. Combined radiochemical procedure for determination of plutonium, americium and strontium-90 in the soil samples from SNTS

    International Nuclear Information System (INIS)

    The results of combined radiochemical procedure for the determination of plutonium, americium and 90Sr (via measurement of 90Y) in the soil samples from SNTS (Semipalatinsk Nuclear Test Site) are presented. The processes of co-precipitation of these nuclides with calcium fluoride in the strong acid solutions have been investigated. The conditions for simultaneous separation of americium and yttrium using extraction chromatography have been studied. It follows from analyses of real soil samples that the procedure developed provides the chemical recovery of plutonium and yttrium in the range of 50-95 % and 60-95 %, respectively. The execution of the procedure requires 3.5 working days including a sample decomposition study. (author)

  18. Extraction of americium(III) from nitric acid medium by CMPO-TBP extractants in ionic liquid diluent

    International Nuclear Information System (INIS)

    Extraction of americium(III) from nitric acid medium by a solution of tri-n-butylphosphate (TBP) and n-octyl(phenyl)-N,N-diisobutylcarbamoylmethylphosphine oxide (CMPO) in room temperature ionic liquid, l-butyl-3-methyl-imidazolium bis(trifluoromethanesulfonyl)imide (bmimNTf2), was studied and the results were compared with that obtained with CMPO-TBP in n-doddecane (n-DD). The distribution ratio of 241Am(III) in TBP-CMPO/bmimNTf2 was measured as a function of various parameters such as concentrations of nitric acid, CMPO, bmimNO3, NaNO3 and TBP and temperature. Remarkably large distribution ratios were observed for the extraction of americium(III) when bmimNTf2 acted as diluent and the extraction was insignificant in the absence of CMPO. The stoichiometry of metal-solvate in organic phase was determined by the slope analysis of extraction data and it indicated the formation of 1:3 (Am: CMPO) complex in organic phase. Viscosity of TBP-CMPO/bmimNTf2 at various temperatures and enthalpy change accompanied by the extraction of americium(III) were determined and reported in this paper. (orig.)

  19. The behaviour under irradiation of molybdenum matrix for inert matrix fuel containing americium oxide (CerMet concept)

    Science.gov (United States)

    D'Agata, E.; Knol, S.; Fedorov, A. V.; Fernandez, A.; Somers, J.; Klaassen, F.

    2015-10-01

    Americium is a strong contributor to the long term radiotoxicity of high activity nuclear waste. Transmutation by irradiation in nuclear reactors or Accelerator Driven System (ADS, subcritical reactors dedicated to transmutation) of long-lived nuclides like 241Am is therefore an option for the reduction of radiotoxicity of waste packages to be stored in a repository. In order to safely burn americium in a fast reactor or ADS, it must be incorporated in a matrix that could be metallic (CerMet target) or ceramic (CerCer target). One of the most promising matrix to incorporate Am is molybdenum. In order to address the issues (swelling, stability under irradiation, gas retention and release) of using Mo as matrix to transmute Am, two irradiation experiments have been conducted recently at the High Flux Reactor (HFR) in Petten (The Netherland) namely HELIOS and BODEX. The BODEX experiment is a separate effect test, where the molybdenum behaviour is studied without the presence of fission products using 10B to "produce" helium, the HELIOS experiment included a more representative fuel target with the presence of Am and fission product. This paper covers the results of Post Irradiation Examination (PIE) of the two irradiation experiments mentioned above where molybdenum behaviour has been deeply investigated as possible matrix to transmute americium (CerMet fuel target). The behaviour of molybdenum looks satisfying at operating temperature but at high temperature (above 1000 °C) more investigation should be performed.

  20. Consideration of the effect of lymph-node deposition upon the measurement of plutonium and americium in the lungs

    International Nuclear Information System (INIS)

    Measurement of an inhaled radionuclide by external photon counting includes quantities which may be contained in lymph nodes, as well as quantities in the lungs. An overestimate of the lung burden can result, if a portion of the radionuclide were present in the lymph nodes. This problem is analyzed with respect to the measurement of inhaled plutonium containing plutonium-241 and americium-241, when americium-241 has been used as a tracer for the plutonium. Equations are derived which yield the amounts of americium and of plutonium in the lungs and in the lymph nodes as a function of time after exposure and for various translocation and retention parameters. Count histories (count profiles) of actual exposure cases are compared with calculated count profiles in order to gain insight into possible values of the translocation and retention parameters. Comparison is also made with calculated count profiles using values of translocation and retention parameters recommended by the International Commission on Radiological Protection (ICRP) for use with the Task Group Lung Model. The magnitude of the possible overestimate (error factor) was calculated for combinations o

  1. HELIOS: the new design of the irradiation of U-free fuels for americium transmutation

    Energy Technology Data Exchange (ETDEWEB)

    D' Agata, E. [European Commission, Joint Research Centre, Institute for Energy, P.O. Box 2, 1755 ZG Petten (Netherlands); Klaassen, F.; Sciolla, C. [Nuclear Research and Consultancy Group, Dept. Life Cycle and Innovations, P.O. Box 25 1755 ZG Petten (Netherlands); Fernandez-Carretero, A. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, 76125 Karlsruhe (Germany); Bonnerot, J.M. [Commissariat a l' Energie Atomique, DEC/SESC/LC2I CEA-Cadarache, 13108 St. Paul lez Durance Cedex (France)

    2009-06-15

    Americium is one of the radioactive elements that mostly contribute to the radiotoxicity of the nuclear spent fuel. Transmutation of long-lived nuclides like Americium is an option for the reduction of the mass, the radiotoxicity and the decay heat of nuclear waste. The HELIOS irradiation experiment is the last evolution in a series of experiments on americium transmutation. The previous experiments, EFTTRA-T4 and T4bis, have shown that the release or trapping of helium is the key issue for the design of such kind of target. In fact, the production of helium, which is characteristic of {sup 241}Am transmutation, is quite significant. The experiment is carried out in the framework of the 4-year project EUROTRANS of the EURATOM 6. Framework Programme (FP6). Therefore, the main objective of the HELIOS experiment is to study the in-pile behaviour of U-free fuels such as CerCer (Pu, Am, Zr)O{sub 2} and Am{sub 2}Zr{sub 2}O{sub 7}+MgO or CerMet (Pu, Am)O{sub 2}+Mo in order to gain knowledge on the role of the fuel microstructure and of the temperature on the gas release and on the fuel swelling. The experiment was planned to be conducted in the HFR (High Flux Reactor) in Petten (The Netherlands) starting the first quarter of 2007. Because of the innovative aspects of the fuel, the fabrication has had some delays as well as the final safety analyses of the original design showed some unexpected deviation. Besides, the HFR reactor has been unavailable since August 2008. Due to the reasons described above, the experiment has been postponed. HELIOS should start in the first quarter of 2009 and will last 300 full power days. The paper will cover the description of the new design of the irradiation experiment HELIOS. The experiment has been split in two parts (HELIOS1 and HELIOS2) which will be irradiated together. Moreover, due to the high temperature achieved in cladding and to the high amount of helium produced during transmutation the experiment previously designed for a

  2. Anomalous aryl strengthening of complexes at americium and europium extraction with alkylenediphospine dioxide from perchloric media

    International Nuclear Information System (INIS)

    Studied was the extraction of americium(3) and europium(3) from perchlorate solutions(0.001 M) with dioxides of alkylenediphosphines of three types: aryl Ph2P(O)CH2(O)PPh2(briefly 4P), and Ph2P(O)(CH2)2(O)PPh2, mixed Ph2P(O)CH2(O)P(C8H17)2 (or 2Ph2Oct) and alkyl (C8H17)2P(O)CH2(O)P(C8H17)2 (or 4 Oct). Trisolvates of MeS3x(ClO4)3 are predominantly formed but americium disolvates are also present upon dilution with dichloroethane. For 4Ph,2Ph2Oct and 4 Oct the concentration is, respectively, 1015, 2x1014, and 1013; for disolvates by 4 orders of magnitude lower which is, nevertheless, by 2 orders of magnitude higher than for nitric acid solutions. The separation coefficient of β Am/Eu for 4Ph attains 6-8. As in the case of nitrate solutions, an anomalous aryl strengthening of the complexes is observed: an increase in the distribution coefficients and extraction constants in the series of 4 Oct - 2Ph 2 Oct - 4Ph, in spite of the introduction of electronegative aryl substituents into the dioxide molecule, which reduce electron density on oxygen atoms and basicity of dioxides. In contrast to nitric acid solutions, observed is a nonlinear effect of a change in basicity on extraction properties upon dilution with dichloroethane (dioxide of 2Ph2 Oct does not occupy an intermediate position but is close to 4Ph). Upon dilution with chloroform the dependence is linear and anomalous effect rises due to a different nature of interactions of dioxides with chloroform. When the bridge increases up to ethylene, an anomalous strengthening of the complexes disappears. However, the distribution coefficients upon extraction with alkyl dioxide are considerably lower, which can be explained by a stronger extraction of perchloric acid

  3. 238Pu fuel form processes. Final report, January-September 1983

    International Nuclear Information System (INIS)

    Progress is reported on the following: analytical studies of weld-quench cracking in DOP-26 iridium alloy, iridium/238PuO2 compatibility test, surface area measurements of 238PuO2 using the Blaine air permeability apparatus, and helium release from 238PuO2

  4. 28 CFR 2.38 - Community supervision by U.S. Probation Officers.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Community supervision by U.S. Probation Officers. 2.38 Section 2.38 Judicial Administration DEPARTMENT OF JUSTICE PAROLE, RELEASE, SUPERVISION AND... § 2.38 Community supervision by U.S. Probation Officers. (a) Pursuant to sections 3655 and...

  5. 49 CFR 238.207 - Link between coupling mechanism and car body.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Link between coupling mechanism and car body. 238.207 Section 238.207 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL... Requirements for Tier I Passenger Equipment § 238.207 Link between coupling mechanism and car body....

  6. Development of AN Active 238UF6 Gas Target

    Science.gov (United States)

    Eckardt, C.; Enders, J.; Freudenberger, M.; Göök, A.; von Neumann-Cosel, P.; Oberstedt, A.; Oberstedt, S.

    2014-09-01

    Detailed studies of the fission process, e.g., the search for parity nonconservation (PNC) effects, the energy dependence of fission modes or the population of fission isomers, depend on high quality data, therefore requiring high luminosities. An active gas target containing uranium may overcome the deterioration of energy and angular resolution caused by large solid target thicknesses. A single Frisch-grid ionization chamber has been built to test a mixture of standard counting gases (e.g., argon) with depleted uranium hexafluoride (238UF6), utilizing a triple alpha source to evaluate signal quality and drift velocity. For mass fractions of up to 4 percent of 238U the drift velocity increases with rising UF6 content, while a good signal quality and energy resolution is preserved.

  7. Measurement of the fission cross section of 238Pu

    International Nuclear Information System (INIS)

    The fission cross sections of 238Pu have been measured from 0.1 eV to 80 keV energy range using the Rensselaer Intense Neutron Spectrometer. The cross sections were normalized to the 235U ENDF/B-V data broadened to the resolution of the Rensselaer Intense Neutron Spectrometer system. The fission areas and widths were determined for the resolved low-energy resonances. The ENDF/B-V fission cross sections for the 238Pu isotope are, in general, not in good agreement with the measured cross sections and a new evaluation is recommended. The observations of structure in the unresolved fission cross sections is suggestive of the existence of intermediate structure. 18 refs., 1 fig., 1 tab

  8. Verification of uranium 238 quantity calculated using waste assay systems

    International Nuclear Information System (INIS)

    The amount of 238U in uranium-contaminated waste drums generated in the decommissioning of nuclear facilities is evaluated from γ-ray measurement. We used the γ-ray measurement system made from CANBERRA(Qualitative and Quantitative (Q2) Low Level Waste Assay Systems) and measured the waste drums. This system assumes uniform distribution of uranium. But, homogeneity can not be checked with real waste drums. Authors developed the new analysis technique which calculates the amount of uranium by correcting the influence of uneven distribution of the uranium. As a result of evaluating using the new analysis technique, the error which influences quantitative value of 238U has been evaluated. (author)

  9. Design of a Pu-238 waste incineration process

    International Nuclear Information System (INIS)

    Combustible 238Pu waste is generated as a result of normal operation and decommissioning activity at the Savannah River Plant and is being retrievably stored at the Plant. As part of the long-term plan to process the stored waste and current waste in preparation for future disposition, a 238Pu incinceration process is being cold-tested at SRL. The incineration process consists of a continuous-feed preparation system, a two-stage, electrically fired incinerator, and a filtration off-gas system. Process equipment has been designed, fabricated, and installed for nonradioactive testing and cold run-in. Design features to maximize the ability to remotely maintain the equipment were incorporated into the process. Interlock, alarm, and control functions are provided by a programmable controller. Cold testing is scheduled to be completed in 1986

  10. THE CHEMICAL AGE OF THE BOK GLOBULE CB238

    International Nuclear Information System (INIS)

    The Bok globule CB238 has been investigated in 13CO (220.4 GHz), C18O (109.7 GHz), CS (97.9 and 146.7 GHz), and SO (99.3 GHz) lines, and mapped with half-power beamwidths of 11'', 22'', 38'', 16'', and 36'', respectively. The two dense cores previously found in NH3 are presently confirmed in CS. The cores exhibit similar physical and chemical characteristics. The lack of outflows, the limited chemical content, and the very modest depletion in the ammonia cores provide evidence that CB238 is not an evolved object. Molecular abundances and density ratios constrain chemical modeling whose results provide a chemical age close to the free-fall timescale.

  11. Delayed fission of the 238U muonic atom

    International Nuclear Information System (INIS)

    The time distributions of fission and muon free decay events with respect to the moment of the muon-stop event have been measured for double and triple coincidences between these three events. The triple-coincidence time distributions give an indication of the o-curence of two new effects: the delayed fission of muonic 238U atom and conversion of muons from the fission fragments

  12. Recovery and purification of uranium-234 from aged plutonium-238

    International Nuclear Information System (INIS)

    The current production methods used to recover and purify uranium-234 from aged plutonium-238 at Mound Laboratory are presented. The three chemical separation steps are described in detail. In the initial separation step, the bulk of the plutonium is precipitated as the oxalate. Successively lower levels of plutonium are achieved by anion exchange in nitrate media and by anion exchange in chloride media. The procedures used to characterize and analyze the final U3O8 are given

  13. Americium and plutonium in water, biota, and sediment from the central Oregon coast

    International Nuclear Information System (INIS)

    Plutonium-239, 240 and americium-241 were measured in the mussel Mytilus californianus from the region of Coos Bay, OR. The flesh of this species has a plutonium concentration of about 90 fCi/kg, and an Am-241/Pu-239, 240 ratio that is high relative to mixed fallout, ranging between two and three. Transuranic concentrations in sediment, unfiltered water, and filterable particulates were also measured; none of these materials has an Am/Pu ratio as greatly elevated as the mussels, and there is no apparent difference in the Am/Pu ratio of terrestrial runoff and coastal water. Sediment core profiles do not allow accumulation rates or depositional histories to be identified, but it does not appear that material characterized by a high Am/Pu ratio has ever been introduced to this estuary. Other bivalves (Tresus capax and Macoma nasuta) and a polychaete (Abarenicola sp.) do not have an elevated Am/Pu ratio, although the absolute activity of plutonium in the infaunal bivalves is roughly four times that in the mussels

  14. Americium-based oxides: Dense pellet fabrication from co-converted oxalates

    Energy Technology Data Exchange (ETDEWEB)

    Horlait, Denis; Lebreton, Florent [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Gauthé, Aurélie [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Caisso, Marie [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France); Arab-Chapelet, Bénédicte; Picart, Sébastien [CEA, DEN, DRCP/SERA/LCAR, 30207 Bagnols-sur-Cèze (France); Delahaye, Thibaud, E-mail: thibaud.delahaye@cea.fr [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze (France)

    2014-01-15

    Mixed oxides are used as nuclear fuels and are notably envisaged for future fuel cycles including plutonium and minor actinide recycling. In this context, processes are being developed for the fabrication of uranium–americium mixed-oxide compounds for transmutation. The purpose of these processes is not only the compliance with fuel specifications in terms of density and homogeneity, but also the simplification of the process for its industrialization as well as lowering dust generation. In this paper, the use of a U{sub 0.85}Am{sub 0.15}O{sub 2±δ} powder synthesized by oxalate co-conversion as a precursor for dense fuel fabrications is assessed. This study notably focuses on sintering, which yielded pellets up to 96% of the theoretical density, taking advantage of the high reactivity and homogeneity of the powder. As-obtained pellets were further characterized to be compared to those obtained via processes based on the UMACS (Uranium Minor Actinide Conventional Sintering) process. This comparison highlights several advantages of co-converted powder as a precursor for simplified processes that generate little dust.

  15. Influence of organic additives on the colour reaction between trivalent americium and arsenazo III

    International Nuclear Information System (INIS)

    The colour reaction of Am(III) with arsenazo III in several hydroorganic media has been examined systematically on the addition of certain polar water-miscible organic solvents in the course of a search for improved and simple spectrophotometric methods for the estimation of americium. Addition of these substances resulted in the stabilization of colour and brought about a drastic enhancement in the absorbance values. The organic additives studied include acetone, acetonitrile, dimethylformamide, dioxane and ethanol. Among the many solvents tested, alcohol and dioxane proved to be the most effective, the highest sensitivity is obtained by using a 60% dioxane-ethanol (1:1) mixture. The apparent molar absorptivity based on Am content is 184616+-9931 mol-1 cm-1 at 655 nm which is about 3 times higher than that attained for the reaction in aqueous medium (65178+-1243). Moreover, this is the highest value reported as yet for its determination. Beer's law is obeyed both in mixed and aqueous media. The effects of some experimental variables on colour development have also been studied to optimize the conditions for the assay of Am. (author)

  16. Speciation and bioavailability of Americium-241 in the fresh water environment

    International Nuclear Information System (INIS)

    Due to its anthropogenic origin, the transuranic americium 241 confronts physiologists with the intriguing question, which mechanisms are involved in the incorporation or elimination of such artificial elements in biological cycles. The investigations on the speciation and bioavailability of 241Am in the freshwater environment aim to establish a relation between the behavior of 241Am in freshwater ecosystems and its availability for biota. In the limnic environment, most often characterized by a high organic load and a low conductivity, the effect of complexation of 241Am with humic acids and competition with trivalent cations such as A1 and Fe, were proven to be significant on the speciation of 241Am. Based on the registration of the 241Am uptake by a large number of freshwater organisms, the crayfish Astacus leptodactylus Eschscholtz was chosen to study the whole-body uptake of 241Am, its corresponding organ distribution and its retention in the animal. The share of external fixation and ingestion in the global uptake, and the effect of speciation on it, were studied more carefully. Other aspects in this physiological part were: the kinetics of 241Am in the hemolymph and the hepatopancreas, and its subcellular distribution in the digestive gland. Finally, by comparing the physiology of 241Am with some other metals (240Pu, 64Cu, 198Au) with analogous or contradictional properties, we tried to find out whether the behavior of 241Am in organisms can be explained from its chemical characteristics

  17. Development and Testing of an Americium/Lanthanide Separation Flowsheet Using Sodium Bismuthate

    Energy Technology Data Exchange (ETDEWEB)

    Jack Law; Bruce Mincher; Troy Garn; Mitchell Greenhalgh; Nicholas Schmitt; Veronica Rutledge

    2014-04-01

    The separation of Am from the lanthanides and curium is a key step in proposed advanced fuel cycle scenarios. The partitioning and transmutation of Am is desirable to minimize the long-term heat load of material interred in a future high-level waste repository. A separation process amenable to process scale-up remains elusive. Given only subtle chemistry differences within and between the ions of the trivalent actinide and lanthanide series this separation is challenging ; however, higher oxidation states of americium can be prepared using sodium bismuthate and separated via solvent extraction using diamylamylphosphonate (DAAP) extraction. Among the other trivalent metals only Ce is also oxidized and extracted. Due to the long-term instability of Am(VI) , the loaded organic phase is readily selectively stripped to partition the actinide to a new acidic aqueous phase. Batch extraction distribution ratio measurements were used to design a flowsheet to accomplish this separation. Additionally, crossflow filtration was investigated as a method to filter the bismuthate solids from the feed solution prior to extraction. Results of the filtration studies, flowsheet development work and flowsheet performance testing using a centrifugal contactor are detailed.

  18. Determination of plutonium americium and curium in soil samples by solvent extraction with trioctylphosphine oxide

    International Nuclear Information System (INIS)

    A method of Pu, Am and Cm determination in soil samples, which was developed for analyzing samples from territories subjected to radioactive contamination as a result of the Chernobyl accident is described. After preliminary treatment the samples were leached by solution of 7 mol/l HNO23+0.3 mol/l KBrO3 during heating. Pu was isolated by extraction with 0.05 mol TOPO from 7 mol/l HNO3. 144Ce and partially remaining in water phase isotopes of Zr, U and Th were isolated in an extraction-chromatographic column with TOPO and PbO2. Then Am and Cm were extracted by 0.2 mol/l TOPO from solution 1 mol/l HLact+0.07 mol/l DTPA+1 mol/l Al(NO3)3. Alpha-activity of both extracted products was determined in liquid scintillation counter. Chemical yield of plutonium counted to 85±10%, that of americium and curium -75±10%. 17 refs

  19. Assessment of radiation doses from residential smoke detectors that contain americium-241

    International Nuclear Information System (INIS)

    External dose equivalents and internal dose commitments were estimated for individuals and populations from annual distribution, use, and disposal of 10 million ionization chamber smoke detectors that contain 110 kBq (3 μCi) americium-241 each. Under exposure scenarios developed for normal distribution, use, and disposal using the best available information, annual external dose equivalents to average individuals were estimated to range from 4 fSv (0.4 prem) to 20 nSv (2 μrem) for total body and from 7 fSv to 40 nSv for bone. Internal dose commitments to individuals under post disposal scenarios were estimated to range from 0.006 to 80 μSv (0.0006 to 8 mrem) to total body and from 0.06 to 800 μSv to bone. The total collective dose (the sum of external dose equivalents and 50-year internal dose commitments) for all individuals involved with distribution, use, or disposal of 10 million smoke detectors was estimated

  20. NMR Evidence for the 8.5 K Phase Transition in Americium Dioxide

    Science.gov (United States)

    Tokunaga, Yo; Nishi, Tsuyoshi; Kambe, Shinsaku; Nakada, Masami; Itoh, Akinori; Homma, Yoshiya; Sakai, Hironori; Chudo, Hiroyuki

    2010-05-01

    We report here the first NMR study of americium dioxide (AmO2). More than 30 years ago, a phase transition was suggested to occur in this compound at 8.5 K based on magnetic susceptibility data, while no evidence had been obtained from microscopic measurements. We have prepared a powder sample of 243AmO2 containing 90 at. % 17O and have performed 17O NMR at temperatures ranging from 1.5 to 200 K. After a sudden drop of the 17O NMR signal intensity below 8.5 K, at 1.5 K we have observed an extremely broad spectrum covering a range of ˜14 kOe in applied field. These data provide the first microscopic evidence for a phase transition as a bulk property in this system. In addition, the 17O NMR spectrum has been found to split into two peaks in the paramagnetic state, an effect which has not been reported for actinide dioxides studied up to now. We suggest that the splitting is induced by self-radiation damage from the alpha decay of 243Am.

  1. Study of biosorbents application on the treatment of radioactive liquid wastes with americium-241

    International Nuclear Information System (INIS)

    The use of nuclear energy for many different purposes has been intensified and highlighted by the benefits that it provides. Medical diagnosis and therapy, agriculture, industry and electricity generation are examples of its application. However, nuclear energy generates radioactive wastes that require suitable treatment ensuring life and environmental safety. Biosorption and bioaccumulation represent an emergent alternative for the treatment of radioactive liquid wastes, providing volume reduction and physical state change. This work aimed to study biosorbents for the treatment of radioactive liquid wastes contaminated with americium-241 in order to reduce the volume and change the physical state from liquid to solid. The biosorbents evaluated were Saccharomyces cerevisiae immobilized in calcium alginate beads, inactivated and free cells of Saccharomyces cerevisiae, calcium alginate beads, Bacillus subtilis, Cupriavidus metallidurans and Ochrobactrum anthropi. The results were quite satisfactory, achieving 100% in some cases. The technique presented in this work may be useful and viable for implementing at the Waste Management Laboratory of IPEN - CNEN/SP in short term, since it is an easy and low cost method. (author)

  2. In Vitro Dissolution Tests of Plutonium and Americium Containing Contamination Originating From ZPPR Fuel Plates

    Energy Technology Data Exchange (ETDEWEB)

    William F. Bauer; Brian K. Schuetz; Gary M. Huestis; Thomas B. Lints; Brian K. Harris; R. Duane Ball; Gracy Elias

    2012-09-01

    Assessing the extent of internal dose is of concern whenever workers are exposed to airborne radionuclides or other contaminants. Internal dose determinations depend upon a reasonable estimate of the expected biological half-life of the contaminants in the respiratory tract. One issue with refractory elements is determining the dissolution rate of the element. Actinides such as plutonium (Pu) and Americium (Am) tend to be very refractory and can have biological half-lives of tens of years. In the event of an exposure, the dissolution rates of the radionuclides of interest needs to be assessed in order to assign the proper internal dose estimates. During the November 2011 incident at the Idaho National Laboratory (INL) involving a ZPPR fuel plate, air filters in a constant air monitor (CAM) and a giraffe filter apparatus captured airborne particulate matter. These filters were used in dissolution rate experiments to determine the apparent dissolution half-life of Pu and Am in simulated biological fluids. This report describes these experiments and the results. The dissolution rates were found to follow a three term exponential decay equation. Differences were noted depending upon the nature of the biological fluid simulant. Overall, greater than 95% of the Pu and 93% of the Am were in a very slow dissolving component with dissolution half-lives of over 10 years.

  3. Solution speciation of plutonium and Americium at an Australian legacy radioactive waste disposal site.

    Science.gov (United States)

    Ikeda-Ohno, Atsushi; Harrison, Jennifer J; Thiruvoth, Sangeeth; Wilsher, Kerry; Wong, Henri K Y; Johansen, Mathew P; Waite, T David; Payne, Timothy E

    2014-09-01

    During the 1960s, radioactive waste containing small amounts of plutonium (Pu) and americium (Am) was disposed in shallow trenches at the Little Forest Burial Ground (LFBG), located near the southern suburbs of Sydney, Australia. Because of periodic saturation and overflowing of the former disposal trenches, Pu and Am have been transferred from the buried wastes into the surrounding surface soils. The presence of readily detected amounts of Pu and Am in the trench waters provides a unique opportunity to study their aqueous speciation under environmentally relevant conditions. This study aims to comprehensively investigate the chemical speciation of Pu and Am in the trench water by combining fluoride coprecipitation, solvent extraction, particle size fractionation, and thermochemical modeling. The predominant oxidation states of dissolved Pu and Am species were found to be Pu(IV) and Am(III), and large proportions of both actinides (Pu, 97.7%; Am, 86.8%) were associated with mobile colloids in the submicron size range. On the basis of this information, possible management options are assessed. PMID:25126837

  4. Comparative study of plutonium and americium bioaccumulation from two marine sediments contaminated in the natural environment

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T.F.; Smith, J.D. (Melbourne Univ., Parkville (Australia). Dept. of Inorganic Chemistry); Fowler, S.W.; LaRosa, J.; Holm, E. (International Atomic Energy Agency, Monaco-Ville (Monaco). Lab. of Marine Radioactivity); Aarkrog, A.; Dahlgaard, H. (Risoe National Lab., Roskilde (Denmark))

    1991-01-01

    Plutonium and americium sediment-animal transfer was studied under controlled laboratory conditions by exposure of the benthic polychaete Nereis diversicolor (O. F. Mueller) to marine sediments contaminated by a nuclear bomb accident (near Thule, Greenland) and nuclear weapons testing (Enewetak Atoll). In both sediment regimes, the bioavailability of plutonium and {sup 241}Am was low, with specific activity in the tissues <1% (dry wt) than in the sediments. Over the first three months, a slight preference in transfer of plutonium over {sup 241}Am occurred and {sup 241}Am uptake from the Thule sediment was enhanced compared to that from lagoon sediments of Enewetak Atoll. Autoradiography studies indicated the presence of hot particles of plutonium in the sediments. The results highlight the importance of purging animals of their gut contents in order to obtain accurate estimates of transuranic transfer from ingested sediments into tissue. It is further suggested that enhanced transuranic uptake by some benthic species could arise from ingestion of highly activity particles and organic-rich detritus present in the sediments. (author).

  5. Pu-238 assay performance with the Canberra IQ3 system

    International Nuclear Information System (INIS)

    Canberra Industries has recently completed a demonstration project at the Westinghouse Savannah River Site (WSRC) to characterize 55-gallon drums containing Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 waste to detection limits of less than 50 nCi/g using gamma assay techniques. This would permit reclassification of these drums from transuranic (TRU) waste to low-level waste (LLW). The instrument used for this assay was a Canberra IQ3 high sensitivity gamma assay system, mounted in a trailer. The results of the measurements demonstrate achievement of detection levels as low as 1 nCi/g for low density waste drums, and good correlation with known concentrations in several test drums. In addition, the data demonstrates significant advantages for using large area low-energy germanium detectors for achieving the lowest possible MDAs for gamma rays in the 80-250 keV range. 1 fig., 2 tabs

  6. Pu-238 assay performance with the Canberra IQ3 system

    Energy Technology Data Exchange (ETDEWEB)

    Booth, L.; Gillespie, B.; Seaman, G.

    1997-11-01

    Canberra Industries has recently completed a demonstration project at the Westinghouse Savannah River Site (WSRC) to characterize 55-gallon drums containing Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 contaminated waste. The goal of this project was to detect and quantify Pu-238 waste to detection limits of less than 50 nCi/g using gamma assay techniques. This would permit reclassification of these drums from transuranic (TRU) waste to low-level waste (LLW). The instrument used for this assay was a Canberra IQ3 high sensitivity gamma assay system, mounted in a trailer. The results of the measurements demonstrate achievement of detection levels as low as 1 nCi/g for low density waste drums, and good correlation with known concentrations in several test drums. In addition, the data demonstrates significant advantages for using large area low-energy germanium detectors for achieving the lowest possible MDAs for gamma rays in the 80-250 keV range. 1 fig., 2 tabs.

  7. Polonium 210Po, uranium (234U, 238U and plutonium (238Pu, 239+240Pu bioaccumulation in marine birds

    Directory of Open Access Journals (Sweden)

    Strumińska-Parulska D. I.

    2013-04-01

    Full Text Available The aim of this work was the determination of 210Po, 234U, 238U, 238Pu and 239+240Pu concentration in marine birds which permanently or temporally live in the southern Baltic Sea coast. We chose 11 species of seabirds: three species permanently residing at southern Baltic Sea, four species of wintering birds and three species of migrating birds. The results show that analyzed radionuclides are non-uniformly distributed in the marine birds. The highest activities of 210Po were observed in feathers, muscles and liver. The highest uranium content was found in liver, rest of viscera and feathers, while plutonium in the digestion organs and feathers. Omnivore seabirds accumulated more polonium, plutonium than species that feed on fish, while herbivore seabirds accumulated more uranium than carnivore.

  8. Radiochemical measurements of the formation cross sections of actinide isotopes in the reaction of 238U ions with 238U

    International Nuclear Information System (INIS)

    The method of high-pressure liquid chromatography was used to separate metal cations and anions. Thereby the influence of different parameters on the separation of lanthanides by cation exchange and extraction chromatography was systematically investigated. The results were used to optimize that separation cycle, in which the elements from Z = 26 to Z = 101 were separated taking into account especially the group of actinides. These separations and the subsequent spectroscopy of gamma radiation, alpha particles and spontaneous fission fragments were used to determine formation cross sections in heavy ion reactions as a function of the atomic charge and the mass number. The most important point was the investigation of the collision of 238U ions at different bombarding energies. On the basis of the measured formation cross sections conclusions can be drawn on the reaction mechanism and the excitation function of the formation of transplutonium elements. According to the results it seems to be reasonable to use transfer reactions between 238U and 238U or 248Cm to synthesize superheavy nuclei around Z = 114. Until now that has been tried only with the help of fusion reactions and the results were negative. (orig.)

  9. Use of radioisotopes in the study of tetracycline analytical application. Extraction of compounds formed between tetracycline and neptunium and americium elements

    International Nuclear Information System (INIS)

    The behavior of tetracycline as complexing agent, in solvent extraction studies of neptunium and americium, using benzyl alcohol as the organic phase, is presented. By using radioactive tracers of 239Np and 241Am the extraction percent of these elements were determined as a function of pH in the absence and in the presence of several masking agents. The influence of shaking time and the use of different types of supporting eletrolytes upon the extraction behavior was also studied. The extraction curves obtained using EDTA as masking agent show that tetracycline can be used for neptunium and americium separation. In this condition neptunium is extracted into the organic phase and americium remains in the aqueous phase. (Author)

  10. Sorption of plutonium and americium on repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura

    International Nuclear Information System (INIS)

    An integrated program of batch sorption experiments and mathematical modeling has been carried out to study the sorption of plutonium and americium on a series of repository, backfill and geological materials relevant to the JNFL low-level radioactive waste repository at Rokkasho-Mura. The sorption of plutonium and americium on samples of concrete, mortar, sand/bentonite, tuff, sandstone and cover soil has been investigated. In addition, specimens of bitumen, cation and anion exchange resins, and polyester were chemically degraded. The resulting degradation product solutions, alongside solutions of humic and isosaccharinic acids were used to study the effects on plutonium sorption onto concrete, sand/bentonite and sandstone. The sorption behavior of plutonium and americium has been modeled using the geochemical speciation program HARPHRQ in conjunction with the HATCHES database

  11. Geographic and vertical distribution of global fallout americium 241, plutonium isotopes and cesium 137 in lake sediments

    International Nuclear Information System (INIS)

    In this study, we present results concerning the activity concentrations of 241Am, 239-240Pu, 238Pu and 137Cs in lake sediments. Bulk cores for radionuclide inventories and high resolution cores for depth distribution are analysed

  12. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  13. Some elements for a revision of the americium reference biokinetic model

    International Nuclear Information System (INIS)

    The interpretation of individual activity measurement after a contamination by 241Am or its parent nuclide 241Pu is based on the reference americium (Am) biokinetic model published by the International Commission on Radiological Protection in 1993 [International Commission on Radiological Protection. Age-dependent doses to members of the public from intake of radionuclides: Part 2 Ingestion dose coefficients. ICRP Publication 67. Ann. ICRP 23(3/4) (1993)]. The authors analysed the new data about Am biokinetics reported afterwards to propose an update of the current model. The most interesting results, from the United States Transuranium and Uranium Registries post-mortem measurement database [Filipy, R. E. and Russel, J. J. The United States Transuranium and Uranium Registries as sources for actinide dosimetry and bio-effects. Radiat. Prot. Dosim. 105(1-4), 185-187 (2003)] and the long-term follow-up of cases of inhalation intake [Malatova, I., Foltanova, S., Beckova, V., Filgas, R., Pospisilova, H. and Hoelgye, Z. Assessment of occupational doses from internal contamination with 241Am. Radiat. Prot. Dosim. 105(1-4), 325-328 (2003)], seemed to show that the current model underestimates the retention in the massive soft tissues and overestimates the retention in the skeleton and the late urinary excretion. However, a critical review of the data demonstrated that all were not equally reliable and suggested that only a slight revision of the model, possibly involving a change in the balance of activity between massive soft tissues, cortical and trabecular bone surfaces, may be required. (authors)

  14. The treatment of liquid radioactive waste containing Americium by using a cation exchange method

    International Nuclear Information System (INIS)

    A research in the treatment of a liquid radioactive waste containing americium has been done. The liquid radioactive waste used in this research was standard solution of U dan Ce with the initial activity of 100 ppm. The experimental investigation is aimed at a study of the effects of the waste pH, the column dimension of IR-120 cation exchanger which is expressed as L/D, the flow rate of a liquid waste and the influence of thiocyanate as a complex agent against the efficiency of a decontamination for uranium and cerium element. The experiment was done by passing downward the feed of uranium and cerium solution into an IR-120 type of cation exchanger with the L/D of 11.37. From the experimental parameters done in this research where the influence of waste pH was varied from 3 - 8, the geometric column (L/D) 11.37, the liquid flow rate was from 2.5 - 10 ml/m and the thiocyanate concentration was between 100 ppm-500 ppm can be concluded that the optimum operational condition for the ion exchange achieved were the waste pH for uranium = 4 and the waste pH for cerium = 6, the flow rate = 2.5 ml/men. From the given maximum value of DF for uranium = 24 (DE = 95.83%) and of DF for cerium = 40 (DE = 97.5%), it can also be concluded that this investigation is to be continued in order that the greater value of DF/DE can be achieved

  15. A study of plutonium and americium concentrations in seaspray on the southern Scottish coast

    International Nuclear Information System (INIS)

    Seaspray and seawater have been collected from the southern Scottish coast and, for comparison, Cumbria in northwest England during 1989 and 1991. The occurrence of sea-to-land transfer of the actinides plutonium and americium in seaspray was observed on these coasts using muslin screens (a semi-quantitative technique most efficient for collecting large spray droplets) and high volume conventional air samplers. The actinides and fine particulate in the spray were present in relatively higher concentrations than measured in the adjacent seawater, i.e. the spray was enriched in particulate actinides. The net efficiency of the muslim screens in collecting airborne plutonium isotopes and 241Am generally appeared to be about 20%. A review of earlier published concentrations of 239+240Pu and 241Am measured in aerosol and deposition for over a year several tens of metres inland was carried out. This suggested that airborne activities are up to a factor of 5 times higher in Cumbria than southern Scotland. However, neither the new data collected in 1989 and 1991 nor this older data suggests any enhancement of seaspray actinide enrichment in southern Scotland compared to Cumbria. This finding contrasts with earlier, more limited, comparisons that have been carried out which suggested such a difference. There is clear evidence of considerable localised spatial and temporal variability in aerosol actinide enrichment over the beaches in both areas. Enrichments varies between 20 and 500 relative to the adjacent surf zone waters. However, the average enrichment in spray based on the continuous measurements made further inland is likely to be at the lower end of this range. (author)

  16. Reduction of. systematic error of In-vivo measurement of americium 241 activity in the skull

    International Nuclear Information System (INIS)

    Excretion analysis and in vivo measuring methods are used for estimation of internal contamination by 241Am. In vivo measurements of the lung are suitable in short time after time of intake when the way of the intake is inhalation. In vivo measurements of the activity in the liver or in the skeleton could be performed at a later time. Detection of radionuclide activity in the liver is quite difficult because it is necessary to distinguish liver activity from the activity of surrounding tissues i.e. lung and skeleton. The skull or knees are the most suitable., for activity assessment in the skeleton. The skull is the most appropriate for measurements because it represents about 15% of total skeleton mass and contributions to measured activity of surrounding tissues are small. Americium activity in the skull could be measured with different instrumentation and in various geometries. Setting of two semiconductors detectors placed 3 cm over temporal region of the skull is used in NRPI. Calibration of the system was done by several head phantoms, in this process was observed that detection efficiencies depend on size of the phantoms. The aim of the paper is to express character of the efficiency as function of the size of skull in order to obtain more accurate value of the activity and decrees its uncertainty. Simulations of head by simplified geometric shapes, i.e. spheres and rotary ellipsoids, is in coherence with phantoms of big size (UCIN, BPAM-0001), but for small phantoms occurred quite serious discrepancy. Activity of real cases determined by calibration with phantom BPAM-0001 (reference phantom) is reduced from 9 to 44 %, when eq. 2 is used and relative uncertainty is reduced from 32% to maximum 12%. (authors)

  17. Transport of plutonium, americium, and curium from soils into plants by roots

    International Nuclear Information System (INIS)

    For assessing the dose from radionuclides in agricultural products by ingestion it is necessary to know the soil to plant transfer factors. The literature was entirely investigated, in order to judge the size of the soil to plant transfer factors. In total, 92 publications - from 1948 to 1978 -have been evaluated. As result, transfer factors from 10-9 to 10-3 have been found for Plutonium, and from 10-6 to 1 for Americium. For Curium only few data are available in literature. The considerable variation of the measured transfer factors is based on the dependence of these transfer factors from the ion exchange capacity of soils, from the amount of organic materials, from the pH-value, and from the mode of contamination. There are, in any case, contradictory data, although there has been detected a dependence of the transfer factors from these parameters. Chelating agenst increase the transfer factors to approximately 1300. As well, fertilizers have an influence on the size of the transfer factors - however, the relationships have been scarcely investigated. The distribution of actinides within the individual parts of plants has been investigated. The highest concentrations are in the roots; in the plant parts above ground the concentration of actinides decreases considerably. The most inferior transfer factors were measured for the respective seed or fruits. The soil to plant transfer factors of actinides are more dependend on the age of the plants within one growing period. At the beginning of the period, the transfer factor is considerably higher than at the end of this period. With respect to plants with a growing period of several years, correlations are unknown. (orig.)

  18. Phosphate fertilizer influence on {sup 238} U content in vegetables

    Energy Technology Data Exchange (ETDEWEB)

    Lauria D, C.; Rodrigues S, J.I. [Instituto de Radioprotecao e Dosimetria (IRD/CNEN), Av. Salvador Allende s/n, Rio de Janeiro-RJ (Brazil); Ribeiro, F.C.A. [Centro Regional de Ciencias Nucleares (CRCN/CNEN) Av. Prof. Luiz Freire 200 Cidade Universitaria Recife-PE (Brazil)]. e-mail: dejanira@ird.gov.br

    2006-07-01

    Uranium is a naturally radioactive element, which is usually found in soils, superficial and ground water, vegetables and animals. After ingestion by human beings, most is excreted in few days by feces and urine, without reaching the bloodstream. However, a small part circulates through the body, being accumulated in the soft tissues, as kidneys. A minor fraction can remain in bones per some years, being able through the radioactive decay to irradiate adjacent tissues. Phosphate fertilizers used in conventional crop management can present variable amounts of uranium. In accordance with origin and use, the fertilizer can raise the content of this element in vegetables, and consequently to increase the human exposure for radiation due the consumption of vegetables. It is estimated that the use of phosphate fertilizer has at least doubled the prolonged exposure of humans from ingestion of food. This work aims to evaluate the contribution of organic and chemical fertilizer on the concentration of {sup 238} U in vegetable samples. An experiment with black beans (a very important vegetable for Brazilian people) was conducted in a field which soil has never been fertilized with any sort of fertilizer, located near to the Rio de Janeiro city. On the organic management, bovine manure was used, while on conventional management urea, potassium chloride and superphosphate were used. Simultaneously, black bean samples from not fertilized management were collected. In addition, lettuce and carrot samples from organic and conventional managements were collected in Nova Friburgo farms (the most important vegetable supplier of Rio de Janeiro city market). The analyses of {sup 238} U have been carried out by conventional fluorimetric method. The geometric mean of {sup 238} U concentrations in the carrot and lettuce samples from conventional management were similar with those from organic management, while for beans the conventional samples had higher values than those ones found in

  19. Phosphate fertilizer influence on 238 U content in vegetables

    International Nuclear Information System (INIS)

    Uranium is a naturally radioactive element, which is usually found in soils, superficial and ground water, vegetables and animals. After ingestion by human beings, most is excreted in few days by feces and urine, without reaching the bloodstream. However, a small part circulates through the body, being accumulated in the soft tissues, as kidneys. A minor fraction can remain in bones per some years, being able through the radioactive decay to irradiate adjacent tissues. Phosphate fertilizers used in conventional crop management can present variable amounts of uranium. In accordance with origin and use, the fertilizer can raise the content of this element in vegetables, and consequently to increase the human exposure for radiation due the consumption of vegetables. It is estimated that the use of phosphate fertilizer has at least doubled the prolonged exposure of humans from ingestion of food. This work aims to evaluate the contribution of organic and chemical fertilizer on the concentration of 238 U in vegetable samples. An experiment with black beans (a very important vegetable for Brazilian people) was conducted in a field which soil has never been fertilized with any sort of fertilizer, located near to the Rio de Janeiro city. On the organic management, bovine manure was used, while on conventional management urea, potassium chloride and superphosphate were used. Simultaneously, black bean samples from not fertilized management were collected. In addition, lettuce and carrot samples from organic and conventional managements were collected in Nova Friburgo farms (the most important vegetable supplier of Rio de Janeiro city market). The analyses of 238 U have been carried out by conventional fluorimetric method. The geometric mean of 238 U concentrations in the carrot and lettuce samples from conventional management were similar with those from organic management, while for beans the conventional samples had higher values than those ones found in organic management

  20. Inert matrices, uranium-free plutonium fuels and americium targets. Synthesis of CAPRA, SPIN and EFTTRA studies

    International Nuclear Information System (INIS)

    A first selection of inert-matrix materials, actinide support alone (Pu and Am based), and compound materials, U free plutonium burning fuels and heterogeneous americium targets are discussed. Basic properties, fabrication, and reprocessing studies, European in-pile and out-of-pile tests, performed recently in the framework of CAPRA, SPIN and EFTTRA programs, are reviewed here. Taking into account these studies and on the bases of the different requirements to be met in each of the fuels and targets, a number of materials have been selected as 'promising candidates'. Trends for further research on these materials are established. (author)

  1. Final Report on the Demonstration of Disposal of Americium and Curium Legacy Material Through the High Level Waste System

    International Nuclear Information System (INIS)

    This report provides the results of experimental demonstrations related to processing of a legacy solution containing americium and curium through the High Level Waste (HLW) system. The testing included eight experiments covering the baseline, mitigation, and enhanced nitrate processing studies. In general, each experiment studied the mixtures generated over a period of time to emulate the lifecycle of actual sludge in the High Level Waste system. While the data in previous reports remain valid, this report supercedes all the previous reports and provides a collective overview of the work

  2. Effect of a long-term release of plutonium and americium into an estuarine and coastal sea ecosystem

    International Nuclear Information System (INIS)

    This paper discusses the general problem of speciation of plutonium and americium in aquatic ecosystems and the implications relative to their fate in those systems. The following conclusions were reached: several oxidation states of plutonium coexist in the natural environment; the effect of environmental changes such as pH and Esub(h) values and complexes are probably the cause of these various oxidation states; a clearer definition of the 'concentration factor' should be given in view of the important role the sediments play in supplying plutonium for transfer through the food web. (author)

  3. Microstructure and elemental distribution of americium-containing MOX fuel under the short-term irradiation tests

    International Nuclear Information System (INIS)

    In order to investigate the effect of americium addition to MOX fuels on the irradiation behavior, the 'Am-1' program is being conducted in JAEA. The Am-1 program consists of two short-term irradiation tests of 10-minute and 24-hour irradiations and a steady-state irradiation test. The short-term irradiation tests were successfully completed and the post irradiation examinations (PIEs) are in progress. The PIEs for Am-containing MOX fuels focused on the microstructural evolution and redistribution behavior of Am at the initial stage of irradiation and the results to date are reported. (author)

  4. Neutron Induced Capture and Fission Processes on 238U

    OpenAIRE

    Oprea Cristiana; Oprea Alexandru

    2016-01-01

    Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit – Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present...

  5. Dicty_cDB: SLD238 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Value N ( AU052389 ) Dictyostelium discoideum slug cDNA, clone SLD238. 533 e-156... 2 ( AU052473 ) Dictyostelium discoideum slug cDNA, clone SLD384. 533 e-156 2 ( AU053348 ) Dictyostelium discoideum slug... cDNA, clone SLI436. 533 e-156 2 ( AU052949 ) Dictyostelium discoideum slug cDNA, clone SLF368. ...533 e-156 2 ( AU033974 ) Dictyostelium discoideum slug cDNA, clone SLB679. 533 e-...156 2 ( AU052416 ) Dictyostelium discoideum slug cDNA, clone SLD280. 533 e-156 2 ( AU052488 ) Dictyostelium discoideum slug

  6. Evaluation of the 238U neutron total cross section

    International Nuclear Information System (INIS)

    Experimental energy-averaged neutron total cross sections of 238U were evaluated from 0.044 to 20.0 MeV using regorous numerical methods. The evaluated results are presented together with the associated uncertainties and correlation matrix. They indicate that this energy-averaged neutron total cross section is known to better than 1% over wide energy regions. There are somwewhat larger uncertainties at low energies (e.g., less than or equal to 0.2 MeV), near 8 MeV and above 15 MeV. The present evaluation is compard with values given in ENDF/B-V

  7. Database for 238U inelastic scattering cross section evaluation

    International Nuclear Information System (INIS)

    There are discrepancies among evaluated neutron inelastic scattering cross sections for 238U in the evaluated nuclear data files, JENDL-3, ENDF/B-VI, JEF-2, BROND-2 and CENDL-2. Re-evaluating them is internationally being discussed to obtain the best outcome which can be accepted in common at the present by experts in the world. This report has been compiled to review the discrepancies among the evaluations in the present data files and to provide a common database for the re-evaluation work (author)

  8. Charge-pickup of 238U at relativistic energies

    International Nuclear Information System (INIS)

    Cross sections for the charge-pickup of 238U projectiles were measured at E/A=600 and 1000 MeV for seven different targets (Be, C, Al, Cu, In, Au and U). Events with two fission fragments with a sum charge of 93 in the exit channel were selected. Due to the significant excitation energy, the dominant part of produced Np nuclei fission instead of decaying to the ground state by evaporation. The observed cross sections can be well reproduced by intranuclear-cascade-plus-evaporation calculations and, therefore, confirm recent results that no exotic processes are needed to explain charge-pickup processes. (orig.)

  9. Development of a methodology for the determination of americium and thorium by ICP-AES and their inter-element effect

    International Nuclear Information System (INIS)

    Due to the scarcity of good quality uranium resources, the growth of nuclear technology in India is dependent on the utilization of the vast thorium resources. Therefore, Advance Heavy Water Reactor is going to acquire significant role in the scenario of Indian nuclear technology, where (Th, Pu)O2 will be utilized as fuel in the outermost ring of the reactor core. This will lead to a complex matrix containing thorium as well as americium, which is formed due to β-decay of plutonium. The amount of americium is dependent on the burn up and the storage time of the Pu based fuels. In the present case, attempt was made to develop a method for the determination of americium as well as thorium by ICP-AES. Two emission lines of americium were identified and calibration curves were established for determination of americium. Though the detection limit of 283.236 nm line (5 ng mL-1) of americium was found to be better than that of 408.930 nm (11 ng mL-1), the former line is significantly interfered by large amount of thorium. Three analytical lines (i.e. 283.242, 283.730 and 401.913 nm) of thorium were identified and calibration curves were established along with their detection limits. It was observed that 283.242 and 401.913 nm line are having similar detection limits (18 and 13 ng mL-1, respectively) which are better than that of 283.730 nm (60 ng mL-1). This can be attributed to the high background of 283.273 nm channel of thorium. The spectral interference study revealed that even small amount of americium has significant contribution on 283.242 nm channel of thorium while the other two channels remain practically unaffected. Considering both these facts, spectral interference and analytical performance (detection limits and sensitivity), it was concluded that 401.913 nm line is the best analytical line out of the three lines for determination of thorium in presence of americium. (author)

  10. A study on physical characteristics of supercritical light - water reactor loaded with (232U-238Th-238U) oxide fuel

    International Nuclear Information System (INIS)

    The attractiveness of using (U-Th)-fuel in supercritical light water reactor is considered. The dilution of 233U in 238U is proposed with the purpose of increasing non-proliferation of this fissile isotope. Comparison of different fuel compositions is accomplished from the point of view of fissile isotope breeding and achieved burn-up; parasitic neutron absorption cross-sections are also compared. It is analyzed the impact for neutron balance of both cladding materials: zirconium alloy and stainless steel

  11. Intermediate structure in the 238U neutron capture cross section

    International Nuclear Information System (INIS)

    Recent measurements of the 238U neutron capture cross section show large fluctuations in the unresolved resonance region. To test whether or not the observed long-range fluctuation of the neutron capture represent departures from the compound nuclear model, the Wald-Wolfowitz runs and correlation tests were applied to the 238U neutron capture data obtained at ORELA. The Wald-Wolfowitz runs test deals with the statistic, R, which is the number of unbroken sequences of data points above or below a given reference line. This statistic is to be compared with the expected value of runs E(R) +- sigma(R) arising from randomly distributed data. In the correlation test we have computed the first serial correlation coefficient of the data as well as its expected value and variance for a set of random data. In both tests one computes the probability, P, for the given statistical entity to depart from its expected value by more than epsilon standard deviations. Both tests confirm the presence of intermediate structure between 5 and 100 keV. The range of the structure far exceeds the width of the experimental resolution and level widths. 3 tables, 2 figures

  12. Effect of radiolysis on leachability of plutonium and americium from 76-101 glass. [Glass containing 2 mole % plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Nash, K.L.; Fried, S.; Friedman, A.M.; Susak, N.; Rickert, P.; Sullivan, J.C.; Karim, D.P.; Lam, D.J.

    1982-01-01

    One aspect of the leachability of actinide-bearing glass which has not been adequately addressed is the effect of radiolysis of the system (glass-water) on the amount of actinides liberated from the glass. In the present study, we have investigated the leaching of plutonium and americium from 76-101 glass samples (containing 2 mole % plutonium) in the presence of a one megaRad/hour gamma-radiation field. The presence of the radiation field was found to increase the leaching rate of both plutonium and americium by a factor of five. Speciation studies of the plutonium in the leachate indicate that the plutonium is present predominantly in the higher oxidation states, Pu(V) and Pu(VI) and that it is significantly associated with colloidal particles. Examination of the glass surfaces with x-ray photoemission spectroscopy, XPS, both before and after leaching was carried out; these studies showed lower surface concentrations of plutonium in the samples of glass leached in the radiation field. 1 figure, 3 tables.

  13. Osteosarcoma induction by plutonium-239, americium-241 and neptunium-237 : the problem of deriving risk estimates for man

    International Nuclear Information System (INIS)

    Spontaneous bone cancer (osteosarcoma) represents only about 0.3% of all human cancers, but is well known to be inducible in humans by internal contamination with radium-226 and radium-224. plutonium-239, americium-241 and neptunium-237 form, or will form, the principal long-lived alpha particle emitting components of high activity waste and burnt-up nuclear fuel elements. These three nuclides deposit extensively in human bone and although, fortunately, no case of a human osteosarcoma induced by any of these nuclides is known, evidence from animal studies suggests that all three are more effective than radium-226 in inducing osteosarcoma. The assumption that the ratio of the risk factors, the number of osteosarcoma expected per 10000 person/animal Gy, for radium-226 and any other bone-seeking alpha-emitter will be independent of animal species has formed the basis of all the important studies of the radiotoxicity of actinide nuclides in experimental animals. The aim of this communication is to review the risk factors which may be calculated from the various animal studies carried out over the last thirty years with plutonium-237, americium-241 and neptunium-237 and to consider the problems which may arise in extrapolating these risk factors to homo sapiens

  14. 238UF6 and 235UF6 spectra measurement in mid IR spectral range

    International Nuclear Information System (INIS)

    Making use of a diode laser one measured the absorption spectra of 238UF6 and 235UF6 molecules within v1+v3 combined oscillation band at λ=7.68 μm wavelength. To determine the possibility to measure 235UF6/ 238UF6 isotope ratio with the required accuracy one measured the absorption factors of 235UF6 and 238UF6 isotope specimens and determined the sources of the errors and the ways to minimize them

  15. The production of unknown neutron-rich isotopes in $^{238}$U+$^{238}$U collisions at near-barrier energy

    CERN Document Server

    Zhao, Kai; Zhang, Yingxun; Wang, Ning; Li, Qingfeng; Shen, Caiwan; Wang, Yongjia; Wu, Xizhen

    2016-01-01

    The production cross sections for primary and residual fragments with charge number from $Z$=70 to 120 produced in the collision of $^{238}$U+$^{238}$U at 7.0 MeV/nucleon are calculated by the improved quantum molecular dynamics (ImQMD) model incorporated with the statistical evaporation model (HIVAP code). The calculation results predict that about sixty unknown neutron-rich isotopes from element Ra ($Z$=88) to Db ($Z$=105) can be produced with the production cross sections above the lower bound of $10^{-8}$ mb in this reaction. And almost all of unknown neutron-rich isotopes are emitted at the laboratory angles $\\theta_{lab}\\leq$ 60$^\\circ$. Two cases, i.e. the production of the unknown uranium isotopes with $A\\geq$ 244 and that of rutherfordium with $A\\geq$ 269 are investigated for understanding the production mechanism of unknown neutron-rich isotopes. It is found that for the former case the collision time between two uranium nuclei is shorter and the primary fragments producing the residues have smaller...

  16. National low-level waste management program radionuclide report series, Volume 15: Uranium-238

    International Nuclear Information System (INIS)

    This report, Volume 15 of the National Low-Level Waste Management Program Radionuclide Report Series, discusses the radiological and chemical characteristics of uranium-238 (238U). The purpose of the National Low-Level Waste Management Program Radionuclide Report Series is to provide information to state representatives and developers of low-level radioactive waste disposal facilities about the radiological, chemical, and physical characteristics of selected radionuclides and their behavior in the waste disposal facility environment. This report also includes discussions about waste types and forms in which 238U can be found, and 238U behavior in the environment and in the human body

  17. Some physico-chemical and radiation properties of plutonium-238 metal prepared by electrochemical amalgamation

    International Nuclear Information System (INIS)

    Pu-238 metal was prepared by electrolytic amalgamation from Pu(III) acetate aqueous solution and by followed by the thermal decomposition of the Pu amalgam. The density, specific heat power, γ-spectra, neutron flux, and corrosion kinetics in dry air at ambient temperature of the prepared 238Pu metal were measured. The neutron flux and γ-spectra from 238Pu metal have been attributed to spontaneous and induced fission and to (α,α'γ), (α,pγ), and (α,nγ) nuclear reactions on light nuclei. The electrochemically prepared 238Pu metal was shown to generate fewer neutrons, produce less gamma radiation, and contains lower 10B, 19F, and 28Si impurities in comparison with biomedical 238PuO2. The increase of neutron flux from the sample due to the reaction 18O(α,nγ) 21Ne was shown to be proportional to the increase of the mass of the 238Pu metal with time due to corrosion in dry air. 238Pu metal corrosion rate maximum and average values (1.1 x 10-2 and 4.7 x 10-3 mg cm-2 h-1, respectively) obtained in dry air were an order of magnitude higher than the rates published for 239Pu under similar experiment conditions. The difference between the 239Pu and 238Pu metal corrosion rate and mechanism is proposed to be due to the greater radiation effects and temperature on the 238Pu surface

  18. Radioactive secular equilibrium in 238U and 232Th series in granitoids from Greece

    International Nuclear Information System (INIS)

    Granitoid rocks belonging to plutons of Greece, covering a wide range of compositions and rock-types, have been studied for their specific activity (Bq/kg) of 238U and 226Ra from 238U radioactive series and 228Ra and 228Th from 232Th radioactive series by using gamma-ray spectroscopy. Results on the radioactive secular equilibrium of both 238U and 232Th radioactive series are presented by studying the 226Ra/238U and 228Ra/228Th ratios. The majority of the samples are in radioactive secular equilibrium for 226Ra/238U±1σ. However, several samples exhibit 226Ra/238U ratios significantly different from 1. The distortion of the secular equilibrium in the 226Ra–238U isotopic system of those samples has occurred over the last 1 Ma, and can be associated with post-magmatic processes, mainly rock–water interactions. All studied samples have 228Ra/228Th ratios equal to unity ±1σ. Consequently, they can be considered to be in secular equilibrium for the last 40 a. - Highlights: ► Generally, a strong correlation between 238U and 226Ra is obvious. ► Post-magmatic processes caused radioactive disequilibrium in the 238U isotopic system. ► All samples are in radioactive secular equilibrium in the 232Τh isotopic system. ► There is no correlation between mineralogy, texture, colour, age and the isotopic ratios studied

  19. Dose effect for South Serbians due to {sup 238}U in natural drinking water

    Energy Technology Data Exchange (ETDEWEB)

    Sahoo, S.K.; Matsumoto, M.; Shiraishi, K.; Fujimoto, K. [Department of Radiation Dosimetry, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan); Cuknic, O.; Zunic, Z.S. [Institute of Nuclear Sciences, VINCA, PO Box 522, 11001 Belgrade (Serbia)

    2007-07-01

    The use of depleted uranium ammunition in South Serbia during the 1999 Kosovo conflict raised a great deal of public concern in the Balkans. Radioactivity levels of {sup 238}U in 20 wells and lake water samples were checked from the viewpoint of internal radiation exposure for South Serbian subjects. We have measured {sup 238}U concentration using inductively coupled plasma mass spectrometry, whereas thermal ionisation mass spectrometry has been used for the measurement of isotope ratios, e.g. {sup 234}U/{sup 238}U and {sup 235}U/{sup 238}U. The concentration of uranium in water samples varies in the range 1.37-63.18 mBq/L. {sup 234}U belongs to the {sup 238}U natural radioactive decay series, and at secular equilibrium, the abundance ratio, {sup 234}U/{sup 238}U, corresponds to the ratio of their half-lives. The {sup 234}U/{sup 238}U activity ratio varies in the range 0.88-2.2 and {sup 235}U/{sup 238}U isotope ratio varies from 0.00698 to 0.00745. These findings indicate that uranium in water was a mixture of natural and anthropogenic origin. The annual effective dose due to {sup 238}U was estimated to be in the range 9.2 x 10{sup -5} - 2.1 x 10{sup -3} mSv. (authors)

  20. Experimental Study on Behavior of Americium in Pyrochemical Process of Nitride Fuel Cycle

    International Nuclear Information System (INIS)

    R and D on the transmutation of long-lived minor actinides (MA) by the accelerator-driven system (ADS) using nitride fuels is underway at JAEA. In regard to reprocessing technology, pyrochemical process has several advantages in case of treating spent fuel with large decay heat and fast neutron emission, and recovering highly enriched N-15. In the pyrochemical reprocessing, plutonium and MA are dissolved in LiCl-KCl eutectic melts and selectively recovered into liquid cadmium (Cd) cathode by molten salt electrorefining. The electrochemical behavior in LiCl-KCl eutectic melts and the subsequent nitride formation behavior of plutonium and MA recovered in liquid Cd cathode are investigated. In this paper, recent results on electrochemical study of americium (Am) on electrolyses of AmN in LiCl-KCl eutectic melts and nitride formation of Am recovered in the liquid Cd cathode are presented. Electrochemical behavior of Am on anodic dissolution of AmN and recovery of Am into a liquid Cd cathode by electrolyses in LiCl-KCl eutectic melts was investigated by transient electrochemical techniques. The formal standard potential of Am(III)/Am(0) obtained with the liquid Cd electrode is more positive than that calculated for the solid metal electrode. The potential shift is considered to be attributed to the lowering of the activity of Am by the formation of the intermetallic compound with Cd. Potentiostatic electrolyses of AmN in LiCl-KCl eutectic melts containing AmCl3 at 773 K were carried out. Nitrogen gas generated by the anodic dissolution of AmN was observed, and the current efficiency was obtained from the ratio of the amount of released nitrogen gas and the passed electric charge to be 20 - 28 %. Am was recovered as Am-Cd alloy in the liquid Cd cathode, in which AmCd6 type phase was identified besides Cd phase. The recovered Am was converted to AmN by the nitridation-distillation combined method, in which the Am-Cd alloy was heated in nitrogen gas stream at 973 K. These

  1. 40K, 137Cs, 90Sr, 238,239+240Pu and 241Am in mammals' skulls from owls' pellets and owl skeletons in Poland

    International Nuclear Information System (INIS)

    Skulls of small mammals belonging to two species of rodents and three species of insectivores collected in Eastern Poland were the subject of the present investigation. The skulls were separated from owl pellets. Activities of 40K, 137Cs, 90Sr, 238,239+240Pu and 241Am were determined by means of gamma spectrometry as well as liquid scintillation spectrometry or alpha spectrometry along with relevant radiochemical procedures. A detailed description of the procedures is provided. The research was supplied with the analysis of three skeletons of owls. No measurable difference between the skulls of rodents and insectivorous animals with regard to activity of any of the examined radionuclides was found. No accumulation effect in the owl skeletons was detected. Though measured activities of 137Cs and 40K for the skulls were of the same magnitude as those found previously for large wild herbivorous animals from typical locations in Poland, those for 90Sr were even lower than previously determined. A big difference was found for activities of plutonium and americium isotopes. Their mean activities were higher by an order of magnitude when compared to the examined previously values. The maximum 239+240Pu activity was equal to 97.5±7.7 mBq/kg, with 65% of it originating from global fallout. Relatively high content of transuranic elements found for rodents and insectivorous mammals seems to be unrelated to their feeding habits and should rather be attributed to the living conditions. It is suggested that small mammals, together with tiny soil particles present in mid-soil living tunnels, can inhale the transuranic elements

  2. Preconcentration of low levels of americium and plutonium from waste waters by synthetic water-soluble metal-binding polymers with ultrafiltration

    International Nuclear Information System (INIS)

    A preconcentration approach to assist in the measurement of low levels of americium and plutonium in waste waters has been developed based on the concept of using water-soluble metal-binding polymers in combination with ultrafiltration. The method has been optimized to give over 90% recovery and accountability from actual waste water. (author)

  3. Neutron Induced Capture and Fission Processes on 238U

    Directory of Open Access Journals (Sweden)

    Oprea Cristiana

    2016-01-01

    Full Text Available Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit – Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present evaluations are necessary in order to obtain the field of neutrons in the design of nuclear reactors and they are compared with experimental data from literature obtained from capture and (n,xn processes.

  4. Neutron Induced Capture and Fission Processes on 238U

    Science.gov (United States)

    Oprea, Cristiana; Oprea, Alexandru

    2016-03-01

    Nuclear data on Uranium isotopes are of crucial interest for new generation of nuclear reactors. Processes of interest are the nuclear reactions induced by neutrons and in this work mainly the capture and the fission process on 238U will be analyzed in a wide energy interval. For slow and resonant neutrons the many levels Breit - Wigner formalism is necessary. In the case of fast and very fast neutrons up to 200 MeV the nuclear reaction mechanism implemented in Talys will be used. The present evaluations are necessary in order to obtain the field of neutrons in the design of nuclear reactors and they are compared with experimental data from literature obtained from capture and (n,xn) processes.

  5. Resonant upscattering effects on 238U absorption rates

    International Nuclear Information System (INIS)

    The new requirements of accuracy in reactor physics calculations justify a review of the current models, like that one adopted in the cross-section processing, for a better evaluation of the keff and the resonant absorption rates. In this context, the aim of this paper is to investigate the effects of the free gas kernel developed by Sanchez on the 238U absorption rates. Homogeneous medium tests point out the increase of the absorption rates in the left wing of the resonances due to the upscattering produced by the new kernel. Heterogeneous tests show that the absorption in the left wing of the resonances is mostly affected by the scattering anisotropy in the laboratory system. (author)

  6. New evaluation of 238U neutron resonance parameters

    International Nuclear Information System (INIS)

    The neutron resonance parameters of 238U were obtained in the energy range 1 keV to 20 keV from a SAMMY Reich-Moore analysis of high resolution transmission measurements performed at ORELA. In the energy range 1 keV to 10 keV, the analysis used as prior values the ENDF/B-VI resonance parameters. The analysis in the energy range 10 keV to 20 keV resulted in the creation of a set of resonance parameters for the representation of the cross section in this energy range. The results are compared to the ENDF/B-VI evaluation. Some statistical properties of the new resonance parameters are examined. (author)

  7. Measurement and resonance analysis of neutron transmission through uranium-238

    International Nuclear Information System (INIS)

    Neutron transmissions through 0.076-, 0.254-, 1.080-, and 3.620-cm-thick samples of isotopically enriched 238U were measured from 0.88 to 100.0 keV by means of a time-of-flight technique over a path length of 150 m, the ORELA pulsed neutron source, and a 13-mm-thick lithium-glass detector. To obtain resonance parameters, these transmissions from 0.88 to 4.00 keV were simultaneously least-squares shape-fitted with a multilevel Breil--Wigner cross-section formalism. In general, large neutron widths were obtained, resulting in an s-wave strength function of (1.208 +- 0.045) x 10-4 over the interval from 0.0 to 4.0 keV. An absolute energy scale accurate to 2 parts in 10,000 was established. 11 figures, 16 tables

  8. Helium release from 238PuO2 fuel particles

    International Nuclear Information System (INIS)

    Coated plutonia fuel particles have recently been proposed for potential use in future space exploration missions that employ radioisotope power systems and/or radioisotope heater units (RHUs). The design of this fuel form calls for full retention of the helium generated by the natural radioactive decay of 238Pu, with the aid of a strong zirconium carbide coating. This paper reviews the potential release mechanisms of helium in small-grain (7-40 μm) plutonia pellets currently being used in the General Purpose Heat Source (GPHS) modules and RHUs, during both steady-state and transient heating conditions. The applicability of these mechanisms to large-grain and polycrystalline 238PuO2 fuel kernels is examined and estimates of helium release during a re-entry heating pulse up to 1723 K are presented. These estimates are based on the reported data for fission gas release from granular and monocrystal UO2 fuel particles irradiated at isothermal conditions up to 6.4 at.% burnup and 2030 K. It is concluded that the helium release fraction from large-grain (≥300 μm) plutonia fuel kernels heated up to 1723 K could be less than 7%, compared to ∼80% from small-grain (7-40 μm) fuel. The helium release fraction from polycrystalline plutonia kernels fabricated using Sol-Gel techniques could be even lower. Sol-Gel fabrication processes are favored over powder metallurgy, because of their high precision and excellent reproducibility and the absence of a radioactive dust waste stream, significantly reducing the fabrication and post-fabrication clean-up costs

  9. Summary of Plutonium-238 Production Alternatives Analysis Final Report

    Energy Technology Data Exchange (ETDEWEB)

    James Werner; Wade E. Bickford; David B. Lord; Chadwick D. Barklay

    2013-03-01

    The Team implemented a two-phase evaluation process. During the first phase, a wide variety of past and new candidate facilities and processing methods were assessed against the criteria established by DOE for this assessment. Any system or system element selected for consideration as an alternative within the project to reestablish domestic production of Pu-238 must meet the following minimum criteria: Any required source material must be readily available in the United States, without requiring the development of reprocessing technologies or investments in systems to separate material from identified sources. It must be cost, schedule, and risk competitive with existing baseline technology. Any identified facilities required to support the concept must be available to the program for the entire project life cycle (notionally 35 years, unless the concept is so novel as to require a shorter duration). It must present a solution that can generate at least 1.5 Kg of Pu-238 oxide per year, for at least 35 years. It must present a low-risk, near-term solution to the National Aeronautics and Space Administration’s urgent mission need. DOE has implemented this requirement by eliminating from project consideration any alternative with key technologies at less than Technology Readiness Level 5. The Team evaluated the options meeting these criteria using a more detailed assessment of the reasonable facility variations and compared them to the preferred option, which consists of target irradiation at the Advanced Test Reactor (ATR) and the High Flux Isotope Reactor (HFIR), target fabrication and chemical separations processing at the ORNL Radiochemical Engineering Development Center, and neptunium 237 storage at the Materials and Fuels Complex at INL. This preferred option is consistent with the Records of Decision from the earlier National Environmental Policy Act (NEPA) documentation

  10. Precise measurement and analysis of neutron transmission through 238U

    International Nuclear Information System (INIS)

    The transmissions of 0.52- to 4000-eV neutrons through 3.62, 1.08-, 0.254-, 0.0762-, 0.0254-, and 0.0127-, and 0.0036-cm-thick samples of uranium, enriched in the 238U isotope, have been measured at 42 m with a 1.0-mm-thick 6Li glass detector using the Oak Ridge Electron Linear Accelerator pulsed neutron source. To obtain resonance parameters, the seven transmissions of neutrons having energies ranging from 0.52 to 1086.8 eV have been shape-fitted by least-squares analysis to a multilevel Breit-Wigner cross-section formalism with ''picket-fence'' terms to account for truncation effects. This simultaneous fit yielded a chi2 per degree of freedom near unity. Averaged over this energy range, an s-wave strength function of (0.968 +- 0.036) x 10-4 cm and an effective radius of (0.944 +- 0.005) x 10-12 cm were obtained. In addition, these transmission data yielded an average radiation width of 23.1 +- 1.0 meV for the 12 lowest energy s-wave resonances with radiation widths of 23.0 +- 0.8, 22.8 +- 0.8, and 22.9 +- 0.8 meV for the 6,67-, 20.9-, and 36.8-eV resonances, respectively. The derived radiation widths for these three resonances are shown to depend on the cross-section formalism employed. This work suggests that a multilevel formalism with truncation compensation is required to adequately represent the 238U total cross section

  11. CAPABILITY TO RECOVER PLUTONIUM-238 IN H-CANYON/HB-LINE

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, Kenneth S. Jr.; Smith, Robert H. Jr.; Goergen, Charles R.

    2013-01-09

    Plutonium-238 is used in Radioisotope Thermoelectric Generators (RTGs) to generate electrical power and in Radioisotope Heater Units (RHUs) to produce heat for electronics and environmental control for deep space missions. The domestic supply of Pu-238 consists of scrap material from previous mission production or material purchased from Russia. Currently, the United States has no significant production scale operational capability to produce and separate new Pu-238 from irradiated neptunium-237 targets. The Department of Energy - Nuclear Energy is currently evaluating and developing plans to reconstitute the United States capability to produce Pu-238 from irradiated Np-237 targets. The Savannah River Site had previously produced and/or processed all the Pu-238 utilized in Radioisotope Thermoelectric Generators (RTGs) for deep space missions up to and including the majority of the plutonium for the Cassini Mission. The previous full production cycle capabilities included: Np-237 target fabrication, target irradiation, target dissolution and Np-237 and Pu-238 separation and purification, conversion of Np-237 and Pu-238 to oxide, scrap recovery, and Pu-238 encapsulation. The capability and equipment still exist and could be revitalized or put back into service to recover and purify Pu-238/Np-237 or broken General Purpose Heat Source (GPHS) pellets utilizing existing process equipment in HB-Line Scrap Recovery, and H-anyon Frame Waste Recovery processes. The conversion of Np-237 and Pu-238 to oxide can be performed in the existing HB-Line Phase-2 and Phase-3 Processes. Dissolution of irradiated Np-237 target material, and separation and purification of Np-237 and Pu-238 product streams would be possible at production rates of ~ 2 kg/month of Pu-238 if the existing H-Canyon Frames Process spare equipment were re-installed. Previously, the primary H-Canyon Frames equipment was removed to be replaced: however, the replacement project was stopped. The spare equipment is

  12. Capability to Recover Plutonium-238 in H-Canyon/HB-Line - 13248

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, Kenneth S. Jr.; Smith, Robert H. Jr.; Goergen, Charles R. [Savannah River Nuclear Solutions, LLC, Savannah River Site, Aiken, SC 29802 (United States)

    2013-07-01

    Plutonium-238 is used in Radioisotope Thermoelectric Generators (RTGs) to generate electrical power and in Radioisotope Heater Units (RHUs) to produce heat for electronics and environmental control for deep space missions. The domestic supply of Pu-238 consists of scrap material from previous mission production or material purchased from Russia. Currently, the United States has no significant production scale operational capability to produce and separate new Pu-238 from irradiated neptunium-237 targets. The Department of Energy - Nuclear Energy is currently evaluating and developing plans to reconstitute the United States capability to produce Pu-238 from irradiated Np-237 targets. The Savannah River Site had previously produced and/or processed all the Pu-238 utilized in Radioisotope Thermoelectric Generators (RTGs) for deep space missions up to and including the majority of the plutonium for the Cassini Mission. The previous full production cycle capabilities included: Np- 237 target fabrication, target irradiation, target dissolution and Np-237 and Pu-238 separation and purification, conversion of Np-237 and Pu-238 to oxide, scrap recovery, and Pu-238 encapsulation. The capability and equipment still exist and could be revitalized or put back into service to recover and purify Pu-238/Np-237 or broken General Purpose Heat Source (GPHS) pellets utilizing existing process equipment in HB-Line Scrap Recovery, and H-Canyon Frame Waste Recovery processes. The conversion of Np-237 and Pu-238 to oxide can be performed in the existing HB-Line Phase-2 and Phase- 3 Processes. Dissolution of irradiated Np-237 target material, and separation and purification of Np-237 and Pu-238 product streams would be possible at production rates of ∼2 kg/month of Pu-238 if the existing H-Canyon Frames Process spare equipment were re-installed. Previously, the primary H-Canyon Frames equipment was removed to be replaced: however, the replacement project was stopped. The spare equipment

  13. 37 CFR 2.38 - Use by predecessor or by related companies.

    Science.gov (United States)

    2010-07-01

    ... related companies. 2.38 Section 2.38 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... Use by predecessor or by related companies. (a) If the first use of the mark was by a predecessor in title or by a related company (sections 5 and 45 of the Act), and the use inures to the benefit of...

  14. 49 CFR 238.105 - Train electronic hardware and software safety.

    Science.gov (United States)

    2010-10-01

    ... all hardware and software components and their interfaces; and comprehensive hardware and software... 49 Transportation 4 2010-10-01 2010-10-01 false Train electronic hardware and software safety. 238... and General Requirements § 238.105 Train electronic hardware and software safety. The requirements...

  15. 49 CFR 238.119 - Rim-stamped straight-plate wheels.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Rim-stamped straight-plate wheels. 238.119 Section... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION PASSENGER EQUIPMENT SAFETY STANDARDS Safety Planning and General Requirements § 238.119 Rim-stamped straight-plate wheels. (a)(1) Except as provided in paragraph (a)(2) of...

  16. 48 CFR 552.238-70 - Identification of Electronic Office Equipment Providing Accessibility for the Handicapped.

    Science.gov (United States)

    2010-10-01

    ... PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 552.238-70 Identification of Electronic Office.... “Handicapped individuals” mean qualified individuals with impairments as cited in 29 CFR 1613.702(f) who can... Electronic Office Equipment Providing Accessibility for the Handicapped. 552.238-70 Section...

  17. 49 CFR 238.111 - Pre-revenue service acceptance testing plan.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Pre-revenue service acceptance testing plan. 238... and General Requirements § 238.111 Pre-revenue service acceptance testing plan. (a) Passenger equipment that has previously been used in revenue service in the United States. For passenger...

  18. 49 CFR 238.411 - Rear end structures of power car cabs.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Rear end structures of power car cabs. 238.411... II Passenger Equipment § 238.411 Rear end structures of power car cabs. The rear end structure of the cab of a power car shall be designed to include the following elements, or their structural...

  19. 49 CFR 238.409 - Forward end structures of power car cabs.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Forward end structures of power car cabs. 238.409... II Passenger Equipment § 238.409 Forward end structures of power car cabs. This section contains requirements for the forward end structure of the cab of a power car. (A conceptual implementation of this...

  20. Chemical behaviour of trivalent and pentavalent americium in saline NaCl-solutions. Studies of transferability of laboratory data to natural conditions. Interim report. Reported period: 1.2.1993-31.12.1993; Chemisches Verhalten von drei- und fuenfwertigem Americium in Salinen NaCl-Loesungen. Untersuchung der Uebertragbarkeit von Labordaten auf natuerliche Verhaeltnisse. Zwischenbericht. Berichtszeitraum 1.2.1993-31.12.1993

    Energy Technology Data Exchange (ETDEWEB)

    Runde, W.; Kim, J.I.

    1994-09-15

    In order to clarify the chemical behaviour of Americium in saline aqueous systems relevant for final storage this study deals with the chemical reactions of trivalent and pentavalent Americium in NaCl-solutions under the influence of radiolysis from its own alpha radiation. The focus of the study was on investigating the geologically relevant reactions, such as hydrolysis or carbonate- and chloride complexing in solid-liquid equilibriums. Comprehensive measurements on solubility and spectroscopic studies in NaCl-solutions were carried out in a CO{sub 2}-free atmosphere and 10{sup -2} atm CO{sub 2} partial pressure. Identification and characterisation of the AM (III) and AM(V) solid phases were supplemented by structural research with the chemically analogue EU (III) and Np(V) compounds. The alpha-radiation induced radiolysis in saline NaCl solutions and the redox behaviour of Americium which was influenced thereby were spectroscopically quantified. (orig.) [Deutsch] Zur Klaerung des chemischen Verhaltens von Americium in endlagerrelevanten salinen aquatischen Systemen befasst sich die vorliegende Arbeit mit den chemischen Reaktionen des drei- und fuenfwertigen Americiums in NaCl-Loesungen unter dem Einfluss der Radiolyse durch die eigene {alpha}-Strahlung. Der Schwerpunkt dieser Arbeit lag auf der Untersuchung der geologisch relevanten Reaktionen, wie Hydrolyse sowie Carbonat- und Chloridkomplexierung in fest-fluessig Gleichgewichtssystemen. Hierzu wurden umfassende Loeslichkeitsmessungen und spektroskopische Untersuchungen in NaCl-Loesungen, sowohl unter CO{sub 2}-freier Atmosphaere als auch unter 10{sup -2} atm CO{sub 2}-Partialdruck, durchgefuehrt. Die Identifizierung und Charakterisierung der Am(III)- und Am(V)-Festphasen wurde ergaenzt durch strukturelle Untersuchungen mit den chemisch analogen Eu(III)- und Np(V)-Verbindungen. Die von der {alpha}-Strahlung induzierte Radiolyse in salinen NaCl-Loesungen und das dadurch beeinflusste Redoxverhalten von Americium

  1. Spatiotemporal variation of dissolved 238U in the Gironde fluvial-estuarine system (France)

    International Nuclear Information System (INIS)

    Dissolved uranium (238UD) was measured within the Gironde fluvial-estuarine system (France), which is well known for its heavy metal pollution and its subsequent environmental effects. Dissolved 238U activities exhibit the highest levels and variability in the small watersheds of the Isle and Riou-Mort rivers, ascribed to low discharges and the occurrence of peculiar features (local U ore deposits; Permian layers). The major tributaries of the Gironde Estuary: Garonne, Lot and Dordogne, show rather stable 238UD, higher than the global mean riverine uranium activity. In the Gironde Estuary 238UD behaves conservatively along the river-estuary-ocean transect. Dissolved 238U distribution in the Gironde fluvial-estuarine system can be explained by the characteristics of considered drainage basins. There is no evidence of anthropogenic pollution

  2. Studying nuclear level densities of 238U in the nuclear reactions within the macroscopic nuclear models

    International Nuclear Information System (INIS)

    In this work the nuclear level density parameters of 238U have been extracted in the back-shifted Fermi gas model (BSFGM), as well as the constant temperature model (CTM), through fitting with the recent experimental data on nuclear level densities measured by the Oslo group. The excitation functions for 238U(p,2nα)233Pa, and 238U(p,4n)235Np reactions and the fragment yields for the fragments of the 238U(p,f) reaction have been calculated using obtained level density parameters. The results are compared to their corresponding experimental values. It was found that the extracted excitation functions and the fragment yields in the CTM coincide well with the experimental values in the low-energy region. This finding is according to the claim made by the Oslo group that the extracted level densities of 238U show a constant temperature behaviour.

  3. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    International Nuclear Information System (INIS)

    Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory (LANL) has initiated a development program to recover and purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. Our initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The most notable non-actinide impurity was silicon, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. 234U was by far the largest actinide impurity observed in the feed material because it is the daughter product of 238Pu by alpha decay. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was finely milled, then dissolved in refluxing HNO3/HF and the solution filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glove box environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values

  4. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    Science.gov (United States)

    Schulte, Louis D.; Silver, Gary L.; Avens, Larry R.; Jarvinen, Gordon D.; Espinoza, Jacob; Foltyn, Elizabeth M.; Rinehart, Gary H.

    1997-01-01

    Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory (LANL) has initiated a development program to recover & purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. Our initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The most notable non-actinide impurity was silicon, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. 234U was by far the largest actinide impurity observed in the feed material because it is the daughter product of 238Pu by alpha decay. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was finely milled, then dissolved in refluxing HNO3/HF and the solution filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glove box environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values.

  5. 234U/238U signatures associated with uranium ore bodies: part 3 Koongarra

    International Nuclear Information System (INIS)

    The Koongarra ore body is an early Proterozoic U ore body in the Alligator Rivers U province, Northern Territory, Australia. It has surface expression with a redox front located ∼30 m below the surface. The 234U/238U activity ratios (AR) for the ground water and the amorphous phase of the solid have been analysed for the ore zone and dispersion halo as a function of depth. The results display a 234U/238U AR signature with depth which may be common to all U ore bodies. The 234U/238U AR is depressed below secular equilibrium in the weathered material above the redox front; rises significantly above secular equilibrium in the vicinity of the redox front; and is followed by a gradual decrease with depth below the redox front. The amplitude of the profile is a function of local conditions. A model is proposed for the signature in which oxidising waters preferentially leach the 234U sites at the redox front due to preconditioning of the 234U sites by α recoil during the decay of 238U to 234U. Mass balance requires the solid material left behind the redox front to have a 234U/238U AR reduced below 1. Local second order effects may be superimposed on the signature. The signature may have application to calibrating scenarios for nuclear waste repositories, assisting in understanding historical climates, economic evaluation of U ore bodies and U exploration. -- Highlights: ► The 234U/238U AR data of the Koongaara U deposit was re-examined. ► The 234U/238U AR was depressed below 1 above the redox front. ► The 234U/238U AR was elevated above 1 at the redox front. ► The 234U/238U AR was decreased beyond the redox front. ► The data indicates that U ore bodies have a generic 234U/238U AR signature

  6. Influence of an alkoxy group on bis-triazinyl-pyridines for selective extraction of americium(III)

    International Nuclear Information System (INIS)

    The extraction of americium(III), curium(III), and lanthanides(III) from nitric acid by 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin-3-yl)-pyridine and 2,6-bis-(5,6-dimethyl-[1,2,4]-triazin- 3-yl)-4-methoxy-pyridine was studied. The physico-chemical properties of these ligands, such as the protonation and complexation constants, were also determined to describe the influence of different substituent groups. The selectivity of substituted-BTP was confirmed both in complexation and in solvent extraction experiments. The presence of an alkoxy-group in position 4 of the pyridine decreases the BTP selectivity. Influence of a long alkyl chain on protonation and complexation constants was also studied with 2,6-bis-(5,6-dimethyl-[1,2,4]- triazin-3-yl)-4-dodecyloxy-pyridine. (authors)

  7. Solvent extraction of europium and americium into phenyltrifluoromethyl sulfone by using synergistic mixture of hydrogen dicarbollylcobaltate and 'classical' CMPO

    International Nuclear Information System (INIS)

    Extraction of microamounts of europium and americium by a phenyltrifluoromethyl sulfone (FS 13) solution of hydrogen dicarbollylcobaltate (H+B-) in the presence of octyl-phenyl-N,N-diisobutylcarbamoylmethyl phosphine oxide ('classical' CMPO, L) has been investigated. The equilibrium data have been explained assuming that the complexes HL+, HL2+, ML23+, ML33+ and ML43+ (M3+ Eu3+, Am3+) are extracted into the organic phase. The values of extraction and stability constants of the cationic complex species in FS 13 saturated with water have been determined. It was found that the stability constants of the corresponding complexes EuLn3+ and AmLn3+, where n 2, 3, 4 and L is 'classical' CMPO, in water-saturated FS 13 are comparable. (author)

  8. Recovery, purification and concentration of plutonium and americium from the aqueous wastes discharged in the reprocessing process studies

    International Nuclear Information System (INIS)

    For recovering and purifying plutonium and americium from the aqueous wastes occurring in the process studies on reprocessing, a standard procedure has been established for use in the laboratory works, through the preliminary tests of the precipitation as hydroxides and the anion exchange in nitrate media. The procedure was proven in the treatment of actual wastes, of which the results were contributed to determine the process conditions in the plutonium purification and product concentration of the JAERI Reprocessing Test Plant. The preliminary tests also include washing of U and Am recovery from the anion-exchanger in nitrate media, direct ion-exchange recovery of Pu from the TBP phase and elution of Am from the cation-exchanger. (auth.)

  9. The bone volume effect on the dosimetry of plutonium-239 and americium-241 in the skeleton of man and baboon

    International Nuclear Information System (INIS)

    Studies were undertaken using bone removed from young adult baboons, which had been contaminated with plutonium-239 at various times prior to sacrifice, and human bone from adult male (USTR Case 246), who had received an internal deposition of americium-241 as a result of a glove-box explosion 11 years prior to his death. The baboon bone was supplied by the CEA, France, and the human bone by the United States Transuranium registry. The bone samples, examined by qualitative and quantitative autoradiography with CR 39 detectors, demonstrated the rapid redistribution of bone surface-seeking radionuclides in younger primates due to growth and the slower, bone turnover driven redistribution in the adult human bone. In both species, primary and secondary surface deposits of radionuclide remained conspicious despite bone activity; true volumization of radionuclide was seldom seen. The dosimetric implications of these findings are discussed. (author) 21 refs.; 6 figs.; 4 tabs

  10. Determination of 234U/238U, 235U/238U and 236U/238U Isotope Ratios in Urine Using Sector Field Inductively Coupled Plasma Mass Spectrometry (SF-ICP-MS)

    Science.gov (United States)

    Xiao, Ge; Jones, Robert L.; Saunders, David; Caldwell, Kathleen L.

    2016-01-01

    Quantification of the isotopic composition of uranium in urine at low levels of concentration is important for assessing both military and civilian populations’ exposures to uranium. However, until now there has been no convenient, precise method established for rapid determination of multiple uranium isotope ratios. Here we report a new method to measure 234U/238U, 235U/238U and 236U/238U. It uses solid phase chelation extraction (via TRU columns) of actinides from the urine matrix, followed by measurement using a magnetic sector field inductively coupled plasma mass spectrometer (SF-ICP-MS - Thermo Element XR) equipped with a high efficiency nebulizer (Apex PFA microflow) and coupled with a membrane desolvating introduction system (Aridus II™). This method provides rapid and reliable results, and has been used successfully to analyze Certified Reference Materials (CRM). PMID:24563523

  11. Elastic and inelastic scattering of neutrons on 238U nucleus

    Directory of Open Access Journals (Sweden)

    Capote R.

    2014-04-01

    Full Text Available Advanced modelling of neutron induced reactions on the 238U nucleus is aimed at improving our knowledge of neutron scattering. Capture and fission channels are well constrained by available experimental data and neutron standard evaluation. A focus of this contribution is on elastic and inelastic scattering cross sections. The employed nuclear reaction model includes – a new rotational-vibrational dispersive optical model potential coupling the low-lying collective bands of vibrational character observed in even-even actinides; – the Engelbrecht-Weidenmüller transformation allowing for inclusion of compound-direct interference effects; – and a multi-humped fission barrier with absorption in the secondary well described within the optical model for fission. Impact of the advanced modelling on elastic and inelastic scattering cross sections including angular distributions and emission spectra is assessed both by comparison with selected microscopic experimental data and integral criticality benchmarks including measured reaction rates (e.g. JEMIMA, FLAPTOP and BIG TEN. Benchmark calculations provided feedback to improve the reaction modelling. Improvement of existing libraries will be discussed.

  12. Experimental investigations of /sup 238/Pu behavior in soil columns

    Energy Technology Data Exchange (ETDEWEB)

    Nelson, G.B.; Herrera, B.; Stalnaker, N.D.; Coffelt, K.P.; Patterson, J.H.; Heaton, R.C.; Matlack, G.M.

    1984-05-01

    Two series of experiments were conducted to study the transport of plutonium through soils. The first series involved deposition of small quantities (2.0 to 3.5 mg) of particulate /sup 238/Pu oxide on soil columns containing silt loam soil. When deionized water was allowed to percolate through the columns, plutonium was released into the drainage at the rate of 8 to 15 pg/day. During the 6.8-y experiment, the total amount of plutonium released into the soil drainage amounted to less than 0.01% of the original source. Analysis of the soil as a function of depth at the end of the experiment revealed that more than 99% of the deposited source remained in the uppermost fraction (2.8 cm) of the column. The second series of experiments was performed by pumping water containing plutonium through columns of soil and comparing the amount of plutonium in the column effluents to that in the feed. For a loamy sand soil, the plutonium content of the effluent reached a steady state of 5% of the feed after 500 days. Analysis of the soil at the end of the experiment (1200 days) showed the columns to be approximately 50% saturated. Saturation of the soil with plutonium would require 13 ..mu..g/g and 6.6 y at the feed rate used (averaged of 1.2 ..mu..g/g into 300 g of soil).

  13. Experimental investigations of 238Pu behavior in soil columns

    International Nuclear Information System (INIS)

    Two series of experiments were conducted to study the transport of plutonium through soils. The first series involved deposition of small quantities (2.0 to 3.5 mg) of particulate 238Pu oxide on soil columns containing silt loam soil. When deionized water was allowed to percolate through the columns, plutonium was released into the drainage at the rate of 8 to 15 pg/day. During the 6.8-y experiment, the total amount of plutonium released into the soil drainage amounted to less than 0.01% of the original source. Analysis of the soil as a function of depth at the end of the experiment revealed that more than 99% of the deposited source remained in the uppermost fraction (2.8 cm) of the column. The second series of experiments was performed by pumping water containing plutonium through columns of soil and comparing the amount of plutonium in the column effluents to that in the feed. For a loamy sand soil, the plutonium content of the effluent reached a steady state of 5% of the feed after 500 days. Analysis of the soil at the end of the experiment (1200 days) showed the columns to be approximately 50% saturated. Saturation of the soil with plutonium would require 13 μg/g and 6.6 y at the feed rate used (averaged of 1.2 μg/g into 300 g of soil)

  14. Early endosteal bone response to incorporated plutonium-238 in mice

    International Nuclear Information System (INIS)

    Ten Swiss albino ICR SPF female mice 110 days old (weight about 30 g) were exposed for 48 hours to a solution of plutonium-238 nitrate (spec. act. 5 MBq/1 ml, pH 2.7) injected in amounts of 0.01 ml into the popliteal area of the right femur, each thus receiving about 500 kBq per 30 g body weight. Of the injected activity, 50% was retained in the right femur, 2% in the left femur and approximately 2 to 3% in the excrements collected separately from each animal during the whole exposure period. Ultrastructurally, electron micrographs revealed a variety of changes, including hypertrophy and destruction of endosteal cell organelles (primary damage), deformation and hypertrophy of osteocytes (secondary damage) and the irregularities in the osteocyte self-burial process leading to an abnormal formation of bone tissue structure (tertiary damage). Qualitatively, these changes in the irradiated bone ultrastructure were analogous to those occurring with age. This was confirmed by comparing two groups of control mice 110 and 330 days old. Assessed quantitatively, the changes due to irradiation were more pronounced than those associated with aging. (author). 6 figs., 6 tabs., 18 refs

  15. Dismantlement and decontamination of a plutonium-238 facility at SRS

    International Nuclear Information System (INIS)

    There has been very little, documented decontamination and decommissioning (D ampersand D) experience on which to project cleanup costs and schedules for plutonium facilities at SRS and other DOE sites. A portion of the HB-Line, a plutonium-238 processing facility at SRS, has been undergoing D ampersand D intermittently since 1984. Although this cleanup effort was not originally intended to quantify results, some key data have been project has demonstrated effective methods of accumulated, and the performing D ampersand D work, and has demonstrated cleanup equipment and techniques under conditions of high contamination. Plutonium facilities where D ampersand D is already underway provide an opportunity for' timely field testing of characterization, size reduction, and decontamination techniques. Some data are presented here; however, more specific tests and data may be obtained during the remainder of this project. This project has been recommended as a candidate test facility for a DOE planned ''Integrated D ampersand D Demonstration'' managed by EM-50 to develop and demonstrate technology for D ampersand D and surplus facilities deactivation. Both the remainder of this project and the Integrated D ampersand D Demonstration Program can benefit from a joint effort, and the, overall costs should be reduced

  16. Elastic and inelastic scattering of neutrons on 238U nucleus

    International Nuclear Information System (INIS)

    Advanced modelling of neutron induced reactions on the 238U nucleus is aimed at improving our knowledge of neutron scattering. Capture and fission channels are well constrained by available experimental data and neutron standard evaluation. A focus of this contribution is on elastic and inelastic scattering cross sections. The employed nuclear reaction model includes - a new rotational-vibrational dispersive optical model potential coupling the low-lying collective bands of vibrational character observed in even-even actinides; - the Engelbrecht-Weidenmüller transformation allowing for inclusion of compound-direct interference effects; - and a multi-humped fission barrier with absorption in the secondary well described within the optical model for fission. Impact of the advanced modelling on elastic and inelastic scattering cross sections including angular distributions and emission spectra is assessed both by comparison with selected microscopic experimental data and integral criticality benchmarks including measured reaction rates (e.g. JEMIMA, FLAPTOP and BIG TEN). Benchmark calculations provided feedback to improve the reaction modelling. Improvement of existing libraries will be discussed. (author)

  17. Double beta decay of Uranium-238: Proton reactions of 238U in 5--12 MeV range. Final report, April 15, 1987--March 31, 1992

    International Nuclear Information System (INIS)

    This report is in two parts. The first part reports on the experimental work determining the half-life for double beta decay of 238U to 238PU to be (2.0 ± 0.6) x 1021 years. This is the first evidence for a third mode of decay of this heaviest naturally occurring nucleus. This rate is about 106 times slower than spontaneous fission, which itself is about 106 times slower than alpha decay. The implication of this double beta decay to neutrino masses depends on uncertain theoretical calculations of the rate for such a heavy nucleus. The second part reports on yields of principal fission products from 5.6, 7.3, 9.4, and 11.5 MeV proton interactions with 238U. The yields at 11.5 MeV are similar to those from 14 MeV neutron fission of 238U. At the same time, the production cross sections of 238Np at the same energies are determined. This nuclide is produced as often as fission at the lowest energy but only 3.8% as often at the highest energy

  18. Barrier function of the placenta and microdistribution of 238Pu in the feto-placental complex of the rat

    International Nuclear Information System (INIS)

    Investigation materials, methods and results are presented. The aim of the investigation was to determine mechanisms of 238Pu transfer through pregnant rats depending on pregnancy time and to determine peculiarities of 238Pu microdistribution in feature tissues and placenta structures. 238Pu distribution in amnious, fetal placenta labyrinthine part and maternal placenta is shown

  19. 40 CFR 23.8 - Timing of Administrator's action under Uranium Mill Tailings Radiation Control Act of 1978.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Timing of Administrator's action under Uranium Mill Tailings Radiation Control Act of 1978. 23.8 Section 23.8 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL JUDICIAL REVIEW UNDER EPA-ADMINISTERED STATUTES § 23.8 Timing of Administrator's action under Uranium...

  20. Development program to recycle and purify plutonium-238 oxide fuel from scrap

    International Nuclear Information System (INIS)

    Nuclear Materials Technology (NMT) Division has initiated a development program to recover and purify plutonium-238 oxide from impure sources. A glove box line has been designed and a process flowsheet developed to perform this task on a large scale. The initial effort has focused on purification of 238PuO2 fuel that fails to meet General Purpose Heat Source (GPHS) specifications because of impurities. The notable non-actinide impurities were silicon and phosphorus, but aluminum, chromium, iron and nickel were also near or in excess of limits specified by GPHS fuel powder specifications. Among actinide impurities, uranium is of paramount concern because 234U is the daughter of 2238Pu by alpha decay, and is the largest actinide impurity. An aqueous method based on nitric acid was selected for purification of the 238PuO2 fuel. All aqueous processing used high purity reagents, and was performed in PTFE apparatus to minimize introduction of new contaminants. Impure 238PuO2 was first dissolved in refluxing HNO3/HF and then the solution was filtered. The dissolved 238Pu was adjusted to the trivalent state by an excess of reducing reagents to compensate for radiolytic effects, precipitated as plutonium(III) oxalate, and recovered by filtration. The plutonium(III) oxalate was subsequently calcined to convert the plutonium to the oxide. Decontamination factors for silicon, phosphorus and uranium were excellent. Decontamination factors for aluminum, chromium, iron and nickel were very good. The purity of the 238PuO2 recovered from this operation was significantly better than specifications. Efforts continue to develop the capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel in a glovebox environment. Plutonium-238 materials targeted for recovery includes impure oxide and scrap items that are lean in 238Pu values

  1. Preconceptual Feasibility Study to Evaluate Alternative Means to Produce Plutonium-238

    Energy Technology Data Exchange (ETDEWEB)

    John D. Bess; Matthew S. Everson

    2013-02-01

    There is currently no large-scale production of 238Pu in the United States. Feasibility studies were performed at the Idaho National Laboratory to assess the capability of developing alternative 238Pu production strategies. Initial investigations indicate potential capability to provision radioisotope-powered systems for future space exploration endeavors. For the short term production of 238Pu, sealed canisters of dilute 237Np solution in nitric acid could be irradiated in the Advanced Test Reactor (ATR). Targets in the large and medium “I” positions of the ATR were irradiated over a simulated period of 306 days and analyzed using MCNP5 and ORIGEN2.2. Approximately 0.5 kg of 238Pu could be produced annually in the ATR with purity greater than 92%. Optimization of the irradiation cycles could further increase the purity to greater than 98%. Whereas the typical purity of space batteries is between 80 to 85%, the higher purity 238Pu produced in the ATR could be blended with existing lower-purity inventory to produce useable material. Development of irradiation methods in the ATR provides the fastest alterative to restart United States 238Pu production. The analysis of 238Pu production in the ATR provides the technical basis for production using TRIGA® (Training, Research, Isotopes, General Atomics) nuclear reactors. Preliminary analyses envisage a production rate of approximately 0.7 kg annually using a single dedicated 5-MW TRIGA reactor with continuous flow loops to achieve high purity product. Two TRIGA reactors represent a robust means of providing at over 1 kg/yr of 238Pu annually using dilute solution targets of 237Np in nitric acid. Further collaboration and optimization of reactor design, radiochemical methods, and systems analyses would further increase annual 238Pu throughput, while reducing the currently evaluated reactor requirements.

  2. Measurement and calculation of 238U fission reaction rates induced by neutrons reflected by carbon material

    International Nuclear Information System (INIS)

    To check the data of carbon material reflecting neutrons, the distribution of 238U fission reaction rates induced by D-T fusion neutrons reflected by carbon material was measured by using the small depleted uranium fission chamber and the capturing detector. For comparison, 238U fission rates without carbon material was measured too. The combined standard uncertainty of 238U fission reaction rate is 5.1%-6.4%. The measured results are consistent with the calculated ones with MCNP/4A code and ENDF/B-IV library data in the range of the error

  3. Experimental Determination of the Antineutrino Spectrum of the Fission Products of $^{238}$U

    CERN Document Server

    Haag, N; Hofmann, M; Oberauer, L; Potzel, W; Schreckenbach, K; Wagner, F M

    2013-01-01

    An experiment was performed at the scientific neutron source FRM II in Garching to determine the cumulative antineutrino spectrum of the fission products of $^{238}$U. This was achieved by irradiating target foils of natural uranium with a thermal and a fast neutron beam and recording the emitted $\\beta$-spectra with a gamma-suppressing electron-telescope. The obtained $\\beta$-spectrum of the fission products of $^{235}$U was normalized to the data of the magnetic spectrometer BILL of $^{235}$U. This method strongly reduces systematic errors in the $^{238}$U measurement. The $\\beta$-spectrum of $^{238}$U was converted into the corresponding antineutrino spectrum. The final $\\bar\

  4. Radiochemical measurement of 10-15 MeV proton induced fission yields for U-238

    International Nuclear Information System (INIS)

    The production of realistic nuclear forensics debris requires an accurate knowledge of cross sections and fission yields for large number of systems. Proton induced fission of U-238 was examined for incident energies in the range of 10-15 MeV. Fission yields were first measured directly from the irradiated materials. The valley and wing fission products were then isolated in various chemical fractions in order to increase the counting statistics leading to improvements in the fission yields. In addition to the total fission cross section and the fission mass yields for U-238, proton based reaction cross sections on U-238 and U-235 were also measured. (author)

  5. Deposition of air-borne 238Pu near a chemical separation facility

    International Nuclear Information System (INIS)

    Three methods were compared to measure deposition of 238Pu released from a chemical separation facility at the Savannah River Plant, Aiken, SC. The following methods were used: adhesive paper; a collector of rain and dryfall; and soil samples. Excellent agreement among the three methods was found. The measured deposition for the particular source term and meteorological conditions at the Savannah River Plant is described by y proportional to x/sup -1.36/ where y is the pCi of 238Pu deposited per square meter per mC: 238Pu released, and x is distance in meters from the source

  6. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium-americium mixed oxides

    Science.gov (United States)

    Prieur, D.; Lebreton, F.; Martin, P. M.; Caisso, M.; Butzbach, R.; Somers, J.; Delahaye, T.

    2015-10-01

    Uranium-americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1-xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1-xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions.

  7. Stability of penta- and hexavalent americium in the solutions of sodium peroxydisulfate and sodium bromate at intensive internal α-irradiation

    International Nuclear Information System (INIS)

    The spectrometric method has been used for studying the dependence of the rates of radiolytic reduction of Am(5) and (6) on the initial concentration of sodium persulfate and bromate, Am(5) and (6), acidity, and the dose rate of inner alpha-irradiation of the solutions. The high dose rates of inner alpha-irradiation of solutions (up to 3.25x1021 eV/lxmin-250Ci/l) have been attained with the aid of curium isotopes. The stability of americium (6) ions towards the action of ionizing radiation in solutions of sodium persulfate and bromate has been shown to be considerable lower than that of americium (5). The chemical difference has been shown in radiolytic behaviour between Am(5) and Am(6) ions in solutions of sodium persulfate and bromate. The equations have been derived showing the dependence of the rates of Am(6) and Am(5) reduction of different variables

  8. Biokinetics of a transuranic (238PU) and a rare earth element (152Eu) in the lobster (Homarus gammarus): transfer mechanisms (accumulation and detoxification) in organs and at the cellular level

    International Nuclear Information System (INIS)

    The work presented here is an experimental investigation of the biokinetics of transfer of a transuranic and a rare earth element (238Pu and 152Eu) in the lobster Homarus gammarus. The study of 238Pu biokinetics forms part of a wider framework of research concerning the transfer of transuranic elements in marine species, while the study of 152Eu is carried out with a view to supporting the analogy between the behaviour of transuranics and rare earths in living organisms. Exactly the same experimental protocol, based on techniques from various disciplines (biology, biochemistry and metrology), was used to Investigate the biokinetics of transfer of these two radionuclides. The Individual lobsters were radiolabelled by means of one-shot or chronic ingestion of spiked meals. As the first approach, the kinetics and transfer mechanisms were studied In whole animal samples and in different organs distinct series of pathways through the different organs were identified in the case of both radionuclides, being mainly linked to digestive processes induced by the meal as well as the transport function of hemo-lymph in this way, the Important role of the digestive gland was picked out, with two of four cellular types displaying a successive involvement In the fixation and then the retention of the studied radionuclides. As a corroborative approach, the digestive gland was subjected to a more detailed investigation with the aim of describing the mechanisms of Incorporation and elucidating transfer processes at the cellular and molecular levels. 238Pu is preferentially partitioned into the cytosol, where it is associated with various constituents such as ferritin (iron-storing protein). 152Eu is more diffusely distributed in the hepato-pancreatic cells, while the lysosomes appear to play a more important role during transfer. The results obtained in this study, both on the macroscopic scale (i.e. the whole animal and different organs) as well as the cellular and molecular levels

  9. Optimization of an analytical method using extraction chromatography for the determination of plutonium, americium and curium in soil samples; Optimierung eines extraktionschromatographischen Analyseverfahrens zur Bestimmung von Plutonium, Americium und Curium in Bodenproben

    Energy Technology Data Exchange (ETDEWEB)

    Gann, Cordula

    2000-09-01

    An analytical method for determination of the actinides {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am and {sup 244}Cm in soil samples was developed and optimized to allow specific immission measurements of radionuclides in the vicinity of the recently constructed radwaste facility at Wuerenlingen/Switzerland. Following a rapid extraction from the soil sample, as well as a preconcentration step via calcium oxalate precipitation, the actinides are separated using extraction chromatography. Separation of the actinides is carrie out applying the specific resins U/TEVA, TRU and TEVA (Eichrom Technologies IL/USA) and the anion exchange resin BioRAD 1-X2. Measurements are then performed using an {alpha}-spectrometer equipped with ion-implanted silicon charged particle detectors. For counting times of less than three days a detection limit of less than 0.05 Bq/kg is obtained for the actinides {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am and {sup 244}Cm. (author) [German] Im Rahmen von Immissionsmessungen auf den Radionuklidgehalt in der Umgebung des kuerzlich erbauten Zwischenlagers Wuerenlingen wurde eine Analysenmethode zur Bestimmung der Aktivitaetskonzentration der Aktiniden {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am und {sup 244}Cm in Bodenproben entwickelt und optimiert. Die Aktiniden werden nach einer kurzen Extraktion der Bodenprobe und einer Vorkonzentration durch eine Calciumoxalatfaellung mittels Extraktionschromatographie separiert. Die Bodenprobe durchlaeuft mehrere Trennungsschritte ueber die Austauscherharze U/TEVA, TRU und TEVA der Firma Eichrom (Illinois, USA) sowie eine zusaetzliche Abtrennung mit dem Harz BioRAD 1-.X2. Die Aktivitaet wird anschliessend ueber die {alpha}-Spektrometrie mit ionen-implantierten Siliziumdetektoren bestimmt. Eine Nachweisgrenze von 0.05 Bq/kg wird fuer die Aktiniden {sup 238}Pu, {sup 239+240}Pu, {sup 241}Am und {sup 244}Cm mit Messzeiten von weniger als drei Tagen im {alpha}-Spektrometer probemlos unterschritten. (Autorin)

  10. A Density Functional Study of Atomic Hydrogen and Oxygen Chemisorption on the Relaxed (0001) Surface of Double Hexagonal Close Packed Americium

    OpenAIRE

    Dholabhai, P. P.; Atta-Fynn, R.; A.K. Ray

    2009-01-01

    Ab initio total energy calculations within the framework of density functional theory have been performed for atomic hydrogen and oxygen chemisorption on the (0001) surface of double hexagonal packed americium using a full-potential all-electron linearized augmented plane wave plus local orbitals method. Chemisorption energies were optimized with respect to the distance of the adatom from the relaxed surface for three adsorption sites, namely top, bridge, and hollow hcp sites, the adlayer str...

  11. Distribution, retention and dosimetry of plutonium and americium in the rat, dog and monkey after inhalation of an industrial-mixed uranium and plutonium oxide aerosol

    International Nuclear Information System (INIS)

    This study provides information on patterns of radiation dose in laboratory animals after inhalation exposure to an aerosol of one form of mixed uranium and plutonium oxide. The aerosol contained a mixture of UO2 and 750 deg C heat-treated PuO2 obtained from the ball milling operation in a mixed-oxide fuel fabrication process. Americium-241 from the decay of 241Pu was also present in the PuO2 matrix. Fischer-344 rats, Beagle dogs, and Cynomolgus and Rhesus monkeys inhaled aerosols re-generated from dry mixed oxide powders with particle size distribution characteristics similar to those observed in samples collected at the industrial site. Clearance from the lung and distribution in other tissues of the plutonium from this UO2 + PuO2 admixture was similar to what has been observed for PuO2 from laboratory-produced aerosols. The UO2-PuO2 aerosol was relatively insoluble in the lungs of all species. Monkeys and rats cleared plutonium and americium from their lungs faster than dogs. Very little plutonium or americium translocated within the first 2 yr after exposure to tissues other than tracheobronchial lymph nodes. The greater accumulation of plutonium and americium in the tracheobronchial lymph nodes of dogs as compared to monkeys and rats combined with the more rapid initial clearance of these radionuclides from the lungs of rats and monkeys suggests that errors could result from using data from a single animal species to estimate risk to humans from inhalation of these industrial aerosols. (author)

  12. Experimental study of Americium-241 biokinetics in Homarus Gammarus lobster. Analysis of the accumulation and detoxication mechanisms at the sub-cellular level

    International Nuclear Information System (INIS)

    The Americium 241 radioelement accumulation and elimination rate and mechanisms in the lobster organism have been experimentally studied; incorporation and detoxification capacities of each organ are evaluated. The existence of various biological compartments is shown; the major role of the digestive gland in accumulation of the radioelement, its distribution towards the various organs, and its resorption is comprehensively described, with an analysis at the subcellular and molecular levels. 401 p., 65 fig., 43 tab., 428 ref

  13. Biokinetics of a transuranic ({sup 238}PU) and a rare earth element ({sup 152}Eu) in the lobster (Homarus gammarus): transfer mechanisms (accumulation and detoxification) in organs and at the cellular level; Biocinetiques d'un element transuranien, le {sup 238}PU, et d'une terre rare, le {sup 152}EU, chez le homard homarus gammarus (organes et niveau cellulaire) modalites des transferts (accumulation et detoxication)

    Energy Technology Data Exchange (ETDEWEB)

    Tocquet, N

    1995-07-01

    The work presented here is an experimental investigation of the biokinetics of transfer of a transuranic and a rare earth element ({sup 238}Pu and {sup 152}Eu) in the lobster Homarus gammarus. The study of {sup 238}Pu biokinetics forms part of a wider framework of research concerning the transfer of transuranic elements in marine species, while the study of {sup 152}Eu is carried out with a view to supporting the analogy between the behaviour of transuranics and rare earths in living organisms. Exactly the same experimental protocol, based on techniques from various disciplines (biology, biochemistry and metrology), was used to Investigate the biokinetics of transfer of these two radionuclides. The Individual lobsters were radiolabelled by means of one-shot or chronic ingestion of spiked meals. As the first approach, the kinetics and transfer mechanisms were studied In whole animal samples and in different organs distinct series of pathways through the different organs were identified in the case of both radionuclides, being mainly linked to digestive processes induced by the meal as well as the transport function of hemo-lymph in this way, the Important role of the digestive gland was picked out, with two of four cellular types displaying a successive involvement In the fixation and then the retention of the studied radionuclides. As a corroborative approach, the digestive gland was subjected to a more detailed investigation with the aim of describing the mechanisms of Incorporation and elucidating transfer processes at the cellular and molecular levels. {sup 238}Pu is preferentially partitioned into the cytosol, where it is associated with various constituents such as ferritin (iron-storing protein). {sup 152}Eu is more diffusely distributed in the hepato-pancreatic cells, while the lysosomes appear to play a more important role during transfer. The results obtained in this study, both on the macroscopic scale (i.e. the whole animal and different organs) as well

  14. 10 CFR 72.238 - Issuance of an NRC Certificate of Compliance.

    Science.gov (United States)

    2010-01-01

    ... STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of Spent Fuel Storage Casks § 72.238 Issuance of an NRC Certificate of Compliance....

  15. Understanding of 234U/238U activity ratio in groundwater of agricultural ecosystem

    International Nuclear Information System (INIS)

    This study was carried out to clarify the natural variation of 234U/238U ratio in groundwater of an agricultural ecosystem. Water samples were collected from 21 locations from Bathinda and Mansa districts, of Punjab state and analysed for uranium concentration and activity ratio of its isotopes. The activity concentration ratio of 234U/238U in the groundwater samples varied between 0.39-0.98 with a mean value of 0.86. The lower isotopic ratio (less than 1) of 234U/238U indicates higher dissolution rate of parent 238U. The results suggest that, most of the dissolved uranium in groundwater is derived from the surrounding host soil or bed rock rather than from anthropogenic input. (author)

  16. Dissolution behaviour of 238U, 234U and 230Th deposited on filters from personal dosemeters

    International Nuclear Information System (INIS)

    Kinetics of dissolution of 238U, 234U and 230Th dust deposited on filters from personal alpha dosemeters was studied by means of a 26-d in vitro dissolution test with a serum ultra-filtrate simulant. Dosemeters had been used by miners at the uranium mine 'Dolni Rozinka' at Rozna, Czech Republic. The sampling flow-rate as declared by the producer is 4 l h-1 and the sampling period is typically 1 month. Studied filters contained 125 ± 6 mBq 238U in equilibrium with 234U and 230Th; no 232Th series nuclides were found. Half-time of rapid dissolution of 1.4 d for 238U and 234U and slow dissolution half-times of 173 and 116 d were found for 238U and 234U, respectively. No detectable dissolution of 230Th was found. (authors)

  17. Mound Laboratory Plutonium-238 Study Off-Site Analytical Data May-December 1974

    Energy Technology Data Exchange (ETDEWEB)

    Robinson, Bob; Rogers, D. R.; Westendorf, W. H.; Black, H. A.

    1975-03-01

    Preliminary samples collected from off-site sediment in the Miami-Erie Canal Area near Mound Laboratory indicated that plutonium-238 concentrations are substantially above baseline levels. As a result an extensive sampling and analysis program was performed to determine the plutonium-238 concentrations as a function of depth and location in a drainage ditch, the canal, two ponds, a run-off hollow, a canal overflow creek and the Great Miami River. The plutonium-238 concentration data was used to estimate the total inventory of 238Pu deposited in these waterways, to determine the extent of the contamination, and to evaluate the potential health hazards to the general population of the area. The scope of this report is to present the data collected during this study. Detailed interpretation of the data will be presented in subsequent reports.

  18. Identification of a new heavy neutron-rich isotope 238Th

    International Nuclear Information System (INIS)

    A new heavy neutron-rich thorium isotope was produced via a multinucleon transfer reaction by irradiation of natural uranium targets with 60 MeV/u 18O ions. The Th activities was radiochemically separated from the uranium and mixture of reaction products by the rapid solvent extraction method. Measurements of the gamma-ray spectra were performed with HPGe detectors. The new neutron-rich isotope 238Th was identified for the first time based on the observation of the growth and decay of the gamma-ray with energy of 1060.5 keV from the decay of 238Pa. The half-life of 238Th has been determined to be 9.4±2.0 minutes. Further, a gamma-ray of 89.0 keV with the 8.9-minute half-life was found, which may be due to the decay of the new isotope 238Th. (author)

  19. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    Energy Technology Data Exchange (ETDEWEB)

    Prieur, D., E-mail: dam.prieur@gmail.com [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Lebreton, F. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Martin, P.M. [CEA, DEN, DEC/SESC/LLCC, 13108 Saint-Paul-Lez-Durance cedex (France); Caisso, M. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France); Butzbach, R. [Helmholtz Zentrum Dresden Rossendorf (HZDR), Institute of Radiochemistry, P.O. Box 10119, 01314 Dresden (Germany); Somers, J. [European Commission, Joint Research Centre, Institute for Transuranium Elements, P.O. Box 2340, D-76125 Karlsruhe (Germany); Delahaye, T. [CEA, DEN, DTEC/SDTC/LEMA, 30207 Bagnols-sur-Cèze cedex (France)

    2015-10-15

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U{sub 1−x}Am{sub x}O{sub 2±δ} samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U{sub 1−x}Am{sub x}O{sub 2±δ} leads to the formation of similar fluorite solid solution indicating the presence of Am{sup +III} and U{sup +V} in equimolar proportions. - Graphical abstract: Formation of (U{sup IV/V},Am{sup III})O{sup 2} solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • U{sup V} and Am{sup III} are formed in equimolar proportions.

  20. An experimental study of americium-241 biokinetics in the Lobster Homarus Gammarus. Analysis of the accumulation/storage and detoxification processes at the subcellular level

    International Nuclear Information System (INIS)

    An experimental study of americium-241 kinetics has been conducted in the lobster Homarus gammmarus. The investigations were conducted at all the levels from the whole body to the subcellular and molecular levels. The animals were contaminated by a single or chronic ingestion of 241 Am labelled mussels. Assessments of accumulation, elimination and distribution of the radionuclide were established on organisms kept in the laboratory; they made it possible to demonstrate the importance of the digestive gland in the radionuclide transfer pathways. The preliminary results led to structural then ultrastructural investigations of the digestive gland in association with radioautographic studies and cellular extractions methods. Four cellular types were demonstrated, only two of them being implied in the radionuclide retention, the former being responsible for americium intake and the latter for its long-term retention. By means of biochemical techniques, subcellular accumulation was studied and the organelles implied in the nuclide retention were specified. Finally, a method of cellular nuclei dissociation was developed; it made it possible to analyse the molecular nature of americium ligands and to demonstrate the function of the protein nuclear matrix in the nuclide retention

  1. A new method for the determination of plutonium and americium using high pressure microwave digestion and alpha-spectrometry or ICP-SMS

    International Nuclear Information System (INIS)

    Plutonium and americium are radionuclides particularly difficult to measure in environmental samples because they are a-emitters and therefore necessitate a careful separation before any measurement, either using radiometric methods or ICP-SMS. Recent developments in extraction chromatography resins such as EichromR TRU and TEVA have resolved many of the analytical problems but drawbacks such as low recovery and spectral interferences still occasionally occur. Here, we report on the use of the new EichromR DGA resin in association with TEVA resin and high pressure microwave acid leaching for the sequential determination of plutonium and americium in environmental samples. The method results in average recoveries of 83 ± 15% for plutonium and 73 ± 22% for americium (n = 60), and a less than 10% deviation from reference values of four IAEA reference materials and three samples from intercomparisons exercises. The method is also suitable for measuring 239Pu in water samples at the μBq/l level, if ICP-SMS is used for the measurement. (author)

  2. Comparative XRPD and XAS study of the impact of the synthesis process on the electronic and structural environments of uranium–americium mixed oxides

    International Nuclear Information System (INIS)

    Uranium–americium mixed oxides are potential compounds to reduce americium inventory in nuclear waste via a partitioning and transmutation strategy. A thorough assessment of the oxygen-to-metal ratio is paramount in such materials as it determines the important underlying electronic structure and phase relations, affecting both thermal conductivity of the material and its interaction with the cladding and coolant. In 2011, various XAS experiments on U1−xAmxO2±δ samples prepared by different synthesis methods have reported contradictory results on the charge distribution of U and Am. This work alleviates this discrepancy. The XAS results confirm that, independently of the synthesis process, the reductive sintering of U1−xAmxO2±δ leads to the formation of similar fluorite solid solution indicating the presence of Am+III and U+V in equimolar proportions. - Graphical abstract: Formation of (UIV/V,AmIII)O2 solid solution by sol–gel and by powder metallurgy. - Highlights: • Uranium–americium mixed oxides were synthesized by sol–gel and powder metallurgy. • Fluorite solid solutions with similar local environment have been obtained. • UV and AmIII are formed in equimolar proportions

  3. Recycle of scrap plutonium-238 oxide fuel to support future radioisotope applications

    International Nuclear Information System (INIS)

    The Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory has initiated a development program to recover ampersand purify plutonium-238 oxide from impure feed sources in a glove box environment. A glove box line has been designed and a chemistry flowsheet developed to perform this recovery task at large scale. The initial demonstration effort focused on purification of 238PuO2 fuel by HNO3/HF dissolution, followed by plutonium(III) oxalate precipitation and calcination to an oxide. Decontamination factors for most impurities of concern in the fuel were very good, producing 238PuO2 fuel significantly better in purity than specified by General Purpose Heat Source (GPHS) fuel powder specifications. A sufficient quantity of purified 238PuO2 fuel was recovered from the process to allow fabrication of a GPHS unit for testing. The results are encouraging for recycle of relatively impure plutonium-238 oxide and scrap residue items into fuel for useful applications. The high specific activity of plutonium-238 magnifies the consequences and concerns of radioactive waste generation. This work places an emphasis on development of waste minimization technologies to complement the aqueous processing operation. Results from experiments on neutralized solutions of plutonium-238 resulted in decontamination to about 1 millicurie/L. Combining ultrafiltration treatment with addition of a water-soluble polymer designed to coordinate Pu, allowed solutions to be decontaminated to about 1 microcurie/L. Efforts continue to develop a capability for efficient, safe, cost-effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel. copyright 1998 American Institute of Physics

  4. Purification of 238PuO2 scrap for heat source fuel

    International Nuclear Information System (INIS)

    The Nuclear Materials Technology (NMT) Division of Los Alamos National Laboratory has initiated a development program to recover and purify plutonium-238 oxide from impure feed sources in a glove box environment. A glove box line has been designed and a chemistry flowsheet developed to perform this recovery task at large scale. The initial demonstration effort focused on purification of 238PuO2 fuel by HNO3/HF dissolution, followed by plutonium(III) oxalate precipitation and calcination to an oxide. Decontamination factors for most impurities of concern in the fuel were very good, producing 238PuO2 fuel significantly better in purity than specified by General Purpose Heat Source (GPHS) fuel powder specifications. A sufficient quantity of purified 238PuO2 fuel was recovered from the process to allow fabrication of a GPHS unit for testing. The results are encouraging for recycle of relatively impure plutonium-238 oxide and scrap residue items into fuel for useful applications. The high specific activity of plutonium-238 magnifies the consequences and concerns of radioactive waste generation. This work places an emphasis on development of waste minimization technologies to complement the aqueous processing operation. Results from experiments on neutralized solutions of plutonium-238 resulted in decontamination to about 1 millicurie/L. Combining ultrafiltration treatment with addition of a water soluble polymer designed to coordinate Pu, allowed solutions to be decontaminated to about 1 microcurie/L. Efforts continue to develop a capability for efficient, safe, cost effective, and environmentally acceptable methods to recover and purify 238PuO2 fuel

  5. 234U/238U signatures associated with uranium ore bodies: part 2 Manyingee

    International Nuclear Information System (INIS)

    The Manyingee ore body is a roll-front U ore body located at depth in the Cretaceous sandstone sediments of a Proterozoic palaeo valley. It is located in a confined aquifer. The aquifer is recharged 4 km upstream by the Ashburton River. Groundwater samples were collected at and up to 4.7 km downstream of the ore body. The ground water 234U/238U activity ratios (AR) were elevated to 1.86 in the vicinity of the ore body and then declined to 1.06 over the 4.7 km transect. The elevated 234U/238U ARs are attributed to selective leaching of 234U sites by oxidising waters, with α recoil as a necessary precursor to produce activated 234U sites. Direct ejection into another phase following α recoil is considered to be a minor contributor to 234U –238U disequilibrium in this environment. The profile is considered to be typical of the 234U/238U AR profile at and down gradient of the redox front of a U ore body. -- Highlights: ► The 234U/238U AR of the ground water of a roll-front U deposit was determined. ► The ground water was sampled at and beyond the redox front. ► The 234U/238U AR was elevated to 1.8 at the redox front. ► The 234U/238U AR was decreased down gradient of the redox front. ► A generic 234U/238U AR signature is proposed for U ore bodies

  6. Experimental determination of the antineutrino spectrum of the fission products of 238U

    International Nuclear Information System (INIS)

    Fission of 238U contributes about 10 % to the antineutrino emission of a pressurized water reactor. In the present thesis, the beta spectrum of the fission products of 238U was determined in an experiment at the neutron source FRM II. This beta spectrum was subsequently converted into an antineutrino spectrum. This first measurement of the antineutrino spectrum supports all current and future reactor antineutrino experiments.

  7. Application of molten salt oxidation for the minimization and recovery of plutonium-238 contaminated wastes

    International Nuclear Information System (INIS)

    Molten salt oxidation (MSO) is proposed as a 238Pu waste treatment technology that should be developed for volume reduction and recovery of 238Pu and as an alternative to the transport and permanent disposal of 238Pu waste to the WIPP repository. In MSO technology, molten sodium carbonate salt at 800--900 C in a reaction vessel acts as a reaction media for wastes. The waste material is destroyed when injected into the molten salt, creating harmless carbon dioxide and steam and a small amount of ash in the spent salt. The spent salt can be treated using aqueous separation methods to reuse the salt and to recover 99.9% of the precious 238Pu that was in the waste. Tests of MSO technology have shown that the volume of combustible TRU waste can be reduced by a factor of at least twenty. Using this factor the present inventory of 574 TRU drums of 238Pu contaminated wastes is reduced to 30 drums. Further 238Pu waste costs of $22 million are avoided from not having to repackage 312 of the 574 drums to a drum total of more than 4,600 drums. MSO combined with aqueous processing of salts will recover approximately 1.7 kilograms of precious 238Pu valued at 4 million dollars (at $2,500/gram). Thus, installation and use of MSO technology at LANL will result in significant cost savings compared to present plans to transport and dispose 238Pu TRU waste to the WIPP site. Using a total net present value cost for the MSO project as $4.09 million over a five-year lifetime, the project can pay for itself after either recovery of 1.6 kg of Pu or through volume reduction of 818 drums or a combination of the two. These savings show a positive return on investment

  8. Analysis of transmission experiments for 238U in the unresolved resonance region

    International Nuclear Information System (INIS)

    From analysis of experimental data on transmission in the region of unresolved resonances, an evaluation of the mean resonance parameters for 238U is obtained. These parameters do not contradict the corresponding evaluations from the region of resolved resonances. On the basis of this evaluation, the group constants for 238U are determined, for the region of unresolved resonances. A comparison is made with data tables

  9. Experimental determination of the antineutrino spectrum of the fission products of {sup 238}U

    Energy Technology Data Exchange (ETDEWEB)

    Haag, Nils-Holger

    2013-10-09

    Fission of {sup 238}U contributes about 10 % to the antineutrino emission of a pressurized water reactor. In the present thesis, the beta spectrum of the fission products of {sup 238}U was determined in an experiment at the neutron source FRM II. This beta spectrum was subsequently converted into an antineutrino spectrum. This first measurement of the antineutrino spectrum supports all current and future reactor antineutrino experiments.

  10. Evaluation of neutron-induced reactions in 48Ti and 238U

    International Nuclear Information System (INIS)

    Preliminary results of the evaluation of neutron-induced reactions in 48Ti and 238U are presented. Calculated cross sections for the reactions (n,γ), (n,n'), (n, 2n) and (n,p) as well as for (n,f) in 238U are given. Comparisons with available experimental data are made and possible changes in the parameters are discussed. (Author)

  11. Application of molten salt oxidation for the minimization and recovery of plutonium-238 contaminated wastes

    Energy Technology Data Exchange (ETDEWEB)

    Wishau, R.

    1998-05-01

    Molten salt oxidation (MSO) is proposed as a {sup 238}Pu waste treatment technology that should be developed for volume reduction and recovery of {sup 238}Pu and as an alternative to the transport and permanent disposal of {sup 238}Pu waste to the WIPP repository. In MSO technology, molten sodium carbonate salt at 800--900 C in a reaction vessel acts as a reaction media for wastes. The waste material is destroyed when injected into the molten salt, creating harmless carbon dioxide and steam and a small amount of ash in the spent salt. The spent salt can be treated using aqueous separation methods to reuse the salt and to recover 99.9% of the precious {sup 238}Pu that was in the waste. Tests of MSO technology have shown that the volume of combustible TRU waste can be reduced by a factor of at least twenty. Using this factor the present inventory of 574 TRU drums of {sup 238}Pu contaminated wastes is reduced to 30 drums. Further {sup 238}Pu waste costs of $22 million are avoided from not having to repackage 312 of the 574 drums to a drum total of more than 4,600 drums. MSO combined with aqueous processing of salts will recover approximately 1.7 kilograms of precious {sup 238}Pu valued at 4 million dollars (at $2,500/gram). Thus, installation and use of MSO technology at LANL will result in significant cost savings compared to present plans to transport and dispose {sup 238}Pu TRU waste to the WIPP site. Using a total net present value cost for the MSO project as $4.09 million over a five-year lifetime, the project can pay for itself after either recovery of 1.6 kg of Pu or through volume reduction of 818 drums or a combination of the two. These savings show a positive return on investment.

  12. Optimization of an analytical method using extraction chromatography for the determination of plutonium, americium and curium in soil samples

    International Nuclear Information System (INIS)

    An analytical method for determination of the actinides 238Pu, 239+240Pu, 241Am and 244Cm in soil samples was developed and optimized to allow specific immission measurements of radionuclides in the vicinity of the recently constructed radwaste facility at Wuerenlingen/Switzerland. Following a rapid extraction from the soil sample, as well as a preconcentration step via calcium oxalate precipitation, the actinides are separated using extraction chromatography. Separation of the actinides is carrie out applying the specific resins U/TEVA, TRU and TEVA (Eichrom Technologies IL/USA) and the anion exchange resin BioRAD 1-X2. Measurements are then performed using an α-spectrometer equipped with ion-implanted silicon charged particle detectors. For counting times of less than three days a detection limit of less than 0.05 Bq/kg is obtained for the actinides 238Pu, 239+240Pu, 241Am and 244Cm. (author)

  13. Preliminary results from uranium/americium affinity studies under experimental conditions for cesium removal from NPP ''Kozloduy'' simulated wastes solutions

    International Nuclear Information System (INIS)

    We use the approach described by Westinghouse Savannah River Company using ammonium molybdophosphate (AMP) to remove elevated concentrations of radioactive cesium to facilitate handling waste samples from NPP Kozloduy. Preliminary series of tests were carried out to determine the exact conditions for sufficient cesium removal from five simulated waste solutions with concentrations of compounds, whose complexing power complicates any subsequent processing. Simulated wastes solutions contain high concentrations of nitrates, borates, H2C2O4, ethylenediaminetetraacetate (EDTA) and Citric acid, according to the composition of the real waste from the NPP. On this basis a laboratory treatment protocol was created. This experiment is a preparation for the analysis of real waste samples. In this sense the results are preliminary. Unwanted removal of non-cesium radioactive species from simulated waste solutions was studied with gamma spectrometry with the aim to find a compromise between on the one hand the AMP effectiveness and on the other hand unwanted affinity to AMP of Uranium and Americium. Success for the treatment protocol is defined by proving minimal uptake of U and Am, while at the same time demonstrating good removal effectiveness through the use of AMP. Uptake of U and Am were determined as influenced by oxidizing agents at nitric acid concentrations, proposed by Savannah River National laboratory. It was found that AMP does not significantly remove U and Am when concentration of oxidizing agents is more than 0.1M for simulated waste solutions and for contact times inherent in laboratory treatment protocol. Uranium and Americium affinity under experimental conditions for cesium removal were evaluated from gamma spectrometric data. Results are given for the model experiment and an approach for the real waste analysis is chosen. Under our experimental conditions simulated wastes solutions showed minimal affinity to AMP when U and Am are most probably in the

  14. Recovery of 238PuO2 by Molten Salt Oxidation Processing of 238PuO2 Contaminated Combustibles (Part II)

    International Nuclear Information System (INIS)

    Pu-238 heat sources are used to fuel radioisotope thermoelectric generators (RTG) used in space missions. The demand for this fuel is increasing, yet there are currently no domestic sources of this material. Much of the fuel is material reprocessed from other sources. One rich source of Pu-238 residual material is that from contaminated combustible materials, such as cheesecloth, ion exchange resins and plastics. From both waste minimization and production efficiency standpoints, the best solution is to recover this material. One way to accomplish separation of the organic component from these residues is a flameless oxidation process using molten salt as the matrix for the breakdown of the organic to carbon dioxide and water. The plutonium is retained in the salt, and can be recovered by dissolution of the carbonate salt in an aqueous solution, leaving the insoluble oxide behind. Further aqueous scrap recovery processing is used to purify the plutonium oxide. Recovery of the plutonium from contaminated combustibles achieves two important goals. First, it increases the inventory of Pu-238 available for heat source fabrication. Second, it is a significant waste minimization process. Because of its thermal activity (0.567 W per gram), combustibles must be packaged for disposition with much lower amounts of Pu-238 per drum than other waste types. Specifically, cheesecloth residues in the form of pyrolyzed ash (for stabilization) are being stored for eventual recovery of the plutonium

  15. Recovery of 238PuO2 by Molten Salt Oxidation Processing of 238PuO2 Contaminated Combustibles (Part II)

    Science.gov (United States)

    Remerowski, Mary Lynn; Dozhier, C.; Krenek, K.; VanPelt, C. E.; Reimus, M. A.; Spengler, D.; Matonic, J.; Garcia, L.; Rios, E.; Sandoval, F.; Herman, D.; Hart, R.; Ewing, B.; Lovato, M.; Romero, J. P.

    2005-02-01

    Pu-238 heat sources are used to fuel radioisotope thermoelectric generators (RTG) used in space missions. The demand for this fuel is increasing, yet there are currently no domestic sources of this material. Much of the fuel is material reprocessed from other sources. One rich source of Pu-238 residual material is that from contaminated combustible materials, such as cheesecloth, ion exchange resins and plastics. From both waste minimization and production efficiency standpoints, the best solution is to recover this material. One way to accomplish separation of the organic component from these residues is a flameless oxidation process using molten salt as the matrix for the breakdown of the organic to carbon dioxide and water. The plutonium is retained in the salt, and can be recovered by dissolution of the carbonate salt in an aqueous solution, leaving the insoluble oxide behind. Further aqueous scrap recovery processing is used to purify the plutonium oxide. Recovery of the plutonium from contaminated combustibles achieves two important goals. First, it increases the inventory of Pu-238 available for heat source fabrication. Second, it is a significant waste minimization process. Because of its thermal activity (0.567 W per gram), combustibles must be packaged for disposition with much lower amounts of Pu-238 per drum than other waste types. Specifically, cheesecloth residues in the form of pyrolyzed ash (for stabilization) are being stored for eventual recovery of the plutonium.

  16. Coulomb fission of 238U in the interaction of 24.3 MeV/nucleon 238U with 197Au

    International Nuclear Information System (INIS)

    Coulomb fission of 238U has been studied in the interaction of a 24.3 MeV/nucleon U beam with an Au target. A novel experimental approach is followed, allowing to isolate the Coulomb fission from the nuclear fission on an event by event basis. The Z distribution of the fragments is studied for both fission processes. (author)

  17. Mechanical behavior of 238UO2, 238PuO2, and 239PuO2 as a function of strain rate and temperature

    International Nuclear Information System (INIS)

    The mechanical response of 238UO2 was measured as a function of strain rate and temperature. We evaluated material produced by two processing schedules: hot pressing followed by a grain stabilization; and cold pressing plus a sintering treatment. The response of these two materials was identical, within the scatter of our data. We complemented our data with that published in the literature, after having made the appropriate corrections for grain size, porosity, and stoichiometry. The entire collection of data was used to evaluate the Follansbee-Kocks mechanical threshold stress (MTS) model for the prediction of yield stress as a function of strain rate and temperature. We used this model to predict the yield stress of 238UO2 for strain rates between var-epsilon = 10-5 and 103 s-1 and temperatures from 800 to 1600C. These predictions provided the basis for constructing a deformation/fracture map for both urania and plutonia. Examination of the maps indicates that for compressive loading and impact strain rates, the 238UO2 will be an excellent mock material for 238PuO2. Under these conditions both the strength and deformation and the fracture modes are consistent between these two materials

  18. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    Energy Technology Data Exchange (ETDEWEB)

    Burns, P.A.; Cooper, M.B.; Lokan, K.H.; Wilks, M.J.; Williams, G.A. [Australian Radiation Lab., Melbourne, VIC (Australia)

    1995-11-01

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ``one point`` safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author).

  19. Characterization of a Sealed Americium-Beryllium (AmBe) Source by Inductively Coupled Plasma Mass Spectrometry

    International Nuclear Information System (INIS)

    Two Americium-Beryllium neutron sources were dismantled, sampled (sub-sampled) and analyzed via inductively coupled plasma mass spectrometry (ICP-MS). Characteristics such as 'age' since purification, actinide content, trace metal content and inter and intra source composition were determined. The 'age' since purification of the two sources was determined to be 25.0 and 25.4 years, respectively. The systematic errors in the 'age' determination were ± 4 % 2s. The amount and isotopic composition of U and Pu varied substantially between the sub-samples of Source 2 (n=8). This may be due to the physical means of sub-sampling or the way the source was manufactured. Source 1 was much more consistent in terms of content and isotopic composition (n=3 sub-samples). The Be-Am ratio varied greatly between the two sources. Source 1 had an Am-Be ratio of 6.3 ± 52 % (1s). Source 2 had an Am-Be ratio of 9.81 ± 3.5 % (1s). In addition, the trace element content between the samples varied greatly. Significant differences were determined between Source 1 and 2 for Sc, Sr, Y, Zr, Mo, Ba and W.

  20. Use of radioanalytical methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in radioactive wastes

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI + EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI + EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  1. Use of radioactive methods for determination of uranium, neptunium, plutonium, americium and curium isotopes in waste radioactive

    International Nuclear Information System (INIS)

    Activated charcoal is a common type of radioactive waste that contains high concentrations of fission and activation products. The management of this waste includes its characterization aiming the determination and quantification of the specific radionuclides including those known as Difficult-to-Measure Radionuclides (RDM). The analysis of the RDM's generally involves complex radiochemical analysis for purification and separation of the radionuclides, which are expensive and time-consuming. The objective of this work was to define a methodology for sequential analysis of the isotopes of uranium, neptunium, plutonium, americium and curium present in a type of radioactive waste, evaluating chemical yield, analysis of time spent, amount of secondary waste generated and cost. Three methodologies were compared and validated that employ ion exchange (TI+EC), extraction chromatography (EC) and extraction with polymers (ECP). The waste chosen was the activated charcoal from the purification system of primary circuit water cooling the reactor IEA-R1. The charcoal samples were dissolved by acid digestion followed by purification and separation of isotopes with ion exchange resins, extraction and chromatographic extraction polymers. Isotopes were analyzed on an alpha spectrometer, equipped with surface barrier detectors. The chemical yields were satisfactory for the methods TI+EC and EC. ECP method was comparable with those methods only for uranium. Statistical analysis as well the analysis of time spent, amount of secondary waste generated and cost revealed that EC method is the most effective for identifying and quantifying U, Np, Pu, Am and Cm present in charcoal. (author)

  2. Migration of the fission products strontium, technetium, iodine, cesium, and the actinides neptunium, plutonium, americium in granitic rock

    International Nuclear Information System (INIS)

    Rock samples were taken from drilling cores in granitic and granodioritic rock, and small (2x2x2 cm) rock tablets from the drilling cores were exposed to a groundwater solution containing one of the studied elements at race levels. The concentration of the element versus penetration depth in the rock tablet was measured radiometrically. The sorption on the mineral faces and the migration into the rock was studied, by an autoradiographic technique. The cationic fission products strontium and cesium had apparent diffusivities of 10-13-10-14 m2/s. They migrate mainly in fissures or filled fractures containing e.g., calcite, epidote or chlorite or in veins with hgih capacity minerals (e.g. biotite). The anionic fission products iodine and technetium had apparent diffusivities of about 10-14 m2/s. These species migrate along mineral boundaries and in open fractures and to a minor extent in high capacity mineral veins. The migration of the actinides neptunium, plutonium and americium is very slow (in the mm-range after 2-3 years contact time). The apparent diffusivities were about 10-15 m2/s. The actinide migration into the rock was largely confined to fissures. (orig./HP)

  3. Distribution of plutonium, americium, and several rare earth fission product elements between liquid cadmium and LiCl-KCl eutectic

    International Nuclear Information System (INIS)

    Separation factors were measured that describe the partition between molten cadmium and molten LiCl-KCl eutectic of plutonium, americium, praseodymium, neodymium, cerium, lanthanum, gadolinium, dysprosium, and yttrium. The temperature range was 753-788 K, and the range of concentrations was that allowed by the sensitivity of the chemical analysis methods. Mean separation factors were derived for Am-Pu, Nd-Am, Nd-Pu, Nd-Pr, Gd-La, Dy-La, La-Ce, La-Nd, Y-La, and Y-Nd. Where previously published data were available, agreement was good. For convenience, the following series of separation factors relative to plutonium was derived by combining the measured separation factors: Pu, 1.00 (basis); Am, 1.54; Pr, 22.0; Nd, 23.4; Ce, 26; La, 70; Gd, 77; Dy, 270; Y, 3000. These data are used in calculating the distribution of the actinide and rare earth elements in the prochemical reprocessing of spent fuel from the Integral Fast Reactor. (orig.)

  4. Characteristics of plutonium and americium contamination at the former U.K. atomic weapons test ranges at Maralinga and Emu

    International Nuclear Information System (INIS)

    Physico-chemical studies on environmental plutonium are described, which provide data integral to an assessment of dose for the inhalation of artificial actinides by Australian Aborigines living a semi-traditional lifestyle at Maralinga and Emu, sites of U.K. atomic weapons tests between 1953 and 1963. The most significant area, from a radiological perspective, is the area contaminated by plutonium in a series of ''one point'' safety trials in which large quantities of plutonium were dispersed explosively at a location known as Taranaki. The activity distribution of plutonium and americium with particle size is quite different from the mass distribution, as a considerably higher proportion of the activity is contained in the finer (inhalable) fraction than of the mass. Except in areas which were disturbed through ploughing during a cleanup in 1967, most the activity remains in the top 1 cm of the surface. Much of the activity is in particulate form, even at distances > 20 km from the firing sites, and discrete particles have been located even at distances beyond 100 km. Data are presented which permit the assessment of annual committed doses through the inhalation pathway, for Aborigines living a semi-traditional lifestyle in the areas affected by the Taranaki firings in particular. (author)

  5. Measured solubilities and speciations of neptunium, plutonium, and americium in a typical groundwater (J-13) from the Yucca Mountain region

    International Nuclear Information System (INIS)

    Solubility and speciation data are important in understanding aqueous radionuclide transport through the geosphere. They define the source term for transport retardation processes such as sorption and colloid formation. Solubility and speciation data are useful in verifying the validity of geochemical codes that are part of predictive transport models. Results are presented from solubility and speciation experiments of 237NpO2+, 239Pu4+, 241Am3+/Nd3+, and 243Am3+ in J-13 groundwater (from the Yucca Mountain region, Nevada, which is being investigated as a potential high-level nuclear waste disposal site) at three different temperatures (25 degree, 60 degree, and 90 degree C) and pH values (5.9, 7.0, and 8.5). The solubility-controlling steady-state solids were identified and the speciation and/or oxidation states present in the supernatant solutions were determined. The neptunium solubility decreased with increasing temperature and pH. Plutonium concentrations decreased with increasing temperature and showed no trend with pH. The americium solutions showed no clear solubility trend with increasing temperature and increasing pH

  6. Fractionation of 238U/235U by reduction during low temperature uranium mineralisation processes

    Science.gov (United States)

    Murphy, Melissa J.; Stirling, Claudine H.; Kaltenbach, Angela; Turner, Simon P.; Schaefer, Bruce F.

    2014-02-01

    Investigations of ‘stable’ uranium isotope fractionation during low temperature, redox transformations may provide new insights into the usefulness of the 238U/235U isotope system as a tracer of palaeoredox processes. Sandstone-hosted uranium deposits accumulate at an oxidation/reduction interface within an aquifer from the low temperature reduction of soluble U(VI) complexes in groundwaters, forming insoluble U(IV) minerals. This setting provides an ideal environment in which to investigate the effects of redox transformations on 238U/235U fractionation. Here we present the first coupled measurements of 238U/235U isotopic compositions and U concentrations for groundwaters and mineralised sediment samples from the same redox system in the vicinity of the high-grade Pepegoona sandstone-hosted uranium deposit, Australia. The mineralised sediment samples display extremely variable 238U/235U ratios (herein expressed as δUCRM145238, the per-mil deviation from the international NBL standard CRM145). The majority of mineralised sediment samples have δUCRM145238 values between -1.30±0.05 and 0.55±0.12‰, spanning a ca. 2‰ range. However, one sample has an unusually light isotopic composition of -4.13±0.05‰, which suggests a total range of U isotopic variability of up to ca. 5‰, the largest variation found thus far in a single natural redox system. The 238U/235U isotopic signature of the mineralised sediments becomes progressively heavier (enriched in 238U) along the groundwater flow path. The groundwaters show a greater than 2‰ variation in their 238U/235U ratios, ranging from δUCRM145238 values of -2.39±0.07 to -0.71±0.05‰. The majority of the groundwater data exhibit a clear systematic relationship between 238U/235U isotopic composition and U concentration; samples with the lowest U concentrations have the lowest 238U/235U ratios. The preferential incorporation of 238U during reduction of U(VI) to U(IV) and precipitation of uranium minerals leaves

  7. Settling standards for body content of 238Pu in man based on animal experimentation

    International Nuclear Information System (INIS)

    The paper is devoted to an urgent problem of radiation medicine, that of setting standards for body content of 238Pu which is of great practical significance. The analysis is based on literature and experimental findings of the authors on the 238Pu metabolism and biological effect for a wide range of doses on 4 animal species: mice, rats, rabbits and monkey. The report consists of two parts. The first deals with experimental results on body distribution of 238Pu, its elimination kinetics, and microdistribution in organs and tissues following intratracheal administration. In the second, characteristics of the radionuclide's biological effect are considered. General regularities for different animal species, as well as some specific peculiarities are established. Some interest are data on 238Pu microdistribution, on mechanisms and consequences of damage relative to changes in the lung tumour spectrum as influenced by the activity administered. Data for the damaging effect of α-radiation on the thymus structure due to relatively low absorbed doses are presented. Late effects of the incorporated 238Pu are studied in detail blastomogenic effect being the most significant. The incidence, latent period, and tumour spectrum are shown to depend on the activity administered. The analysis of experimental evidence suggests that damage of bone marrow stem cells due to low doses of 238Pu results in haematopoietic and lymphoid tissues tumours at late times. The significance of regulatory system damage for tumour genesis is discussed. The data obtained by the authors and clinical observations of lung tumours in uranium miners served as a basis for comparison of lung and bone radiosensitivities, and conclusion that susceptibilities of the rat and human lung tissues to α-radiation are similar, thus permitting direct extrapolation to man of experimental findings on carcinogenic effect of the incorporated 238Pu. From the analysis made, the authors conclude that safety factors of the

  8. 49 CFR Figure 2 to Subpart B of... - Example of a Multi-Level Car Complying with Window Location and Staggering Requirements-§§ 238...

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Example of a Multi-Level Car Complying with Window Location and Staggering Requirements-§§ 238.113 and 238.114 2 Figure 2 to Subpart B of Part 238... Window Location and Staggering Requirements—§§ 238.113 and 238.114 ER01FE08.005...

  9. Radiationless transition probabilities in muonic 208Pb, 232Th, and 238U

    International Nuclear Information System (INIS)

    The probabilities for non-radiative (n.r.) excitations Pn.r. in the muonic nuclides 208Pb, 232Th, and 238U have been determined for (μ-, γγ)-measurements by comparing the intensities of muonic X-ray transitions in single and coincidence spectra. The value of Pn.r. (3p→1s), measured for the first time, is about 90% for the actinides 232Th and 238U, but only about 8% for 208Pb. The value of Pn.r. (3d→1s) is found to be 10% for 233Th, 13% for 238U, and about 4% for 208Pb. For 208Pb a vanishing strength of the n.r. decay of the 2p-level is found, while for 232Th and for 238U n.r. strengths of about 20% and 26%, respectively, are observed. By regarding two subcomplexes of the 2p→1s transitions leading to different mean excitation energies the n.r. transition probabilities were found to be different for 238U only, 21.6% and 31.1%, respectively. (orig.)

  10. Fission fragment mass and angular distribution in 6,7Li+235,238U reactions

    International Nuclear Information System (INIS)

    Fission fragment (FF) angular distributions for 6,7Li+235,238U reactions and mass distributions for 6,7Li+ 238U reactions have been measured at energies near and above the Coulomb barrier. The angle integrated fission cross sections for 6Li induced reactions at sub-barrier energies are found to be higher than 7Li induced reactions possibly due to larger contribution of breakup induced fission in case of the former compared to the latter. The FF anisotropy for 6,7Li+235U was found to be smaller than 6,7Li+238U, manifesting the effect of target ground state spin. The statistical saddle point (SSP) model predictions were found to be consistent with the measured FF anisotropy for 6,7Li+235U, however they were under-estimated for 6,7Li+238U particularly at lower energies. Observation of larger FWHM of FF folding angle distribution and sharp increase in peak to valley ratio for FF mass distribution with the decrease in bombarding energy in 6,7Li+238U reactions confirms the presence of breakup induced fission. (authors)

  11. Fission fragment mass and angular distribution in 6,7Li+235,238U reactions

    Directory of Open Access Journals (Sweden)

    Santra S.

    2013-12-01

    Full Text Available Fission fragment (FF angular distributions for 6,7Li+235,238U reactions and mass distributions for 6,7Li+238U reactions have been measured at energies near and above the Coulomb barrier. The angle integrated fission cross sections for 6Li induced reactions at sub-barrier energies are found to be higher than 7Li induced reactions possibly due to larger contribution of breakup induced fission in case of the former compared to the latter. The FF anisotropy for 6,7Li+235U was found to be smaller than 6,7Li+238U, manifesting the effect of target ground state spin. The statistical saddle point (SSP model predictions were found to be consistent with the measured FF anisotropy for 6,7Li+235U, however they were under-estimated for 6,7Li+238U particularly at lower energies. Observation of larger FWHM of FF folding angle distribution and sharp increase in peak to valley ratio for FF mass distribution with the decrease in bombarding energy in 6,7Li+238U reactions confirms the presence of breakup induced fission.

  12. Summary of the work of the NEANDC task force on U-238

    International Nuclear Information System (INIS)

    The work of the Nuclear Energy Agency Nuclear Data Committee (NEANDC) Task Force on U-238 is summarised. The Task Force was set up in 1982 to consider two discrepancies in U-238 data - the neutron widths of the resolved resonance above 1.4 keV and the capture cross-section in the resolved and unresolved resonance regions. The work is summarised historically and to put the activities of the Task Force into context the paper starts with a brief description of the methods and data used to determine U-238 resonance parameters. It follows with a description of the state of the data in 1982 and then describes the work of the Task Force in the period up to 1985, the period during which the Task Force found the reasons for the discrepancies. Consideration is then given to the period following 1985 during which resonance analysis on U-238 has been performed and a recommended set of parameters covering the energy range 0-10 keV produced. These are listed in an appendix to the paper and are now included in the U-238 evaluations contained in JEF-2 and ENDF/B-VI. Finally a review is given of the main conclusions of the Task Force followed by a list of work still requiring to be done. (author). 15 figs., 10 tabs., 49 refs., 3 appendix

  13. (234)U/(238)U signatures associated with uranium ore bodies: part 3 Koongarra.

    Science.gov (United States)

    Lowson, Richard T

    2013-04-01

    The Koongarra ore body is an early Proterozoic U ore body in the Alligator Rivers U province, Northern Territory, Australia. It has surface expression with a redox front located ∼30 m below the surface. The (234)U/(238)U activity ratios (AR) for the ground water and the amorphous phase of the solid have been analysed for the ore zone and dispersion halo as a function of depth. The results display a (234)U/(238)U AR signature with depth which may be common to all U ore bodies. The (234)U/(238)U AR is depressed below secular equilibrium in the weathered material above the redox front; rises significantly above secular equilibrium in the vicinity of the redox front; and is followed by a gradual decrease with depth below the redox front. The amplitude of the profile is a function of local conditions. A model is proposed for the signature in which oxidising waters preferentially leach the (234)U sites at the redox front due to preconditioning of the (234)U sites by α recoil during the decay of (23)(8)U to (23)(4)U. Mass balance requires the solid material left behind the redox front to have a (234)U/(238)U AR reduced below 1. Local second order effects may be superimposed on the signature. The signature may have application to calibrating scenarios for nuclear waste repositories, assisting in understanding historical climates, economic evaluation of U ore bodies and U exploration. PMID:23142336

  14. Application of a canine 238Pu biokinetics/dosimetry model to human bioassay data.

    Science.gov (United States)

    Hickman, A W; Griffith, W C; Roessler, G S; Guilmette, R A

    1995-03-01

    Associated with the use of 238Pu in thermoelectric power sources for space probes is the potential for human exposure, primarily by inhalation and most likely as 238PuO2. Several models have been developed for assessing the level of intake and predicting the resulting radiation dose following human exposure to 239Pu. However, there are indications that existing models do not adequately describe the disposition and dosimetry of 238Pu following human exposure. In this study, a canine model that accounts for these differences has been adapted for use with human excretion data. The model is based on existing knowledge about organ retention of plutonium. An analysis of the sensitivity of the model to changes in aerosol-associated properties indicated that predictions of urinary excretion are most sensitive to changes in particle solubility and diameter and in the ratio of fragment:particle surface area. Application of the model to urinary excretion data from seven workers exposed to a 238Pu ceramic aerosol gave estimated intakes of 390-8,200 Bq and associated initial pulmonary burdens of 80-1,700 Bq. The resulting 50-y dose commitments to critical organs per Bq of 238Pu intake were estimated to be 0.5 mSv for the thoracic region, 0.2 mSv for the liver, and 1 mSv for the bone surfaces. PMID:7860307

  15. Hematological responses after inhaling {sup 238}PuO{sub 2}: An extrapolation from beagle dogs to humans

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.; Muggenburg, B.A.; Welsh, C.A.; Angerstein, D.A.

    1994-11-01

    The alpha emitter plutonium-238 ({sup 238}Pu), which is produced in uranium-fueled, light-water reactors, is used as a thermoelectric power source for space applications. Inhalation of a mixed oxide form of Pu is the most likely mode of exposure of workers and the general public. Occupational exposures to {sup 238}PuO{sub 2} have occurred in association with the fabrication of radioisotope thermoelectric generators. Organs and tissue at risk for deterministic and stochastic effects of {sup 238}Pu-alpha irradiation include the lung, liver, skeleton, and lymphatic tissue. Little has been reported about the effects of inhaled {sup 238}PuO{sub 2} on peripheral blood cell counts in humans. The purpose of this study was to investigate hematological responses after a single inhalation exposure of Beagle dogs to alpha-emitting {sup 238}PuO{sub 2} particles and to extrapolate results to humans.

  16. Generation of 238U Covariance Matrices by Using the Integral Data Assimilation Technique of the CONRAD Code

    OpenAIRE

    Privas E.; Archier P.; Bernard D.; Jean C. De Saint; Destouche C.; Leconte P.; Noguère G.; Peneliau Y.; Capote R.

    2016-01-01

    A new IAEA Coordinated Research Project (CRP) aims to test, validate and improve the IRDF library. Among the isotopes of interest, the modelisation of the 238U capture and fission cross sections represents a challenging task. A new description of the 238U neutrons induced reactions in the fast energy range is within progress in the frame of an IAEA evaluation consortium. The Nuclear Data group of Cadarache participates in this effort utilizing the 238U spectral indices measurements and Post I...

  17. Adsorption of Cs-137 and U-238 in semi-arid soils; Adsorcion de Cs-137 y U-238 en suelos semiaridos

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez T, U. O. [Instituto Tecnologico de Toluca, Av. Tecnologico s/n, 52140 Metepec, Estado de Mexico (Mexico); Monroy G, F.; Anguiano A, J. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Fernandez R, E., E-mail: uohtrejo@gmail.com [Universidad Politecnica del Valle de Toluca, Carretera Toluca-Almoloya de Juarez Km. 5.6, Santiaguito Tlalcilalcali, Estado de Mexico (Mexico)

    2013-10-15

    Is of great importance to determine the adsorption properties of the soils where radioactive wastes are stored, fundamentally of the radioisotopes contained in these wastes, with the purpose of knowing like will be their behavior in the event of happening radionuclide migration toward the surrounding means. Therefore, in this work the adsorption properties of {sup 137}Cs{sup +} and {sup 238}UO{sub 2}{sup 2+} in soils coming from the Storage Center of Radioactive Wastes are studied. Was studied the effect of the soil type and the particle size of the soil in the adsorption properties of Cs (I) and U (Vi). 13 soil samples and six different particle sizes were analyzed. The adsorption studies were carried out by the radiotracers technique in static way. The results indicate an important adsorption affinity toward the Cs-137 and a very vulnerable affinity for the {sup 238}UO{sub 2}{sup 2+}. (author)

  18. 238U, 226Ra and 210Pb in some vent waters of the Galapagos spreading center

    International Nuclear Information System (INIS)

    The concentrations of 226Ra, 238U and 210Pb have been measured in waters from the Mussel Bed and the Rose Garden thermal fields at the Galapagos spreading center over a temperature range of approx.2.5--16 0C. The 226Ra-T plots yield slopes of 0.112 and 0.036 dpm/kg 0C for the Mussel Bed and the Rose Garden respectively yielding a global hydrothermal 226Ra flux less than 5% of that required to sustain the oceanic inventory. 238U concentration in waters 0C is the same as that in ambient sea water whereas water hotter than approx.9 0C shows a decreasing trend with temperature to zero 238U at approx.29 0C. 210Pb concentration in Mussel Bed increases with temperature, and extrapolated to approx.350 0C yields a 210Pb concentration considerably less than that expected from 222Rn decay and basalt alteration

  19. Fabrication of gamma sources using the neutron-gamma reactions of 238Pu13C

    International Nuclear Information System (INIS)

    A production campaign for 238Pu13C sources with gamma fluence ranging from 2500 to 4500 gamma/s/4π at 6.13 MeV was carried out in 2002 in Atalante. An experimental study was undertaken to prepare the 238PuC mixture, which is the most delicate step. This procedure is described together with the other steps in the source fabrication process: purification of a plutonium oxide batch, preparation of a nitric solution of 238Pu, measurement of the gamma fluence of the PuC mixture before and after insertion into each of the two stainless steel capsules that constitute a PuN2O package, welding of the second envelope followed by leak testing, final measurement of the gamma fluence of the sealed source. This PuC sources fabrication procedure is effective: all the sources include the required gamma activity with an uncertainty on the gamma fluence of less than 10%. (authors)

  20. Transmission Nuclear Resonance Fluorescence Measurements of 238U in Thick Targets

    Energy Technology Data Exchange (ETDEWEB)

    Quiter, Brian J.; Ludewigt, Bernhard A.; Mozin, Vladimir V.; Wilson, Cody; Korbly, Steve

    2010-08-31

    Transmission nuclear resonance fluorescence measurements were made on targets consisting of Pb and depleted U with total areal densities near 86 g/cm2. The 238U content n the targets varied from 0 to 8.5percent (atom fraction). The experiment demonstrates the capability of using transmission measurements as a non-destructive technique to identify and quantify the presence of an isotope in samples with thicknesses comparable to he average thickness of a nuclear fuel assembly. The experimental data also appear to demonstrate the process of notch refilling with a predictable intensity. Comparison of measured spectra to previous backscatter 238U measurements indicates general agreement in observed excited states. Two new 238U excited states and possibly a third state have also been observed.

  1. 238PuO2 Fuel and Dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Mayo, Douglas R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Rawool-Sullivan, Mohini [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Garner, Scott Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wenz, Tracy R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-01

    238Pu is an ideal material for use as a heat source with its half-life of 87.7 years and copious particle emissions. 238Pu radioisotope thermoelectric generators (RTGs) have found use for pacemakers, Apollo Space missions, Mars rovers, and Voyager spacecraft. In evaluating the dose to personnel and components near a 238Pu-based RTG, a number of additional nuclides and their daughter products must be considered to get an accurate estimate for γ-dose, and the amount of 17O and 18O for the neutron-dose must be considered. This paper looks at the contributing nuclides and their daughter products that add the most to the dose rates.

  2. Radiological impact from atmospheric releases of 238U and 226Ra from phosphate rock processing plants

    International Nuclear Information System (INIS)

    Phosphate rocks are used extensively, mainly as a source of phosphorus for fertilizers and secondly for phosphoric acid and gypsum (phosphogypsum). Phosphates are, therefore one of the sources of technologically enhanced exposure to man from natural radionuclides (TENR). Emissions from phosphate rocks processing plants in gaseous and particulate form contain radioisotopes, such as 238U and 226Ra, which are discharged into the environment causing radiation exposures to the population. About 10 MBq of 238U and 226Ra, respectively, are discharged to the environment each year from a phosphate rocks processing plant in Thessaloniki area, Northern Greece. The collective dose commitment to lung tissue resulting from atmospheric release was estimated to be ∼2x10-9 man Gy t-1 for 238U and ∼0.1x10-9 Plan Gy t-1 for 226Ra, i.e. about 2 times higher than that reported in UNSCEAR 1992 Report. (author)

  3. The role of natural organic matter in the migration behaviour of americium in the Boom Clay - Part 1: migration experiments

    International Nuclear Information System (INIS)

    Full text of publication follows: In demonstrating the suitability of Boom Clay as reference site for studying the disposal of radioactive waste, the role of the relatively high amount of Natural Organic Matter (NOM) present in the Boom Clay on the mobility of critical radionuclides needs to be investigated thoroughly. It is generally accepted that trivalent actinides and lanthanides form strong complexes with humic substances. Complexation of these trivalent radionuclides with NOM present in the Boom Clay may therefore have two opposite effects. If complexed by the aqueous phase NOM (the mobile NOM), the radionuclide transport will be governed by the mobility of these dissolved radionuclide- NOM species. If complexed by the solid phase NOM (the immobile NOM) the migration will be retarded. One of the aims of the EC projects TRANCOM-Clay and TRANCOM-II was to investigate the role of mobile NOM as radionuclide carrier in order to develop a conceptual model for inclusion in a performance assessment (PA) model. The migration behaviour of Americium (used as an analogue for the critical radionuclide Pu) was investigated by complexing 241Am with radiolabelled (14C-labelled) NOM before passing through undisturbed Boom Clay cores contained in columns. The use of two different radionuclides, allows the migration behaviour of both the NOM and the Am to be followed. The results of the migration experiments showed that the Am-NOM complexes dissociated when they came into contact with Boom Clay and that the bulk of Am became immobilised (either as Am complexed to immobile NOM or sorbed to the mineral phase). Only a small percentage of the complex persisted as 'stabilised' Am-OM complex which exhibited slow dissociation kinetics upon moving through the Boom Clay. When the applied radionuclide source also contains Am in the form of an inorganic solid phase (when Am is applied above the solubility limit), a continuous source of Am exists to form 'temporarily stabilised' Am

  4. Molten salt extraction (MSE) of americium from plutonium metal in CaCl2-KCl-PuCl3 and CaCl2-PuCl3 salt systems

    International Nuclear Information System (INIS)

    Molten salt extraction (MSE) of americium-241 from reactor-grade plutonium has been developed using plutonium trichloride salt in stationary furnaces. Batch runs with oxidized and oxide-free metal have been conducted at temperature ranges between 750 and 945C, and plutonium trichloride concentrations from one to one hundred mole percent. Salt-to-metal ratios of 0.10, 0.15, and 0 30 were examined. The solvent salt was either eutectic 74 mole percent CaCl2 endash 26 mole percent KCl or pure CaCl2. Evidence of trivalent product americium, and effects of temperature, salt-to-metal ratio, and oxide contamination on the americium extraction efficiency are given. 24 refs, 20 figs, 13 tabs

  5. Plutonium, americium and radiocaesium in the marine environment close to the Vandellos I nuclear power plant before decommissioning

    International Nuclear Information System (INIS)

    The Vandellos nuclear power plant (NPP), releasing low-level radioactive liquid waste to the Mediterranean Sea, is the first to be decommissioned in Spain, after an incident which occurred in 1989. The presence, distribution and uptake of various artificial radionuclides (radiocaesium, plutonium and americium) in the environment close to the plant were studied in seawater, bottom sediments and biota, including Posidonia oceanica, fish, crustaceans and molluscs. Seawater, sediments and Posidonia oceanica showed enhanced levels in the close vicinity of the NPP, although the effect was restricted to its near environment. Maximum concentrations in seawater were 11.6±0.5 Bq m-3 and 16.9±1.2 mBq m-3 for 137Cs and 239,240Pu, respectively. When sediment concentrations were normalized to excess 210Pb, they showed both the short-distance transport of artificial radionuclides from the Vandellos plant and the long-distance transport of 137Cs from the Asco NPP. Posidonia oceanica showed the presence of various gamma-emitters attributed to the impact of the Chernobyl accident, on which the effect of the NPP was superimposed. Seawater, sediment and Posidonia oceanica collected near the plant also showed an enhancement of the plutonium isotopic ratio above the fallout value. The uptake of these radionuclides by marine organisms was detectable but limited. Pelagic fish showed relatively higher 137Cs concentrations and only in the case of demersal fish was the plutonium isotopic ratio increased. The reported levels constitute a set of baseline values against which the impact of the decommissioning operations of the Vandellos I NPP can be studied

  6. Recent measurements of 234U/238U isotope ratio in spring waters from the Hadzici area.

    Science.gov (United States)

    Vidic, Alfred; Ilić, Zorana; Benedik, Ljudmila

    2013-06-01

    The Hadzici area has become interesting for investigation since depleted uranium ammunition had been employed in 1995 during the NATO air strike campaign in Bosnia and Herzegovina. The purpose of this study is to determine uranium concentration and (234)U/(238)U activity ratio in the spring waters of this area and to investigate their relationship, as well as spatial variations. The spring water samples were taken at 18 sites in total. For the determination of uranium radioisotopes, radiochemical separation procedure followed by alpha-particle spectrometry was applied. Uranium concentration in analyzed waters range from 0.15 to 1.12 μg/L. Spring waters from carbonate based sediments have a lower uranium concentration of between 0.15 and 0.43 μg/L, in comparison to waters sampled within sandstone-based sediments ranging from 0.53 to 1.12 μg/L. Dissolved uranium shows significant spatial variability and correlation with bedrock type confirmed by Principal Component Analysis and Hierarchical Cluster Analysis. The majority of the analyzed waters have a (234)U/(238)U activity ratio ranging from 1.02 to 1.90, of which half of the results range between 1.02 and 1.16. No apparent depleted uranium (DU) contamination was observed, as (234)U/(238)U activity ratio is dependent on geochemical conditions in the environment. Even though the tested spring waters demonstrate significant variability in uranium concentration, (234)U/(238)U activity ratio and (234)U excess, waters with similar uranium isotopic signatures are observable within the region. The guidelines on the spatial redistribution of dissolved uranium (corresponding to (238)U mass concentration), along with (234)U/(238)U activity ratios were provided by the Inverse Distance Weighting (IDW) method. Waters having similar isotopic signature have been delineated. PMID:23410592

  7. Activity disequilibrium between 234U and 238U isotopes in natural environment

    International Nuclear Information System (INIS)

    The aim of this work was to calculate the values of the 234U/238U activity ratio in natural environment (water, sediments, Baltic organisms and marine birds from various regions of the southern Baltic Sea; river waters (the Vistula and the Oder River); plants and soils collected near phosphogypsum waste heap in Wislinka (Northern Poland) and deer-like animals from Northern Poland. On the basis of the studies it was found that the most important processes of uranium geochemical migration in the southern Baltic Sea ecosystem are the sedimentation of suspended material and the vertical diffusion from the sediments into the bottom water. Considerable values of the 234U/238U are characterized for the Vistula and Oder Rivers and its tributaries. The values of the 234U/238U activity ratio in different tissues and organs of the Baltic organisms, sea birds and wild deer are varied. Such a large variation value of obtained activity ratios indicates different behavior of uranium isotopes in the tissues and organisms of sea birds and wild animals. This value shows that uranium isotopes can be disposed at a slower or faster rate. The values of the 234U/238U activity ratio in the analyzed plants, soils and mosses collected in the vicinity of phosphogypsum dumps in Wislinka are close to one and indicate the phosphogypsum origin of the analyzed nuclides. Uranium isotopes 234U and 238U are not present in radioactive equilibrium in the aquatic environment, which indicates that their activities are not equal. The inverse relationship is observed in the terrestrial environment, where the value of the of the 234U/238U activity ratio really oscillates around unity. (author)

  8. Application of a canine {sup 238}Pu dosimetry model to human bioassay data

    Energy Technology Data Exchange (ETDEWEB)

    Hickman, A.W. Jr. [Florida Univ., Gainesville, FL (United States)

    1991-08-01

    Associated with the use of 2{sup 238}Pu in thermoelectric power sources for space probes and power supplies for cardiac devices is the potential for human exposure to {sup 238}Pu, primarily by inhalation. In the event of human internal exposure, a means is needed for assessing the level of intake and calculating radiation doses. Several bioassay/dosimetry models have been developed for {sup 239}Pu. However, results from studies with laboratory animals have indicated that the biokinetics, and therefore the descriptive models, of {sup 238}Pu are significantly different from those for {sup 239}Pu. A canine model accounting for these differences has been applied in this work to urinary excretion data from seven humans occupationally exposed to low levels of an insoluble {sup 238}Pu compound. The modified model provides a good description of the urinary excretion kinetics observed in the exposed humans. The modified model was also used to provide estimates of the initial intakes of {sup 238}Pu for the seven individuals; these estimates ranged from 4.5 nCi (170 Bq) to 87 nCi (3200 Bq). Autopsy data on the amount and distribution of {sup 238}Pu retained in the organs may be used in the future to validate or refute both these estimates and the assumptions used to formulate the human model. Modification of the human model to simulate an injection exposure to {sup 239}Pu gave patterns of retention in the organs and urinary excretion comparable to those seen previously in humans; further modification of the model using fecal data (unavailable for the subjects of this study) is indicated.

  9. Development of an Efficient Approach to Perform Neutronics Simulations for Plutonium-238 Production

    Energy Technology Data Exchange (ETDEWEB)

    Chandler, David [ORNL; Ellis, Ronald James [ORNL

    2016-01-01

    Conversion of 238Pu decay heat into usable electricity is imperative to power National Aeronautics and Space Administration (NASA) deep space exploration missions; however, the current stockpile of 238Pu is diminishing and the quality is less than ideal. In response, the US Department of Energy and NASA have undertaken a program to reestablish a domestic 238Pu production program and a technology demonstration sub-project has been initiated. Neutronics simulations for 238Pu production play a vital role in this project because the results guide reactor safety-basis, target design and optimization, and post-irradiation examination activities. A new, efficient neutronics simulation tool written in Python was developed to evaluate, with the highest fidelity possible with approved tools, the time-dependent nuclide evolution and heat deposition rates in 238Pu production targets irradiated in the High Flux Isotope Reactor (HFIR). The Python Activation and Heat Deposition Script (PAHDS) was developed specifically for experiment analysis in HFIR and couples the MCNP5 and SCALE 6.1.3 software quality assured tools to take advantage of an existing high-fidelity MCNP HFIR model, the most up-to-date ORIGEN code, and the most up-to-date nuclear data. Three cycle simulations were performed with PAHDS implementing ENDF/B-VII.0, ENDF/B-VII.1, and the Hybrid Library GPD-Rev0 cross-section libraries. The 238Pu production results were benchmarked against VESTA-obtained results and the impact of various cross-section libraries on the calculated metrics were assessed.

  10. Determination by gamma-ray spectrometry of the plutonium and americium content of the Pu/Am separation scraps. Application to molten salts; Determination par spectrometrie gamma de la teneur en plutonium et en americium de produits issus de separation Pu/Am. Application aux bains de sels

    Energy Technology Data Exchange (ETDEWEB)

    Godot, A. [CEA Valduc, Dept. de Traitement des Materiaux Nucleaires, 21 - Is-sur-Tille (France); Perot, B. [CEA Cadarache, Dept. de Technologie Nucleaire, Service de Modelisation des Transferts et Mesures Nucleaires, 13 - Saint-Paul-lez-Durance (France)

    2005-07-01

    Within the framework of plutonium recycling operations in CEA Valduc (France), americium is extracted from molten plutonium metal into a molten salt during an electrolysis process. The scraps (spent salt, cathode, and crucible) contain extracted americium and a part of plutonium. Nuclear material management requires a very accurate determination of the plutonium content. Gamma-ray spectroscopy is performed on Molten Salt Extraction (MSE) scraps located inside the glove box, in order to assess the plutonium and americium contents. The measurement accuracy is influenced by the device geometry, nuclear instrumentation, screens located between the sample and the detector, counting statistics and matrix attenuation, self-absorption within the spent salt being very important. The purpose of this study is to validate the 'infinite energy extrapolation' method employed to correct for self-attenuation, and to detect any potential bias. We present a numerical study performed with the MCNP computer code to identify the most influential parameters and some suggestions to improve the measurement accuracy. A final uncertainty of approximately 40% is achieved on the plutonium mass. (authors)

  11. The AS-76 interlaboratory experiment on the alpha spectrometric determination of Pu-238. Pt. 3

    International Nuclear Information System (INIS)

    Four plutonium samples containing 0.2, 0.8, 1.6 and 0.9 Atom% of 238Pu have been prepared for the Interlaboratory Experiment AS-76. Of these, three were input solutions from a reprocessing plant. The fourth sample was from a plutonium product solution. These samples have been characterized by two alpha spectrometry laboratories and two mass spectrometry laboratories to certify the ratio of alpha activities 238Pu/(239Pu + 240Pu) and the isotopic composition, respectively. (orig.) 891 HP/orig. 892 MKO

  12. Preparation of a 238Pu standard source . II. Source preparation and standardization

    Science.gov (United States)

    Nobuo, Shinohara; Nobuaki, Kohno

    1988-07-01

    A standard source of 238Pu was prepared for calibrating the counting efficiency of alpha-ray detector. The plutonium was electrodeposited on a platinum or tantalum disk using isopropyl alcohol-hydrochloric acid solution as an electrolyte. The absolute activity was certified by isotope dilution alpha-ray spectrometry. Several types of the source, whose areas 238Pu-deposited are from 2.0 to 25.0 mm in diameter, were also prepared by the method. The overall uncertainties of the certified values for the standard sources prepared are estimated to be within 0.15 to 0.25% (1σ).

  13. Effects of nuclear orientation on fusion and fission in the reaction using 238U target nucleus

    OpenAIRE

    Hirose K.; Hofmann S.; Ohtsuki T.; Nagame Y.; Nishinaka I.; Mitsuoka S.; Ikezoe H.; Nishio K.

    2011-01-01

    Fission fragment mass distributions in the reaction of 30Si+238U were measured around the Coulomb barrier. At the above-barrier energies, the mass distribution showed a Gaussian shape. At the subbarrier energies, triple-humped distribution was observed, which consists of symmetric fission and asymmetric fission peaked at AL/AH ≈ 90/178. The asymmetric fission should be attributed to quasifission from the results of the measured evaporation residue (ER) cross-sections for 30Si+238U. Th...

  14. Radionuclides of 210Po, 234U and 238U in drinking bottled mineral water in Poland

    International Nuclear Information System (INIS)

    A study of the radioactive content of drinking mineral bottled water in Poland was carried out. 210Po, 238U and 234U activity concentrations were determined by alpha-spectrometry with low-level-activity silicon detectors. The results revealed that the mean concentration of 210Po, 238U and 234U in analyzed water sample were 1.28, 0.80 and 0.80 mBq x dm-3, respectively. The effective doses due to the polonium and uranium emissions were calculated for bottled drinking water. (author)

  15. An isotopic analysis system for plutonium samples enriched in 238Pu

    International Nuclear Information System (INIS)

    We have designed and built a gamma-ray spectrometer system that measures the relative plutonium isotopic abundances of plutonium oxide enriched in 238Pu. The first system installed at Westinghouse Savannah River Company was tested and evaluated on plutonium oxide in stainless steel EP60/61 containers. 238Pu enrichments ranged from 20% to 85%. Results show that 200 grams of plutonium oxide in an EP60.61 container can be measured with ±0.3% precision and better than ±1.0% accuracy in the specific power using a counting time of 50 minutes. 3 refs., 2 figs

  16. Gastrointestinal absorption and retention of plutonium-238 and uranium-233 in neonatal swine

    International Nuclear Information System (INIS)

    Newborn swine absorbed as much as one-half of a gavaged dose of 238Pu nitrate within 6 to 12 hr, and another one-fourth of the dose was retained in the stomach for up to 24 hr after intragastric administration. The small intestine accumulated one-third of the dose within 36 hr. Animals gavaged between 5 and 21 days of age absorbed decreasing amounts, especially at 14 and 21 days. Absorption of 233Pu (gavaged as the nitrate) by day-old pigs was similar to that of 238Pu

  17. Inhalation exposure of ponies to aerosols of 169Yb-labeled 238PuO2

    International Nuclear Information System (INIS)

    Techniques and apparatus were developed for the exposure, maintenance, and profile scanning of Shetland-type ponies. Two ponies were exposed to monodisperse aerosols of 169Yb-labeled 238PuO2. One pony was maintained for 36 days after exposure, but had an abnormal lung which made projections about early distribution and translocation of 238Pu difficult. The ability to achieve substantial lung burdens of inhaled particulates and to perform meaningful linear profile scans in the pony was demonstrated. (U.S.)

  18. Absorption and retention of plutonium-238 nitrate and oxide in neonatal swine after inhalation

    International Nuclear Information System (INIS)

    Measurements of retention of plutonium in swine exposed to either 238Pu nitrate or oxide at 1 day of age and killed at 1 hr postexposure indicated that 38% and 52%, respectively, of the administered dose was initially deposited in the lung. Less than one-half that amount remained in the lung after 1 or 2 wk. At 7 days, most of the 238Pu inhaled as the nitrate was retained in the gut. Retention of the oxide in gut at 7 days was about 10% of the inhaled dose

  19. Measurement of resonance self-shielding factors of neutron capture cross section by 238U

    International Nuclear Information System (INIS)

    Resonance self-shielding factors fsub(c) of neutron capture cross section by 238U in the 20-100 keV energy range are measured. The method for determining the fsub(c) factor consists in measuring partial transmission and transmission in the total cross section at different 238U filter thickness. The fsub(c) factor values in the 46.5-100 and 21.5-46.5 keV energy ranges are equal to 0.89+-0.03 and 0.81+-0.04, respectively

  20. Recovery of plutonium and americium from laboratory acidic waste solutions using tri-n-octylamine and octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide.

    Science.gov (United States)

    Michael, K M; Rizvi, G H; Mathur, J N; Kapoor, S C; Ramanujam, A; Iyer, R H

    1997-11-01

    Plutonium from acidic waste solutions has been recovered quantitatively using tri-n-octylamine (TnOA) in xylene and americium using a mixture of octylphenyl-N-N- diisobutylcarbamoylmethylphosphine oxide (CMPO) and TBP in dodecane by extraction and extraction chromatographic methods. The Pu ( IV ) TnOA species extracted into the organic phase from higher nitric acid concentrations has been confirmed as (R(3)NH)(2)Pu(NO(3))(6) (where R(3)N = TnOA by employing slope analysis as well as spectrophotometric studies. PMID:18966958

  1. Theoretical investigation of pressure-induced structural transitions in americium using GGA+U and hybrid density functional theory methods

    DEFF Research Database (Denmark)

    Verma, Ashok K.; Modak, P.; Sharma, Surinder M.;

    2013-01-01

    First-principles calculations have been performed for americium (Am) metal using the generalized gradient approximation + orbital-dependent onsite Coulomb repulsion via Hubbard interaction (GGA+U) and hybrid density functional theory (HYB-DFT) methods to investigate various ground state properties...... phase in order to match the experimental data. Thus, neither the GGA+U nor the HYB-DFT methods are able to describe the energetics of Am metal properly in the entire pressure range from 0 GPa to 50 GPa with a single choice of their respectiveU and α parameters. Low binding-energy peaks in the...

  2. Dissertation on the computer-based exploitation of a coincidence multi parametric recording. Application to the study of the disintegration scheme of Americium 241

    International Nuclear Information System (INIS)

    After having presented the meaning of disintegration scheme (alpha and gamma emissions, internal conversion, mean lifetime), the author highlights the benefits of the use of multi-parametric chain for the recording of correlated parameters, and of the use of a computer for the analysis of bi-parametric information based on contour lines. Using the example of Americium 241, the author shows how these information are obtained (alpha and gamma spectrometry, time measurement), how they are chosen, coded, analysed and stored, and then processed by contour lines

  3. Uptake of curium (244Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    International Nuclear Information System (INIS)

    Curium (244Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium. (author)

  4. Uptake of curium (/sup 244/Cm) by five benthic marine species (Arenicola marina, Cerastoderma edule, Corophium volutator, Nereis diversicolor and Scrobicularia plana): comparison with americium and plutonium

    Energy Technology Data Exchange (ETDEWEB)

    Miramand, P.; Germain, P.; Arzur, J.C.

    1987-01-01

    Curium (/sup 244/Cm) uptake from contaminated sea water was studied in five benthic marine species: two bivalve molluscs (Scrobicularia plana and Cerastoderma edule), two polychaete annelids (Arenicola marina and Nereis diversicolor) and one amphidpod crustacean (Corophium volutator). The concentrations in the whole organisms relative to the concentration in the sea water (concentration factors) were: 700 for the amphipods (after 11 d of accumulation), 140 for the cockles (after 28 d), 80 for the scrobicularia (after 23d) and approx. 30 for the two annelids (after > 20 d). All species except S. plana accumulated americium and curium similarly; S. plana accumulated similar amounts of curium and plutonium.

  5. Concentration and speciation of plutonium, americium, uranium, thorium, potassium and 137Cs in a venice canal sediment sample

    Science.gov (United States)

    Testa, C.; Desideri, D.; Guerra, F.; Meli, M. A.; Roselli, C.; Degetto, S.

    1999-01-01

    A sequential extraction method consisting of six operationally-defined fractions has been developed for determining the geochemical partitioning of natural (U, Th, 40K) and antropogenic (Pu, Am, 137Cs) radionuclides in a 40-50 cm deep sediment sample collected in a Venice canal. Extraction chromatography with Microthene-TOPO (U, Th), Microthene-TNOA (Pu) and Microthene-HDEHP (Am) column was used for the chemical separation of a single radionuclide; the final recoveries were calculated by adding 236U, 229Th, 242Pu and 243Am as the yield tracers. After electrodeposition the alpha spectrometry was carried out. 137Cs and 40K were measured by gamma spectrometry. The total concentrations in the wet sample (Bq/kgd), obtained by a complete disgregation of the matrix by wet and dry treatment, were the following: 239+240Pu=1.03±0.07, 238Pu=0.022±0.005, 241Am=0.337±0.027, 137Cs=9.78±0.78, 238U=28.84±1.62, 232Th=21.42±1.93, 40K=376.05±12.78. The mean ratio 238Pu/239+240Pu (0.02) shows a contamination due essentially to fall-out and U and Th alpha spectra indicate the natural origin of two elements. The absence of 134Cs in the sample proves that at 40-50 cm depth the sediment was not affected by the Chernobyl fall-out. As far as the speciation is concerned the following fractions were considered: water soluble, carbonates, Fe-Mn oxides, organic matter, acid soluble, residue. Pu (˜67%) an Am (˜95%) were present principally in the carbonate fraction; U was more distributed and about 30% and 45% appeared in the carbonate fraction and in the residue respectively; the majority of Th was present in the residue (˜60%); 40K was totally present in the residue; finally 137Cs was found mostly in the acid soluble fraction (˜53%) and in the residue (˜47%). Some stable elements (Fe, Mn, Al, Ti, Ca, Pb, Ba) were also determined in the different fractions to get more information about the chemical association of the single radionuclides.

  6. Metals for the containment of nitric acid solutions of plutonium-238

    International Nuclear Information System (INIS)

    Results of a study of the corrosion of various transition-metal alloys, tantalum, and tantalum/2.5% tungsten are reported. The solvent contained nitric acid, hydrofluoric acid, and ammonium hexanitratocerate. It was designed to imitate the corrosiveness of the nitric acid, hydrofluoric acid mixture used to dissolve 238-plutonium dioxide. (author)

  7. Photo fission cross-section of 232Th, 238U and 237Np

    International Nuclear Information System (INIS)

    In the present work, photo fission cross-section of 232Th, 238U and 237Np evaluated with the help of fission fragment angular distribution measurements by using Bremsstrahlung radiation from 7.4 MeV to 9.0 MeV have been carried out by employing high efficiency SSNTD technique

  8. 49 CFR 238.447 - Train operator's controls and power car cab layout.

    Science.gov (United States)

    2010-10-01

    ... employee regularly assigned to occupy a power car cab and any floor-mounted seat in the cab shall be: (1... 49 Transportation 4 2010-10-01 2010-10-01 false Train operator's controls and power car cab layout... Specific Requirements for Tier II Passenger Equipment § 238.447 Train operator's controls and power car...

  9. Radiochemical measurement of mass distribution in 16O+238U reaction at sub-barrier energy

    International Nuclear Information System (INIS)

    In the present, radiochemical study of the mass distribution in 16O+238U has been carried out at sub-barrier energy to investigate the nature of mass distribution in CFF and TF channels. In addition, cross sections of evaporation residues formed in one nucleon transfer/pick-up reactions have also been measured

  10. Some important aspects of fragment angular momentum in medium energy fission of 238U

    International Nuclear Information System (INIS)

    Independent isomeric yield ratios of 131Te, 133Te and 134I have been determined at five different energies in the range of 25-44 MeV alpha particle induced fission of 238U using radiochemical and gamma spectrometric techniques. From the independent isomeric yield ratios, fragment angular momenta (Jrms) have been deduced using a statistical model analysis. The Jrms were also calculated theoretically based on thermal equilibration of various collective modes after considering the occurrence of multichance fission. These data and the literature data for various fragments in the mass region 126-136 in 238U (α,f), 238U (p,f) and 238U (γ,f) show the following important features: (i) Both the entrance channel excitation energy and input angular momentum affect the fragment angular momentum in the exit channel. (ii) There are two groups of fission products from the point of view of change of fragment angular momentum with increase in excitation energy and input angular momentum. (iii) Fragment angular momentum depends on nuclear structure effect such as shell closure proximity and odd-even effect. (iv) The fragment angular momentum calculated theoretically based on statistical equilibration of various collective modes are in good agreement with the experimental values indicating the validity of such an assumption

  11. Late effects of inhaled 238PuO2 in beagles

    International Nuclear Information System (INIS)

    Osteosarcomas were the primary cause of death in beagle dogs 4 to 8 years after inhalation of 238PuO2. The plutonium body burden at death ranged from 0.4 to 2.6 μCi with 32 to 55 percent of the plutonium in the skeleton. Pulmonary neoplasia was observed in three of the bone-tumor-bearing dogs

  12. Determination of 238U nucleus number using grid ionization chamber method and small solid angle method

    International Nuclear Information System (INIS)

    Using the grid ionization chamber method and small solid angle method, the number of 238U nucleus in the highly pure U3O8 sample is determined. Although the ratio of efficiency for the two methods is as high as 484, the results are in good agreement

  13. Biokinetics aand dosimetry of inhaled 238PuO2 in the beagle dog: An update

    International Nuclear Information System (INIS)

    The temporal and spatial distributions of 238Pu have been measured during the course of a dose-response study of the biological effects of inhaled 238PuO2 in Beagle dogs. These measurements were done on the dose-response study animals, as well as a separate group of dogs exposed to similar aerosols and killed serially out to 4 y after exposure. The data from this latter group provided the basis for the development of a biokinetic/dosimetric model for 238PuO2 in dogs. Since the publication of this model, several important findings have been made that affected the dosimetric evaluations. The first involved the discovery of significant quantities of natural uranium (U) in the feces samples. The U was measured with the plutonium (Pu), which inflated the values for purported Pu in feces. The second finding involved the addition of Pu biokinetics data from the dose-response dogs, which increased the period of observation from 4 y to 15 y; these later data were not consistent with the earlier model predictions. The purpose of this investigation was (1) to remove the analytical bias in the 238Pu radiochemical data due to the U and (2) to modify the original model of Mewhinney and Diel, taking into account all data from both studies

  14. Conceptual designs for a long term 238PuO2 storage vessel

    International Nuclear Information System (INIS)

    This is a report on conceptual designs for a long term, 250 years, storage container for plutonium oxide ([sup 238]PuO[sub 2]). These conceptual designs are based on the use of a quartz filter to release the helium generated during the plutonium decay. In this report a review of filter material selection, design concepts, thermal modeling, and filter performance are discussed

  15. Spatial distribution of U-238, Ra-226 and Pb-210 at Urgeirica uranium mill tailings

    International Nuclear Information System (INIS)

    The extensive exploitation and treatment of the uranium ore in the Urgeirica mine, Portugal, where exists a chemical treatment plant, led to an accumulation of large amounts of solid wastes (tailings) deposited in piles or dams. The objective of this work is to investigate the extent of the contamination at the oldest dams (more than 40 years old) taking into account the U-238, Ra-226 and Pb-210 distribution at those dams. Tailings core and surface samples were randomly collected at the dams. Tailings samples were dried and the activity in U-238 (through the peaks of Th-234), Ra-226 (through the progenies Pb-214 and Bi-214) and Pb-210 were determined by gamma spectrometry. The results show a big variability (by a factor of 5 to 10) if the U-238, Ra-226 and Pb-210 concentrations at the surface tailings, which indicates a heterogeneity of the radionuclides distribution at the dams area. A good correlation between Ra-226 and U-238 concentrations at the sampling site (dam D2) that presents lower Ra-226 concentrations was obtained. As expected, the most important contribution to the high natural radioactivity at the oldest dams is due to the radium rejected as a waste product from the uranium ore treatment (author)

  16. Characterization and testing of a 238Pu loaded ceramic waste form

    International Nuclear Information System (INIS)

    This paper will describe the preparation and progress of the effort at Argonne National Laboratory-West to produce ceramic waste forms loaded with 238Pu. The purpose of this study is to determine the extent of damage, if any, that alpha decay events will play over time to the ceramic waste form under development at Argonne. The ceramic waste form is glass-bonded sodalite. The sodalite is utilized to encapsulate the fission products and transuranics which are present in a chloride salt matrix which results from a spent fuel conditioning process. 238Pu possesses approximately 250 times the specific activity of 239Pu and thus allows for a much shorter time frame to address the issue. In preparation for production of 238Pu loaded waste forms 239Pu loaded samples were produced. Data is presented for samples produced with typical reactor grade plutonium. X-ray diffraction, scanning electron micrographs and durability test results will be presented. The ramifications for the production of the 238Pu loaded samples will be discussed

  17. Gastrointestinal absorption and retention of plutonium-238 in neonatal rats and swine

    International Nuclear Information System (INIS)

    Neonatal rats gavaged with 237Pu or 238Pu retained a substantial quantity in gut mucosa for a week but absorbed only 2.9% of the 237Pu. After 140 days the amount retained fell to half that initially deposited. Newborn swine also retained large amounts in the gut and absorbed about 40% of the dose

  18. 238U spontaneous fission half-life and a new probable radioactivity mode

    International Nuclear Information System (INIS)

    The 238U spontaneous fission half-life is reinvestigated using a special nuclear emulsion technique previously developed in our laboratory. A perfect visualisation of the fission fragments tracks in the absence of alpha particle tracks was obtained with the present method that also avoids the fading of the latent image. Under these conditions, two well defined peaks are observed experimentaly: one corresponding to the well-known range (approx 24 μm) of the 238U fission fragments tracks and the other showing evidence of short range tracks (approx 10 μm). For the 238U spontaneous fission half-life our result is (6.0+-0.4) x1015 y, in good agreement with the values obtained by some other workers using different experimental methods. A systematic theoretical analysis shows that the 238U spontaneous emission of nuclides with mass number between approx 20 e 70 is possible. The Kinetic energies calculated for these nuclides are found to fit the short range tracks observed in our experiment. From the experimental data, we attribute a (2 +- 1) x 1015 y half-life for all modes of emission involved in this process. (Author)

  19. Two types of adakites revealed by 238U-230Th disequilibrium from Daisen volcano, southwestern Japan

    International Nuclear Information System (INIS)

    Daisen volcano is located on the Quaternary volcanic front in southwestern Japan. The volcano is composed mainly of andesite and dacite, which chemically resemble adakites, with high Al2O3 and Sr/Y, steep REE patterns, and no negative Eu anomaly. (238U/230Th) disequilibrium (herein, a ratio in parentheses denotes the activity ratio) and trace element analyses of adakites from two volcanic domes, Karasugasen and Misen, indicate two adakite types. Adakite from Karasugasen is characterized by excess (230Th) over (238U), typical of most adakites, whereas adakite from Misen is characterized by excess (238U) over (230Th). The latter is consistent with enrichment in fluid-mobile elements relative to fluid immobile elements compared to rocks from Karasugasen. The values of (230Th/232Th) of adakites from Karasugasen and Misen are, respectively, around 0.75 and 0.81. These low (230Th/232Th) ratios result from the incorporation of subducted sedimentary material. The ratios, nevertheless, are higher than that for the estimate of lower crustal material suggesting significant incorporation of lower crust is unlikely. As adakites from Misen have (238U) excess over (230Th), adakite magma must have interacted with wedge mantle metasomatized by a slab-derived fluid, confirming the presence of a fluid-metasomatized mantle beneath Daisen volcano. (author)

  20. Uses of uranium isotopes 234U and 238U in hydrology and hydrogeology

    International Nuclear Information System (INIS)

    This work describes the application of the uranium isotopes 234U, 238U as a practically usuable indicator in hydrology and hydrogeology as well as its value in scientific research. The emphasis is laid on the methods of interpretation of U-data and the application of these methods to special hydrologic and hydrogeologic problems in the GDR. (author)

  1. Determination of 235U/238U Ratio on Urine by ICP-MS

    International Nuclear Information System (INIS)

    LLNL Internal Dosimetry Program - The new procedure satisfies the requirement to determine 235U/238U ratio in bioassay urine samples. MDA - The LC and MDA95 for 235U are well below the required detection limit of 0.00035 μg/L. Turn around time - Analysis of 10 samples plus 2 QCs can be completed in one work day (8 hours).

  2. 238U(n,γ) cross section above the resonance region

    International Nuclear Information System (INIS)

    A number of measurements of the 238U(n,γ) cross section above the resonance region have been completed in the past few years. In the keV range, these measurements suggest a considerable amount of intermediate structure. Comparisons are made of pre-1970 and more recent evaluations with ENDF/B-IV results. Discrepancies and uncertainties are discussed

  3. Study of fusion-fission dynamics in 19F+238U reaction

    Science.gov (United States)

    Dubey, R.; Sugathan, P.; Jhingan, A.; Kaur, Gurpreet; Mukul, Ish; Siwal, Davinder; Saneesh, N.; Banerjee, Tathagata; Yadav, Abhishek; Thakur, Meenu; Mahajan, Ruchi; Chaterjee, M. B.

    2016-05-01

    Mass angle distribution measurements for 19F+238U reaction were carried out around the sub barrier energies. Mass angle correlation has not been observed at above and below the fusion barrier in present reaction. This infer the minimal presence of non compound like events at these bombarding energies range.

  4. 49 CFR 238.209 - Forward end structure of locomotives, including cab cars and MU locomotives.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Forward end structure of locomotives, including... SAFETY STANDARDS Specific Requirements for Tier I Passenger Equipment § 238.209 Forward end structure of locomotives, including cab cars and MU locomotives. (a)(1) The skin covering the forward-facing end of...

  5. Energy dependence of 238U fission yields investigated in inverse kinematics

    Directory of Open Access Journals (Sweden)

    Veselsky M.

    2010-03-01

    Full Text Available The production cross sections of neutron-rich fission residues produced in reactions induced by a 238U beam impinging onto Pb and Be targets were investigated at the Fragment Separator (FRS at GSI using the inverse kinematic technique. These data allowed us to discuss the optimum energies in fission for producing the most neutron-rich residues.

  6. Recent measurements of 234U/238U isotope ratio in spring waters from the Hadzici area

    International Nuclear Information System (INIS)

    The Hadzici area has become interesting for investigation since depleted uranium ammunition had been employed in 1995 during the NATO air strike campaign in Bosnia and Herzegovina. The purpose of this study is to determine uranium concentration and 234U/238U activity ratio in the spring waters of this area and to investigate their relationship, as well as spatial variations. The spring water samples were taken at 18 sites in total. For the determination of uranium radioisotopes, radiochemical separation procedure followed by alpha-particle spectrometry was applied. Uranium concentration in analyzed waters range from 0.15 to 1.12 μg/L. Spring waters from carbonate based sediments have a lower uranium concentration of between 0.15 and 0.43 μg/L, in comparison to waters sampled within sandstone-based sediments ranging from 0.53 to 1.12 μg/L. Dissolved uranium shows significant spatial variability and correlation with bedrock type confirmed by Principal Component Analysis and Hierarchical Cluster Analysis. The majority of the analyzed waters have a 234U/238U activity ratio ranging from 1.02 to 1.90, of which half of the results range between 1.02 and 1.16. No apparent depleted uranium (DU) contamination was observed, as 234U/238U activity ratio is dependent on geochemical conditions in the environment. Even though the tested spring waters demonstrate significant variability in uranium concentration, 234U/238U activity ratio and 234U excess, waters with similar uranium isotopic signatures are observable within the region. The guidelines on the spatial redistribution of dissolved uranium (corresponding to 238U mass concentration), along with 234U/238U activity ratios were provided by the Inverse Distance Weighting (IDW) method. Waters having similar isotopic signature have been delineated. -- Highlights: ► Uranium concentration in analyzed spring waters ranges from 0.15 to 1.12 μg/L. ► Dissolved uranium shows correlation with bedrock type. ► Low 234U/238U

  7. Investigation of solubility of cesium, strontium, barium, rare-earth, uranium and americium fluorides in acid nitrosyl fluoride (NOFx3HF)

    International Nuclear Information System (INIS)

    Solubility of Am and other elements, which are fission products, in acid nitrosylfluoride has been studied. Cesium fluoride has maximum solubility; uranium tetrafluoride is also noticeably soluble; americium trifluoride is practically insoluble; fluorides of rare earth elements are slightly soluble in NOFx3HF. Analysis of the solid phase obtained after treating the mixture of the above fluorides with acid nitrosylfluoride has shown that cesium fluoride reacts with NOFx3HF with the formation of an acid salt (CsFxHF), whereas fluorides of alkaline and rare earth elements remain unchanged. The behaviour of a mixture of cesium, barium, and lanthanum fluorides in the process of three-multiple treating with acid nitrosylfluoride has been studied. It is shown that more than 98% of cesium fluoride and 5% of barium fluoride pass into the mother liquor while lanthanum fluoride remains completely in the solid phase. The data on americium fluoride solubility in acid nitrosylfluoride have indicated that it behaves in the same way as fluorides of rare earth elements; it is practically insoluble in HOFx3HF

  8. Determining the americium transmutation rate and fission rate by post-irradiation examination within the scope of the ECRIX-H experiment

    International Nuclear Information System (INIS)

    The ECRIX-H experiment aims to assess the feasibility of transmuting americium micro-dispersed in an inert magnesia matrix under a locally moderated neutron flux in the Phénix reactor. A first set of examinations demonstrated that pellet behaviour was satisfactory with moderate swelling at the end of the irradiation. Additional post-irradiation examinations needed to be conducted to confirm the high transmutation rate so as to definitively conclude on the success of the ECRIX-H experiment. This article presents and discusses the results of these new examinations. They confirm the satisfactory behaviour of the MgO matrix not only during the basic irradiation but also during post-irradiation thermal transients. These examinations also provide additional information on the behaviour of fission products both in the americium-based particles and in the MgO matrix. These results particularly validate the transmutation rate predicted by the calculation codes using several different analytical techniques. The fission rate is also determined

  9. Definition of a process for the recovery of ultra traces of Pu238 from a 300 Kg depleted uranium batch

    International Nuclear Information System (INIS)

    In order to measure the half life of the double beta decay of U238, a process for the recovery of trace amounts of Pu238 (about 30 000 atoms) from a 300 kg batch of depleted uranium has been studied and tested. The process includes a Pu (IV) valency adjustment step with nitrous oxide, followed by nine chromatographic cycles (plutonium decontamination factor up to 1011 have been achieved for Th, Pa and U). The procedure to realize the alpha spectrometry measurement has also been defined. Full scale apparatus have been set in the CRN facility near STRASBOURG. The first part of the experiment (U238 purification before one year aging and measurement of the extracted Pu238 traces) has been realized. The results of the Pu traces counting allows the validation of the chemical process but also show an important Pu238 contamination certainly a consequence of the TCHERNOBYL accident. (author). 76 refs., 63 tabs., 49 figs

  10. Studying nuclear level densities of {sup 238}U in the nuclear reactions within the macroscopic nuclear models

    Energy Technology Data Exchange (ETDEWEB)

    Razavi, Rohallah; Aghajani, Maghsood; Khooy, Asghar [Imam Hossein Comprehensive Univ., Tehran (Iran, Islamic Republic of). Dept. of Physics; Rahmatinejad, Azam; Taheri, Fariba [Univ. of Zanjan (Iran, Islamic Republic of). Dept. of Physics; Kakavand, Tayeb [Imam Khomeini International Univ., Qazvin (Iran, Islamic Republic of). Dept. of Physics

    2016-05-01

    In this work the nuclear level density parameters of {sup 238}U have been extracted in the back-shifted Fermi gas model (BSFGM), as well as the constant temperature model (CTM), through fitting with the recent experimental data on nuclear level densities measured by the Oslo group. The excitation functions for {sup 238}U(p,2nα){sup 233}Pa, and {sup 238}U(p,4n){sup 235}Np reactions and the fragment yields for the fragments of the {sup 238}U(p,f) reaction have been calculated using obtained level density parameters. The results are compared to their corresponding experimental values. It was found that the extracted excitation functions and the fragment yields in the CTM coincide well with the experimental values in the low-energy region. This finding is according to the claim made by the Oslo group that the extracted level densities of {sup 238}U show a constant temperature behaviour.

  11. Large scale production of Pu-238 to 'denature' weapons-grade plutonium. Rev. 0

    International Nuclear Information System (INIS)

    The concept of open-quote denaturing close-quote weapons-grade or reactor-grade plutonium through the addition of Pu-238 has been proposed recently by Dr. Mel Coops of Lawrence Livermore National Laboratory. He indicates that on the order of 2-3 wt.% plutonium-238 (Pu-238) may be sufficient to render the plutonium impractical for weapons use due to excessive heat generation. This would significantly reduce or eliminate proliferation concerns for use of plutonium in commercial nuclear fuels. This report presents a high-level assessment of the potential for producing large quantities of Pu-238 for the purpose of open-quote denaturing close-quote the weapons-grade or reactor-grade plutonium that may be used in commercial reactors as mixed-oxide (MOX) fuels. Pu-238 production can be done by two methods. The traditional method employed in the U.S. was to irradiate targets of neptunium-237 (Np-237), this isotope being produced from neutron capture in U-236. Recycling enriched uranium fuels in the defense production reactor fuel cycle increased the U-236 content, increasing the subsequent yield of Np-237. Production by this method thus involves significant reactor irradiation time, and reprocessing of fuel to recover uranium and Np-237 for fabrication into new fuel and targets, respectively. The second method would be to irradiate targets of Am-241, recovered as a decay product from aged plutonium. This method again would require processing of plutonium or spent fuel to recover Am-241. Either method would require processing of targets after irradiation, and a facility for fabricating targets and processing the plutonium to a final pure oxide form

  12. Experimental study of 238U Doppler reactivity worth in FCA XVI-1 and XVI-2 cores

    International Nuclear Information System (INIS)

    Doppler reactivity worths of natural uranium samples were measured in metallic fueled cores, FCA XVI-1 and XVI-2, using a sample heating technique. In a metallic fueled LMFBR, the neutron spectrum is generally harder than a similar size oxide fueled LMFBR owing to the luck of oxygen. The accuracy of Doppler effect calculation for a harder neutron spectrum was evaluated by comparing C/E values of Doppler reactivity worth in oxide fueled cores and in metallic fueled cores using FCA experiments. It was found that calculation using 70-group constant set JFS-3-J2 underestimates 238U Doppler reactivity worth in metallic fueled cores. An inadequate treatment of resonance parameters of 238U above 50 keV in JENDL-2 is one of the reasons for this underestimation. In JENDL-2 the resonance parameters of 238U above 50 keV are not included, and hence JFS-3-J2 which is processed from JENDL-2 does not have a self-shielding factor table above 40.9 keV of 238U. When the contribution of this energy region for Doppler reactivity worth was corrected using ENDF/B-VI, which includes resonance parameters of 238U up to 149 keV, the JFS-3-J2 based calculation gave 13% higher values for metallic sample experiments and 8% for oxide samples. Even after this correction, the calculation still gave smaller Doppler reactivity worths than the measurements, and the ratios of calculated value to experimental one vary widely from 0.6 to 1.0. (author)

  13. Energy distribution of neutrons from the (n,2n) reaction in 238U

    International Nuclear Information System (INIS)

    Energy distribution of the first and second neutrons from (n,2n) scattering event in 238U was evaluated according to the consistent compound nucleus model recently proposed by Segev. The law for deriving the energy distribution of secondary neutrons from a (n,2n) scattering event, depends on whether the reaction is considered as a simultaneous emission of two neutrons from one compound nucleus, or a successive emission of neutrons from different compound nuclei. Segev has presented a means of calculating the energy distribution assuming the latter model. The laws presented in the ENDF/B data files suggest the former model. The evaluation was based on inelastic level excitation and evaporation data for 238U and 237U. Data was retrieved from ENDF/B files. The evaporation data for 237U was based on (γ,n) reaction 238U. The inelastic level excitation data for 237U was evaluated at the Soreq Nuclear Research Centre. It is concluded from the application of Segev's model to 238U, that the energetic spectrum of secondary neutrons, is harder in the high range of energy than the one predicted by the use of the distribution law presented in ENDF/B data files. The spectrum of secondary (n,2n) neutrons, resulting from the interaction of 14 MeV neutrons in 238U calculated with Segev's model, is compared with the corresponding spectrum of the LLL library, ENDF/B library and the recent evaluation of BNWL. It is found that the spectrum evaluated by LLL and BNWL is harder than that evaluated with Segev's model

  14. Evaluation of synthetic water-soluble metal-binding polymers with ultrafiltration for selective concentration of americium and plutonium

    International Nuclear Information System (INIS)

    Water-soluble metal-binding polymers in combination with ultrafiltration are shown to be an effective method for selectively removing dilute actinide ions from acidic solutions of high ionic strength. The actinide-binding properties of commercially available water-soluble polymers and several polymers which have been reported in the literature were evaluated. The functional groups incorporated in the polymers were pyrrolidone, amine, oxime, and carboxylic, phosphonic, or sulfonic acid. The polymer containing phosphonic acid groups gave the best results with high distribution coefficients and concentration factors for 241Am(III) and 238Pu(III)/(IV) at pH 4 to 6 and ionic strengths of 0.1 to 4. (author)

  15. 238U, and its decay products, in grasses from an abandoned uranium mine

    Science.gov (United States)

    Childs, Edgar; Maskall, John; Millward, Geoffrey

    2016-04-01

    Bioaccumulation of radioactive contaminants by plants is of concern particularly where the sward is an essential part of the diet of ruminants. The abandoned South Terras uranium mine, south west England, had primary deposits of uraninite (UO2) and pitchblende (U3O8), which contained up to 30% uranium. When the mine was active uranium and radium were extracted but following closure it was abandoned without remediation. Waste rock and gangue, consisting of inefficiently processed minerals, were spread around the site, including a field where ruminants are grazed. Here we report the activity concentrations of 238U, 235U 214,210Pb, and the concentrations of selected metals in the soils, roots and leaves of grasses taken from the contaminated field. Soil samples were collected at the surface, and at 30 cm depth, using an auger along a 10-point transect in the field from the foot of a waste heap. Whole, individual grass plants were removed with a spade, ensuring that their roots were intact. The soils and roots and grass leaves were freeze-dried. Activity concentrations of the radionuclides were determined by gamma spectroscopy, following 30 days incubation for development of secular equilibrium. Dried soils, roots and grasses were also digested in aqua regia and the concentrations of elements determined by ICP techniques. Maximum activity concentrations of 238U, 235U, 214Pb and 210Pb surface soils were 63,300, 4,510, 23,300 and 49,400 Bq kg‑1, respectively. The mean 238U:235U ratio was 11.8 ± 1.8, an order of magnitude lower than the natural value of 138, indicating disequilibrium within the decay chain due to mineral processing. Radionuclides in the roots had 5 times lower concentration and only grass leaves in the vicinity of the waste heap had measureable values. The mean soil to root transfer factor for 238U was 36%, the mean root to leaf was 3% and overall only 0.7% of 238U was transferred from the soil to the leaves. The roots contained 0.8% iron, possibly as

  16. 49 CFR Figure 1a to Subpart B of... - Example of Location of Rescue Access Windows-§ 238.114

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Example of Location of Rescue Access Windows-§ 238.114 1A Figure 1A to Subpart B of Part 238 Transportation Other Regulations Relating to... B of Part 238—Example of Location of Rescue Access Windows—§ 238.114 ER01FE08.002...

  17. 49 CFR Figure 1 to Subpart B of... - Example of Location and Staggering of Emergency Window Exits-§ 238.113

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Example of Location and Staggering of Emergency Window Exits-§ 238.113 1 Figure 1 to Subpart B of Part 238 Transportation Other Regulations Relating to... of Part 238—Example of Location and Staggering of Emergency Window Exits—§ 238.113 ER01FE08.001...

  18. The inflow of 234U and 238U from the River Odra drainage basin to the Baltic Sea

    Directory of Open Access Journals (Sweden)

    Bogdan Skwarzec

    2010-12-01

    Full Text Available In this study the activity of uranium isotopes 234U and 238U in Odra river water samples, collected from October 2003 to July2004, was measured using alpha spectrometry. The uranium concentrations were different in each of the seasons analysed; the lowest values were recorded in summer. In all seasons, uranium concentrations were the highest in Bystrzyca river waters (from 27.81 ± 0.29Bq m-3 of 234U and 17.82 ± 0.23 Bq m-3 of 238U in spring to 194.76 ± 3.43 Bq m-3 of 234U and 134.88 ± 2.85 Bq m-3 of 238U in summer. The lowest concentrations were noted in the Mała Panew (from 1.33 ± 0.02 Bq m-3 of 234U and 1.06 ± 0.02 Bq m-3 of 238U in spring to 3.52 ± 0.05 Bq m-3 of 234U and 2.59± 0.04 Bq m-3 of 238U in autumn. The uranium radionuclides 234U and 238U in the water samples were not in radioactive equilibrium. The 234U / 238U activity ratios were the highest in Odra water samples collected at Głogów (1.84 in autumn, and the lowest in water from the Noteć (1.03 in winter and spring. The 234U / 238U activity ratio decreases along the main stream of the Odra, owing to changes in the salinity of the river's waters. Annually, 8.19 tons of uranium (126.29 G Bq of 234U and 100.80 G Bq of 238U flow into the Szczecin Lagoon with Odra river waters.

  19. 238U self-indication ratio measurement in the resonance region

    International Nuclear Information System (INIS)

    An accurate representation of the 238U cross-section structures in the resonance region is required to compute the resonance self-shielded effective cross sections used in the calculation of thermal and fast-reactor performance parameters. Several authors have demonstrated the usefulness of self-indication and average transmission measurements to investigate the resonance structure of the 238U cross sections. This paper compares measured self-indication ratios with calculations based on ENDF/B-V, in the resolved energy range from 100 eV to 4 keV. In that energy range the ENDF/B-V evaluation is chiefly based on high resolution transmission measurements. The immediate purpose of the comparison presented is not to generate a new set of improved resonance parameters but to provide an additional test of the adequacy of the ENDF/B-V representation for the calculation of resonance self-shielding

  20. Effects of nuclear orientation on fusion and fission in the reaction using 238U target nucleus

    Directory of Open Access Journals (Sweden)

    Hirose K.

    2010-03-01

    Full Text Available Fission fragment mass distributions in the reaction of 30Si+238U were measured around the Coulomb barrier. At the above-barrier energies, the mass distribution showed a Gaussian shape. At the subbarrier energies, triple-humped distribution was observed, which consists of symmetric fission and asymmetric fission peaked at AL/AH ≈ 90/178. The asymmetric fission should be attributed to quasifission from the results of the measured evaporation residue (ER cross-sections for 30Si+238U. The cross-section for 263Sg at the abovebarrier energy agree with the statistical model calculation which assumes that the measured fission cross-section originates from fusion-fission, whereas the one for 264 Sg measured at the sub-barrier energy is smaller than the calculation, which suggests the presence of quasifission.