WorldWideScience

Sample records for american lung association

  1. American Lung Association

    Science.gov (United States)

    ... Association's 'Tobacco 21' Initiative to Save Lives of Millennials, Future Generations by Raising Tobacco Sales Age to ... by lung disease. Help us continue to deliver education, advocacy and research to those who need it. $ ...

  2. American Lung Association's radon public information program

    International Nuclear Information System (INIS)

    The American Lung Association (ALA), the nation's oldest voluntary health organization, is dedicated to the conquest of lung disease and the promotion of lung health. The objective of the ALA Radon Public Information Program is to reduce public exposure to elevated indoor radon levels through implementing grassroots-based radon public awareness campaigns by 22 local ALA groups. The program, which is funded by a grant from the US Environmental Protection Agency (EPA), was initiated in December 1989; the first phase will continue until May, 1991. Activities of local Lung Associations include distribution of free or reduced-cost radon kits; presenting programs in elementary and secondary schools; presenting information on TV news series and talk shows, and on radio Public Service Announcements and talk shows; presenting articles and feature stories in the print media; holding conferences, workshops, and displays at fairs and other exhibitions; distributing radon fact sheets through libraries and utility company mailings; and distributing videos through video chains and libraries. The local Lung Associations also serve as promoters for the EPA/Advertising Council Radon Public Service Announcement Campaign. We will highlight the activities of the groups in communicating radon health risks to the public; we will describe the results obtained and will attempt to evaluate the merits of the various approaches on the basis of the initial results

  3. Adolescents' perceptions about smoking prevention strategies: a comparison of the programmes of the American Lung Association and the Tobacco Institute

    OpenAIRE

    DeBon, M.; Klesges, R. C.

    1996-01-01

    OBJECTIVE: To evaluate components of the teenage smoking prevention programmes of the American Lung Association (ALA) and the Tobacco Institute (TI). DESIGN: Group administration of written questionnaires in school. The components of the ALA's and TI's programmes were presented to students in seven strategy vignettes, covering the following topics: peer pressure/enhanced communication; parents as role models; health consequences of smoking; cost of smoking; smoking as an illegal act; ti...

  4. Perspectives of African Americans on Lung Cancer: A Qualitative Analysis

    OpenAIRE

    Lathan, Christopher S.; Waldman, Laura Tesler; Browning, Emily; Gagne, Joshua; Emmons, Karen

    2015-01-01

    This qualitative study suggests that African American smokers are aware of the relationship between smoking and lung cancer and are interested in smoking-cessation treatment. These data also indicate that lung cancer disparities are unlikely to be associated with differential willingness to receive care but that African Americans may perceive financial and insurance barriers to lung cancer treatment.

  5. American College Health Association

    Science.gov (United States)

    ... Dollars at Work Recognizing Donors Find us on social media! Home Contact Us Marketplace Cart Copyright © 2016 American College Health Association | Privacy and Usage Policies | Spokesperson and ...

  6. Genetic Ancestry-Smoking Interactions and Lung Function in African Americans: A Cohort Study

    OpenAIRE

    Aldrich, Melinda C.; Kumar, Rajesh; Colangelo, Laura A.; Williams, L. Keoki; Sen, Saunak; Kritchevsky, Stephen B.; Meibohm, Bernd; Galanter, Joshua; Hu, Donglei; Gignoux, Christopher R.; Liu, Yongmei; Harris, Tamara B.; Ziv, Elad; Zmuda, Joseph; Garcia, Melissa

    2012-01-01

    Background Smoking tobacco reduces lung function. African Americans have both lower lung function and decreased metabolism of tobacco smoke compared to European Americans. African ancestry is also associated with lower pulmonary function in African Americans. We aimed to determine whether African ancestry modifies the association between smoking and lung function and its rate of decline in African Americans. Methodology/Principal Findings We evaluated a prospective ongoing cohort of 1,281 Afr...

  7. American Music Therapy Association

    Science.gov (United States)

    American Music Therapy Association Home Contact News Help/FAQ Members Only Login Quick Links Facts About Music Therapy Qualifications ... with AMTA Sponsor AMTA Events Social Networking Support Music Therapy When you shop at AmazonSmile, Amazon will ...

  8. American Therapeutic Recreation Association

    Science.gov (United States)

    ... Remember Me I forgot my password American Therapeutic Recreation Association Promoting Health & Wellness Services Annual Conference 2016 ... and leave your opinion Join thousands of Therapeutic Recreation specialists today Join Now Renew your membership today ...

  9. American Sleep Association

    Science.gov (United States)

    ... Public Health Professionals Join ASA Press Room American Sleep Association Share What is Sleep ? Insight into the ... Forums Contact Us Login Join ASA – for FREE Sleep Blog ASA Charitable Work – Sleeping Children Around the ...

  10. American Tinnitus Association

    Science.gov (United States)

    American Tinnitus Association Donate Become A Member Member Login Find A Provider Search form Search Menu Close Understanding The Facts Managing Your Tinnitus Research Toward A Cure About Us Initiatives News & ...

  11. International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society International Multidisciplinary Classification of Lung Adenocarcinoma

    OpenAIRE

    Travis, William,; Brambilla, Elisabeth; Noguchi, Masayuki; Nicholson, Andrew; Geisinger, Kim,; Yatabe, Yasushi; Beer, David; Powell, Charles; Riely, Gregory; Van Schil, Paul; Garg, Kavita; Austin, John; Asamura, Hisao; Rusch, Valerie; Hirsch, Fred,

    2011-01-01

    International audience This new classification strategy is based on a multidisciplinary approach to diagnosis of lung adenocarcinoma that incorporates clinical, molecular, radiologic, and surgical issues, but it is primarily based on histology. This classification is intended to support clinical practice, and research investigation and clinical trials. As EGFR mutation is a validated predictive marker for response and progression-free survival with EGFR tyrosine kinase inhibitors in advanc...

  12. Opportunities to address lung cancer disparities among African Americans

    OpenAIRE

    Coughlin, Steven S.; Matthews-Juarez, Patricia; Juarez, Paul D.; Melton, Courtnee E; King, Mario

    2014-01-01

    Race and socioeconomic status are well known to influence lung cancer incidence and mortality patterns in the U.S. Lung cancer incidence and mortality rates are higher among blacks than whites. In this article we review opportunities to address disparities in lung cancer incidence, mortality, and survivorship among African Americans. First, we summarize recent advances in the early detection and treatment of lung cancer. Then we consider black-white disparities in lung cancer treatment includ...

  13. American Telemedicine Association

    Science.gov (United States)

    ... ATA On Twitter Tweets by @AmericanTelemed ATA On Facebook Physicians and Clinicians Increase your reach as a ... the global deployment of telemedicine. ATA provides proven marketing opportunities, connecting buyers and sellers. Upcoming Trade Shows ...

  14. American Heart Association

    Science.gov (United States)

    ... American Heart area Search by State SELECT YOUR LANGUAGE Español (Spanish) 简体中文 (Traditional Chinese) 繁体中文 (Simplified Chinese) Tiếng Việt (Vietnamese) Healthy Living Conditions Caregiver ...

  15. American Association Of State Climatologists

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Records documenting the business, membership, and meetings of the American Association of State Climatologists, from 1976-92. Material donated in 2008 by the estate...

  16. Radiation Therapy for Lung Cancer

    Science.gov (United States)

    ... are available to help. HELPFUL WEB SITES ON LUNG CANCER American Lung Association www.lung.org Lungcancer.org www.lungcancer.org Lung Cancer Alliance www.lungcanceralliance.org Lung Cancer Online www. ...

  17. CT features of lung cancer associated with idiopathic pulmonary fibrosis

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jun Hyoung; Song, Koun Sik; Lee, Deok Hee; Kim, Jin Suh; Lim, Tae Hwan [Ulsan Univ. College of Medicine, Seoul (Korea, Republic of)

    1996-01-01

    It is well known that the incidence of lung cancer is high in patients with idiopathic pulmonary fibrosis(IPF). We analyzed the CT features of lung cancer associated with IPF. Retrospective analyzed the CT features of lung cancer associated with IPF. Retrospective analysis was performed in 23 patients with lung cancer(24 lung cancers) associated with IPF. The diagnosis of IPF was made by clinical and CT findings, and lung cancer was confirmed pathologically. We divided the location of lung cancer by lobar distribution and central or peripheral lung zone, and measured the size of mass. We classified the mediastinal lymph node enlargement by American Thoracic Society (ATS) mapping scheme. We evaluated the CT pattern of IPF. The subjects consisted of 6 cases of small cell carcinoma and 18 cases of non-small cell lung cancer. Non-small cell lung cancers were located in the right upper lobe in 5 cases, left upper lobe in 6 cases, right middle lobe in 1 case, right lower lobe in 9 cases, and left lower lobe in 3 cases. Twenty cancers(85%) were located in the peripheral lung zone. Eighteen cancers(73%) were surrounded by fibrotic lung. The size of the mass ranged from 1 to 12 cm, and in 12 cases it was below 3cm in diameter. Mediastinal lymph nodes were enlarged in 22 cases(92%) and classified as N2 or N3 in 15 cases out of 18 non-small cell lung. The size of the mass ranged from 1 to 12 cm, and in 12 cases it was below 3 cm in diameter. Mediastinal lymph nodes were enlarged in 22 cases(92%) and classified as N2 or N3 in 15 cases out of 18 non-small cell lung cancers. CT patterns of underlying IPF were honey-combing in 18 patients(78%) and mixed honey-combing and ground-glass opacity in 5 patients(22%). The lung cancer associated with IPF shows variable cell types. Most of the lung cancers were located peripherally, surrounded by end-stage fibrosis, and were associated with mediastinal lymph node enlargement.

  18. CT features of lung cancer associated with idiopathic pulmonary fibrosis

    International Nuclear Information System (INIS)

    It is well known that the incidence of lung cancer is high in patients with idiopathic pulmonary fibrosis(IPF). We analyzed the CT features of lung cancer associated with IPF. Retrospective analyzed the CT features of lung cancer associated with IPF. Retrospective analysis was performed in 23 patients with lung cancer(24 lung cancers) associated with IPF. The diagnosis of IPF was made by clinical and CT findings, and lung cancer was confirmed pathologically. We divided the location of lung cancer by lobar distribution and central or peripheral lung zone, and measured the size of mass. We classified the mediastinal lymph node enlargement by American Thoracic Society (ATS) mapping scheme. We evaluated the CT pattern of IPF. The subjects consisted of 6 cases of small cell carcinoma and 18 cases of non-small cell lung cancer. Non-small cell lung cancers were located in the right upper lobe in 5 cases, left upper lobe in 6 cases, right middle lobe in 1 case, right lower lobe in 9 cases, and left lower lobe in 3 cases. Twenty cancers(85%) were located in the peripheral lung zone. Eighteen cancers(73%) were surrounded by fibrotic lung. The size of the mass ranged from 1 to 12 cm, and in 12 cases it was below 3cm in diameter. Mediastinal lymph nodes were enlarged in 22 cases(92%) and classified as N2 or N3 in 15 cases out of 18 non-small cell lung. The size of the mass ranged from 1 to 12 cm, and in 12 cases it was below 3 cm in diameter. Mediastinal lymph nodes were enlarged in 22 cases(92%) and classified as N2 or N3 in 15 cases out of 18 non-small cell lung cancers. CT patterns of underlying IPF were honey-combing in 18 patients(78%) and mixed honey-combing and ground-glass opacity in 5 patients(22%). The lung cancer associated with IPF shows variable cell types. Most of the lung cancers were located peripherally, surrounded by end-stage fibrosis, and were associated with mediastinal lymph node enlargement

  19. [Interstitial lung diseases associated with smoking].

    Science.gov (United States)

    Nová, Markéta; Hornychová, Helena; Matěj, Radoslav

    2016-01-01

    There are many different interstitial lung diseases associated with smoking. This short review describes officially recognized disorders (desquamative interstitial pneumonia, respiratory bronchiolitis and pulmonary Langerhans´cells histiocytosis) and entities with uncertain relationship to smoking, which have recently been published in the literature. Histopathological pictures and differential diagnosis of smoking-related diseases of the lungs are discussed. PMID:27223588

  20. American Speech-Language-Hearing Association

    Science.gov (United States)

    ... Careers Certification Publications Events Advocacy Continuing Education Practice Management Research American Speech-Language-Hearing Association (ASHA) Making effective communication, a human ...

  1. Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans.

    Science.gov (United States)

    Hansen, Helen M; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M; Wrensch, Margaret R; Sison, Jennette D; Chang, Jeffery S; Smirnov, Ivan V; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P; Kelsey, Karl T; Wiencke, John K

    2010-09-15

    Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10(-20)). In order to narrow the region of association and identify potential causal variations, we performed a fine-mapping study using 77 SNPs in a 194 kb segment of the 15q25.1 region in a sample of 448 African-American lung cancer cases and 611 controls. Four regions, two SNPs and two distinct haplotypes from sliding window analyses, were associated with lung cancer. CHRNA5 rs17486278 G had OR = 1.28, 95% CI 1.07-1.54 and P = 0.008, whereas CHRNB4 rs7178270 G had OR = 0.78, 95% CI 0.66-0.94 and P = 0.008 for lung cancer risk. Lung cancer associations remained significant after pack-year adjustment. Rs7178270 decreased lung cancer risk in women but not in men; gender interaction P = 0.009. For two SNPs (rs7168796 A/G and rs7164594 A/G) upstream of PSMA4, lung cancer risks for people with haplotypes GG and AA were reduced compared with those with AG (OR = 0.56, 95% CI 0.38-0.82; P = 0.003 and OR = 0.73, 95% CI 0.59-0.90, P = 0.004, respectively). A four-SNP haplotype spanning CHRNA5 (rs11637635 C, rs17408276 T, rs16969968 G) and CHRNA3 (rs578776 G) was associated with increased lung cancer risk (P = 0.002). The identified regions contain SNPs predicted to affect gene regulation. There are multiple lung cancer risk loci in the 15q25.1 region in African-Americans. PMID:20587604

  2. American Association for Clinical Chemistry

    Science.gov (United States)

    ... indispensable patient care tool. Learn more IN CLINICAL CHEMISTRY ddPCR Quantification of Lymphoma Mutations Researchers have developed ... Online Harmonization.net Commission on Accreditation in Clinical Chemistry American Board of Clinical Chemistry Clinical Chemistry Trainee ...

  3. American Health Information Management Association

    Science.gov (United States)

    ... Government Corporate & Government Training Signature Partners Sponsorship Exhibitors Advertise With AHIMA Copyright & Permissions RSS LinkedIn Facebook Twitter YouTube Copyright © 2016 by The American Health ...

  4. Joint Effects of Smoking and Sedentary Lifestyle on Lung Function in African Americans: The Jackson Heart Study Cohort

    OpenAIRE

    Campbell Jenkins, Brenda W.; Sarpong, Daniel F.; Clifton Addison; Monique S. White; Hickson, DeMarc A; Wendy White; Cecil Burchfiel

    2014-01-01

    This study examined: (a) differences in lung function between current and non current smokers who had sedentary lifestyles and non sedentary lifestyles and (b) the mediating effect of sedentary lifestyle on the association between smoking and lung function in African Americans. Sedentary lifestyle was defined as the lowest quartile of the total physical activity score. The results of linear and logistic regression analyses revealed that non smokers with non sedentary lifestyles had the highes...

  5. American Association of Occupational Health Nurses

    Science.gov (United States)

    ... Vision & Mission Board of Directors Fellows What is Occupational Health Nursing Public/Legislative Affairs AAOHN Alliances AAOHN Affiliates AAOHN ... Total Worker Health ® Agenda The American Association of Occupational ... nursing education by the American Nurses Credentialing Center’s Commission ...

  6. American Association of Critical-Care Nurses

    Science.gov (United States)

    ... American Journal of Critical Care AACN Bold Voices Critical Care Nurse eNewsletter NTI Voices Career Options Books Search The ... Ambassadors Chapters Privacy Policy Disclaimer © American Association of Critical-Care Nurses Learn more about what we have to offer ...

  7. American Association of Colleges of Nursing

    Science.gov (United States)

    ... Joining Forces Public Health Nursing QSEN Module Series NURSING SHORTAGE RESOURCES About the Nursing Shortage I mpact ... Social Media Communities American Association of Colleges of Nursing One Dupont Circle, NW Suite 530 Washington, DC ...

  8. American Evaluation Association Guiding Principles for Evaluators

    Energy Technology Data Exchange (ETDEWEB)

    None

    2009-01-18

    Five principles developed by American Evaluation Associ intended to guide professional practice of evaluators & to inform evaluation clients and the general public about principles they can expect to be upheld by professional evaluators.

  9. Genetic variants associated with lung function

    DEFF Research Database (Denmark)

    Thyagarajan, Bharat; Wojczynski, Mary; Minster, Ryan L;

    2014-01-01

    with exceptional longevity have not been identified. METHOD: We conducted a genome wide association study (GWAS) to identify novel genetic variants associated with lung function in the Long Life Family Study (LLFS) (n = 3,899). Replication was performed using data from the CHARGE/SpiroMeta consortia....... The association between SNPs and FEV1 and FEV1/FVC was analyzed using a linear mixed effects model adjusted for age, age2, sex, height, field center, ancestry principal components and kinship structure to adjust for family relationships separately for ever smokers and never smokers. In the linkage...

  10. Noncompaction cardiomyopathy associated with hypogenetic lung

    Institute of Scientific and Technical Information of China (English)

    WU Chang-yan; ZHAO Jing; JIANG Teng-yong; HUANG Xiao-yong

    2007-01-01

    @@ Noncompaction of the ventricular myocardium is a rare form of congenital cardiomyopathy with a high incidence of cardiovascular complications. It frequently manifests in an isolated form, namely isolated noncompaction of the ventricular myocardium. Not only does noncompaction of the ventricular myocardium associate with other congenital cardiac malformations, but also with other neuromuscular disorders. The purpose of this study was to explore the correlation of hypogenetic lung with myocardial noncompaction in terms of the clinical course of one of our patients.

  11. American Evaluation Association: Guiding Principles for Evaluators

    Science.gov (United States)

    American Journal of Evaluation, 2009

    2009-01-01

    The American Evaluation Association (AEA) strives to promote ethical practice in the evaluation of programs, products, personnel, and policy. This article presents the list of principles which AEA developed to guide evaluators in their professional practice. These principles are: (1) Systematic Inquiry; (2) Competence; (3) Integrity/Honesty; (4)…

  12. 75 FR 73076 - National Gas Supply Association, American Forest and Paper Association, Inc., American Public Gas...

    Science.gov (United States)

    2010-11-29

    ...., American Public Gas Association, Independent Petroleum Association of America, Process Gas Consumers Group... Petroleum Association of America, and Process Gas Consumers Group (collectively, the Associations), filed in... desiring to intervene or to protest in this proceeding must file in accordance with Rules 211 and 214...

  13. Forty years of the international association for study of lung cancer pathology committee.

    Science.gov (United States)

    Tsao, Ming-Sound; Travis, William D; Brambilla, Elisabeth; Nicholson, Andrew G; Noguchi, Masayuki; Hirsch, Fred R

    2014-12-01

    Lung cancer classification during the last four decades has undergone major changes and evolution, mostly lead by pathologists who were actively involved in the International Association for the Study of Lung Cancer (IASLC) Pathology Committee. The Committee members have led the development and writing of the second (1981), third (1999 and 2004), and fourth (2015) editions of the World Health Organization classifications on lung tumors. Committee members were responsible for defining and refining the classifications of small-cell carcinoma and adenocarcinoma subtypes that are relevant to their clinical behavior. Particularly notable was development of the 2011 IASLC/American Thoracic Society/European Respiratory Society international, multidisciplinary lung adenocarcinoma classification. The multidisciplinary approach that represents the IASLC culture in research, education, and practice in clinical management of lung cancer patients have paved the way for integrating pathology practice into the new era of personalized cancer care. PMID:25393791

  14. American Telemedicine Association: 2014 Fall Forum

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2014-09-01

    Full Text Available The American Telemedicine Association (ATA will host its annual Fall Forum in Palm Desert, California, Sept. 6-9, 2014. In addition to two full days of programs related to managing and improving chronic conditions, ATA will host a full-day American-Chinese Telemedicine Forum on Sunday, Sept. 7, 2014. The forum, co-sponsored by the American International Telemedicine Council, will deliver the tools and information that are essential to building a successful telemedicine business abroad. Attendees will learn about the existing clinical and business landscape oftelemedicine in China, and how to establish key partnerships to help their respective health system, or business, grow in the international market.

  15. Interstitial Lung Disease Associated with Lung Cancer Treatment

    OpenAIRE

    Cao, Zhiwei; Jin, Shi; Yu, Yan

    2013-01-01

    Interstitial lung disease is one of the most serious side effects caused by lung cancer treatment. Due to the complexity diagnosis and variability of the disease, it is often not diagnosied and treated in time, even endanger the patient's life and affect the patient's prognosis. The mechanism of interstitial pneumonia caused by radiotherapy, chemotherapy and targeted therapy is still not fully known. Therefore, it become a problem that how to early detection, diagnosis and treat the interstit...

  16. Gender-associated Differences of Lung Cancer and Mechanism

    OpenAIRE

    XING, XIN; Liao, Yongde; Hexiao TANG; Chen, Guang; Ju, Sheng; You, Liangkun

    2011-01-01

    Lung cancer has been viewed as the most common malignant cancer with high incidence, mortality and poor survival all over the world. A lot of investigations indicated there are significant gender-associated differences in lung cancer in several characteristics such as epidemiology, pathology, clinical outcome and prognosis. The insight into these differences may help to clarify the gender-associated characteristics of lung cancer, and to drawn out new approach for treatment and prevent of lun...

  17. The American Kinesiology Association Undergraduate Core Curriculum©

    Science.gov (United States)

    Chodzko-Zajko, Wojtek

    2014-01-01

    This article describes the elements of the undergraduate core in kinesiology that have been established by the American Kinesiology Association. The American Kinesiology Association also describes a set of ten student-learning outcomes that emanate from the four core content elements. This information has been developed by the American Kinesiology…

  18. Invasive thymoma associated with lung cancer: report of a case.

    Science.gov (United States)

    Shimada, T; Terashima, H; Shimizu, T; Hirayama, K

    2001-01-01

    We report herein a case of invasive thymoma simultaneously associated with lung cancer. A 64-year-old man presented with a cough and anterior chest pain, and preoperative examinations revealed an anterior mediastinal tumor as well as lung cancer. The patient underwent a total thymectomy, partial resection of the right lung, left lower lobectomy, and mediastinal lymph node dissection, followed by radiotherapy. Although it is well known that thymomas may be accompanied by nonthymic cancers, invasive thymomas occurring coincidentally with lung cancer are rarely reported in Japan. This case is very interesting in its relation to the oncogenesis of thymomas. PMID:11428602

  19. Rheumatoid arthritis-associated interstitial lung disease

    Directory of Open Access Journals (Sweden)

    Brown KK

    2012-03-01

    Full Text Available Joshua J Solomon, Kevin K BrownAutoimmune Lung Center and Interstitial Lung Disease Program, National Jewish Health, Denver, CO, USAAbstract: Rheumatoid arthritis (RA is a systemic inflammatory disorder affecting 1% of the US population. Patients can have extra-articular manifestations of their disease and the lungs are commonly involved. RA can affect any compartment of the respiratory system and high resolution computed tomography (HRCT of the lung is abnormal in over half of these patients. Interstitial lung disease is a dreaded complication of RA. It is more prevalent in smokers, males, and those with high antibody titers. The pathogenesis is unknown but data suggest an environmental insult in the setting of a genetic predisposition. Smoking may play a role in the pathogenesis of disease through citrullination of protein in the lung leading to the development of autoimmunity. Patients usually present in middle age with cough and dyspnea. Pulmonary function testing most commonly shows reduced diffusion capacity for carbon monoxide and HRCT reveals a combination of reticulation and ground glass abnormalities. The most common pattern on HRCT and histopathology is usual interstitial pneumonia (UIP, with nonspecific interstitial pneumonia seen less frequently. There are no large-scale well-controlled treatment trials. In severe or progressive cases, treatment usually consists of corticosteroids with or without a cytotoxic agent for 6 months or longer. RA interstitial lung disease is progressive; over half of patients show radiographic progression within 2 years. Patients with a UIP pattern on biopsy have a survival similar to idiopathic pulmonary fibrosis.Keywords: rheumatoid arthritis, interstitial lung disease, nonspecific interstitial pneumonia, usual interstitial pneumonia, anti-CCP

  20. Spontaneous pneumothorax associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Sung, Dong Wook; Jung, Seung Hyae; Yoon, Yup; Lim, Jae Hoon; Cho, Kyu Soek; Yang, Moon Ho [Kyung Hee University Hospital, Seoul (Korea, Republic of)

    1991-05-15

    Spontaneous pneumothorax is a rare manifestation of lung cancer. Eight cases of pneumothorax found in 1648 patients with lung cancer from 1979-1990 are reported. Histopathologic types of cancer were adenocarcinoma in three cases, squamous cell carcinoma in two cases, bronchioloalveolar carcinoma in two cases, and metastatic renal cell carcinoma in one case. The primary tumor mass was not found even after thoracotomy in two cases. Spontaneous pneumothorax occurred on the ipsilateral side of the cancer. All the patients were more than 40 years old with a history of smoking 1-2 packs a day for 20 to 50 years, and had chronic lung diseases. The authors emphasize that bronchogenic carcinoma may be one of the causes of spontaneous pneumothorax in appropriate clinical settings.

  1. Spontaneous pneumothorax associated with lung cancer

    International Nuclear Information System (INIS)

    Spontaneous pneumothorax is a rare manifestation of lung cancer. Eight cases of pneumothorax found in 1648 patients with lung cancer from 1979-1990 are reported. Histopathologic types of cancer were adenocarcinoma in three cases, squamous cell carcinoma in two cases, bronchioloalveolar carcinoma in two cases, and metastatic renal cell carcinoma in one case. The primary tumor mass was not found even after thoracotomy in two cases. Spontaneous pneumothorax occurred on the ipsilateral side of the cancer. All the patients were more than 40 years old with a history of smoking 1-2 packs a day for 20 to 50 years, and had chronic lung diseases. The authors emphasize that bronchogenic carcinoma may be one of the causes of spontaneous pneumothorax in appropriate clinical settings

  2. Diesel engine exhaust and lung cancer: an unproven association.

    OpenAIRE

    Muscat, J E; Wynder, E. L.

    1995-01-01

    The risk of lung cancer associated with diesel exhaust has been calculated from 14 case-control or cohort studies. We evaluated the findings from these studies to determine whether there is sufficient evidence to implicate diesel exhaust as a human lung carcinogen. Four studies found increased risks associated with long-term exposure, although two of the four studies were based on the same cohort of railroad workers. Six studies were inconclusive due to missing information on smoking habits, ...

  3. Pulmonary hypertension associated with lung diseases and hypoxemia.

    Science.gov (United States)

    Cuttica, Michael J

    2016-05-01

    Pulmonary hypertension that develops in the setting of underlying lung diseases such as COPD or idiopathic pulmonary fibrosis (IPF) is associated with decreased functional status, worsening hypoxemia and quality of life, and increased mortality. This complication of lung disease is complex in its origin and carries a unique set of diagnostic and therapeutic issues. This review attempts to provide an overview of mechanisms associated with the onset of pulmonary hypertension in COPD and IPF, touches on appropriate evaluation, and reviews the state of knowledge on treating pulmonary hypertension related to underlying lung disease. PMID:27086030

  4. Primary lung cancer associated with Werner syndrome.

    Science.gov (United States)

    Ohnishi, Shunichiro; Fujimoto, Masaki; Oide, Takashi; Nakatani, Yukio; Tsurutani, Yuya; Koshizaka, Masaya; Mezawa, Morito; Ishikawa, Takahiro; Takemoto, Minoru; Yokote, Koutaro

    2010-10-01

    A 52-year-old man with Werner Syndrome (WS) was admitted to our hospital for the treatment of skin ulcers on his thighs. Routine chest radiography revealed an abnormal shadow in the left upper lung field. Computed tomography (CT) revealed a poorly demarcated homogeneous mass (diameter, 4 cm) in the S1 + 2 lung area; no pleural effusion was observed. CT-guided percutaneous needle biopsy revealed the presence of an adenocarcinoma. Other imaging studies did not reveal any lymph-node involvement or presence of metastatic lesions. The patient was diagnosed with stage IB adenocarcinoma (T2N0M0), and a left upper lobectomy was successfully carried out; postoperative wound healing was steady and uneventful, with no obvious ulcer formation. Primary lung cancers very rarely develop in patients with WS; non-epithelial tumors are usually observed in such patients. Patients with WS usually develop severe skin problems, such as refractory skin ulcers in the extremities; however, our patient did not develop any skin-related complications after surgery. As the expected lifespan of patients with WS is increasing, we need to pay attention not only to the rare non-epithelial malignancy, but also cancer. Further, the expected short lifespan of patients with WS, as well as the possibility of skin-related problems after surgery, should not be considered while deciding whether to take the option of surgery in the case of malignancy. PMID:20887625

  5. Individualized lung recruitment during high-frequency ventilation in preterm infants is not associated with lung hyperinflation and air leaks

    OpenAIRE

    De Jaegere, Anne P; Deurloo, Eline E.; van Rijn, Rick R.; Offringa, Martin; van Kaam, Anton H.

    2016-01-01

    Lung recruitment during high-frequency ventilation (HFV) in preterm infants with respiratory distress syndrome (RDS) has been associated with an increased risk of lung hyperinflation and air leaks. Individualizing the lung recruitment procedure to the severity of lung disease of each patient might reduce these risks. In this prospective cohort study, we evaluated chest X-ray (CXR) characteristics during individualized oxygenation-guided lung recruitment with HFV in preterm infants with RDS, b...

  6. [A case of humidifier lung associated with BHL].

    Science.gov (United States)

    Osaki, J; Nakano, H; Matsumoto, H; Yamazaki, Y; Sakai, H; Tsuji, T; Osaki, Y; Fujikane, T; Sasaki, N; Onodera, S

    1992-06-01

    We encountered a rare case of hypersensitivity pneumonitis associated with bilateral hilar lymphadenopathy (BHL). The patient was a 53-year-old male, who developed dry cough and shortness of breath when using a humidifier since 1982. He was admitted to our hospital for further evaluation in 1987. Chest X-ray films showed BHL and ground glass appearance in the bilateral lung fields. Pulmonary function test indicated disturbance of diffusing capacity. Transbronchial lung biopsy revealed interstitial pneumonitis, and lymph node biopsy by mediastinoscopy showed lymphoid sinus histiocytosis without noncaseating granuloma. Provocation test using the humidifier was positive, and the diagnosis of humidifier lung with BHL was made. PMID:1507691

  7. Factors Associated with Hepatitis B Testing Among Vietnamese Americans

    OpenAIRE

    Tung T Nguyen; McPhee, Stephen J.; Stewart, Susan; Gildengorin, Ginny; Zhang, Lena; Wong, Ching; Maxwell, Annette E.; Bastani, Roshan; Taylor, Vicky M.; Chen, Moon S.

    2010-01-01

    BACKGROUND Chronic hepatitis B and hepatitis B-associated liver cancer is a major health disparity among Vietnamese Americans, who have a chronic hepatitis B prevalence rate of 7–14% and an incidence rate for liver cancer six times that of non-Latino whites. OBJECTIVE Describe factors associated with hepatitis B testing among Vietnamese Americans. DESIGN A population-based telephone survey conducted in 2007–2008. PARTICIPANTS Vietnamese Americans age 18–64 and living in the Northern Californi...

  8. Association of genetic loci with sleep apnea in European Americans and African-Americans: the Candidate Gene Association Resource (CARe.

    Directory of Open Access Journals (Sweden)

    Sanjay R Patel

    Full Text Available Although obstructive sleep apnea (OSA is known to have a strong familial basis, no genetic polymorphisms influencing apnea risk have been identified in cross-cohort analyses. We utilized the National Heart, Lung, and Blood Institute (NHLBI Candidate Gene Association Resource (CARe to identify sleep apnea susceptibility loci. Using a panel of 46,449 polymorphisms from roughly 2,100 candidate genes on a customized Illumina iSelect chip, we tested for association with the apnea hypopnea index (AHI as well as moderate to severe OSA (AHI≥15 in 3,551 participants of the Cleveland Family Study and two cohorts participating in the Sleep Heart Health Study.Among 647 African-Americans, rs11126184 in the pleckstrin (PLEK gene was associated with OSA while rs7030789 in the lysophosphatidic acid receptor 1 (LPAR1 gene was associated with AHI using a chip-wide significance threshold of p-value<2×10(-6. Among 2,904 individuals of European ancestry, rs1409986 in the prostaglandin E2 receptor (PTGER3 gene was significantly associated with OSA. Consistency of effects between rs7030789 and rs1409986 in LPAR1 and PTGER3 and apnea phenotypes were observed in independent clinic-based cohorts.Novel genetic loci for apnea phenotypes were identified through the use of customized gene chips and meta-analyses of cohort data with replication in clinic-based samples. The identified SNPs all lie in genes associated with inflammation suggesting inflammation may play a role in OSA pathogenesis.

  9. Rheumatoid arthritis associated interstitial lung disease: a review

    Directory of Open Access Journals (Sweden)

    Deborah Assayag

    2014-04-01

    Full Text Available Rheumatoid arthritis is a common inflammatory disease affecting about 1% of the population. Interstitial lung disease is a serious and frequent complication of rheumatoid arthritis. Rheumatoid arthritis associated interstitial lung disease (RA-ILD is characterized by several histopathologic subtypes. This article reviews the proposed pathogenesis and risk factors for RA-ILD. We also outline the important steps involved in the work-up of RA-ILD and review the evidence for treatment and prognosis.

  10. [Respiratory bronchiolitis-associated interstitial lung disease (RB-ILD)].

    Science.gov (United States)

    Goeckenjan, G

    2003-05-01

    Respiratory bronchiolitis-associated interstitial lung disease (RB-ILD) designates interstitial lung changes in smokers, characterized histologically by bronchiolocentric accumulation of pigmented alveolar macrophages and fibrotic or cellular inflammatory changes of pulmonary interstitium. The definition is nearly identical to that of condensate pneumopathy, smoker's pneumopathy or smoker's lung, defined by accumulation of pigmented alveolar macrophages with bland alveoloseptal or peribronchial fibrosis and cellular inflammation of the bronchial wall. In addition to respiratory bronchiolitis, which is found in nearly all smokers, RB-ILD comprises a broad spectrum of varying degrees of the interstitial reaction to the exogenous injury of inhalation smoking with gradual transition to desquamative interstitial pneumonia (DIP). In most cases RB-ILD manifestations are subclinical and detected coincidentally. Radiographic features are reticulonodular and ground glass opacities of the lung. The high resolution computed tomography reveals centrilobular nodules, ground glass opacities, thickening of bronchial walls, and in some cases a reticular pattern. Mild emphysema is frequent. Lung function analysis reveals only minor restrictive or obstructive defects in most cases, often combined with hyperinflation. CO diffusing capacity is slightly to moderately impaired. Pronounced interstitial lung diseases with serious restrictive defects and arterial hypoxemia have been reported infrequently. In differential diagnosis smoking related interstitial lung diseases (DIP, Langerhans cell histiocytosis, idiopathic pulmonary fibrosis) and other interstitial lung diseases have to be excluded. In most cases diagnosis can be achieved by bronchoalveolar lavage and transbronchial lung biopsy. In cases of pronounced interstitial lung disease or assumption of an additional interstitial lung disease besides RB-ILD a thoracoscopic or open lung biopsy can be necessary. RB-ILD has a favourable

  11. Association Between Interstitial Lung Abnormalities and All-Cause Mortality

    Science.gov (United States)

    Putman, Rachel K.; Hatabu, Hiroto; Araki, Tetsuro; Gudmundsson, Gunnar; Gao, Wei; Nishino, Mizuki; Okajima, Yuka; Dupuis, Josée; Latourelle, Jeanne C.; Cho, Michael H.; El-Chemaly, Souheil; Coxson, Harvey O.; Celli, Bartolome R.; Fernandez, Isis E.; Zazueta, Oscar E.; Ross, James C.; Harmouche, Rola; Estépar, Raúl San José; Diaz, Alejandro A.; Sigurdsson, Sigurdur; Gudmundsson, Elías F.; Eiríksdottír, Gudny; Aspelund, Thor; Budoff, Matthew J.; Kinney, Gregory L.; Hokanson, John E.; Williams, Michelle C; Murchison, John T.; MacNee, William; Hoffmann, Udo; O’Donnell, Christopher J.; Launer, Lenore J.; Harrris, Tamara B.; Gudnason, Vilmundur; Silverman, Edwin K.; O’Connor, George T.; Washko, George R.; Rosas, Ivan O.; Hunninghake, Gary M.

    2016-01-01

    IMPORTANCE Interstitial lung abnormalities have been associated with decreased six-minute walk distance, diffusion capacity for carbon monoxide and total lung capacity; however to our knowledge, an association with mortality has not been previously investigated. OBJECTIVE To investigate whether interstitial lung abnormalities are associated with increased mortality. DESIGN, SETTING, POPULATION Prospective cohort studies of 2633 participants from the Framingham Heart Study (FHS) (CT scans obtained 9/08–3/11), 5320 from the Age Gene/Environment Susceptibility (AGES)-Reykjavik (recruited 1/02–2/06), 2068 from COPDGene (recruited 11/07–4/10), and 1670 from the Evaluation of COPD Longitudinally to Identify Predictive Surrogate End-points (ECLIPSE) (between 12/05–12/06). EXPOSURES Interstitial lung abnormality status as determined by chest CT evaluation. MAIN OUTCOMES AND MEASURES All cause mortality over approximately 3 to 9 year median follow up time. Cause-of-death information was also examined in the AGES-Reykjavik cohort. RESULTS Interstitial lung abnormalities were present in 177 (7%) of the participants from FHS, 378 (7%) from AGES-Reykjavik, 156 (8%) from COPDGene, and in 157 (9%) from ECLIPSE. Over median follow-up times of ~3–9 years there were more deaths (and a greater absolute rate of mortality) among those with interstitial lung abnormalities compared to those without interstitial lung abnormalities in each cohort; 7% compared to 1% in FHS (6% difference, 95% confidence interval [CI] 2%, 10%), 56% compared to 33% in AGES-Reykjavik (23% difference, 95% CI 18%, 28%), 16% compared to 11% in COPDGene (5% difference, 95% CI −1%, 11%) and 11% compared to 5% in ECLIPSE (6% difference, 95% CI 1%, 11%). After adjustment for covariates, interstitial lung abnormalities were associated with an increase in the risk of death in the FHS (HR=2.7, 95% CI, 1.1–65, P=0.030), AGES-Reykjavik (HR 1.3, 95% CI 1.2–1.4, P<0.001), COPDGene (HR=1.8, 95% CI, 1.1, 2

  12. Effect of primarily cultured human lung cancer-associated fibroblasts on radiosensitivity of lung cancer cells

    International Nuclear Information System (INIS)

    Objective: To investigate the effect of human lung cancer-associated fibroblasts (CAF) on the radiosensitivity of lung cancer cells when CAF is placed in direct contact co-culture with lung cancer cells. Methods: Human lung CAF was obtained from fresh human lung adenocarcinoma tissue specimens by primary culture and subculture and was then identified by immunofluorescence staining. The CAF was placed in direct contact co-culture with lung cancer A549 and H1299 cells, and the effects of CAF on the radiosensitivity of A549 and H1299 cells were evaluated by colony-forming assay. Results: The human lung CAF obtained by adherent culture could stably grow and proliferate, and it had specific expression of α-smooth muscle actin, vimentin, and fibroblast activation protein,but without expression of cytokeratin-18. The plating efficiency (PE, %) of A549 cells at 0 Gy irradiation was (20.0 ± 3.9)% when cultured alone versus (32.3 ± 5.5)% when co-cultured with CAF (t=3.16, P<0.05), and the PE of H1299 cells at 0 Gy irradiation was (20.6 ± 3.1)% when cultured alone versus (35.2 ± 2.3)% when co-cultured with CAF (t=6.55, P<0.05). The cell survival rate at 2 Gy irradiation (SF2) of A549 cells was 0.727 ±0.061 when cultured alone versus 0.782 ± 0.089 when co-cultured with CAF (t=0.88, P>0.05), and the SF2 of H1299 cells was 0.692 ±0.065 when cultured alone versus 0.782 ± 0.037 when co-cultured with CAF (t=2.08, P>0.05). The protection enhancement ratios of human lung CAF for A549 cells and H1299 cells were 1.29 and 1.25, respectively. Conclusions: Human lung CAF reduces the radiosensitivity of lung cancer cells when placed in direct contact co-culture with them, and the radioprotective effect may be attributed to CAF promoting the proliferation of lung cancer cells. (authors)

  13. Interstitial lung disease associated with connective tissue diseases

    International Nuclear Information System (INIS)

    An interstitial lung disease (ILD) belongs to a group of diffuse parenchyma lung diseases it should be differentiated from other pathologies among those are idiopathic and ILD associated to connective tissue diseases (CTD) New concepts have been developed in the last years and they have been classified in seven defined subgroups. It has been described the association of each one of these subgroups with CTD. Natural history and other aspects of its treatment is not known completely .For complete diagnose it is required clinical, image and histopathologic approaches. The biopsy lung plays an essential role. It is important to promote and to stimulate the subclasification of each subgroup with the purpose of knowing their natural history directing the treatment and to improve their outcome

  14. Association of Epstein Barr virus deoxyribonucleic acid with lung carcinoma

    Directory of Open Access Journals (Sweden)

    Amir Hossein Jafarian

    2013-01-01

    Full Text Available Context: Lung cancer is the leading cause of cancer death worldwide. In addition to smoking, a variety of other contributing factors, including viral infection, have been suggested in tumorigenesis. Epstein Barr virus (EBV, which is linked to various malignancies, seems to be a good candidate. Aims: The aim of this study was to investigate the association of EBV with lung carcinomas. Settings and Design: A total number of 90 formalin fixed paraffin embedded lung tissue samples including 48 cases of lung cancers (18 squamous cell carcinomas [SCCs], 18 adenocarcinomas and 12 small cell carcinomas and 42 non-tumoral samples (control group, were retrieved from the pathology archive. Materials and Methods: Following deoxyribonucleic acid extraction, polymerase chain reaction (PCR was performed using an EBV-Eph PCR kit. The positive cases were studied immunohistochemically for the expression of EBV-late membrane protein-1 (EBV-LMP-1 in tumoral tissues. Statistical Analysis Used: The t-test and Fisher exact test were used and P < 0.05 was considered statistically significant. Results: Five of our cases, including four SCCs and one adenocarcinoma and two control samples showed a positive reaction in PCR. All positive tumoral cases showed diffuse staining with LMP-1 in immunohistochemistry. Conclusions: We found a significant difference in the presence of the EBV genome in cases of lung SCC compared to other lung lesions (P = 0.02. According to our data, EBV is not at major play in the non-lymphoepithelioma-like cancers of the lung in general, but may have a role in the tumorigenesis of some lung SCCs.

  15. American Kinesiology Association: A National Effort to Promote Kinesiology

    Science.gov (United States)

    Morrow, James R., Jr.; Thomas, Jerry R.

    2010-01-01

    The American Academy of Kinesiology and Physical Education (AAKPE) and The American Kinesiology Association (AKA) should work together to help kinesiology thrive. Data are provided about kinesiology that reflects its visibility in PubMed and Google. Survey data from AKA show the rapid growth of the undergraduate major and graduate programs. In…

  16. Faculty member receives American Agricultural Law Association highest honor

    OpenAIRE

    Sutphin, Michael D.

    2008-01-01

    L. Leon Geyer of Blacksburg, Va., professor of agricultural and applied economics in Virginia Tech's College of Agriculture and Life Sciences, has received the 2008 American Agricultural Law Association (AALA) Distinguished Service Award.

  17. Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans

    OpenAIRE

    Hansen, Helen M.; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M.; Wrensch, Margaret R.; Sison, Jennette D.; Chang, Jeffery S.; Smirnov, Ivan V.; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P.; Kelsey, Karl T.; Wiencke, John K.

    2010-01-01

    Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10−20). In order to narrow the region of association and identify potential c...

  18. Factors Associated with Hepatitis B Testing Among Vietnamese Americans

    OpenAIRE

    Tung T Nguyen; McPhee, Stephen J.; Stewart, Susan; Gildengorin, Ginny; Zhang, Lena; Wong, Ching; Maxwell, Annette E.; Bastani, Roshan; Taylor, Vicky M.; Chen, Moon S.

    2010-01-01

    Chronic hepatitis B and hepatitis B-associated liver cancer is a major health disparity among Vietnamese Americans, who have a chronic hepatitis B prevalence rate of 7–14% and an incidence rate for liver cancer six times that of non-Latino whites. Describe factors associated with hepatitis B testing among Vietnamese Americans. A population-based telephone survey conducted in 2007–2008. Vietnamese Americans age 18–64 and living in the Northern California and Washington, DC areas (N = ...

  19. Association of variations in HLA class II and other loci with susceptibility to EGFR-mutated lung adenocarcinoma.

    Science.gov (United States)

    Shiraishi, Kouya; Okada, Yukinori; Takahashi, Atsushi; Kamatani, Yoichiro; Momozawa, Yukihide; Ashikawa, Kyota; Kunitoh, Hideo; Matsumoto, Shingo; Takano, Atsushi; Shimizu, Kimihiro; Goto, Akiteru; Tsuta, Koji; Watanabe, Shun-Ichi; Ohe, Yuichiro; Watanabe, Yukio; Goto, Yasushi; Nokihara, Hiroshi; Furuta, Koh; Yoshida, Akihiko; Goto, Koichi; Hishida, Tomoyuki; Tsuboi, Masahiro; Tsuchihara, Katsuya; Miyagi, Yohei; Nakayama, Haruhiko; Yokose, Tomoyuki; Tanaka, Kazumi; Nagashima, Toshiteru; Ohtaki, Yoichi; Maeda, Daichi; Imai, Kazuhiro; Minamiya, Yoshihiro; Sakamoto, Hiromi; Saito, Akira; Shimada, Yoko; Sunami, Kuniko; Saito, Motonobu; Inazawa, Johji; Nakamura, Yusuke; Yoshida, Teruhiko; Yokota, Jun; Matsuda, Fumihiko; Matsuo, Keitaro; Daigo, Yataro; Kubo, Michiaki; Kohno, Takashi

    2016-01-01

    Lung adenocarcinoma driven by somatic EGFR mutations is more prevalent in East Asians (30-50%) than in European/Americans (10-20%). Here we investigate genetic factors underlying the risk of this disease by conducting a genome-wide association study, followed by two validation studies, in 3,173 Japanese patients with EGFR mutation-positive lung adenocarcinoma and 15,158 controls. Four loci, 5p15.33 (TERT), 6p21.3 (BTNL2), 3q28 (TP63) and 17q24.2 (BPTF), previously shown to be strongly associated with overall lung adenocarcinoma risk in East Asians, were re-discovered as loci associated with a higher susceptibility to EGFR mutation-positive lung adenocarcinoma. In addition, two additional loci, HLA class II at 6p21.32 (rs2179920; P =5.1 × 10(-17), per-allele OR=1.36) and 6p21.1 (FOXP4) (rs2495239; P=3.9 × 10(-9), per-allele OR=1.19) were newly identified as loci associated with EGFR mutation-positive lung adenocarcinoma. This study indicates that multiple genetic factors underlie the risk of lung adenocarcinomas with EGFR mutations. PMID:27501781

  20. Impact of Neuro-Psychological Factors on Smoking-Associated Lung Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Schuller, Hildegard M. [Experimental Oncology Laboratory, Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, 2407 River Drive, Knoxville, TN 37996 (United States)

    2014-03-13

    Smoking has been extensively documented as a risk factor for all histological types of lung cancer and tobacco-specific nitrosamines and polycyclic aromatic hydrocarbons reproducibly cause lung cancer in laboratory rodents. However, the most common lung cancer, non-small cell lung cancer (NSCLC), frequently develops in never smokers and is particularly common in women and African Americans, suggesting that factors unrelated to smoking significantly impact this cancer. Recent experimental investigations in vitro and in animal models have shown that chronic psychological stress and the associated hyperactive signaling of stress neurotransmitters via β-adrenergic receptors significantly promote the growth and metastatic potential of NSCLC. These responses were caused by modulation in the expression and sensitization state of nicotinic acetylcholine receptors (nAChRs) that regulate the production of stress neurotransmitters and the inhibitory neurotransmitter γ-aminobutyric acid (GABA). Similar changes in nAChR-mediated neurotransmitter production were identified as the cause of NSCLC stimulation in vitro and in xenograft models by chronic nicotine. Collectively, these data suggest that hyperactivity of the sympathetic branch of the autonomic nervous system caused by chronic psychological stress or chronic exposure to nicotinic agonists in cigarette smoke significantly contribute to the development and progression of NSCLC. A recent clinical study that reported improved survival outcomes with the incidental use of β-blockers among patients with NSCLC supports this interpretation.

  1. Impact of Neuro-Psychological Factors on Smoking-Associated Lung Cancer

    International Nuclear Information System (INIS)

    Smoking has been extensively documented as a risk factor for all histological types of lung cancer and tobacco-specific nitrosamines and polycyclic aromatic hydrocarbons reproducibly cause lung cancer in laboratory rodents. However, the most common lung cancer, non-small cell lung cancer (NSCLC), frequently develops in never smokers and is particularly common in women and African Americans, suggesting that factors unrelated to smoking significantly impact this cancer. Recent experimental investigations in vitro and in animal models have shown that chronic psychological stress and the associated hyperactive signaling of stress neurotransmitters via β-adrenergic receptors significantly promote the growth and metastatic potential of NSCLC. These responses were caused by modulation in the expression and sensitization state of nicotinic acetylcholine receptors (nAChRs) that regulate the production of stress neurotransmitters and the inhibitory neurotransmitter γ-aminobutyric acid (GABA). Similar changes in nAChR-mediated neurotransmitter production were identified as the cause of NSCLC stimulation in vitro and in xenograft models by chronic nicotine. Collectively, these data suggest that hyperactivity of the sympathetic branch of the autonomic nervous system caused by chronic psychological stress or chronic exposure to nicotinic agonists in cigarette smoke significantly contribute to the development and progression of NSCLC. A recent clinical study that reported improved survival outcomes with the incidental use of β-blockers among patients with NSCLC supports this interpretation

  2. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Science.gov (United States)

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  3. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    OpenAIRE

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  4. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Directory of Open Access Journals (Sweden)

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  5. Translating Lung Function Genome-Wide Association Study (GWAS) Findings: New Insights for Lung Biology.

    Science.gov (United States)

    Kheirallah, A K; Miller, S; Hall, I P; Sayers, I

    2016-01-01

    Chronic respiratory diseases are a major cause of worldwide mortality and morbidity. Although hereditary severe deficiency of α1 antitrypsin (A1AD) has been established to cause emphysema, A1AD accounts for only ∼1% of Chronic Obstructive Pulmonary Disease (COPD) cases. Genome-wide association studies (GWAS) have been successful at detecting multiple loci harboring variants predicting the variation in lung function measures and risk of COPD. However, GWAS are incapable of distinguishing causal from noncausal variants. Several approaches can be used for functional translation of genetic findings. These approaches have the scope to identify underlying alleles and pathways that are important in lung function and COPD. Computational methods aim at effective functional variant prediction by combining experimentally generated regulatory information with associated region of the human genome. Classically, GWAS association follow-up concentrated on manipulation of a single gene. However association data has identified genetic variants in >50 loci predicting disease risk or lung function. Therefore there is a clear precedent for experiments that interrogate multiple candidate genes in parallel, which is now possible with genome editing technology. Gene expression profiling can be used for effective discovery of biological pathways underpinning gene function. This information may be used for informed decisions about cellular assays post genetic manipulation. Investigating respiratory phenotypes in human lung tissue and specific gene knockout mice is a valuable in vivo approach that can complement in vitro work. Herein, we review state-of-the-art in silico, in vivo, and in vitro approaches that may be used to accelerate functional translation of genetic findings. PMID:26915270

  6. 2009 Annual Report of the American Psychological Association

    Science.gov (United States)

    American Psychologist, 2010

    2010-01-01

    This annual report of the American Psychological Association (APA) describes the association's activities and accomplishments in 2009. It describes strides made toward the goal of infusing psychology into the health care marketplace and of bringing psychology--and the unique skills of psychologists--to the attention of the public. This report aims…

  7. 2010 Annual Report of the American Psychological Association

    Science.gov (United States)

    American Psychologist, 2011

    2011-01-01

    This report presents the 2010 annual report of the American Psychological Association (APA). It provides the highlights of the association's and individual directorate's activities to APA members. APA continued its efforts to advance psychological practice and ensure the public's access to high-quality psychological services, apply psychological…

  8. An Association Perspective: Responding to the American Dental Association's Future of Dentistry Project.

    Science.gov (United States)

    Hutchinson, Rowland A.; Haden, N. Karl; Valachovic, Richard W.

    2000-01-01

    In response to the American Dental Association's (ADA) Future of Dentistry Project, the American Dental Education Association (ADEA) provided perspective on the most critical issues facing the dental profession. ADEA responded in six areas, each corresponding to areas of focus in the ADA project. This report reflects comments provided to the ADEA…

  9. Reading and analysis on management guidelines for hyperthyroidism published in 2011 by American Thyroid Association and American Association of Clinical Endocrinologists

    International Nuclear Information System (INIS)

    Recently, the American Thyroid Association and American Association of Clinical Endocrinologists published 'Hyperthyroidism and other causes of thyrotoxicosis: management guidelines of the American Thyroid Association and American Association of Clinical Endocrinologists', and created 100 evidence-based recommendations. The guideline systematically introduced the diagnoses and therapies of hyperthyroidism, emphasizing the indications, contraindications, preparations, methodologies and follow-up strategies. The guideline also provided detailed management principles for hyperthyroidism in children and pregnancy, Graves' ophthalmopathy and some unusual causes of hyperthyroidism. (authors)

  10. Association between lung function and airway wall density

    Science.gov (United States)

    Leader, J. Ken; Zheng, Bin; Fuhrman, Carl R.; Tedrow, John; Park, Sang C.; Tan, Jun; Pu, Jiantao; Drescher, John M.; Gur, David; Sciurba, Frank C.

    2009-02-01

    Computed tomography (CT) examination is often used to quantify the relation between lung function and airway remodeling in chronic obstructive pulmonary disease (COPD). In this preliminary study, we examined the association between lung function and airway wall computed attenuation ("density") in 200 COPD screening subjects. Percent predicted FVC (FVC%), percent predicted FEV1 (FEV1%), and the ratio of FEV1 to FVC as a percentage (FEV1/FVC%) were measured post-bronchodilator. The apical bronchus of the right upper lobe was manually selected from CT examinations for evaluation. Total airway area, lumen area, wall area, lumen perimeter and wall area as fraction of the total airway area were computed. Mean HU (meanHU) and maximum HU (maxHU) values were computed across pixels assigned membership in the wall and with a HU value greater than -550. The Pearson correlation coefficients (PCC) between FVC%, FEV1%, and FEV1/FVC% and meanHU were -0.221 (p = 0.002), -0.175 (p = 0.014), and -0.110 (p = 0.123), respectively. The PCCs for maxHU were only significant for FVC%. The correlations between lung function and the airway morphometry parameters were slightly stronger compared to airway wall density. MeanHU was significantly correlated with wall area (PCC = 0.720), airway area (0.498) and wall area percent (0.611). This preliminary work demonstrates that airway wall density is associated with lung function. Although the correlations in our study were weaker than a recent study, airway wall density initially appears to be an important parameter in quantitative CT analysis of COPD.

  11. Rare variant associations with waist-to-hip ratio in European-American and African-American women from the NHLBI-Exome Sequencing Project.

    Science.gov (United States)

    Kan, Mengyuan; Auer, Paul L; Wang, Gao T; Bucasas, Kristine L; Hooker, Stanley; Rodriguez, Alejandra; Li, Biao; Ellis, Jaclyn; Adrienne Cupples, L; Ida Chen, Yii-Der; Dupuis, Josée; Fox, Caroline S; Gross, Myron D; Smith, Joshua D; Heard-Costa, Nancy; Meigs, James B; Pankow, James S; Rotter, Jerome I; Siscovick, David; Wilson, James G; Shendure, Jay; Jackson, Rebecca; Peters, Ulrike; Zhong, Hua; Lin, Danyu; Hsu, Li; Franceschini, Nora; Carlson, Chris; Abecasis, Goncalo; Gabriel, Stacey; Bamshad, Michael J; Altshuler, David; Nickerson, Deborah A; North, Kari E; Lange, Leslie A; Reiner, Alexander P; Leal, Suzanne M

    2016-08-01

    Waist-to-hip ratio (WHR), a relative comparison of waist and hip circumferences, is an easily accessible measurement of body fat distribution, in particular central abdominal fat. A high WHR indicates more intra-abdominal fat deposition and is an established risk factor for cardiovascular disease and type 2 diabetes. Recent genome-wide association studies have identified numerous common genetic loci influencing WHR, but the contributions of rare variants have not been previously reported. We investigated rare variant associations with WHR in 1510 European-American and 1186 African-American women from the National Heart, Lung, and Blood Institute-Exome Sequencing Project. Association analysis was performed on the gene level using several rare variant association methods. The strongest association was observed for rare variants in IKBKB (P=4.0 × 10(-8)) in European-Americans, where rare variants in this gene are predicted to decrease WHRs. The activation of the IKBKB gene is involved in inflammatory processes and insulin resistance, which may affect normal food intake and body weight and shape. Meanwhile, aggregation of rare variants in COBLL1, previously found to harbor common variants associated with WHR and fasting insulin, were nominally associated (P=2.23 × 10(-4)) with higher WHR in European-Americans. However, these significant results are not shared between African-Americans and European-Americans that may be due to differences in the allelic architecture of the two populations and the small sample sizes. Our study indicates that the combined effect of rare variants contribute to the inter-individual variation in fat distribution through the regulation of insulin response. PMID:26757982

  12. Obesity in American Indian and Mexican American Men and Women: Associations with Blood Pressure and Cardiovascular Autonomic Control

    OpenAIRE

    Criado, José R.; Gilder, David A.; Kalafut, Mary A.; Ehlers, Cindy L.

    2013-01-01

    Obesity is a serious public health problem, especially in some minority communities, and it has been associated with an increased risk of cardiovascular diseases. While obesity is a serious health concern in both American Indian and Mexican American populations, the relationship between obesity and cardiac autonomic control in these two populations is not well understood. The present study in a selected sample of American Indians and Mexican Americans assessed associations between obesity, bl...

  13. Low cognitive ability in early adulthood is associated with reduced lung function in middle age

    DEFF Research Database (Denmark)

    Carroll, Douglas; Batty, G David; Mortensen, Laust Hvas;

    2011-01-01

    Reduced lung function has been linked to poorer cognitive ability later in life. In the present study, the authors examined the converse: whether there was a prospective association between cognitive ability in early adulthood and lung function in middle age.......Reduced lung function has been linked to poorer cognitive ability later in life. In the present study, the authors examined the converse: whether there was a prospective association between cognitive ability in early adulthood and lung function in middle age....

  14. European and North American lung cancer screening experience and implications for pulmonary nodule management

    International Nuclear Information System (INIS)

    The potential for low dose computed tomography (LDCT) to act as an effective tool in screening for lung cancer is currently the subject of several randomised control trials. It has recently been given prominence by interim results released by the North American National Lung Screening Trial (NLST). Several other trials assessing LDCT as a screening tool are currently underway in Europe, and are due to report their final results in the next few years. These include the NELSON, DLSCT, DANTE, ITALUNG, MILD and LUSI trials. Although slow to instigate a trial of its own, the UK Lung Screen (UKLS) trial will shortly commence. The knowledge gained from the newer trials has mostly reinforced and refined previous concepts that have formed the basis of existing nodule management guidelines. This article takes the opportunity to summarise the main aspects and initial results of the trials presently underway, assess the status of current collaborative efforts and the scope for future collaboration, and analyse observations from these studies that may usefully inform the management of the indeterminate pulmonary nodule. (orig.)

  15. Associations of cigarette smoking with rheumatoid arthritis in African Americans

    Science.gov (United States)

    Mikuls, Ted R.; Sayles, Harlan; Yu, Fang; LeVan, Tricia; Gould, Karen A.; Thiele, Geoffrey M.; Conn, Doyt; Jonas, Beth L.; Callahan, Leigh F.; Smith, Edwin; Brasington, Richard; Moreland, Larry W.; Reynolds, Richard; Bridges, S. Louis

    2010-01-01

    Objective To examine the associations of cigarette smoking with rheumatoid arthritis (RA) in African Americans and to determine to whether this association is impacted by HLA-DRB1 shared epitope (SE). Methods Smoking status, cumulative smoking exposure, and SE status were measured in African American patients with RA and in healthy controls. Associations of smoking with RA were examined using age- and gender-adjusted logistic regression. Additive and multiplicative SE-smoking interactions were examined. Results After adjusting for age and gender, ever (OR = 1.45; 95% CI 1.07 to 1.97) and current smoking (OR = 1.56; 95% CI 1.07 to 2.26) were more common in African American RA cases (n = 605) than in controls (n = 255). The association of smoking with RA was limited to those with a cumulative exposure exceeding 10 pack-years, associations that were evident in both autoantibody positive and negative disease. There was evidence of a significant additive interaction between SE status and heavy smoking (≥ 10 pack-years) in RA risk (attributable proportion due to interaction [AP] of 0.58, p = 0.007) with an AP of 0.47 (p = 0.006) between SE status and ever smoking. There was no evidence of multiplicative interactions. Conclusion Among African Americans, cigarette smoking is associated not only with the risk of autoantibody positive RA but also with the risk of autoantibody negative disease. RA risk attributable to smoking is limited to African Americans with more than 10 pack-years of exposure and is more pronounced among individuals positive for HLA-DRB1 SE. PMID:20722010

  16. Society for melanoma research and american heart association scientific sessions.

    Science.gov (United States)

    Alexander, Walter

    2015-01-01

    Among the featured topics: oncolytic immunotherapy, BRAF/MEK inhibition, and a programmed death-1 inhibitor at the Society for Melanoma Research; and anticoagulation therapy, an alternative to statins, and endocarditis in the absence of dental antibiotic prophylaxis at the American Heart Association Scientific Sessions. PMID:25628510

  17. Associations among Asian Americans' Enculturation, Emotional Experiences, and Depressive Symptoms

    Science.gov (United States)

    Wong, Y. Joel; Tran, Kimberly K.; Lai, Andre

    2009-01-01

    Using a computer-based text analysis of 218 Asian Americans' writing samples, the authors found that enculturation as well as use of negative emotion and positive emotion words were associated with depressive symptoms. Enculturation was also found to moderate the relation between use of negative emotion words and cognitive--affective depressive…

  18. American Art Therapy Association, Inc.: 2011 Membership Survey Report

    Science.gov (United States)

    Elkins, David E.; Deaver, Sarah P.

    2013-01-01

    The American Art Therapy Association (AATA) surveys its members biennially to gather information on general demographics, employment-related characteristics, licensing, and professional affiliations. The surveys are used in the development of national media opportunities and public policy initiatives to help increase recognition for the field of…

  19. American Art Therapy Association, Inc.: 2013 Membership Survey Report

    Science.gov (United States)

    Elkins, David E.; Deaver, Sarah P.

    2015-01-01

    The American Art Therapy Association (AATA) surveys its members biennially to collect data regarding membership demographics as well as variables concerning the work environment for art therapists. These surveys can provide a detailed description of these characteristics and how they may change over time. This article statistically compares the…

  20. American Association of Dental Schools Curricular Guidelines for Oral Radiology.

    Science.gov (United States)

    Journal of Dental Education, 1980

    1980-01-01

    Oral radiology curricular guidelines developed by the American Association of Dental Schools are provided. The guidelines describe minimal conditions under which a satisfactory educational experience can be offered. Principles of x-radiation, radiobiological concepts, radiological health, radiographic technique, radiographic quality, and darkroom…

  1. American Association of Physics Teachers Annual Report, 2009

    Science.gov (United States)

    American Association of Physics Teachers (NJ1), 2009

    2009-01-01

    The American Association of Physics Teachers (AAPT) mission is to enhance the understanding and appreciation of physics through teaching. Embracing the notion that physics understanding is critical to the wellbeing of society, AAPT is committed to serving its members and the larger community by promoting effectiveness in physics teaching for…

  2. American Association of Dental Schools Curricular Guidelines for Orthodontics.

    Science.gov (United States)

    Journal of Dental Education, 1980

    1980-01-01

    Guidelines reviewed and approved by the American Association of Dental Schools and sent to the Council on Dental Education in June 1979 are outlined. Educational goals and objectives and sequence of instruction (including growth and development, preclinical orthodontics, and clinical experience) are discussed. (MLW)

  3. Past and future American Psychological Association guidelines for statistical practice

    NARCIS (Netherlands)

    Finch, S; Thomason, N; Cumming, G

    2002-01-01

    We review the publication guidelines of the American Psychological Association (APA) since 1929 and document their advice for authors about statistical practice. Although the advice has been extended with each revision of the guidelines, it has largely focused on null hypothesis significance testing

  4. An Official American Thoracic Society Workshop Report 2015. Stem Cells and Cell Therapies in Lung Biology and Diseases.

    Science.gov (United States)

    Wagner, Darcy E; Cardoso, Wellington V; Gilpin, Sarah E; Majka, Susan; Ott, Harald; Randell, Scott H; Thébaud, Bernard; Waddell, Thomas; Weiss, Daniel J

    2016-08-01

    The University of Vermont College of Medicine, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, Cystic Fibrosis Foundation, European Respiratory Society, International Society for Cellular Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, "Stem Cells and Cell Therapies in Lung Biology and Lung Diseases," held July 27 to 30, 2015, at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This 10th anniversary conference was a follow up to five previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, 2011, and 2013. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and respiratory disease foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields. PMID:27509163

  5. Vitamin D intake is associated with insulin sensitivity in African American, but not European American, women

    Directory of Open Access Journals (Sweden)

    Oster Robert A

    2010-04-01

    Full Text Available Abstract Background The prevalence of type 2 diabetes is higher among African Americans (AA vs European Americans (EA, independent of obesity and other known confounders. Although the reason for this disparity is not known, it is possible that relatively low levels of vitamin D among AA may contribute, as vitamin D has been positively associated with insulin sensitivity in some studies. The objective of this study was to test the hypothesis that dietary vitamin D would be associated with a robust measure of insulin sensitivity in AA and EA women. Methods Subjects were 115 African American (AA and 137 European American (EA healthy, premenopausal women. Dietary intake was determined with 4-day food records; the insulin sensitivity index (SI with a frequently-sampled intravenous glucose tolerance test and minimal modeling; the Homeostasis Model Assessment of Insulin Resistance (HOMA-IR with fasting insulin and glucose; and body composition with dual-energy X-ray absorptiometry. Results Vitamin D intake was positively associated with SI (standardized β = 0.18, P = 0.05 and inversely associated with HOMA-IR (standardized β = -0.26, P = 0.007 in AA, and the relationships were independent of age, total body fat, energy intake, and % kcal from fat. Vitamin D intake was not significantly associated with indices of insulin sensitivity/resistance in EA (standardized β = 0.03, P = 0.74 and standardized β = 0.02, P = 0.85 for SI and HOMA-IR, respectively. Similar to vitamin D, dietary calcium was associated with SI and HOMA-IR among AA but not EA. Conclusions This study provides novel findings that dietary vitamin D and calcium were independently associated with insulin sensitivity in AA, but not EA. Promotion of these nutrients in the diet may reduce health disparities in type 2 diabetes risk among AA, although longitudinal and intervention studies are required.

  6. The American Library Association in Latin America: American Librarianship as a "Modern" Model during the Good Neighbor Policy Era.

    Science.gov (United States)

    Maymi-Sugranes, Hector J.

    2002-01-01

    Through American Library Association (ALA) projects in Latin America, American librarianship progressed from conceptualization to implementation as the model in modernizing Latin American library practices and societies. Development of library practices was fundamental to pursuit of a "modern" society. In fighting fascist propaganda, the United…

  7. Ventilator-associated lung injury during assisted mechanical ventilation.

    Science.gov (United States)

    Saddy, Felipe; Sutherasan, Yuda; Rocco, Patricia R M; Pelosi, Paolo

    2014-08-01

    Assisted mechanical ventilation (MV) may be a favorable alternative to controlled MV at the early phase of acute respiratory distress syndrome (ARDS), since it requires less sedation, no paralysis and is associated with less hemodynamic deterioration, better distal organ perfusion, and lung protection, thus reducing the risk of ventilator-associated lung injury (VALI). In the present review, we discuss VALI in relation to assisted MV strategies, such as volume assist-control ventilation, pressure assist-control ventilation, pressure support ventilation (PSV), airway pressure release ventilation (APRV), APRV with PSV, proportional assist ventilation (PAV), noisy ventilation, and neurally adjusted ventilatory assistance (NAVA). In summary, we suggest that assisted MV can be used in ARDS patients in the following situations: (1) Pao(2)/Fio(2) >150 mm Hg and positive end-expiratory pressure ≥ 5 cm H(2)O and (2) with modalities of pressure-targeted and time-cycled breaths including more or less spontaneous or supported breaths (A-PCV [assisted pressure-controlled ventilation] or APRV). Furthermore, during assisted MV, the following parameters should be monitored: inspiratory drive, transpulmonary pressure, and tidal volume (6 mL/kg). Further studies are required to determine the impact of novel modalities of assisted ventilation such as PAV, noisy pressure support, and NAVA on VALI. PMID:25105820

  8. International Association for the Study of Lung Cancer Computed Tomography Screening Workshop 2011 Report

    NARCIS (Netherlands)

    Field, John K.; Smith, Robert A.; Aberle, Denise R.; Oudkerk, Matthijs; Baldwin, David R.; Yankelevitz, David; Pedersen, Jesper Holst; Swanson, Scott James; Travis, William D.; Wisbuba, Ignacio I.; Noguchi, Masayuki; Mulshine, Jim L.

    2012-01-01

    The International Association for the Study of Lung Cancer (IASLC) Board of Directors convened a computed tomography (CT) Screening Task Force to develop an IASLC position statement, after the National Cancer Institute press statement from the National Lung Screening Trial showed that lung cancer de

  9. Multiple loci associated with renal function in African Americans.

    Directory of Open Access Journals (Sweden)

    Daniel Shriner

    Full Text Available The incidence of chronic kidney disease varies by ethnic group in the USA, with African Americans displaying a two-fold higher rate than European Americans. One of the two defining variables underlying staging of chronic kidney disease is the glomerular filtration rate. Meta-analysis in individuals of European ancestry has identified 23 genetic loci associated with the estimated glomerular filtration rate (eGFR. We conducted a follow-up study of these 23 genetic loci using a population-based sample of 1,018 unrelated admixed African Americans. We included in our follow-up study two variants in APOL1 associated with end-stage kidney disease discovered by admixture mapping in admixed African Americans. To address confounding due to admixture, we estimated local ancestry at each marker and global ancestry. We performed regression analysis stratified by local ancestry and combined the resulting regression estimates across ancestry strata using an inverse variance-weighted fixed effects model. We found that 11 of the 24 loci were significantly associated with eGFR in our sample. The effect size estimates were not significantly different between the subgroups of individuals with two copies of African ancestry vs. two copies of European ancestry for any of the 11 loci. In contrast, allele frequencies were significantly different at 10 of the 11 loci. Collectively, the 11 loci, including four secondary signals revealed by conditional analyses, explained 14.2% of the phenotypic variance in eGFR, in contrast to the 1.4% explained by the 24 loci in individuals of European ancestry. Our findings provide insight into the genetic basis of variation in renal function among admixed African Americans.

  10. Biomarkers in connective tissue disease-associated interstitial lung disease.

    Science.gov (United States)

    Bonella, Francesco; Costabel, Ulrich

    2014-04-01

    This article reviews major biomarkers in serum and bronchoalveolar lavage fluid (BALF) with respect to their diagnostic and prognostic value in connective tissue disease-associated interstitial lung disease (CTD-ILD). In some CTD such as systemic sclerosis (SSc), the incidence of ILD is up to two-third of patients, and currently ILD represents the leading cause of death in SSc. Because of the extremely variable incidence and outcome of ILD in CTD, progress in the discovery and validation of biomarkers for diagnosis, prognosis, patients' subtyping, response to treatment, or as surrogate endpoints in clinical trials is extremely important. In contrast to idiopathic interstitial pneumonias, autoantibodies play a crucial role as biomarkers in CTD-ILD because their presence is strictly linked to the pathogenesis and tissue damage. Patterns of autoantibodies, for instance, anticitrullinated peptide antibodies in rheumatoid arthritis or aminoacyl-tRNA synthetases (ARS) in polymyositis/dermatomyositis, have been found to correlate with the presence and occasionally with the course of ILD in CTD. Besides autoantibodies, an increase in serum or BALF of a biomarker of pulmonary origin may be able to predict or reflect the development of fibrosis, the impairment of lung function, and ideally also the prognosis. Promising biomarkers are lung epithelium-derived proteins such as KL-6 (Krebs von den Lungen-6), SP-D (surfactant protein-D), SP-A (surfactant protein-A), YKL-40 (chitinase-3-like protein 1 [CHI3L1] or cytokines such as CCL18 [chemokine (C-C) motif ligand 18]). In the future, genetic/epigenetic markers, such as human leukocyte antigen (HLA) haplotypes, single nucleotide polymorphisms, and micro-RNA, may help to identify subtypes of patients with different needs of management and treatment strategies. PMID:24668534

  11. Genetic variants associated with lung function: the long life family study

    OpenAIRE

    Thyagarajan, Bharat; Wojczynski, Mary; Minster, Ryan L.; Sanders, Jason; Barral, Sandra; Christiansen, Lene; Barr, R Graham; ,; Newman, Anne

    2014-01-01

    Background Reduced forced expiratory volume in 1 second (FEV1) and the ratio of FEV1 to forced vital capacity (FVC) are strong predictors of mortality and lung function is higher among individuals with exceptional longevity. However, genetic factors associated with lung function in individuals with exceptional longevity have not been identified. Method We conducted a genome wide association study (GWAS) to identify novel genetic variants associated with lung function in the Long Life Family S...

  12. Fatal interstitial lung disease associated with oral erlotinib therapy for lung cancer

    International Nuclear Information System (INIS)

    Erlotinib is a Human Epidermal Growth Factor Receptor Type 1/tyrosine kinase (EGFR) inhibitor which is used for non-small-cell lung cancer treatment. Despite that erlotinib is considered to have a favorable safety profile, adverse events such as interstitial lung disease (ILD) were reported in pivotal studies. The authors report the first histologically confirmed case of fatal ILD associated with erlotinib therapy. The medical record of a patient who developed fatal ILD after receiving erlotinib treatment was reviewed to identify the cause of death and other factors potentially contributive to this adverse outcome. A 55-year-old smoker with no evidence of pre-existing interstitial disease developed bilateral ILD and respiratory failure which could be explained only as a toxicity of erlotinib. He had a history of stage IV left upper lobe squamous-cell carcinoma for which he had received three successive regimens of chemotherapy (ifosfamide plus gemcitabine, docetaxel, mitomycin plus navelbine), followed five months later by erlotinib. At initiation of erlotinib treatment there were no radiological signs suggestive of ILD disease or apparent clinical signs of respiratory distress. While the patient completed two months with erlotinib therapy he developed bilateral interstitial infiltrates; despite discontinuation of erlotinib he was admitted with respiratory failure two weeks later. Diagnostic work up for other causes of pneumonitis including infectious diseases, congestive cardiac failure and pulmonary infraction was negative. Empiric treatment with oxygene, corticosteroids and later with cyclophosphamide was ineffective and the patient progressively deteriorated and died. The clinical and post-mortem examination findings are presented and the possible association relationship between erlotinib induced ILD and previous chemotherapy is discussed. Physicians should be alert to the fact that erlotinib related ILD, although infrequent, is potential fatal. The

  13. Recommendations for responsible monitoring and regulation of clinical software systems. American Medical Informatics Association, Computer-based Patient Record Institute, Medical Library Association, Association of Academic Health Science Libraries, American Health Information Management Association, American Nurses Association.

    Science.gov (United States)

    Miller, R A; Gardner, R M

    1997-01-01

    In mid-1996, the FDA called for discussions on regulation of clinical software programs as medical devices. In response, a consortium of organizations dedicated to improving health care through information technology has developed recommendations for the responsible regulation and monitoring of clinical software systems by users, vendors, and regulatory agencies. Organizations assisting in development of recommendations, or endorsing the consortium position include the American Medical Informatics Association, the Computer-based Patient Record Institute, the Medical Library Association, the Association of Academic Health Sciences Libraries, the American Health Information Management Association, the American Nurses Association, the Center for Healthcare Information Management, and the American College of Physicians. The consortium proposes four categories of clinical system risks and four classes of measured monitoring and regulatory actions that can be applied strategically based on the level of risk in a given setting. The consortium recommends local oversight of clinical software systems, and adoption by healthcare information system developers of a code of good business practices. Budgetary and other constraints limit the type and number of systems that the FDA can regulate effectively. FDA regulation should exempt most clinical software systems and focus on those systems posing highest clinical risk, with limited opportunities for competent human intervention. PMID:9391932

  14. Warning Signs of Lung Disease

    Science.gov (United States)

    ... with our registered nurses, respiratory therapists and quit smoking specialists; 1-800-LUNGUSA (586-4872). Related Content News: May – Focusing on Asthma Awareness and Control News: American Lung Association Statement on ...

  15. Structure-Activity Association of Flavonoids in Lung Diseases

    Directory of Open Access Journals (Sweden)

    João Henrique G. Lago

    2014-03-01

    Full Text Available Flavonoids are polyphenolic compounds classified into flavonols, flavones, flavanones, isoflavones, catechins, anthocyanidins, and chalcones according to their chemical structures. They are abundantly found in Nature and over 8,000 flavonoids have from different sources, mainly plant materials, have been described. Recently reports have shown the valuable effects of flavonoids as antiviral, anti-allergic, antiplatelet, antitumor, antioxidant, and anti-inflammatory agents and interest in these compounds has been increasing since they can be helpful to human health. Several mechanisms of action are involved in the biological properties of flavonoids such as free radical scavenging, transition metal ion chelation, activation of survival genes and signaling pathways, regulation of mitochondrial function and modulation of inflammatory responses. The anti-inflammatory effects of flavonoids have been described in a number of studies in the literature, but not frequently associated to respiratory disease. Thus, this review aims to discuss the effects of different flavonoids in the control of lung inflammation in some disorders such as asthma, lung emphysema and acute respiratory distress syndrome and the possible mechanisms of action, as well as establish some structure-activity relationships between this biological potential and chemical profile of these compounds.

  16. Darkness’s Descent on the American Anthropological Association

    OpenAIRE

    Dreger, Alice

    2011-01-01

    In September 2000, the self-styled “anthropological journalist” Patrick Tierney began to make public his work claiming that the Yanomamö people of South America had been actively—indeed brutally—harmed by the sociobiological anthropologist Napoleon Chagnon and the geneticist-physician James Neel. Following a florid summary of Tierney’s claims by the anthropologists Terence Turner and Leslie Sponsel, the American Anthropological Association (AAA) saw fit to take Tierney’s claims seriously by c...

  17. The association of systemic microvascular changes with lung function and lung density: a cross-sectional study.

    Directory of Open Access Journals (Sweden)

    Bianca Harris

    Full Text Available Smoking causes endothelial dysfunction and systemic microvascular disease with resultant end-organ damage in the kidneys, eyes and heart. Little is known about microvascular changes in smoking-related lung disease. We tested if microvascular changes in the retina, kidneys and heart were associated with obstructive spirometry and low lung density on computed tomography. The Multi-Ethnic Study of Atherosclerosis recruited participants age 45-84 years without clinical cardiovascular disease. Measures of microvascular function included retinal arteriolar and venular caliber, urine albumin-to-creatinine ratio and, in a subset, myocardial blood flow on magnetic resonance imaging. Spirometry was measured following ATS/ERS guidelines. Low attenuation areas (LAA were measured on lung fields of cardiac computed tomograms. Regression models adjusted for pulmonary and cardiac risk factors, medications and body size. Among 3,397 participants, retinal venular caliber was inversely associated with forced expiratory volume in one second (FEV(1 (P<0.001 and FEV(1/forced vital capacity (FVC ratio (P = 0.04. Albumin-to-creatinine ratio was inversely associated with FEV(1 (P = 0.002 but not FEV(1/FVC. Myocardial blood flow (n = 126 was associated with lower FEV(1 (P = 0.02, lower FEV(1/FVC (P = 0.001 and greater percentage LAA (P = 0.04. Associations were of greater magnitude among smokers. Low lung function was associated with microvascular changes in the retina, kidneys and heart, and low lung density was associated with impaired myocardial microvascular perfusion. These cross-sectional results suggest that microvascular damage with end-organ dysfunction in all circulations may pertain to the lung, that lung dysfunction may contribute to systemic microvascular disease, or that there may be a shared predisposition.

  18. Multi-walled carbon nanotube-induced gene expression in the mouse lung: Association with lung pathology

    International Nuclear Information System (INIS)

    Due to the fibrous shape and durability of multi-walled carbon nanotubes (MWCNT), concerns regarding their potential for producing environmental and human health risks, including carcinogenesis, have been raised. This study sought to investigate how previously identified lung cancer prognostic biomarkers and the related cancer signaling pathways are affected in the mouse lung following pharyngeal aspiration of well-dispersed MWCNT. A total of 63 identified lung cancer prognostic biomarker genes and major signaling biomarker genes were analyzed in mouse lungs (n = 80) exposed to 0, 10, 20, 40, or 80 μg of MWCNT by pharyngeal aspiration at 7 and 56 days post-exposure using quantitative PCR assays. At 7 and 56 days post-exposure, a set of 7 genes and a set of 11 genes, respectively, showed differential expression in the lungs of mice exposed to MWCNT vs. the control group. Additionally, these significant genes could separate the control group from the treated group over the time series in a hierarchical gene clustering analysis. Furthermore, 4 genes from these two sets of significant genes, coiled-coil domain containing-99 (Ccdc99), muscle segment homeobox gene-2 (Msx2), nitric oxide synthase-2 (Nos2), and wingless-type inhibitory factor-1 (Wif1), showed significant mRNA expression perturbations at both time points. It was also found that the expression changes of these 4 overlapping genes at 7 days post-exposure were attenuated at 56 days post-exposure. Ingenuity Pathway Analysis (IPA) found that several carcinogenic-related signaling pathways and carcinogenesis itself were associated with both the 7 and 11 gene signatures. Taken together, this study identifies that MWCNT exposure affects a subset of lung cancer biomarkers in mouse lungs. - Research highlights: → Multi-Walled Carbon Nanotubes affect lung cancer biomarkers in mouse lungs. → The results suggest potentially harmful effects of MWCNT exposure on human lungs. → The results could potentially be used

  19. Religiosity and physical and emotional functioning among African American and White colorectal and lung cancer patients.

    Science.gov (United States)

    Holt, Cheryl L; Oster, Robert A; Clay, Kimberly S; Urmie, Julie; Fouad, Mona

    2011-01-01

    The literature suggests that religiosity helps cope with illness. The present study examined the role of religiosity in functioning among African Americans and Whites with a cancer diagnosis. Patients were recruited from an existing study and mailed a religiosity survey. Participants (N = 269; 36% African American, 56% women) completed the mail survey, and interview data from the larger cohort was utilized in the analysis. Multivariate analyses indicated that in the overall sample religious behaviors were marginally and positively associated with mental health and negatively with depressive symptoms. Among women, religious behaviors were positively associated with mental health and negatively with depressive symptoms. Religiosity was not a predictor of study outcomes for men. Among African Americans, religious behaviors were positively associated with mental health and vitality. Among Whites, religious behaviors were negatively associated with depressive symptoms. These findings suggest a mixed role of religious involvement in cancer outcomes. The current findings may have applied potential in the areas of emotional functioning and depression. PMID:21966724

  20. Identification of recently described porcine parvoviruses in archived North American samples from 1996 and association with porcine circovirus associated disease.

    Science.gov (United States)

    Opriessnig, Tanja; Xiao, Chao-Ting; Gerber, Priscilla F; Halbur, Patrick G

    2014-09-17

    The association of porcine circovirus (PCV) type 2 and porcine parvovirus (PPV) type 1 as a cause of porcine circovirus associated disease (PCVAD) is well established. The objective of this study was to investigate the prevalence rates of classical PPV1 and recently recognized PPV2-5 in serum and lung samples from pigs and farms with known PCV2 status. A total of 586 serum samples and 164 lung homogenates collected from 1996 to 2013 in the USA and Canada were utilized. All samples were tested for PPV1-5 and PCV2. PCV2 was detected in 27.7% (162/586) and PPV in 48.8% (286/586) of the serum samples, whereas 78.7% (129/164) of the lung tissues were positive for PCV2 and 56.7% (93/164) were positive for PPV. Overall, PPV2 had the highest prevalence rates in sera (35.2%) and tissues (42.7%). Concurrent infection of PCV2 and PPV occurred in 14.3% (84/586) of the serum samples and in 49.4% (81/164) of the tissue samples. Moreover, the prevalence of PPV1 or PPV2 DNA was significantly higher in tissues containing high amounts of PCV2 DNA compared to non-PCVAD cases. The frequency of concurrent PPV/PCV2 infection was higher for PCVAD herds compared to negative or subclinically infected herds. PPV2, PPV3 and PPV4 were all identified in samples collected in 1998 and PPV5 was first identified in 2006. The obtained findings indicate that similar to PCV2, PPVs are widespread in North American pigs. Nevertheless, diagnostic investigations into PCVAD cases should give more consideration to the role of PPV1 and PPV2 as contributing cofactors. PMID:25081955

  1. Association of the California tobacco control program with declines in lung cancer incidence

    OpenAIRE

    Barnoya, J; Glantz, Stanton A. Ph.D.

    2004-01-01

    Objective: The California tobacco control program enacted in 1988 has been associated with declines in smoking and heart disease mortality. Since smoking also causes lung cancer, we investigated whether the program was associated with a decline in lung and other cancer incidence. Methods: Age-adjusted incidence rates of lung and bladder cancer (which are caused by smoking) and prostate and brain cancer (which are not) in the San Francisco-Oakland (SFO) Surveillance Epidemiology End Results (S...

  2. Rheumatoid Arthritis (RA) associated interstitial lung disease (ILD).

    LENUS (Irish Health Repository)

    O'Dwyer, David N

    2013-10-01

    Rheumatoid Arthritis (RA) is the most common Connective Tissue Disease (CTD) and represents an increasing burden on global health resources. Interstitial lung disease (ILD) has been recognised as a complication of RA but its potential for mortality and morbidity has arguably been under appreciated for decades. New studies have underscored a significant lifetime risk of ILD development in RA. Contemporary work has identified an increased risk of mortality associated with the Usual Interstitial Pneumonia (UIP) pattern which shares similarity with the most devastating of the interstitial pulmonary diseases, namely Idiopathic Pulmonary Fibrosis (IPF). In this paper, we discuss recent studies highlighting the associated increase in mortality in RA-UIP. We explore associations between radiological and histopathological features of RA-ILD and the prognostic implications of same. We emphasise the need for translational research in this area given the growing burden of RA-ILD. We highlight the importance of the respiratory physician as a key stakeholder in the multidisciplinary management of this disorder. RA-ILD focused research offers the opportunity to identify early asymptomatic disease and define the natural history of this extra articular manifestation. This may provide a unique opportunity to define key regulatory fibrotic events driving progressive disease. We also discuss some of the more challenging and novel aspects of therapy for RA-ILD.

  3. Lung cancer in Hodgkin's disease: association with previous radiotherapy

    International Nuclear Information System (INIS)

    Seven cases of lung cancer were observed in patients with Hodgkin's disease (HD) since 1970. The risk ratio for the development of lung cancer among HD patients was 5.6 times that expected in the general population. The pertinent clinical data from these patients are described and compared to 28 additional patients reported from other institutions. Small-cell lung cancer represented the predominant histologic type of lung cancer encountered in both smoking and nonsmoking patients with HD, accounting for 42% of cases overall and greater than 55% of cases reported in reviews of second malignancies. Tobacco use was noted in only 53% of patients. Twenty-eight (94%) of 30 patients developing metachronous lung cancer received supradiaphragmatic irradiation as primary therapy for HD. Nineteen (68%) of these patients received subsequent chemotherapy salvage. The median age at diagnosis of HD and lung cancer was 39 and 45 years, respectively. The interval between diagnosis of HD and metachronous lung cancer averaged seven years but appeared to vary inversely with age. HD patients treated with supradiaphragmatic irradiation or combined modality therapy may be at increased risk for developing lung cancer. The high frequency of in-field malignancies that the authors observed and the prevalence of small-cell lung cancer in both smoking and nonsmoking patients suggests that chest irradiation may influence the development of metachronous lung cancer in these patients. The finding of a mean latent interval in excess of seven years emphasizes the need for close long-term observation

  4. Factors Associated With Overweight and Obesity Among Mexican Americans and Central Americans: Results From the 2001 California Health Interview Survey

    Directory of Open Access Journals (Sweden)

    Janice V. Bowie, PhD, MPH

    2007-01-01

    Full Text Available IntroductionHispanics are the fastest growing demographic group in the United States; however, “Hispanic” is a broad term that describes people who are from or whose ancestors are from multiple countries of origin. This study examines, separately, the social, cultural, and behavioral factors associated with overweight and obesity among Mexican American adults and among Central American adults. MethodsTo estimate the prevalence of overweight and obesity among Mexican and Central Americans living in California, we conducted a cross-sectional analysis of data from the 2001 California Health Interview Survey using SUDAAN software to account for the survey’s multistage sampling design.ResultsOf the 8304 Mexican Americans participating in the survey, 36.8% were overweight and 26.2% were obese. Of the 1019 Central Americans, 39.2% were overweight and 22.2% were obese. Among Mexican American men, age and marital status were associated with overweight and obesity; and education, acculturation, health insurance status, health status, and use of vitamins were associated with obesity only. Among Mexican American women, age, education, number of children, health status, and health behavior were associated with overweight and obesity. Among Central American men, age, education, and access to health care were associated with overweight, whereas marital status, acculturation, health care, and binge drinking were associated with obesity. Among Central American women, number of children was associated with overweight and obesity; and age and education were associated with obesity only. ConclusionsOur findings of high rates of overweight and obesity among Mexican and Central Americans in California indicate the need for a wide variety of effective weight-loss interventions targeting these populations, and the differences we found in the factors associated with overweight and obesity may suggest the need for unique intervention strategies for different

  5. The association between combined non-cystic fibrosis bronchiectasis and lung cancer in patients with chronic obstructive lung disease

    Directory of Open Access Journals (Sweden)

    Kim YW

    2015-05-01

    Full Text Available Yeon Wook Kim,1 Kwang-Nam Jin,2 Eun Young Heo,3 Sung Soo Park,3 Hee Soon Chung,3 Deog Kyeom Kim31Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Republic of Korea; 2Department of Radiology, Seoul National University College of Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, Seoul, Republic of Korea; 3Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Seoul National University College of Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, Seoul, Republic of KoreaBackground: Whereas the epidemiological association between lung cancer and chronic obstructive pulmonary disease (COPD, a chronic inflammatory respiratory disease, is well known, limited studies have examined the association between lung cancer and non-cystic fibrosis bronchiectasis, a representative chronic airway inflammatory disease. This study evaluated the association between bronchiectasis and lung cancer in patients with COPD.Methods: A matched case–control study was conducted in a referral hospital in South Korea. Among COPD patients with moderate to very severe airflow limitation (forced expiratory volume in one second/forced vital capacity <0.7 and forced expiratory volume in one second ≤70% [% predicted] who underwent chest computed tomography (CT between January 1, 2010 and May 30, 2013, patients with lung cancer and controls matched for age, sex, and smoking history were selected. The risk of lung cancer was assessed according to the presence of underlying bronchiectasis confirmed by chest CT.Results: The study enrolled 99 cases and 198 controls. Combined bronchiectasis on chest CT was inversely associated with the risk of lung cancer compared with controls (odds ratio [OR] 0.25, 95% confidence interval [CI] 0.12–0.52, P<0.001. Significant associations were found in

  6. Two cases of liver alveolar echinococcosis associated with simultaneous lung and brain metastases

    Institute of Scientific and Technical Information of China (English)

    蒋次鹏

    2002-01-01

    @@ Alveolar echinococcosis (AE) of liver associated with simultaneous lung and brain metastases is rare clinically. During a period of 15 years (1985-2000), 2 (1.9%) of 103 cases with liver AE diagnosed at our laboratory were associated with simultaneous lung or brain metastases.1 They were confirmed pathologically through surgical biopsy or autopsy respectively, and reported as follows.

  7. Factors Associated With Overweight and Obesity Among Mexican Americans and Central Americans: Results From the 2001 California Health Interview Survey

    OpenAIRE

    Bowie, Janice V.; Juon, Hee-Soon; Rodriguez, Elisa M.; Cho, Juhee

    2006-01-01

    Introduction Hispanics are the fastest growing demographic group in the United States; however, "Hispanic" is a broad term that describes people who are from or whose ancestors are from multiple countries of origin. This study examines, separately, the social, cultural, and behavioral factors associated with overweight and obesity among Mexican American adults and among Central American adults. Methods To estimate the prevalence of overweight and obesity among Mexican and Central Americans li...

  8. RELATED GENES IN LUNG CANCER TISSUES ASSOCIATED WITH RESIDENTIAL HIGH RADON EXPOSURE

    Institute of Scientific and Technical Information of China (English)

    夏英; 杨梅英; 张守志; 叶常青

    2002-01-01

    Objective: To investigate the related genes in lung cancer tissues associated with residential high radon exposure. Methods: Differentially expressed gene fragments in lung cancer and normal lung tissues were discovered by differential display and reverse Northern blot hybridization method. The fragments positive in lung cancer and negative in normal lung tissue were determined. Results: Seven differential displayed fragments were sequenced. One of them named NA7 is 95% homologous with AI208667 in EAT of Genbank. Another fragment named NG2 is up to 98% homologous with five fragments. The remained one CA1 may be a new gene fragment. Conclusion: 3 gene fragments were discovered from lung cancer and normal lung tissues of high radon exposure resident.

  9. American Telemedicine Association: First China (Tianjin International Telemedicine Technology Exhibition

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2014-09-01

    Full Text Available With the support of Tianjin Municipal People’s Government and the People’s Government of Binhai New Area, the “First China (Tianjin International Telemedicine Technology Exhibition” hosted by the American Telemedicine Association (ATA, will be held October 28- 30, 2014 at the Tianjin Binhai International Convention and Exhibition Center. The three day event will feature keynote sessions, concurrent discussion forums, exhibits (e.g., telemedicine, information technology, mHealth, a venture summit, meet-and-greet sessions for international and domestic companies for potential business collaboration, and policy discussions on China healthcare. For registration information: http://www.atacn.org/en/

  10. A critical review of the American Journal of Physiology-Lung Cellular and Molecular Physiology: 2012-2015.

    Science.gov (United States)

    Matalon, Sadis

    2014-12-15

    I have had the privilege of serving as Editor-in-Chief of the American Journal of Physiology: Lung Cellular and Molecular Physiology from 1/1/2012 to 1/1/2015 and have been reappointed for another 3-year term. When I took over as editor, I published an editorial in AJP-Lung in which I highlighted my vision and outlined the tasks to be accomplished to transform AJP-Lung into "The best place to publish basic, translational, and hypothesis-driven clinical lung research." Herein I review our accomplishments during the first term. As promised, we review each article submitted to this journal and our reviews always help the quality and impact of every paper. We recognized the contributions of junior authors by establishing a number of awards and increased the visibility of AJP-Lung by establishing Facebook and Blog electronic pages and sponsoring symposia in scientific meetings. Our impact factor increased from 3.523 in 2011 to 4.041 in 2012 and, thanks to our calls for papers, we are receiving large numbers of high-quality papers in all aspects of pulmonary cell biology and lung diseases. The best is yet to come. PMID:25381028

  11. High procedure volume is strongly associated with improved survival after lung cancer surgery

    DEFF Research Database (Denmark)

    Lüchtenborg, Margreet; Riaz, Sharma P; Coupland, Victoria H;

    2013-01-01

    Studies have reported an association between hospital volume and survival for non-small-cell lung cancer (NSCLC). We explored this association in England, accounting for case mix and propensity to resect.......Studies have reported an association between hospital volume and survival for non-small-cell lung cancer (NSCLC). We explored this association in England, accounting for case mix and propensity to resect....

  12. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea;

    2016-01-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials for...

  13. Fatal pneumonitis associated with postoperative intensity-modulated radiotherapy in lung cancer: Case report and review

    OpenAIRE

    Hu, Yan; Li, Jingjing; SU, XIAOYAN

    2012-01-01

    Radiation pneumonitis (RP) is the most significant complication of acute treatment-related toxicities in lung cancer. Intensity-modulated radiotherapy (IMRT) with inverse planning enables us to achieve the desired dose distribution. However, there are many high-risk procedures associated with lung irradiation, including chemotherapy and surgery. We report a case of fatal treatment-related pneumonitis, where the patient had undergone postoperative IMRT for lung cancer. Following completion of ...

  14. Distribution and surfactant association of carcinoembryonic cell adhesion molecule 6 in human lung

    OpenAIRE

    Chapin, Cheryl; Bailey, Nicole A.; Gonzales, Linda W.; Lee, Jae-Woo; Gonzalez, Robert F.; Ballard, Philip L.

    2011-01-01

    Carcinoembryonic cell adhesion molecule 6 (CEACAM6) is a glycosylated, glycophosphatidylinositol-anchored protein expressed in epithelial cells of various primate tissues. It binds gram-negative bacteria and is overexpressed in human cancers. CEACAM6 is associated with lamellar bodies of cultured type II cells of human fetal lung and protects surfactant function in vitro. In this study, we characterized CEACAM6 expression in vivo in human lung. CEACAM6 was present in lung lavage of premature ...

  15. CT Air Trapping Is Independently Associated with Lung Function Reduction over Time

    OpenAIRE

    Mets, O.M.; de Jong, P. A.; van Ginneken, B.; Kruitwagen, C.L.J.J.; Prokop, M; Oudkerk, M; Lammers, J. W.; Zanen, P.

    2013-01-01

    Purpose We aimed to study the association between lung function decline and quantitative computed tomography (CT) air trapping. Materials and Methods Current and former heavy smokers in a lung cancer screening trial underwent volumetric low-dose CT in inspiration and expiration. Spirometry was obtained at baseline and after 3 years. The expiratory to inspiratory ratio of mean lung density (E/I-ratioMLD) was used to quantify air trapping. CT emphysema was defined as voxels in inspiratory CT be...

  16. Pseudomonas aeruginosa vesicles associate with and are internalized by human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kuehn Meta J

    2009-02-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is the major pathogen associated with chronic and ultimately fatal lung infections in patients with cystic fibrosis (CF. To investigate how P. aeruginosa-derived vesicles may contribute to lung disease, we explored their ability to associate with human lung cells. Results Purified vesicles associated with lung cells and were internalized in a time- and dose-dependent manner. Vesicles from a CF isolate exhibited a 3- to 4-fold greater association with lung cells than vesicles from the lab strain PAO1. Vesicle internalization was temperature-dependent and was inhibited by hypertonic sucrose and cyclodextrins. Surface-bound vesicles rarely colocalized with clathrin. Internalized vesicles colocalized with the endoplasmic reticulum (ER marker, TRAPα, as well as with ER-localized pools of cholera toxin and transferrin. CF isolates of P. aeruginosa abundantly secrete PaAP (PA2939, an aminopeptidase that associates with the surface of vesicles. Vesicles from a PaAP knockout strain exhibited a 40% decrease in cell association. Likewise, vesicles from PAO1 overexpressing PaAP displayed a significant increase in cell association. Conclusion These data reveal that PaAP promotes the association of vesicles with lung cells. Taken together, these results suggest that P. aeruginosa vesicles can interact with and be internalized by lung epithelial cells and contribute to the inflammatory response during infection.

  17. Bleomycin-associated Lung Toxicity in Childhood Cancer Survivors.

    Science.gov (United States)

    Zorzi, Alexandra P; Yang, Connie L; Dell, Sharon; Nathan, Paul C

    2015-11-01

    Pulmonary disease is a significant morbidity among childhood cancer survivors. The aim of this study was to characterize the pulmonary dysfunction experienced by childhood cancer survivors treated with bleomycin. A cross-sectional analysis of pulmonary function testing (PFT) in survivors treated with bleomycin was preformed. The most recent posttherapy PFT was assessed. Spirometry and lung volumes were categorized as normal, restrictive, obstructive, or mixed. Diffusing capacity of carbon monoxide (DLCO) was categorized as normal or abnormal. PFT data of 143 survivors was analyzed. PFTs were performed a median of 2.3 years (interquartile range, 1.4 to 4.9) from completion of therapy. Spirometry was abnormal in 58 (41%), only 5 (9%) had respiratory symptoms. Forty-two (70%) had obstructive, 11 (18%) restrictive, and 5 (9%) mixed ventilatory defects. The majority of abnormalities were mild (91%). DLCO was abnormal in 27. Reductions were mild in 96%. Patients with a history of relapse were more likely to develop abnormalities in spirometry and/or DLCO (odds ratio=5.02, 95% confidence interval: 1.3-19.4, P=0.01; odds ratio=3.47, 95% confidence interval: 1.01-11.9, P=0.03). Asymptomatic abnormalities of PFT are common among childhood cancer survivors treated with bleomycin and associated with a history of relapse. Research studying the risk for clinical progression of this dysfunction is warranted. PMID:26422284

  18. Evaluation and Diagnosis of HIV-Associated Lung Disease.

    Science.gov (United States)

    Maximous, Stephanie; Huang, Laurence; Morris, Alison

    2016-04-01

    There are myriad pulmonary conditions associated with HIV, ranging from acute infections to chronic noncommunicable diseases. The epidemiology of these diseases has changed significantly in the era of widespread antiretroviral therapy. Evaluation of the HIV-infected patient involves assessment of the severity of illness and a thorough yet efficient pursuit of definitive diagnosis, which may involve multiple etiologies simultaneously. Important clues to a diagnosis include medical and social history, demographic details such as travel and geography of residence, substance use, sexual practices, and domiciliary and incarceration status. CD4 cell count is a tremendously useful measure of immune function and risk for HIV-related diseases, and helps narrow down the differential. Careful history of current symptoms and physical examination with particular attention to extrapulmonary signs are crucial early steps. Many adjunctive laboratory studies can suggest or rule out particular diagnoses. Pulmonary function testing (PFT) may aid in characterization of several chronic noninfectious illnesses accelerated by HIV. Chest radiograph and computed tomography (CT) scan allow for classification of diseases by pathognomonic imaging patterns, although many infectious conditions present atypically, particularly with lower CD4 counts. Ultimately, definitive diagnosis with sputum, bronchoscopy with bronchoalveolar lavage, or lung tissue is often needed. It is of utmost importance to maintain a high degree of suspicion for HIV in otherwise undiagnosed patients, as the first presentation of HIV may be via an acute pulmonary illness. PMID:26974298

  19. 2015 Annual Report of the American Psychological Association.

    Science.gov (United States)

    2016-01-01

    Presents the 2015 Annual Report of the American Psychological Association. In his introduction, President Barry Anton describes how 2015 was among APA's most challenging. Although 2015 ushered in an era of greater transparency within the association and enhanced communications to members and the public, it also required painful self-reflection stemming from the revelations of an independent review by an outside law firm. The review examined the question of whether APA played any role related to the Bush administration's use of abusive interrogation techniques during the war on terror. Anton's introduction also discusses (1) the APA convention, (2) representing APA at a White House meeting with health care providers and insurance companies, (3) APA's effort to increase the number of APA-accredited internships, (4) international activities, and (5) the global summit on psychology and integrated care. (PsycINFO Database Record PMID:27504583

  20. Lung cancer-associated tumor antigens and the present status of immunotherapy against non-small-cell lung cancer

    International Nuclear Information System (INIS)

    Despite recent advances in surgery, irradiation, and chemotherapy, the prognosis of patients with lung cancer is still poor. Therefore, the development and application of new therapeutic strategies are essential for improving the prognosis of this disease. Significant progress in our understanding of tumor immunology and molecular biology has allowed us to identify the tumor-associated antigens recognized by cytotoxic T lymphocytes. Immune responses and tumor-associated antigens against not only malignant melanoma but also lung cancer have been elucidated at the molecular level. In a theoretical sense, tumor eradication is considered possible through antigen-based immunotherapy against such diseases. However, many clinical trials of cancer vaccination with defined tumor antigens have resulted in objective clinical responses in only a small number of patients. Tumor escape mechanisms from host immune surveillance remain a major obstacle for cancer immunotherapy. A better understanding of the immune escape mechanisms employed by tumor cells is necessary before we can develop a more effective immunotherapeutic approach to lung cancer. We review recent studies regarding the identification of tumor antigens in lung cancer, tumor immune escape mechanisms, and clinical vaccine trials in lung cancer. (author)

  1. Male tobacco smoke load and non-lung cancer mortality associations in Massachusetts

    Directory of Open Access Journals (Sweden)

    Clancy Luke

    2008-11-01

    Full Text Available Abstract Background Different methods exist to estimate smoking attributable cancer mortality rates (Peto and Ezzati methods, as examples. However, the smoking attributable estimates using these methods cannot be generalized to all population sub-groups. A simpler method has recently been developed that can be adapted and applied to different population sub-groups. This study assessed cumulative tobacco smoke damage (smoke load/non-lung cancer mortality associations across time from 1979 to 2003 among all Massachusetts males and ages 30–74 years, using this novel methodology. Methods Annual lung cancer death rates were used as smoke load bio-indices, and age-adjusted lung/all other (non-lung cancer death rates were analyzed with linear regression approach. Non-lung cancer death rates include all cancer deaths excluding lung. Smoking-attributable-fractions (SAFs for the latest period (year 2003 were estimated as: 1-(estimated unexposed cancer death rate/observed rate. Results Male lung and non-lung cancer death rates have declined steadily since 1992. Lung and non-lung cancer death rates were tightly and steeply associated across years. The slopes of the associations analyzed were 1.69 (95% confidence interval (CI 1.35–2.04, r = 0.90, and 1.36 (CI 1.14–1.58, r = 0.94 without detected autocorrelation (Durbin-Watson statistic = 1.8. The lung/non-lung cancer death rate associations suggest that all-sites cancer death rate SAFs in year 2003 were 73% (Sensitivity Range [SR] 61–82% for all ages and 74% (SR 61–82% for ages 30–74 years. Conclusion The strong lung/non-lung cancer death rate associations suggest that tobacco smoke load may be responsible for most prematurely fatal cancers at both lung and non-lung sites. The present method estimates are greater than the earlier estimates. Therefore, tobacco control may reduce cancer death rates more than previously noted.

  2. Association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury after intensity-modulated radiotherapy in lung cancer: a retrospective analysis

    OpenAIRE

    Chen, Jinmei; Hong, Jinsheng; Zou, Xi; Lv, Wenlong; Guo, Feibao; Hong, Hualan; Zhang, Weijian

    2015-01-01

    The aim of this study was to investigate the association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury (RILI) after intensity-modulated radiotherapy (IMRT) for lung cancer. The normal lung relative volumes receiving greater than 5, 10, 20 and 30 Gy (V5–30) mean lung dose (MLD), and absolute volumes spared from greater than 5, 10, 20 and 30 Gy (AVS5–30) for the bilateral and ipsilateral lungs of 83 patients were recorded. Any association of...

  3. VEGFA variants are associated with pre-school lung function, but not neonatal lung function

    DEFF Research Database (Denmark)

    Kreiner-Møller, E; Chawes, B L K; Vissing, N H;

    2013-01-01

    Vascular endothelial growth factor (VEGF) is implicated in airway remodelling and asthma development. We studied VEGFA gene variants and plasma levels and the development of lung function, bronchial hyperresponsiveness and asthma in childhood.......Vascular endothelial growth factor (VEGF) is implicated in airway remodelling and asthma development. We studied VEGFA gene variants and plasma levels and the development of lung function, bronchial hyperresponsiveness and asthma in childhood....

  4. Portable stove use is associated with lower lung cancer mortality risk in lifetime smoky coal users

    Energy Technology Data Exchange (ETDEWEB)

    Hosgood, H.D.; Chapman, R.; Shen, M.; Blair, A.; Chen, E.; Zheng, T.; Lee, K.M.; He, X.; Lan, Q. [NCI, Bethesda, MD (United States)

    2008-11-15

    Domestic fuel combustion from cooking and heating, to which about 3 billion people worldwide are exposed, is associated with increased lung cancer risk. Lung cancer incidence in Xuanwei is the highest in China, and the attributable risk of lung cancer from unvented smoky coal burning is greater than 90%. To evaluate any lung cancer mortality reduction after changing from unvented stoves to portable stoves, we used lifetime smoky coal users in a retrospective cohort of all farmers born during 1917-1951 and residing in Xuanwei in 1976. Of the 42 422 enrolled farmers, 4054 lifetime smoky coal users changed to portable stoves, 4364 did not change, and 1074 died of lung cancer. Lung cancer morality associated with stove change was assessed by product-limit survival curves and multivariate Cox regression models. Both men (P < 0.0001) and women (P < 0.0001) who changed to portable stoves had a significantly increased probability of survival compared with those who did not change. Portable stoves were associated with decreased risk of lung cancer mortality in male participants (hazard ratio (HR) 0.62, 95% confidence interval (CI) 0.46-0.82) and female participants (HR 0.41, 95% CI 0.29-0.57). Portable stove use is associated with reduced lung cancer mortality risk, highlighting a cost-effective intervention that could substantially benefit health in developing countries.

  5. Connective Tissue Disease-associated Interstitial Lung Disease: A review

    OpenAIRE

    Gutsche, Markus; Rosen, Glenn D.; Swigris, Jeffrey J.

    2012-01-01

    Interstitial lung disease (ILD) is commonly encountered in patients with connective tissue diseases (CTD). Besides the lung parenchyma, the airways, pulmonary vasculature and structures of the chest wall may all be involved, depending on the type of CTD. As a result of this so-called multi-compartment involvement, airflow limitation, pulmonary hypertension, vasculitis and extrapulmonary restriction can occur alongside fibro-inflammatory parenchymal abnormalities in CTD. Rheumatoid arthritis (...

  6. Interstitial lung disease associated to erlotinib treatment: a case report

    OpenAIRE

    del Castillo, Yolanda; Espinosa, Paulina; Bodí, Fernanda; Alcega, Raquel; Muñoz, Emma; Rabassó, Carlos; Castander, David

    2010-01-01

    Introduction Few cases of pulmonary toxicity related to epidermal growth factor receptor-targeted agents have been described. Case presentation We report a case of a 63-year-old white male with stage IV non-small cell lung cancer treated with erlotinib who developed a interstitial lung disease. Conclusion Respiratory symptoms during treatment with erlotinib should alert clinicians to rule out pulmonary toxicity. Early erlotinib withdrawal and corticoid administration were successful.

  7. Factors Associated with Pregnancy among Incarcerated African American Adolescent Girls.

    Science.gov (United States)

    Gray, Simone C; Holmes, Kristin; Bradford, Denise R

    2016-08-01

    The purpose of this study was to examine the social and behavioral factors associated with pregnancy history among a sample of African American adolescent girls recruited from a short-term juvenile detention center in order to better understand the needs of this vulnerable population. Data were collected from a sample of 188 detained African American, 13-17-year-old girls in Atlanta, Georgia, who participated in a larger HIV prevention study. An audio computer-assisted self-interviewing survey was completed by participants to obtain information on socioecological factors to include individual, parental/familial, sexual risk, psychosocial, and substance use factors. Among the 188 participants, 25.5 % reported a history of pregnancy. A multivariable logistic regression model showed that girls with a history of pregnancy were more likely to live in a household receiving government aid, use hormonal contraceptives at last sex, participate in sex trading, have casual sex partners, have condomless sex in the past 90 days, and have a history of physical abuse. Girls with no history of pregnancy were more likely to have been incarcerated at least twice and to have previously used alcohol. Detention-based interventions and pregnancy prevention programs for this vulnerable population may benefit by addressing factors related to sexual behavior and development, substance use, individual background, and psychosocial health. PMID:27271026

  8. Lung Adenocarcinomas and Lung Cancer Cell Lines Show Association of MMP-1 Expression With STAT3 Activation

    Directory of Open Access Journals (Sweden)

    Alexander Schütz

    2015-04-01

    Full Text Available Signal transducer and activator of transcription 3 (STAT3 is constitutively activated in the majority of lung cancer. This study aims at defining connections between STAT3 function and the malignant properties of non–small cell lung carcinoma (NSCLC cells. To address possible mechanisms by which STAT3 influences invasiveness, the expression of matrix metalloproteinase-1 (MMP-1 was analyzed and correlated with the STAT3 activity status. Studies on both surgical biopsies and on lung cancer cell lines revealed a coincidence of STAT3 activation and strong expression of MMP-1. MMP-1 and tyrosine-phosphorylated activated STAT3 were found co-localized in cancer tissues, most pronounced in tumor fronts, and in particular in adenocarcinomas. STAT3 activity was constitutive, although to different degrees, in the lung cancer cell lines investigated. Three cell lines (BEN, KNS62, and A549 were identified in which STAT3 activitation was inducible by Interleukin-6 (IL-6. In A549 cells, STAT3 activity enhanced the level of MMP-1 mRNA and stimulated transcription from the MMP-1 promoter in IL-6–stimulated A549 cells. STAT3 specificity of this effect was confirmed by STAT3 knockdown through RNA interference. Our results link aberrant activity of STAT3 in lung cancer cells to malignant tumor progression through up-regulation of expression of invasiveness-associated MMPs.

  9. American Telemedicine Association: 19th Annual International Meeting & Tradeshow

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2013-12-01

    Full Text Available The 2014 American Telemedicine Association (ATA 2014 Annual International Meeting & Exposition, will be held May 18-20, 2014 in Baltimore, Maryland. ATA 2014 will bring together healthcare professionals, leading telemedicine programs, and industry. This meeting has been the premier forum for professionals in the telemedicine, telehealth and mHealth space for over 19 years. ATA 2014 is on course to be the largest ATA meeting ever, with over 6,000 projected attendees. The exhibit hall will feature nearly 300 of the leading vendors in remote healthcare technologies. The program will include 500 educational sessions and posters highlighting the latest innovations, applications and research in telemedicine. The educational sessions at ATA 2014 will offer training, information, and updates on issues vital to the practice and industry of telemedicine.   Detailed program information--including courses, sessions and Continuing Medical Education (CME information--will be available January 2014 at: http://www.americantelemed.org.

  10. American Telemedicine Association: 18th Annual International Meeting & Tradeshow

    Directory of Open Access Journals (Sweden)

    Benjamin Forstag

    2012-12-01

    Full Text Available For 18 years, the American Telemedicine Association (ATA Annual International Meeting & Exposition has been the premier forum for professionals in the telemedicine, telehealth and mHealth space -- one of the fastest growing meetings in the country. ATA 2013 is on course to be the largest ATA meeting ever, with over 6,000 projected attendees.  The program will include 500 educational sessions and posters, highlighting the latest innovations, applications and research in telemedicine. The 2013 exhibit hall will feature nearly 300 of the leading vendors in remote healthcare technologies. With over 6000 projected attendees, from all around the world, there's no better place to meet and network with your peers and thought leaders in the field. Detailed program information--including courses, sessions and CME information--will be available January 2013 at:http://www.americantelemed.org.

  11. American Telemedicine Association: 20th Annual International Meeting & Tradeshow

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2015-01-01

    Full Text Available The 2015 American Telemedicine Association (ATA 2015 Annual International Meeting & Tradeshow, will be held May 3-5, 2015 at the Los Angeles Convention Center. ATA 2015 will bring together healthcare professionals, leading telemedicine programs, and industry. This meeting has been the premier forum for professionals in the telemedicine, telehealth and mHealth space for over 20 years.  The world-class, peer reviewed program will include over 500 educational sessions and posters, highlighting the latest innovations, applications and delivery models in telemedicine. The expansive exhibit hall will host hundreds of leading vendors with groundbreaking remote healthcare technologies and services. The educational sessions at ATA 2015 will offer training, information, and updates on issues vital to the practice and industry of telemedicine.Detailed program information--including courses, sessions and Continuing Medical Education (CME information--will be available at: http://www.americantelemed.org/ata-2015/conference-overview

  12. Paraseptal emphysema: Prevalence and distribution on CT and association with interstitial lung abnormalities

    International Nuclear Information System (INIS)

    Highlights: • The prevalence of pure paraseptal emphysema was 3% (85/2633) in the Framingham Heart Study population, predominantly affects the upper lung zone, and contributes to slightly decreased pulmonary function. • There was significant association between paraseptal emphysema and interstitial lung abnormalities, which is a novel finding. • Prevalence of paraseptal emphysema and its impact on pulmonary function could have been underestimated in the previous reports. - Abstract: Objective: To investigate the prevalence and distribution of paraseptal emphysema on chest CT images in the Framingham Heart Study (FHS) population, and assess its impact on pulmonary function. Also pursued was the association with interstitial lung abnormalities. Materials and methods: We assessed 2633 participants in the FHS for paraseptal emphysema on chest CT. Characteristics of the participants, including age, sex, smoking status, clinical symptoms, and results of pulmonary function tests, were compared between those with and without paraseptal emphysema. The association between paraseptal emphysema and interstitial lung abnormalities was investigated. Results: Of the 2633 participants, 86 (3%) had pure paraseptal emphysema (defined as paraseptal emphysema with no other subtypes of emphysema other than paraseptal emphysema or a very few centrilobular emphysema involved) in at least one lung zone. The upper zone of the lungs was almost always involved. Compared to the participants without paraseptal emphysema, those with pure paraseptal emphysema were significantly older, and were more frequently male and smokers (mean 64 years, 71% male, mean 36 pack-years, P < 0.001) and had significantly decreased FEV1/FVC% (P = 0.002), and diffusion capacity of carbon monoxide (DLCO) (P = 0.002). There was a significant association between pure paraseptal emphysema and interstitial lung abnormalities (P < 0.001). Conclusions: The prevalence of pure paraseptal emphysema was 3% in the FHS

  13. Association of GSTM1 and GSTT1 deletion with lung cancer development in Pakistani population

    Directory of Open Access Journals (Sweden)

    Nosheen Masood

    2016-01-01

    Conclusion: Results revealed that certain environmental factors may be considered as a risk factor but deletion of GSTM1 and GSTT1 are not associated with the development of lung cancer; however, studies including >500 patient samples is suggested.

  14. Interleukin-22 ameliorates acute severe pancreatitis-associated lung injury in mice

    OpenAIRE

    Qiao, Ying-Ying; Liu, Xiao-Qin; Xu, Chang-Qin; Zhang, Zheng; Xu, Hong-wei

    2016-01-01

    AIM: To investigate the potential protective effect of exogenous recombinant interleukin-22 (rIL-22) on L-arginine-induced acute severe pancreatitis (SAP)-associated lung injury and the possible signaling pathway involved.

  15. High-sensitive C-reactive protein is associated with reduced lung function in young adults

    DEFF Research Database (Denmark)

    Rasmussen, F; Mikkelsen, D; Hancox, R J; Lambrechtsen, J; Nybo, M; Hansen, H S; Siersted, H C

    2009-01-01

    Systemic inflammation has been associated with reduced lung function. However, data on the interrelationships between lung function and inflammation are sparse, and it is not clear if low-grade inflammation leads to reduced lung function. Associations between high-sensitive C-reactive protein (CRP......, higher levels of CRP at age 20 yrs were associated with a greater reduction in both FEV(1) and forced vital capacity between ages 20 and 29 yrs. The findings show that higher levels of C-reactive protein in young adults are associated with subsequent decline in lung function, suggesting that low...... average decline was 6.2 mL.yr(-1) in the highest CRP quintile versus an increase of 1.8 mL.yr(-1) in the lowest CRP quintile. In a multiple regression analysis adjusted for sex, body mass index, cardiorespiratory fitness, smoking, asthma, airway hyperresponsiveness and serum eosinophil cationic protein...

  16. Adverse childhood experiences are associated with the risk of lung cancer: A prospective cohort study

    NARCIS (Netherlands)

    D.W. Brown (David); R.F. Anda (Robert); V.J. Felitti (Vincent); V.J. Edwards (Valerie); A.M. Malarcher (Ann Marie); J.B. Croft (Janet); W.H. Giles (Wayne)

    2010-01-01

    textabstractBackground. Strong relationships between exposure to childhood traumatic stressors and smoking behaviours inspire the question whether these adverse childhood experiences (ACEs) are associated with an increased risk of lung cancer during adulthood. Methods. Baseline survey data on health

  17. Your Lung Operation: After Your Operation

    Medline Plus

    Full Text Available ... Stay Up to Date with ACS Association Management Jobs Events Find a Surgeon Patients and Family Contact My Profile Shop/Donate ( 0 ) Items American College of Surgeons Education Patients and Family Skills Programs Your Lung Operation ...

  18. International Association for the Study of Lung Cancer Computed Tomography Screening Workshop 2011 report.

    Science.gov (United States)

    Field, John K; Smith, Robert A; Aberle, Denise R; Oudkerk, Matthijs; Baldwin, David R; Yankelevitz, David; Pedersen, Jesper Holst; Swanson, Scott James; Travis, William D; Wisbuba, Ignacio I; Noguchi, Masayuki; Mulshine, Jim L

    2012-01-01

    The International Association for the Study of Lung Cancer (IASLC) Board of Directors convened a computed tomography (CT) Screening Task Force to develop an IASLC position statement, after the National Cancer Institute press statement from the National Lung Screening Trial showed that lung cancer deaths fell by 20%. The Task Force's Position Statement outlined a number of the major opportunities to further improve the CT screening in lung cancer approach, based on experience with cancer screening from other organ sites.The IASLC CT Screening Workshop 2011 further developed these discussions, which are summarized in this report. The recommendation from the workshop, and supported by the IASLC Board of Directors, was to set up the Strategic CT Screening Advisory Committee (IASLC-SSAC). The Strategic CT Screening Advisory Committee is currently engaging professional societies and organizations who are stakeholders in lung cancer CT screening implementation across the globe, to focus on delivering guidelines and recommendations in six specific areas: (i) identification of high-risk individuals for lung cancer CT screening programs; (ii) develop radiological guidelines for use in developing national screening programs; (iii) develop guidelines for the clinical work-up of "indeterminate nodules" resulting from CT screening programmers; (iv) guidelines for pathology reporting of nodules from lung cancer CT screening programs; (v) recommendations for surgical and therapeutic interventions of suspicious nodules identified through lung cancer CT screening programs; and (vi) integration of smoking cessation practices into future national lung cancer CT screening programs. PMID:22173661

  19. Human lung tumor-associated antigen identified as an extracellular matrix adhesion molecule

    OpenAIRE

    1991-01-01

    A single chain glycoprotein with an estimated molecular mass of 160 kD (gp160) was previously identified as a human lung tumor-associated antigen. This tumor marker is shown here to be associated noncovalently with a second 130-kD protein. Sequential immunoprecipitation studies of surface iodinated lung tumor cell lysates reveal that this heterodimeric complex is indistinguishable serologically and structurally from the integrin VLA-2, found originally on activated T lymphocytes and platelets...

  20. Association of Body Mass Index with Chromosome Damage Levels and Lung Cancer Risk among Males

    OpenAIRE

    Li, Xiaoliang; Bai, Yansen; Wang, Suhan; Nyamathira, Samuel Mwangi; Zhang, Xiao; Zhang, Wangzhen; Wang, Tian; Deng, Qifei; He, Meian; Zhang, Xiaomin; Wu, Tangchun; Guo, Huan

    2015-01-01

    Epidemiological studies have shown an etiological link between body mass index (BMI) and cancer risk, but evidence supporting these observations is limited. This study aimed to investigate potential associations of BMI with chromosome damage levels and lung cancer risk. First, we recruited 1333 male workers from a coke-oven plant to examine their chromosome damage levels; and then, a cohort study of 12 052 males was used to investigate the association of BMI with lung cancer incidence. We fur...

  1. Clinical analysis of 64 patients with lung-cancer-associated hypercalcemia

    OpenAIRE

    Xu Li; Zhixin Bie; Zijin Zhang; Yuanming Li; Xueqing Hu; Wenbo Liu; Shuai Zhang; Gang Cheng; Bin Ai

    2015-01-01

    Objective: This study investigated the factors influencing survival time of patients with lung-cancer-associated hypercalcemia. Data and Methods: A total of 64 pathologically confirmed patients with Stage IV lung-cancer-associated hypercalcemia were enrolled from Beijing Hospitals between August 2010 and July 2015. Clinical materials included patients' gender, age, pathological type, highest albumin-corrected calcium level, serum alkaline phosphatase level, creatinine clearance rate, organ...

  2. Association between diabetes or antidiabetic therapy and lung cancer: A meta‐analysis

    OpenAIRE

    Wang, Zhida; Bao, Cuiping; Su, Cheng; Xu, Weili; Luo, Hongbin; Chen, Liming; Qi, Xiuying

    2013-01-01

    Abstract Aims/Introduction Diabetes can increase the risk of cancers at several sites, but the association between diabetes and lung cancer remains unclear. We aimed to provide the quantitative estimates for the association between diabetes or antidiabetic treatment and lung cancer risk in the present meta‐analysis. Materials and Methods Cohort studies were identified by searching the PubMed database (January 1960 through October 2012) and manually assessing the cited references in the retrie...

  3. Are interstitial lung abnormalities associated with COPD? A nested case–control study

    Science.gov (United States)

    Bozzetti, Francesca; Paladini, Ilaria; Rabaiotti, Enrico; Franceschini, Alessandro; Alfieri, Veronica; Chetta, Alfredo; Crisafulli, Ernesto; Silva, Mario; Pastorino, Ugo; Sverzellati, Nicola

    2016-01-01

    Purpose In this study, we tested the association between COPD and interstitial lung abnormality (ILA), notably in relation to the presence of computed tomography (CT) signs of lung fibrosis. Patients and methods COPD cases were selected from participants undergoing lung cancer screening (Multicentric Italian Lung Detection trial) for airflow obstruction (n=311/2,303, 13.5%) and 146 consecutive patients with clinical COPD. In all, 457 COPD cases were selected and classified according to the stages of Global Initiative for Chronic Obstructive Lung Disease. A nested matching (case:control = 1:2) according to age, sex, and smoking history was operated between each COPD case and two control subjects from Multicentric Italian Lung Detection trial without airflow obstruction. Low-dose CT scans of COPD cases and controls were reviewed for the presence of ILA, which were classified into definite or indeterminate according to the presence of signs of lung fibrosis. Results The frequency of definite ILA was similar between COPD cases and controls (P=0.2), independent of the presence of signs of lung fibrosis (P=0.07). Combined definite and indeterminate ILA was homogeneously distributed across Global Initiative for Chronic Obstructive Lung Disease stages (P=0.6). Definite ILA was directly associated with current smoker status (odds ratio [OR] 4.05, 95% confidence interval [CI]: 2.2–7.4) and increasing pack-years (OR 1.01, 95% CI: 1–1.02). Subjects with any fibrotic ILA were more likely to be older (OR 1.17, 95% CI: 1.10–1.25) and male (OR 8.58, 95% CI: 1.58–68.9). Conclusion There was no association between COPD and definite ILA. However, low-dose CT signs of lung fibrosis were also observed in COPD, and their clinical relevance is yet to be determined. PMID:27307724

  4. Circulating Histones Are Mediators of Trauma-associated Lung Injury

    OpenAIRE

    Abrams, Simon T.; Zhang, Nan; Manson, Joanna; Liu, Tingting; Dart, Caroline; Baluwa, Florence; Wang, Susan Siyu; Brohi, Karim; Kipar, Anja; Yu, Weiping; Wang, Guozheng; Toh, Cheng-Hock

    2013-01-01

    Rationale: Acute lung injury is a common complication after severe trauma, which predisposes patients to multiple organ failure. This syndrome largely accounts for the late mortality that arises and despite many theories, the pathological mechanism is not fully understood. Discovery of histone-induced toxicity in mice presents a new dimension for elucidating the underlying pathophysiology.

  5. Association of XPC polymorphisms and lung cancer risk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Bo Jin

    Full Text Available BACKGROUND: Xeroderma pigmentosum complementation group C gene (XPC is a key member of nucleotide excision repair pathway and plays an important role in human DNA repair system. It is reported that several common polymorphisms of XPC are associated with susceptibility to lung cancer. However, the conclusion is still elusive. METHOD: This meta-analysis was performed to determine the relationship between XPC polymorphisms (Lys939Gln, Ala499Val, and PAT and lung cancer risk. Published literatures were identified by searching online databases and reference lists of relevant studies. Odds ratios (ORs and 95% confidence intervals (CIs were calculated to estimate the association strength. Publication bias were detected by Egger's and Begg's test. RESULT: After strict screening, we identified 14 eligible studies in this meta-analysis, including 5647 lung cancer cases and 6908 controls. By pooling all eligible studies, we found that the homozygote Gln939Gln genotype was associated with a significantly increased risk of lung cancer in Asian population (GlnGln vs LysLys, OR=1.229, 95% CI: 1.000-1.510; GlnGln vs LysLys/LysGln, OR=1.257, 95% CI: 1.038-1.522. As for the PAT polymorphism, in Caucasian population, we found carriers of the -/- genotype were associated significantly reduced risk of lung cancer in homozygote comparison model (-/- vs +/+, OR=0.735, 95% CI: 0.567-0.952. CONCLUSION: In this meta-analysis we found that Gln939Gln genotype was associated with significantly increased risk of lung cancer in Asian population; the PAT -/- genotype significantly reduced susceptibility to lung cancer in Caucasian population; while the XPC Ala499Val polymorphism was not associated with lung cancer risk.

  6. Association between chronic obstructive pulmonary disease and lung cancer: the missing link

    Institute of Scientific and Technical Information of China (English)

    WANG Zeng-li

    2013-01-01

    Objective This review focuses on current knowledge of specific processes that drive chronic airway inflammation which are important in the pathogenesis of both chronic obstructive pulmonary disease (COPD) and lung cancer.Data sources The data used in this review were obtained mainly from studies reported in the PubMed database (1997-2012) using the terms of COPD and lung cancer.Study selection Data from published articles about prevalence of COPD-lung cancer overlap and mechanism involved in lung cancer development in COPD were identified,retrieved and reviewed.Results COPD prevalence,morbidity and mortality vary and are directly related to the prevalence of tobacco smoking except in developing countries where air pollution resulting from the burning of biomass fuels is also important.COPD is characterized by a chronic inflammation of lower airway and,importantly,the presence of COPD increases the risk of lung cancer up to 4.5 fold among long-term smokers.COPD is by far the greatest risk factor for lung cancer amongst smokers and is found in 50%-90% of patients with lung cancer.Conclusions Both COPD and lung cancer are tobacco smoking-associated chronic diseases that cluster in families and aggravate with age,and 50%-70% of patients diagnosed with lung cancer have declined spirometric evidence of COPD.Understanding and targeting common pathogenic mechanisms for lung cancer and COPD would have potential diagnostic and therapeutic implications for patients with these lung diseases and for people at risk.

  7. Interleukin-22 ameliorates acute severe pancreatitis-associated lung injury in mice

    Science.gov (United States)

    Qiao, Ying-Ying; Liu, Xiao-Qin; Xu, Chang-Qin; Zhang, Zheng; Xu, Hong-Wei

    2016-01-01

    AIM: To investigate the potential protective effect of exogenous recombinant interleukin-22 (rIL-22) on L-arginine-induced acute severe pancreatitis (SAP)-associated lung injury and the possible signaling pathway involved. METHODS: Balb/c mice were injected intraperitoneally with L-arginine to induce SAP. Recombinant mouse IL-22 was then administered subcutaneously to mice. Serum amylase levels and myeloperoxidase (MPO) activity in the lung tissue were measured after the L-arginine administration. Histopathology of the pancreas and lung was evaluated by hematoxylin and eosin (HE) staining. Expression of B cell lymphoma/leukemia-2 (Bcl-2), Bcl-xL and IL-22RA1 mRNAs in the lung tissue was detected by real-time PCR. Expression and phosphorylation of STAT3 were analyzed by Western blot. RESULTS: Serum amylase levels and MPO activity in the lung tissue in the SAP group were significantly higher than those in the normal control group (P 0.05). Moreover, no significant differences in the degrees of pancreatic and lung injuries were observed between the PBS and SAP groups. However, the serum amylase levels and lung tissue MPO activity in the rIL-22 group were significantly lower than those in the SAP group (P < 0.05), and the injuries in the pancreas and lung were also improved. Compared with the PBS group, rIL-22 stimulated the expression of Bcl-2, Bcl-xL and IL-22RA1 mRNAs in the lung (P < 0.05). In addition, the ratio of p-STAT3 to STAT3 protein in the rIL-22 group was significantly higher than that in the PBS group (P < 0.05). CONCLUSION: Exogenous recombinant IL-22 protects mice against L-arginine-induced SAP-associated lung injury by enhancing the expression of anti-apoptosis genes through the STAT3 signaling pathway. PMID:27275094

  8. Pyrosequencing Unveils Cystic Fibrosis Lung Microbiome Differences Associated with a Severe Lung Function Decline

    Science.gov (United States)

    Bacci, Giovanni; Paganin, Patrizia; Lopez, Loredana; Vanni, Chiara; Dalmastri, Claudia; Cantale, Cristina; Daddiego, Loretta; Perrotta, Gaetano; Dolce, Daniela; Morelli, Patrizia; Tuccio, Vanessa; De Alessandri, Alessandra; Fiscarelli, Ersilia Vita; Taccetti, Giovanni; Lucidi, Vincenzina; Mengoni, Alessio

    2016-01-01

    Chronic airway infection is a hallmark feature of cystic fibrosis (CF) disease. In the present study, sputum samples from CF patients were collected and characterized by 16S rRNA gene-targeted approach, to assess how lung microbiota composition changes following a severe decline in lung function. In particular, we compared the airway microbiota of two groups of patients with CF, i.e. patients with a substantial decline in their lung function (SD) and patients with a stable lung function (S). The two groups showed a different bacterial composition, with SD patients reporting a more heterogeneous community than the S ones. Pseudomonas was the dominant genus in both S and SD patients followed by Staphylococcus and Prevotella. Other than the classical CF pathogens and the most commonly identified non-classical genera in CF, we found the presence of the unusual anaerobic genus Sneathia. Moreover, the oligotyping analysis revealed the presence of other minor genera described in CF, highlighting the polymicrobial nature of CF infection. Finally, the analysis of correlation and anti-correlation networks showed the presence of antagonism and ecological independence between members of Pseudomonas genus and the rest of CF airways microbiota, with S patients showing a more interconnected community in S patients than in SD ones. This population structure suggests a higher resilience of S microbiota with respect to SD, which in turn may hinder the potential adverse impact of aggressive pathogens (e.g. Pseudomonas). In conclusion, our findings shed a new light on CF airway microbiota ecology, improving current knowledge about its composition and polymicrobial interactions in patients with CF. PMID:27355625

  9. Depletion of tumor associated macrophages slows the growth of chemically-induced mouse lung adenocarcinomas

    Directory of Open Access Journals (Sweden)

    Jason M. Fritz

    2014-11-01

    Full Text Available Chronic inflammation is a risk factor for lung cancer, and low dose aspirin intake reduces lung cancer risk. However, the roles that specific inflammatory cells and their products play in lung carcinogenesis have yet to be fully elucidated. In mice, alveolar macrophage numbers increase as lung tumors progress, and pulmonary macrophage programming changes within 2 weeks of carcinogen exposure. To examine how macrophages specifically affect lung tumor progression, they were depleted in mice bearing urethane-induced lung tumors using clodronate-encapsulated liposomes. Alveolar macrophage populations decreased to ≤ 50% of control levels after 4-6 weeks of liposomal clodronate treatment. Tumor burden decreased by 50% compared to vehicle treated mice, and tumor cell proliferation, as measured by Ki67 staining, was also attenuated. Pulmonary fluid levels of IGF-I, CXCL1, IL-6 and CCL2 diminished with clodronate liposome treatment. Tumor associated macrophages expressed markers of both M1 and M2 programming in vehicle and clodronate liposome treated mice. Mice lacking CCR2 (the receptor for macrophage chemotactic factor CCL2 had comparable numbers of alveolar macrophages and showed no difference in tumor growth rates when compared to similarly treated wild-type mice suggesting that while CCL2 may recruit macrophages to lung tumor microenvironments, redundant pathways can compensate when CCL2/CCR2 signaling is inactivated. Depletion of pulmonary macrophages rather than inhibition of their recruitment may be an advantageous strategy for attenuating lung cancer progression.

  10. Association of arsenic exposure with lung cancer incidence rates in the United States.

    Directory of Open Access Journals (Sweden)

    Joseph J Putila

    Full Text Available Although strong exposure to arsenic has been shown to be carcinogenic, its contribution to lung cancer incidence in the United States is not well characterized. We sought to determine if the low-level exposures to arsenic seen in the U.S. are associated with lung cancer incidence after controlling for possible confounders, and to assess the interaction with smoking behavior.Measurements of arsenic stream sediment and soil concentration obtained from the USGS National Geochemical Survey were combined, respectively, with 2008 BRFSS estimates on smoking prevalence and 2000 U.S. Census county level income to determine the effects of these factors on lung cancer incidence, as estimated from respective state-wide cancer registries and the SEER database. Poisson regression was used to determine the association between each variable and age-adjusted county-level lung cancer incidence. ANOVA was used to assess interaction effects between covariates.Sediment levels of arsenic were significantly associated with an increase in incident cases of lung cancer (P<0.0001. These effects persisted after controlling for smoking and income (P<0.0001. Across the U.S., exposure to arsenic may contribute to up to 5,297 lung cancer cases per year. There was also a significant interaction between arsenic exposure levels and smoking prevalence (P<0.05.Arsenic was significantly associated with lung cancer incidence rates in the U.S. after controlling for smoking and income, indicating that low-level exposure to arsenic is responsible for excess cancer cases in many parts of the U.S. Elevated county smoking prevalence strengthened the association between arsenic exposure and lung cancer incidence rate, an effect previously unseen on a population level.

  11. Gene by Environment Interaction Linking the Chromosome 15q25 Locus With Cigarette Consumption and Lung Cancer Susceptibility — Are African American Affected Differently?

    OpenAIRE

    Hopkins, R.J.; R. P. Young

    2016-01-01

    The majority of lung cancer cases result from complex interactions between smoking exposure, genetic susceptibility and a person's immune response to chronic inflammation or lung remodelling. Epidemiological studies confirm that susceptibility to developing chronic obstructive pulmonary disease (COPD), especially emphysema, is also closely linked to lung cancer susceptibility. Genetic epidemiology studies have consistently reported associations between the chromosome 15q25 locus with lung can...

  12. Are interstitial lung abnormalities associated with COPD? A nested case–control study

    Directory of Open Access Journals (Sweden)

    Bozzetti F

    2016-05-01

    Full Text Available Francesca Bozzetti,1 Ilaria Paladini,1 Enrico Rabaiotti,2 Alessandro Franceschini,1 Veronica Alfieri,3 Alfredo Chetta,3 Ernesto Crisafulli,3 Mario Silva,2 Ugo Pastorino,4 Nicola Sverzellati11Section of Radiology, Department of Surgical Sciences, University of Parma, 2Department of Radiology, Academic Hospital of Parma, 3Respiratory Disease and Lung Function Unit, Department of Clinical and Experimental Medicine, University of Parma, Parma, 4Division of Thoracic Surgery, Fondazione IRCCS Istituto Nazionale dei Tumori, Milan, ItalyPurpose: In this study, we tested the association between COPD and interstitial lung abnormality (ILA, notably in relation to the presence of computed tomography (CT signs of lung fibrosis.Patients and methods: COPD cases were selected from participants undergoing lung cancer screening (Multicentric Italian Lung Detection trial for airflow obstruction (n=311/2,303, 13.5% and 146 consecutive patients with clinical COPD. In all, 457 COPD cases were selected and classified according to the stages of Global Initiative for Chronic Obstructive Lung Disease. A nested matching (case:control =1:2 according to age, sex, and smoking history was operated between each COPD case and two control subjects from Multicentric Italian Lung Detection trial without airflow obstruction. Low-dose CT scans of COPD cases and controls were reviewed for the presence of ILA, which were classified into definite or indeterminate according to the presence of signs of lung fibrosis.Results: The frequency of definite ILA was similar between COPD cases and controls (P=0.2, independent of the presence of signs of lung fibrosis (P=0.07. Combined definite and indeterminate ILA was homogeneously distributed across Global Initiative for Chronic Obstructive Lung Disease stages (P=0.6. Definite ILA was directly associated with current smoker status (odds ratio [OR] 4.05, 95% confidence interval [CI]: 2.2–7.4 and increasing pack-years (OR 1.01, 95% CI: 1–1

  13. Association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury after intensity-modulated radiotherapy in lung cancer: a retrospective analysis.

    Science.gov (United States)

    Chen, Jinmei; Hong, Jinsheng; Zou, Xi; Lv, Wenlong; Guo, Feibao; Hong, Hualan; Zhang, Weijian

    2015-11-01

    The aim of this study was to investigate the association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury (RILI) after intensity-modulated radiotherapy (IMRT) for lung cancer. The normal lung relative volumes receiving greater than 5, 10, 20 and 30 Gy (V5-30) mean lung dose (MLD), and absolute volumes spared from greater than 5, 10, 20 and 30 Gy (AVS5-30) for the bilateral and ipsilateral lungs of 83 patients were recorded. Any association of clinical factors and dose-volume parameters with Grade ≥2 RILI was analyzed. The median follow-up was 12.3 months; 18 (21.7%) cases of Grade 2 RILI, seven (8.4%) of Grade 3 and two (2.4%) of Grade 4 were observed. Univariate analysis revealed the located lobe of the primary tumor. V5, V10, V20, MLD of the ipsilateral lung, V5, V10, V20, V30 and MLD of the bilateral lung, and AVS5 and AVS10 of the ipsilateral lung were associated with Grade ≥2 RILI (P lung was prognostic for Grade ≥2 RILI (P = 0.010, OR = 0.272, 95% CI: 0.102-0.729). Receiver operating characteristic curves indicated Grade ≥2 RILI could be predicted using AVS5 of the ipsilateral lung (area under curve, 0.668; cutoff value, 564.9 cm(3); sensitivity, 60.7%; specificity, 70.4%). The incidence of Grade ≥2 RILI was significantly lower with AVS5 of the ipsilateral lung ≥564.9 cm(3) than with AVS5 lung were associated with Grade ≥2 RILI, and AVS5 of the ipsilateral lung was prognostic for Grade ≥2 RILI for lung cancer after IMRT. PMID:26454068

  14. A genome-wide association search for type 2 diabetes genes in African Americans

    DEFF Research Database (Denmark)

    Palmer, Nicholette D; McDonough, Caitrin W; Hicks, Pamela J;

    2012-01-01

    African Americans are disproportionately affected by type 2 diabetes (T2DM) yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wid...

  15. International Association for the Study of Lung Cancer Computed Tomography Screening Workshop 2011 report

    DEFF Research Database (Denmark)

    Field, John K; Smith, Robert A; Aberle, Denise R;

    2011-01-01

    The International Association for the Study of Lung Cancer (IASLC) Board of Directors convened a computed tomography (CT) Screening Task Force to develop an IASLC position statement, after the National Cancer Institute press statement from the National Lung Screening Trial showed that lung cancer......, which are summarized in this report. The recommendation from the workshop, and supported by the IASLC Board of Directors, was to set up the Strategic CT Screening Advisory Committee (IASLC-SSAC). The Strategic CT Screening Advisory Committee is currently engaging professional societies and organizations...

  16. Statin Use Is Associated with Reduced Mortality in Patients with Interstitial Lung Disease

    DEFF Research Database (Denmark)

    Vedel Krogh, Signe; Nielsen, Sune F; Nordestgaard, Børge G

    2015-01-01

    INTRODUCTION: We hypothesized that statin use begun before the diagnosis of interstitial lung disease is associated with reduced mortality. METHODS: We studied all patients diagnosed with interstitial lung disease in the entire Danish population from 1995 through 2009, comparing statin use versus...... no statin use in a nested 1:2 matched study. RESULTS: The cumulative survival as a function of follow-up time from the date of diagnosis of interstitial lung disease (n = 1,786+3,572) and idiopathic lung fibrosis (n = 261+522) was higher for statin users versus never users (log-rank: P = 7·10-9 and P...... statin use was associated with reduced all-cause mortality....

  17. Position of the American Dietetic Association: vegetarian diets.

    Science.gov (United States)

    Craig, Winston J; Mangels, Ann Reed

    2009-07-01

    It is the position of the American Dietetic Association that appropriately planned vegetarian diets, including total vegetarian or vegan diets, are healthful, nutritionally adequate, and may provide health benefits in the prevention and treatment of certain diseases. Well-planned vegetarian diets are appropriate for individuals during all stages of the life cycle, including pregnancy, lactation, infancy, childhood, and adolescence, and for athletes. A vegetarian diet is defined as one that does not include meat (including fowl) or seafood, or products containing those foods. This article reviews the current data related to key nutrients for vegetarians including protein, n-3 fatty acids, iron, zinc, iodine, calcium, and vitamins D and B-12. A vegetarian diet can meet current recommendations for all of these nutrients. In some cases, supplements or fortified foods can provide useful amounts of important nutrients. An evidence- based review showed that vegetarian diets can be nutritionally adequate in pregnancy and result in positive maternal and infant health outcomes. The results of an evidence-based review showed that a vegetarian diet is associated with a lower risk of death from ischemic heart disease. Vegetarians also appear to have lower low-density lipoprotein cholesterol levels, lower blood pressure, and lower rates of hypertension and type 2 diabetes than nonvegetarians. Furthermore, vegetarians tend to have a lower body mass index and lower overall cancer rates. Features of a vegetarian diet that may reduce risk of chronic disease include lower intakes of saturated fat and cholesterol and higher intakes of fruits, vegetables, whole grains, nuts, soy products, fiber, and phytochemicals. The variability of dietary practices among vegetarians makes individual assessment of dietary adequacy essential. In addition to assessing dietary adequacy, food and nutrition professionals can also play key roles in educating vegetarians about sources of specific nutrients

  18. RESPIRATORY SYMPTOMS AND LUNG FUNCTION IN RELATION TO PASSIVE SMOKING: A COMPARATIVE STUDY OF AMERICAN AND FRENCH WOMEN

    Science.gov (United States)

    Results are reported from a parallel analysis of the association of passive smoking with respiratory symptoms and lung function (FEV, FVC, and FEV/FVC) in 2200 U.S. and 3866 French women from the general population examined over the same time period using similar methods. ge, cit...

  19. Variation in lung function is associated with worse clinical outcomes in cystic fibrosis

    OpenAIRE

    João Paulo Heinzmann-Filho; Leonardo Araujo Pinto; Paulo José Cauduro Marostica; Márcio Vinícius Fagundes Donadio

    2015-01-01

    ABSTRACT OBJECTIVE: To determine whether the variation in lung function over one year is associated with worse clinical outcomes, as well as with a decline in lung function in the following years, in patients with cystic fibrosis (CF). METHODS: This was a retrospective study involving CF patients (4-19 years of age), evaluated over a three-year period. We evaluated demographic characteristics, chronic Pseudomonas aeruginosa infection, antibiotic use, hospitalization, six-minute walk dista...

  20. Variation in lung function is associated with worse clinical outcomes in cystic fibrosis

    OpenAIRE

    Heinzmann-Filho, João Paulo; Pinto, Leonardo Araujo; Marostica, Paulo José Cauduro; Donadio, Márcio Vinícius Fagundes

    2015-01-01

    ABSTRACT OBJECTIVE: To determine whether the variation in lung function over one year is associated with worse clinical outcomes, as well as with a decline in lung function in the following years, in patients with cystic fibrosis (CF). METHODS: This was a retrospective study involving CF patients (4-19 years of age), evaluated over a three-year period. We evaluated demographic characteristics, chronic Pseudomonas aeruginosa infection, antibiotic use, hospitalization, six-minute walk distance ...

  1. The crossover lung segment: congenital malformation associated with a variant of scimitar syndrome.

    OpenAIRE

    Clements, B S; Warner, J O

    1987-01-01

    Three cases of a congenitally misplaced segment of lung are described. In one case the abnormal segment was identified at thoracotomy; it extended from an origin in the right upper lobe across the midline into the left hemithorax. The remaining two patients, with identical radiographic features, were identified in a review of 24 cases of bronchovascular malformation. In all three patients the crossover segment was associated with a variant of the scimitar syndrome: right lung hypoplasia with ...

  2. The Association of Transporter Genes Polymorphisms and Lung Cancer Chemotherapy Response

    OpenAIRE

    Wang, Ying; Yin, Ji-Ye; Li, Xiang-ping; Chen, Juan; Qian, Chen-yue; Zheng, Yi; Fu, Yi-Lan; Chen, Zi-Yu; Zhou, Hong-Hao; Liu, Zhao-Qian

    2014-01-01

    Lung cancer is one of the most common cancers and is the leading cause of death worldwide. Platinum-based chemotherapy is the main treatment method in lung cancer patients. Our previous studies indicated that single nucleotide polymorphisms (SNPs) in some transporter genes played important role in platinum-based chemotherapy efficacy. The aim of this study was to investigate the association of SNPs in transporter genes and platinum-based chemotherapy efficacy. The main polymorphisms on transp...

  3. Distress and alexithymia in lung recipients - psychosocial strains and associations with chronic allograft dysfunction

    OpenAIRE

    Goetzmann, L; Irani, S; Schwegler, K.; Stamm, M.; Bricman, R; Buddeberg, C; Schmid, C.; Benden, C; Klaghofer, R; Boehler, A

    2010-01-01

    QUESTIONS UNDER STUDY: In recent years, distress and alexithymia have been recognised as psychosocial factors related to both somatic and psychosomatic diseases. In this study distress and alexithymia and their associations with physical parameters were investigated in lung recipients. METHODS: The study, which included 76 patients after a lung transplant, measured psychological distress (Symptom Checklist, SCL-K-9) and alexithymia (Toronto Alexithymia Scale, TAS-20). Physical health was asse...

  4. Association of Arsenic Exposure with Lung Cancer Incidence Rates in the United States

    OpenAIRE

    Putila, Joseph J.; Guo, Nancy Lan

    2011-01-01

    Background Although strong exposure to arsenic has been shown to be carcinogenic, its contribution to lung cancer incidence in the United States is not well characterized. We sought to determine if the low-level exposures to arsenic seen in the U.S. are associated with lung cancer incidence after controlling for possible confounders, and to assess the interaction with smoking behavior. Methodology Measurements of arsenic stream sediment and soil concentration obtained from the USGS National G...

  5. Association between the XPG gene Asp1104His polymorphism and lung cancer risk.

    Science.gov (United States)

    Zhou, B; Hu, X M; Wu, G Y

    2016-01-01

    It has been suggested that the xeroderma pigmentosum complementation group G (XPG) gene Asp1104His polymorphism is linked to susceptibility to lung cancer. However, the results from the published studies are contradictory rather than conclusive. With this meta-analysis, we aimed to achieve a better understanding of the effects of the XPG gene Asp1104His polymorphism on lung cancer risk. We identified six eligible studies from five publications that included a total of 2293 lung cancer patients and 2586 controls. There was a significant association between the XPG gene Asp1104His polymorphism and lung cancer (His/His vs Asp/Asp: OR = 1.24, 95%CI = 1.04-1.48; Asp/His vs Asp/Asp: OR = 1.17, 95%CI = 1.03-1.34; the dominant model: OR = 1.18, 95%CI = 1.04-1.33; the recessive model: OR = 1.10, 95%CI = 0.94-1.28). In a subgroup analysis by nationality, we found a significant association between the XPG gene Asp1104His polymorphism and lung cancer risk in Asians. No publication bias was found in this study. The results from this meta-analysis indicate that the XPG gene Asp1104His polymorphism is associated with lung cancer risk, especially in Asians. PMID:27323149

  6. Association of Body Mass Index with Chromosome Damage Levels and Lung Cancer Risk among Males

    Science.gov (United States)

    Li, Xiaoliang; Bai, Yansen; Wang, Suhan; Nyamathira, Samuel Mwangi; Zhang, Xiao; Zhang, Wangzhen; Wang, Tian; Deng, Qifei; He, Meian; Zhang, Xiaomin; Wu, Tangchun; Guo, Huan

    2015-01-01

    Epidemiological studies have shown an etiological link between body mass index (BMI) and cancer risk, but evidence supporting these observations is limited. This study aimed to investigate potential associations of BMI with chromosome damage levels and lung cancer risk. First, we recruited 1333 male workers from a coke-oven plant to examine their chromosome damage levels; and then, a cohort study of 12 052 males was used to investigate the association of BMI with lung cancer incidence. We further carried out a meta-analysis for BMI and male lung cancer risk based on cohort studies. We found that men workers with excess body weight (BMI ≥ 25 kg/m2) had lower levels of MN frequencies than men with normal-weight (BMI: 18.5–24.9). Our cohort study indicated that, the relative risk (RR) for men with BMI ≥ 25 to develop lung cancer was 35% lower than RR for normal-weight men. Further meta-analysis showed that, compared to normal-weight men, men with BMI ≥ 25 had decreased risk of lung cancer among both the East-Asians and others populations. These results indicate that men with excess body weight had significant decreased chromosome damage levels and lower risk of lung cancer than those with normal-weight. However, further biological researches were needed to validate these associations. PMID:25820198

  7. AGER -429T/C is associated with an increased lung disease severity in cystic fibrosis.

    Directory of Open Access Journals (Sweden)

    Julie Beucher

    Full Text Available The clinical course of cystic fibrosis (CF varies between patients bearing identical CFTR mutations, suggesting the involvement of modifier genes. We assessed the association of lung disease severity with the variant AGER -429 T/C, coding for RAGE, a pro-inflammatory protein, in CF patients from the French CF Gene Modifier Study. We analyzed the lung function of 967 CF patients p.Phe508del homozygous. FEV(1 was analyzed as CF-specific percentile adjusted on age, height and mortality. AGER -429T/C polymorphism was genotyped and its function was evaluated in vitro by measurement of the luciferase activity. AGER -429 minor allele (C was associated with poorer lung function (p = 0.03. In vitro, the promoter activity was higher in cells transfected with AGER -429C compared to cells transfected with the AGER -429T allele (p = 0.016 in BEAS-2B cells. AGER seems to be a modifier gene of lung disease severity in CF, and could be an interesting biomarker of CF airway inflammation. The functional promoter AGER -429C variant is associated with an increased RAGE expression that can lead to an increased lung inflammation and a more severe lung disease.

  8. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia.

    NARCIS (Netherlands)

    Lan, Q.; Hsiung, C.A.; Matsuo, K.; Hong, Y.C.; Seow, A.; Wang, Z.; Hosgood, H.D.; Chen, K.; Wang, J.C.; Chatterjee, N.; Hu, W.; Wong, M.P.; Zheng, W.; Caporaso, N.; Park, J.Y.; Chen, C.J.; Kim, Y.H.; Kim, Y.T.; Landi, M.T.; Shen, H.; Lawrence, C.; Burdett, L.; Yeager, M.; Yuenger, J.; Jacobs, K.B.; Chang, I.S.; Mitsudomi, T.; Kim, H.N.; Chang, G.C.; Bassig, B.A.; Tucker, M.; Wei, F.; Yin, Y.; Wu, C.; An, S.J.; Qian, B.; Lee, V.H.; Lu, D.; Liu, J.; Jeon, H.S.; Hsiao, C.F.; Sung, J.S.; Kim, J.H.; Gao, Y.T.; Tsai, Y.H.; Jung, Y.J.; Guo, H.; Hu, Z.; Hutchinson, A.; Wang, W.C.; Klein, R.; Chung, C.C.; Oh, I.J.; Chen, K.Y.; Berndt, S.I.; He, X.; Wu, W.; Chang, J.; Zhang, X.C.; Huang, M.S.; Zheng, H.; Wang, J.; Zhao, X.; Li, Y.; Choi, J.E.; Su, W.C.; Park, K.H.; Sung, S.W.; Shu, X.O.; Chen, Y.M.; Liu, L.; Kang, C.H.; Hu, L.; Chen, C.H.; Pao, W.; Kim, Y.C.; Yang, T.Y.; Xu, J.; Guan, P.; Tan, W.; Su, J.; Wang, C.L.; Li, H.; Sihoe, A.D.; Zhao, Z.; Chen, Y.; Choi, Y.Y.; Hung, J.Y.; Kim, J.S.; Yoon, H.I.; Cai, Q.; Lin, C.C.; Park, I.K.; Xu, P.; Dong, J.; Kim, C.; He, Q; Perng, R.P.; Kohno, T.; Kweon, S.S.; Chen, C.Y.; Vermeulen, R.; Wu, J.; Lim, W.Y.; Chen, K.C.; Chow, W.H.; Ji, B.T.; Chan, J.K.; Chu, M.; Li, Y.J.; Yokota, J.; Li, J.; Chen, H.; Xiang, Y.B.; Yu, C.J.; Kunitoh, H.; Wu, G.; Jin, L.; Lo, Y.L.; Shiraishi, K.; Chen, Y.H.; Lin, H.C.; Wu, T.; WU, Y.; Yang, P.C.; Zhou, B.; Shin, M.H.; Fraumeni, J.F.; Lin, D.; Chanock, S.J.; Rothman, N.

    2012-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland Ch

  9. American National Standards Institute/American Dental Association Specification No. 52 for uranium content in dental porcelain and porcelain teeth

    International Nuclear Information System (INIS)

    Standards have been established by the American Dental Association limiting the amount of uranium permitted in dental porcelain to no more than 0.003% by weight. This is a reduction by 40% of the previous standard set by the AEC in 1950. A procedure for uranium determination by neutron activation is described

  10. Your Lung Operation: After Your Operation

    Medline Plus

    Full Text Available ... Stay Up to Date with ACS Association Management Jobs Events Find a Surgeon Patients and Family Contact My Profile Shop/Donate ( 0 ) Items American College of Surgeons Education Patients and Family Skills Programs Your Lung Operation Your Lung Operation DVD ...

  11. Extracorporeal photochemotherapy for Epstein-Barr virus-associated lymphoma after lung transplantation.

    Science.gov (United States)

    Schoch, O D; Boehler, A; Speich, R; Nestle, F O

    1999-10-15

    Posttransplantation lymphoproliferative disorder (PTLD) is a serious complication after transplantation of solid organs. Highest incidence rates have been reported for lung transplant recipients. With the current treatment strategy for early onset PTLD, a reduction of immunosuppressive drugs, mortality of lung transplant recipients with PTLD remains high, due to both, incomplete control of PTLD and transplant rejection. We present a lung transplant recipient with a history of acute rejection and Epstein Barr virus-associated posttransplantation malignant non-Hodgkin's lymphoma. Extracorporeal photochemotherapy, in combination with a moderate reduction of immunosuppressive therapy, resulted in complete disappearance of PTLD. After a first year of follow-up, no further rejection and no recurrence of PTLD have occurred. Treatment with ECP, with its beneficial effects on both, rejection after organ transplantation and malignant lymphoma, may be a particularly valuable approach for the treatment of PTLD in patients after lung transplantation, with its increased risk for transplant rejection. PMID:10532551

  12. Individual and cumulative effects of GWAS susceptibility loci in lung cancer: associations after sub-phenotyping for COPD.

    Directory of Open Access Journals (Sweden)

    Robert P Young

    Full Text Available Epidemiological studies show that approximately 20-30% of chronic smokers develop chronic obstructive pulmonary disease (COPD while 10-15% develop lung cancer. COPD pre-exists lung cancer in 50-90% of cases and has a heritability of 40-77%, much greater than for lung cancer with heritability of 15-25%. These data suggest that smokers susceptible to COPD may also be susceptible to lung cancer. This study examines the association of several overlapping chromosomal loci, recently implicated by GWA studies in COPD, lung function and lung cancer, in (n = 1400 subjects sub-phenotyped for the presence of COPD and matched for smoking exposure. Using this approach we show; the 15q25 locus confers susceptibility to lung cancer and COPD, the 4q31 and 4q22 loci both confer a reduced risk to both COPD and lung cancer, the 6p21 locus confers susceptibility to lung cancer in smokers with pre-existing COPD, the 5p15 and 1q23 loci both confer susceptibility to lung cancer in those with no pre-existing COPD. We also show the 5q33 locus, previously associated with reduced FEV(1, appears to confer susceptibility to both COPD and lung cancer. The 6p21 locus previously linked to reduced FEV(1 is associated with COPD only. Larger studies will be needed to distinguish whether these COPD-related effects may reflect, in part, associations specific to different lung cancer histology. We demonstrate that when the "risk genotypes" derived from the univariate analysis are incorporated into an algorithm with clinical variables, independently associated with lung cancer in multivariate analysis, modest discrimination is possible on receiver operator curve analysis (AUC = 0.70. We suggest that genetic susceptibility to lung cancer includes genes conferring susceptibility to COPD and that sub-phenotyping with spirometry is critical to identifying genes underlying the development of lung cancer.

  13. American ginseng suppresses inflammation and DNA damage associated with mouse colitis

    OpenAIRE

    Jin, Yu; Kotakadi, Venkata S.; Ying, Lei; Hofseth, Anne B.; Cui, Xiangli; Wood, Patricia A; Windust, Anthony; Matesic, Lydia E.; Pena, Edsel A.; Chiuzan, Codruta; Singh, Narendra P.; Nagarkatti, Mitzi; Nagarkatti, Prakash S.; Wargovich, Michael J.; Hofseth, Lorne J.

    2008-01-01

    Ulcerative colitis (UC) is a dynamic, idiopathic, chronic inflammatory condition associated with a high colon cancer risk. American ginseng has antioxidant properties and targets many of the players in inflammation. The aim of this study was to test whether American ginseng extract prevents and treats colitis. Colitis in mice was induced by the presence of 1% dextran sulfate sodium (DSS) in the drinking water or by 1% oxazolone rectally. American ginseng extract was mixed in the chow at level...

  14. Inadequate glucose control in type 2 diabetes is associated with impaired lung function and systemic inflammation: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Rondón Martin

    2010-07-01

    Full Text Available Abstract Background Inadequate glucose control may be simultaneously associated with inflammation and decreased lung function in type 2 diabetes. We evaluated if lung function is worse in patients with inadequate glucose control, and if inflammatory markers are simultaneously increased in these subjects. Methods Subjects were selected at the Colombian Diabetes Association Center in Bogotá. Pulmonary function tests were performed and mean residual values were obtained for forced expiratory volume (FEV1, forced vital capacity (FVC and FEV1/FVC, with predicted values based on those derived by Hankinson et al. for Mexican-Americans. Multiple least-squares regression was used to adjust for differences in known determinants of lung function. We measured blood levels of glycosylated hemoglobin (HBA1c, interleukin 6 (IL-6, tumor necrosis factor (TNF-α, fibrinogen, ferritin, and C-reactive protein (C-RP. Results 495 diabetic patients were studied, out of which 352 had inadequate control (HBA1c > 7%. After adjusting for known determinants of lung function, those with inadequate control had lower FEV1 (-75.4 mL, IC95%: -92, -59; P 1/FVC (0.013%, IC95%: 0.009, 0.018, P Conclusions Subjects with type 2 diabetes and inadequate control had lower FVC and FEV1 than predicted and than those of subjects with adequate control. It is postulated that poorer pulmonary function may be associated with increased levels of inflammatory mediators.

  15. Educational activities of the American Association of Physicists in Medicine

    International Nuclear Information System (INIS)

    Full text: The American Association of Physicists in Medicine (AAPM) was incorporated in 1958. Among the main purposes of the Association as specified in its Articles of Incorporation is to 'promote the application of physics to medicine and biology, to encourage interest and training in medical physics and related fields, and to prepare and to disseminate technical information in medical physics and related fields'. AAPM's activities in education emanate primarily from its Educational and Science Councils, International Affairs Committee (IAC), Annual Meeting, Annual Summer School, Medical Physics journal, and Website (www.aapm.org). AAPM devotes nearly one third of its total budget to educational activities not only in the United States but also internationally, with many of the international activities being co-sponsored and/or in conjunction and cooperation with the International Organization of Medical Physics, International Atomic Energy Agency, and other international societies. The AAPM's IAC has subcommittees devoted to all regions of the earth including subcommittees for African Affairs, Asian Oceanic Affairs, European Affairs, Latin American Affairs, Middle East Affairs, and the Exchange Scientist Program. The AAPM includes under its umbrella of Education the creation of Task Group Reports on various training and standard of practice documents, teaching syllabi, slide sets, PowerPoint presentations, support of continuing educational meetings throughout the world including meetings in developing countries, and free access to most of the educational and professional modules on its website. The AAPM's Education Council oversees the activities of several committees and task groups dedicated to national and international educational activities for medical physicists as well as other health professional (such as physicians and medical technologists) via the activities of our committees on Continuing Professional Development, Education and Training of Medical

  16. A meta-analysis of the association between Chlamydia pneumoniae infection and lung cancer risk

    Directory of Open Access Journals (Sweden)

    X Hua-Feng

    2015-01-01

    Full Text Available Objective: The association between Chlamydia pneumoniae infection and lung cancer risk was not clear with small number of cases in each study. The aim of this meta-analysis was to evaluate the correlation between pneumonia infection and lung cancer risk by pooling the open published papers. Materials and Methods: We searched the electronic databases of Medline, EMBASE, Web of Science, and China National Knowledge Infrastructure databases for publications related to the association between pneumonia infection and lung cancer risk. Odds ratio (OR and its 95% confidence interval (95% CI was used to assess the correlation. The data were pooled by Stata11.0 software (Stata Corporation, College Station, TX, USA. Results: Thirteen publications, involving 2549 lung cancer patients and 2764 controls were included in this meta-analysis. The pooled results indicated that the C. pneumoniae infection significant increased the risk of lung cancer OR = 2.07 (95% CI: 1.43–2.99 by random effect model. And for serum IgG, 12 publications reported the IgG positive rate in lung cancer patients and relative healthy controls. The pooled OR was 2.22 (95% CI: 1.41–3.50 by using the random effects model which indicated that the IgG positive rate was significantly higher in lung cancer patients than that of healthy controls. The sensitivity analysis indicated the pooled OR was not sensitive to a single study. However, Begger's funnel plot and Egger's line regression analysis indicated significant publications bias for this meta-analysis. Conclusions: According to the present published data, C. pneumoniae infection may increase the risk of lung cancer. However, for its significant publications and heterogeneity among the included studies, the conclusion should be interpreted cautiously.

  17. SIRT1 expression is associated with poor prognosis of lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Li C

    2015-04-01

    Full Text Available Chong Li,1,2,* Lingling Wang,3,* Liang Zheng,4 Xianghong Zhan,4 Bin Xu,1,2 Jingting Jiang,1,2 Changping Wu1,2 1Department of Tumor Biological Treatment, the Third Affiliated Hospital, Soochow University, Changzhou, 2Cancer Immunotherapy Engineering Research Center of Jiangsu Province, Changzhou, 3Department of Medical Education, Jinling Hospital, Medical School of Nanjing University, Nanjing, 4Department of Thoracic Surgery, the Third Affiliated Hospital, Soochow University, Changzhou, Jiangsu, People’s Republic of China *These authors contributed equally to this work Abstract: Several studies have reported that the overexpression of Sirtuin 1 (SIRT1 was associated with poor prognosis in various human cancers. However, little is known regarding the prognostic value of SIRT1 in lung adenocarcinoma. Therefore, the aim of this study is to evaluate the role of SIRT1 in the prognosis of lung adenocarcinoma patients. Using a tissue microarray, we detected SIRT1 expression by immunohistochemistry in lung adenocarcinoma tissue, as well as in corresponding noncancerous tissues (NCTs. A high expression level of SIRT1 was observed in 74.7% (56/75 of patients with lung adenocarcinoma and 6.7% (5/75 of NCTs (P<0.001. SIRT1 expression was significantly associated with high pathological stage. Importantly, we found that SIRT1 expression was associated with worse overall survival in these lung adenocarcinoma patients (67.0 months vs 104.5 months; P=0.005. In addition, anaplastic lymphoma kinase, epidermal growth factor receptor, vascular endothelial growth factor (VEGF, and Survivin expression were evaluated by fluorescent in situ hybridization or immunohistochemistry, respectively. We found that VEGF and Survivin were both highly expressed in the lung adenocarcinoma tissues, as compared to NCTs. Moreover, the SIRT1 and VEGF expression statuses were significantly positively correlated (r=0.238, P=0.039, while SIRT1 and Survivin expression status were not

  18. Paraseptal emphysema: Prevalence and distribution on CT and association with interstitial lung abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Araki, Tetsuro, E-mail: taraki@partners.org [Department of Radiology, Center for Pulmonary Functional Imaging, Brigham and Women' s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215 (United States); Department of Radiology, Kinki University Faculty of Medicine, Osaka-Sayama (Japan); Nishino, Mizuki [Department of Radiology, Center for Pulmonary Functional Imaging, Brigham and Women' s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215 (United States); Zazueta, Oscar E. [The Pulmonary and Critical Care Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gao, Wei [Department of Biostatistics, Boston University School of Public Health, Boston, MA (United States); Dupuis, Josée [Department of Biostatistics, Boston University School of Public Health, Boston, MA (United States); The National Heart Lung and Blood Institute' s Framingham Heart Study, Framingham, MA (United States); Okajima, Yuka [Department of Radiology, Center for Pulmonary Functional Imaging, Brigham and Women' s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215 (United States); Latourelle, Jeanne C. [Department of Medicine and Neurology, Boston University School of Medicine, Boston, MA (United States); Rosas, Ivan O. [The Pulmonary and Critical Care Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Murakami, Takamichi [Department of Radiology, Kinki University Faculty of Medicine, Osaka-Sayama (Japan); O’Connor, George T. [The National Heart Lung and Blood Institute' s Framingham Heart Study, Framingham, MA (United States); Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, MA (United States); Washko, George R.; Hunninghake, Gary M. [The Pulmonary and Critical Care Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); and others

    2015-07-15

    Highlights: • The prevalence of pure paraseptal emphysema was 3% (85/2633) in the Framingham Heart Study population, predominantly affects the upper lung zone, and contributes to slightly decreased pulmonary function. • There was significant association between paraseptal emphysema and interstitial lung abnormalities, which is a novel finding. • Prevalence of paraseptal emphysema and its impact on pulmonary function could have been underestimated in the previous reports. - Abstract: Objective: To investigate the prevalence and distribution of paraseptal emphysema on chest CT images in the Framingham Heart Study (FHS) population, and assess its impact on pulmonary function. Also pursued was the association with interstitial lung abnormalities. Materials and methods: We assessed 2633 participants in the FHS for paraseptal emphysema on chest CT. Characteristics of the participants, including age, sex, smoking status, clinical symptoms, and results of pulmonary function tests, were compared between those with and without paraseptal emphysema. The association between paraseptal emphysema and interstitial lung abnormalities was investigated. Results: Of the 2633 participants, 86 (3%) had pure paraseptal emphysema (defined as paraseptal emphysema with no other subtypes of emphysema other than paraseptal emphysema or a very few centrilobular emphysema involved) in at least one lung zone. The upper zone of the lungs was almost always involved. Compared to the participants without paraseptal emphysema, those with pure paraseptal emphysema were significantly older, and were more frequently male and smokers (mean 64 years, 71% male, mean 36 pack-years, P < 0.001) and had significantly decreased FEV{sub 1}/FVC% (P = 0.002), and diffusion capacity of carbon monoxide (DLCO) (P = 0.002). There was a significant association between pure paraseptal emphysema and interstitial lung abnormalities (P < 0.001). Conclusions: The prevalence of pure paraseptal emphysema was 3% in the

  19. Adverse childhood experiences are associated with the risk of lung cancer: a prospective cohort study

    Directory of Open Access Journals (Sweden)

    Edwards Valerie J

    2010-01-01

    Full Text Available Abstract Background Strong relationships between exposure to childhood traumatic stressors and smoking behaviours inspire the question whether these adverse childhood experiences (ACEs are associated with an increased risk of lung cancer during adulthood. Methods Baseline survey data on health behaviours, health status and exposure to adverse childhood experiences (ACEs were collected from 17,337 adults during 1995-1997. ACEs included abuse (emotional, physical, sexual, witnessing domestic violence, parental separation or divorce, or growing up in a household where members with mentally ill, substance abusers, or sent to prison. We used the ACE score (an integer count of the 8 categories of ACEs as a measure of cumulative exposure to traumatic stress during childhood. Two methods of case ascertainment were used to identify incident lung cancer through 2005 follow-up: 1 hospital discharge records and 2 mortality records obtained from the National Death Index. Results The ACE score showed a graded relationship to smoking behaviors. We identified 64 cases of lung cancer through hospital discharge records (age-standardized risk = 201 × 100,000-1 population and 111 cases of lung cancer through mortality records (age-standardized mortality rate = 31.1 × 100,000-1 person-years. The ACE score also showed a graded relationship to the incidence of lung cancer for cases identified through hospital discharge (P = 0.0004, mortality (P = 0.025, and both methods combined (P = 0.001. Compared to persons without ACEs, the risk of lung cancer for those with ≥ 6 ACEs was increased approximately 3-fold (hospital records: RR = 3.18, 95%CI = 0.71-14.15; mortality records: RR = 3.55, 95%CI = 1.25-10.09; hospital or mortality records: RR = 2.70, 95%CI = 0.94-7.72. After a priori consideration of a causal pathway (i.e., ACEs → smoking → lung cancer, risk ratios were attenuated toward the null, although not completely. For lung cancer identified through hospital

  20. Are CRIS Cluster Patterns Differentially Associated with African American Enculturation and Social Distance?

    Science.gov (United States)

    Chavez-Korell, Shannon; Vandiver, Beverly J.

    2012-01-01

    The authors examined whether Black racial identity cluster patterns, using Cross Racial Identity Scale (CRIS) scores, were differentially associated with preference for African American culture and social distance from various cultural groups. African American college students (N = 351) completed the CRIS, an enculturation scale, and a social…

  1. Profusion of opacities in simple coal workers’ pneumoconiosis is associated with reduced lung function

    Science.gov (United States)

    Blackley, David J.; Laney, A. Scott; Halldin, Cara N.; Cohen, Robert A.

    2015-01-01

    Background A large body of evidence demonstrates dose-response relationships of cumulative coal mine dust exposure with lung function impairment and with small opacity profusion. However, medical literature generally holds that simple coal workers’ pneumoconiosis (CWP) is not associated with lung function impairment. This study examines the relationship between small opacity profusion and lung function in U.S. underground coal miners with simple CWP. Methods Miners were examined during 2005–2013 as part of the Enhanced Coal Workers’ Health Surveillance Program. Work histories were obtained, and chest radiographs and spirometry were administered. For those with multiple Program encounters, the most recent visit was used. Lung parenchymal abnormalities consistent with CWP were classified according to International Labour Organization guidelines, and reference values for FEV1 and FVC were calculated using reference equations derived from the 3rd National Health and Nutrition Examination Survey. Differences in lung function were evaluated by opacity profusion, and regression models were fit to characterize associations between profusion and lung function. Results A total of 8,230 miners were eligible for analysis; 269 had category 1 or 2 simple CWP. Decrements in FEV1 percent predicted were nearly consistent across profusion subcategories. Clear decrements in FVC percent predicted and FEV1/FVC were also observed, although these were less consistent. Controlling for smoking status, BMI, and mining tenure, each one-unit subcategory increase in profusion was associated with decreases of 1.5% (95% CI 1.0% to 1.9%), 1.0% (95% CI 0.6% to 1.3%), and 0.6% (95% CI 0.4% to 0.8%) in FEV1 percent predicted, FVC percent predicted, and FEV1/FVC, respectively. Conclusions We observed progressively lower lung function across the range of small opacity profusion. These findings address a longstanding question in occupational medicine, and point to the importance of medical

  2. Reading and analysis on management guidelines for hypothyroidism published in 2012 by American thyroid association and American association of clinical endocrinologists

    International Nuclear Information System (INIS)

    Recently, American Thyroid Association and American Association of Clinical Endocrinologists published Clinical Guideline for Hypothyroidism. The authors took an evidence-based medicine approach, and created 52 recommendations on 15 issues. The guideline emphasized that serum thyrotropin is the single best screening test for primary thyroid dysfunction for the vast majority of outpatient clinical situations. The standard treatment for hypothyroidism is replacement with L-thyroxine. The decision to treat subclinical hypothyroidism when the serum thyrotropin is less than 10 mIU/L should be tailored to the individual patient. (authors)

  3. Rare Case of Unilateral Hypoplasia of Lung with Associated Ventricular Mass in an Adult

    Science.gov (United States)

    Alam, Azad; Iyer, Aparna; Kutty, Jayalakshmi Thelapurath

    2016-01-01

    Hypoplasia of the lung is a rare congenital condition which can be: a) primary i.e. no apparent cause is found; or b) secondary i.e. associated with other congenital anomalies that are implicated in its pathogenesis. These anomalies may involve the diaphragm, cardiovascular, central nervous, urogenital and musculoskeletal system. Patients usually present in neonatal, infancy or childhood period and very rarely in adulthood. Our patient was an adult having a unilateral hypoplastic lung associated with a ventricular mass and to our knowledge this rare combination has never been reported in the English literature; though there are reports of prenatal or newborns with hypoplastic lung and rhabdomyoma of ventricle who did not survive.

  4. Genomewide association study of lung lesions in cattle using sample pooling.

    Science.gov (United States)

    Keele, J W; Kuehn, L A; McDaneld, T G; Tait, R G; Jones, S A; Smith, T P L; Shackelford, S D; King, D A; Wheeler, T L; Lindholm-Perry, A K; McNeel, A K

    2015-03-01

    Bovine respiratory disease complex (BRDC) is the most expensive disease in beef cattle in the United States costing the industry at least US$1 billion annually. Bovine respiratory disease complex causes damage to lung tissue resulting in persistent lung lesions observable at slaughter. Severe lung lesions at harvest have been associated with decreased preharvest ADG and increased clinical BRDC in the feedlot. Our objective was to identify SNP that are associated with severe lung lesions observed at harvest in feedlot cattle. We conducted a genomewide association study (GWAS) using a case-control design for severe lung lesions in fed cattle at slaughter using the Illumina Bovine HD array (approximately 770,000 SNP) and sample pooling. Lung samples were collected from 11,520 young cattle, a portion of which had not been treated with antibiotics (participating in a "natural" marketing program), at a large, commercial beef processing plant in central Nebraska. Lung samples with lesions (cases) and healthy lungs (controls) were collected when both phenotypes were in close proximity on the viscera (offal) table. We constructed 60 case and 60 control pools with 96 animals per pool. Pools were constructed by sampling sequence to ensure that case and control pool pairs were matched by proximity on the processing line. The Bovine HD array (770,000 SNP) was run on all pools. Fourteen SNP on BTA 2, 3, 4, 9, 11, 14, 15, 22, 24, and 25 were significant at the genomewide experiment-wise error rate of 5% ( ≤ 1.49 × 10). Eighty-five SNP on 28 chromosomes achieved a false discovery rate of 5% ( ≤ 5.38 × 10). Significant SNP were near (±100 kb) genes involved in tissue repair and regeneration, tumor suppression, cell proliferation, apoptosis, control of organ size, and immunity. Based on 85 significantly associated SNP in or near a collection of genes with diverse function on 28 chromosomes, we conclude that the genomic footprint of lung lesions is complex. A complex genomic

  5. Your Lung Operation: After Your Operation

    Medline Plus

    Full Text Available ... About the ACS Catalog Find a Product Contribute Education Journal of the American College of Surgeons About JACS ... News Stay Up to Date with ACS Association ... ( 0 ) Items American College of Surgeons Education Patients and Family Skills Programs Your Lung Operation ...

  6. Ishwar Puri elected a Fellow of the American Association for the Advancement of Science

    OpenAIRE

    Crumbley, Liz

    2005-01-01

    The American Association for the Advancement of Science (AAAS) has awarded the distinction of Fellow to Ishwar Puri, head of the Department of Engineering Science and Mechanics in the Virginia Tech College of Engineering.

  7. Equine dental seminar hosted by the American Association of Equine Practitioners

    OpenAIRE

    Douglas, Jeffrey S.

    2005-01-01

    The student chapter of the American Association of Equine Practitioners at the Virginia-Maryland Regional College of Veterinary Medicine recently presented an equine dental seminar for about 60 registrants.

  8. Changes in the lung microbiome following lung transplantation include the emergence of two distinct Pseudomonas species with distinct clinical associations.

    Directory of Open Access Journals (Sweden)

    Robert P Dickson

    Full Text Available BACKGROUND: Multiple independent culture-based studies have identified the presence of Pseudomonas aeruginosa in respiratory samples as a positive risk factor for bronchiolitis obliterans syndrome (BOS. Yet, culture-independent microbiological techniques have identified a negative association between Pseudomonas species and BOS. Our objective was to investigate whether there may be a unifying explanation for these apparently dichotomous results. METHODS: We performed bronchoscopies with bronchoalveolar lavage (BAL on lung transplant recipients (46 procedures in 33 patients and 26 non-transplant control subjects. We analyzed bacterial communities in the BAL fluid using qPCR and pyrosequencing of 16S rRNA gene amplicons and compared the culture-independent data with the clinical metadata and culture results from these subjects. FINDINGS: Route of bronchoscopy (via nose or via mouth was not associated with changes in BAL microbiota (p = 0.90. Among the subjects with positive Pseudomonas bacterial culture, P. aeruginosa was also identified by culture-independent methods. In contrast, a distinct Pseudomonas species, P. fluorescens, was often identified in asymptomatic transplant subjects by pyrosequencing but not detected via standard bacterial culture. The subject populations harboring these two distinct pseudomonads differed significantly with respect to associated symptoms, BAL neutrophilia, bacterial DNA burden and microbial diversity. Despite notable differences in culturability, a global database search of UM Hospital Clinical Microbiology Laboratory records indicated that P. fluorescens is commonly isolated from respiratory specimens. INTERPRETATION: We have reported for the first time that two prominent and distinct Pseudomonas species (P. fluorescens and P. aeruginosa exist within the post-transplant lung microbiome, each with unique genomic and microbiologic features and widely divergent clinical associations, including presence during

  9. The Association Between Alcohol Consumption and Lung Carcinoma by Histological Subtype.

    Science.gov (United States)

    Troche, Jose Ramon; Mayne, Susan T; Freedman, Neal D; Shebl, Fatma M; Abnet, Christian C

    2016-01-15

    Alcohol is a carcinogen suspected of increasing lung cancer risk. Therefore, we prospectively evaluated the relationship between alcohol consumption and lung carcinoma in 492,902 persons from the National Institutes of Health-AARP Diet and Health Study. We used Cox models to calculate hazard ratios and 95% confidence intervals, adjusting for tobacco smoking and other potential confounders. Between 1995/1996 and December 31, 2006, there were 10,227 incident cases of lung carcinoma, classified as adenocarcinoma (n = 4,036), squamous cell carcinoma (n = 1,998), small cell carcinoma (n = 1,524), undifferentiated carcinoma (n = 559), and other (n = 2,110). Compared with nondrinking, alcohol consumption was associated with a modest nonlinear reduction in total lung carcinoma risk at lower levels of consumption (for 0.5-drink/day, HR = 0.89, 95% confidence interval: 0.82, 0.96) but a modest increase in risk in the highest category (for ≥7 drinks/day, HR = 1.11, 95% confidence interval: 1.00, 1.24). Regarding histological type, alcohol was associated with a nonlinear reduction in squamous cell carcinoma that became attenuated as consumption increased and a modest increase in adenocarcinoma among heavier drinkers. Cubic spline models confirmed these findings. Our data suggest that the relationship between alcohol consumption and lung carcinoma differs by histological subtype. PMID:26672017

  10. Physical activity is not associated with spirometric indices in lung-healthy German youth.

    Science.gov (United States)

    Smith, Maia P; von Berg, Andrea; Berdel, Dietrich; Bauer, Carl-Peter; Hoffmann, Barbara; Koletzko, Sibylle; Nowak, Dennis; Heinrich, Joachim; Schulz, Holger

    2016-08-01

    In lung disease, physical activity improves lung function and reduces morbidity. However, healthy populations are not well studied. We estimate the relationship between spirometric indices and accelerometric physical activity in lung-healthy adolescents.895 nonsmoking German adolescents without chronic lung disease (45% male, mean±sd age 15.2±0.26 years) from the GINIplus and LISAplus cohorts completed questionnaires, spirometry, 7-day accelerometry and an activity diary. Physical activity was measured as minutes, quintiles and regularity of daily moderate, vigorous and moderate-to-vigorous physical activity (MVPA), participation in sport and active commuting to school. Primary outcomes were forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), FEV1/FVC and forced expiratory flow at 25-75% of FVC; they were separately correlated with physical activity and adjusted for confounders of respiratory function, including early-life exposures.Adolescents averaged 40 min MVPA per day, typical for European youth. 79% participated in sports and 51% commuted actively. An association was suggested between 3% higher FVC (∼100 mL) and either extreme MVPA quintile or percentage of days with >30 min MVPA (plifestyle and physical activity were nonsignificant.Spirometric indices were not significantly associated with active lifestyle or measures of activity in lung-healthy adolescents after adjustment for confounding and multiple-comparison artefacts. PMID:27009173

  11. Proteomic Analysis of Cytokeratin Isoforms Uncovers Association with Survival in Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Tarek G. Gharib

    2002-01-01

    Full Text Available Cytokeratins. (CK are intermediate filaments whose expression is often altered in epithelial cancer. Systematic identification of lung adenocarcinoma proteins using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry has uncovered numerous CK isoforms. In this study, 93 lung adenocarcinomas. (64 stage I and 29 stage III and 10 uninvolved lung samples were quantitatively examined for protein expression. Fourteen of 21 isoforms of CK 7, 8, 18, 19 occurred at significantly higher levels. (P<.05 in tumors compared to uninvolved adjacent tissue. Specific isoforms of the four types of CK identified correlated with either clinical outcome or individual clinical-pathological parameters. All five of the CK7 isoforms associated with patient survival represented cleavage products. Two of five CK7 isoforms. (nos. 2165 and 2091, one of eight CK8 isoforms. (no. 439, one of three CK19 isoforms. (no. 1955 were associated with survival and significantly correlated to their mRNA levels, suggesting that transcription underlies overexpression of these CK isoforms. Our data indicate substantial heterogeneity among CK in lung adenocarcinomas resulting from posttranslational modifications, some of which correlated with patient survival and other clinical parameters. Therefore, specific isoforms of individual CK may have utility as diagnostic or predictive markers in lung adenocarcinomas.

  12. Physical Performance Is Associated with Executive Functioning in Older African American Women

    OpenAIRE

    Schneider, Brooke C.; Lichtenberg, Peter A.

    2011-01-01

    An older adult's ability to perform physical tasks is predictive of disability onset and is associated with declines in cognition. Risk factors for physical performance declines among African Americans, a group with the highest rates of disability, remain understudied. This study sought to identify demographic, health, and cognitive factors associated with lower-extremity physical performance in a sample of 106 African American women ages 56 to 91. After controlling for global cognitive funct...

  13. Association Between Asthma and Obesity Among Immigrant Asian Americans, California Health Interview Survey, 2001–2011

    OpenAIRE

    Benjamin J. Becerra; Scroggins, Christy M.; Monideepa B. Becerra

    2014-01-01

    Our objective was to study the comorbidity of asthma and obesity among foreign-born Asian Americans, by subgroups. Public data from the California Health Interview Survey, 2001–2011, were analyzed by using independent logistic regressions, yielding the association between asthma and obesity (Asian and standard cutoffs for body mass index [BMIs]) of 19,841 Asian American immigrant respondents. Chinese, Filipino, South Asian, and Japanese immigrants had a positive association between lifetime a...

  14. No association between vitamin D and atopy, asthma, lung function or atopic dermatitis

    DEFF Research Database (Denmark)

    Thuesen, B H; Heede, N G; Tang, L; Skaaby, T; Thyssen, J P; Friedrich, N; Linneberg, A

    2015-01-01

    Studies suggest that vitamin D may be involved in the pathogenesis of allergic disorders, asthma and decreased lung function. However, results are inconsistent and only few prospective studies have examined adults. The purpose of this study was to investigate the association of serum 25-hydroxy v...

  15. Clinical analysis of 64 patients with lung-cancer-associated hypercalcemia

    Directory of Open Access Journals (Sweden)

    Xu Li

    2015-01-01

    Conclusions: Patients with Stage IV lung-cancer-associated moderate and severe hypercalcemia exhibited shorter survival time and poor prognosis. After correction, moderate and severe elevations of hypercalcemia and abnormal elevation of alkaline phosphatase levels were shown to be significant factors shortening patients' survival time.

  16. Reduced lung function is independently associated with increased risk of type 2 diabetes in Korean men

    Directory of Open Access Journals (Sweden)

    Kwon Chang-Hee

    2012-04-01

    Full Text Available Abstract Background Reduced lung function is associated with incident insulin resistance and diabetes. The aim of this study was to assess the relationship between lung function and incident type 2 diabetes in Korean men. Methods This study included 9,220 men (mean age: 41.4 years without type 2 diabetes at baseline who were followed for five years. Subjects were divided into four groups according to baseline forced vital capacity (FVC (% predicted and forced expiratory volume in one second (FEV1 (% predicted quartiles. The incidence of type 2 diabetes at follow-up was compared according to FVC and FEV1 quartiles. Results The overall incidence of type 2 diabetes was 2.2%. Reduced lung function was significantly associated with the incidence of type 2 diabetes after adjusting for age, BMI, education, smoking, exercise, alcohol, and HOMA-IR. Both FVC and FEV1 were negatively associated with type 2 diabetes (P 1 had a significantly higher odds ratio for type 2 diabetes compared with the highest quartile after adjusting for age and BMI (2.15 [95% CI 1.02-4.57] and 2.19 [95% CI 1.09-4.42]. Conclusions Reduced lung function is independently associated with the incidence of type 2 diabetes in Korean men.

  17. Computed tomography of granulomatous pneumonia with oxalosis in an American alligator (Alligator mississippiensis) associated with Metarhizium anisopliae var anisopliae.

    Science.gov (United States)

    Hall, Natalie H; Conley, Kenneth; Berry, Clifford; Farina, Lisa; Sigler, Lynne; Wellehan, James F X; Roehrl, Michael H A; Heard, Darryl

    2011-12-01

    An 18-yr-old, male, albino, American alligator (Alligator mississippiensis) was evaluated for decreased appetite and abnormal buoyancy. Computed tomography (CT) of the coelomic cavity showed multifocal mineral and soft tissue attenuating pulmonary masses consistent with pulmonary fungal granulomas. Additionally, multifocal areas of generalized, severe emphysema and pulmonary and pleural thickening were identified. The alligator was euthanized and necropsy revealed severe fungal pneumonia associated with oxalosis. Metarhizium anisopliae var. anisopliae was cultured from lung tissue and exhibited oxalate crystal formation in vitro. Crystals were identified as calcium oxalate monohydrate by X-ray powder defractometry. Fungal identification was based on morphology, including tissue sporulation, and DNA sequence analysis. This organism is typically thought of as an entomopathogen. Clinical signs of fungal pneumonia in nonavian reptiles are often inapparent until the disease is at an advanced stage, making antemortem diagnosis challenging. This case demonstrates the value of CT for pulmonary assessment and diagnosis of fungal pneumonia in the American alligator. Fungal infection with associated oxalosis should not be presumed to be aspergillosis. PMID:22204066

  18. Lung

    International Nuclear Information System (INIS)

    At present no simple statement can be made relative to the role of radionuclidic lung studies in the pediatric population. It is safe to assume that they will be used with increasing frequency for research and clinical applications because of their sensitivity and ready applicability to the pediatric patient. Methods comparable to those used in adults can be used in children older than 4 years. In younger children, however, a single injection of 133Xe in solution provides an index of both regional perfusion and ventilation which is easier to accomplish. This method is particularly valuable in infants and neonates because it is rapid, requires no patient cooperation, results in a very low radiation dose, and can be repeated in serial studies. Radionuclidic studies of ventilation and perfusion can be performed in almost all children if the pediatrician and the nuclear medicine specialist have motivation and ingenuity. S

  19. Association between brain metastasis from lung cancer and the serum level of myelin basic protein

    OpenAIRE

    Liu, Wei; Zhao, Jing; WEI, YUJUAN

    2015-01-01

    The aim of the present study was to determine the association between the expression of myelin basic protein in the serum and the metastasis of lung cancer to the brain. A total of 68 lung cancer patients, treated in the Department of Respiratory Medicine of the People’s Hospital of Rizhao (Rizhao, China), were divided into two groups, those with brain metastasis (32 cases) and those without brain metastasis (36 cases). The expression levels of myelin basic protein were measured for all the p...

  20. EGFR mutations in patients with brain metastases from lung cancer: Association with the efficacy of gefitinib

    OpenAIRE

    Shimato, Shinji; Mitsudomi, Tetsuya; Kosaka, Takayuki; Yatabe, Yasushi; Wakabayashi, Toshihiko; Mizuno, Masaaki; NAKAHARA, NORIMOTO; Hatano, Hisashi; Natsume, Atsushi; Ishii, Dai; YOSHIDA, Jun

    2006-01-01

    Gefitinib—a specific inhibitor of epidermal growth factor receptor (EGFR)-associated tyrosine kinase—has demonstrated efficacy in a subgroup of patients with non-small-cell lung carcinoma (NSCLC) who fail conventional chemotherapy. It is also reported to have an antitumor effect in brain metastases from NSCLC. Additionally, EGFR mutations have shown a strong association with gefitinib sensitivity for NSCLC. Here, we assessed the efficacy of gefitinib in brain metastases from NSCLC and evaluat...

  1. Matrix-Gla protein promotes osteosarcoma lung metastasis and associates with poor prognosis.

    Science.gov (United States)

    Zandueta, Carolina; Ormazábal, Cristina; Perurena, Naiara; Martínez-Canarias, Susana; Zalacaín, Marta; Julián, Mikel San; Grigoriadis, Agamemnon E; Valencia, Karmele; Campos-Laborie, Francisco J; Rivas, Javier De Las; Vicent, Silvestre; Patiño-García, Ana; Lecanda, Fernando

    2016-08-01

    Osteosarcoma (OS) is the most prevalent osseous tumour in children and adolescents and, within this, lung metastases remain one of the factors associated with a dismal prognosis. At present, the genetic determinants driving pulmonary metastasis are poorly understood. We adopted a novel strategy using robust filtering analysis of transcriptomic profiling in tumour osteoblastic cell populations derived from human chemo-naive primary tumours displaying extreme phenotypes (indolent versus metastatic) to uncover predictors associated with metastasis and poor survival. We identified MGP, encoding matrix-Gla protein (MGP), a non-collagenous matrix protein previously associated with the inhibition of arterial calcification. Using different orthotopic models, we found that ectopic expression of Mgp in murine and human OS cells led to a marked increase in lung metastasis. This effect was independent of the carboxylation of glutamic acid residues required for its physiological role. Abrogation of Mgp prevented lung metastatic activity, an effect that was rescued by forced expression. Mgp levels dramatically altered endothelial adhesion, trans-endothelial migration in vitro and tumour cell extravasation ability in vivo. Furthermore, Mgp modulated metalloproteinase activities and TGFβ-induced Smad2/3 phosphorylation. In the clinical setting, OS patients who developed lung metastases had high serum levels of MGP at diagnosis. Thus, MGP represents a novel adverse prognostic factor and a potential therapeutic target in OS. Microarray datasets may be found at: http://bioinfow.dep.usal.es/osteosarcoma/ Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:27172275

  2. Carcinosarcoma of the Lung Associated with Neurofibromatosis Type 1: A Case Re

    Directory of Open Access Journals (Sweden)

    Rana ÇİTİL

    2012-01-01

    Full Text Available Neurofibromatosis or von Recklinghausen's disease is the most common inherited syndrome predisposing to neoplasia. Carcinosarcoma is a rare malignant mixed tumor of the lung. Association of carcinosarcoma of lung with Neurofibromatosis-1 is not common. A 57-year-old man presented with history of fever, cough, hemoptysis, breathlessness, weight loss, chest pain. Multiple cutaneous neurofibromas and café au lait spots were revealed by physical examination. A homogeneous opacity was found in the right middle and right upper zone on posterior-anterior chest radiography. A 8x8x7 cm mass that had irregular borders in right upper posterior and apical segment was seen on contrast enhanced chest computed tomography. On bronchoscopy, the lumen of right upper apical segment was obstructed with vegetating tumoral lesion. The biopsy taken from this region was diagnosed as carcinosarcoma by histopathological and immunohistochemical examination.A rare case with carcinosarcoma of the lung and Neurofibromatosis-1 was reported.

  3. Position of the American Dietetic Association, School Nutrition Association, and Society for Nutrition Education: Comprehensive School Nutrition Services

    Science.gov (United States)

    Briggs, Marilyn; Mueller, Constance G.; Fleischhacker, Sheila

    2010-01-01

    It is the position of the American Dietetic Association (ADA), School Nutrition Association (SNA), and Society for Nutrition Education (SNE) that comprehensive, integrated nutrition services in schools, kindergarten through grade 12, are an essential component of coordinated school health programs and will improve the nutritional status, health,…

  4. Hyperthyroidism and Other Causes of Thyrotoxicosis: Management Guidelines of the American Thyroid Association and American Association of Clinical Endocrinologists

    Directory of Open Access Journals (Sweden)

    V V Fadeyev

    2011-12-01

    Full Text Available В конце весны 2011 г. вышли новые рекомендации Американской тиреоидной ассоциации и Американской ассоциации клинических эндокринологов по диагностике и лечению тиреотоксикоза. Они озаглавлены “Гипертиреоз и другие причины тиреотоксикоза”. Bahn R.S., Burch H.B., Cooper D.S., Garber J.R., Greenlee M.C., Klein I., Laurberg P., McDougall I.R., Montori V.M., Rivkees S.A., Ross D.S., Sosa J.A., Stan M.N. Hyperthyroidism and Other Causes of Thyrotoxicosis: Management Guidelines of the American Thyroid Association and American Association of Clinical Endocrinologists. Thyroid. 2011:21. Рекомендации представляют собой достаточно большой документ, изданный на 54 журнальных страницах. Важно отметить, что в его создании участвовали не только американские, но и европейские эксперты, т.е. представленные рекомендации не узкоспецифичны для США, где, как известно, есть свои особенности организации медицинской помощи. В документе сформулировано собственно 100 пунктов рекомендаций, каждому из которых представлен уровень силы рекомендации и уровень доказательности. Большая же часть объема документа представлена обсуждением и аргументацией,на основании которой были сформулированы 100 рекомендаций. В этой статье хотелось бы

  5. Novel variation at chr11p13 associated with cystic fibrosis lung disease severity

    Science.gov (United States)

    Dang, Hong; Gallins, Paul J; Pace, Rhonda G; Guo, Xue-liang; Stonebraker, Jaclyn R; Corvol, Harriet; Cutting, Garry R; Drumm, Mitchell L; Strug, Lisa J; Knowles, Michael R; O’Neal, Wanda K

    2016-01-01

    Published genome-wide association studies (GWASs) identified an intergenic region with regulatory features on chr11p13 associated with cystic fibrosis (CF) lung disease severity. Targeted resequencing in n=377, followed by imputation to n=6,365 CF subjects, was used to identify unrecognized genetic variants (including indels and microsatellite repeats) associated with phenotype. Highly significant associations were in strong linkage disequilibrium and were seen only in Phe508del homozygous CF subjects, indicating a CFTR genotype-specific mechanism. PMID:27408752

  6. Timing and tempo: Exploring the complex association between pubertal development and depression in African American and European American girls.

    Science.gov (United States)

    Keenan, Kate; Culbert, Kristen M; Grimm, Kevin J; Hipwell, Alison E; Stepp, Stephanie D

    2014-11-01

    The relative contribution of pubertal timing and tempo to the development of depression has not been tested in a large, representative sample, nor has the interface among pubertal maturation, depression, and race been tested. Participants were a community-based sample of 2,450 girls from the Pittsburgh Girls Study who were interviewed annually from ages 9 to 17 years. Pubertal timing and tempo were characterized as a unitary construct and also separately for pubic hair and breast development using child and maternal report. Depression symptoms were assessed annually. African American girls had higher depression symptoms and progressed through puberty earlier, but at a slower tempo than European American girls. Girls with earlier timing had higher levels of depression symptoms at age 10 years. Slower tempo was associated with higher depression symptoms at age 10, and faster tempo was associated with increases in depression from ages 10 to 13. As well, race moderated the associations among timing, tempo, and depression symptoms, and the association between race and depression was partially mediated by pubertal timing and tempo. Pubertal timing and tempo and race contribute to the developmental course of depression from early to late adolescence. The pattern of association varies as a function of the developmental window within which depression is assessed. Thus, repeated measures of depression symptoms and puberty across the span of pubertal development are necessary for exploring the relative importance of dimensions of pubertal development to depression etiology. PMID:25314262

  7. Bronchial anthracofibrosis with interstitial lung disease: an association yet to be highlighted.

    Science.gov (United States)

    Kunal, Shekhar; Pilaniya, Vikas; Shah, Ashok

    2016-01-01

    Bronchial anthracofibrosis (BAF), an emerging pulmonary disease due to long-standing exposure to biomass fuel smoke, is predominantly seen in females from developing nations. BAF is known to be associated with tuberculosis, pneumonia, chronic obstructive pulmonary disease and lung cancer, but the association of BAF with interstitial lung disease (ILD) is rare and yet to be highlighted. A 72-year-old woman with a 30-year history of exposure to biomass fuel smoke presented with dry cough and exertional dyspnoea. Imaging demonstrated interlobular, intralobular and peribronchovascular interstitial thickening and honeycombing adjoining the subpleural regions, suggestive of the usual interstitial pneumonia pattern. A restrictive pattern with diffusion defect was noted. Fibrebronchoscopy revealed a bluish-black anthracotic pigmentation with a narrowed and distorted left upper lobe, and apical segment of left lower lobe bronchus, confirming BAF. A diagnosis of BAF with ILD was made. To the best of our knowledge, this is the first detailed description of this association. PMID:26759407

  8. Workplace wellness recognition for optimizing workplace health: a presidential advisory from the American Heart Association.

    Science.gov (United States)

    Fonarow, Gregg C; Calitz, Chris; Arena, Ross; Baase, Catherine; Isaac, Fikry W; Lloyd-Jones, Donald; Peterson, Eric D; Pronk, Nico; Sanchez, Eduardo; Terry, Paul E; Volpp, Kevin G; Antman, Elliott M

    2015-05-19

    The workplace is an important setting for promoting cardiovascular health and cardiovascular disease and stroke prevention in the United States. Well-designed, comprehensive workplace wellness programs have the potential to improve cardiovascular health and to reduce mortality, morbidity, and disability resulting from cardiovascular disease and stroke. Nevertheless, widespread implementation of comprehensive workplace wellness programs is lacking, and program composition and quality vary. Several organizations provide worksite wellness recognition programs; however, there is variation in recognition criteria, and they do not specifically focus on cardiovascular disease and stroke prevention. Although there is limited evidence to suggest that company performance on employer health management scorecards is associated with favorable healthcare cost trends, these data are not currently robust, and further evaluation is needed. As a recognized national leader in evidence-based guidelines, care systems, and quality programs, the American Heart Association/American Stroke Association is uniquely positioned and committed to promoting the adoption of comprehensive workplace wellness programs, as well as improving program quality and workforce health outcomes. As part of its commitment to improve the cardiovascular health of all Americans, the American Heart Association/American Stroke Association will promote science-based best practices for comprehensive workplace wellness programs and establish benchmarks for a national workplace wellness recognition program to assist employers in applying the best systems and strategies for optimal programming. The recognition program will integrate identification of a workplace culture of health and achievement of rigorous standards for cardiovascular health based on Life's Simple 7 metrics. In addition, the American Heart Association/American Stroke Association will develop resources that assist employers in meeting these rigorous

  9. Spectrum of fibrosing diffuse parenchymal lung disease.

    Science.gov (United States)

    Morgenthau, Adam S; Padilla, Maria L

    2009-02-01

    The interstitial lung diseases are a heterogeneous group of disorders characterized by inflammation and/or fibrosis of the pulmonary interstitium. In 2002, the American Thoracic Society and the European Respiratory Society revised the classification of interstitial lung diseases and introduced the term diffuse parenchymal lung disease. The idiopathic interstitial pneumonias are a subtype of diffuse parenchymal lung disease. The idiopathic interstitial pneumonias are subdivided into usual interstitial pneumonia (with its clinical counterpart idiopathic interstitial pneumonia), nonspecific interstitial pneumonia, cryptogenic organizing pneumonia, acute interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis interstitial lung disease, and lymphocytic pneumonia. Sarcoidosis and hypersensitivity pneumonitis are the 2 most common granulomatous diffuse parenchymal lung diseases. Rheumatoid arthritis, systemic sclerosis, and dermatomyositis/polymyositis (causing antisynthetase syndrome) are diffuse parenchymal lung diseases of known association because these conditions are associated with connective tissue disease. Hermansky-Pudlak syndrome is a rare genetic diffuse parenchymal lung disease characterized by the clinical triad of pulmonary disease, oculocutaneous albinism, and bleeding diathesis. This review provides an overview of the chronic fibrosing diffuse parenchymal lung diseases. Its primary objective is to illuminate the clinical challenges encountered by clinicians who manage the diffuse parenchymal lung diseases regularly and to offer potential solutions to those challenges. Treatment for the diffuse parenchymal lung diseases is limited, and for many patients with end-stage disease, lung transplantation remains the best option. Although much has been learned about the diffuse parenchymal lung diseases during the past decade, research in these diseases is urgently needed. PMID:19170214

  10. HPV Literacy and Associated Factors Among Hmong American Immigrants: Implications for Reducing Cervical Cancer Disparity.

    Science.gov (United States)

    Beltran, Raiza; Simms, Tina; Lee, Hee Yun; Kwon, Melissa

    2016-06-01

    Previous studies show that certain minority and ethnic communities experience low human papillomavirus (HPV) vaccination rates despite a higher cervical cancer burden. HPV is known to be responsible for almost all cervical cancer cases. Hmong Americans, a growing Asian American population, appear to be at increased risk. The cervical cancer incidence rate among Hmong American women is three times higher than other Asian/Pacific Islanders and more than four times higher than Non-Hispanic Whites. Despite such alarming statistics, there is limited research focusing on HPV literacy and its associated factors in the Hmong American community. This study's objectives are to investigate: (1) the level of HPV knowledge among Hmong Americans; (2) HPV vaccination initiation and completion rates of Hmong Americans; and (3) factors associated with HPV literacy in the Hmong American community. Andersen's Behavioral Model of Health Services Use was used as the study's theoretical framework. A self-administered paper and online health survey was completed by192 Hmong Americans living in a major metropolitan area in Minnesota. Results revealed a mean score of 4.76 (SD 1.67) for the 7-item questionnaire measuring HPV knowledge. The HPV vaccination initiation rate was 46.3 % (n = 56), with 32.7 % completing the recommended three doses. Multiple regression analysis found that participants' level of education, number of doctor visits, and cervical cancer screening literacy were significantly associated with HPV knowledge. This study's results indicate the important role of health providers in educating Hmong Americans patients about HPV and cervical cancer prevention to decrease the cervical cancer burden in this high-risk population. PMID:26696118

  11. Tumor-associated neutrophils stimulate T cell responses in early-stage human lung cancer

    Science.gov (United States)

    Eruslanov, Evgeniy B.; Bhojnagarwala, Pratik S.; Quatromoni, Jon G.; Stephen, Tom Li; Ranganathan, Anjana; Deshpande, Charuhas; Akimova, Tatiana; Vachani, Anil; Litzky, Leslie; Hancock, Wayne W.; Conejo-Garcia, José R.; Feldman, Michael; Albelda, Steven M.; Singhal, Sunil

    2014-01-01

    Infiltrating inflammatory cells are highly prevalent within the tumor microenvironment and mediate many processes associated with tumor progression; however, the contribution of specific populations remains unclear. For example, the nature and function of tumor-associated neutrophils (TANs) in the cancer microenvironment is largely unknown. The goal of this study was to provide a phenotypic and functional characterization of TANs in surgically resected lung cancer patients. We found that TANs constituted 5%–25% of cells isolated from the digested human lung tumors. Compared with blood neutrophils, TANs displayed an activated phenotype (CD62LloCD54hi) with a distinct repertoire of chemokine receptors that included CCR5, CCR7, CXCR3, and CXCR4. TANs produced substantial quantities of the proinflammatory factors MCP-1, IL-8, MIP-1α, and IL-6, as well as the antiinflammatory IL-1R antagonist. Functionally, both TANs and neutrophils isolated from distant nonmalignant lung tissue were able to stimulate T cell proliferation and IFN-γ release. Cross-talk between TANs and activated T cells led to substantial upregulation of CD54, CD86, OX40L, and 4-1BBL costimulatory molecules on the neutrophil surface, which bolstered T cell proliferation in a positive-feedback loop. Together our results demonstrate that in the earliest stages of lung cancer, TANs are not immunosuppressive, but rather stimulate T cell responses. PMID:25384214

  12. Polymorphic allele of human IRGM1 is associated with susceptibility to tuberculosis in African Americans.

    Directory of Open Access Journals (Sweden)

    Katherine Y King

    Full Text Available An ancestral polymorphic allele of the human autophagy-related gene IRGM1 is associated with altered gene expression and a genetic risk for Crohn's Disease (CD. We used the single nucleotide polymorphism rs10065172C/T as a marker of this polymorphic allele and genotyped 370 African American and 177 Caucasian tuberculosis (TB cases and 180 African American and 110 Caucasian controls. Among African Americans, the TB cases were more likely to carry the CD-related T allele of rs10065172 (odds ratio of 1.54; 95% confidence interval, 1.17-2.02; P<0.01 compared to controls. Our finding suggests that this CD-related IRGM1 polymorphic allele is also associated with human susceptibility to TB disease among African Americans.

  13. Systemic inflammation in young adults is associated with abnormal lung function in middle age.

    Directory of Open Access Journals (Sweden)

    Ravi Kalhan

    Full Text Available BACKGROUND: Systemic inflammation is associated with reduced lung function in both healthy individuals and those with chronic obstructive pulmonary disease (COPD. Whether systemic inflammation in healthy young adults is associated with future impairment in lung health is uncertain. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the association between plasma fibrinogen and C-reactive protein (CRP in young adults and lung function in the Coronary Artery Risk Development in Young Adults cohort study. Higher year 7 fibrinogen was associated with greater loss of forced vital capacity (FVC between years 5 and 20 (439 mL in quartile 4 vs. 398 mL in quartile 1, P<0.001 and forced expiratory volume in 1 second (FEV(1 (487 mL in quartile 4 vs. 446 mL in quartile 1, P<0.001 independent of cigarette smoking, body habitus, baseline lung function and demographic factors. Higher year 7 CRP was also associated with both greater loss of FVC (455 mL in quartile 4 vs. 390 mL in quartile 1, P<0.001 and FEV(1 (491 mL in quartile 4 vs. 442 mL in quartile 1, P = 0.001. Higher year 7 fibrinogen and CRP were associated with abnormal FVC at year 20 (odds ratio (OR per standard deviation 1.51 (95% confidence interval (CI: 1.30-1.75 for fibrinogen and 1.35 (95% CI: 1.14-1.59 for CRP. Higher year 5 fibrinogen was additionally associated with abnormal FEV(1. A positive interaction was observed between pack-years cigarette smoking and year 7 CRP for the COPD endpoint, and among participants with greater than 10 pack-years of cigarette exposure, year 7 CRP was associated with greater odds of COPD at year 20 (OR per standard deviation 1.53 (95% CI: 1.08-2.16. CONCLUSION/SIGNIFICANCE: Systemic inflammation in young adults is associated with abnormal lung function in middle age. In particular, elevated CRP may identify vulnerability to COPD among individuals who smoke. TRIAL REGISTRATION: ClinicalTrials.gov NCT00005130.

  14. The associations of perceived neighborhood disorder and physical activity with obesity among African American adolescents

    OpenAIRE

    Dulin-Keita, Akilah; Kaur Thind, Herpreet; Affuso, Olivia; Baskin, Monica L.

    2013-01-01

    Background According to recent research studies, the built and socioeconomic contexts of neighborhoods are associated with African American adolescents’ participation in physical activity and obesity status. However, few research efforts have been devoted to understand how African American adolescents’ perceptions of their neighborhood environments may affect physical activity behaviors and obesity status. The objective of the current study was to use a perceived neighborhood disorder concept...

  15. Efficacy of immunosoppressive therapy and steroid sparing effect in interstitial lung disease associated to antisynthetase syndrome

    Directory of Open Access Journals (Sweden)

    G. De Marchi

    2011-09-01

    Full Text Available Objective: To evaluate the role of bronchoalveolar lavage (BAL in patients with interstitial lung disease associated to antisynthetase syndrome. Methods: We describe 5 patients, anti-Jo1 positive, with interstitial lung disease (lung fibrosis and/or diffusion capacity of CO <80%. Patients were monitored with lung function tests every 6 months, with high-resolution computed tomography (HRCT every 12 months, and with bronchoalveolar lavage (BAL at baseline and in the subsequent follow-up. Patients were treated as follows: a azathioprine with colchicine, or cyclosporine alone b cyclophosphamide when high neutrophil or eosinophil count on BAL was observed. Only low-dose steroids were used for mild muscular or articular involvement. Results: Pulmonary involvement remained stable in all patients at months +24. Lung function remained unchanged compared to the baseline evaluation; HRCT was stable in patients with fibrosis and no progression into fibrosis was observed in patients with ground glass areas at baseline. Bacterial pneumonia occurred in one patient treated with cyclophosphamide and resolved after antibiotic therapy. Conclusions: Clinical manifestations, instrumental tests and BAL may be of value to choice the best immunosuppressive therapy in the single case. An early less aggressive approach (azathioprine with colchicine, or cyclosporine alone may be useful. BAL could be performed when a progression of the lung involvement is demonstrated in the subsequent follow-up. Cyclophosphamide may be a valid alternative treatment in the presence of a neutrophilic or eosinophilic alveolitis. Efficacy and safety of the aforementioned immunosuppressive approach were observed in our series, avoiding prolonged high-dose steroid administration.

  16. Lung cancer stage at diagnosis: Individual associations in the prospective VITamins and lifestyle (VITAL cohort

    Directory of Open Access Journals (Sweden)

    Au David H

    2011-06-01

    Full Text Available Abstract Background Lung cancer is the leading cause of cancer death in the United States. Identifying factors associated with stage of diagnosis can improve our understanding of biologic and behavioral pathways of lung cancer development and detection. We used data from a prospective cohort study to evaluate associations of demographic, health history, and health behaviors with early versus late stage at diagnosis of non-small cell lung cancer (NSCLC. Methods We calculated odds ratios (ORs for the association of patient-level characteristics with advanced stage of diagnosis for NSCLC. The OR's were then adjusted for age, gender, race/ethnicity, smoking status, income, education, chronic obstructive pulmonary disease, and a comorbidity index. Results We identified 612 cases of NSCLC among 77,719 adults, aged 50 to 76 years from Washington State recruited in 2000-2002, with followup through December 2007. In univariate analyses, subjects who quit smoking Conclusions Smoking status, education, and a screening activity were associated with stage at diagnosis of NSCLC. These results may guide future studies of the underlying mechanisms that influence how NSCLC is detected and diagnosed.

  17. 77 FR 38378 - Hours of Service (HOS) of Drivers; Revision of Exemption; American Pyrotechnics Association (APA)

    Science.gov (United States)

    2012-06-27

    ... carriers and added 9 new APA-member carriers (76 FR 37876 and 76 FR 37880, June 28, 2011) for their... published on June 28, 2011 (76 FR 37876-37882). Issued on: June 21, 2012. Larry W. Minor, Associate... Exemption; American Pyrotechnics Association (APA) AGENCY: Federal Motor Carrier Safety...

  18. Valuation and the American Evaluation Association: Helping 100 Flowers Bloom, or at Least Be Understood?

    Science.gov (United States)

    Morris, Michael

    2012-01-01

    The author explores the challenges encountered when organizations attempt to facilitate evaluation and improvement through policy statements of professional associations. The American Evaluation Association (AEA) is used as an example. Various AEA statements are described as general and avoiding particular value preferences. The author concludes…

  19. 78 FR 17679 - Implementation of the Updated American Veterinary Medical Association Guidelines for the...

    Science.gov (United States)

    2013-03-22

    ... Association Guidelines for the Euthanasia of Animals: 2013 Edition SUMMARY: The National Institutes of Health... the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals: 2013... updated Guidelines. DATES: Public concerns regarding the updated AVMA Guidelines for the Euthanasia...

  20. Pulmonary Artery Agenesis Associated With Emphysema and Multiple Invasive Non-Small Cell Lung Cancers.

    Science.gov (United States)

    Makdisi, George; Edell, Eric S; Maleszewski, Joseph J; Molina, Julian R; Deschamps, Claude

    2015-06-01

    Pulmonary artery (PA) agenesis in the absence of associated cardiac abnormalities is a rare congenital abnormality. It may remain undiagnosed until adulthood when patients present with respiratory symptoms such as hemoptysis, dyspnea, repeated respiratory infections, or pulmonary hypertension. Herein we present a case of a 50-year-old woman who was found to have multiple, morphologically distinct non-small cell lung cancers in association with agenesis of the PA. This instance represents the fourth reported case of such association in the English literature. PMID:26046873

  1. Clinicopathological Characteristics and Prognosis of Non-Small Cell Lung Cancer Patients Associated with a Family History of Lung Cancer

    OpenAIRE

    Shuji Haraguchi, Kiyoshi Koizumi, Iwao Mikami, Okamoto Junichi, Yoshihito Iijima, Takayuki Ibi, Kazuo Shimizu

    2012-01-01

    Introduction: Clinicopathological characteristics and prognosis of non-small cell lung cancer (NSCLC) patients with a family history of lung cancer (FHLC) have not been well established.Methods: Clinical records of patients with NSCLC treated at our institute from 1982 to 2010 were reviewed with special reference to family history of lung cancer and clinicopathological factors including patient's outcome. Univariate analyses of the factors between the groups of FHLC and non-FHLC were performe...

  2. Clinicopathological Characteristics and Prognosis of Non-Small Cell Lung Cancer Patients Associated with a Family History of Lung Cancer

    OpenAIRE

    Haraguchi, Shuji; Koizumi, Kiyoshi; Mikami, Iwao; Junichi, Okamoto; Iijima, Yoshihito; Ibi, Takayuki; Shimizu, Kazuo

    2011-01-01

    Introduction: Clinicopathological characteristics and prognosis of non-small cell lung cancer (NSCLC) patients with a family history of lung cancer (FHLC) have not been well established. Methods: Clinical records of patients with NSCLC treated at our institute from 1982 to 2010 were reviewed with special reference to family history of lung cancer and clinicopathological factors including patient's outcome. Univariate analyses of the factors between the groups of FHLC and non-FHLC were perform...

  3. Genetic variants in chromatin-remodeling pathway associated with lung cancer risk in a Chinese population.

    Science.gov (United States)

    Geng, Liguo; Zhu, Meng; Wang, Yuzhuo; Cheng, Yang; Liu, Jia; Shen, Wei; Li, Zhihua; Zhang, Jiahui; Wang, Cheng; Jin, Guangfu; Ma, Hongxia; Shen, Hongbing; Hu, Zhibin; Dai, Juncheng

    2016-08-10

    Chromatin remodeling complexes utilize the energy of ATP hydrolysis to remodel nucleosomes and have essential roles in transcriptional modulation. Increasing evidences indicate that these complexes directly interact with numerous proteins and regulate the formation of cancer. However, few studies reported the association of polymorphisms in chromatin remodeling genes and lung cancer. We hypothesized that variants in critical genes of chromatin remodeling pathway might contribute to the susceptibility of lung cancer. To validate this hypothesis, we systematically screened 40 polymorphisms in six key chromatin remodeling genes (SMARCA5, SMARCC2, SMARCD2, ARID1A, NR3C1 and SATB1) and evaluated them with a case-control study including 1341 cases and 1982 controls. Logistic regression revealed that four variants in NR3C1 and SATB1 were significantly associated with lung cancer risk after false discovery rate (FDR) correction [For NR3C1, rs9324921: odds ratio (OR)=1.23, P for FDR=0.029; rs12521436: OR=0.85, P for FDR=0.040; rs4912913: OR=1.17, P for FDR=0.040; For SATB1, rs6808523: OR=1.33, P for FDR=0.040]. Combing analysis presented a significant allele-dosage tendency for the number of risk alleles and lung cancer risk (Ptrendlung tumor and adjacent normal tissues in the database of The Cancer Genome Atlas (TCGA) (P=0.009 for rs6808523). These findings suggested that genetic variants in key chromatin remodeling genes may contribute to lung cancer risk in Chinese population. Further large and well-designed studies are warranted to validate our results. PMID:27179949

  4. An examination of the association between demographic and educational factors and African American achievement in science

    Science.gov (United States)

    Cottledge, Michael Christopher

    Objective of the Study: The objective of this research study was to investigate whether an association exists between teacher demographic factors (years of teaching experience and gender), 2 educational factors (certification type and certification pathway) and the percent passing rate of tenth grade African American male students on the 2010 science TAKS. Answers to the following questions were sought: 1. Is there an association between teacher demographic factors and the percent passing rate of their tenth grade African American male students on the 2010 science TAKS? 2. Is there an association between teacher educational factors and the percent passing rate of their tenth grade African American male students on the 2010 science TAKS? 3. Is there an association between teacher demographic factors, educational factors and the percent passing rate of their tenth grade African American male students on the 2010 science TAKS? Status of the Question: According to the Bureau of Labor Statistics (BLS), science and engineering jobs in the U.S. have increased steadily over recent years and by the year 2016 the number of STEM (Science, Technology, Engineering and Math) jobs will have grown by more than 21 percent. This increase in science and engineering jobs will double the growth rate of all other workforce sectors combined. The BLS also reports that qualified minority applicants needed to fill these positions will be few and far between. African Americans, Latinos, and other minorities constitute 24 percent of the U.S. population but only 13 percent of college graduates and just 10 percent of people with college degrees who work in science and engineering (Education Trust, 2009). Drawing on the above information, I proposed the following hypotheses to the research questions: H01: There will be no significant statistical association between the demographic factors teacher gender and years of teaching experience and the percent passing rate of their tenth grade African

  5. Association between Image Characteristics on Chest CT and Severe Pleural Adhesion during Lung Cancer Surgery.

    Directory of Open Access Journals (Sweden)

    Kwang Nam Jin

    Full Text Available The aim of this study was to investigate the association between image characteristics on preoperative chest CT and severe pleural adhesion during surgery in lung cancer patients. We included consecutive 124 patients who underwent lung cancer surgeries. Preoperative chest CT was retrospectively reviewed to assess pleural thickening or calcification, pulmonary calcified nodules, active pulmonary inflammation, extent of emphysema, interstitial pneumonitis, and bronchiectasis in the operated thorax. The extent of pleural thickening or calcification was visually estimated and categorized into two groups: localized and diffuse. We measured total size of pulmonary calcified nodules. The extent of emphysema, interstitial pneumonitis, and bronchiectasis was also evaluated with a visual scoring system. The occurrence of severe pleural adhesion during lung cancer surgery was retrospectively investigated from the electrical medical records. We performed logistic regression analysis to determine the association of image characteristic on chest CT with severe pleural adhesion. Localized pleural thickening was found in 8 patients (6.5%, localized pleural calcification in 8 (6.5%, pulmonary calcified nodules in 28 (22.6%, and active pulmonary inflammation in 22 (17.7%. There was no patient with diffuse pleural thickening or calcification in this study. Trivial, mild, and moderate emphysema was found in 31 (25.0%, 21 (16.9%, and 12 (9.7% patients, respectively. Severe pleural adhesion was found in 31 (25.0% patients. The association of localized pleural thickening or calcification on CT with severe pleural adhesion was not found (P = 0.405 and 0.107, respectively. Size of pulmonary calcified nodules and extent of emphysema were significant variables in a univariate analysis (P = 0.045 and 0.005, respectively. In a multivariate analysis, moderate emphysema was significantly associated with severe pleural adhesion (odds ratio of 11.202, P = 0.001. In conclusion

  6. Acute pancreatitis in association with small cell lung carcinoma: potential pitfall in diagnosis and management.

    OpenAIRE

    Allan, S. G.; Bundred, N; Eremin, O; Leonard, R. C.

    1985-01-01

    Tumour metastases to the pancreas are a rare but recognized cause of acute pancreatitis, there is a 24-40% incidence of pancreatic involvement from small cell lung cancer in autopsy series but only a very few cases of tumour-induced acute pancreatitis have been described. Chemotherapy has been advocated as the primary therapy in patients with known oat cell carcinoma who develop acute pancreatitis. We describe 2 patients with acute haemorrhagic pancreatitis in association with disseminated sm...

  7. Association between MGMT Promoter Methylation and Non-Small Cell Lung Cancer: A Meta-Analysis

    OpenAIRE

    Changmei Gu; Jiachun Lu; Tianpen Cui; Cheng Lu; Hao Shi; Wenmao Xu; Xueli Yuan; Xiaobo Yang; Yangxin Huang; Meixia Lu

    2013-01-01

    BACKGROUND: O(6)-methylguanine-DNA methyltransferase (MGMT) is one of most important DNA repair enzyme against common carcinogens such as alkylate and tobacco. Aberrant promoter methylation of the gene is frequently observed in non-small cell lung cancer (NSCLC). However, the importance of epigenetic inactivation of the gene in NSCLC published in the literature showed inconsistence. We quantified the association between MGMT promoter methylation and NSCLC using a meta-analysis method. METHODS...

  8. Thoracic dust exposure is associated with lung function decline in cement production workers.

    Science.gov (United States)

    Nordby, Karl-Christian; Notø, Hilde; Eduard, Wijnand; Skogstad, Marit; Fell, Anne Kristin; Thomassen, Yngvar; Skare, Øivind; Bergamaschi, Antonio; Pietroiusti, Antonio; Abderhalden, Rolf; Kongerud, Johny; Kjuus, Helge

    2016-08-01

    We hypothesised that exposure to workplace aerosols may lead to lung function impairment among cement production workers.Our study included 4966 workers in 24 cement production plants. Based on 6111 thoracic aerosol samples and information from questionnaires we estimated arithmetic mean exposure levels by plant and job type. Dynamic lung volumes were assessed by repeated spirometry testing during a mean follow-up time of 3.5 years (range 0.7-4.6 years). The outcomes considered were yearly change of dynamic lung volumes divided by the standing height squared or percentage of predicted values. Statistical modelling was performed using mixed model regression. Individual exposure was classified into quintile levels limited at 0.09, 0.89, 1.56, 2.25, 3.36, and 14.6 mg·m(-3), using the lowest quintile as the reference. Employees that worked in administration were included as a second comparison group.Exposure was associated with a reduction in forced expiratory volume in 1 s (FEV1), forced expiratory volume in 6 s and forced vital capacity. For FEV1 % predicted a yearly excess decline of 0.84 percentage points was found in the highest exposure quintile compared with the lowest.Exposure at the higher levels found in this study may lead to a decline in dynamic lung volumes. Exposure reduction is therefore warranted. PMID:27103386

  9. Overexpression of Cathepsin L is associated with gefitinib resistance in non-small cell lung cancer.

    Science.gov (United States)

    Cui, F; Wang, W; Wu, D; He, X; Wu, J; Wang, M

    2016-07-01

    Lung cancer, the most common malignancy, is still the leading cause of cancer-related death worldwide. Non-small-cell lung cancer (NSCLC) accounts for 80 % of all lung cancers. Recent studies showed Cathepsin L (CTSL) is overexpressed in various cancerous tissues; however, the association between CTSL expression and EGFR-TKI resistance remains unknown. In this study, we investigated the expression of CTSL in lung cancer specimens and matched normal tissues by quantitative real-time PCR and IHC. The functional role of CTSL in resistant PC-9/GR cell line was investigated by proliferation and apoptosis analysis compared with control PC-9 cells. Our results found that the level of CTSL expression was higher in NSCLC tissues compared with matched normal adjacent tissue samples, and CTSL was more highly expressed in PC-9/GR cells compared to PC-9 cells. Knocking-down of CTSL in PC-9/GR cells could decrease cell proliferation and potentiate apoptosis induced by gefitinib, suggesting CTSL may contribute to gefitinib resistance in NSCLC. CTSL might be explored as a candidate of therapeutic target for modulating EGFR-TKI sensitivity in NSCLC. PMID:26474873

  10. Subpleural lung cysts in Down syndrome: prevalence and association with coexisting diagnoses

    International Nuclear Information System (INIS)

    Although subpleural cysts are known to be associated with Down syndrome, their etiology and prevalence remains unknown. To determine the prevalence of subpleural cysts in children with Down syndrome and the association with prematurity, congenital heart disease (CHD), extracorporeal membrane oxygenation (ECMO), and chronic ventilator support. A review of the CT examinations of 25 children with Down syndrome was performed to determine the presence, location, and distribution of cysts along with associated abnormalities. Charts were reviewed and coexistent diagnoses and past treatments were recorded. The prevalence of subpleural cysts was 36% with no significant association with CHD, ECMO, or chronic ventilator support. An association was found in the two children with a history of prematurity. The cysts were most commonly found in the anteromedial portion of the lung. Subpleural cysts are common in Down syndrome and should not be confused with another pathological process. An association with prematurity was found, but the low number of children in this study makes the connection uncertain. The etiology remains unclear, but it has been hypothesized that the cysts are associated with lung hypoplasia. (orig.)

  11. CHARACTER OF TUMOR ASSOCIATED PROTEIN RECOGNIZED BY MONOCLONAL ANTIBODY AGAINST YUNNAN GEJIU LUNG CANCER

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objectives: To identify and characterize lung cancer associated protein N35 and attempt to learn the prospective possibility of the clinical application of the protein N35. Methods: Immunoprecipitation, immunoblotting, differential centrifigation and subcellular assay, immunohistochemistry, N-glycanase digestion, mitotic cell immunoflourescence and multiple methods of affinity chromatography have been used with the monoclonal antibody N-35 to detect the distribution of the protein N35 among the various cancer cell lines and normal human tissue, the relationship between the protein N35 and glycoprotein, the location of the subcellular structure and chromosomal domain of the protein N35,the most effective way of purification of tumor associated protein N35. Results: The protein N35 is a glycoprotein, distributes to the human lung cancer cell line GLC-82, human cervical cancer cell line Hela, human hepatic cancer cell line HepG-2 and human breast cancer cell line PMC with different relative molecular mass(Mr), but no expression of the protein ingredient in normal human fresh tissue; concentrates at the nuclei significantly ,much more than at the mitochondrail and membrane, locates at the centriole of the chromosomal domain. Conclusions: The lung cancer associated protein N35 might be expressed only by the cancer cells and related with the proliferation of cancer cells as a role of tumor cell growth regulator.

  12. Association between household income and overweight of Korean and American children: trends and differences.

    Science.gov (United States)

    Kwon, Yongju; Oh, Sangwoo; Park, Sangshin; Park, Yongsoon

    2010-07-01

    The prevalence of overweight in children has been dramatically increasing worldwide, and socioeconomic status is an important risk factor. The purpose of this study was to examine the hypothesis that household income is negatively associated with overweight in Korean and American girls and boys. In the study, 2117 children 7 to 12 years of age from the Korean National Health and Nutrition Examination Survey between 2001 and 2007 and 3016 children from the US National Health and Nutrition Examination Survey between 2001 and 2006 were included. Overweight is defined as the sex- and age-specific body mass index cutoffs recommended by the International Obesity Task Force. Lower household income significantly increased the risk for overweight in Korean boys, irrespective of adjustments. The negative association between household income and overweight of American boys disappeared after adjusting for the frequency of dining out and TV viewing time. There was no significant association between household income and overweight of Korean and American girls. As household income increased, the intake of energy from protein was increased, but energy from carbohydrates was decreased in Korean boys. On the other hand, as household income increased, energy intake from carbohydrates was increased and energy intake from proteins decreased in American boys. In conclusion, positive association between household income and overweight was found in Korean boys, but not in Korean girls and American boys and girls. Effects solely targeting reduction in income disparities cannot effectively reduce sex disparities in overweight of children. PMID:20797479

  13. HLA disease association and protection in HIV infection among African Americans and Caucasians.

    Science.gov (United States)

    Cruse, J M; Brackin, M N; Lewis, R E; Meeks, W; Nolan, R; Brackin, B

    1991-01-01

    In a previous investigation, we demonstrated an increased progression of overt AIDS in the African American population compared to the Caucasian population as reflected by the significantly lower absolute number of CD4+ lymphocytes detected in the African American population in an earlier study. The present study elucidates some of the possible genetic factors which may contribute to disease association or protection against HIV infection. The HLA phenotypes expressed as A, B, C, DR and DQw antigens were revealed by the Amos-modified typing procedure. NIH scoring was utilized to designate positive cells taking up trypan blue. A test of proportion equivalent to the chi 2 approximation was used to compare the disease population (n = 62; 38 African Americans, 24 Caucasians) to race-matched normal heterosexual local controls (323 African Americans, 412 Caucasians). Significant p values were corrected for the number of HLA antigens tested. HLA markers associated with possible protection from infection for African Americans were Cw4 and DRw6, whereas Caucasians expressed none. Disease association markers present in the African American population were A31, B35, Cw6, Cw7, DR5, DR6, DRw11, DRw12, DQw6 and DQw7, whereas in the Caucasian population A28, Aw66, Aw48, Bw65, Bw70, Cw7, DRw10, DRw12, DQw6 and DQw7 were demonstrated. The highest phenotypic frequency for a disease association marker in the study was for HLA-DR5 (62.9%) in the HIV-infected African American population without Kaposi's sarcoma compared to a frequency of 28.9% for the regional control group (p = 0.0012). We conclude that genetic factors do have a role in HIV infection since only 50-60% of those exposed to the AIDS virus will become infected. PMID:1910527

  14. Anxiety, Alexithymia, and Depression as Mediators of the Association between Childhood Abuse and Eating Disordered Behavior in African American and European American Women

    Science.gov (United States)

    Mazzeo, Suzanne E.; Mitchell, Karen S.; Williams, Larry J.

    2008-01-01

    This study evaluated structural equation models of the associations among family functioning, childhood abuse, depression, anxiety, alexithymia, and eating disorder symptomatology in a sample of 412 European American and 192 African American female undergraduates. Additionally, the specific roles of anxiety, depression, and alexithymia as…

  15. Aberrant DNA methylation in non-small cell lung cancer-associated fibroblasts

    Science.gov (United States)

    Vizoso, Miguel; Puig, Marta; Carmona, F.Javier; Maqueda, María; Velásquez, Adriana; Gómez, Antonio; Labernadie, Anna; Lugo, Roberto; Gabasa, Marta; Rigat-Brugarolas, Luis G.; Trepat, Xavier; Ramírez, Josep; Moran, Sebastian; Vidal, Enrique; Reguart, Noemí; Perera, Alexandre; Esteller, Manel; Alcaraz, Jordi

    2015-01-01

    Epigenetic changes through altered DNA methylation have been implicated in critical aspects of tumor progression, and have been extensively studied in a variety of cancer types. In contrast, our current knowledge of the aberrant genomic DNA methylation in tumor-associated fibroblasts (TAFs) or other stromal cells that act as critical coconspirators of tumor progression is very scarce. To address this gap of knowledge, we conducted genome-wide DNA methylation profiling on lung TAFs and paired control fibroblasts (CFs) from non-small cell lung cancer patients using the HumanMethylation450 microarray. We found widespread DNA hypomethylation concomitant with focal gain of DNA methylation in TAFs compared to CFs. The aberrant DNA methylation landscape of TAFs had a global impact on gene expression and a selective impact on the TGF-β pathway. The latter included promoter hypermethylation-associated SMAD3 silencing, which was associated with hyperresponsiveness to exogenous TGF-β1 in terms of contractility and extracellular matrix deposition. In turn, activation of CFs with exogenous TGF-β1 partially mimicked the epigenetic alterations observed in TAFs, suggesting that TGF-β1 may be necessary but not sufficient to elicit such alterations. Moreover, integrated pathway-enrichment analyses of the DNA methylation alterations revealed that a fraction of TAFs may be bone marrow-derived fibrocytes. Finally, survival analyses using DNA methylation and gene expression datasets identified aberrant DNA methylation on the EDARADD promoter sequence as a prognostic factor in non-small cell lung cancer patients. Our findings shed light on the unique origin and molecular alterations underlying the aberrant phenotype of lung TAFs, and identify a stromal biomarker with potential clinical relevance. PMID:26449251

  16. Metagenes Associated with Survival in Non-Small Cell Lung Cancer

    Science.gov (United States)

    Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres

    2011-01-01

    NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068

  17. Prevalence and Clinical Characteristics Associated with Pulmonary Hypertension in African-Americans

    OpenAIRE

    Choudhary, Gaurav; Jankowich, Matthew; Wu, Wen-Chih

    2013-01-01

    Background Pulmonary hypertension (PH) is associated with increased mortality and morbidity. It is frequently associated with cardiopulmonary diseases that are prevalent in African Americans (AAs). However, the prevalence or determinants of PH in the AA population is not known. Methods We conducted a cross-sectional study to estimate the prevalence of PH (defined as trans-tricuspid gradient ≥ 35 mm Hg) and associated clinical characteristics in AAs using the Jackson Heart Study cohort (n=3,28...

  18. Paraneoplastic Syndromes of Hypercalcemia and Leukocytosis Associated with Colonic Metastases from Squamous Cell Carcinoma of the Lung: a Case Report

    Institute of Scientific and Technical Information of China (English)

    Xiangtao Ma; Xu Wang; Liwei Yu; Jing Fu; Shan Wang; Ruyu Du; Zhirong Cui

    2006-01-01

    @@ Lung cancer is the most common cancer-related death in both men and women in the world. Approximately 25% of all cancer deaths are attributable to lung carcinoma. Moreover, about one-half of patients with lung cancer have metastases at the time of initial diagnosis, most frequently of lymph nodes, adrenals, liver, bone and brain.However metastasis to the colon is very rare. Over the past 25 years about 13 cases of symptomatic colonic metastases from lung malignancies of all types have been reported in the literature. Hypercalcemia and leukocytosis are two of the most common paraneoplastic syndromes associated with various malignancies. However, concomitant manifestation of hypercalcemia and leukocytosis are occasionally observed in the same cancer patients. Here, we present a rare case of colonic metastasis from a squamous cell carcinoma of the lung associated with paraneoplastic syndromes of hypercalcemia and leukocytosis.

  19. 2011 Annual Report of the American Psychological Association

    Science.gov (United States)

    American Psychologist, 2012

    2012-01-01

    As we have throughout the association's history, we focused in 2011 on multiple initiatives--all designed to further, support, and communicate the important work that psychologists do. This year we had the benefit of APA's first-ever strategic plan as well as funding for the following seven initiatives that are specifically designed to execute the…

  20. Genetic variants in ABCG1 are associated with survival of nonsmall-cell lung cancer patients.

    Science.gov (United States)

    Wang, Yanru; Liu, Hongliang; Ready, Neal E; Su, Li; Wei, Yongyue; Christiani, David C; Wei, Qingyi

    2016-06-01

    Cell membrane transporters and metabolic enzymes play a crucial role in the transportation of a wide variety of substrates that maintain homeostasis in biological processes. We explored associations between genetic variants in these genes and survival of nonsmall-cell lung cancer (NSCLC) patients by reanalyzing two datasets from published genome-wide association studies (GWASs). In the discovery by using the GWAS dataset of the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial, we evaluated associations of 1,245 single-nucleotide polymorphisms (SNPs) in genes of four transporter families and two metabolic enzyme families with survival of 1,185 NSCLC patients. We then performed a replication analysis in the Harvard University Lung Cancer study (LCS) with 984 NSCLC patients. Multivariate Cox proportional hazards regression and false discovery rate (FDR) corrections were performed to evaluate the associations. We identified that 21 genotyped SNPs in eight gene regions were significantly associated with survival with FDR ≤0.1 in the discovery dataset. Subsequently, we confirmed six SNPs, which were putative functional, in ABCG1 of the ATP-binding cassette transporter family in the replication dataset. In the pooled analysis, two tagging (at r(2)  > 0.8 for linkage disequilibrium with other replicated SNPs)/functional SNPs were independently associated with survival: rs225388 G > A [adjusted hazards ratio (HR) = 1.12, 95% confidence interval (CI) = 1.03-1.20, Ptrend  = 4.6 × 10(-3) ] and rs225390 A > G (adjusted HR = 1.16, 95% CI = 1.07-1.25, Ptrend  = 3.8 × 10(-4) ). Our results indicated that genetic variants of ABCG1 may be predictors of survival of NSCLC patients. PMID:26757251

  1. Factors associated with willingness to participate in biospecimen research among Chinese Americans.

    Science.gov (United States)

    Gao, Wanzhen; Ma, Grace X; Tan, Yin; Fang, Carolyn; Weaver, JoEllen; Jin, Ming; Lai, Philip

    2014-04-01

    A paucity of information exists on the recruitment of Asian Americans for biospecimen research. Although studies show that Chinese Americans are at high risk for hepatitis B virus (HBV) infection, little is known about their willingness to participate in HBV-related biospecimen research and how knowledge, attitudes, and cultural factors impact their willingness to participate. The study was guided by Community-Based Participatory Research principles. Data were derived from an assessment study on HBV-related biospecimen research participation among Chinese Americans in the Philadelphia region. The assessment was conducted with 415 Chinese Americans recruited from eight Chinese community-based organizations. Cultural beliefs, knowledge, and attitudes toward biospecimen research were examined for associations with their willingness to participate in biospecimen banking research. Overall, 192 (46.3%) of 415 participants who completed the assessment indicated they were willing to participate if they were invited to donate blood to be frozen and stored for future HBV biospecimen studies. Cultural variables significant in bivariate analysis included collectivism, knowledge about biospecimen research, and Yin-Yang beliefs. Fatalism and individualism were not associated with participation willingness. In multivariate analysis, age, health care attitudes, and trust were significantly associated with willingness to participate in biospecimen banking research. Asian American communities have little knowledge of biospecimen banking and will benefit from educational campaigns that emphasize collective benefits and attitudes towards and trust in the health care system. Understanding cultural factors is important for improving Chinese Americans' knowledge, awareness, and intentions of participation in biospecimen research. Similar efforts need to be undertaken to develop culturally appropriate educational intervention programs to increase participation in biospecimen research

  2. Quantitative computed tomographic descriptors associate tumor shape complexity and intratumor heterogeneity with prognosis in lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Olya Grove

    Full Text Available Two CT features were developed to quantitatively describe lung adenocarcinomas by scoring tumor shape complexity (feature 1: convexity and intratumor density variation (feature 2: entropy ratio in routinely obtained diagnostic CT scans. The developed quantitative features were analyzed in two independent cohorts (cohort 1: n = 61; cohort 2: n = 47 of patients diagnosed with primary lung adenocarcinoma, retrospectively curated to include imaging and clinical data. Preoperative chest CTs were segmented semi-automatically. Segmented tumor regions were further subdivided into core and boundary sub-regions, to quantify intensity variations across the tumor. Reproducibility of the features was evaluated in an independent test-retest dataset of 32 patients. The proposed metrics showed high degree of reproducibility in a repeated experiment (concordance, CCC≥0.897; dynamic range, DR≥0.92. Association with overall survival was evaluated by Cox proportional hazard regression, Kaplan-Meier survival curves, and the log-rank test. Both features were associated with overall survival (convexity: p = 0.008; entropy ratio: p = 0.04 in Cohort 1 but not in Cohort 2 (convexity: p = 0.7; entropy ratio: p = 0.8. In both cohorts, these features were found to be descriptive and demonstrated the link between imaging characteristics and patient survival in lung adenocarcinoma.

  3. Nuclear factor, erythroid 2-like 2-associated molecular signature predicts lung cancer survival.

    Science.gov (United States)

    Qian, Zhongqing; Zhou, Tong; Gurguis, Christopher I; Xu, Xiaoyan; Wen, Qing; Lv, Jingzhu; Fang, Fang; Hecker, Louise; Cress, Anne E; Natarajan, Viswanathan; Jacobson, Jeffrey R; Zhang, Donna D; Garcia, Joe G N; Wang, Ting

    2015-01-01

    Nuclear factor, erythroid 2-like 2 (NFE2L2), a transcription factor also known as NF-E2-related factor 2 (Nrf2), is a key cytoprotective gene that regulates critical antioxidant and stress-responsive genes. Nrf2 has been demonstrated to be a promising therapeutic target and useful biomarker in malignant disease. We hypothesized that NFE2L2-mediated gene expression would reflect cancer severity and progression. We conducted a meta-analysis of microarray data for 240 NFE2L2-mediated genes that were enriched in tumor tissues. We then developed a risk scoring system based on NFE2L2 gene expression profiling and designated 50 tumor-associated genes as the NFE2L2-associated molecular signature (NAMS). We tested the relationship between this gene expression signature and both recurrence-free survival and overall survival in lung cancer patients. We find that NAMS predicts clinical outcome in the training cohort and in 12 out of 20 validation cohorts. Cox proportional hazard regressions indicate that NAMS is a robust prognostic gene signature, independent of other clinical and pathological factors including patient age, gender, smoking, gene alteration, MYC level, and cancer stage. NAMS is an excellent predictor of recurrence-free survival and overall survival in human lung cancer. This gene signature represents a promising prognostic biomarker in human lung cancer. PMID:26596768

  4. Erlotinib-associated Near-fatal Interstitial Pneumonitis in A Patient with Relapsed Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Chun-Liang Chou

    2010-02-01

    Full Text Available Erlotinib (Tarceva® is a human epidermal growth factor receptor (EGFR tyrosinekinase inhibitor used for treatment of locally advanced or metastatic non-small cell lung cancer(NSCLC after failure of at least one prior chemotherapy regimen. Interstitial lung disease,associated with gefitinib (Iressa® use, has been reported in approximately 1% ofpatients worldwide. However, the adverse pulmonary effects of erlotinib remain poorly documented.Reviewed English language publications in MEDLINE and PubMed suggest thatthis report is to be the first case report in English of a histologically-confirmed case of nearfatalinterstitial pneumonitis with acute lung injury, associated with erlotinib, in East Asianpatients. Physicians are hereby encouraged to promptly evaluate new or worsening pulmonarysymptoms so that they can detect early radiographic signs of pulmonary toxicity inpatients on erlotinib. If toxicity is confirmed, erlotinib should be discontinued and thepatient treated appropriately. The case presented suggests that the outcome of erlotinib-associatedpulmonary toxicity with acute respiratory failure may be favorable with adequateearly management.

  5. Potentially Functional Polymorphisms in POU5F1 Gene Are Associated with the Risk of Lung Cancer in Han Chinese

    Science.gov (United States)

    Niu, Rui; Wang, Yuzhuo; Zhu, Meng; Wen, Yifan; Sun, Jie; Shen, Wei; Cheng, Yang; Zhang, Jiahui; Jin, Guangfu; Ma, Hongxia; Hu, Zhibin; Shen, Hongbing; Dai, Juncheng

    2015-01-01

    POU5F1 is a key regulator of self-renewal and differentiation in embryonic stem cells and may be associated with initiation, promotion, and progression in cancer. We hypothesized that functional polymorphisms in POU5F1 may play an important role in modifying the lung cancer risk. To test this hypothesis, we conducted a case-control study to explore the association between 17 potentially functional SNPs in POU5F1 gene and the lung cancer risk in 1,341 incident lung cancer cases and 1,982 healthy controls in a Chinese population. We found that variant alleles of rs887468 and rs3130457 were significantly associated with increased risk of lung cancer after multiple comparison (OR = 1.29, 95% CI: 1.11–1.51, Pfdr = 0.017 for rs887468; OR = 1.29, 95% CI: 1.10–1.51, Pfdr = 0.034 for rs3130457, resp.). In addition, we detected a significant interaction between rs887468 genotypes and smoking status on lung cancer risk (P = 0.017). Combined analysis of these 2 SNPs showed a significant allele-dosage association between the number of risk alleles and increased risk of lung cancer (Ptrend < 0.001). These findings indicate that potentially functional polymorphisms in POU5F1 gene may contribute to lung cancer susceptibility in a Chinese population. PMID:26824036

  6. Interstitial pneumonia associated to peginterferon alpha-2a: A focus on lung function.

    Science.gov (United States)

    Cortés-Telles, Arturo

    2016-01-01

    Pulmonary toxicity related to the use of pegylated interferon alpha-2a during treatment of hepatitis C infections is rare; nonetheless, some cases with fatal outcomes have been reported. Evaluating patients' pulmonary function is a key to diagnosis, follow-up and prognosis of several respiratory diseases, but case reports of respiratory manifestations related to the use of pegylated interferon alpha-2a have limited their findings to only baseline measurements. This paper examines the case of a 65-year-old woman with chronic hepatitis C virus infection who developed interstitial pneumonitis associated with pegylated interferon alpha-2a. Initial lung function evaluation revealed a marked reduction compared to an earlier assessment; the results were consistent with a moderate restricted pattern. Fortunately, over the ensuing 8 weeks of follow-up after discontinuing the drug, the patient recovered her lung function and experienced an overall improvement in her respiratory symptoms. PMID:27051119

  7. Interstitial pneumonia associated to peginterferon alpha-2a: A focus on lung function

    Directory of Open Access Journals (Sweden)

    Arturo Cortés-Telles

    2016-01-01

    Full Text Available Pulmonary toxicity related to the use of pegylated interferon alpha-2a during treatment of hepatitis C infections is rare; nonetheless, some cases with fatal outcomes have been reported. Evaluating patients' pulmonary function is a key to diagnosis, follow-up and prognosis of several respiratory diseases, but case reports of respiratory manifestations related to the use of pegylated interferon alpha-2a have limited their findings to only baseline measurements. This paper examines the case of a 65-year-old woman with chronic hepatitis C virus infection who developed interstitial pneumonitis associated with pegylated interferon alpha-2a. Initial lung function evaluation revealed a marked reduction compared to an earlier assessment; the results were consistent with a moderate restricted pattern. Fortunately, over the ensuing 8 weeks of follow-up after discontinuing the drug, the patient recovered her lung function and experienced an overall improvement in her respiratory symptoms.

  8. [Lung diseases in children associated with inherited disorders of surfactant metabolism].

    Science.gov (United States)

    Delestrain, C; Flamein, F; Jonard, L; Couderc, R; Guillot, L; Fanen, P; Epaud, R

    2013-08-01

    Pulmonary surfactant is a unique mixture of lipids and specific proteins that reduces surface tension at the air-liquid interface, preventing collapse of the lung at the end of expiration. Recessive loss-of-function mutations of pulmonary surfactant protein B (SP-B) was initially described in infants who develop respiratory failure at birth. More recently, mutations in other constitutive surfactant proteins like surfactant protein C or implied in its metabolism like ATP-binding cassette, sub-family A, member 3 (ABCA3) or NK2 homeobox (NKX2-1) were identified in newborn with respiratory distress but also in children with diffuse infiltrative pneumonia. Intra-alveolar accumulation of protein related to surfactant dysfunction leads to cough, hypoxemia and radiological abnormalities including ground-glass opacities and lung cysts. The clinical and radiological features associated with these genetic disorders, along with their treatment and outcome, are reviewed. PMID:23856024

  9. Cell type specificity of female lung cancer associated with sulfur dioxide from air pollutants in Taiwan: An ecological study

    OpenAIRE

    Tseng Ching-Yu; Huang Yi-Chia; Su Shih-Yung; Huang Jing-Yang; Lai Cheng-Hsiu; Lung Chia-Chi; Ho Chien-Chang; Liaw Yung-Po

    2012-01-01

    Abstract Background Many studies have examined the association between air pollutants (including sulfur dioxide [SO2], carbon monoxide [CO], nitrogen dioxide [NO2], nitric oxide [NO], ozone [O3], and particulate matter < 10 μm [PM10]) and lung cancer. However, data from previous studies on pathological cell types were limited, especially for SO2 exposure. We aimed to explore the association between SO2 exposure from outdoor air pollutants and female lung cancer incidence by cell type specific...

  10. Association between Catechol-O-methyltransferase rs4680 (G > A) polymorphism and lung cancer risk

    OpenAIRE

    Tan, Xiang; CHEN, MINGWU

    2014-01-01

    Background The association between the Val158Met polymorphism in the catechol-O-methyltransferase (COMT) gene and lung cancer risk remains controversial and inconclusive. Therefore, the meta-analysis was performed to provide a quality reevaluation of the association between the COMT Val158Met polymorphism and the risk of lung cancer. Methods Two major public databases (Pubmed and Embase) and several Chinese databases were searched for eligible studies. Pooled odds ratios (OR) and 95% confiden...

  11. Association between the COMT 158 G/A polymorphism and lung cancer risk: a meta-analysis

    OpenAIRE

    Peng, Shifeng; Tong, Xiang; Liu, Sitong; Feng, Yulin; FAN, HONG

    2015-01-01

    Catechol-O-methyltransferase (COMT) 158 G/A gene polymorphism seem to associate with lung cancer, but the results are inconclusive. This meta-analysis aims to investigate the association between COMT 158 G/A gene polymorphism and lung cancer susceptibility. We searched PubMed, Embase, China National Knowledge Infrastructure (CNKI), VIP Chinese science and technology periodical database (VIP) and Wanfang databases up to March 25, 2015 for articles on the connection between the COMT 158 G/A pol...

  12. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia

    OpenAIRE

    Lan, Qing; Hsiung, Chao A.; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wang, Zhaoming; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Chatterjee, Nilanjan; Hu, Wei; Wong, Maria Pik; Zheng, Wei; Caporaso, Neil; PARK, JAE YONG

    2012-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland China, South Korea, Japan, Singapore, Taiwan, and Hong Kong. We genotyped the most promising variants (associated at P < 5 × 10-6) in an additional 1,099 cases and 2,913 controls. We identified three...

  13. Associations between housing conditions, smoking habits and ventilatory lung function in men with clean jobs.

    Science.gov (United States)

    Rasmussen, F V; Borchsenius, L; Winsløw, J B; Ostergaard, E R

    1978-10-01

    In 218 men, who had minimal occupational exposure to dusts, fumes, temperature variability, or physical exercise, the relation between housing conditions throughout life and lung function was analysed. The number of years spend in dwellings without central heating was significantly inversely associated with the level of FEV1 and MMEF, and significantly directly associated with closing capacity in per cent of TLC, CC%. Significant dose-response relationships between smoking habits and FEV1, MMEF, CC% and slope of the alveolar plateau (phase III) were found, whereas closing volume, CV%, was only correlated to age. The association between dwelling conditions and ventilatory capacity was independent of smoking habits. Tobacco smoking, however, moderated the association in as much as it was strengthened after standardisation for tobacco consumption. These data support the hypothesis that poor dwelling conditions during childhood and adolescence are associated with development of peripheral airways disease and expiratory airflow obstruction at middle age, and that comparisons of lung function between different occupational categories are incomplete and may be misleading if lifelong housing conditions or other factors reflecting socio-economic status are not taken into consideration. PMID:734386

  14. The First Successful Heart-Lung Transplant in a Korean Child with Humidifier Disinfectant-Associated Interstitial Lung Disease.

    Science.gov (United States)

    Jhang, Won Kyoung; Park, Seong Jong; Lee, Eun; Yang, Song I; Hong, Soo Jong; Seo, Ju-Hee; Kim, Hyung-Young; Park, Jeong-Jun; Yun, Tae-Jin; Kim, Hyeong Ryul; Kim, Yong-Hee; Kim, Dong Kwan; Park, Seung-Il; Lee, Sang-Oh; Hong, Sang-Bum; Shim, Tae-Sun; Choi, In-Cheol; Yu, Jinho

    2016-05-01

    From 2006 to 2011, an outbreak of a particular type of childhood interstitial lung disease occurred in Korea. The condition was intractable and progressed to severe respiratory failure, with a high mortality rate. Moreover, in several familial cases, the disease affected young women and children simultaneously. Epidemiologic, animal, and post-interventional studies identified the cause as inhalation of humidifier disinfectants. Here, we report a 4-year-old girl who suffered from severe progressive respiratory failure. She could survive by 100 days of extracorporeal membrane oxygenation support and finally, underwent heart-lung transplantation. This is the first successful pediatric heart-lung transplantation carried out in Korea. PMID:27134508

  15. Predicting the Risk of Secondary Lung Malignancies Associated With Whole-Breast Radiation Therapy

    International Nuclear Information System (INIS)

    Purpose: The risk of secondary lung malignancy (SLM) is a significant concern for women treated with whole-breast radiation therapy after breast-conserving surgery for early-stage breast cancer. In this study, a biologically based secondary malignancy model was used to quantify the risk of secondary lung malignancies (SLMs) associated with several common methods of delivering whole-breast radiation therapy (RT). Methods and Materials: Both supine and prone computed tomography simulations of 15 women with early breast cancer were used to generate standard fractionated and hypofractionated whole-breast RT treatment plans for each patient. Dose–volume histograms (DVHs) of the ipsilateral breast and lung were calculated for each patient on each plan. A model of spontaneous and radiation-induced carcinogenesis was used to determine the relative risks of SLMs for the different treatment techniques. Results: A higher risk of SLMs was predicted for supine breast irradiation when compared with prone breast irradiation for both the standard fractionation and hypofractionation schedules (relative risk [RR] = 2.59, 95% confidence interval (CI) = 2.30–2.88, and RR = 2.68, 95% CI = 2.39–2.98, respectively). No difference in risk of SLMs was noted between standard fractionation and hypofractionation schedules in either the supine position (RR = 1.05, 95% CI = 0.97–1.14) or the prone position (RR = 1.01, 95% CI = 0.88–1.15). Conclusions: Compared with supine whole-breast irradiation, prone breast irradiation is associated with a significantly lower predicted risk of secondary lung malignancy. In this modeling study, fractionation schedule did not have an impact on the risk of SLMs in women treated with whole-breast RT for early breast cancer.

  16. Airway CD8(+) T Cells Are Associated with Lung Injury during Infant Viral Respiratory Tract Infection.

    Science.gov (United States)

    Connors, Thomas J; Ravindranath, Thyyar M; Bickham, Kara L; Gordon, Claire L; Zhang, Feifan; Levin, Bruce; Baird, John S; Farber, Donna L

    2016-06-01

    Infants and young children are disproportionately susceptible to severe complications from respiratory viruses, although the underlying mechanisms remain unknown. Recent studies show that the T cell response in the lung is important for protective responses to respiratory infections, although details on the infant/pediatric respiratory immune response remain sparse. The objectives of the present study were to characterize the local versus systemic immune response in infants and young children with respiratory failure from viral respiratory tract infections and its association to disease severity. Daily airway secretions were sampled from infants and children 4 years of age and younger receiving mechanical ventilation owing to respiratory failure from viral infection or noninfectious causes. Samples were examined for immune cell composition and markers of T cell activation. These parameters were then correlated with clinical disease severity. Innate immune cells and total CD3(+) T cells were present in similar proportions in airway aspirates derived from infected and uninfected groups; however, the CD8:CD4 T cell ratio was markedly increased in the airways of patients with viral infection compared with uninfected patients, and specifically in infected infants with acute lung injury. T cells in the airways were phenotypically and functionally distinct from those in blood with activated/memory phenotypes and increased cytotoxic capacity. We identified a significant increase in airway cytotoxic CD8(+) T cells in infants with lung injury from viral respiratory tract infection that was distinct from the T cell profile in circulation and associated with increasing disease severity. Airway sampling could therefore be diagnostically informative for assessing immune responses and lung damage. PMID:26618559

  17. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  18. Predicting the Risk of Secondary Lung Malignancies Associated With Whole-Breast Radiation Therapy

    Energy Technology Data Exchange (ETDEWEB)

    Ng, John, E-mail: jon9024@nyp.org [Department of Radiation Oncology, Columbia University Medical Center, New York, NY (United States); Shuryak, Igor [Center for Radiological Research, Columbia University Medical Center, New York, NY (United States); Xu Yanguang; Clifford Chao, K.S. [Department of Radiation Oncology, Columbia University Medical Center, New York, NY (United States); Brenner, David J. [Center for Radiological Research, Columbia University Medical Center, New York, NY (United States); Burri, Ryan J. [Department of Radiation Oncology, Columbia University Medical Center, New York, NY (United States)

    2012-07-15

    Purpose: The risk of secondary lung malignancy (SLM) is a significant concern for women treated with whole-breast radiation therapy after breast-conserving surgery for early-stage breast cancer. In this study, a biologically based secondary malignancy model was used to quantify the risk of secondary lung malignancies (SLMs) associated with several common methods of delivering whole-breast radiation therapy (RT). Methods and Materials: Both supine and prone computed tomography simulations of 15 women with early breast cancer were used to generate standard fractionated and hypofractionated whole-breast RT treatment plans for each patient. Dose-volume histograms (DVHs) of the ipsilateral breast and lung were calculated for each patient on each plan. A model of spontaneous and radiation-induced carcinogenesis was used to determine the relative risks of SLMs for the different treatment techniques. Results: A higher risk of SLMs was predicted for supine breast irradiation when compared with prone breast irradiation for both the standard fractionation and hypofractionation schedules (relative risk [RR] = 2.59, 95% confidence interval (CI) = 2.30-2.88, and RR = 2.68, 95% CI = 2.39-2.98, respectively). No difference in risk of SLMs was noted between standard fractionation and hypofractionation schedules in either the supine position (RR = 1.05, 95% CI = 0.97-1.14) or the prone position (RR = 1.01, 95% CI = 0.88-1.15). Conclusions: Compared with supine whole-breast irradiation, prone breast irradiation is associated with a significantly lower predicted risk of secondary lung malignancy. In this modeling study, fractionation schedule did not have an impact on the risk of SLMs in women treated with whole-breast RT for early breast cancer.

  19. The number and microlocalization of tumor-associated immune cells are associated with patient's survival time in non-small cell lung cancer

    OpenAIRE

    Zhang Shangfu; Ma Junliang; Pu Qiang; Yu Nanbin; Che Guowei; Liu Lunxu; Dai Fuqiang; Ma Lin; You Zongbing

    2010-01-01

    Abstract Background Tumor microenvironment is composed of tumor cells, fibroblasts, endothelial cells, and infiltrating immune cells. Tumor-associated immune cells may inhibit or promote tumor growth and progression. This study was conducted to determine whether the number and microlocalization of macrophages, mature dendritic cells and cytotoxic T cells in non-small cell lung cancer are associated with patient's survival time. Methods Ninety-nine patients with non-small cell lung cancer (NSC...

  20. Female genital mutilation. Council on Scientific Affairs, American Medical Association.

    Science.gov (United States)

    1995-12-01

    Female genital mutilation is the medically unnecessary modification of female genitalia. Female genital mutilation typically occurs at about 7 years of age, but mutilated women suffer severe medical complications throughout their adult lives. Female genital mutilation most frequently occurs in Africa, the Middle East, and Muslim parts of Indonesia and Malaysia, and it is generally part of a ceremonial induction into adult society. Recent political and economic problems in these regions, however, have increased the numbers of students and refugees to the United States. Consequently, US physicians are treating an increasing number of mutilated patients. The Council on Scientific Affairs recommends that US physicians join the World Health Organization, the World Medical Association, and other major health care organizations in opposing all forms of medically unnecessary surgical modification of the female genitalia. PMID:7474278

  1. Expanding the Epistemological Terrain: Increasing Equity and Diversity within the American Educational Research Association

    Science.gov (United States)

    Banks, James A.

    2016-01-01

    During the civil rights movement of the 1960s and 1970s, the quest for civil rights by African Americans and other groups of color reverberated throughout the United States and the world, including within educational professional and research organizations, such as the Association for Supervision and Curriculum Development, the National Council of…

  2. The Asian American Psychological Association: Parallels and Intersections with Counseling Psychology

    Science.gov (United States)

    Alvarez, Alvin N.; Singh, Anneliese A.; Wu, Jenny

    2012-01-01

    This article provides an overview of the Asian American Psychological Association (AAPA). A brief history is provided, followed by current status and resources, connections to counseling psychology, and implications for the Society of Counseling Psychology and for the future of the AAPA. AAPA was created in 1972 in response to psychology's neglect…

  3. Importation of Hybrid Human-Associated Trypanosoma cruzi Strains of Southern South American Origin, Colombia.

    Science.gov (United States)

    Messenger, Louisa A; Ramirez, Juan David; Llewellyn, Martin S; Guhl, Felipe; Miles, Michael A

    2016-08-01

    We report the characterization of Trypanosoma cruzi of southern South American origin among humans, domestic vectors, and peridomestic hosts in Colombia using high-resolution nuclear and mitochondrial genotyping. Expanding our understanding of the geographic range of lineage TcVI, which is associated with severe Chagas disease, will help clarify risk of human infection for improved disease control. PMID:27434772

  4. AERA Code of Ethics: American Educational Research Association Approved by the AERA Council February 2011

    Science.gov (United States)

    Educational Researcher, 2011

    2011-01-01

    The Code of Ethics of the American Educational Research Association (AERA) articulates a common set of values upon which education researchers build their professional and scientific work. The Code is intended to provide both the principles and the rules to cover professional situations encountered by education researchers. It has as its primary…

  5. Neuropsychological Training in American Psychological Association-Accredited and Nonaccredited School Psychology Programs.

    Science.gov (United States)

    D'Amato, Rik Carl; And Others

    1992-01-01

    Examines whether American Psychological Association (APA)-accredited and nonaccredited programs differ in views and offerings of neuropsychological training. Of 72 programs surveyed, 59 percent of APA-accredited programs and 53 percent of nonaccredited programs offered course work in neuropsychology. Found that students viewed neuropsychological…

  6. Attempted Suicide and Associated Health Risk Behaviors among Native American High School Students

    Science.gov (United States)

    Shaughnessy, Lana; Doshi, Sonal R.; Jones, Sherry Everett

    2004-01-01

    Suicide represents the second-leading cause of death among American Indian/Alaska Native (AI/AN) youth aged 15-24 years. Data from the 2001 Bureau of Indian Affairs (BIA) Youth Risk Behavior Survey were used to examine the association between attempted suicide among high school students and unintentional injury and violence behaviors, sexual risk…

  7. 77 FR 42229 - Gruma Corporation, Spina Bifida Association, March of Dimes Foundation, American Academy of...

    Science.gov (United States)

    2012-07-18

    ...The Food and drug Administration (FDA) is correcting a notice that appeared in the Federal Register of June 13, 2012 (77 FR 35317). The document announced that Gruma Corporation, Spina Bifida Association, March of Dimes Foundation, American Academy of Pediatrics, Royal DSM N.V., and National Council of La Raza had jointly filed a petition proposing that the food additive regulations be amended......

  8. Tobacco industry influence on the definition of tobacco related disorders by the American Psychiatric Association

    OpenAIRE

    Neuman, M; Bitton, A; Glantz, S

    2005-01-01

    Objective: The Diagnostic and statistical manual of mental disorders, third edition (DSM-III), published by the American Psychiatric Association (APA) in 1980, included the first official definitions by the APA of tobacco dependence and tobacco withdrawal. Tobacco industry efforts to influence the DSM-III were investigated.

  9. The American Bar Association and Legislatively Mandated Treatment for Sex Offenders.

    Science.gov (United States)

    Pallone, Nathanial J.

    1991-01-01

    Offers historical overview of "criminal sexual psychopath" legislation, which customarily prescribes confinement for treatment (rather than incarceration for punishment) for offenders whose sex crimes are attributed to sexual psychopathology. Discusses desire of American Bar Association and Group for the Advancement of Psychiatry to repeal extant…

  10. University of Central Florida and the American Association of State Colleges and Universities: Blended Learning Toolkit

    Science.gov (United States)

    EDUCAUSE, 2014

    2014-01-01

    The Blended Learning Toolkit supports the course redesign approach, and interest in its openly available clearinghouse of online tools, strategies, curricula, and other materials to support the adoption of blended learning continues to grow. When the resource originally launched in July 2011, 20 AASCU [American Association of State Colleges and…

  11. The Clinical Research Forum and Association of American Physicians disagree with criticism of the NIH Roadmap

    OpenAIRE

    Crowley, William; Courtney, John; Pardes, Herbert; Moskowitz, Jay; Orringer, Eugene; Rubenstein, Arthur; Wood, Alastair; Rettig, Richard; Ausiello, Dennis; Brenner, David; Collins, Francis; Elias, Jack; Greene, Warner; Horowitz, Ralph; Jameson, Larry

    2006-01-01

    As representatives of 50 leading academic medical centers focusing on clinical research and many of academic medicine’s scientific leaders, the Clinical Research Forum and Association of American Physicians disagree with the JCI’s recent editorials on the NIH Roadmap, Elias Zerhouni’s leadership, and the future directions of biomedical research.

  12. 2011 New lung adenocarcinoma multidisciplinary classification: imaging aspects

    International Nuclear Information System (INIS)

    The new classification of lung adenocarcinoma has been proposed by International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society in 2011. This new classification proposes a series of new concepts, such as lung adenocarcinoma in situ replacing the old term bronchioloalveolar carcinoma, minimally invasive adenocarcinoma and subtypes of invasive adenocarcinoma. This paper reviews the major advances of this new classification and its effect on imaging evaluation of lung adenocarcinoma and CT appearances of various subtypes of lung adenocarcinoma. (authors)

  13. The association between ambient temperature and children's lung function in Baotou, China

    Science.gov (United States)

    Li, Shanshan; Guo, Yuming; Williams, Gail; Baker, Peter; Ye, Xiaofang; Madaniyazi, Lina; Kim, Dae-Seon; Pan, Xiaochuan

    2015-07-01

    The objective of this study is to examine the association between ambient temperature and children's lung function in Baotou, China. We recruited 315 children (8-12 years) from Baotou, China in the spring of 2004, 2005, and 2006. They performed three successive forced expiratory measurements three times daily (morning, noon, and evening) for about 5 weeks. The highest peak expiratory flow (PEF) was recorded for each session. Daily data on ambient temperature, relative humidity, and air pollution were monitored during the same period. Mixed models with a distributed lag structure were used to examine the effects of temperature on lung function while adjusting for individual characteristics and environmental factors. Low temperatures were significantly associated with decreases in PEF. The effects lasted for lag 0-2 days. For all participants, the cumulative effect estimates (lag 0-2 days) were -1.44 (-1.93, -0.94) L/min, -1.39 (-1.92, -0.86) L/min, -1.40 (-1.97, -0.82) L/min, and -1.28 (-1.69, -0.88) L/min for morning, noon, evening, and daily mean PEF, respectively, associated with 1 °C decrease in daily mean temperature. Generally, the effects of temperature were slightly stronger in boys than in girls for noon, evening, and daily mean PEF, while the effects were stronger in girls for morning PEF. PM2.5 had joint effects with temperature on children's PEF. Higher PM2.5 increased the impacts of low temperature. Low ambient temperatures are associated with lower lung function in children in Baotou, China. Preventive health policies will be required for protecting children from the cold weather.

  14. Neuronal calcium sensor-1 and cocaine addiction: A genetic association study in African-Americans and European Americans

    Science.gov (United States)

    Multani, Pushpinder K.; Clarke, Toni-Kim; Narasimhan, Sneha; Ambrose-Lanci, Lisa; Kampman, Kyle M.; Pettinati, Helen M.; Oslin, David W.; O’Brien, Charles P.; Berrettini, Wade H.; Lohoff, Falk W.

    2013-01-01

    Genes involved in drug reward pathways are plausible candidates for susceptibility to substance use disorders. Given the prominent role of dopamine in drug reward, dopamine receptor-interacting proteins (DRIPs) such as the neuronal calcium sensor-1 (NCS-1) protein have been hypothesized to play a role in the pathophysiology of cocaine addiction (CA). In this study, we investigated whether genetic variants in the NCS-1 gene confer risk to CA. We genotyped 8 SNPs (rs4837479, rs7849345, rs3824544, rs10819611, rs947513, rs2277200, rs7873936 and rs1342043) in our discovery sample (cases n = 796, controls n = 416) of African descent. Confirmation of associated or trending SNPs (rs7849345, rs10819611, rs1342043) was attempted using a replication sample of African American (AA) ethnicity (cases n = 335, controls n = 336) and European-American (EA) ancestry (cases n = 336, controls n = 656). Secondary sex specific analysis was also carried out for each SNP in both AA and EA individuals. Genotyping of the discovery cohort showed significant genotypic (p = 0.0005, corrected q-value) as well as allelic (p = 0.005, corrected q-value) associations of rs1342043 with CA in AAs; however, this marker could not be confirmed in either the AA or EA replication sample. Combined analysis of all AA samples (n = 1883) for rs1342043 showed a significant association with CA (genotypic p = 0.0001, allelic p = 0.002) with a gender specific effect for males (allelic p = 0.005, genotypic p = 0.0003). Our data suggest that genetic variants in the NCS-1 gene contribute to susceptibility of CA in individuals of African descent. PMID:22999924

  15. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink.

    Science.gov (United States)

    Cirera, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea; Vissenberg, Kris; Fredholm, Merete; Christensen, Knud; Anistoroaei, Razvan

    2016-04-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials for amplifying the genomic DNA and cDNA at the beginning of intron 2 of AP TYRP1 revealed the presence of a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene. In AP RNAseq data indicate, however, the presence of the wild-type (wt) transcript at very low levels and Western blot reveals three products when using an antibody raised against middle part of the TYRP1 protein. One individual from another brown mink phenotype-commercially named Dawn-was also investigated at the molecular level by long-range PCR and the same size insertion appears to be present. By this we suggest that certain modifiers of TYRP1 would induce different brown colour degradation, which results in at least two different phases of brown. PMID:26886941

  16. Adjuvant and Salvage Radiation Therapy After Prostatectomy: American Society for Radiation Oncology/American Urological Association Guidelines

    Energy Technology Data Exchange (ETDEWEB)

    Valicenti, Richard K., E-mail: Richard.valicenti@ucdmc.ucdavis.edu [Department of Radiation Oncology, University of California, Davis School of Medicine, Davis, California (United States); Thompson, Ian [Department of Urology, University of Texas Health Science Center at San Antonio, San Antonio, Texas (United States); Albertsen, Peter [Division of Urology, University of Connecticut Health Center, Farmington, Connecticut (United States); Davis, Brian J. [Department of Radiation Oncology, Mayo Medical School, Rochester, Minnesota (United States); Goldenberg, S. Larry [Department of Urologic Sciences, University of British Columbia, Vancouver, British Columbia (Canada); Wolf, J. Stuart [Department of Urology, University of Michigan, Ann Arbor, Michigan (United States); Sartor, Oliver [Department of Medicine and Urology, Tulane Medical School, New Orleans, Louisiana (United States); Klein, Eric [Glickman Urological Kidney Institute, Cleveland Clinic, Cleveland, Ohio (United States); Hahn, Carol [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Michalski, Jeff [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Roach, Mack [Department of Radiation Oncology, University of California, San Francisco, San Francisco, California (United States); Faraday, Martha M. [Four Oaks, Inc (United States)

    2013-08-01

    Purpose: The purpose of this guideline was to provide a clinical framework for the use of radiation therapy after radical prostatectomy as adjuvant or salvage therapy. Methods and Materials: A systematic literature review using PubMed, Embase, and Cochrane database was conducted to identify peer-reviewed publications relevant to the use of radiation therapy after prostatectomy. The review yielded 294 articles; these publications were used to create the evidence-based guideline statements. Additional guidance is provided as Clinical Principles when insufficient evidence existed. Results: Guideline statements are provided for patient counseling, use of radiation therapy in the adjuvant and salvage contexts, defining biochemical recurrence, and conducting a restaging evaluation. Conclusions: Physicians should offer adjuvant radiation therapy to patients with adverse pathologic findings at prostatectomy (ie, seminal vesicle invastion, positive surgical margins, extraprostatic extension) and salvage radiation therapy to patients with prostate-specific antigen (PSA) or local recurrence after prostatectomy in whom there is no evidence of distant metastatic disease. The offer of radiation therapy should be made in the context of a thoughtful discussion of possible short- and long-term side effects of radiation therapy as well as the potential benefits of preventing recurrence. The decision to administer radiation therapy should be made by the patient and the multidisciplinary treatment team with full consideration of the patient's history, values, preferences, quality of life, and functional status. The American Society for Radiation Oncology and American Urological Association websites show this guideline in its entirety, including the full literature review.

  17. Adjuvant and Salvage Radiation Therapy After Prostatectomy: American Society for Radiation Oncology/American Urological Association Guidelines

    International Nuclear Information System (INIS)

    Purpose: The purpose of this guideline was to provide a clinical framework for the use of radiation therapy after radical prostatectomy as adjuvant or salvage therapy. Methods and Materials: A systematic literature review using PubMed, Embase, and Cochrane database was conducted to identify peer-reviewed publications relevant to the use of radiation therapy after prostatectomy. The review yielded 294 articles; these publications were used to create the evidence-based guideline statements. Additional guidance is provided as Clinical Principles when insufficient evidence existed. Results: Guideline statements are provided for patient counseling, use of radiation therapy in the adjuvant and salvage contexts, defining biochemical recurrence, and conducting a restaging evaluation. Conclusions: Physicians should offer adjuvant radiation therapy to patients with adverse pathologic findings at prostatectomy (ie, seminal vesicle invastion, positive surgical margins, extraprostatic extension) and salvage radiation therapy to patients with prostate-specific antigen (PSA) or local recurrence after prostatectomy in whom there is no evidence of distant metastatic disease. The offer of radiation therapy should be made in the context of a thoughtful discussion of possible short- and long-term side effects of radiation therapy as well as the potential benefits of preventing recurrence. The decision to administer radiation therapy should be made by the patient and the multidisciplinary treatment team with full consideration of the patient's history, values, preferences, quality of life, and functional status. The American Society for Radiation Oncology and American Urological Association websites show this guideline in its entirety, including the full literature review

  18. The use of abatacept in debilitating cavitating lung disease associated with rheumatoid arthritis, bronchocentric granulomatosis and aspergillosis.

    LENUS (Irish Health Repository)

    Neff, K

    2010-06-01

    A case of debilitating cavitating lung disease associated with rheumatoid arthritis and bronchocentric granulomatosis, which failed to respond to conventional medical or surgical treatment, is described. The patient was treated over 10 years with steroids, antimicrobial agents, disease-modifying antirheumatoid drugs and surgery. Lung function continued to decline and the patient presented for admission with recurrent pneumonia. Abatacept was initiated to modify the underlying immunopathology. Following 12 months of treatment with abatacept the patient has demonstrable improvement in lung function and lung anatomy, and has not presented to hospital with pneumonia. She has tolerated the treatment without complication. The use of abatacept has stabilised the lung disease in this case in the medium term and prevented readmission to hospital. These results suggest a larger role for abatacept in those with such disease in the future and may warrant further investigation.

  19. Oestrogen receptor beta over expression in males with non-small cell lung cancer is associated with better survival

    DEFF Research Database (Denmark)

    Skov, Birgit Guldhammer; Sode, Birgitte M Fischer; Pappot, H.

    2008-01-01

    BACKGROUND: Adenocarcinoma of the lung is more frequent in females than in males and the association with smoking is less pronounced than for the other histological subtypes of lung cancer. Oestrogen induction of cell proliferation has been found in breast adenocarcinomas, and since oestrogen...... receptors (ER) have been demonstrated in lung tumours, a similar role of oestrogens in the development of lung cancer has been suggested. We examined the expression of ERalpha, ERbeta and progesterone in a well defined cohort of patients with NSCLC with more than 15 years of follow up, and related the...... immunohistochemical staining and any of the clinical variables, including survival. None of the 104 patients had tumours positive for progesterone. CONCLUSION: The presence of ERbeta in a tumour seems to be a positive prognostic factor for men with non-small cell lung cancer. The finding confirms another recent study...

  20. Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

    Directory of Open Access Journals (Sweden)

    Wang Xiaoqin

    2005-10-01

    Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

  1. Harsh voice quality and its association with blackness in popular American media

    OpenAIRE

    Moisik, S.

    2013-01-01

    Performers use various laryngeal settings to create voices for characters and personas they portray. Although some research demonstrates the sociophonetic associations of laryngeal voice quality, few studies have documented or examined the role of harsh voice quality, particularly with vibration of the epilaryngeal structures (growling). This article qualitatively examines phonetic properties of vocal performances in a corpus of popular American media and evaluates the association of voice qu...

  2. The Association Between Self-Efficacy and Hypertension Self-Care Activities Among African American Adults

    OpenAIRE

    Warren-Findlow, Jan; Seymour, Rachel B.; Brunner Huber, Larissa R.

    2012-01-01

    Chronic disease management requires the individual to perform varying forms of self-care behaviors. Self-efficacy, a widely used psychosocial concept, is associated with the ability to manage chronic disease. In this study, we examine the association between self-efficacy to manage hypertension and six clinically prescribed hypertension self-care behaviors. We interviewed 190 African Americans with hypertension who resided in the greater metropolitan Charlotte area about their self-efficacy a...

  3. Heroin addiction in African Americans: a hypothesis-driven association study

    OpenAIRE

    Levran, Orna; Londono, Douglas; O'Hara, Kim; Randesi, Matthew; Rotrosen, John; Casadonte, Paul; Linzy, Shirley; Ott, Jurg; Adelson, Miriam; Kreek, Mary Jeanne

    2009-01-01

    Heroin addiction is a chronic complex disease with a substantial genetic contribution. This study was designed to identify gene variants associated with heroin addiction in African Americans. The emphasis was on genes involved in reward modulation, behavioral control, cognitive function, signal transduction, and stress response. We have performed a case-control association analysis by screening with 1350 variants of 130 genes. The sample consisted of 202 former severe heroin addicts in methad...

  4. Respiratory failure following anti-lung serum: study on mechanisms associated with surfactant system damage

    International Nuclear Information System (INIS)

    Within 2 minutes intravenous anti-lung serum (ALS) into guinea pig induces a respiratory failure that is fatal within 30 min. The relationship between surfactant, alveolar-capillary permeability and respiratory failure was studied. Within two minutes ALS induced a leak in the alveolar-capillary barrier. Within 30 minutes 28.3% (controls, given normal rabbit serum: 0.7%) of iv 131I-albumin, and 0.5% (controls 0.02%) of iv surfactant phospholipid tracer were recovered in bronchoalveolar lavage. Furthermore, 57% (controls 32%) of the endotracheally administered surfactant phospholipid became associated with lung tissue and only less than 0.5% left the lung. The distribution of proteins and phospholipids between the in vivo small volume bronchoalveolar lavages and the ex vivo bronchoalveolar lavages were dissimilar: 84% (controls 20%) of intravenously injected, lavageable 131I-albumin and 23% (controls 18%) of total lavageable phospholipid were recovered in the in vivo small volume bronchoalveolar lavages. ALS also decreased lavageable surfactant phospholipid by 41%. After ALS the minimum surface tension increased. The supernatant of the lavage increased the minimum surface tension of normal surfactant. In addition, the sediment fraction of the lavage had slow surface adsorption, and a marked reduction in 35,000 and 10,000 MW peptides. Exogenous surfactant ameliorated the ALS-induced respiratory failure. We propose that inhibition, altered intrapulmonary distribution, and dissociation of protein and phospholipid components of surfactant are important in early pathogenesis of acute respiratory failure

  5. TREM2 is associated with increased risk for Alzheimer’s disease in African Americans

    OpenAIRE

    Jin, Sheng Chih; Carrasquillo, Minerva M.; Benitez, Bruno A.; Skorupa, Tara; Carrell, David; Patel, Dwani; Lincoln, Sarah; Krishnan, Siddharth; Kachadoorian, Michaela; Reitz, Christiane; Mayeux, Richard; Wingo, Thomas S.; Lah, James J.; Levey, Allan I.; Murrell, Jill

    2015-01-01

    Background TREM2 encodes for triggering receptor expressed on myeloid cells 2 and has rare, coding variants that associate with risk for late-onset Alzheimer’s disease (LOAD) in Caucasians of European and North-American origin. This study evaluated the role of TREM2 in LOAD risk in African-American (AA) subjects. We performed exonic sequencing and validation in two independent cohorts of >800 subjects. We selected six coding variants (p.R47H, p.R62H, p.D87N, p.E151K, p.W191X, and p.L211P) for...

  6. ANCA-associated vasculitis in Hispanic Americans: an unrecognized severity.

    Science.gov (United States)

    Sreih, Antoine G; Mandhadi, Ranadeep; Aldaghlawi, Fadi; Khan, Asad; Irshad, Vajiha; Finn, Katherine; Block, Joel A

    2015-05-01

    This study aims to compare the severity and outcomes of antineutrophil cytoplasmic antibody (ANCA)-associated vasculitis (AAV) between Hispanics and Caucasians living in the same geographical area. All patients diagnosed with AAV at two academic institutions in Chicago from January 2006 to December 2012 were retrospectively and prospectively identified. Disease activity was measured with the Birmingham Vasculitis Activity Score (BVAS), and disease damage was measured with the Vasculitis Damage Index (VDI). Student's t test and chi-square tests were employed; p ≤ 0.05 was considered significant. Seventy patients with AAV were identified; 15 patients were excluded. Fifty-five patients were included in the study: 23 Hispanics and 32 Caucasians, 35 patients with granulomatosis with polyangiitis (Wegener's), 12 with microscopic polyangiitis, 7 with eosinophilic granulomatosis with polyangiitis, and 1 with renal-limited vasculitis. Compared to Caucasians, Hispanics had a higher BVAS at presentation (16.3 ± 7.6 versus 10.7 ± 7.5, p = 0.006), a higher VDI at presentation (2.90 ± 1.50 versus 2.06 ± 1.30, p = 0.030), and a cumulative VDI (3.90 ± 1.70 versus 2.50 ± 1.90, p = 0.010). Renal involvement was more common among Hispanics (85 % of Hispanics versus 48 % of Caucasians, p = 0.01). Seventy percent of Hispanics had acute renal failure (mean creatinine = 3.37 ± 4.4 mg/dl) of whom seven (50 %) required dialysis, versus 25 % of Caucasians (mean creatinine = 1.78 ± 1.57 mg/dl, p = 0.03) and only two requiring dialysis. Compared to Caucasians, Hispanics with AAV present with more severe disease and higher damage indices. Larger studies are required to confirm these findings and delineate the respective roles of environment and genetics in the pathogenesis of the disease. PMID:24752347

  7. Dose–Volume Metrics Associated With Radiation Pneumonitis After Stereotactic Body Radiation Therapy for Lung Cancer

    International Nuclear Information System (INIS)

    Purpose: To identify dose–volume factors associated with radiation pneumonitis (RP) after stereotactic body radiation therapy (SBRT) for lung cancer. Methods and Materials: This study analyzed 74 patients who underwent SBRT for primary lung cancer. The prescribed dose for SBRT was uniformly 48 Gy in four fractions at the isocenter. RP was graded according to the Common Terminology Criteria for Adverse Events (CTCAE) v.3. Symptomatic RP was defined as grade 2 or worse. Optimal cut-offs dividing the patient population into two subgroups based on the incidence of symptomatic RP were sought using the following dose–volume metrics: PTV volume (ml), mean lung dose (Gy), and V5, V10, V15, V20, V25, V30, V35, and V40 (%) of both lungs excluding the PTV. Results: With a median follow-up duration of 31.4 months, symptomatic RP was observed in 15 patients (20.3%), including 1 patient with grade 3. Optimal cut-offs for pulmonary dose–volume metrics were V25 and V20. These two factors were highly correlated with each other, and V25 was more significant. Symptomatic RP was observed in 14.8% of the patients with V25 <4.2%, and the rate was 46.2% in the remainder (p = 0.019). PTV volume was another significant factor. The symptomatic RP rate was significantly lower in the group with PTV <37.7 ml compared with the larger PTV group (11.1% vs. 34.5%, p = 0.020). The patients were divided into three subgroups (patients with PTV <37.7 ml; patients with, PTV ≥37.7 ml and V25 <4.2%; and patients with PTV ≥37.7 ml and V25 ≥4.2%); the incidence of RP grade 2 or worse was 11.1%, 23.5%, and 50.0%, respectively (p = 0.013). Conclusions: Lung V25 and PTV volume were significant factors associated with RP after SBRT.

  8. Dose-Volume Metrics Associated With Radiation Pneumonitis After Stereotactic Body Radiation Therapy for Lung Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Matsuo, Yukinori, E-mail: ymatsuo@kuhp.kyoto-u.ac.jp [Department of Radiation Oncology and Image-applied Therapy, Kyoto University, Kyoto (Japan); Shibuya, Keiko; Nakamura, Mitsuhiro; Narabayashi, Masaru; Sakanaka, Katsuyuki; Ueki, Nami; Miyagi, Ken; Norihisa, Yoshiki; Mizowaki, Takashi [Department of Radiation Oncology and Image-applied Therapy, Kyoto University, Kyoto (Japan); Nagata, Yasushi [Division of Radiation Oncology, Hiroshima University Hospital, Hiroshima (Japan); Hiraoka, Masahiro [Department of Radiation Oncology and Image-applied Therapy, Kyoto University, Kyoto (Japan)

    2012-07-15

    Purpose: To identify dose-volume factors associated with radiation pneumonitis (RP) after stereotactic body radiation therapy (SBRT) for lung cancer. Methods and Materials: This study analyzed 74 patients who underwent SBRT for primary lung cancer. The prescribed dose for SBRT was uniformly 48 Gy in four fractions at the isocenter. RP was graded according to the Common Terminology Criteria for Adverse Events (CTCAE) v.3. Symptomatic RP was defined as grade 2 or worse. Optimal cut-offs dividing the patient population into two subgroups based on the incidence of symptomatic RP were sought using the following dose-volume metrics: PTV volume (ml), mean lung dose (Gy), and V5, V10, V15, V20, V25, V30, V35, and V40 (%) of both lungs excluding the PTV. Results: With a median follow-up duration of 31.4 months, symptomatic RP was observed in 15 patients (20.3%), including 1 patient with grade 3. Optimal cut-offs for pulmonary dose-volume metrics were V25 and V20. These two factors were highly correlated with each other, and V25 was more significant. Symptomatic RP was observed in 14.8% of the patients with V25 <4.2%, and the rate was 46.2% in the remainder (p = 0.019). PTV volume was another significant factor. The symptomatic RP rate was significantly lower in the group with PTV <37.7 ml compared with the larger PTV group (11.1% vs. 34.5%, p = 0.020). The patients were divided into three subgroups (patients with PTV <37.7 ml; patients with, PTV {>=}37.7 ml and V25 <4.2%; and patients with PTV {>=}37.7 ml and V25 {>=}4.2%); the incidence of RP grade 2 or worse was 11.1%, 23.5%, and 50.0%, respectively (p = 0.013). Conclusions: Lung V25 and PTV volume were significant factors associated with RP after SBRT.

  9. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    International Nuclear Information System (INIS)

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates β-catenin and RUNX2. -- Abstract: Wnt/β-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of β-catenin and RUNX2, as well as inhibiting the nuclear translocation of β-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC

  10. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates β-catenin and RUNX2. -- Abstract: Wnt/β-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of β-catenin and RUNX2, as well as inhibiting the nuclear translocation of β-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  11. Pericardial tamponade masking associated pulmonary thrombo embolism in a case of adeno carcinoma of lung

    Directory of Open Access Journals (Sweden)

    Srinivasan Kandasamy

    2015-08-01

    Full Text Available This case report describes a patient admitted with shortness of breath of 15 days duration and found to have cardiac tamponade, which masked concomitant pulmonary embolism that was diagnosed by echocardiographic signs of dilate RA/RV with PAH only after successful pericardiocentesis. Subsequently patient was found to have widely metastatic adenocarcinoma of lungs. This case emphasizes the diagnostic challenge when cardiac tamponade is associated with pulmonary thromboembolism and requires high index of clinical suspicion in patients with underlying malignancy. [Int J Res Med Sci 2015; 3(8.000: 2126-2128

  12. Longitudinal association of hemostatic factors with risk for cancers of the breast, colorectum, and lung among postmenopausal women.

    Science.gov (United States)

    Kabat, Geoffrey C; Salazar, Christian R; Zaslavsky, Oleg; Lane, Dorothy S; Rohan, Thomas E

    2016-09-01

    The aim of this study was to examine whether hemostatic factors associated with coagulation and inflammation pathways are associated with cancer risk in postmenopausal women. We used data from the Women's Health Initiative study to examine the association of plasma fibrinogen levels, factor VII antigen activity, and factor VII concentration measured at baseline and during follow-up with the risk for cancers of the breast, colorectum, and lung. Among 5287 women who were followed up for a median of 11.4 years, 275 cases of breast cancer, 102 cases of colorectal cancer, and 90 cases of lung cancer were identified. Cox proportional hazards models were used to estimate hazard ratios and 95% confidence intervals for the association of hemostatic factors with each cancer. Hemostatic factors were not associated with breast cancer in either baseline or longitudinal analyses. Baseline hemostatic factors showed weak associations with colorectal cancer; however, no association was seen in longitudinal analyses. Fibrinogen was positively associated with lung cancer in both baseline and longitudinal analyses; the association was seen only in never and former smokers, not in current smokers. We found no evidence of an association between hemostatic factors and breast or colorectal cancer in postmenopausal women. The positive association of fibrinogen levels with lung cancer requires confirmation in larger studies. PMID:26317383

  13. Frequency Distribution and Association of some Morpho- and Physiological Traits in Patients with Lung Diseases in Kosova.

    Science.gov (United States)

    Alija, Avdulla J; Bajraktari, Ismet D; Bresgen, Nikolaus; Hadziselimovic, Rifat; Beqiraj, Valentina; Selimi, Mimoza; Salihu, Hyrzeme; Mikullovci, Besime; Eckl, Peter M

    2015-12-01

    The aim of this study was to investigate the distribution of specific phenotypes in patients with lung diseases as well as their eventual association with the risk of developing lung diseases. For this purpose 2777 patients with lung diseases and 2778 healthy individuals from all over Kosova were examined for the appearance of the following selected phenotypes: ear lobe free (ELF)/ear lobe attached, normal chin (NC)/cleft chin, tongue roller (TR)/non roller, hand clasping right thumb over (HC)/hand clasping left thumb over, righthanded (RH)/lefthanded. In addition, the blood group from ABO system and the presence or absence of the Rhesus factor asphenotypical markers were observed. The results obtained show significant differences between control and lung disease patients for NC (p ≤ 0.05) and TR (p ≤ 0.005) as well as for blood groups AB (p ≤ 0.05) and O (p ≤ 0.005). These results point to eventually increased levels of genetic load as a result of the increased homozygosity in some gene loci causing an increased frequency of some recessive phenotypes in patients with lung diseases. Together with the specific associations observed, these preliminary findings could serve as a basis for further in depth investigations with respect to the types of lung diseases, occupational exposure and dietary habits, and thus is expected to contribute to an understanding of predispositions and susceptibility to lung diseases. PMID:26987159

  14. American Association of Clinical Endocrinologists, Associazione Medici Endocrinologi, and European Thyroid Association Medical Guidelines for Clinical Practice for the Diagnosis and Management of thyroid Nodules

    DEFF Research Database (Denmark)

    Gharib, Hossein; Papini, Enrico; Paschke, Ralf;

    2010-01-01

    American Association of Clinical Endocrinologists, Associazione Medici Endocrinologi, and European Thyroid Association Medical Guidelines for Clinical Practice for the Diagnosis and Management of Thyroid Nodules are systematically developed statements to assist health care professionals in medica...

  15. American Association of Clinical Endocrinologists, Associazione Medici Endocrinologi, and European Thyroid Association Medical guidelines for clinical practice for the diagnosis and management of thyroid nodules

    DEFF Research Database (Denmark)

    Gharib, Hossein; Papini, Enrico; Paschke, Ralf;

    2010-01-01

    American Association of Clinical Endocrinologists, Associazione Medici Endocrinologi, and European Thyroid Association Medical Guidelines for Clinical Practice for the Diagnosis and Management of Thyroid Nodules are systematically developed statements to assist health care professionals in medica...

  16. Cruciferous vegetable intake is inversely associated with lung cancer risk among smokers: a case-control study

    Directory of Open Access Journals (Sweden)

    Zhang Yuesheng

    2010-04-01

    Full Text Available Abstract Background Inverse associations between cruciferous vegetable intake and lung cancer risk have been consistently reported. However, associations within smoking status subgroups have not been consistently addressed. Methods We conducted a hospital-based case-control study with lung cancer cases and controls matched on smoking status, and further adjusted for smoking status, duration, and intensity in the multivariate models. A total of 948 cases and 1743 controls were included in the analysis. Results Inverse linear trends were observed between intake of fruits, total vegetables, and cruciferous vegetables and risk of lung cancer (ORs ranged from 0.53-0.70, with P for trend Conclusions Our findings are consistent with the smoking-related carcinogen-modulating effect of isothiocyanates, a group of phytochemicals uniquely present in cruciferous vegetables. Our data support consumption of a diet rich in cruciferous vegetables may reduce the risk of lung cancer among smokers.

  17. Report of a National Heart, Lung, And Blood Institute Workshop: heterogeneity in cardiometabolic risk in Asian Americans In the U.S. Opportunities for research.

    Science.gov (United States)

    Narayan, K M Venkat; Aviles-Santa, Larissa; Oza-Frank, Reena; Pandey, Mona; Curb, J David; McNeely, Marguerite; Araneta, Maria Rosario G; Palaniappan, Latha; Rajpathak, Swapnil; Barrett-Connor, Elizabeth

    2010-03-01

    The Asian and Pacific Islander population (Asian Americans) in the U.S. has increased dramatically in the last few decades. Yet, data on cardiovascular disease (CVD) in this population are scarce. The National Heart, Lung, and Blood Institute (NHLBI) of the National Institutes of Health conducted an Expert Workshop to: 1) assess the importance of studying CVD in Asian Americans in the U.S.; and 2) consider strategic options for further investigations of CVD in this population. There is considerable geographical, ethnic, cultural, and genetic diversity within this population. Limited data also suggest striking differences in the risk of CVD, obesity, type 2 diabetes mellitus, and other CVD risk factors across the Asian-American population. The Asian-American population is a new diverse pool with less contemporary genetic and cultural admixture relative to groups that have lived in the U.S. for generations, plus it is diverse in lifestyle including culture, diet, and family structure. This diversity provides a window of opportunity for research on genes and gene-environment interactions and also to investigate how acculturation/assimilation to U.S. lifestyles affects health and CVD risk among relatively homogenous groups of recent immigrants. Given the heterogeneity in body weight, body size, and CVD risk, the Asian-American population in the U.S. offers a unique model to study the interaction and relationships between visceral adiposity and adipose tissue distribution and beta cell function, insulin resistance, and atherosclerosis. PMID:20202512

  18. Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast

    International Nuclear Information System (INIS)

    Carcinoma-associated fibroblasts (CAFs) can promote carcinogenesis and tumor progression. Only limited data on the response of CAFs to chemotherapy and their potential impact on therapy outcome are available. This study was undertaken to analyze the influence of chemotherapy on carcinoma-associated fibroblasts (CAFs) in vitro and in vivo. The in vivo response of stromal cells to chemotherapy was investigated in 22 neoadjuvant treated breast tumors on tissue sections before and after chemotherapy. Response to chemotherapy was analyzed in vitro in primary cultures of isolated CAFs from 28 human lung and 9 breast cancer tissues. The response was correlated to Mdm2, ERCC1 and TP53 polymorphisms and TP53 mutation status. Additionally, the cytotoxic effects were evaluated in an ex vivo experiment using cultured tissue slices from 16 lung and 17 breast cancer specimens. Nine of 22 tumors showed a therapy-dependent reduction of stromal activity. Pathological response of tumor or stroma cells did not correlate with clinical response. Isolated CAFs showed little sensitivity to paclitaxel. In contrast, sensitivity of CAFs to cisplatinum was highly variable with a GI50 ranging from 2.8 to 29.0 μM which is comparable to the range observed in tumor cell lines. No somatic TP53 mutation was detected in any of the 28 CAFs from lung cancer tissue. In addition, response to cisplatinum was not significantly associated with the genotype of TP53 nor Mdm2 and ERCC1 polymorphisms. However, we observed a non-significant trend towards decreased sensitivity in the presence of TP53 variant genotype. In contrast to the results obtained in isolated cell culture, in tissue slice culture breast cancer CAFs responded to paclitaxel within their microenvironment in the majority of cases (9/14). The opposite was observed in lung cancer tissues: only few CAFs were sensitive to cisplatinum within their microenvironment (2/15) whereas a higher proportion responded to cisplatinum in isolated culture

  19. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: a report from the female lung cancer consortium in Asia.

    Science.gov (United States)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2015-07-15

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of seven telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a previously reported genome-wide association study. Using a group of 1,536 individuals with phenotypically measured telomere length in WBCs in the prospective Shanghai Women's Health study, we demonstrated the utility of a genetic risk score (GRS) of seven telomere-length associated variants to predict telomere length in an Asian population. We then found that GRSs used as instrumental variables to predict longer telomere length were associated with increased lung cancer risk (OR = 1.51 (95% CI = 1.34-1.69) for upper vs. lower quartile of the weighted GRS, p value = 4.54 × 10(-14) ) even after removing rs2736100 (p value = 4.81 × 10(-3) ), a SNP in the TERT locus robustly associated with lung cancer risk in prior association studies. Stratified analyses suggested the effect of the telomere-associated GRS is strongest among younger individuals. We found no difference in GRS effect between adenocarcinoma and squamous cell subtypes. Our results indicate that a genetic background that favors longer telomere length may increase lung cancer risk, which is consistent with earlier prospective studies relating longer telomere length with increased lung cancer risk. PMID:25516442

  20. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: A report from the Female Lung Cancer Consortium in Asia

    Science.gov (United States)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2016-01-01

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of 7 telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a previously reported genome-wide association study. Using a group of 1,536 individuals with phenotypically measured telomere length in WBCs in the prospective Shanghai Women’s Health study, we demonstrated the utility of a genetic risk score (GRS) of 7 telomere-length associated variants to predict telomere length in an Asian population. We then found that GRSs used as instrumental variables to predict longer telomere length were associated with increased lung cancer risk (OR = 1.51 (95% CI=1.34–1.69) for upper vs. lower quartile of the weighted GRS, P-value=4.54×10−14) even after removing rs2736100 (P-value=4.81×10−3), a SNP in the TERT locus robustly associated with lung cancer risk in prior association studies. Stratified analyses suggested the effect of the telomere-associated GRS is strongest among younger individuals. We found no difference in GRS effect between adenocarcinoma and squamous cell subtypes. Our results indicate that a genetic background that favors longer telomere length may increase lung cancer risk, which is consistent with earlier prospective studies relating longer telomere length with increased lung cancer risk. PMID:25516442

  1. Cost-effectiveness analysis on the results of screening of lung cancer using helical CT conducted by the anti-lung cancer association (ALCA)

    International Nuclear Information System (INIS)

    To compare Yen/person saved in lung cancer screening using helical CT with Yen/person in the screening using conventional direct chest X-rays conducted under the Anti-lung cancer association program of the Tokyo Health Service Association. A mathematical model for cancer screening was used to estimate net number of person relieved from lung cancer by the screening and net cost required for the screening. Finally cost-effectiveness ratios in terms of Yen/person saved were calculated and compared between the two programs. Several important variables employed in the model were as follows: 5 year survival rate in chest X-ray group was 50%, and the rate in helical CT group was 75%. Cost of screening in the chest X-ray group was 15,000 Yen, and that in the helical CT group was 25,000 Yen. Cost/person screened was 14,470 Yen for chest X-ray and 21,890 Yen for helical CT. Cost/person saved was 267 x 105 Yen in X-ray group and 112 x 105 Yen in CT group. Thus the cost was higher, but cost-effectiveness ratio was better in the CT screening group. Helical CT can be adopted for lung cancer screening in stead of chest X-ray if total cost is affordable. (author)

  2. IGFBP2/FAK pathway is causally associated with dasatinib resistance in non-small Cell Lung Cancer Cells

    OpenAIRE

    Lu, Haibo; Wang, Li; Gao, Wen; Meng, Jieru; Dai, Bingbing; Wu, Shuhong; Minna, John; Roth, Jack A.; Hofstetter, Wayne L.; Swisher, Stephen G.; Fang, Bingliang

    2013-01-01

    IGFBP2 expression is increased in various types of cancers, including in a subset of lung cancer patients. Because IGFBP2 is involved in signal transduction of some critical cancer related pathways, we analyzed the association between IGFBP2 and response to pathway-targeted agents in seven human non–small cell lung cancer (NSCLC) cell lines. Western blot analysis and enzyme-linked immunosorbent assay (ELISA) showed that four of the seven NSCLC cell lines analyzed expressed high levels of IGFB...

  3. Improved pulmonary function following pirfenidone treatment in a patient with progressive interstitial lung disease associated with systemic sclerosis

    Directory of Open Access Journals (Sweden)

    Zarir F Udwadia

    2015-01-01

    Full Text Available Pirfenidone is an anti-fibrotic drug which has been approved for the management of patients with Idiopathic Pulmonary Fibrosis (IPF. However, its role in interstitial lung disease (ILD due to other causes such as systemic sclerosis (SSc is not clear. We present a case of a patient with SSc associated ILD who showed a subjective as well as objective improvement in lung function with pirfenidone.

  4. The International Association for the Study of Lung Cancer Lymph Node Map: A Radiologic Atlas and Review

    OpenAIRE

    Kim, Jin Hwan; van Beek, Edwin JR; Murchison, John T; Marin, Aleksander; Mirsadraee, Saeed

    2015-01-01

    Accurate lymph node staging of lung cancer is crucial in determining optimal treatment plans and predicting patient outcome. Currently used lymph node maps have been reconciled to the internationally accepted International Association for the Study of Lung Cancer (IASLC) map published in the seventh edition of TNM classification system of malignant tumours. This article provides computed tomographic illustrations of the IASLC nodal map, to facilitate its application in day-to-day clinical pra...

  5. Treatment with ginkgo biloba extract protects rats against acute pancreatitis-associated lung injury by modulating alveolar macrophage

    OpenAIRE

    Xu, Xiao-Wu; Yang, Xiao-Min; Bai, Yong-Heng; Zhao, Yan-Rong; SHI, GONG-SHENG; Zhang, Jian-Guo; Zheng, Yi-Hu

    2014-01-01

    Introduction Acute pancreatitis (AP) protease release induces lung parenchymal destruction via inflammatory mediators. Ginkgo biloba has been reported to have anti-inflammatory effects. Aim To evaluate the effect of ginkgo biloba extract on experimental acute pancreatitis-associated lung injury in the rat and to investigate the underlying mechanisms. Material and methods Acute pancreatitis was induced in rats by injection of 5% sodium taurocholate into the biliary pancreatic duct. Ginkgo bilo...

  6. Health effects of radon exposure. Report of the Council on Scientific Affairs, American Medical Association

    International Nuclear Information System (INIS)

    The consensus of scientists is that exposure to radon is hazardous, but disagreement exists about the effects of lower radon concentrations. Studies of underground miners have indicated that the risk of lung cancer increases in proportion to the intensity and duration of exposure to radon, and a recent authoritative report (BEIR IV) has concluded that estimates based on those studies are appropriate for estimating risks for occupants of homes. The BEIR IV report concluded that smoking cigarettes increases the risk of lung cancer associated with radon. Average radon levels in US homes range from 0.055 to 0.148 Bq/L (1.5 to 4 pCi/L), depending on the circumstances of measurement. Few studies have investigated health outcomes in occupants of homes with high radon levels. In advising patients about reducing the risks associated with radon, physicians should consider the costs, as well as the benefits, of remedial actions, and they should emphasize that, by far, the best way to avoid lung cancer is to stop smoking

  7. Comparison between the International Physical Activity Questionnaire and the American College of Sports Medicine/American Heart Association criteria to classify the physical activity profile in adults

    Directory of Open Access Journals (Sweden)

    Suzana Alves de Moraes

    2013-07-01

    Full Text Available OBJECTIVE: the study aims to evaluate the reproducibility between the International Physical Activity Questionnaire and the American College of Sports Medicine/American Heart Association criteria to classify the physical activity profile in an adult population living in Ribeirão Preto, SP, Brazil. METHODS: population-based cross-sectional study, including 930 adults of both genders. The reliability was evaluated by Kappa statistics, estimated according to socio-demographic strata. RESULTS: the kappa estimates showed good agreement between the two criteria in all strata. However, higher prevalence of "actives" was found by using the American College of Sports Medicine/American Heart Association. CONCLUSIONS: although the estimates have indicated good agreement, the findings suggest caution in choosing the criteria to classify physical activity profile mainly when "walking" is the main modality of physical activity.

  8. A Meta-analysis of Association between MGMT Gene 
Promoter Methylation and Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Nianzhen FANG

    2014-08-01

    Full Text Available Backgroud and objective DNA promoter methylation of the tumor suppressor genes was one of the key mechanism for gene silence. The aim of this study is to investigate the difference of MGMT gene promoter methylation rate in tumor tissue and autologous controls (serum, normal lung tissue and bronchial lavage fluid in patients with non-small cell lung cancer (NSCLC. Methods The databases of Medline, EMBSE, CNKI and Wanfang were searched for selection of published articles of MGMT gene promoter methylation and non-small cell lung carcinoma risk. The pooled odds ratio (OR and percentage of MGMT for lung cancer tissue of NSCLC patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled. Results 15 articles of association between MGMT gene promoter methylation and non small cell lung carcinoma risk were included in this meta-analysis. The combined results demonstrated the methylation rate of MGMT in NSCLC cancer tissue was 38% (95%CI: 23%-53%. For normal lung tissue, plasma and the bronchial lavage fluid were 16% (95%CI: 5%-27%, 23% (95%CI: 10%-34% and 39% (95%CI: 23%-55% respectively. The OR in cancer tissue was much higher than that in normal lung tissue and plasma odds ratio (OR 3.98 (95%CI: 2.71-5.84, P0.05. Conclusions Mehtylation rate in MGMT gene promoter of cancer tissue in NSCLC patients was much higher than that in normal lung tissue and plasma, which showed a close association between NSCLC cancer and MGMT gene promoter methylation.

  9. Evidence for chronic inflammation as a component of the interstitial lung disease associated with progressive systemic sclerosis

    International Nuclear Information System (INIS)

    Progressive systemic sclerosis (PSS) is a generalized disorder characterized by fibrosis of many organs including the lung parenchyma. Unlike most other interstitial disorders, traditional concepts of the interstitial lung disease associated with PSS have held it to be a ''pure'' fibrotic disorder without a significant inflammatory component. To directly evaluate whether an active alveolitis is associated with this disorder, patients with chronic interstitial lung disease and PSS were studied by open lung biopsy, gallium-67 scanning, and bronchoalveolar lavage. Histologic evaluation of the biopsies demonstrated that the interstitial fibrosis of PSS is clearly associated with the presence of macrophages, lymphocytes, and polymorphonuclear leukocytes, both in the interstitium and on the alveolar epithelial surface. Gallium-67 scans were positive in 77% of the patients, showing diffuse, primarily lower zone uptake, suggestive of active inflammation. Consistent with the histologic findings, bronchoalveolar lavage studies demonstrated a mild increase in the proportions of neutrophils and eosinophils with occasional increased numbers of lymphocytes. Importantly, alveolar macrophages from patients with PSS showed increased release of fibronectin and alveolar-macrophage-derived growth factor, mediators that together stimulate lung fibroblasts to proliferate, thus suggesting at least one mechanism modulating the lung fibrosis of these patients

  10. Association with Amino Acids Does Not Enhance Efficacy of Polymerized Liposomes As a System for Lung Gene Delivery.

    Science.gov (United States)

    Bandeira, Elga; Lopes-Pacheco, Miquéias; Chiaramoni, Nadia; Ferreira, Débora; Fernandez-Ruocco, Maria J; Prieto, Maria J; Maron-Gutierrez, Tatiana; Perrotta, Ramiro M; de Castro-Faria-Neto, Hugo C; Rocco, Patricia R M; Alonso, Silvia Del Valle; Morales, Marcelo M

    2016-01-01

    Development of improved drug and gene delivery systems directly into the lungs is highly desirable given the important burden of respiratory diseases. We aimed to evaluate the safety and efficacy of liposomes composed of photopolymerized lipids [1,2-bis-(tricosa-10,12-diynoyl)-sn-glycero-3-phosphocholine] associated with amino acids as vectors for gene delivery into the lungs of healthy animals. Lipopolymer vesicles, in particular, are more stable than other types of liposomes. In this study, lipopolymers were associated with l-arginine, l-tryptophan, or l-cysteine. We hypothesized that the addition of these amino acids would enhance the efficacy of gene delivery to the lungs by the lipopolymers. l-Arginine showed the highest association efficiency due to its positive charge and better surface interactions. None of the formulations caused inflammation or altered lung mechanics, suggesting that these lipopolymers can be safely administered as aerosols. All formulations were able to induce eGFP mRNA expression in lung tissue, but the addition of amino acids reduced delivery efficacy when compared with the simple lipopolymer particle. These results indicate that this system could be further explored for gene or drug delivery targeting lung diseases. PMID:27199766

  11. Association with amino acids does not enhance efficacy of polymerized liposomes as a system for lung gene delivery

    Directory of Open Access Journals (Sweden)

    Elga eBernardo Bandeira De Melo

    2016-04-01

    Full Text Available Development of improved drug and gene delivery systems directly into the lungs is highly desirable given the important burden of respiratory diseases. We aimed to evaluate the safety and efficacy of liposomes composed of photopolymerized lipids (1,2-bis-(tricosa-10,12-diynoyl-sn-glycero-3-phosphocholine associated with amino acids as vectors for gene delivery into the lungs of healthy animals. Lipopolymer vesicles, in particular, are more stable than other types of liposomes. In this study, lipopolymers were associated with L-arginine, L-tryptophan, or L-cysteine. We hypothesized that the addition of these amino acids would enhance the efficacy of gene delivery to the lungs by the lipopolymers. L-Arginine showed the highest association efficiency due to its positive charge and better surface interactions. None of the formulations caused inflammation or altered lung mechanics, suggesting that these lipopolymers can be safely administered as aerosols. All formulations were able to induce eGFP mRNA expression in lung tissue, but the addition of amino acids reduced delivery efficacy when compared with the simple lipopolymer particle. These results indicate that this system could be further explored for gene or drug delivery targeting lung diseases.

  12. Association with Amino Acids Does Not Enhance Efficacy of Polymerized Liposomes As a System for Lung Gene Delivery

    Science.gov (United States)

    Bandeira, Elga; Lopes-Pacheco, Miquéias; Chiaramoni, Nadia; Ferreira, Débora; Fernandez-Ruocco, Maria J.; Prieto, Maria J.; Maron-Gutierrez, Tatiana; Perrotta, Ramiro M.; de Castro-Faria-Neto, Hugo C.; Rocco, Patricia R. M.; Alonso, Silvia del Valle; Morales, Marcelo M.

    2016-01-01

    Development of improved drug and gene delivery systems directly into the lungs is highly desirable given the important burden of respiratory diseases. We aimed to evaluate the safety and efficacy of liposomes composed of photopolymerized lipids [1,2-bis-(tricosa-10,12-diynoyl)-sn-glycero-3-phosphocholine] associated with amino acids as vectors for gene delivery into the lungs of healthy animals. Lipopolymer vesicles, in particular, are more stable than other types of liposomes. In this study, lipopolymers were associated with l-arginine, l-tryptophan, or l-cysteine. We hypothesized that the addition of these amino acids would enhance the efficacy of gene delivery to the lungs by the lipopolymers. l-Arginine showed the highest association efficiency due to its positive charge and better surface interactions. None of the formulations caused inflammation or altered lung mechanics, suggesting that these lipopolymers can be safely administered as aerosols. All formulations were able to induce eGFP mRNA expression in lung tissue, but the addition of amino acids reduced delivery efficacy when compared with the simple lipopolymer particle. These results indicate that this system could be further explored for gene or drug delivery targeting lung diseases. PMID:27199766

  13. Heroin addiction in African Americans: a hypothesis-driven association study.

    Science.gov (United States)

    Levran, O; Londono, D; O'Hara, K; Randesi, M; Rotrosen, J; Casadonte, P; Linzy, S; Ott, J; Adelson, M; Kreek, M J

    2009-07-01

    Heroin addiction is a chronic complex disease with a substantial genetic contribution. This study was designed to identify gene variants associated with heroin addiction in African Americans. The emphasis was on genes involved in reward modulation, behavioral control, cognitive function, signal transduction and stress response. We have performed a case-control association analysis by screening with 1350 variants of 130 genes. The sample consisted of 202 former severe heroin addicts in methadone treatment and 167 healthy controls with no history of drug abuse. Single nucleotide polymorphism (SNP), haplotype and multi-SNP genotype pattern analyses were performed. Seventeen SNPs showed point-wise significant association with heroin addiction (nominal Pvulnerability. PMID:19500151

  14. Knowledge Gaps in Cardiovascular Care of the Older Adult Population: A Scientific Statement From the American Heart Association, American College of Cardiology, and American Geriatrics Society.

    Science.gov (United States)

    Rich, Michael W; Chyun, Deborah A; Skolnick, Adam H; Alexander, Karen P; Forman, Daniel E; Kitzman, Dalane W; Maurer, Mathew S; McClurken, James B; Resnick, Barbara M; Shen, Win K; Tirschwell, David L

    2016-05-24

    The incidence and prevalence of most cardiovascular disorders increase with age, and cardiovascular disease is the leading cause of death and major disability in adults ≥75 years of age; however, despite the large impact of cardiovascular disease on quality of life, morbidity, and mortality in older adults, patients aged ≥75 years have been markedly underrepresented in most major cardiovascular trials, and virtually all trials have excluded older patients with complex comorbidities, significant physical or cognitive disabilities, frailty, or residence in a nursing home or assisted living facility. As a result, current guidelines are unable to provide evidence-based recommendations for diagnosis and treatment of older patients typical of those encountered in routine clinical practice. The objectives of this scientific statement are to summarize current guideline recommendations as they apply to older adults, identify critical gaps in knowledge that preclude informed evidence-based decision making, and recommend future research to close existing knowledge gaps. To achieve these objectives, we conducted a detailed review of current American College of Cardiology/American Heart Association and American Stroke Association guidelines to identify content and recommendations that explicitly targeted older patients. We found that there is a pervasive lack of evidence to guide clinical decision making in older patients with cardiovascular disease, as well as a paucity of data on the impact of diagnostic and therapeutic interventions on key outcomes that are particularly important to older patients, such as quality of life, physical function, and maintenance of independence. Accordingly, there is a critical need for a multitude of large population-based studies and clinical trials that include a broad spectrum of older patients representative of those seen in clinical practice and that incorporate relevant outcomes important to older patients in the study design. The

  15. Genetic variants in inducible nitric oxide synthase gene are associated with the risk of radiation-induced lung injury in lung cancer patients receiving definitive thoracic radiation

    International Nuclear Information System (INIS)

    Background and purpose: Nitric oxide (NO), mainly synthesized by inducible nitric oxide synthase (NOS2) in pathological conditions, plays an important role in cytotoxicity, inflammation and fibrosis. Elevations in exhaled NO after thoracic radiation have been reported to predict radiation-induced lung injury (RILI). This study examined whether genetic variations in NOS2 gene is associated with the risk of RILI. Material and methods: A cohort of 301 patients between 2009 and 2011 were genotyped for 21 single nucleotide polymorphisms (SNPs) in the NOS2 gene by the Sequenom MassArray system. Kaplan–Meier cumulative probability was used to assess RILI risk and Cox proportional hazards analyses were performed to evaluate the effect of NOS2 genotypes on RILI. Results: Multivariate analysis found that three SNPs (rs2297518, rs1137933 and rs16949) in NOS2 were significantly associated with risk of RILI ⩾ 2 (P value = 0.001, 0.000092, 0.001, respectively) after adjusting for other covariates. Their associations were independent of radiation dose and mean lung dose. Further haplotype analysis indicated that the ATC haplotype of three SNPs is associated with reducing the risk of developing RILI. Conclusion: Our results demonstrate that genetic variants of NOS2 may serve as a reliable predictor of RILI in lung cancer patients treated with thoracic radiation

  16. Lung cancer

    International Nuclear Information System (INIS)

    There will be over 160,000 cases of lung cancer diagnosed in the US in 1991, and deaths from this disease account for a quarter of all cancer deaths in this country. The incidence of lung cancer has continued to increase, especially among women. With 31% of American men and 25% of American women identified in the 1985 census as cigarette smokers, it is likely that this trend will continue well into the next century. Unfortunately, the majority of patients present with locally advanced tumors or distant metastatic disease. Presently, most patients with lung cancer will receive radiation therapy either in an attempt to control inoperable or locally advanced disease, or for palliation of symptomatic intrathoracic or metastatic disease. Because of the poor prognosis of all patients excepting those with early stage resectable lesions, lung cancer is appropriately the subject of intense clinical investigation and controversy throughout the world

  17. Lymphopenia Association With Gross Tumor Volume and Lung V5 and Its Effects on Non-Small Cell Lung Cancer Patient Outcomes

    International Nuclear Information System (INIS)

    Purpose: Radiation therapy (RT) can both suppress and stimulate the immune system. We sought to investigate the mechanisms underlying radiation-induced lymphopenia and its associations with patient outcomes in non-small cell lung cancer (NSCLC). Methods and Materials: Subjects consisted of 711 patients who had received definitive RT for NSCLC. A lymphocyte nadir was calculated as the minimum lymphocyte value measured during definitive RT. Associations between gross tumor volumes (GTVs) and lung dose-volume histogram (DVH) parameters with lymphocyte nadirs were assessed with Spearman correlation coefficients. Relationships between lymphocyte nadirs with overall survival (OS) and event free survival (EFS) were evaluated with Kaplan-Meier analysis and compared with log-rank test results. Multivariate regressions were conducted with linear and Cox regression analyses. All variables were analyzed as continuous if possible. Results: Larger GTVs were correlated with lower lymphocyte nadirs regardless of concurrent chemotherapy receipt (with concurrent: r = −0.26, P<.0001; without: r = −0.48, P<.0001). Analyses of lung DVH parameters revealed significant correlations at lower doses (lung V5-V10: P<.0001) that incrementally decreased and became nonsignificant at higher doses (lung V60-V70: P>.05). Of note, no significant associations were detected between GTV and lung DVH parameters with total leukocyte, neutrophil, or monocyte nadirs during RT or with lymphocyte count prior to RT. Multivariate analysis revealed larger GTV (P<.0001), receipt of concurrent chemotherapy (P<.0001), twice-daily radiation fractionation (P=.02), and stage III disease (P=.05) to be associated with lower lymphocyte nadirs. On univariate analysis, patients with higher lymphocyte nadirs exhibited significantly improved OS (hazard ratio [HR] = 0.51 per 103 lymphocytes/μL, P=.01) and EFS (HR = 0.46 per 103 lymphocytes/μL, P<.0001). These differences held on multivariate analyses, controlling

  18. Lymphopenia Association With Gross Tumor Volume and Lung V5 and Its Effects on Non-Small Cell Lung Cancer Patient Outcomes

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Chad [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao, Zhongxing, E-mail: zliao@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gomez, Daniel; Levy, Lawrence; Zhuang, Yan; Gebremichael, Rediet A. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Hong, David S. [Department of Investigational Cancer Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Komaki, Ritsuko; Welsh, James W. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2014-08-01

    Purpose: Radiation therapy (RT) can both suppress and stimulate the immune system. We sought to investigate the mechanisms underlying radiation-induced lymphopenia and its associations with patient outcomes in non-small cell lung cancer (NSCLC). Methods and Materials: Subjects consisted of 711 patients who had received definitive RT for NSCLC. A lymphocyte nadir was calculated as the minimum lymphocyte value measured during definitive RT. Associations between gross tumor volumes (GTVs) and lung dose-volume histogram (DVH) parameters with lymphocyte nadirs were assessed with Spearman correlation coefficients. Relationships between lymphocyte nadirs with overall survival (OS) and event free survival (EFS) were evaluated with Kaplan-Meier analysis and compared with log-rank test results. Multivariate regressions were conducted with linear and Cox regression analyses. All variables were analyzed as continuous if possible. Results: Larger GTVs were correlated with lower lymphocyte nadirs regardless of concurrent chemotherapy receipt (with concurrent: r = −0.26, P<.0001; without: r = −0.48, P<.0001). Analyses of lung DVH parameters revealed significant correlations at lower doses (lung V5-V10: P<.0001) that incrementally decreased and became nonsignificant at higher doses (lung V60-V70: P>.05). Of note, no significant associations were detected between GTV and lung DVH parameters with total leukocyte, neutrophil, or monocyte nadirs during RT or with lymphocyte count prior to RT. Multivariate analysis revealed larger GTV (P<.0001), receipt of concurrent chemotherapy (P<.0001), twice-daily radiation fractionation (P=.02), and stage III disease (P=.05) to be associated with lower lymphocyte nadirs. On univariate analysis, patients with higher lymphocyte nadirs exhibited significantly improved OS (hazard ratio [HR] = 0.51 per 10{sup 3} lymphocytes/μL, P=.01) and EFS (HR = 0.46 per 10{sup 3} lymphocytes/μL, P<.0001). These differences held on multivariate analyses

  19. Associations Between Epidermal Growth Factor Receptor Gene Mutation and Serum Tumor Markers in Advanced Lung Adenocarcinomas:A Retrospective Study

    Institute of Scientific and Technical Information of China (English)

    Ying-qiu Pan; Wei-wu Shi; Dan-ping Xu; Hui-hui Xu; Mei-ying Zhou; Wei-hua Yan

    2014-01-01

    Objective To investigate the associations between epidermal growth factor receptor (EGFR) gene mutations and serum tumor markers in advanced lung adenocarcinomas. Methods We investigated the association between EGFR gene mutations and clinical features, including serum tumor marker levels, in 97 advanced lung adenocarcinomas patients who did not undergo the treatment of EGFR tyrosine kinase inhibitors. EGFR gene mutation was detected by real-time PCR at exons 18, 19, 20, and 21. Serum tumor marker concentrations were analyzed by chemiluminescence assay kit at the same time. Results EGFR gene mutations were detected in 42 (43%) advanced lung adenocarcinoma patients. Gender (P=0.003), smoking status (P=0.001), and abnormal serum status of carcinoembryonic antigen (CEA, P=0.028) were significantly associated with EGFR gene mutation incidence. Multivariate analysis showed the abnormal CEA level in serum was independently associated with the incidence of EGFR gene mutation (P=0.046) with an odds ratio of 2.613 (95%CI:1.018-6.710). However, receiver operating characteristic (ROC) curve analysis revealed CEA was not an ideal predictive marker for EGFR gene mutation status in advanced lung adenocarcinoma (the area under the ROC curve was 0.608, P=0.069). Conclusions EGFR gene mutation status is significantly associated with serum CEA status in advanced lung adenocarcinmoas. However, serum CEA is not an ideal predictor for EGFR mutation.

  20. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia.

    Science.gov (United States)

    Lan, Qing; Hsiung, Chao A; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wang, Zhaoming; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Chatterjee, Nilanjan; Hu, Wei; Wong, Maria Pik; Zheng, Wei; Caporaso, Neil; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Yuenger, Jeffrey; Jacobs, Kevin B; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; Wu, Chen; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; He, Xingzhou; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Shu, Xiao-Ou; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel

    2012-12-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland China, South Korea, Japan, Singapore, Taiwan and Hong Kong. We genotyped the most promising variants (associated at P < 5 × 10(-6)) in an additional 1,099 cases and 2,913 controls. We identified three new susceptibility loci at 10q25.2 (rs7086803, P = 3.54 × 10(-18)), 6q22.2 (rs9387478, P = 4.14 × 10(-10)) and 6p21.32 (rs2395185, P = 9.51 × 10(-9)). We also confirmed associations reported for loci at 5p15.33 and 3q28 and a recently reported finding at 17q24.3. We observed no evidence of association for lung cancer at 15q25 in never-smoking women in Asia, providing strong evidence that this locus is not associated with lung cancer independent of smoking. PMID:23143601

  1. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia

    Science.gov (United States)

    Lan, Qing; Hsiung, Chao A; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wang, Zhaoming; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Chatterjee, Nilanjan; Hu, Wei; Wong, Maria Pik; Zheng, Wei; Caporaso, Neil; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Yuenger, Jeffrey; Jacobs, Kevin B; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; Wu, Chen; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; He, Xingzhou; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Shu, Xiao-Ou; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li1, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel

    2014-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland China, South Korea, Japan, Singapore, Taiwan, and Hong Kong. We genotyped the most promising variants (associated at P < 5 × 10-6) in an additional 1,099 cases and 2,913 controls. We identified three new susceptibility loci at 10q25.2 (rs7086803, P = 3.54 × 10-18), 6q22.2 (rs9387478, P = 4.14 × 10-10) and 6p21.32 (rs2395185, P = 9.51 × 10-9). We also confirmed associations reported for loci at 5p15.33 and 3q28 and a recently reported finding at 17q24.3. We observed no evidence of association for lung cancer at 15q25 in never-smoking women in Asia, providing strong evidence that this locus is not associated with lung cancer independent of smoking. PMID:23143601

  2. Mushroom β-Glucan May Immunomodulate the Tumor-Associated Macrophages in the Lewis Lung Carcinoma

    Directory of Open Access Journals (Sweden)

    Wan-Jhen Wang

    2015-01-01

    Full Text Available The present study showed that oral mushroom beta-glucan treatment significantly increased IFN-γ mRNA expression but significantly reduced COX-2 mRNA expression within the lung. For LLC tumor model, oral Ganoderma lucidum or Antrodia camphorata polysaccharides treatments significantly reduced TGF-β production in serum. In addition, IL-12 and IFN-γ mRNA expression were significantly increased, but IL-6, IL-10, COX-2, and TGF-β mRNA expression were substantially following oral mushroom polysaccharides treatments. The study highlights the efficacious effect of mushroom polysaccharides for ameliorating the immune suppression in the tumor microenvironment. Increased M1 phenotype of tumor-associated macrophages and attenuated M2 phenotype of tumor-associated macrophages could be achieved by ingesting mushroom polysaccharides.

  3. Available Interventions for Prevention of Cotton Dust-Associated Lung Diseases Among Textile Workers.

    Science.gov (United States)

    Nafees, Asaad Ahmed; Fatmi, Zafar

    2016-08-01

    The authors reviewed literature on interventions for cotton dust-associated lung diseases among textile workers. Internet sources (PubMed, Cochrane Library, Google and Google Scholar) were accessed and interventions were categorized into: Engineering or administrative controls, or personal protective equipment (PPE). Ten relevant articles were shortlisted, five related to engineering controls (pre-processing, bactericidal treatment of cotton, improved workplace design, machinery and dust control measures). Administrative controls may involve setting standards, environmental surveillance, periodic medical examinations, and workers training. Although specific guidelines are available regarding the use of PPEs, but there was little literature on their effectiveness. It was concluded that there is a dearth of literature regarding field-based assessment of interventions for control of cotton dust associated respiratory diseases and the available studies primarily focus on pre-processing of cotton. This review highlights the uncertainties that remain; and recommends several areas for future research on respiratory health of textile workers. PMID:27539764

  4. Characterization of human lung cancer-associated fibroblasts in three-dimensional in vitro co-culture model

    International Nuclear Information System (INIS)

    Highlights: ► We established three patient-paired sets of CAFs and NFs. ► CAFs and NFs were analyzed using three-dimensional co-culture experiments. ► CAFs clearly enhanced collagen gel contraction. ► CAFs showed higher α-SMA expression than NFs. ► CAFs were implicated in invasion and differentiation of lung cancer cells. -- Abstract: Lung cancer is the most common cause of cancer-related death worldwide. Stromal cancer-associated fibroblasts (CAFs) play crucial roles in carcinogenesis, proliferation, invasion, and metastasis of non-small cell lung carcinoma, and targeting of CAFs could be a novel strategy for cancer treatment. However, the characteristics of human CAFs still remain to be better defined. In this study, we established patient-matched CAFs and normal fibroblasts (NFs), from tumoral and non-tumoral portions of resected lung tissue from lung cancer patients. CAFs showed higher α-smooth muscle actin (α-SMA) expression than NFs, and CAFs clearly enhanced collagen gel contraction. Furthermore, we employed three-dimensional co-culture assay with A549 lung cancer cells, where CAFs were more potent in inducing collagen gel contraction. Hematoxylin and eosin staining of co-cultured collagen gel revealed that CAFs had the potential to increase invasion of A549 cells compared to NFs. These observations provide evidence that lung CAFs have the tumor-promoting capacity distinct from NFs.

  5. A genome-wide association search for type 2 diabetes genes in African Americans.

    Directory of Open Access Journals (Sweden)

    Nicholette D Palmer

    Full Text Available African Americans are disproportionately affected by type 2 diabetes (T2DM yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wide Association Study (GWAS using the Affymetrix 6.0 array in 965 African-American cases with T2DM and end-stage renal disease (T2DM-ESRD and 1029 population-based controls. The most significant SNPs (n = 550 independent loci were genotyped in a replication cohort and 122 SNPs (n = 98 independent loci were further tested through genotyping three additional validation cohorts followed by meta-analysis in all five cohorts totaling 3,132 cases and 3,317 controls. Twelve SNPs had evidence of association in the GWAS (P<0.0071, were directionally consistent in the Replication cohort and were associated with T2DM in subjects without nephropathy (P<0.05. Meta-analysis in all cases and controls revealed a single SNP reaching genome-wide significance (P<2.5×10(-8. SNP rs7560163 (P = 7.0×10(-9, OR (95% CI = 0.75 (0.67-0.84 is located intergenically between RND3 and RBM43. Four additional loci (rs7542900, rs4659485, rs2722769 and rs7107217 were associated with T2DM (P<0.05 and reached more nominal levels of significance (P<2.5×10(-5 in the overall analysis and may represent novel loci that contribute to T2DM. We have identified novel T2DM-susceptibility variants in the African-American population. Notably, T2DM risk was associated with the major allele and implies an interesting genetic architecture in this population. These results suggest that multiple loci underlie T2DM susceptibility in the African-American population and that these loci are distinct from those identified in other ethnic populations.

  6. Gastroesophageal Reflux Disease Is Associated With an Increased Rate of Acute Rejection in Lung Transplant Allografts

    Science.gov (United States)

    Shah, N.S.; Force, S.D.; Mitchell, P.O.; Lin, E.; Lawrence, E.C.; Easley, K.; Qian, J.; Ramirez, A.; Neujahr, D.C.; Gal, A.; Leeper, K.; Pelaez, A.

    2012-01-01

    Purpose Gastric fundoplication (GF) for gastroesophageal reflux disease (GERD) may protect against the progression of chronic rejection in lung transplant (LT) recipients. However, the association of GERD with acute rejection episodes (ARE) is uncertain. This study sought to identify if ARE were linked to GERD in LT patients. Methods This single-center retrospective observational study, of patients transplanted from January 1, 2000, to January 31, 2009, correlated results of pH probe testing for GERD with ARE (≥International Society for Heart and Lung Transplantation A1 or B1). We compared the rates of ARE among patients with GERD (DeMeester Score > 14.7) versus without GERD as number of ARE per 1,000 patient-days after LT. Patients undergoing GF prior to LT were excluded. Results The analysis included 60 LT subjects and 9,249 patient-days: 33 with GERD versus 27 without GERD. We observed 51 ARE among 60 LT recipients. The rate of ARE was highest among patients with GERD: 8.49 versus 2.58, an incidence density ratio (IDR) of 3.29 (P = .00016). Upon multivariate negative binomial regression modeling, only GERD was associated with ARE (IDR 2.15; P = .009). Furthermore, GERD was associated with multiple ARE (36.4% vs 0%; P < .0001) and earlier onset compared with patients without GERD: ARE proportion at 2 months was 0.55 versus 0.26 P = .004). Conclusion In LT recipients, GERD was associated with a higher rate, multiple events, and earlier onset of ARE. The efficacy of GF to reduce ARE among patients with GERD needs further evaluation. PMID:20832573

  7. Association of Lung Inflammatory Cells with Small Airways Function and Exhaled Breath Markers in Smokers – Is There a Specific Role for Mast Cells?

    OpenAIRE

    Nussbaumer-Ochsner, Yvonne; Stolk, Jan; Ferraz da Silva, Luiz F.; van Schadewijk, Annemarie; de Jeu, Ronald C.; Prins, Frans A.; Mauad, Thais; Rabe, Klaus F; Hiemstra, Pieter S.

    2015-01-01

    Background Smoking is associated with a mixed inflammatory infiltrate in the airways. We evaluated whether airway inflammation in smokers is related to lung function parameters and inflammatory markers in exhaled breath. Methods Thirty-seven smokers undergoing lung resection for primary lung cancer were assessed pre-operatively by lung function testing including single-breath-nitrogen washout test (sb-N2-test), measurement of fractional exhaled nitric oxide (FeNO) and pH/8-isoprostane in exha...

  8. How Planners Deal with Uncomfortable Knowledge: The Dubious Ethics of the American Planning Association

    OpenAIRE

    Bent Flyvbjerg

    2013-01-01

    With a point of departure in the concept "uncomfortable knowledge," this article presents a case study of how the American Planning Association (APA) deals with such knowledge. APA was found to actively suppress publicity of malpractice concerns and bad planning in order to sustain a boosterish image of planning. In the process, APA appeared to disregard and violate APA's own Code of Ethics. APA justified its actions with a need to protect APA members' interests, seen as preventing planning a...

  9. The Policy Views of American Economic Association Members: The Results of a New Survey

    OpenAIRE

    Robert Whaples

    2009-01-01

    This article presents the results of a 2007 policy-views survey of a random sample of members of the American Economic Association. The new survey contains questions about many policy issues not treated by previous surveys. The questions treat such issues as trade restrictions, social insurance for those put out of work by international competition, genetically modified foods, curbside recycling, health insurance (several questions), medical malpractice, barriers to entering the medical profe...

  10. Drug Addiction and Stress-Response Genetic Variability: Association Study in African Americans

    OpenAIRE

    Levran, Orna; Randesi, Matthew; Li, Yi; Rotrosen, John; Ott, Jurg; Adelson, Miriam; Kreek, Mary Jeanne

    2014-01-01

    Stress is a significant risk factor in the development of drug addictions and in addiction relapse susceptibility. This hypothesis-driven study was designed to determine if specific SNPs in genes related to stress response are associated with heroin and/or cocaine addiction in African Americans. The analysis included 27 genes (124 SNPs) and was performed independently for each addiction. The sample consisted of former heroin addicts in methadone maintenance treatment (n = 314), cocaine addict...

  11. Examination of Association with Candidate Genes for Diabetic Nephropathy in a Mexican American Population

    OpenAIRE

    Kim, Sulgi; Abboud, Hanna E.; Pahl, Madeleine V.; Tayek, John; Snyder, Susan; Tamkin, James; Alcorn, Harry; Ipp, Eli; Nast, Cynthia C.; Elston, Robert C.; Iyengar, Sudha K.; Adler, Sharon G.

    2010-01-01

    Background and objectives: Diabetic nephropathy (DN) is a multifactorial complication characterized by persistent proteinuria in susceptible individuals with type 1 and type 2 diabetes. Disease burden in people of Mexican-American descent is particularly high, but there are only a few studies that characterize genes for DN in this ethnic group. Two genes, carnosine dipeptidase 1 (CNDP1) and engulfment and cell motility 1 (ELMO1) previously showed association with DN in other ethnic groups. CN...

  12. Yogurt consumption is associated with better diet quality and metabolic profile in American men and women

    OpenAIRE

    Wang, Huifen; Livingston, Kara A.; Fox, Caroline S; Meigs, James B.; Jacques, Paul F.

    2012-01-01

    The evidence-based Dietary Guidelines for Americans recommends increasing the intake of fat-free or low-fat milk and milk products. However, yogurt, a nutrient-dense milk product, has been understudied. This cross-sectional study examined whether yogurt consumption was associated with better diet quality and metabolic profile among adults (n = 6526) participating in the Framingham Heart Study Offspring (1998-2001) and Third Generation (2002-2005) cohorts. A validated food frequency questionna...

  13. Genome-wide association study of age at menarche in African-American women

    OpenAIRE

    Demerath, Ellen W; Liu, Ching-Ti; Franceschini, Nora; Chen, Gary; Palmer, Julie R.; Smith, Erin N.; Chen, Christina T. L.; Ambrosone, Christine B.; Arnold, Alice M.; Bandera, Elisa V.; Berenson, Gerald S.; Bernstein, Leslie; Britton, Angela; Cappola, Anne R.; Carlson, Christopher S.

    2013-01-01

    African-American (AA) women have earlier menarche on average than women of European ancestry (EA), and earlier menarche is a risk factor for obesity and type 2 diabetes among other chronic diseases. Identification of common genetic variants associated with age at menarche has a potential value in pointing to the genetic pathways underlying chronic disease risk, yet comprehensive genome-wide studies of age at menarche are lacking for AA women. In this study, we tested the genome-wide associati...

  14. Management of Hyperthyroidism in Pregnancy: Comparison of Recommendations of American Thyroid Association and Endocrine Society

    OpenAIRE

    Shahram Alamdari; Fereidoun Azizi; Hossein Delshad; Farzaneh Sarvghadi; Atieh Amouzegar; Ladan Mehran

    2013-01-01

    Appropriate diagnosis and treatment of hyperthyroidism during pregnancy are of outmost importance, because hyperthyroidism has major adverse impact on both mother and fetus. Since data on the management of thyroid dysfunction during pregnancy is rapidly evolving, two guidelines have been developed by the American Thyroid Association and the Endocrine society in the last 2 years. We compare here the recommendations of these two guidelines regarding management of hyperthyroidism during pregnanc...

  15. Association of ambient air quality with children`s lung function in urban and rural Iran

    Energy Technology Data Exchange (ETDEWEB)

    Asgari, M.M.; Dubois, A.; Beckett, W.S. [Yale Univ. School of Medicine, New Haven, CT (United States); Asgari, M. [Shaheed Beheshti Univ., Tehran (Iran, Islamic Republic of); Gent, J. [John B. Pierce Lab., New Haven, CT (United States)

    1998-05-01

    During the summer of 1994, a cross-sectional epidemiological study, in which the pulmonary function of children in Tehran was compared with pulmonary function in children in a rural town in Iran, was conducted. Four hundred children aged 5--11 y were studied. Daytime ambient nitrogen dioxide, sulfur dioxide, and particulate matter were measured with portable devices, which were placed in the children`s neighborhoods on the days of study. Levels of these ambient substances were markedly higher in urban Tehran than in rural areas. Children`s parents were questioned about home environmental exposures (including heating source and environmental tobacco smoke) and the children`s respiratory symptoms. Pulmonary function was assessed, both by spirometry and peak expiratory flow meter. Forced expiratory volume in 1 s and forced vital capacity--as a percentage of predicted for age, sex and height--were significantly lower in urban children than in rural children. Both measurements evidenced significant reverse correlations with levels of sulfur dioxide, nitrogen dioxide, and particulate matter. Differences in spirometric lung function were not explained by nutritional status, as assessed by height and weight for age, or by home environmental exposures. Reported airway symptoms were higher among rural children, whereas reported physician diagnosis of bronchitis and asthma were higher among urban children. The association between higher pollutant concentrations and reduced pulmonary function in this urban-rural comparison suggests that there is an effect of urban air pollution on short-term lung function and/or lung growth and development during the preadolescent years.

  16. Genome-wide association study identifies novel loci association with fasting insulin and insulin resistance in African Americans.

    Science.gov (United States)

    Chen, Guanjie; Bentley, Amy; Adeyemo, Adebowale; Shriner, Daniel; Zhou, Jie; Doumatey, Ayo; Huang, Hanxia; Ramos, Edward; Erdos, Michael; Gerry, Norman; Herbert, Alan; Christman, Michael; Rotimi, Charles

    2012-10-15

    Insulin resistance (IR) is a key determinant of type 2 diabetes (T2D) and other metabolic disorders. This genome-wide association study (GWAS) was designed to shed light on the genetic basis of fasting insulin (FI) and IR in 927 non-diabetic African Americans. 5 396 838 single-nucleotide polymorphisms (SNPs) were tested for associations with FI or IR with adjustments for age, sex, body mass index, hypertension status and first two principal components. Genotyped SNPs (n = 12) with P KLF14 and PPARG) which exert their action via IR. In summary, variants in/near SC4MOL, and TCERG1L were associated with FI and IR in this cohort of African Americans and were replicated in West Africans. SC4MOL is under-expressed in an animal model of T2D and plays a key role in lipid biosynthesis, with implications for the regulation of energy metabolism, obesity and dyslipidemia. TCERG1L is associated with plasma adiponectin, a key modulator of obesity, inflammation, IR and diabetes. PMID:22791750

  17. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: A report from the Female Lung Cancer Consortium in Asia

    OpenAIRE

    Machiela, Mitchell J.; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan

    2014-01-01

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of 7 telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a...

  18. Gender-associated Differences of Lung Cancer and Mechanism%肺癌的性别差异及机制

    Institute of Scientific and Technical Information of China (English)

    邢昕; 廖永德; 唐和孝; 陈广; 具晟; 游良琨

    2011-01-01

    Lung cancer has been viewed as the most common malignant cancer with high incidence, mortality and poor survival all over the world. A lot of investigations indicated there are significant gender-associated differences in lung cancer in several characteristics such as epidemiology, pathology, clinical outcome and prognosis. The insight into these differences may help to clarify the gender-associated characteristics of lung cancer, and to drawn out new approach for treatment and prevent of lung cancer depending on gender-associated characteristics. Furthmore, study on mechanism of gender-associated characteristics may even help to illuminate the pathogenesis of lung cancer.%肺癌是全球发病率、死亡率最高、治疗效果差的恶性肿瘤.肺癌在流行病学、病理类型、疗效和预后、甚至发病机制等多方面均表现出明显性别差异.对这些差异的深入剖析能更好地认识男女性别肺癌各自的特点,为肺癌防治采用不同的性别化措施提供新线索和思路;而对导致性别差异的具体机制进行深入研究,有助于阐明肺癌的发病机制.

  19. A usability evaluation exploring the design of American Nurses Association state web sites.

    Science.gov (United States)

    Alexander, Gregory L; Wakefield, Bonnie J; Anbari, Allison B; Lyons, Vanessa; Prentice, Donna; Shepherd, Marilyn; Strecker, E Bradley; Weston, Marla J

    2014-08-01

    National leaders are calling for opportunities to facilitate the Future of Nursing. Opportunities can be encouraged through state nurses association Web sites, which are part of the American Nurses Association, that are well designed, with appropriate content, and in a language professional nurses understand. The American Nurses Association and constituent state nurses associations provide information about nursing practice, ethics, credentialing, and health on Web sites. We conducted usability evaluations to determine compliance with heuristic and ethical principles for Web site design. We purposefully sampled 27 nursing association Web sites and used 68 heuristic and ethical criteria to perform systematic usability assessments of nurse association Web sites. Web site analysis included seven double experts who were all RNs trained in usability analysis. The extent to which heuristic and ethical criteria were met ranged widely from one state that met 0% of the criteria for "help and documentation" to states that met greater than 92% of criteria for "visibility of system status" and "aesthetic and minimalist design." Suggested improvements are simple yet make an impact on a first-time visitor's impression of the Web site. For example, adding internal navigation and tracking features and providing more details about the application process through help and frequently asked question documentation would facilitate better use. Improved usability will improve effectiveness, efficiency, and consumer satisfaction with these Web sites. PMID:24818790

  20. Inhibition of TGF-β signaling and decreased apoptosis in IUGR-associated lung disease in rats.

    Directory of Open Access Journals (Sweden)

    Miguel Angel Alejandre Alcázar

    Full Text Available Intrauterine growth restriction is associated with impaired lung function in adulthood. It is unknown whether such impairment of lung function is linked to the transforming growth factor (TGF-β system in the lung. Therefore, we investigated the effects of IUGR on lung function, expression of extracellular matrix (ECM components and TGF-β signaling in rats. IUGR was induced in rats by isocaloric protein restriction during gestation. Lung function was assessed with direct plethysmography at postnatal day (P 70. Pulmonary activity of the TGF-β system was determined at P1 and P70. TGF-β signaling was blocked in vitro using adenovirus-delivered Smad7. At P70, respiratory airway compliance was significantly impaired after IUGR. These changes were accompanied by decreased expression of TGF-β1 at P1 and P70 and a consistently dampened phosphorylation of Smad2 and Smad3. Furthermore, the mRNA expression levels of inhibitors of TGF-β signaling (Smad7 and Smurf2 were reduced, and the expression of TGF-β-regulated ECM components (e.g. collagen I was decreased in the lungs of IUGR animals at P1; whereas elastin and tenascin N expression was significantly upregulated. In vitro inhibition of TGF-β signaling in NIH/3T3, MLE 12 and endothelial cells by adenovirus-delivered Smad7 demonstrated a direct effect on the expression of ECM components. Taken together, these data demonstrate a significant impact of IUGR on lung development and function and suggest that attenuated TGF-β signaling may contribute to the pathological processes of IUGR-associated lung disease.

  1. Predictors of mortality in rheumatoid arthritis-associated interstitial lung disease.

    Science.gov (United States)

    Solomon, Joshua J; Chung, Jonathan H; Cosgrove, Gregory P; Demoruelle, M Kristen; Fernandez-Perez, Evans R; Fischer, Aryeh; Frankel, Stephen K; Hobbs, Stephen B; Huie, Tristan J; Ketzer, Jill; Mannina, Amar; Olson, Amy L; Russell, Gloria; Tsuchiya, Yutaka; Yunt, Zulma X; Zelarney, Pearlanne T; Brown, Kevin K; Swigris, Jeffrey J

    2016-02-01

    Interstitial lung disease (ILD) is a common pulmonary manifestation of rheumatoid arthritis. There is lack of clarity around predictors of mortality and disease behaviour over time in these patients.We identified rheumatoid arthritis-related interstitial lung disease (RA-ILD) patients evaluated at National Jewish Health (Denver, CO, USA) from 1995 to 2013 whose baseline high-resolution computed tomography (HRCT) scans showed either a nonspecific interstitial pneumonia (NSIP) or a "definite" or "possible" usual interstitial pneumonia (UIP) pattern. We used univariate, multivariate and longitudinal analytical methods to identify clinical predictors of mortality and to model disease behaviour over time.The cohort included 137 subjects; 108 had UIP on HRCT (RA-UIP) and 29 had NSIP on HRCT (RA-NSIP). Those with RA-UIP had a shorter survival time than those with RA-NSIP (log rank p=0.02). In a model controlling for age, sex, smoking and HRCT pattern, a lower baseline % predicted forced vital capacity (FVC % pred) (HR 1.46; p<0.0001) and a 10% decline in FVC % pred from baseline to any time during follow up (HR 2.57; p<0.0001) were independently associated with an increased risk of death.Data from this study suggest that in RA-ILD, disease progression and survival differ between subgroups defined by HRCT pattern; however, when controlling for potentially influential variables, pulmonary physiology, but not HRCT pattern, independently predicts mortality. PMID:26585429

  2. A case of lung cancer associated with acute respiratory distress syndrome after thoracic radiotherapy

    International Nuclear Information System (INIS)

    A 73-year-old man presented with dyspnea, cough, fever, appetite loss and stridor due to bronchial stenosis. Fiber-optic bronchoscopy revealed an endobronchial lesion in the right main bronchus and biopsy specimens showed poorly differentiated squamous cell carcinoma. The clinical stage of lung cancer was IIIB (T4N2M0). The patient received 60 Gy in 30 fractions over 43 days to a field including the right hilum and mediastinum. The tumor decreased in size and stenosis of the bronchus disappeared. A week after completion of radiation the patient began to have high grade fever and dyspnea, and progressive hypoxia developed. A chest radiograph showed diffuse bilateral interstitial infiltrates. Despite mechanical ventilation with PEEP and the administration of steroids, he died of respiratory failure three weeks after completion of radiation. Necropsy specimens obtained from the left lung revealed massive deposition of fibrin in the alveolar airspaces associated with hyaline membranes and hyperplasia of type II cells indicating diffuse alveolar damage. The patient had mild pulmonary fibrosis on a CT scan taken before the start of radiotherapy. We conclude that care should be taken if the case has pulmonary fibrosis because radiation therapy can precipitate severe radiation pneumonitis and acute respiratory distress syndrome in such cases. (author)

  3. Selenoprotein N deficiency in mice is associated with abnormal lung development.

    Science.gov (United States)

    Moghadaszadeh, Behzad; Rider, Branden E; Lawlor, Michael W; Childers, Martin K; Grange, Robert W; Gupta, Kushagra; Boukedes, Steve S; Owen, Caroline A; Beggs, Alan H

    2013-04-01

    Mutations in the human SEPN1 gene, encoding selenoprotein N (SepN), cause SEPN1-related myopathy (SEPN1-RM) characterized by muscle weakness, spinal rigidity, and respiratory insufficiency. As with other members of the selenoprotein family, selenoprotein N incorporates selenium in the form of selenocysteine (Sec). Most selenoproteins that have been functionally characterized are involved in oxidation-reduction (redox) reactions, with the Sec residue located at their catalytic site. To model SEPN1-RM, we generated a Sepn1-knockout (Sepn1(-/-)) mouse line. Homozygous Sepn1(-/-) mice are fertile, and their weight and lifespan are comparable to wild-type (WT) animals. Under baseline conditions, the muscle histology of Sepn1(-/-) mice remains normal, but subtle core lesions could be detected in skeletal muscle after inducing oxidative stress. Ryanodine receptor (RyR) calcium release channels showed lower sensitivity to caffeine in SepN deficient myofibers, suggesting a possible role of SepN in RyR regulation. SepN deficiency also leads to abnormal lung development characterized by enlarged alveoli, which is associated with decreased tissue elastance and increased quasi-static compliance of Sepn1(-/-) lungs. This finding raises the possibility that the respiratory syndrome observed in patients with SEPN1 mutations may have a primary pulmonary component in addition to the weakness of respiratory muscles. PMID:23325319

  4. Association of incidental emphysema with annual lung function decline and future development of airflow limitation

    Directory of Open Access Journals (Sweden)

    Koo HK

    2016-01-01

    Full Text Available Hyeon-Kyoung Koo,1 Kwang Nam Jin,2 Deog Kyeom Kim,3 Hee Soon Chung,3 Chang-Hoon Lee3,4 1Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, College of Medicine, Ilsan Paik Hospital, Inje University, Goyang-si, Gyeonggi-Do, 2Department of Radiology, Seoul Metropolitan Government – Seoul National University Boramae Medical Center, 3Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, 4Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, Seoul National University College of Medicine, Seoul National University Hospital, Seoul, Republic of Korea Objectives: Emphysema is one of the prognostic factors for rapid lung function decline in patients with COPD, but the impact of incidentally detected emphysema on population without spirometric abnormalities has not been evaluated. This study aimed to determine whether emphysema detected upon computed tomography (CT screening would accelerate the rate of lung function decline and influence the possibility of future development of airflow limitation in a population without spirometric abnormalities.Materials and methods: Subjects who participated in a routine screening for health checkup and follow-up pulmonary function tests for at least 3 years between 2004 and 2010 were retrospectively enrolled. The percentage of low-attenuation area below −950 Hounsfield units (%LAA−950 was calculated automatically. A calculated value of %LAA−950 that exceeded 10% was defined as emphysema. Adjusted annual lung function decline was analyzed using random-slope, random-intercept mixed linear regression models.Results: A total of 628 healthy subjects within the normal range of spriometric values were included. Multivariable analysis showed that the emphysema group exhibited a faster decline in forced vital capacity (−33.9 versus −18.8

  5. DNA methylation profiles at precancerous stages associated with recurrence of lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Takashi Sato

    Full Text Available The aim of this study was to clarify the significance of DNA methylation alterations at precancerous stages of lung adenocarcinoma. Using single-CpG resolution Infinium array, genome-wide DNA methylation analysis was performed in 36 samples of normal lung tissue obtained from patients without any primary lung tumor, 145 samples of non-cancerous lung tissue (N obtained from patients with lung adenocarcinomas, and 145 samples of tumorous tissue (T. Stepwise progression of DNA methylation alterations from normal lung tissue to non-cancerous lung tissue obtained from patients with lung adenocarcinomas, and then tumorous tissue samples, was observed at 3,270 CpG sites, suggesting that non-cancerous lung tissue obtained from patients with lung adenocarcinomas was at precancerous stages with DNA methylation alterations. At CpG sites of 2,083 genes, DNA methylation status in samples of non-cancerous lung tissue obtained from patients with lung adenocarcinomas was significantly correlated with recurrence after establishment of lung adenocarcinomas. Among such recurrence-related genes, 28 genes are normally unmethylated (average β-values based on Infinium assay in normal lung tissue samples was less than 0.2 and their DNA hypermethylation at precancerous stages was strengthened during progression to lung adenocarcinomas (Δβ(T-N>0.1. Among these 28 genes, we focused on 6 for which implications in transcription regulation, apoptosis or cell adhesion had been reported. DNA hypermethylation of the ADCY5, EVX1, GFRA1, PDE9A, and TBX20 genes resulted in reduced mRNA expression in tumorous tissue samples. 5-Aza-2'-deoxycytidine treatment of lung cancer cell lines restored the mRNA expression levels of these 5 genes. Reduced mRNA expression in tumorous tissue samples was significantly correlated with tumor aggressiveness. These data suggest that DNA methylation alterations at precancerous stages determine tumor aggressiveness and outcome through silencing of

  6. DNA Methylation Profiles at Precancerous Stages Associated with Recurrence of Lung Adenocarcinoma

    Science.gov (United States)

    Sato, Takashi; Arai, Eri; Kohno, Takashi; Tsuta, Koji; Watanabe, Shun-ichi; Soejima, Kenzo; Betsuyaku, Tomoko; Kanai, Yae

    2013-01-01

    The aim of this study was to clarify the significance of DNA methylation alterations at precancerous stages of lung adenocarcinoma. Using single-CpG resolution Infinium array, genome-wide DNA methylation analysis was performed in 36 samples of normal lung tissue obtained from patients without any primary lung tumor, 145 samples of non-cancerous lung tissue (N) obtained from patients with lung adenocarcinomas, and 145 samples of tumorous tissue (T). Stepwise progression of DNA methylation alterations from normal lung tissue to non-cancerous lung tissue obtained from patients with lung adenocarcinomas, and then tumorous tissue samples, was observed at 3,270 CpG sites, suggesting that non-cancerous lung tissue obtained from patients with lung adenocarcinomas was at precancerous stages with DNA methylation alterations. At CpG sites of 2,083 genes, DNA methylation status in samples of non-cancerous lung tissue obtained from patients with lung adenocarcinomas was significantly correlated with recurrence after establishment of lung adenocarcinomas. Among such recurrence-related genes, 28 genes are normally unmethylated (average β-values based on Infinium assay in normal lung tissue samples was less than 0.2) and their DNA hypermethylation at precancerous stages was strengthened during progression to lung adenocarcinomas (ΔβT–N>0.1). Among these 28 genes, we focused on 6 for which implications in transcription regulation, apoptosis or cell adhesion had been reported. DNA hypermethylation of the ADCY5, EVX1, GFRA1, PDE9A, and TBX20 genes resulted in reduced mRNA expression in tumorous tissue samples. 5-Aza-2′-deoxycytidine treatment of lung cancer cell lines restored the mRNA expression levels of these 5 genes. Reduced mRNA expression in tumorous tissue samples was significantly correlated with tumor aggressiveness. These data suggest that DNA methylation alterations at precancerous stages determine tumor aggressiveness and outcome through silencing of specific genes

  7. An Analysis of Independent, Non-Academic Characteristics of Chinese and American Business Students Associated with Emotional Intelligence

    Science.gov (United States)

    Margavio, Thomas M.; Margavio, Geanie W.; Hignite, Michael A.; Moses, Duane R.

    2014-01-01

    In a continuation of their prior research which focused on the differences in Emotional Intelligence (EI) levels between Chinese and American business students and the academic variables associated with those scores, the authors extend their efforts to investigate those personal (non-academic) characteristics of both American and Chinese business…

  8. Blood cadmium levels are associated with a decline in lung function in males

    International Nuclear Information System (INIS)

    Background: Cadmium exposure was found to cause a decline in lung function among the general population, but these findings were limited to smokers and gender differences were not explored. Objectives: To examine the relationship between cadmium and chronic obstructive pulmonary disease (COPD) according to gender and smoking status in Korea. Methods: Cross-sectional data from the Korean National Health and Nutrition Examination Survey from 2008 to 2011 were analyzed. COPD was defined by a pre-bronchodilator forced expiratory volume in 1 s divided by forced vital capacity of <0.70. A logistic regression model was used to elucidate the association between blood cadmium levels and COPD according to gender and smoking status. Results: Among 3861 eligible participants, 3622 were included in the analysis. The prevalence of COPD demonstrated an increasing trend in males (P for trend<0.001), but not in females (P for trend=0.67). After adjusting for covariates, a higher blood cadmium level, but within the normal range, was associated with COPD in males, including those who had never-smoked (P for trend <0.001 and P for trend=0.008). However, a higher blood cadmium level was not significantly associated with COPD in females, including those who had never smoked (P for trend=0.39 and P for trend=0.43). Conclusions: A higher blood cadmium level, within the normal range, was associated with COPD in males, including those who had never smoked. However, there was no significant association between blood cadmium levels and COPD in females. - Highlights: • Elevated blood cadmium level is associated with chronic obstructive pulmonary disease in male. • This association can be seen even in never smoked male. • However, this association is present only in male, but not in female

  9. Blood cadmium levels are associated with a decline in lung function in males

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Chang-Mo [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of); The Korea Central Cancer Registry, National Cancer Center, Goyang (Korea, Republic of); Oh, In-Hwan; Lee, Jong-Keun [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Park, Yoon Hyung [Departments of Preventive Medicine, School of Medicine, Soonchunhyang University, Seoul (Korea, Republic of); Choe, Bong-Keun; Yoon, Tai-Young [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Choi, Joong-Myung, E-mail: jmchoi@khu.ac.kr [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of)

    2014-07-15

    Background: Cadmium exposure was found to cause a decline in lung function among the general population, but these findings were limited to smokers and gender differences were not explored. Objectives: To examine the relationship between cadmium and chronic obstructive pulmonary disease (COPD) according to gender and smoking status in Korea. Methods: Cross-sectional data from the Korean National Health and Nutrition Examination Survey from 2008 to 2011 were analyzed. COPD was defined by a pre-bronchodilator forced expiratory volume in 1 s divided by forced vital capacity of <0.70. A logistic regression model was used to elucidate the association between blood cadmium levels and COPD according to gender and smoking status. Results: Among 3861 eligible participants, 3622 were included in the analysis. The prevalence of COPD demonstrated an increasing trend in males (P for trend<0.001), but not in females (P for trend=0.67). After adjusting for covariates, a higher blood cadmium level, but within the normal range, was associated with COPD in males, including those who had never-smoked (P for trend <0.001 and P for trend=0.008). However, a higher blood cadmium level was not significantly associated with COPD in females, including those who had never smoked (P for trend=0.39 and P for trend=0.43). Conclusions: A higher blood cadmium level, within the normal range, was associated with COPD in males, including those who had never smoked. However, there was no significant association between blood cadmium levels and COPD in females. - Highlights: • Elevated blood cadmium level is associated with chronic obstructive pulmonary disease in male. • This association can be seen even in never smoked male. • However, this association is present only in male, but not in female.

  10. Position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine: Nutrition and athletic performance.

    Science.gov (United States)

    Rodriguez, Nancy R; DiMarco, Nancy M; Langley, Susie

    2009-03-01

    It is the position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine that physical activity, athletic performance, and recovery from exercise are enhanced by optimal nutrition. These organizations recommend appropriate selection of foods and fluids, timing of intake, and supplement choices for optimal health and exercise performance. This updated position paper couples a rigorous, systematic, evidence-based analysis of nutrition and performance-specific literature with current scientific data related to energy needs, assessment of body composition, strategies for weight change, nutrient and fluid needs, special nutrient needs during training and competition, the use of supplements and ergogenic aids, nutrition recommendations for vegetarian athletes, and the roles and responsibilities of sports dietitians. Energy and macronutrient needs, especially carbohydrate and protein, must be met during times of high physical activity to maintain body weight, replenish glycogen stores, and provide adequate protein to build and repair tissue. Fat intake should be sufficient to provide the essential fatty acids and fat-soluble vitamins, as well as contribute energy for weight maintenance. Although exercise performance can be affected by body weight and composition, these physical measures should not be a criterion for sports performance and daily weigh-ins are discouraged. Adequate food and fluid should be consumed before, during, and after exercise to help maintain blood glucose concentration during exercise, maximize exercise performance, and improve recovery time. Athletes should be well hydrated before exercise and drink enough fluid during and after exercise to balance fluid losses. Sports beverages containing carbohydrates and electrolytes may be consumed before, during, and after exercise to help maintain blood glucose concentration, provide fuel for muscles, and decrease risk of dehydration and hyponatremia. Vitamin

  11. Erlotinib-induced acute interstitial lung disease associated with extreme elevation of the plasma concentration in an elderly non-small-cell lung cancer patient

    Directory of Open Access Journals (Sweden)

    Yukari Tsubata

    2012-01-01

    Full Text Available We herein describe a case of drug-induced interstitial lung disease (ILD following treatment with erlotinib. The plasma trough concentration of erlotinib at the time of the ILD diagnosis was extremely elevated compared with the plasma maximum concentration on day 1. We hypothesized that this phenomenon was associated with the pharmacodynamic interaction with a concomitant drug. The present case indicates that erlotinib-induced ILD was associated with a high plasma concentration of erlotinib. Oncologists should be aware of the possibility of ILD induced by erlotinib, especially for patients with co-morbidities.

  12. Large-scale genome-wide association studies and meta-analyses of longitudinal change in adult lung function.

    Directory of Open Access Journals (Sweden)

    Wenbo Tang

    Full Text Available Genome-wide association studies (GWAS have identified numerous loci influencing cross-sectional lung function, but less is known about genes influencing longitudinal change in lung function.We performed GWAS of the rate of change in forced expiratory volume in the first second (FEV1 in 14 longitudinal, population-based cohort studies comprising 27,249 adults of European ancestry using linear mixed effects model and combined cohort-specific results using fixed effect meta-analysis to identify novel genetic loci associated with longitudinal change in lung function. Gene expression analyses were subsequently performed for identified genetic loci. As a secondary aim, we estimated the mean rate of decline in FEV1 by smoking pattern, irrespective of genotypes, across these 14 studies using meta-analysis.The overall meta-analysis produced suggestive evidence for association at the novel IL16/STARD5/TMC3 locus on chromosome 15 (P  =  5.71 × 10(-7. In addition, meta-analysis using the five cohorts with ≥3 FEV1 measurements per participant identified the novel ME3 locus on chromosome 11 (P  =  2.18 × 10(-8 at genome-wide significance. Neither locus was associated with FEV1 decline in two additional cohort studies. We confirmed gene expression of IL16, STARD5, and ME3 in multiple lung tissues. Publicly available microarray data confirmed differential expression of all three genes in lung samples from COPD patients compared with controls. Irrespective of genotypes, the combined estimate for FEV1 decline was 26.9, 29.2 and 35.7 mL/year in never, former, and persistent smokers, respectively.In this large-scale GWAS, we identified two novel genetic loci in association with the rate of change in FEV1 that harbor candidate genes with biologically plausible functional links to lung function.

  13. Large-Scale Genome-Wide Association Studies and Meta-Analyses of Longitudinal Change in Adult Lung Function

    Science.gov (United States)

    Tang, Wenbo; Kowgier, Matthew; Loth, Daan W.; Soler Artigas, María; Joubert, Bonnie R.; Hodge, Emily; Gharib, Sina A.; Smith, Albert V.; Ruczinski, Ingo; Gudnason, Vilmundur; Mathias, Rasika A.; Harris, Tamara B.; Hansel, Nadia N.; Launer, Lenore J.; Barnes, Kathleen C.; Hansen, Joyanna G.; Albrecht, Eva; Aldrich, Melinda C.; Allerhand, Michael; Barr, R. Graham; Brusselle, Guy G.; Couper, David J.; Curjuric, Ivan; Davies, Gail; Deary, Ian J.; Dupuis, Josée; Fall, Tove; Foy, Millennia; Franceschini, Nora; Gao, Wei; Gläser, Sven; Gu, Xiangjun; Hancock, Dana B.; Heinrich, Joachim; Hofman, Albert; Imboden, Medea; Ingelsson, Erik; James, Alan; Karrasch, Stefan; Koch, Beate; Kritchevsky, Stephen B.; Kumar, Ashish; Lahousse, Lies; Li, Guo; Lind, Lars; Lindgren, Cecilia; Liu, Yongmei; Lohman, Kurt; Lumley, Thomas; McArdle, Wendy L.; Meibohm, Bernd; Morris, Andrew P.; Morrison, Alanna C.; Musk, Bill; North, Kari E.; Palmer, Lyle J.; Probst-Hensch, Nicole M.; Psaty, Bruce M.; Rivadeneira, Fernando; Rotter, Jerome I.; Schulz, Holger; Smith, Lewis J.; Sood, Akshay; Starr, John M.; Strachan, David P.; Teumer, Alexander; Uitterlinden, André G.; Völzke, Henry; Voorman, Arend; Wain, Louise V.; Wells, Martin T.; Wilk, Jemma B.; Williams, O. Dale; Heckbert, Susan R.; Stricker, Bruno H.; London, Stephanie J.; Fornage, Myriam; Tobin, Martin D.; O′Connor, George T.; Hall, Ian P.; Cassano, Patricia A.

    2014-01-01

    Background Genome-wide association studies (GWAS) have identified numerous loci influencing cross-sectional lung function, but less is known about genes influencing longitudinal change in lung function. Methods We performed GWAS of the rate of change in forced expiratory volume in the first second (FEV1) in 14 longitudinal, population-based cohort studies comprising 27,249 adults of European ancestry using linear mixed effects model and combined cohort-specific results using fixed effect meta-analysis to identify novel genetic loci associated with longitudinal change in lung function. Gene expression analyses were subsequently performed for identified genetic loci. As a secondary aim, we estimated the mean rate of decline in FEV1 by smoking pattern, irrespective of genotypes, across these 14 studies using meta-analysis. Results The overall meta-analysis produced suggestive evidence for association at the novel IL16/STARD5/TMC3 locus on chromosome 15 (P  =  5.71 × 10-7). In addition, meta-analysis using the five cohorts with ≥3 FEV1 measurements per participant identified the novel ME3 locus on chromosome 11 (P  =  2.18 × 10-8) at genome-wide significance. Neither locus was associated with FEV1 decline in two additional cohort studies. We confirmed gene expression of IL16, STARD5, and ME3 in multiple lung tissues. Publicly available microarray data confirmed differential expression of all three genes in lung samples from COPD patients compared with controls. Irrespective of genotypes, the combined estimate for FEV1 decline was 26.9, 29.2 and 35.7 mL/year in never, former, and persistent smokers, respectively. Conclusions In this large-scale GWAS, we identified two novel genetic loci in association with the rate of change in FEV1 that harbor candidate genes with biologically plausible functional links to lung function. PMID:24983941

  14. Tumor-Derived CXCL1 Promotes Lung Cancer Growth via Recruitment of Tumor-Associated Neutrophils

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    2016-01-01

    Full Text Available Neutrophils have a traditional role in inflammatory process and act as the first line of defense against infections. Although their contribution to tumorigenesis and progression is still controversial, accumulating evidence recently has demonstrated that tumor-associated neutrophils (TANs play a key role in multiple aspects of cancer biology. Here, we detected that chemokine CXCL1 was dramatically elevated in serum from 3LL tumor-bearing mice. In vitro, 3LL cells constitutively expressed and secreted higher level of CXCL1. Furthermore, knocking down CXCL1 expression in 3LL cells significantly hindered tumor growth by inhibiting recruitment of neutrophils from peripheral blood into tumor tissues. Additionally, tumor-infiltrated neutrophils expressed higher levels of MPO and Fas/FasL, which may be involved in TAN-mediated inhibition of CD4+ and CD8+ T cells. These results demonstrate that tumor-derived CXCL1 contributes to TANs infiltration in lung cancer which promotes tumor growth.

  15. Surfactant Protein A Suppresses Lung Cancer Progression by Regulating the Polarization of Tumor-Associated Macrophages

    OpenAIRE

    Mitsuhashi, Atsushi; Goto, Hisatsugu; Kuramoto, Takuya; Tabata, Sho; Yukishige, Sawaka; Abe, Shinji; Hanibuchi, Masaki; Kakiuchi, Soji; Saijo, Atsuro; Aono, Yoshinori; Uehara, Hisanori; Yano, Seiji; Ledford, Julie G.; Sone, Saburo; Nishioka, Yasuhiko

    2013-01-01

    Surfactant protein A (SP-A) is a large multimeric protein found in the lungs. In addition to its immunoregulatory function in infectious respiratory diseases, SP-A is also used as a marker of lung adenocarcinoma. Despite the finding that SP-A expression levels in cancer cells has a relationship with patient prognosis, the function of SP-A in lung cancer progression is unknown. We investigated the role of SP-A in lung cancer progression by introducing the SP-A gene into human lung adenocarcino...

  16. Sodium, blood pressure, and cardiovascular disease: further evidence supporting the American Heart Association sodium reduction recommendations.

    Science.gov (United States)

    Whelton, Paul K; Appel, Lawrence J; Sacco, Ralph L; Anderson, Cheryl A M; Antman, Elliott M; Campbell, Norman; Dunbar, Sandra B; Frohlich, Edward D; Hall, John E; Jessup, Mariell; Labarthe, Darwin R; MacGregor, Graham A; Sacks, Frank M; Stamler, Jeremiah; Vafiadis, Dorothea K; Van Horn, Linda V

    2012-12-11

    Recent reports of selected observational studies and a meta-analysis have stirred controversy and have become the impetus for calls to abandon recommendations for reduced sodium intake by the US general population. A detailed review of these studies documents substantial methodological concerns that limit the usefulness of these studies in setting, much less reversing, dietary recommendations. Indeed, the evidence base supporting recommendations for reduced sodium intake in the general population remains robust and persuasive. The American Heart Association is committed to improving the health of all Americans through implementation of national goals for health promotion and disease prevention, including its recommendation to reduce dietary sodium intake to <1500 mg/d. PMID:23124030

  17. Radiation-associated lung cancer: A comparison of the histology of lung cancers in uranium miners and survivors of the atomic bombings of Hiroshima and Nagasaki

    International Nuclear Information System (INIS)

    A binational panel of Japanese and American pulmonary pathologists reviewed tissue slides of lung cancer cases diagnosed among Japanese A-bomb survivors and American uranium miners and classified the cases according to histological subtype. Blind reviews were completed on slides from 92 uranium miners and 108 A-bomb survivors, without knowledge of population, sex, age, smoking history, or level of radiation exposure. Consensus diagnoses were obtained with respect to principal subtype, including squamous-cell cancer, small-cell cancer, adenocarcinoma, and less frequent subtypes. The results were analyzed in terms of population, radiation dose, and smoking history. As expected, the proportion of squamous-cell cancer was positively related to smoking history in both populations. The relative frequencies of small-cell cancer and adenocarcinoma were very different in the two populations, but this difference was accounted for adequately by differences in radiation dose or, more specifically, dose-based relative risk estimates based on published data. Radiation-induced cancers appeared more likely to be of the small-cell subtype, and less likely to be adenocarcinomas, in both populations. The data appeared to require no additional explanation in terms of radiation quality (alpha particles vs gamma rays), uniform or local irradiation, inhaled vs external radiation source, or other population difference

  18. Serial chest CT findings in interstitial lung disease associated with polymyositis-dermatomyositis

    International Nuclear Information System (INIS)

    Objective: A retrospective study was carried out in two institutions to determine serial changes in the pattern, distribution, and extent of interstitial lung disease (ILD) associated with polymyositis (PM)-dermatomyositis (DM) using HRCT. Subjects and methods: Twenty patients with PM-DM and clinical suspicion of ILD who underwent at least two serial HRCT examinations were retrospectively evaluated by two readers. Patients were classified according to the dominant CT pattern which was correlated with clinical evolution and underlying histology when available (n=6). Results: Patients were classified into four groups according to the dominant pattern: ground-glass attenuation and reticulation (group 1, n=9); honeycombing (group 2, n=4); airspace consolidation (group 3, n=4), and normal or almost normal lung (group 4, n=3). Under medical treatment, serial HRCT showed that the extent of areas of ground-glass opacities (group 1) decreased in five patients, stabilized in two, and increased in two. Pathologic findings demonstrated usual interstitial pneumonia (UIP) in two cases and unspecified interstitial pneumonia in one. In group 2, extent of honeycombing increased in three cases and stabilized in one. In group 3, dramatic resolution of airspace consolidation occurred in three cases. Clinical deterioration with extensive consolidation at CT and diffuse alveolar damage (DAD) at histology occurred in one patient of each of the three previous groups. Lesions stayed invisible or progressed slightly in the fourth group. Conclusion: In ILD associated with PM-DM, clinical deterioration and DAD in the follow-up can be observed whatever the HRCT pattern. However, unfavorable evolution is constant when honeycombing is present at the initial CT

  19. Treatment of rheumatoid arthritis-associated interstitial lung disease: a perspective review

    Science.gov (United States)

    Iqbal, Kundan; Kelly, Clive

    2015-01-01

    Rheumatoid arthritis (RA) is a systemic autoimmune disease affecting 0.5–1% of the worldwide population. Whilst predominantly causing chronic pain and inflammation in synovial joints, it is also associated with significant extra-articular manifestations in a large proportion of patients. Among the various pulmonary manifestations, interstitial lung disease (ILD), a progressive fibrotic disease of the lung parenchyma, is the commonest and most important, contributing significantly to increased morbidity and mortality. The most frequent patterns of RA-associated ILD (RA-ILD) are usual interstitial pneumonia and nonspecific interstitial pneumonia. New insights during the past several years have highlighted the epidemiological impact of RA-ILD and have begun to identify factors contributing to its pathogenesis. Risk factors include smoking, male sex, human leukocyte antigen haplotype, rheumatoid factor and anticyclic citrullinated protein antibodies (ACPAs). Combined with clinical information, chest examination and pulmonary function testing, high-resolution computed tomography of the chest forms the basis of investigation and allows assessment of subtype and disease extent. The management of RA-ILD is a challenge. Several therapeutic agents have been suggested in the literature but as yet no large randomized controlled trials have been undertaken to guide clinical management. Therapy is further complicated by commonly prescribed drugs of proven articular benefit such as methotrexate, leflunomide (LEF) and anti-tumour necrosis factor α agents having been implicated in both ex novo occurrence and acceleration of existing ILD. Agents that offer promise include immunomodulators such as mycophenolate and rituximab as well as newly studied antifibrotic agents. In this review, we discuss the current literature to evaluate recommendations for the management of RA-ILD and discuss key gaps in our knowledge of this important disease. PMID:26622326

  20. Association of TERT Polymorphisms with Clinical Outcome of Non-Small Cell Lung Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Xueying Zhao

    Full Text Available TERT is of great importance in cancer initiation and progression. Many studies have demonstrated the TERT polymorphisms as risk factors for many cancer types, including lung cancer. However, the impacts of TERT variants on cancer progression and treatment efficacy have remained controversial. This study aimed to investigate the association of TERT polymorphisms with clinical outcome of advanced non-small cell lung cancer (NSCLC patients receiving first-line platinum-based chemotherapy, including response rate, clinical benefit, progression-free survival (PFS, overall survival (OS, and grade 3 or 4 toxicity. Seven polymorphisms of TERT were assessed, and a total of 1004 inoperable advanced NSCLC patients treated with platinum-based chemotherapy were enrolled. It is exhibited that the variant heterozygote of rs4975605 showed significant association with a low rate of clinical benefit, and displayed a much stronger effect in never-smoking female subset, leading to the clinical benefit rate decreased from 82.9% (C/C genotype to 56.4% (C/A genotype; adjusted OR, 3.58; P=1.40×10(-4. It is also observed that the polymorphism rs2736109 showed significant correlation with PFS (log-rank P=0.023. In age > 58 subgroup, patients carrying the heterozygous genotype had a longer median PFS than those carrying the wild-type genotypes (P=0.002. The results from the current study, for the first time to our knowledge, provide suggestive evidence of an effect of TERT polymorphisms on disease progression variability among Chinese patients with platinum-treated advanced NSCLC.

  1. Treatment of rheumatoid arthritis-associated interstitial lung disease: a perspective review.

    Science.gov (United States)

    Iqbal, Kundan; Kelly, Clive

    2015-12-01

    Rheumatoid arthritis (RA) is a systemic autoimmune disease affecting 0.5-1% of the worldwide population. Whilst predominantly causing chronic pain and inflammation in synovial joints, it is also associated with significant extra-articular manifestations in a large proportion of patients. Among the various pulmonary manifestations, interstitial lung disease (ILD), a progressive fibrotic disease of the lung parenchyma, is the commonest and most important, contributing significantly to increased morbidity and mortality. The most frequent patterns of RA-associated ILD (RA-ILD) are usual interstitial pneumonia and nonspecific interstitial pneumonia. New insights during the past several years have highlighted the epidemiological impact of RA-ILD and have begun to identify factors contributing to its pathogenesis. Risk factors include smoking, male sex, human leukocyte antigen haplotype, rheumatoid factor and anticyclic citrullinated protein antibodies (ACPAs). Combined with clinical information, chest examination and pulmonary function testing, high-resolution computed tomography of the chest forms the basis of investigation and allows assessment of subtype and disease extent. The management of RA-ILD is a challenge. Several therapeutic agents have been suggested in the literature but as yet no large randomized controlled trials have been undertaken to guide clinical management. Therapy is further complicated by commonly prescribed drugs of proven articular benefit such as methotrexate, leflunomide (LEF) and anti-tumour necrosis factor α agents having been implicated in both ex novo occurrence and acceleration of existing ILD. Agents that offer promise include immunomodulators such as mycophenolate and rituximab as well as newly studied antifibrotic agents. In this review, we discuss the current literature to evaluate recommendations for the management of RA-ILD and discuss key gaps in our knowledge of this important disease. PMID:26622326

  2. Association between cooking oil fume exposure and lung cancer among Chinese nonsmoking women: a meta-analysis.

    Science.gov (United States)

    Xue, Yingbo; Jiang, Ying; Jin, Shan; Li, Yong

    2016-01-01

    Lung cancer has been the main cause of cancer death around the world. Cigarette smoking has been identified as a risk factor for lung cancer in males. However, the etiological factors in nonsmoking women remain elusive. A meta-analysis was conducted to evaluate the relationship between cooking oil fume exposure and lung cancer among Chinese nonsmoking women. Thirteen articles containing three population-based case-control and ten hospital-based case-control studies were included in this meta-analysis. These studies with a total of 3,596 lung cancer women and 6,082 healthy controls were analyzed by RevMan 5.3. Fixed effects model or random effects model was used to obtain pooled estimates of risk ratio. The risk ratios with a 95% CI were 1.74 (95% CI =1.57-1.94) and 2.11 (95% CI =1.54-2.89), respectively. Cooking oil fume exposure as well as not using a kitchen ventilator when cooking was significantly associated with lung cancer among nonsmoking women (Z=10.07, P<0.00001; Z=4.65, P<0.00001). Cooking oil fume exposure, especially lacking a fume extractor, may increase the risk of lung cancer among Chinese nonsmoking women. PMID:27284248

  3. Association of GWAS-Identified Lung Cancer Susceptibility Loci with Survival Length in Patients with Small-Cell Lung Cancer Treated with Platinum-Based Chemotherapy

    Science.gov (United States)

    Li, Dong; Wei, Lixuan; Xu, Binghe; Yu, Dianke; Chang, Jiang; Yuan, Peng; Du, Zhongli; Tan, Wen; Shen, Hongbing; Wu, Tangchun; Wu, Chen; Lin, Dongxin

    2014-01-01

    Genetic variants have been shown to affect length of survival in cancer patients. This study explored the association between lung cancer susceptibility loci tagged by single-nucleotide polymorphisms (SNPs) identified in the genome-wide association studies and length of survival in small-cell lung cancer (SCLC). Eighteen SNPs were genotyped among 874 SCLC patients and Cox proportional hazards regression was used to examine the effects of genotype on survival length under an additive model with age, sex, smoking status and clinical stage as covariates. We identified 3 loci, 20q13.2 (rs4809957G >A), 22q12.2 (rs36600C >T) and 5p15.33 (rs401681C >T), significantly associated with the survival time of SCLC patients. The adjusted hazard ratio (HR) for patients with the rs4809957 GA or AA genotype was 0.80 (95% CI, 0.66–0.96; P = 0.0187) and 0.73 (95% CI, 0.55–0.96; P = 0.0263) compared with the GG genotype. Using the dominant model, the adjusted HR for patients carrying at least one T allele at rs36600 or rs401681 was 0.78 (95% CI, 0.63–0.96; P = 0.0199) and 1.29 (95% CI, 1.08–1.55; P = 0.0047), respectively, compared with the CC genotype. Stratification analyses showed that the significant associations of these 3 loci were only seen in smokers and male patients. The rs4809957 SNP was only significantly associated with length of survival of patients with extensive-stage but not limited-stage tumor. These results suggest that some of the lung cancer susceptibility loci might also affect the prognosis of SCLC. PMID:25415319

  4. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia : a report from the female lung cancer consortium in Asia

    NARCIS (Netherlands)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2015-01-01

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by exam

  5. Associations between metabolomic compounds and incident heart failure among African Americans: the ARIC Study.

    Science.gov (United States)

    Zheng, Yan; Yu, Bing; Alexander, Danny; Manolio, Teri A; Aguilar, David; Coresh, Josef; Heiss, Gerardo; Boerwinkle, Eric; Nettleton, Jennifer A

    2013-08-15

    Heart failure is more prevalent among African Americans than in the general population. Metabolomic studies among African Americans may efficiently identify novel biomarkers of heart failure. We used untargeted methods to measure 204 stable serum metabolites and evaluated their associations with incident heart failure hospitalization (n = 276) after a median follow-up of 20 years (1987-2008) by using Cox regression in data from 1,744 African Americans aged 45-64 years without heart failure at baseline from the Jackson, Mississippi, field center of the Atherosclerosis Risk in Communities (ARIC) Study. After adjustment for established risk factors, we found that 16 metabolites (6 named with known structural identities and 10 unnamed with unknown structural identities, the latter denoted by using the format X-12345) were associated with incident heart failure (P < 0.0004 based on a modified Bonferroni procedure). Of the 6 named metabolites, 4 are involved in amino acid metabolism, 1 (prolylhydroxyproline) is a dipeptide, and 1 (erythritol) is a sugar alcohol. After additional adjustment for kidney function, 2 metabolites remained associated with incident heart failure (for metabolite X-11308, hazard ratio = 0.75, 95% confidence interval: 0.65, 0.86; for metabolite X-11787, hazard ratio = 1.23, 95% confidence interval: 1.10, 1.37). Further structural analysis revealed X-11308 to be a dihydroxy docosatrienoic acid and X-11787 to be an isoform of either hydroxyleucine or hydroxyisoleucine. Our metabolomic analysis revealed novel biomarkers associated with incident heart failure independent of traditional risk factors. PMID:23788672

  6. Circulating alpha1-antitrypsin in the general population: Determinants and association with lung function

    Directory of Open Access Journals (Sweden)

    Berger Wolfgang

    2008-04-01

    Full Text Available Abstract Background Severe alpha1-antitrypsin (AAT deficiency associated with low AAT blood concentrations is an established genetic COPD risk factor. Less is known about the respiratory health impact of variation in AAT serum concentrations in the general population. We cross-sectionally investigated correlates of circulating AAT concentrations and its association with FEV1. Methods In 5187 adults (2669 females with high-sensitive c-reactive protein (CRP levels ≤ 10 mg/l from the population-based Swiss SAPALDIA cohort, blood was collected at the time of follow-up examination for measuring serum AAT and CRP. Results Female gender, hormone intake, systolic blood pressure, age in men and in postmenopausal women, as well as active and passive smoking were positively, whereas alcohol intake and BMI inversely correlated with serum AAT levels, independent of CRP adjustment. We observed an inverse association of AAT with FEV1 in the total study population (p Conclusion The results of this population-based study reflect a complex interrelationship between tobacco exposure, gender related factors, circulating AAT, systemic inflammatory status and lung function.

  7. Clinical analysis of interstitial lung disease associated with lung cancer%间质性肺病合并肺癌的临床分析

    Institute of Scientific and Technical Information of China (English)

    陈美芳; 施举红; 刘鸿瑞; 许文兵; 肖毅

    2013-01-01

    目的 探讨间质性肺病合并肺癌患者的临床特点,以提高临床诊治水平.方法 对8例经病理确诊的间质性肺病合并肺癌患者的临床表现、影像学、病理进行分析,治疗后随访.结果 8例患者中男性6例,女性2例,6例有吸烟史,中位年龄64岁.主要临床症状为咯血、刺激性于咳、咳大量泡沫痰、胸闷气短加重.3例有免疫学指标阳性.影像学表现为沿胸膜下分布为主的细网格及蜂窝肺,伴肺内结节.间质性肺病类型为非特异性间质性肺炎及寻常型间质性肺炎;肺癌以腺癌为主.2例ANCA阳性的患者给予糖皮质激素治疗;5例患者行肺癌根治术,其中3例患者无法耐受术后化疗,2例患者术后给予辅助化疗,1例行单纯化疗后出现重度骨髓抑制死亡.另2例患者放弃进一步治疗,分别于确诊后8个月及10个月死亡.结论 间质性肺炎合并肺癌起病隐匿,容易误诊、漏诊,临床应引起高度重视.%Objective To investigate the clinical features of interstitial lung disease associated with lung cancer.Methods The clinical manifestations,chest radiography,and pathology of eight interstitial lung disease associated with lung cancer patients were analyzed.All cases were followed up after treatment.Results The patients included six males and two females,six cases had history of smoking,three cases had positive immunological markers.The main clinical symptoms were hemoptysis,dry cough,frothy sputum,and shortness of breath.The pathological types of interstitial lung disease were usual interstitial pneumonia and nonspecific interstitial pneumonia.The pathological type of lung cancer was mainly adenocarcinoma.Five cases were treated with radical resection,three cases of them were unable to tolerate postoperative chemotherapy,two cases of them were given adjuvant chemotherapy.One case was died of severe bone marrow suppression after chemotherapy.The other two cases abandoned further treatment and died at

  8. Associations among body size dissatisfaction, perceived dietary control, and diet history in African American and European American women

    OpenAIRE

    Chandler-Laney, Paula; Hunter, Gary; Bush, Nikki; Alvarez, Jessica; Roy, Jane; Byrne, Nuala; Gower, Barbara

    2009-01-01

    European American (EA) women report greater body dissatisfaction and less dietary control than do African American (AA) women. This study investigated whether ethnic differences in dieting history contributed to differences in body dissatisfaction and dietary control, or to differential changes that may occur during weight loss and regain. Eighty-nine EA and AA women underwent dual energy X-ray absorptiometry to measure body composition and completed questionnaires to assess body dissatisfact...

  9. The human mineral dust-induced gene, mdig, is a cell growth regulating gene associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.D.; Lu, Y.J.; Yuan, B.Z.; Castranova, V.; Shi, X.L.; Stauffer, J.L.; Demers, L.M.; Chen, F. [NIOSH, Morgantown, WV (US). Health Effects Laboratory Division

    2005-07-21

    Environmental or occupational exposure to mineral dusts, mainly silica and asbestos, is associated with an increased incidence of lung inflammation, fibrosis, and/or cancer. To better understand the molecular events associated with these pulmonary diseases, we attempted to identify genes that are regulated by mineral dusts. Using a differential display reverse transcription polymerase chain reaction technique and mRNAs of alveolar macrophages from both normal individuals and coal miners, we identified a novel mineral dust-induced gene named mdig, which had not been fully characterized. The expression of mdig mRNA was detected in alveolar macrophages from coal miners but not from normal subjects. The inducible expression of mdig could be observed in A549 cells exposed to silica particles in a time-dependent manner. The full-length mdig mRNA was expressed in human lung cancer tissues but was barely detectable in the adjacent normal tissues. In addition, a number of lung cancer cell lines constitutively express mdig. Alternative spliced transcripts of mdig were detected in some lung cancer cell lines. Silencing mdig mRNA expression in A549 lung cancer cells by siRNA-mediated RNA interference inhibits cell proliferation and sensitizes the cells to silica-induced cytotoxicity. These results suggest that the mdig gene may be involved in the regulation of cell growth and possibly the development of cancer.

  10. Association between 8-oxo-7,8-dihydroguanine excretion and risk of lung cancer in a prospective study

    DEFF Research Database (Denmark)

    Loft, Steffen; Svoboda, Peter; Kawai, Kazuaki;

    2012-01-01

    in a population-based cohort of 25,717 men and 27,972 women aged 50-64 years with 3-7 years follow-up. We included 260 cases with lung cancer and a subcohort of 263 individuals matched on sex, age, and smoking duration for comparison. Urine collected at entry was analysed for 8-oxoGua by HPLC with...... in the steady state. The aim of this study was to investigate urinary 8-oxoGua as a risk factor for lung cancer. In a nested case-cohort design we examined associations between urinary excretion of 8-oxoGua and risk of lung cancer as well as potential interaction with the OGG1 Ser326Cys polymorphism...... electrochemical detection. There was no significant effect of smoking or OGG1 genotype on the excretion of 8-oxoGua. Overall the incidence rate ratio (IRR) (95% confidence interval) of lung cancer was 1.06 (0.97-1.15) per doubling of 8-oxoGua excretion. The association between lung cancer risk and 8-oxo...

  11. Lung cancer in Hodgkin's disease: association with previous radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    List, A.F.; Doll, D.C.; Greco, F.A.

    1985-02-01

    Seven cases of lung cancer were observed in patients with Hodgkin's disease (HD) since 1970. The risk ratio for the development of lung cancer among HD patients was 5.6 times that expected in the general population. The pertinent clinical data from these patients are described and compared to 28 additional patients reported from other institutions. Small-cell lung cancer represented the predominant histologic type of lung cancer encountered in both smoking and nonsmoking patients with HD, accounting for 42% of cases overall and greater than 55% of cases reported in reviews of second malignancies. Tobacco use was noted in only 53% of patients. Twenty-eight (94%) of 30 patients developing metachronous lung cancer received supradiaphragmatic irradiation as primary therapy for HD. Nineteen (68%) of these patients received subsequent chemotherapy salvage. The median age at diagnosis of HD and lung cancer was 39 and 45 years, respectively. The interval between diagnosis of HD and metachronous lung cancer averaged seven years but appeared to vary inversely with age. HD patients treated with supradiaphragmatic irradiation or combined modality therapy may be at increased risk for developing lung cancer. The high frequency of in-field malignancies that the authors observed and the prevalence of small-cell lung cancer in both smoking and nonsmoking patients suggests that chest irradiation may influence the development of metachronous lung cancer in these patients. The finding of a mean latent interval in excess of seven years emphasizes the need for close long-term observation.

  12. Target Therapy in Lung Cancer.

    Science.gov (United States)

    Cafarotti, Stefano; Lococo, Filippo; Froesh, Patrizia; Zappa, Francesco; Andrè, Dutly

    2016-01-01

    Lung cancer is an extremely heterogeneous disease, with well over 50 different histological variants recognized under the fourth revision of the World Health Organization (WHO) typing system. Because these variants have differing genetic and biological properties correct classification of lung cancer is necessary to assure that lung cancer patients receive optimum management. Due to the recent understanding that histologic typing and EGFR mutation status are important for target the therapy in lung adenocarcinoma patients there was a great need for a new classification that addresses diagnostic issues and strategic management to allow for molecular testing in small biopsy and cytology specimens. For this reason and in order to address advances in lung cancer treatment an international multidisciplinary classification was proposed by the International Association for the Study of Lung Cancer (IASLC), American Thoracic Society (ATS), and European Respiratory Society (ERS), further increasing the histological heterogeneity and improving the existing WHO-classification. Is now the beginning of personalized therapy era that is ideally finalized to treat each individual case of lung cancer in different way. PMID:26667341

  13. Associations of racial discrimination and parental discrimination coping messages with African American adolescent racial identity.

    Science.gov (United States)

    Richardson, Bridget L; Macon, Tamarie A; Mustafaa, Faheemah N; Bogan, Erin D; Cole-Lewis, Yasmin; Chavous, Tabbye M

    2015-06-01

    Research links racial identity to important developmental outcomes among African American adolescents, but less is known about the contextual experiences that shape youths' racial identity. In a sample of 491 African American adolescents (48% female), associations of youth-reported experiences of racial discrimination and parental messages about preparation for racial bias with adolescents' later racial identity were examined. Cluster analysis resulted in four profiles of adolescents varying in reported frequency of racial discrimination from teachers and peers at school and frequency of parental racial discrimination coping messages during adolescents' 8th grade year. Boys were disproportionately over-represented in the cluster of youth experiencing more frequent discrimination but receiving fewer parental discrimination coping messages, relative to the overall sample. Also examined were clusters of adolescents' 11th grade racial identity attitudes about the importance of race (centrality), personal group affect (private regard), and perceptions of societal beliefs about African Americans (public regard). Girls and boys did not differ in their representation in racial identity clusters, but 8th grade discrimination/parent messages clusters were associated with 11th grade racial identity cluster membership, and these associations varied across gender groups. Boys experiencing more frequent discrimination but fewer parental coping messages were over-represented in the racial identity cluster characterized by low centrality, low private regard, and average public regard. The findings suggest that adolescents who experience racial discrimination but receive fewer parental supports for negotiating and coping with discrimination may be at heightened risk for internalizing stigmatizing experiences. Also, the findings suggest the need to consider the context of gender in adolescents' racial discrimination and parental racial socialization. PMID:25300508

  14. Up-to-Date Information on Rheumatoid Arthritis-Associated Interstitial Lung Disease.

    Science.gov (United States)

    Suda, Takafumi

    2015-01-01

    Pulmonary involvement is common in rheumatoid arthritis (RA) and affects all the components of the lung. Interstitial lung disease (ILD) is the most predominant pulmonary manifestation and has been identified as the main cause of morbidity and mortality in RA. Clinically significant RA-ILD occurs in approximately 10% of RA patients. Several risk factors, such as old age, male gender, and smoking, have been reported to date. Histologically, the proportion of the usual interstitial pneumonia (UIP) pattern is higher in RA-ILD than in ILD associated with other connective tissue diseases, and RA-ILD also shows nonspecific interstitial pneumonia and organizing pneumonia patterns. High-resolution computed tomography scans are highly predictive of the histological UIP pattern with a specificity of 96%-100%. Acute exacerbation, which is the acute deterioration of the respiratory status characterized by newly developed bilateral infiltrates with unknown etiologies, has been reported in RA-ILD. Although acute exacerbation of RA-ILD has high mortality, similar to that of idiopathic pulmonary fibrosis, its incidence is lower in RA-ILD than in idiopathic pulmonary fibrosis. A consensus treatment has not yet been established. Current therapeutic regimens typically include corticosteroids with or without cytotoxic agents. Recent large longitudinal studies reported that the prognosis of RA-ILD was poor with a median survival of 2.6-3.0 years. Furthermore, histological and/or radiological patterns, such as UIP or non-UIP, have significant prognostic implications. RA-ILD patients with histological or radiological UIP patterns have poorer prognoses than those with non-UIP patterns. This review assessed the characteristics of RA-ILD by overviewing recent studies in the field and focused on the clinical significance of histological and/or radiological patterns in RA-ILD. PMID:27279757

  15. [A case of lymphocytic adenohypophysitis associated with sarcoidosis of the lung and eye].

    Science.gov (United States)

    Tokunaga, T; Shigemori, M; Katayama, M; Kuramoto, S; Hayashi, H; Yamada, K; Nonaka, K; Sasaguri, Y

    1990-02-01

    Lymphocytic adenohypophysitis is considered to be an inflammatory disease of the adenohypophysis that is commonly present with visual disturbance and hypopituitarism. Its etiology remains unclear but it is often related to an autoimmune disorder involving other organs, such as the thyroid, parathyroid, or adrenal glands. We encountered a rare case of lymphocytic adenohypophysitis associated with sarcoidosis of the lung and eye during the follow-up period. A 23-year-old woman was hospitalized in July 1986, with a one-month history of headache and visual disturbances which began three days after her second normal delivery. On admission, she showed slight visual impairment and had a left temporal superior quadrantanopia. Endocrinological evaluation revealed thyroid and adrenal hypofunction, and low response of human growth hormone to the loading test. A skull X-ray showed normal shaped sella with some erosion of the dorsum. CT scan showed a rounded contrast-enhanced intrasellar mass extending into the suprasellar cistern. MRI (SR: 500/30) showed a homogeneous low intensity mass which contained a small high intensity area on the relative T2-weighted image (2000/50). A biopsy was performed via right frontotemporal craniotomy. The consistency of the resected tissue was firmer than that of pituitary adenoma. Histologically, the tissue showed diffuse lymphocytic infiltration with some normal adenohypophysis. Her postoperative course was uneventful and the visual impairment improved two months later after the operation. Six months after the operation, she was readmitted with complaints of general fatigue and breathlessness. Chest X-ray showed diffuse infiltration throughout both lung fields, but there was no bilateral hilar lymphadenopathy.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2186292

  16. Workforce and Salary Survey Trends: Opportunities and Challenges for the American Association of Medical Dosimetrists

    International Nuclear Information System (INIS)

    The American Association of Medical Dosimetrists (AAMD) designed and directed 2 surveys of the AAMD membership. The first was in 2011 and the second in 2014. There were a number of questions common to both surveys, and this article seeks to evaluate these common questions to determine trends among the professional membership of the AAMD. It is demonstrated that the observed trends are consistent with the goals and objectives established by the leadership of the AAMD and the Medical Dosimetry Certification Board (MDCB) for the medical dosimetry community. In addition, certain challenges and opportunities involving the scope of practice for the medical dosimetry profession are discussed

  17. Homophobic Attitudes and Associated Factors Among Adolescents: A Comparison of Six Latin American Countries.

    Science.gov (United States)

    Chaux, Enrique; León, Manuela

    2016-09-01

    Homophobic attitudes are still very common in the world, although there are large differences between countries. This study analyzed the responses of almost 30,000 8th- and 9th-grade students from six countries who participated in the Latin American component of the International Civic and Citizenship Education Study. Higher levels of homophobia were found in the Dominican Republic, Guatemala, and Paraguay than in Chile, Colombia, and Mexico. Homophobic attitudes were positively associated with being male, having lower levels of empathy, spending less time with friends and the media, having aggressive attitudes, and being more religious, in particular non-Catholic Christian. PMID:26861958

  18. Workforce and Salary Survey Trends: Opportunities and Challenges for the American Association of Medical Dosimetrists

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Michael D., E-mail: mdmill03@exchange.louisville.edu

    2015-07-01

    The American Association of Medical Dosimetrists (AAMD) designed and directed 2 surveys of the AAMD membership. The first was in 2011 and the second in 2014. There were a number of questions common to both surveys, and this article seeks to evaluate these common questions to determine trends among the professional membership of the AAMD. It is demonstrated that the observed trends are consistent with the goals and objectives established by the leadership of the AAMD and the Medical Dosimetry Certification Board (MDCB) for the medical dosimetry community. In addition, certain challenges and opportunities involving the scope of practice for the medical dosimetry profession are discussed.

  19. Association between Traffic-Related Black Carbon Exposure and Lung Function among Urban Women

    OpenAIRE

    Suglia, Shakira Franco; Gryparis, Alexandros; Schwartz, Joel David; Wright, Rosalind Jo

    2008-01-01

    Background: Although a number of studies have documented the relationship between lung function and traffic-related pollution among children, few have focused on adult lung function or examined community-based populations. Objective: We examined the relationship between black carbon (BC), a surrogate of traffic-related particles, and lung function among women in the Maternal–Infant Smoking Study of East Boston, an urban cohort in Boston, Massachusetts. Methods: We estimated local BC levels us...

  20. HOXA11 hypermethylation is associated with progression of non-small cell lung cancer

    OpenAIRE

    Hwang, Jung-Ah; Lee, Bo Bin; Kim, Yujin; Park, Seong-Eun; Heo, Kyun; Hong, Seung-Hyun; Kim, Young-Ho; Han, Joungho; Shim, Young Mog; Lee, Yeon-Su; Kim, Duk-Hwan

    2013-01-01

    This study was aimed at understanding the functional significance of HOXA11 hypermethylation in non-small cell lung cancer (NSCLC). HOXA11 hypermethylation was characterized in six lung cancer cell lines, and its clinical significance was analyzed using formalin-fixed paraffin-embedded tissues from 317 NSCLC patients, and Ki-67 expression was analyzed using immunohistochemistry. The promoter region of HOXA11 was highly methylated in six lung cancer cell lines, but not in normal bronchial epit...

  1. Lung cancer and its association with chronic obstructive pulmonary disease:update on nexus of epigenetics

    OpenAIRE

    Sundar, Isaac K.; Mullapudi, Nandita; Yao, Hongwei; Spivack, Simon D.; Rahman, Irfan

    2011-01-01

    PURPOSE OF REVIEW:Chronic obstructive pulmonary disease (COPD) and lung cancer are the leading causes of morbidity and mortality worldwide. The current research is focused on identifying the common and disparate events involved in epigenetic modifications that concurrently occur during the pathogenesis of COPD and lung cancer. The purpose of this review is to describe the current knowledge and understanding of epigenetic modifications in pathogenesis of COPD and lung cancer.RECENT FINDINGS:Th...

  2. Lung hyperpermeability and asthma prevalence in schoolchildren: unexpected associations with the attendance at indoor chlorinated swimming pools

    OpenAIRE

    Bernard, Alfred; Carbonnelle, Sylviane; Michel, O; Higuet, S; de Burbure, Claire; Buchet, Jean-Pierre; Hermans, Cédric; Dumont, Xavier; Doyle, I

    2003-01-01

    AIMS: To study whether exposure to nitrogen trichloride in indoor chlorinated pools may affect the respiratory epithelium of children and increase the risk of some lung diseases such as asthma. METHODS: In 226 healthy children, serum surfactant associated proteins A and B (SP-A and SP-B), 16 kDa Clara cell protein (CC16), and IgE were measured. Lung specific proteins were measured in the serum of 16 children and 13 adults before and after exposure to NCl(3) in an indoor chlorinated pool. Rela...

  3. A dataset to assess providers׳ knowledge and attitudes towards the 2013 American College of Cardiology/American Heart Association Cholesterol Management Guideline.

    Science.gov (United States)

    Pokharel, Yashashwi; Steinberg, Lynne; Chan, Winston; Akeroyd, Julia M; Jones, Peter H; Nambi, Vijay; Nasir, Khurram; Petersen, Laura; Ballantyne, Christie M; Virani, Salim S

    2016-06-01

    We previously examined provider׳s understanding of the 2013 American College of Cardiology/American Heart Association (ACC/AHA) cholesterol management guideline (DOI: http://dx.doi.org/10.1016/j.jacl.2015.11.002)(Virani et al., 2013) [1], and also assessed whether a case-based educational intervention could improve providers׳ knowledge gaps and attitudes towards the guideline (DOI: 10.1016/j.atherosclerosis.2015.12.044) (Pokharel, et al., 2016) [2]. Here we describe the dataset that we used to examine our objectives. PMID:27054163

  4. Clinical evaluation of multidrug resistance associated protein expression by FDG PET and MIBI SPECT in lung cancer

    International Nuclear Information System (INIS)

    Multidrug resistance is one of the major obstacles in the successful anticancer therapy. The aim of this study is to evaluate whether FDG PET and MIBI SPECT can be markers for p-glycoprotein (Pgp), multidrug resistance-associated protein (MRP), lung resistance protein (LRP) expression in lung cancer tissues. Eighty-eight patients with 92 lung cancer lesions were enrolled in this study. Before surgery, FDG PET imaging was performed 40 min after injection of FDG 185 MBq, and standardized uptake values (SUVs) were obtained. MIBI SPECT imaging was performed 15 min and 3 hour after injection of MIBI 370 MBq. Early ratio (ER), delayed ratio (DR), and washout rate (WR) were obtained. Pgp, MRP, and LRP expression in lung cancer tissues were determined by immunohistochemical staining. No significant correlations were observed between MIBI uptake and expression of Pgp, MRP and LRP. FDG uptake significantly correlated with expression of Pgp and LRP. The lung cancer with high degree of Pgp and LRP expression had significantly low FDG uptake. However, there is no correlation between FDG uptake and MRP expression. Pgp and LRP expression of adenocarcinomas were significantly higher than that of squamous cell carcinomas. FDG uptake of adenocarcinomas were significantly lower than that of squamous cell carcinomas. In lung adenocarcinomas, Pgp and LRP expression of bronchioloalveolar carcinomas were significantly higher than that of poorly differentiated adenocarcinomas. In contrast, FDG uptake of bronchioloalveolar carcinomas were significantly low when compared with that of poorly differentiated adenocarcinomas. In addition, it was also suggested that biological behavior of LRP expression was similar to that of Pgp expression. FDG uptake may be a marker for Pgp and LRP expression but not for MRP expression in patients with lung cancer. Both Pgp, LRP expression and FDG uptake correlate with cellular differentiation and histological type. (author)

  5. Sheep bronchoalveolar carcinoma: tissue associated protein complex (TAPC) in normal lung tissue and in the tumor differed quantitatively.

    Science.gov (United States)

    Livneh, O; Hod, I; Yegana, Y; Mashiah, A; Ben-Menahem, N; Ron, A; Sternfeld, M

    1988-01-01

    Sheep lungs experimentally and naturally affected by bronchoalveolar carcinoma were washed out exhaustively of soluble components by phosphate-buffered saline, pH 7.4 (PBS), followed by glycine buffer, pH 2.8 (GB), and then again by 1M KCl followed by PBS. The tissue matrix (TM) of the tumor-free region and the tumor-affected tissue were analysed separately by sodium dodecyl sulfate (SDS) polyacrylamide electrophoresis. Normal lung tissues obtained from normal sheep served as controls. Several protein fractions and fragments, identified in both the normal and the tumorous lung, have the molecular weight (MW) of 130,000-228,000, as compared with the major soluble tissue associated protein having MW of 70,000. Coomassie blue staining used in the SDS polyacrylamide system and alkaline phosphatase immunoreaction used in the Enzyme Linked Immunosorbant Assay (ELISA) showed tenfold increased concentration of the TAPC in the TM of the tumor tissue and in the blood of tumor-affected animals, respectively. Total concentration of the TAPC in the serum of tumor-affected animals was higher than in the normal. Immunofluorescent antibody test (IAT) detected the TAPC in the cytoplasm of tumor as well as in normal lung cells, and the study suggested that the TAPC reaches the peripheral blood during tissue destruction occurring at the tumor site, as observed by light and electron microscopy (LM and EM). The concentration of each of the TAPC fractions was higher in the tumor-affected sheep lung as compared with normal sheep lung. Antibodies prepared against the TAPC fractions were toxic to sheep lung cells in tissue culture. Tumor cells were more susceptible. PMID:2839292

  6. Interstitial lung abnormalities in treatment-naïve advanced non-small-cell lung cancer patients are associated with shorter survival

    Energy Technology Data Exchange (ETDEWEB)

    Nishino, Mizuki, E-mail: Mizuki_Nishino@DFCI.HARVARD.EDU [Department of Radiology, Brigham and Women' s Hospital, 75 Francis St., Boston, MA 02115 (United States); Department of Imaging, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215 (United States); Cardarella, Stephanie [Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215, (United States); Dahlberg, Suzanne E. [Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215 (United States); Araki, Tetsuro [Department of Radiology, Brigham and Women' s Hospital, 75 Francis St., Boston, MA 02115 (United States); Lydon, Christine; Jackman, David M.; Rabin, Michael S. [Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215, (United States); Hatabu, Hiroto [Department of Radiology, Brigham and Women' s Hospital, 75 Francis St., Boston, MA 02115 (United States); Johnson, Bruce E. [Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215, (United States)

    2015-05-15

    Highlights: • Interstitial lung abnormalities were present in 14% of stage IV NSCLC patients. • ILA was more common in older patients with heavier smoking history. • ILA was associated with shorter survival after adjusting for smoking and therapy. • ILA could be an additional independent marker for survival in advanced NSCLC. - Abstract: Objective: Interstitial lung diseases are associated with increased risk of lung cancer. The prevalence of ILA at diagnosis of advanced non-small-cell lung cancer (NSCLC) and its impact on overall survival (OS) remain to be investigated. Materials and method: The study included 120 treatment-naïve stage IV NSCLC patients (53 males, 67 females). ILA was scored on CT prior to any systemic therapy using a 4-point scale [0 = no evidence of ILA, 1 = equivocal for ILA, 2 = suspicious for ILA, 3 = ILA] by a sequential reading method previously reported. ILA scores of 2 or 3 indicated the presence of ILA. Results: ILA was present in 17 patients (14%) with advanced NSCLC prior to any treatment (score3: n = 2, score2: n = 15). These 17 patients were significantly older (median age: 69 vs. 63, p = 0.04) and had a heavier smoking history (median: 40 vs. 15.5 pack-year, p = 0.003) than those with ILA score 0 or 1. Higher ILA scores were associated with shorter OS (p = 0.001). Median OS of the 17 patients with ILA was 7.2 months [95%CI: 2.9–9.4] compared to 14.8 months [95%CI: 11.1–18.4] in patients with ILA score 0 or 1 (p = 0.002). In a multivariate model, the presence of ILA remained significant for increased risk for death (HR = 2.09, p = 0.028) after adjusting for first-line systemic therapy (chemotherapy, p < 0.001; TKI, p < 0.001; each compared to no therapy) and pack years of smoking (p = 0.40). Conclusion: Radiographic ILA was present in 14% of treatment-naïve advanced NSCLC patients. Higher ILA scores were associated with shorter OS, indicating that ILA could be a marker of shorter survival in advanced NSCLC.

  7. Interstitial lung abnormalities in treatment-naïve advanced non-small-cell lung cancer patients are associated with shorter survival

    International Nuclear Information System (INIS)

    Highlights: • Interstitial lung abnormalities were present in 14% of stage IV NSCLC patients. • ILA was more common in older patients with heavier smoking history. • ILA was associated with shorter survival after adjusting for smoking and therapy. • ILA could be an additional independent marker for survival in advanced NSCLC. - Abstract: Objective: Interstitial lung diseases are associated with increased risk of lung cancer. The prevalence of ILA at diagnosis of advanced non-small-cell lung cancer (NSCLC) and its impact on overall survival (OS) remain to be investigated. Materials and method: The study included 120 treatment-naïve stage IV NSCLC patients (53 males, 67 females). ILA was scored on CT prior to any systemic therapy using a 4-point scale [0 = no evidence of ILA, 1 = equivocal for ILA, 2 = suspicious for ILA, 3 = ILA] by a sequential reading method previously reported. ILA scores of 2 or 3 indicated the presence of ILA. Results: ILA was present in 17 patients (14%) with advanced NSCLC prior to any treatment (score3: n = 2, score2: n = 15). These 17 patients were significantly older (median age: 69 vs. 63, p = 0.04) and had a heavier smoking history (median: 40 vs. 15.5 pack-year, p = 0.003) than those with ILA score 0 or 1. Higher ILA scores were associated with shorter OS (p = 0.001). Median OS of the 17 patients with ILA was 7.2 months [95%CI: 2.9–9.4] compared to 14.8 months [95%CI: 11.1–18.4] in patients with ILA score 0 or 1 (p = 0.002). In a multivariate model, the presence of ILA remained significant for increased risk for death (HR = 2.09, p = 0.028) after adjusting for first-line systemic therapy (chemotherapy, p < 0.001; TKI, p < 0.001; each compared to no therapy) and pack years of smoking (p = 0.40). Conclusion: Radiographic ILA was present in 14% of treatment-naïve advanced NSCLC patients. Higher ILA scores were associated with shorter OS, indicating that ILA could be a marker of shorter survival in advanced NSCLC

  8. Intravenous pamidronate in the treatment of osteoporosis associated with corticosteroid dependent lung disease: an open pilot study.

    OpenAIRE

    Gallacher, S. J.; Fenner, J A; Anderson, K.; Bryden, F M; Banham, S W; Logue, F C; Cowan, R. A.; Boyle, I T

    1992-01-01

    BACKGROUND: Bisphosphonates have been shown to be effective agents in the treatment of postmenopausal osteoporosis. Because corticosteroid associated osteoporosis is often associated with increased bone turnover, the effect of intermittent intravenous infusions of pamidronate on this condition has been investigated. METHODS: Seventeen patients (five male) with chronic corticosteroid dependent lung disease (15 asthma, two sarcoidosis) were treated with infusions of 30 mg pamidronate once every...

  9. Genome Wide Association Identifies PPFIA1 as a Candidate Gene for Acute Lung Injury Risk Following Major Trauma

    OpenAIRE

    Christie, Jason D.; Wurfel, Mark M.; Feng, Rui; O'Keefe, Grant E; Bradfield, Jonathan; Ware, Lorraine B.; Calfee, Carolyn S.; Matthay, Michael; Meyer, Nuala J.; Kim, Cecilia; Li, Mingyao; Akey, Joshua; Barnes, Kathleen C.; Sevransky, Jonathan; Lanken, Paul N

    2012-01-01

    Acute Lung Injury (ALI) is a syndrome with high associated mortality characterized by severe hypoxemia and pulmonary infiltrates in patients with critical illness. We conducted the first investigation to use the genome wide association (GWA) approach to identify putative risk variants for ALI. Genome wide genotyping was performed using the Illumina Human Quad 610 BeadChip. We performed a two-stage GWA study followed by a third stage of functional characterization. In the discovery phase (Phas...

  10. Blood transfusion during cardiac surgery is associated with inflammation and coagulation in the lung: a case control study

    OpenAIRE

    Tuinman, Pieter R; Vlaar, Alexander P; Cornet, Alexander D.; Hofstra, Jorrit J.; Levi, Marcel; Meijers, Joost CM; Beishuizen, Albertus; Schultz, Marcus J; Groeneveld, AB Johan; Juffermans, Nicole P.

    2011-01-01

    Introduction Blood transfusion is associated with increased morbidity and mortality in cardiac surgery patients, but cause-and-effect relations remain unknown. We hypothesized that blood transfusion is associated with changes in pulmonary and systemic inflammation and coagulation occurring in patients who do not meet the clinical diagnosis of transfusion-related acute lung injury (TRALI). Methods We performed a case control study in a mixed medical-surgical intensive care unit of a university...

  11. Post-partum sequential occurrence of two diverse transfusion reactions (transfusion associated circulatory overload and transfusion related acute lung injury)

    OpenAIRE

    Rudrashish Haldar; Sukhen Samanta

    2013-01-01

    Transfusion associated circulatory overload (TACO) and transfusion related acute lung injury (TRALI) are two dissimilar pathological conditions associated with transfusion of blood products where the time course of the events and clinical presentation overlap leading to uncertainty in establishing the diagnosis and initiating the treatment, which otherwise differs. We encountered a case where a patient of post-partum hemorrhage developed TACO in the immediate post-operative period due to aggr...

  12. Gastrin-releasing peptide receptor expression in non-cancerous bronchial epithelia is associated with lung cancer: a case-control study

    Directory of Open Access Journals (Sweden)

    Egloff Ann Marie

    2012-02-01

    Full Text Available Abstract Background Normal bronchial tissue expression of GRPR, which encodes the gastrin-releasing peptide receptor, has been previously reported by us to be associated with lung cancer risk in 78 subjects, especially in females. We sought to define the contribution of GRPR expression in bronchial epithelia to lung cancer risk in a larger case-control study where adjustments could be made for tobacco exposure and sex. Methods We evaluated GRPR mRNA levels in histologically normal bronchial epithelial cells from 224 lung cancer patients and 107 surgical cancer-free controls. Associations with lung cancer were tested using logistic regression models. Results Bronchial GRPR expression was significantly associated with lung cancer (OR = 4.76; 95% CI = 2.32-9.77 in a multivariable logistic regression (MLR model adjusted for age, sex, smoking status and pulmonary function. MLR analysis stratified by smoking status indicated that ORs were higher in never and former smokers (OR = 7.74; 95% CI = 2.96-20.25 compared to active smokers (OR = 1.69; 95% CI = 0.46-6.33. GRPR expression did not differ by subject sex, and lung cancer risk associated with GRPR expression was not modified by sex. Conclusions GRPR expression in non-cancerous bronchial epithelium was significantly associated with the presence of lung cancer in never and former smokers. The association in never and former smokers was found in males and females. Association with lung cancer did not differ by sex in any smoking group.

  13. IgG4-related Lung Disease Associated with Autoimmune Hemolytic Anemia: A Case Report and a Literature Review.

    Science.gov (United States)

    Noguchi, Shingo; Yatera, Kazuhiro; Jinbo, Mitsutaka; Yamada, Sohsuke; Shimabukuro, Ikuko; Yamasaki, Kei; Kido, Takashi; Ishimoto, Hiroshi; Yoshii, Chiharu; Mukae, Hiroshi

    2016-01-01

    We herein report a case of IgG4-related lung disease (IgG4-RLD) associated with autoimmune hemolytic anemia (AIHA). A 73-year-old Japanese female visited our hospital for an examination following an abnormal chest X-ray in 1999. She was diagnosed with bronchiolitis and AIHA, and treatment with prednisolone was started. After seven years, she visited our department due to a cough. Chest computed tomography (CT) demonstrated focal consolidation with ground-glass attenuations and thickened bronchial walls in the bilateral lungs. She was clinically diagnosed and treated for bronchial asthma. CT findings had shown no changes, and a lung biopsy was performed using video-assisted thoracic surgery at eleven years from the first diagnosis of AIHA. The pathological findings demonstrated the presence of peribronchovascular lymphoplasmacytic infiltrates with stromal fibrotic changes, admixed with many IgG4-positive plasma cells. Furthermore, the patient's serum IgG4 level was high, and her CT findings did not show any obvious abnormal findings in the any organs other than the lungs. She was diagnosed with IgG4-RLD based on the findings. We believe that this case report of IgG4-RLD associated with AIHA is clinically helpful for a better understanding of these diseases, although there are five reported cases of IgG4-related disease associated with AIHA. PMID:27580552

  14. Health seeking behavioral analysis associated with breast cancer screening among Asian American women

    Directory of Open Access Journals (Sweden)

    Ma GX

    2012-05-01

    Full Text Available Grace X Ma,1 Wanzhen Gao,1 Sunmin Lee,2 MinQi Wang,3 Yin Tan,1 Steven E Shive,1,41Department of Public Health, Center for Asian Health, College of Health Professions, Temple University, Philadelphia, PA, USA; 2Department of Epidemiology and Biostatistics, School of Public Health, University of Maryland, College Park, MD, USA; 3Department of Public and Community Health, University of Maryland, College Park, Maryland, MD, USA; 4East Stroudsburg University, East Stroudsburg, PA, USAObjective: The purpose of this community-based study was to apply a Sociocultural Health Behavior Model to determine the association of factors proposed in the model with breast cancer screening behaviors among Asian American women.Methods: A cross-sectional design included a sample of 682 Chinese, Korean, and Vietnamese women aged 40 years and older. The frequency distribution analysis and Chi-square analysis were used for the initial screening of the following variables: sociodemographic, cultural, enabling, environmental, and social support. Univariate and multivariate analyses were conducted on factors for breast cancer screening using multinomial logistic regression analysis.Results: Correlates to positive breast cancer screening included demographics (ethnicity, cultural factors (living in the United States for 15 years or more, speaking English well, enabling factors (having a regular physician to visit, health insurance covering the screening, and family/social support factors (those who had a family/friend receiving a mammogram.Conclusions: The results of this study suggest that breast cancer screening programs will be more effective if they include the cultural and health beliefs, enabling, and social support factors associated with breast cancer screening. The use of community organizations may play a role in helping to increase breast cancer screening rates among Asian American women.Keywords: breast cancer screening, Vietnamese, Korean, Chinese, breast

  15. Alpha-1 Antitrypsin Therapy in Cystic Fibrosis and the Lung Disease Associated with Alpha-1 Antitrypsin Deficiency.

    Science.gov (United States)

    McElvaney, Noel G

    2016-04-01

    Cystic fibrosis and alpha-1 antitrypsin (AAT) deficiency are two of the commonest lethal hereditary lung diseases affecting white individuals. Although having quite different phenotypic extrapulmonary presentations, the lung disease associated with these conditions is exemplified by a neutrophil-dominated inflammation in which neutrophil elastase plays a major role. In AAT deficiency the diminution of the anti-neutrophil elastase protection, due to diminished AAT levels in the lung, predisposes the lung to an unopposed neutrophil elastase attack, whereas, in cystic fibrosis, the levels of AAT and other antiproteases are normal, but the neutrophil elastase burden is so large that it overwhelms the normal anti-neutrophil elastase protection. With this as background, it seems logical to augment the anti-neutrophil elastase defenses of the lung in both conditions using exogenous AAT. The type of AAT, the route of administration, and the physiologic, radiologic, and clinical readouts for this type of therapy are discussed, along with the similarities and differences between the two conditions and their responses to AAT therapy. PMID:27115956

  16. Integrative proteomics and tissue microarray profiling indicate the association between overexpressed serum proteins and non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Yansheng Liu

    Full Text Available Lung cancer is the leading cause of cancer deaths worldwide. Clinically, the treatment of non-small cell lung cancer (NSCLC can be improved by the early detection and risk screening among population. To meet this need, here we describe the application of extensive peptide level fractionation coupled with label free quantitative proteomics for the discovery of potential serum biomarkers for lung cancer, and the usage of Tissue microarray analysis (TMA and Multiple reaction monitoring (MRM assays for the following up validations in the verification phase. Using these state-of-art, currently available clinical proteomic approaches, in the discovery phase we confidently identified 647 serum proteins, and 101 proteins showed a statistically significant association with NSCLC in our 18 discovery samples. This serum proteomic dataset allowed us to discern the differential patterns and abnormal biological processes in the lung cancer blood. Of these proteins, Alpha-1B-glycoprotein (A1BG and Leucine-rich alpha-2-glycoprotein (LRG1, two plasma glycoproteins with previously unknown function were selected as examples for which TMA and MRM verification were performed in a large sample set consisting about 100 patients. We revealed that A1BG and LRG1 were overexpressed in both the blood level and tumor sections, which can be referred to separate lung cancer patients from healthy cases.

  17. The First Type III Domain of Fibronectin is Associated with the Expression of Cytokines within the Lung Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Mingzhe Zheng, David M. Jones, Carol Horzempa, Aparna Prasad, Paula J. McKeown-Longo

    2011-01-01

    Full Text Available Recent studies have pointed to changes in tissue mechanics as a contributory element to the development of malignancies. Increased tissue rigidity is associated with the unfolding of the Type III domains of fibronectin within the extracellular matrix. The consequences of this unfolding on cellular functions within the lung are not well understood. In the present study, we evaluated the effect of a peptide representing a partially unfolded intermediate of the first Type III repeat of fibronectin (FnIII-1c on inflammatory gene expression in adult human lung fibroblast cells. FnIII-1c induced expression of cytokines, CXCL1-3, IL-8 and TNF-α, by lung fibroblast cells. The increase in IL-8 expression was dependent on Toll-like receptor 2 and NFκB. Immunohistochemistry of tissue arrays representing squamous cell carcinoma of the lung revealed extensive stromal staining for IL-8 and fibronectin fibrils which were co-aligned with myofibroblasts. These data suggest a model in which unfolding of FnIII domains secondary to myofibroblast-generated tension may induce the release of cytokines by stromal fibroblasts present within the lung tumor.

  18. Association of mitochondrial DNA variations with lung cancer risk in a Han Chinese population from southwestern China.

    Directory of Open Access Journals (Sweden)

    Shizhen Zheng

    Full Text Available Mitochondrial DNA (mtDNA is particularly susceptible to oxidative damage and mutation due to the high rate of reactive oxygen species (ROS production and limited DNA-repair capacity in mitochondrial. Previous studies demonstrated that the increased mtDNA copy number for compensation for damage, which was associated with cigarette smoking, has been found to be associated with lung cancer risk among heavy smokers. Given that the common and "non-pathological" mtDNA variations determine differences in oxidative phosphorylation performance and ROS production, an important determinant of lung cancer risk, we hypothesize that the mtDNA variations may play roles in lung cancer risk. To test this hypothesis, we conducted a case-control study to compare the frequencies of mtDNA haplogroups and an 822 bp mtDNA deletion between 422 lung cancer patients and 504 controls. Multivariate logistic regression analysis revealed that haplogroups D and F were related to individual lung cancer resistance (OR = 0.465, 95%CI = 0.329-0.656, p<0.001; and OR = 0.622, 95%CI = 0.425-0.909, p = 0.014, respectively, while haplogroups G and M7 might be risk factors for lung cancer (OR = 3.924, 95%CI = 1.757-6.689, p<0.001; and OR = 2.037, 95%CI = 1.253-3.312, p = 0.004, respectively. Additionally, multivariate logistic regression analysis revealed that cigarette smoking was a risk factor for the 822 bp mtDNA deletion. Furthermore, the increased frequencies of the mtDNA deletion in male cigarette smoking subjects of combined cases and controls with haplogroup D indicated that the haplogroup D might be susceptible to DNA damage from external ROS caused by heavy cigarette smoking.

  19. Lack of association between IL-6 -174G>C polymorphism and lung cancer: a meta-analysis.

    Science.gov (United States)

    Liu, Y; Song, X L; Zhang, G L; Peng, A M; Fu, P F; Li, P; Tan, M; Li, X; Li, M; Wang, C H

    2015-01-01

    The results of previous case-control studies examining the relationship between the interleukin (IL)-6 gene -174G>C polymorphism and lung cancer are controversial. In this study, we evaluated the relationship between the IL-6 gene -174G>C polymorphism and lung cancer. We selected 5 case-control studies related to the IL-6 gene -174G>C polymorphism and lung cancer by searching the PubMed, EMBase, Chinese Biomedical Literature Database, and Wanfang database. We utilized the Q-test and I2 test to determine heterogeneity between each study. To merge the odds ratios (OR) and 95% confidence intervals (CI), we utilized the fixed effects model and random effect model for analyses. The present study included 2801 patients with lung cancer and 3234 cancer-free control subjects. The meta-analysis revealed no association between the IL-6 gene -174G>C polymorphism and lung cancer in either genotype or allele distribution [CC+GC vs GG: OR = 1.04, 95%CI (0.86-1.26), P = 0.70; GG+GC vs CC: OR = 0.93, 95%CI (0.82-1.05), P = 0. 23; CC vs GG: OR = 1.08, 95%CI (0.95-1.23), P = 0.23; C allele vs D allele: OR = 1.03, 95%CI (0.96-1.11), P = 0.44]. We concluded that the IL-6 gene -174G>C polymorphism was not associated with lung cancer. PMID:25729947

  20. IL-17A-producing T cells are associated with the progression of lung adenocarcinoma.

    Science.gov (United States)

    Bao, Zhang; Lu, Guohua; Cui, Dawei; Yao, Yinan; Yang, Guangdie; Zhou, Jianying

    2016-08-01

    Accumulating evidence has shown that T cells are crucial in shaping the tumor microenvironment and regulating tumor development. However, the roles of IL-17A‑producing T cells (IL-17A+CD4+ Th17, IL-17A+CD8+ Tc17 and IL-17A+ γδT17 cells) and related cytokines in the progression of lung cancer (LC) remain uncertain. Here, we found that the frequencies of both Th17 and γδT17 cells in the peripheral blood of patients with lung adenocarcinoma (LA) were higher than those in healthy controls (HCs), whereas the frequency of Tc17 cells in the patients with LA was decreased. In addition, the frequencies of circulating Th17 and γδT17 cells, but not Tc17 cells, were positively associated with tumor invasion and metastasis. Furthermore, the major source of IL-17A production was Th17 cells, followed by Tc17 and γδT17 cells, in peripheral blood from patients with LA and HCs; but the percentages of Th17 and γδT17 cells in total intracellular IL-17A+ cells obtained from the patients with LC were higher than those from HCs. Moreover, the protein and corresponding mRNA levels of IL-17A, IL-23, IL-1β, and TGF-β1 were much higher in the patients with LA than those in HCs, and the levels of IL-17A in patients were positively correlated with numbers of both Th17 and γδT17 cells, but not Tc17 cells. Finally, the frequencies of circulating Th17 and γδT17 cells, along with the levels of IL-17A, IL-23, IL-1β, and TGF-β1 were decreased in the patients with LA after tumor resection, whereas the frequency of circulating Tc17 cells was inversely increased in these patients. Our findings indicate that Th17, Tc17, γδT17 cells, and IL-17A-associated cytokines contribute to the development of LA and thus represent promising targets for therapeutic strategies. PMID:27277161

  1. Association by Spatial Interpolation between Ozone Levels and Lung Function of Residents at an Industrial Complex in South Korea

    Science.gov (United States)

    Jung, Soon-Won; Lee, Kyoungho; Cho, Yong-Sung; Choi, Ji-Hee; Yang, Wonho; Kang, Tack-Shin; Park, Choonghee; Kim, Geun-Bae; Yu, Seung-Do; Son, Bu-Soon

    2016-01-01

    Spatial interpolation is employed to improve exposure estimates and to assess adverse health effects associated with environmental risk factors. Since various studies have reported that high ozone (O3) concentrations can give rise to adverse effects on respiratory symptoms and lung function, we investigated the association between O3 levels and lung function using a variety of spatial interpolation techniques and evaluated how different methods for estimating exposure may influence health results for a cohort from an industrial complex (Gwangyang Bay) in South Korea in 2009. To estimate daily concentrations of O3 in each subject, four different methods were used, which include simple averaging, nearest neighbor, inverse distance weighting, and kriging. Also, to compare the association between O3 levels and lung function by age-groups, we explored ozone’s impacts on three age-related groups: children (9–14 years), adults (15–64 years), and the elderly (≥65 years). The overall change of effect size on lung function in each age group tended to show similar patterns for lag and methods for estimating exposure. A significant negative association was only observed between O3 levels and FVC and FEV1 for most of the lag and methods in children. The largest effect of O3 levels was found at the average for the lung function test day and last 2 days (0–2 days). In conclusions, the spatial interpolation methods may benefit in providing individual-level exposure with appropriate temporal resolution from ambient monitors. However, time-activity patterns of residents, monitoring site locations, methodological choices, and other factors should be considered to minimize exposure misclassification. PMID:27447653

  2. Association of acculturative stress, Islamic practices, and internalizing symptoms among Arab American adolescents.

    Science.gov (United States)

    Goforth, Anisa N; Pham, Andy V; Chun, Heejung; Castro-Olivo, Sara M; Yosai, Erin R

    2016-06-01

    Although the numbers of Arab American immigrant youth in schools is increasing, there is little understanding of their mental health and the sociocultural factors that might influence it. This study examined the relationship between 2 sociocultural factors (i.e., acculturative stress and religious practices) and internalizing symptoms in first- and second-generation Muslim Arab American adolescents. Adolescents (n = 88) ages 11 to 18 completed measures related to acculturative stress, religious practices, internalizing symptoms, and general demographic information. Results of multiple regression analyses found that acculturative stress significantly predicted internalizing symptoms. Gender was found to moderate this association. No differences in the reported acculturative stress and internalizing symptoms were found between youth of different generational status (i.e., first- vs. second-generation). Finally, adolescents' organizational religious practices, but not their private religious practices, were found to be associated with lower acculturative stress. Implications are discussed related to how school psychologists can provide culturally responsive services to this population. (PsycINFO Database Record PMID:27243243

  3. Autosomal Recessive Congenital Ichthyosis in American Bulldogs Is Associated With NIPAL4 (ICHTHYIN) Deficiency.

    Science.gov (United States)

    Mauldin, E A; Wang, P; Evans, E; Cantner, C A; Ferracone, J D; Credille, K M; Casal, M L

    2015-07-01

    A minority of patients with nonsyndromic autosomal recessive congenital ichthyosis (ARCI) display mutations in NIPAL4 (ICHTHYIN). This protein plays a role in epidermal lipid metabolism, although the mechanism is unknown. The study describes a moderate form of ARCI in an extended pedigree of American Bulldogs that is linked to the gene encoding ichthyin. The gross phenotype was manifest as a disheveled pelage shortly after birth, generalized scaling, and adherent brown scale with erythema of the abdominal skin. Pedigree analysis indicated an autosomal recessive mode of inheritance. Ultrastructurally, the epidermis showed discontinuous lipid bilayers, unprocessed lipid within corneocytes, and abnormal lamellar bodies. Linkage analysis, performed by choosing simple sequence repeat markers and single-nucleotide polymorphisms near genes known to cause ACRI, revealed an association with NIPAL4. NIPAL4 was identified and sequenced using standard methods. No mutation was identified within the gene, but affected dogs had a SINE element 5' upstream of exon 1 in a highly conserved region. Of 545 DNA samples from American Bulldogs, 32 dogs (17 females, 15 males) were homozygous for the polymerase chain reaction fragment. All affected dogs were homozygous, with parents heterozygous for the insertion. Immunolabeling revealed an absence of ichthyin in the epidermis. This is the first description of ARCI associated with decreased expression of NIPAL4 in nonhuman species. PMID:25322746

  4. Superoxide Dismutase 3 Polymorphism Associated with Reduced Lung Function in Two Large Populations

    DEFF Research Database (Denmark)

    Dahl, Morten; Bowler, Russell P; Juul, Klaus;

    2008-01-01

    Rationale: Superoxide dismutase (SOD) 3 inhibits oxidative fragmentation of lung matrix components Collagen 1, hyaluronan, and heparan sulfate. Inherited change in SOD3 expression or function could affect lung matrix homeostasis and influence pulmonary function. Objectives: To identify novel SOD3...

  5. Novel therapeutic strategies for lung disorders associated with airway remodelling and fibrosis.

    Science.gov (United States)

    Royce, Simon G; Moodley, Yuben; Samuel, Chrishan S

    2014-03-01

    Inflammatory cell infiltration, cytokine release, epithelial damage, airway/lung remodelling and fibrosis are central features of inflammatory lung disorders, which include asthma, chronic obstructive pulmonary disease, acute respiratory distress syndrome and idiopathic pulmonary fibrosis. Although the lung has some ability to repair itself from acute injury, in the presence of ongoing pathological stimuli and/or insults that lead to chronic disease, it no longer retains the capacity to heal, resulting in fibrosis, the final common pathway that causes an irreversible loss of lung function. Despite inflammation, genetic predisposition/factors, epithelial-mesenchymal transition and mechanotransduction being able to independently contribute to airway remodelling and fibrosis, current therapies for inflammatory lung diseases are limited by their ability to only target the inflammatory component of the disease without having any marked effects on remodelling (epithelial damage and fibrosis) that can cause lung dysfunction independently of inflammation. Furthermore, as subsets of patients suffering from these diseases are resistant to currently available therapies (such as corticosteroids), novel therapeutic approaches are required to combat all aspects of disease pathology. This review discusses emerging therapeutic approaches, such as trefoil factors, relaxin, histone deacetylase inhibitors and stem cells, amongst others that have been able to target airway inflammation and airway remodelling while improving related lung dysfunction. A better understanding of the mode of action of these therapies and their possible combined effects may lead to the identification of their clinical potential in the setting of lung disease, either as adjunct or alternative therapies to currently available treatments. PMID:24513131

  6. Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically Resected Lung Adenocarcinoma

    OpenAIRE

    Kenichi Suda; Katsuaki Sato; Shigeki Shimizu; Kenji Tomizawa; Toshiki Takemoto; Takuya Iwasaki; Masahiro Sakaguchi; Tetsuya Mitsudomi

    2014-01-01

    The International Association for the Study of Lung Cancer, American Thoracic Society, and European Respiratory Society (IASLC/ATS/ERS) proposed a new classification for lung adenocarcinoma (AD) based on predominant histologic subtypes, such as lepidic, papillary, acinar, solid, and micropapillary; this system reportedly reflects well outcomes of patients with surgically resected lung AD. However, the prognostic implication of predominant histologic subtypes in lymph nodes metastases is uncle...

  7. Pairing smoking-cessation services with lung cancer screening: A clinical guideline from the Association for the Treatment of Tobacco Use and Dependence and the Society for Research on Nicotine and Tobacco.

    Science.gov (United States)

    Fucito, Lisa M; Czabafy, Sharon; Hendricks, Peter S; Kotsen, Chris; Richardson, Donna; Toll, Benjamin A

    2016-04-15

    Smoking cessation is crucial for reducing cancer risk and premature mortality. The US Preventive Services Task Force (USPSTF) has recommended annual lung cancer screening with low-dose computed tomography (LDCT), and the Center for Medicare and Medicaid Services recently approved lung screening as a benefit for patients ages 55 to 77 years who have a 30 pack-year history. The Society for Research on Nicotine and Tobacco (SRNT) and the Association for the Treatment of Tobacco Use and Dependence (ATTUD) developed the guideline described in this commentary based on an illustrative literature review to present the evidence for smoking-cessation health benefits in this high-risk group and to provide clinical recommendations for integrating evidence-based smoking-cessation treatment with lung cancer screening. Unfortunately, extant data on lung cancer screening participants were scarce at the time this guideline was written. However, in this review, the authors summarize the sufficient evidence on the benefits of smoking cessation and the efficacy of smoking-cessation interventions for smokers ages 55 to 77 years to provide smoking-cessation interventions for smokers who seek lung cancer screening. It is concluded that smokers who present for lung cancer screening should be encouraged to quit smoking at each visit. Access to evidence-based smoking-cessation interventions should be provided to all smokers regardless of scan results, and motivation to quit should not be a necessary precondition for treatment. Follow-up contacts to support smoking-cessation efforts should be arranged for smokers. Evidence-based behavioral strategies should be used at each visit to motivate smokers who are unwilling to try quitting/reducing smoking or to try evidence-based treatments that may lead to eventual cessation. Cancer 2016;122:1150-9. © 2016 American Cancer Society. PMID:26916412

  8. Genetic variation in BCL2 3'-UTR was associated with lung cancer risk and prognosis in male Chinese population.

    Directory of Open Access Journals (Sweden)

    Ping Xu

    Full Text Available OBJECTIVES: Bcl-2 is a critical apoptosis inhibitor with established carcinogenic potential, and can confer cancer cell resistance to therapeutic treatments by activating anti-apoptotic cellular defense. We hypothesized that genetic variants of BCL2 gene may be associated with lung cancer susceptibility and prognosis. METHODS: Three selected tagSNPs of BCL2 (rs2279115, rs1801018, and rs1564483 were genotyped in 1017 paired male Chinese lung cancer cases and controls by TaqMan assay. The associations of these variants with risk of lung cancer and overall survival of 242 male advanced non-small-cell lung cancer (NSCLC patients were separately investigated. RESULTS: Compared with the BCL2 3'UTR rs1564483GG genotype, the rs1564483GA, AA, and GA+AA genotypes were associated with significantly decreased susceptibilities of lung cancer in male Chinese (adjusted OR = 0.78, 0.73, and 0.76, P = 0.016, 0.038, and 0.007, respectively, while rs1564483A allele has a inverse dose-response relationship with lung cancer risk (P trend = 0.010. These effects were more evident in the elders, smokers, and subjects without family history of cancer (P trend = 0.017, 0.043 and 0.005, respectively. Furthermore, advanced NSCLC males carrying BCL2 rs1564483 GA+AA genotypes had significantly longer median survival time (Long-rank P = 0.036 and decreased death risk (adjusted HR = 0.69, P = 0.027 than patients with rs1564483GG genotype. These effects were more obvious in patients with smoking, stage IIIA, and in patients without surgery but underwent chemotherapy or radiotherapy (adjusted HR = 0.68, 0.49, 0.67, 0.69, 0.50, respectively, all P<0.05. CONCLUSION: The BCL2 3'UTR rs1564483A allele was associated with a decreased lung cancer risk and better survival for advanced NSCLC in male Chinese, which may offer a novel biomarker for identifying high-risk population and predicting clinical outcomes.

  9. Changes in the lung in adenoma sebaceum (Pringle's tumour) associated with tuberous sclerosis (Bourneville's disease) - a contribution to X-ray differential diagnosis of interstitial pulmonary processes

    International Nuclear Information System (INIS)

    Adenoma sebaceum, also known as Pringle's tumour, is frequently associated with tuberous sclerosis (Bourneville's disease); if the lungs are involved, however, the clinical course is different from that of the 'classical' type of the combination of these two diseases without lung involvement. The case record of a woman patient in whom the lung was affected, is presented with a brief discussion of the X-ray and pathological changes and their differential diagnosis. (orig.)

  10. Global DNA methylation loss associated with mercury contamination and aging in the American alligator (Alligator mississippiensis).

    Science.gov (United States)

    Nilsen, Frances M; Parrott, Benjamin B; Bowden, John A; Kassim, Brittany L; Somerville, Stephen E; Bryan, Teresa A; Bryan, Colleen E; Lange, Ted R; Delaney, J Patrick; Brunell, Arnold M; Long, Stephen E; Guillette, Louis J

    2016-03-01

    Mercury is a widespread environmental contaminant with exposures eliciting a well-documented catalog of adverse effects. Yet, knowledge regarding the underlying mechanisms by which mercury exposures are translated into biological effects remains incomplete. DNA methylation is an epigenetic modification that is sensitive to environmental cues, and alterations in DNA methylation at the global level are associated with a variety of diseases. Using a liquid chromatography tandem mass spectrometry-based (LC-MS/MS) approach, global DNA methylation levels were measured in red blood cells of 144 wild American alligators (Alligator mississippiensis) from 6 sites with variable levels of mercury contamination across Florida's north-south axis. Variation in mercury concentrations measured in whole blood was highly associated with location, allowing the comparison of global DNA methylation levels across different "treatments" of mercury. Global DNA methylation in alligators across all locations was weakly associated with increased mercury exposure. However, a much more robust relationship was observed in those animals sampled from locations more highly contaminated with mercury. Also, similar to other vertebrates, global DNA methylation appears to decline with age in alligators. The relationship between age-associated loss of global DNA methylation and varying mercury exposures was examined to reveal a potential interaction. These findings demonstrate that global DNA methylation levels are associated with mercury exposure, and give insights into interactions between contaminants, aging, and epigenetics. PMID:26748003

  11. Global DNA methylation loss associated with mercury contamination and aging in the American alligator (Alligator mississippiensis)

    Science.gov (United States)

    Nilsen, Frances M.; Parrott, Benjamin B.; Bowden, John A.; Kassim, Brittany L.; Somerville, Stephen E.; Bryan, Teresa A.; Bryan, Colleen E.; Lange, Ted R.; Delaney, J. Patrick; Brunell, Arnold M.; Long, Stephen E.; Guillette, Louis J.

    2016-01-01

    Mercury is a widespread environmental contaminant with exposures eliciting a well-documented catalog of adverse effects. Yet, knowledge regarding the underlying mechanisms by which mercury exposures are translated into biological effects remains incomplete. DNA methylation is an epigenetic modification that is sensitive to environmental cues, and alterations in DNA methylation at the global level are associated with a variety of diseases. Using a liquid chromatography tandem mass spectrometry-based (LC-MS/MS) approach, global DNA methylation levels were measured in red blood cells of 144 wild American alligators (Alligator mississippiensis) from 6 sites with variable levels of mercury contamination across Florida’s north-south axis. Variation in mercury concentrations measured in whole blood was highly associated with location, allowing the comparison of global DNA methylation levels across different “treatments” of mercury. Global DNA methylation in alligators across all locations was weakly associated with increased mercury exposure. However, a much more robust relationship was observed in those animals sampled from locations more highly contaminated with mercury. Also, similar to other vertebrates, global DNA methylation appears to decline with age in alligators. The relationship between age-associated loss of global DNA methylation and varying mercury exposures was examined to reveal a potential interaction. These findings demonstrate that global DNA methylation levels are associated with mercury exposure, and give insights into interactions between contaminants, aging, and epigenetics. PMID:26748003

  12. Drug addiction and stress-response genetic variability: association study in African Americans.

    Science.gov (United States)

    Levran, Orna; Randesi, Matthew; Li, Yi; Rotrosen, John; Ott, Jurg; Adelson, Miriam; Kreek, Mary Jeanne

    2014-07-01

    Stress is a significant risk factor in the development of drug addictions and in addiction relapse susceptibility. This hypothesis-driven study was designed to determine if specific SNPs in genes related to stress response are associated with heroin and/or cocaine addiction in African Americans. The analysis included 27 genes (124 SNPs) and was performed independently for each addiction. The sample consisted of former heroin addicts in methadone maintenance treatment (n = 314), cocaine addicts (n = 281), and controls (n = 208). Fourteen SNPs showed nominally significant association with heroin addiction (p gene (GALR1) and the functional FKBP5 intronic SNP rs1360780. Thirteen SNPs showed association with cocaine addiction, including the synonymous SNPs rs237902, in the oxytocin receptor gene (OXTR), and rs5374 in GALR1. No signal remained significant after correction for multiple testing. Four additional SNPs (GALR1 rs2717162, AVP rs2282018, CRHBP rs1875999, and NR3C2 rs1040288) were associated with both addictions and may indicate common liability. The study provides preliminary evidence for novel association of variants in several stress-related genes with heroin and/or cocaine addictions and may enhance the understanding of the interaction between stress and addictions. PMID:24766650

  13. Reverse-migrated neutrophils regulated by JAM-C are involved in acute pancreatitis-associated lung injury.

    Science.gov (United States)

    Wu, Deqing; Zeng, Yue; Fan, Yuting; Wu, Jianghong; Mulatibieke, Tunike; Ni, Jianbo; Yu, Ge; Wan, Rong; Wang, Xingpeng; Hu, Guoyong

    2016-01-01

    Junctional adhesion molecule-C (JAM-C) plays a key role in the promotion of the reverse transendothelial migration (rTEM) of neutrophils, which contributes to the dissemination of systemic inflammation and to secondary organ damage. During acute pancreatitis (AP), systemic inflammatory responses lead to distant organ damage and typically result in acute lung injury (ALI). Here, we investigated the role of rTEM neutrophils in AP-associated ALI and the molecular mechanisms by which JAM-C regulates neutrophil rTEM in this disorder. In this study, rTEM neutrophils were identified in the peripheral blood both in murine model of AP and human patients with AP, which elevated with increased severity of lung injury. Pancreatic JAM-C was downregulated during murine experimental pancreatitis, whose expression levels were inversely correlated with both increased neutrophil rTEM and severity of lung injury. Knockout of JAM-C resulted in more severe lung injury and systemic inflammation. Significantly greater numbers of rTEM neutrophils were present both in the circulation and pulmonary vascular washout in JAM-C knockout mice with AP. This study demonstrates that during AP, neutrophils that are recruited to the pancreas may migrate back into the circulation and then contribute to ALI. JAM-C downregulation may contribute to AP-associated ALI via promoting neutrophil rTEM. PMID:26841848

  14. Daily School Peer Victimization Experiences Among Mexican-American Adolescents: Associations with Psychosocial, Physical and School Adjustment

    OpenAIRE

    Espinoza, Guadalupe; Gonzales, Nancy A.; Fuligni, Andrew J.

    2012-01-01

    School bullying incidents, particularly experiences with victimization, are a significant social and health concern among adolescents. The current study extended past research by examining the daily peer victimization experiences of Mexican-American adolescents and examining how chronic (mean-level) and episodic (daily-level) victimization incidents at school are associated with psychosocial, physical and school adjustment. Across a two-week span, 428 ninth and tenth grade Mexican-American st...

  15. Differential Associations Between Partner Violence and Physical Health Symptoms Among Caucasian and African American Help-Seeking Women

    OpenAIRE

    Iverson, Katherine M.; Bauer, Margret R.; Shipherd, Jillian C.; Pineles, Suzanne L.; Harrington, Ellen F.; Resick, Patricia A.

    2011-01-01

    The relationship between partner violence and physical health symptoms is well-established. Although some researchers have theorized that the physical health effects of partner violence may be worse for ethnic minority women, there is little research addressing this topic. The current study examined whether African American women demonstrate a differential association in this relationship than Caucasian women. This study included 323 women (232 African American, 91 Caucasian) who participated...

  16. Gender and the Association between Discrimination and Psychological Distress Amongst African Americans in the California Quality of Life Survey

    OpenAIRE

    Glenn, Matthew

    2013-01-01

    Racial discrimination serves as a psychosocial stressor with implications for health, including mental health. Previous research indicates that while African American men report more discrimination events, African American women are at greater risk for some psychiatric conditions. The responses from Black respondents to the California Quality of Life Survey (Cal-QOL) in 2005 and 2007 were analyzed to test the hypothesis that gender moderates the association between discrimination and distres...

  17. Examining the Associations of Racism, Sexism, and Stressful Life Events on Psychological Distress among African American Women

    OpenAIRE

    Stevens-Watkins, Danelle; Perry, Brea; Pullen, Erin; Jewell, Jennifer; Oser, Carrie B.

    2014-01-01

    African American women may be susceptible to stressful events and adverse health outcomes as a result of their distinct social location at the intersection of gender and race. Here, racism and sexism are examined concurrently using survey data from 204 African American women residing in a southeastern U.S. urban city. Associations between racism, sexism, and stressful events across social roles and contexts (i.e., social network loss, motherhood and childbirth, employment and finances, person...

  18. AEA Ideology: Campaign Contributions of American Economic Association Members, Committee Members, Officers, Editors, Referees, Authors, and Acknowledgees

    OpenAIRE

    William A. McEachern

    2006-01-01

    This paper investigates the 2004-election-cycle campaign contributions of the leadership of the American Economic Association. By cross-checking a name with an occupation, employer, and address, I develop a contribution profile for a sample of 2,000 AEA members, then use this profile as a benchmark to examine contributions of editors, referees, authors, and acknowledgees of the 2003 and 2004 issues of the American Economic Review, Journal of Economic Literature, and Journal of Economic Perspe...

  19. Association of body mass index with lung function in pre- pubertal girls in Vadodara District

    Directory of Open Access Journals (Sweden)

    Rajeshri K Bodat

    2015-09-01

    Full Text Available Introduction: Among the various investigations available, pulmonary function test (PFT is a one of the important tool for the assessment of pulmonary function. There must be differences in reference values in India between different state, different region for spirometric parameters. Methodology: The present study was conducted among normal healthy pre pubertal girl in Vadodara region. The study was conducted among pre pubertal girls (10-12 yrs. Standard anthropometric measurements weight (kg, height (cm, was measured in a beam balance. Minimum three readings were given and best of the three was chosen for analysis, based on standardization of spirometry study based on ATS/ERS task force series and various other studies. Results: Mean age of the participants was 11.36 (+/-0.69 years. Similarly mean height, weight, BMI and BSA was 134.8(+/-8.91 cm, 28(+/-5.9 kg, 15.29(+/-2.02 (Kg/m2, and 1.02(+/-0.13 (m2 respectively. There were 27(60 % participants with BMI 18. There was significant statistical association between BMI and FEV1 (%, FEV1/FVC (%, PEFR (% (P < 0.05. Conclusion: There is significant relation between pulmonary function and BMI in pre pubertal girls. As BMI increase lung function tends to be decrease as compared to those who have low BMI. [Natl J Med Res 2015; 5(3.000: 256-258

  20. Association studies of ERCC1 polymorphisms with lung cancer susceptibility: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Jinhong Zhu

    Full Text Available BACKGROUND: Excision repair cross-complimentary group 1 (ERCC1 is an essential component of the nucleotide excision repair system that is responsible for repairing damaged DNA. Functional genetic variations in the ERCC1 gene may alter DNA repair capacity and modulate cancer risk. The putative roles of ERCC1 gene polymorphisms in lung cancer susceptibility have been widely investigated. However, the results remain controversial. OBJECTIVES: An updated meta-analysis was conducted to explore whether lung cancer risk could be attributed to the following ERCC1 polymorphisms: rs11615 (T>C, rs3212986 (C>A, rs3212961 (A>C, rs3212948 (G>C, rs2298881 (C>A. METHODS: Several major databases (MEDLINE, EMBASE and Scopus and the Chinese Biomedical database were searched for eligible studies. Crude odds ratios (ORs with 95% confidence intervals (CIs were used to measure the strength of associations. RESULTS: Sixteen studies with 10,106 cases and 13,238 controls were included in this meta-analysis. Pooled ORs from 11 eligible studies (8,215 cases vs. 11,402 controls suggested a significant association of ERCC1 rs11615 with increased risk for lung cancer (homozygous: CC versus TT, OR = 1.24, 95% CI: 1.04-1.48, P = 0.02. However, such an association was disproportionately driven by a single study. Removal of that study led to null association. Moreover, initial analyses suggested that ERCC1 rs11615 exerts a more profound effect on the susceptibility of non-smokers to lung cancer than that of smokers. Moreover, no statistically significant association was found between remaining ERCC1 polymorphisms of interest and lung cancer risk, except for rs3212948 variation (heterozygous: CG vs.GG, OR = 0.78, 95% CI: 0.67-0.90, P = 0.001; dominant: CG/CC vs.GG, OR = 0.79, 95% CI: 0.69-0.91, P = 0.001. CONCLUSION: Overall, this meta-analysis suggests that ERCC1 rs3212948 G>C, but not others, is a lung cancer risk-associated polymorphism. Carefully

  1. Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weina, E-mail: liweina228@163.com [Department of Biomedical Engineering, Fourth Military Medical University, Xi’an 710032 (China); He, Fei, E-mail: hesili1027@163.com [Department of Hepatic Surgery, Xijing Hospital, Fourth Military Medical University, Xi’an 710032 (China)

    2014-07-18

    Highlights: • Expression of MMD is increased in lung cancer tissues. • Knockdown of MMD inhibits growth of A549 and LLC cells in vitro and in vivo. • MMD is a direct functional target of miR-140-5p. • MiR-140-5p/MMD axis regulates Erk1/2 signaling. - Abstract: Monocyte to macrophage differentiation-associated (MMD) is identified in macrophages as a gene associated with the differentiation from monocytes to macrophages. Recent microarray analysis for non-small cell lung cancer (NSCLC) suggests that MMD is an important signature associated with relapse and survival among patients with NSCLC. Therefore, we speculate that MMD likely plays a role in lung cancer. In this study, we found that the protein level of MMD was increased in lung cancer compared to benign lung tissues, and knockdown of MMD inhibited the growth of A549 and Lewis lung cancer cells (LLC) in vitro and in vivo. Integrated analysis demonstrated that MMD was a direct functional target of miR-140-5p. Furthermore, we found that miR-140-5p/MMD axis could affect the cell proliferation of lung cancer cells by regulating Erk signaling. Together, our results highlight the significance of miR-140-5p/MMD axis in lung cancer, and miR-140-5p/MMD axis could serve as new molecular targets for the therapy against lung cancer.

  2. Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer

    International Nuclear Information System (INIS)

    Highlights: • Expression of MMD is increased in lung cancer tissues. • Knockdown of MMD inhibits growth of A549 and LLC cells in vitro and in vivo. • MMD is a direct functional target of miR-140-5p. • MiR-140-5p/MMD axis regulates Erk1/2 signaling. - Abstract: Monocyte to macrophage differentiation-associated (MMD) is identified in macrophages as a gene associated with the differentiation from monocytes to macrophages. Recent microarray analysis for non-small cell lung cancer (NSCLC) suggests that MMD is an important signature associated with relapse and survival among patients with NSCLC. Therefore, we speculate that MMD likely plays a role in lung cancer. In this study, we found that the protein level of MMD was increased in lung cancer compared to benign lung tissues, and knockdown of MMD inhibited the growth of A549 and Lewis lung cancer cells (LLC) in vitro and in vivo. Integrated analysis demonstrated that MMD was a direct functional target of miR-140-5p. Furthermore, we found that miR-140-5p/MMD axis could affect the cell proliferation of lung cancer cells by regulating Erk signaling. Together, our results highlight the significance of miR-140-5p/MMD axis in lung cancer, and miR-140-5p/MMD axis could serve as new molecular targets for the therapy against lung cancer

  3. Academic Freedom and Educational Responsibility: A Statement of the Board of Directors of the Association of American Colleges and Universities

    Science.gov (United States)

    Liberal Education, 2006

    2006-01-01

    This article presents a statement of the Board of Directors of the Association of American Colleges and Universities, which was endorsed by member representatives at the association's 2006 annual meeting. In their statement, the Board of Directors revisit the basic principles and discuss the role of academic freedom. Four misconceptions about…

  4. The Association of Resilience with Mental and Physical Health among Older American Indians: The Native Elder Care Study

    Science.gov (United States)

    Schure, Marc B.; Odden, Michelle; Goins, R. Turner

    2013-01-01

    We examined the association of resilience with measures of mental and physical health in a sample of older American Indians (AIs). A validated scale measuring resilience was administered to 185 noninstitutionalized AIs aged greater than or equal to 55 years. Unadjusted analyses revealed that higher levels of resilience were associated with lower…

  5. NAC is associated with additional alleviation of lung injury induced by invasive pulmonary aspergillosis in a neutropenic model

    Institute of Scientific and Technical Information of China (English)

    Peng XU; Jie-ming QU; Jin-fu XU; Jing ZHANG; Hong-ni JIANG; Hui-jun ZHANG

    2009-01-01

    Aim:Neutropenic individuals are at high risk for invasive pulmonary aspergillosis (IPA),a life-threatening infection.To evaluate the therapeutic potential of antioxidants,IPA was induced in neutropenic mice and the effect of N-acetyl-l-cysteine (NAC) on oxidative stress levels and lung injury was analyzed.Methods:Mice were pretreated with three daily intraperitoneal injections of 150 mg/kg cyclophosphamide,followed by intratracheal inoculation with 4.5×106 conidia of Aspergillus fumigatus.The infected mice were then randomly assigned to an amphotericin B (AMB) group,an AMB plus NAC group,or an untreated control (C) group.In each group,the duration of treatment was 24,48,or 72 h,and activities such as appearance,feeding,and dermal temperature were observed throughout the experiment.Sera and lung tissues were collected and analyzed by quantitative enzyme-linked immunosorbent assay (ELISA) for total protein,superoxide dismutase(SOD),malondialdehyde (MDA),tumor necrosis factor-α (TNF-α),and interleukin-lO (IL-10) levels.The wet/dry weight ratio of the lung was also calculated and lung sections were stained with hematoxylin-eosin for pathological examination and with methenamine silver stain for fungus detection.Results:Compared with the mice untreated with NAC,mice in the AMB plus NAC group had increased SOD and reduced MDA levels both systemically and locally at 24,48,and 72 h after inoculation with conidia.NAC treatment also decreased the pulmonary protein content at 48 and 72 h and the lung wet/dry weight ratio at 24 and 48 h.Additionally,NAC enhanced pulmonary production of TNF-α and IL-10 at 24 h and 48 h.Conclusion:In combination with antifungal therapy,NAC treatment can alleviate oxidative stress and lung injury associated with IPA in neutropenic mice.

  6. Genome-wide association study of coronary and aortic calcification in lung cancer screening CT

    Science.gov (United States)

    de Vos, Bob D.; van Setten, Jessica; de Jong, Pim A.; Mali, Willem P.; Oudkerk, Matthijs; Viergever, Max A.; Išgum, Ivana

    2016-03-01

    Arterial calcification has been related to cardiovascular disease (CVD) and osteoporosis. However, little is known about the role of genetics and exact pathways leading to arterial calcification and its relation to bone density changes indicating osteoporosis. In this study, we conducted a genome-wide association study of arterial calcification burden, followed by a look-up of known single nucleotide polymorphisms (SNPs) for coronary artery disease (CAD) and myocardial infarction (MI), and bone mineral density (BMD) to test for a shared genetic basis between the traits. The study included a subcohort of the Dutch-Belgian lung cancer screening trial comprised of 2,561 participants. Participants underwent baseline CT screening in one of two hospitals participating in the trial. Low-dose chest CT images were acquired without contrast enhancement and without ECG-synchronization. In these images coronary and aortic calcifications were identified automatically. Subsequently, the detected calcifications were quantified using coronary artery calcium Agatston and volume scores. Genotype data was available for these participants. A genome-wide association study was conducted on 10,220,814 SNPs using a linear regression model. To reduce multiple testing burden, known CAD/MI and BMD SNPs were specifically tested (45 SNPs from the CARDIoGRAMplusC4D consortium and 60 SNPS from the GEFOS consortium). No novel significant SNPs were found. Significant enrichment for CAD/MI SNPs was observed in testing Agatston and coronary artery calcium volume scores. Moreover, a significant enrichment of BMD SNPs was shown in aortic calcium volume scores. This may indicate genetic relation of BMD SNPs and arterial calcification burden.

  7. Modification by antioxidant supplementation of changes in human lung function associated with air pollutant exposure: A systematic review

    Directory of Open Access Journals (Sweden)

    Chow Katherine S

    2011-07-01

    Full Text Available Abstract Background Outdoor air pollution, given its demonstrated negative effects on the respiratory system, is a growing public health concern worldwide, particularly in urban cities. Human exposure to pollutants such as ozone, nitrogen oxides, combustion-related particulate matter and oxides of sulfur is responsible for significant cardiopulmonary morbidity and mortality in both adults and children. Several antioxidants have shown an ability to partially attenuate the negative physiological and functional impacts of air pollutants. This study systematically presents current data on the potential benefits of antioxidant supplementation on lung function outcomes associated with air pollutant exposures in intact humans. Methods Electronic databases (MEDLINE, EMBASE, BIOSIS Previews, Web of Sciences, Environmental Sciences & Pollution Management and TOXNET were systematically searched for all studies published up to April 2009. Search terms relating to the concepts of respiratory tract diseases, respiratory function tests, air pollution, and antioxidants were used. Data was systematically abstracted from original articles that satisfied selection criteria for inclusion. For inclusion, the studies needed to have evaluated human subjects, given supplemental antioxidants, under conditions of known levels of air pollutants with measured lung function before and after antioxidant administration and/or air pollution exposure. Selected studies were summarized and conclusions presented. Results Eight studies investigated the role of antioxidant supplementation on measured lung function outcomes after subject exposure to air pollutants under controlled conditions; 5 of these studies concluded that pollutant-induced airway hyper-responsiveness and diminution in lung function measurements were attenuated by antioxidant supplementation. The remaining five studies took place under ambient (uncontrolled exposures and unanimously concluded that antioxidant

  8. Incidental gastrointestinal 18F-Fluorodeoxyglucose uptake associated with lung cancer

    OpenAIRE

    Vella-Boucaud, Juliette; Papathanassiou, Dimitri; Bouche, Olivier; Prevost, Alain; Lestra, Thibault; Dury, Sandra; Vallerand, Hervé; Perotin, Jeanne-Marie; Launois, Claire; Boissiere, Louis; Brasseur, Mathilde; Lebargy, François; Deslee, Gaëtan

    2015-01-01

    Background F-Fluorodeoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT) is increasingly used for the initial staging and restaging of lung cancer. Incidental gastrointestinal findings are often observed on 18F-FDG PET/CT. The objective of this study was to assess incidental 18F-FDG uptake by the gastrointestinal tract (GIT) in patients with lung cancer. Methods Two hundred thirty consecutive 18F-FDG PET/CT examinations performed for lung cancer over a 3-year period w...

  9. Associations of red and processed meat with survival among patients with cancers of the upper aerodigestive tract and lung.

    Science.gov (United States)

    Miles, Fayth L; Chang, Shen-Chih; Morgenstern, Hal; Tashkin, Donald; Rao, Jian-Yu; Cozen, Wendy; Mack, Thomas; Lu, Qing-Yi; Zhang, Zuo-Feng

    2016-06-01

    The effect of red and processed meats on cancer survival is unclear. We sought to examine the role of total and processed red meat consumption on all-cause mortality among patients with cancers of the upper aerodigestive tract (UADT) and lung, in order to test our hypothesis that red or processed meat was associated with overall mortality in these patients. Using data from a population-based case-control study conducted in Los Angeles County, we conducted a case-only analysis to examine the association of red or processed meat consumption on mortality after 12 years of follow-up, using a diet history questionnaire. Cox regression was used to estimate adjusted hazard ratios (HRs) with 95% confidence intervals (CIs), adjusting for potential confounders. Of 601 UADT cancer cases and 611 lung cancer cases, there were 248 and 406 deaths, respectively, yielding crude mortality rates of 0.07 and 0.12 deaths per year. Comparing the highest with lowest quartile of red meat consumption, the adjusted HR was 1.64 (95% CI, 1.04-2.57) among UADT cancer cases; for red or processed meat, the adjusted HR was 1.76 (95% CI, 1.10-2.82). A dose-response trend was observed. A weaker association was observed with red meat consumption and overall mortality among lung cancer cases. In conclusion, this case-only analysis demonstrated that increased consumption of red or processed meats was associated with mortality among UADT cancer cases and WAS weakly associated with mortality among lung cancer cases. PMID:27188908

  10. Socioeconomic and nutritional factors account for the association of gastric cancer with Amerindian ancestry in a Latin American admixed population.

    Directory of Open Access Journals (Sweden)

    Latife Pereira

    Full Text Available Gastric cancer is one of the most lethal types of cancer and its incidence varies worldwide, with the Andean region of South America showing high incidence rates. We evaluated the genetic structure of the population from Lima (Peru and performed a case-control genetic association study to test the contribution of African, European, or Native American ancestry to risk for gastric cancer, controlling for the effect of non-genetic factors. A wide set of socioeconomic, dietary, and clinic information was collected for each participant in the study and ancestry was estimated based on 103 ancestry informative markers. Although the urban population from Lima is usually considered as mestizo (i.e., admixed from Africans, Europeans, and Native Americans, we observed a high fraction of Native American ancestry (78.4% for the cases and 74.6% for the controls and a very low African ancestry (<5%. We determined that higher Native American individual ancestry is associated with gastric cancer, but socioeconomic factors associated both with gastric cancer and Native American ethnicity account for this association. Therefore, the high incidence of gastric cancer in Peru does not seem to be related to susceptibility alleles common in this population. Instead, our result suggests a predominant role for ethnic-associated socioeconomic factors and disparities in access to health services. Since Native Americans are a neglected group in genomic studies, we suggest that the population from Lima and other large cities from Western South America with high Native American ancestry background may be convenient targets for epidemiological studies focused on this ethnic group.

  11. Complication associated with abdominal surgical implantation of a radio transmitter in an American badger (Taxidea taxus).

    Science.gov (United States)

    Quinn, Jessica H; Gaffney, Patricia M; Gilardi, Kirsten; Murray, Michael; Jessup, David A; Johnson, Christine K

    2010-03-01

    Radio telemetry has greatly advanced the understanding of wild animal ecology. Telemetry studies must ensure that placement of transmitters does not influence the health and behavior of study animals. Here, 10 American badgers (Taxidea taxus) were implanted with beeswax-coated abdominal radio transmitters under general anesthesia and tracked for an average of 14 mo. Behavior and movements of all badgers indicated successful short-term recovery from implantation; however, three mortalities were observed between 5 mo and 15 mo after capture. Cause of death could not be determined for two badgers due to decomposition of the carcasses. A third badger that was recovered in good postmortem condition died from sepsis secondary to a transmitter-related omental torsion. This study indicates that there is some risk associated with abdominally implanted radio transmitters in badgers. Future studies involving implanted transmitters in mammals should focus on identifying safe and effective telemetry devices that do not affect the health of study animals. American badger, omental adhesion, peritoneal implant, telemetry, Taxidea taxus. PMID:20722276

  12. An update on the regional organizations of the american burn association.

    Science.gov (United States)

    Harrington, David; Holmes, James; Conlon, Kathe; Jeng, James

    2014-01-01

    In 1985, the American Burn Association (ABA) created 10 regions in the United States and charged the Chiefs of these regions with the development of regional disaster plans. Now more than 25 years after this mandate, the ABA's Organizational and Delivery of Burn Care Committee assessed the status of regional development. The extant region leaders were contacted by email and queried as to the activities of their region and their opinion as to the success or failure of the regionalization initiative. Several regional organizational meetings were attended at the annual ABA meeting and many phone interviews were conducted to clear up any conflicting information. The original map of the burn regions was based on the American College of Surgeons Committee on Trauma regions, but these have undergone significant redistricting. The organizational structure, age, and activities of the regions vary significantly. The financial costs of maintaining a regional organization and holding an annual meeting are a major concern for most regions. For the most part the regional organizations are a good source of professional networking and a cost-effective source of continuing medical education/continuing education units for burn centers. The regionalization experiment of the ABA been reasonably successful in its first 25 years, but the ABA and the regions should take this opportunity to consider the next steps for the regions in the coming 25 years. PMID:23799483

  13. Korean American Women's Experiences with Smoking and Factors Associated with Their Quit Intentions

    Science.gov (United States)

    Kim, Sun S.; Kim, Seongho; Seward, Gregory; Fortuna, Lisa; McKee, Sherry A.

    2013-01-01

    This study explored Korean American women's experiences with smoking and tested the theory of planned behavior to identify factors associated with their intentions to quit smoking. It employed a mixed-methods research design, using qualitative and quantitative data. Participants were recruited via a combination of random (N = 49) and convenience (N = 45) sampling techniques. Women in this study initiated smoking at age of 23 on average, and nearly half smoked at indoor houses. They initiated smoking out of curiosity about the effect and belief that smoking would relieve their stress. Reasons for continued smoking were (a) to avoid nicotine withdrawal symptoms, (b) to cope with life stressors, including acculturative stress, and (c) to fulfill one's destiny as a lifetime smoker. Many attempted to quit due to health issues and pregnancy. Fear of disclosure and limited English proficiency were found to be major barriers to seeking help for quitting. Past-year quit attempt(s), attitudes toward quitting, and perceived family norm favoring quitting explained 25% of the variance in intentions to quit smoking (F[3,90] = 11.58, P < 0.001). Findings suggest that gender- and culture-specific intervention strategies are needed to assist Korean American women in smoking cessation. PMID:25938119

  14. TRANSCULTURALIZATION RECOMMENDATIONS FOR DEVELOPING LATIN AMERICAN CLINICAL PRACTICE ALGORITHMS IN ENDOCRINOLOGY--PROCEEDINGS OF THE 2015 PAN-AMERICAN WORKSHOP BY THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY.

    Science.gov (United States)

    Mechanick, Jeffrey I; Harrell, R Mack; Allende-Vigo, Myriam Z; Alvayero, Carlos; Arita-Melzer, Onix; Aschner, Pablo; Camacho, Pauline M; Castillo, Rogelio Zacarias; Cerdas, Sonia; Coutinho, Walmir F; Davidson, Jaime A; Garber, Jeffrey R; Garvey, W Timothy; González, Fernando Javier Lavalle; Granados, Denis O; Hamdy, Osama; Handelsman, Yehuda; Jiménez-Navarrete, Manuel Francisco; Lupo, Mark A; Mendoza, Enrique J; Jiménez-Montero, José G; Zangeneh, Farhad

    2016-04-01

    The American Association of Clinical Endocrinologists (AACE) and American College of Endocrinology (ACE) convened their first Workshop for recommendations to optimize Clinical Practice Algorithm (CPA) development for Latin America (LA) in diabetes (focusing on glycemic control), obesity (focusing on weight loss), thyroid (focusing on thyroid nodule diagnostics), and bone (focusing on postmenopausal osteoporosis) on February 28, 2015, in San Jose, Costa Rica. A standardized methodology is presented incorporating various transculturalization factors: resource availability (including imaging equipment and approved pharmaceuticals), health care professional and patient preferences, lifestyle variables, socio-economic parameters, web-based global accessibility, electronic implementation, and need for validation protocols. A standardized CPA template with node-specific recommendations to assist the local transculturalization process is provided. Participants unanimously agreed on the following five overarching principles for LA: (1) there is only one level of optimal endocrine care, (2) hemoglobin A1C should be utilized at every level of diabetes care, (3) nutrition education and increased pharmaceutical options are necessary to optimize the obesity care model, (4) quality neck ultrasound must be part of an optimal thyroid nodule care model, and (5) more scientific evidence is needed on osteoporosis prevalence and cost to justify intervention by governmental health care authorities. This 2015 AACE/ACE Workshop marks the beginning of a structured activity that assists local experts in creating culturally sensitive, evidence-based, and easy-to-implement tools for optimizing endocrine care on a global scale. PMID:27031655

  15. Association between MGMT Promoter Methylation and Non-Small Cell Lung Cancer: A Meta-Analysis

    Science.gov (United States)

    Gu, Changmei; Lu, Jiachun; Cui, Tianpen; Lu, Cheng; Shi, Hao; Xu, Wenmao; Yuan, Xueli; Yang, Xiaobo; Huang, Yangxin; Lu, Meixia

    2013-01-01

    Background O6-methylguanine-DNA methyltransferase (MGMT) is one of most important DNA repair enzyme against common carcinogens such as alkylate and tobacco. Aberrant promoter methylation of the gene is frequently observed in non-small cell lung cancer (NSCLC). However, the importance of epigenetic inactivation of the gene in NSCLC published in the literature showed inconsistence. We quantified the association between MGMT promoter methylation and NSCLC using a meta-analysis method. Methods We systematically reviewed studies of MGMT promoter methylation and NSCLC in PubMed, EMBASE, Ovid, ISI Web of Science, Elsevier and CNKI databases and quantified the association between MGMT promoter methylation and NSCLC using meta-analysis method. Odds ratio (OR) and corresponding 95% confidence interval (CI) were calculated to evaluate the strength of association. Potential sources of heterogeneity were assessed by subgroup analysis and meta-regression. Results A total of 18 studies from 2001 to 2011, with 1, 160 tumor tissues and 970 controls, were involved in the meta-analysis. The frequencies of MGMT promote methylation ranged from 1.5% to 70.0% (median, 26.1%) in NSCLC tissue and 0.0% to 55.0% (median, 2.4%) in non-cancerous control, respectively. The summary of OR was 4.43 (95% CI: 2.85, 6.89) in the random-effects model. With stratification by potential source of heterogeneity, the OR was 20.45 (95% CI: 5.83, 71.73) in heterogeneous control subgroup, while it was 4.16 (95% CI: 3.02, 5.72) in the autologous control subgroup. The OR was 5.31 (95% CI: 3.00, 9.41) in MSP subgroup and 3.06 (95% CI: 1.75, 5.33) in Q-MSP subgroup. Conclusion This meta-analysis identified a strong association between methylation of MGMT gene and NSCLC. Prospective studies should be required to confirm the results in the future. PMID:24086261

  16. Association between MGMT promoter methylation and non-small cell lung cancer: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Changmei Gu

    Full Text Available BACKGROUND: O(6-methylguanine-DNA methyltransferase (MGMT is one of most important DNA repair enzyme against common carcinogens such as alkylate and tobacco. Aberrant promoter methylation of the gene is frequently observed in non-small cell lung cancer (NSCLC. However, the importance of epigenetic inactivation of the gene in NSCLC published in the literature showed inconsistence. We quantified the association between MGMT promoter methylation and NSCLC using a meta-analysis method. METHODS: We systematically reviewed studies of MGMT promoter methylation and NSCLC in PubMed, EMBASE, Ovid, ISI Web of Science, Elsevier and CNKI databases and quantified the association between MGMT promoter methylation and NSCLC using meta-analysis method. Odds ratio (OR and corresponding 95% confidence interval (CI were calculated to evaluate the strength of association. Potential sources of heterogeneity were assessed by subgroup analysis and meta-regression. RESULTS: A total of 18 studies from 2001 to 2011, with 1, 160 tumor tissues and 970 controls, were involved in the meta-analysis. The frequencies of MGMT promote methylation ranged from 1.5% to 70.0% (median, 26.1% in NSCLC tissue and 0.0% to 55.0% (median, 2.4% in non-cancerous control, respectively. The summary of OR was 4.43 (95% CI: 2.85, 6.89 in the random-effects model. With stratification by potential source of heterogeneity, the OR was 20.45 (95% CI: 5.83, 71.73 in heterogeneous control subgroup, while it was 4.16 (95% CI: 3.02, 5.72 in the autologous control subgroup. The OR was 5.31 (95% CI: 3.00, 9.41 in MSP subgroup and 3.06 (95% CI: 1.75, 5.33 in Q-MSP subgroup. CONCLUSION: This meta-analysis identified a strong association between methylation of MGMT gene and NSCLC. Prospective studies should be required to confirm the results in the future.

  17. The lung adenocarcinoma guidelines: what to be considered by surgeons

    OpenAIRE

    Sardenberg, Rodrigo A. S.; de Mello, Evandro Sobroza; Younes, Riad N.

    2014-01-01

    In 2011 the International Association for the Study of Lung Cancer (IASLC), the American Thoracic Society (ATS), and the European Respiratory Society (ERS), have proposed a new subclassification of lung adenocarcinomas. This new classification was founded on an evidence-based approach to a systematic review of 11,368 citations from the related literature. Validation has involved projects relating to histologic and cytologic analysis of small biopsy specimens, histologic subtyping, grading, an...

  18. CD5-positive marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT of the lung

    Directory of Open Access Journals (Sweden)

    Terada Tadashi

    2012-02-01

    Full Text Available Abstract CD5-positive marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT of the lung is very rare. An 82-year-old Japanese woman was found to have an abnormal lung shadow on chest X-ray photography, and was admitted to our hospital. Imaging modalities including X-ray photography, computed tomography, and magnetic resonance imaging showed a small (2 × 1 × 1 cm opacity of the right upper lobe. Transbronchial lung biopsy was performed. It showed severe proliferation of small lymphocytes. The small lymphocytes were centrocytes-like, and minor plasma cell differentiation was recognized. Lymphoepithelial lesions were scattered. Immunohistochemically, the tumor cells were positive for CD5, CD20, CD43, CD45, CD79α, bcl-2, and κ-chain, but negative for CD2, CD3, CD10, CD21, CD23, CD35, CD45RO, CD56, IgA, IgG, IgM, IgD, λ-chain, TdT, and cyclin D1. The Ki-67 labeling was 10%. CD3-positive and CD45RO-positive inflammatory T-cells were scattered in small amount. The pathological diagnosis was CD5-positive marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT of the lung. The patient was treated with chemotherapy (CHOP: cyclophosphamide, hydroxydaunorbicin, vincristine, and predonisone, and the lung tumor disappeared. The patient is now free of the lymphoma 10 years after the first manifestation. Virtual slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1541653085652296

  19. Paradigm shift in LUNG SBRT dose calculation associated with Heterogeneity correction

    International Nuclear Information System (INIS)

    Treatment of lung injury SBRT requires great dosimetric accuracy, the increasing clinical importance of dose calculation heterogeneities introducing algorithms that adequately model the transport of particles narrow beams in media of low density, as with Monte Carlo calculation. (Author)

  20. Position of the American Dietetic Association, School Nutrition Association, and Society for Nutrition Education: comprehensive school nutrition services.

    Science.gov (United States)

    Briggs, Marilyn; Mueller, Constance G; Fleischhacker, Sheila

    2010-11-01

    It is the position of the American Dietetic Association (ADA), School Nutrition Association (SNA), and Society for Nutrition Education (SNE) that comprehensive, integrated nutrition services in schools, kindergarten through grade 12, are an essential component of coordinated school health programs and will improve the nutritional status, health, and academic performance of our nation's children. Local school wellness policies may strengthen comprehensive nutrition services by encouraging multidisciplinary wellness teams, composed of school and community members, to work together in identifying local school needs, developing feasible strategies to address priority areas, and integrating comprehensive nutrition services with a coordinated school health program. This joint position paper affirms schools as an important partner in health promotion. To maximize the impact of school wellness policies on strengthening comprehensive, integrated nutrition services in schools nationwide, ADA, SNA, and SNE recommend specific strategies in the following key areas: nutrition education and promotion, food and nutrition programs available on the school campus, school-home-community partnerships, and nutrition-related health services. PMID:21061737

  1. Massive pleural effusion and associated pulmonary embolism in a case of Gefitinib responsive lung cancer

    Directory of Open Access Journals (Sweden)

    Rajiv Garg

    2015-01-01

    Full Text Available Pulmonary embolism (PE and venous thrombosis is a common complication in lung cancer patients with a high misdiagnosis rate and high mortality. However, when an undiagnosed lung cancer patient presents as PE, cancer as a cause may not always be explored. We present a case of a young male patient presenting with venous thromboembolism causing massive pleural effusion, leading to the diagnosis of epidermal growth factor receptor mutation positive adenocarcinoma, showing good response to gefitinib therapy.

  2. Association between Lung Function and Vocal Affections Arising from Tobacco Consumption

    OpenAIRE

    Santos, Karoline Weber dos; Echeveste, Simone Soares; Vidor, Deisi Cristina Gollo Marques

    2013-01-01

    Introduction Smoking is a major risk factor for numerous diseases; it is necessary to analyze the impact that the habit can have on vocal health. Objectives To determine the influence of smoking on changes in vocal production and lung vital capacity compared with nonsmokers. Methods This cross-sectional study compared smokers and nonsmokers (24 subjects each). Each participant underwent a vocal and spirometric evaluation to measure vital lung capacity. Results The results showed a wo...

  3. Metagenes Associated with Survival in Non-Small Cell Lung Cancer

    OpenAIRE

    Egon Urgard; Tõnu Vooder; Urmo Võsa; Kristjan Välk; Mingming Liu; Cheng Luo; Fabian Hoti; Retlav Roosipuu; Tarmo Annilo; Jukka Laine; Frenz, Christopher M.; Liqing Zhang; Andres Metspalu

    2011-01-01

    NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expressio...

  4. Association of DNA repair gene XRCC1 and lung cancer susceptibility among nonsmoking Chinese women

    DEFF Research Database (Denmark)

    Yin, J.; Vogel, Ulla Birgitte; Ma, Y.;

    2009-01-01

    predisposition to cancer risk. To address this question in more detail, we conducted a hospital-based case-control study consisting of 55 lung cancer cases and 74 cancer-free controls matched on age and ethnicity among nonsmoking Chinese women. We analyzed five coding single-nucleotide polymorphisms in the XRCC1...... the haplotype encompassing the variant alleles may contribute to susceptibility of lung cancer in a Chinese population....

  5. Diffuse alveolar damage associated mortality in selected acute respiratory distress syndrome patients with open lung biopsy

    OpenAIRE

    Kao, Kuo-Chin; Hu, Han-Chung; Chang, Chih-Hao; Hung, Chen-Yiu; Chiu, Li-Chung; Li, Shih-Hong; Lin, Shih-Wei; Chuang, Li-Pang; Wang, Chih-Wei; Li, Li-Fu; Chen, Ning-Hung; Yang, Cheng-Ta; Huang, Chung-Chi; Tsai, Ying-Huang

    2015-01-01

    Introduction Diffuse alveolar damage (DAD) is the pathological hallmark of acute respiratory distress syndrome (ARDS), however, the presence of DAD in the clinical criteria of ARDS patients by Berlin definition is little known. This study is designed to investigate the role of DAD in ARDS patients who underwent open lung biopsy. Methods We retrospectively reviewed all ARDS patients who met the Berlin definition and underwent open lung biopsy from January 1999 to January 2014 in a referred med...

  6. iASPP is over-expressed in human non-small cell lung cancer and regulates the proliferation of lung cancer cells through a p53 associated pathway

    International Nuclear Information System (INIS)

    iASPP is a key inhibitor of tumour suppressor p53 and is found to be up-regulated in certain malignant conditions. The present study investigated the expression of iASPP in clinical lung cancer, a leading cancer type in the world, and the biological impact of this molecule on lung cancer cells. iASPP protein levels in lung cancer tissues were evaluated using an immunohistochemical method. In vitro, iASPP gene expression was suppressed with a lentvirus-mediated shRNA method and the biological impact after knocking down iASSP on lung cancer cell lines was investigated in connection with the p53 expression status. We showed here that the expression of iASPP was significantly higher in lung cancer tissues compared with the adjacent normal tissues. iASPP shRNA treatment resulted in a down-regulation of iASPP in lung cancer cells. There was a subsequent reduction of cell proliferation of the two lung tumour cell lines A459 and 95D both of which had wild-type p53 expression. In contrast, reduction of iASPP in H1229 cells, a cell with little p53 expression, had no impact on its growth rate. iASPP regulates the proliferation and motility of lung cancer cells. This effect is intimately associated with the p53 pathway. Together with the pattern of the over-expression in clinical lung cancers, it is concluded that iASPP plays an pivotal role in the progression of lung cancer and is a potential target for lung cancer therapy

  7. Residential Proximity to Major Roadways Is Not Associated with Cardiac Function in African Americans: Results from the Jackson Heart Study.

    Science.gov (United States)

    Weaver, Anne M; Wellenius, Gregory A; Wu, Wen-Chih; Hickson, DeMarc A; Kamalesh, Masoor; Wang, Yi

    2016-01-01

    Cardiovascular disease (CVD), including heart failure, is a major cause of morbidity and mortality, particularly among African Americans. Exposure to ambient air pollution, such as that produced by vehicular traffic, is believed to be associated with heart failure, possibly by impairing cardiac function. We evaluated the cross-sectional association between residential proximity to major roads, a marker of long-term exposure to traffic-related pollution, and echocardiographic indicators of left and pulmonary vascular function in African Americans enrolled in the Jackson Heart Study (JHS): left ventricular ejection fraction, E-wave velocity, isovolumic relaxation time, left atrial diameter index, and pulmonary artery systolic pressure. We examined these associations using multivariable linear or logistic regression, adjusting for potential confounders. Of 4866 participants at study enrollment, 106 lived African Americans. PMID:27304962

  8. Report from the American Nurses' Association council on psychiatric and mental health nursing.

    Science.gov (United States)

    Joel, L A; Baldwin, B; Stevens, G

    1989-01-01

    Society has demonstrated a major need for expanded gerontological and geropsychiatric nursing services. Current needs have not yet been met and the call for service will increase throughout the balance of this century and beyond. Social responsiveness demands that nurses: (1) formally establish their clinical authority in care of the aged; (2) lobby for public policy which enables the provider professional to control the practice environment, rather than be controlled by it; (3) improve the educational preparation of nurses to care for the aged; and (4) expand the professions' scientific and research base in this area. The national professional organization of registered nurses, the American Nurses' Association, provides leadership to influence the course of nursing as it continues to provide vital services in a dramatically changing environment. PMID:2744491

  9. Fourth joint meeting of the American Urological Association and the Japanese Urological Association Specialty Society program at the 104th annual meeting of the American Urological Association at Chicago 2009.

    Science.gov (United States)

    Cooperberg, Matthew R; Hinotsu, Shiro; Chancellor, Michael B; Homma, Yukio; Nelson, Peter S; Matsuyama, Hideyasu; Menon, Mani; Kucuk, Omer; Hara, Isao; Egawa, Shin; Uzzo, Robert G; Kanayama, Hiro-Omi; Okuyama, Akihiko; Akaza, Hideyuki

    2009-08-01

    We are heartily grateful for the warm support of all of the people concerned, including the moderators and panelists of both societies for giving us the opportunity to hold the 4th American Urological Association/Japanese Urological Association (AUA/JUA) Joint Meeting, held once again at the 104th Annual Meeting of the American Urological Association (25-30 April 2009, Chicago, Illinois, USA). 2009 is a memorable year, being the start of new collaborations between AUA and JUA. The JUA in collaboration with AUA is promoting an academic exchange program whereby outstanding and promising Japanese and American junior faculty members will be given the opportunity to work in the USA and Japan for one month. The program not only allows the sharing of knowledge and experience, but is designed to foster a closer alliance between the AUA and JUA, and assists in identifying future leaders within both organizations. The JUA will have an exhibit booth at the AUA annual meeting, promoting our new joint activities. The Journal of Urology and International Journal of Urology will share reviewers. The JUA will participate in developing AUA guidelines. With all of these activities, the JUA hopes it will provide greater opportunities to young Japanese urologists to participate in educational projects in the US. We would like to thank Professor Robert C. Flanigan, the Secretary General of AUA, Professor Glenn M. Preminger, the Chairman of the AUA Office of Education and the staff of AUA and JUA for supporting our program. We hope to keep holding the joint meeting and have plenty of ideas on themes and forums. We believe that this international program helps to establish a closer relationship between JUA and AUA in the scientific field. PMID:19682110

  10. Reverse-migrated neutrophils regulated by JAM-C are involved in acute pancreatitis-associated lung injury

    OpenAIRE

    Deqing Wu; Yue Zeng; Yuting Fan; Jianghong Wu; Tunike Mulatibieke; Jianbo Ni; Ge Yu; Rong Wan; Xingpeng Wang; Guoyong Hu

    2016-01-01

    Junctional adhesion molecule-C (JAM-C) plays a key role in the promotion of the reverse transendothelial migration (rTEM) of neutrophils, which contributes to the dissemination of systemic inflammation and to secondary organ damage. During acute pancreatitis (AP), systemic inflammatory responses lead to distant organ damage and typically result in acute lung injury (ALI). Here, we investigated the role of rTEM neutrophils in AP-associated ALI and the molecular mechanisms by which JAM-C regula...

  11. The International Association for the Study of Lung Cancer Consensus Statement on Optimizing Management of EGFR Mutation-Positive Non-Small Cell Lung Cancer: Status in 2016.

    Science.gov (United States)

    Tan, Daniel S W; Yom, Sue S; Tsao, Ming S; Pass, Harvey I; Kelly, Karen; Peled, Nir; Yung, Rex C; Wistuba, Ignacio I; Yatabe, Yasushi; Unger, Michael; Mack, Philip C; Wynes, Murry W; Mitsudomi, Tetsuya; Weder, Walter; Yankelevitz, David; Herbst, Roy S; Gandara, David R; Carbone, David P; Bunn, Paul A; Mok, Tony S K; Hirsch, Fred R

    2016-07-01

    Mutations in the epidermal growth factor receptor gene (EGFR) represent one of the most frequent "actionable" alterations in non-small cell lung cancer (NSCLC). Typified by high response rates to targeted therapies, EGFR tyrosine kinase inhibitors (TKIs) are now established first-line treatment options and have transformed the treatment paradigm for NSCLC. With the recent breakthrough designation and approval of the third-generation EGFR TKI osimertinib, available systemic and local treatment options have expanded, requiring new clinical algorithms that take into account individual patient molecular and clinical profiles. In this International Association for the Study of Lung Cancer commissioned consensus statement, key pathologic, diagnostic, and therapeutic considerations, such as optimal choice of EGFR TKI and management of brain metastasis, are discussed. In addition, recommendations are made for clinical guidelines and research priorities, such as the role of repeat biopsies and use of circulating free DNA for molecular studies. With the rapid pace of progress in treating EGFR-mutant NSCLC, this statement provides a state-of-the-art review of the contemporary issues in managing this unique subgroup of patients. PMID:27229180

  12. Management of Differentiated Thyroid Cancer in Children: Focus on the American Thyroid Association Pediatric Guidelines.

    Science.gov (United States)

    Parisi, Marguerite T; Eslamy, Hedieh; Mankoff, David

    2016-03-01

    First introduced in 1946, radioactive iodine (I-131) produces short-range beta radiation with a half-life of 8 days. The physical properties of I-131 combined with the high degree of uptake in the differentiated thyroid cancers (DTCs) led to the use of I-131 as a therapeutic agent for DTC in adults. There are two indications for the potential use of I-131 therapy in pediatric thyroid disorders: nonsurgical treatment of hyperthyroidism owing to Graves' disease and the treatment of children with intermediate- and high-risk DTC. However, children are not just miniature adults. Not only are children and the pediatric thyroid gland more sensitive to radiation than adults but also the biologic behavior of DTC differs between children and adults as well. As opposed to adults, children with DTC typically present with advanced disease at diagnosis; yet, they respond rapidly to therapy and have an excellent prognosis that is significantly better than that in adult counterparts with advanced disease. Unfortunately, there are also higher rates of local and distant disease recurrence in children with DTC compared with adults, mandating lifelong surveillance. Further, children have a longer life expectancy during which the adverse effects of I-131 therapy may become manifest. Recognizing the differences between adults and children with DTC, the American Thyroid Association commissioned a task force of experts who developed and recently published a guideline to address the unique issues related to the management of thyroid nodules and DTC in children. This article reviews the epidemiology, diagnosis, staging, treatment, therapy-related effects, and suggestions for surveillance in children with DTC, focusing not only on the differences between adults and children with this disease but also on the latest recommendations from the inaugural pediatric management guidelines of the American Thyroid Association. PMID:26897719

  13. Readability of Patient Education Materials on the American Association for Surgery of Trauma Website

    Science.gov (United States)

    Eltorai, Adam E. M.; Ghanian, Soha; Adams, Charles A.; Born, Christopher T.; Daniels, Alan H.

    2014-01-01

    Background: Because the quality of information on the Internet is of dubious worth, many patients seek out reliable expert sources. As per the American Medical Association (AMA) and the National Institutes of Health (NIH) recommendations, readability of patient education materials should not exceed a sixth-grade reading level. The average reading skill of U.S. adults is at the eighth-grade level. Objectives: This study evaluates whether a recognized source of expert content, the American Association for Surgery of Trauma (AAST) website’s patient education materials, recommended readability guidelines for medical information. Materials and Methods: Using the well-validated Flesch-Kincaid formula to analyze grade level readability, we evaluated the readability of all 16 of the publicly-accessible entries within the patient education section of the AAST website. Results: Mean ± SD grade level readability was 10.9 ± 1.8 for all the articles. All but one of the articles had a readability score above the sixth-grade level. Readability of the articles exceeded the maximum recommended level by an average of 4.9 grade levels (95% confidence interval, 4.0-5.8; P < 0.0001). Readability of the articles exceeded the eighth-grade level by an average of 2.9 grade levels (95% confidence interval, 2.0-3.8; P < 0.0001). Only one of the articles had a readability score below the eighth-grade level. Conclusions: The AAST’s online patient education materials may be of limited utility to many patients, as the readability of the information exceeds the average reading skill level of adults in the U.S. Lack of patient comprehension represents a discrepancy that is not in accordance with the goals of the AAST’s objectives for its patient education efforts. PMID:25147778

  14. Screening Metastasis-associated Genes from Anoikis Resistant A549 Lung Cancer Cells by Human Genome Array

    Directory of Open Access Journals (Sweden)

    Xiaoping WANG

    2010-01-01

    Full Text Available Background and objective As a barrier to metastases, cells normally undergo apoptosis after they lose contact with their extra cellular matrix (ECM. This process has been termed “anoikis”. Tumour cells that acquire malignant potential have developed mechanisms to resist anoikis and thereby survive after detachment from their primary site while traveling through the lymphatic and circulatory systems. This “anoikis resistance” is considered the first step to tumor metastases. The aim of this study was to screen metastasis-associated genes from anoikis resistant and adherent growth A549 lung cancer cell by Human Genome Array. Methods Establish anoikis resistant A549 lung cancer cell lines by using poly-hydroxyethyl methacrylate resin processed petri dishes, which causes cell free from adherent. The different expressed gene between anoikis resistant A549 cell and adherent growth A549 cell was tested using human V2.0 whole-genome oligonucleotide microarray, a product of Capitalbio Corporation, Beijing. Screen metastasis-associated genes. Results 745 different expressed genes were screened, including 63 highly metastasis-associated genes. Conclusion The successfully established anoikis resistant A549 cell lines and screened different expressed genes provide us basis for further research on metastasis of lung cancer.

  15. Changes in the Lung Microbiome following Lung Transplantation Include the Emergence of Two Distinct Pseudomonas Species with Distinct Clinical Associations

    OpenAIRE

    Dickson, Robert P; Erb-Downward, John R.; Freeman, Christine M.; Walker, Natalie; Scales, Brittan S.; Beck, James M.; Martinez, Fernando J; Curtis, Jeffrey L.; Lama, Vibha N.; Huffnagle, Gary B.

    2014-01-01

    Background Multiple independent culture-based studies have identified the presence of Pseudomonas aeruginosa in respiratory samples as a positive risk factor for bronchiolitis obliterans syndrome (BOS). Yet, culture-independent microbiological techniques have identified a negative association between Pseudomonas species and BOS. Our objective was to investigate whether there may be a unifying explanation for these apparently dichotomous results. Methods We performed bronchoscopies with bronch...

  16. CDK-associated Cullin 1 promotes cell proliferation with activation of ERK1/2 in human lung cancer A549 cells

    International Nuclear Information System (INIS)

    Highlights: •CDK-associated Cullin 1 (CAC1) expression increases in human lung carcinoma. •CAC1 promotes the proliferation of lung cancer A549 cells. •CAC1 promotes human lung cancer A549 cell proliferation with activation of ERK1/2. -- Abstract: Lung cancer is one of the most common causes of cancer-related death in the world, but the mechanisms remain unknown. In this study, we investigated the expression of CDK-associated Cullin 1 (CAC1) in lung cancer, the effect of CAC1 on the proliferation of human lung cancer A549 cells, and the activation of signaling pathways of mitogen-activated protein kinases (MAPKs). Results showed that CAC1 expression was higher levels in human lung carcinoma than normal lung tissue, and CAC1 siRNA reduced the proliferation of lung cancer A549 cells by decreasing cell activity and cell division in vitro. The proportion of cells treated with CAC1 siRNA increased in the G1 phase and decreased in the S and G2/M phase, indicative of G1 cell cycle arrest. Furthermore, the proportions of early/late apoptosis in lung cancer A549 cells were enhanced with CAC1 siRNA treatment. It was also found that activation of extracellular signal-regulated protein kinase (ERK) and p38 signaling pathways were involved in the proliferation of A549 cells. After CAC1 siRNA treatment, p-ERK1/2 levels decreased, and meanwhile p-p38 level increased, A549 cell proliferation increased when ERK1/2 signaling is activated by PMA. Our findings demonstrated that CAC1 promoted the proliferation of human lung cancer A549 cells with activation of ERK1/2 signaling pathways, suggesting a potential cure target for treatment of human lung cancer

  17. CDK-associated Cullin 1 promotes cell proliferation with activation of ERK1/2 in human lung cancer A549 cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Tian Jun [Respiratory Department, The First Affiliated Hospital, Xi’an Jiaotong University College of Medicine, Xi’an 710061 (China); Gao, Fei [Hua-shan Central Hospital of Xi’an, Xi’an 710043 (China); Yang, Tian; Thakur, Asmitanand; Ren, Hui; Li, Yang; Zhang, Shuo; Wang, Ting [Respiratory Department, The First Affiliated Hospital, Xi’an Jiaotong University College of Medicine, Xi’an 710061 (China); Chen, Ming Wei, E-mail: xjtucmw@163.com [Respiratory Department, The First Affiliated Hospital, Xi’an Jiaotong University College of Medicine, Xi’an 710061 (China)

    2013-07-19

    Highlights: •CDK-associated Cullin 1 (CAC1) expression increases in human lung carcinoma. •CAC1 promotes the proliferation of lung cancer A549 cells. •CAC1 promotes human lung cancer A549 cell proliferation with activation of ERK1/2. -- Abstract: Lung cancer is one of the most common causes of cancer-related death in the world, but the mechanisms remain unknown. In this study, we investigated the expression of CDK-associated Cullin 1 (CAC1) in lung cancer, the effect of CAC1 on the proliferation of human lung cancer A549 cells, and the activation of signaling pathways of mitogen-activated protein kinases (MAPKs). Results showed that CAC1 expression was higher levels in human lung carcinoma than normal lung tissue, and CAC1 siRNA reduced the proliferation of lung cancer A549 cells by decreasing cell activity and cell division in vitro. The proportion of cells treated with CAC1 siRNA increased in the G1 phase and decreased in the S and G2/M phase, indicative of G1 cell cycle arrest. Furthermore, the proportions of early/late apoptosis in lung cancer A549 cells were enhanced with CAC1 siRNA treatment. It was also found that activation of extracellular signal-regulated protein kinase (ERK) and p38 signaling pathways were involved in the proliferation of A549 cells. After CAC1 siRNA treatment, p-ERK1/2 levels decreased, and meanwhile p-p38 level increased, A549 cell proliferation increased when ERK1/2 signaling is activated by PMA. Our findings demonstrated that CAC1 promoted the proliferation of human lung cancer A549 cells with activation of ERK1/2 signaling pathways, suggesting a potential cure target for treatment of human lung cancer.

  18. Association Between White Blood Cell Count Following Radiation Therapy With Radiation Pneumonitis in Non-Small Cell Lung Cancer

    International Nuclear Information System (INIS)

    Purpose: Radiation pneumonitis (RP) is an inflammatory response to radiation therapy (RT). We assessed the association between RP and white blood cell (WBC) count, an established metric of systemic inflammation, after RT for non-small cell lung cancer. Methods and Materials: We retrospectively analyzed 366 patients with non-small cell lung cancer who received ≥60 Gy as definitive therapy. The primary endpoint was whether WBC count after RT (defined as 2 weeks through 3 months after RT completion) was associated with grade ≥3 or grade ≥2 RP. Median lung volume receiving ≥20 Gy (V20) was 31%, and post-RT WBC counts ranged from 1.7 to 21.2 × 103 WBCs/μL. Odds ratios (ORs) associating clinical variables and post-RT WBC counts with RP were calculated via logistic regression. A recursive-partitioning algorithm was used to define optimal post-RT WBC count cut points. Results: Post-RT WBC counts were significantly higher in patients with grade ≥3 RP than without (P3/μL for grade ≥3 and ≥2 RP, respectively. Univariate analysis revealed significant associations between post-RT WBC count and grade ≥3 (n=46, OR=2.6, 95% confidence interval [CI] 1.4‒4.9, P=.003) and grade ≥2 RP (n=164, OR=2.0, 95% CI 1.2‒3.4, P=.01). This association held in a stepwise multivariate regression. Of note, V20 was found to be significantly associated with grade ≥2 RP (OR=2.2, 95% CI 1.2‒3.4, P=.01) and trended toward significance for grade ≥3 RP (OR=1.9, 95% CI 1.0-3.5, P=.06). Conclusions: Post-RT WBC counts were significantly and independently associated with RP and have potential utility as a diagnostic or predictive marker for this toxicity

  19. Radiation dose is associated with prognosis of small cell lung cancer with superior vena cava syndrome

    Science.gov (United States)

    Wang, Zhen-Bo; Ning, Fang-Ling; Wang, Xiao-Le; Cheng, Yu-Feng; Dong, Xin-Jun; Liu, Chang-Min; Chen, Shao-Shui

    2015-01-01

    Approximately 10% of small cell lung cancer (SCLC) cases develop superior vena cava syndrome (SVCS). Many SCLC patients with SVCS have relatively limited disease, requiring curative rather than palliative treatment. Besides chemotherapy, radiotherapy is important for treating SCLC with SVCS. We retrospectively evaluated the influence of radiotherapy dose on the prognosis of 57 patients with SCLC with SVCS treated with concurrent chemoradiotherapy. The mean biological equivalent radiation dose was 71.5 Gy. We administered etoposide/cisplatin as sequential and concurrent chemotherapy. All patients received at least one cycle of concurrent chemotherapy. All patients had partial or complete response; SVCS-associated symptoms were reduced in 87.7% (50/57) of patients within 3-10 days after treatment. Radiation dose did not affect 2-year local control (74.2% vs. 80.8%). Patients who received high-dose radiation had a lower 2-year overall survival rate than those who received low-dose radiation (11.6 vs. 33%; P = 0.024). The high dose group median survival was 15.0 months (95% confidence interval [CI]: 11.2-19.0) compared with 18.7 months (95% CI: 13.9-23.6) in the low dose group. Grade 3/4 neutropenia occurred in 22/26 high dose patients (84.6%) and 21/31 low dose patients (67.7%). In the high dose group, 30.8% of patients had grade 3/4 esophagitis compared with 19.4% of low dose patients. Only 29.0% of low dose patients received < 4 cycles of chemotherapy in the first 12 weeks after treatment began compared with 46.2% of high dose patients. Concurrent chemoradiotherapy is a tolerable modality for treating stage IIIA/IIIB SCLC with SVCS. Moderate-dose radiotherapy is preferable. PMID:26064339

  20. Variants in intron 13 of the ELMO1 gene are associated with diabetic nephropathy in African Americans

    OpenAIRE

    Leak, T. S.; Perlegas, P.S.; Smith, S. G.; Keene, K.L.; Hicks, P. J.; Langefeld, C. D.; Mychaleckyj, J. C.; Rich, S S; Kirk, J.K.; Freedman, B.I.; Bowden, D. W.; Sale, M.M.

    2009-01-01

    Variants in the engulfment and cell motility 1 (ELMO1) gene are associated with nephropathy due to type 2 diabetes mellitus (T2DM) in a Japanese cohort. We comprehensively evaluated this gene in African American (AA) T2DM patients with end-stage renal disease (ESRD). Three hundred nine HapMap tagging SNPs and 9 reportedly associated SNPs were genotyped in 577 AA T2DM-ESRD patients and 596 AA non-diabetic controls, plus 43 non-diabetic European American controls and 45 Yoruba Nigerian samples ...

  1. Association of Long Runs of Homozygosity With Alzheimer Disease Among African American Individuals

    Science.gov (United States)

    Ghani, Mahdi; Reitz, Christiane; Cheng, Rong; Vardarajan, Badri Narayan; Jun, Gyungah; Sato, Christine; Naj, Adam; Rajbhandary, Ruchita; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B.; Graff-Radford, Neill R.; Evans, Denis; De Jager, Philip L.; Crane, Paul K.; Buxbaum, Joseph D.; Murrell, Jill R.; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T.; Green, Robert C.; Barnes, Lisa L.; Cantwell, Laura B.; Fallin, M. Daniele; Go, Rodney C. P.; Griffith, Patrick A.; Obisesan, Thomas O.; Manly, Jennifer J.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Lopez, Oscar L.; Bennett, David A.; Hendrie, Hugh; Hall, Kathleen S.; Goate, Alison M.; Byrd, Goldie S.; Kukull, Walter A.; Foroud, Tatiana M.; Haines, Jonathan L.; Farrer, Lindsay A.; Pericak-Vance, Margaret A.; Lee, Joseph H.; Schellenberg, Gerard D.; St. George-Hyslop, Peter; Mayeux, Richard; Rogaeva, Ekaterina

    2015-01-01

    IMPORTANCE Mutations in known causal Alzheimer disease (AD) genes account for only 1% to 3% of patients and almost all are dominantly inherited. Recessive inheritance of complex phenotypes can be linked to long (>1-megabase [Mb]) runs of homozygosity (ROHs) detectable by single-nucleotide polymorphism (SNP) arrays. OBJECTIVE To evaluate the association between ROHs and AD in an African American population known to have a risk for AD up to 3 times higher than white individuals. DESIGN, SETTING, AND PARTICIPANTS Case-control study of a large African American data set previously genotyped on different genome-wide SNP arrays conducted from December 2013 to January 2015. Global and locus-based ROH measurements were analyzed using raw or imputed genotype data. We studied the raw genotypes from 2 case-control subsets grouped based on SNP array: Alzheimer’s Disease Genetics Consortium data set (871 cases and 1620 control individuals) and Chicago Health and Aging Project–Indianapolis Ibadan Dementia Study data set (279 cases and 1367 control individuals). We then examined the entire data set using imputed genotypes from 1917 cases and 3858 control individuals. MAIN OUTCOMES AND MEASURES The ROHs larger than 1 Mb, 2 Mb, or 3 Mb were investigated separately for global burden evaluation, consensus regions, and gene-based analyses. RESULTS The African American cohort had a low degree of inbreeding (F ~ 0.006). In the Alzheimer’s Disease Genetics Consortium data set, we detected a significantly higher proportion of cases with ROHs greater than 2 Mb (P = .004) or greater than 3 Mb (P = .02), as well as a significant 114-kilobase consensus region on chr4q31.3 (empirical P value 2 = .04; ROHs >2 Mb). In the Chicago Health and Aging Project–Indianapolis Ibadan Dementia Study data set, we identified a significant 202-kilobase consensus region on Chr15q24.1 (empirical P value 2 = .02; ROHs >1 Mb) and a cluster of 13 significant genes on Chr3p21.31 (empirical P value 2 = .03

  2. Prevalence and clinical characteristics associated with pulmonary hypertension in African-Americans.

    Directory of Open Access Journals (Sweden)

    Gaurav Choudhary

    Full Text Available BACKGROUND: Pulmonary hypertension (PH is associated with increased mortality and morbidity. It is frequently associated with cardiopulmonary diseases that are prevalent in African Americans (AAs. However, the prevalence or determinants of PH in the AA population is not known. METHODS: We conducted a cross-sectional study to estimate the prevalence of PH (defined as trans-tricuspid gradient ≥ 35 mm Hg and associated clinical characteristics in AAs using the Jackson Heart Study cohort (n=3,282 who underwent echocardiography and had a measurable trans-tricuspid regurgitant jet. Echocardiography is frequently used for screening for PH despite its limitations in estimating accurate PA systolic pressures. Overall and age-adjusted gender-specific prevalence were estimated and modified Poisson regression was used to identify independent clinical, spirometric, and echocardiographic characteristics associated with PH. RESULTS: The mean age of the study population was 56.1 ± 12.6 years with 67.5% female. The prevalence of PH was 6.8%, with higher prevalence in female AAs (age-adjusted prevalence: Men 4.9%, 95% CI 3.6-6.2%; Women 7.7%, 95% CI 6.6-8.8%. Pulmonary hypertension prevalence increased with age (Prevalence Ratio: 10.0, 95%CI 4.0-25.1, >65 versus <45 years old, presence of obesity, higher pulse pressure, diabetes, obstructive or restrictive spirometry pattern, and severe left heart valvular disease. Also, PH was significantly associated with left atrial size and left ventricular ejection fraction. CONCLUSIONS: Pulmonary hypertension is prevalent in AAs, more in women than in men. The identified cardiopulmonary risk factors that increase the prevalence of PH may assist in diagnosis and management of these at-risk subjects in the AA population.

  3. Enrichment of the lung microbiome with oral taxa is associated with lung inflammation of a Th17 phenotype.

    Science.gov (United States)

    Segal, Leopoldo N; Clemente, Jose C; Tsay, Jun-Chieh J; Koralov, Sergei B; Keller, Brian C; Wu, Benjamin G; Li, Yonghua; Shen, Nan; Ghedin, Elodie; Morris, Alison; Diaz, Phillip; Huang, Laurence; Wikoff, William R; Ubeda, Carles; Artacho, Alejandro; Rom, William N; Sterman, Daniel H; Collman, Ronald G; Blaser, Martin J; Weiden, Michael D

    2016-01-01

    Microaspiration is a common phenomenon in healthy subjects, but its frequency is increased in chronic inflammatory airway diseases, and its role in inflammatory and immune phenotypes is unclear. We have previously demonstrated that acellular bronchoalveolar lavage samples from half of the healthy people examined are enriched with oral taxa (here called pneumotypeSPT) and this finding is associated with increased numbers of lymphocytes and neutrophils in bronchoalveolar lavage. Here, we have characterized the inflammatory phenotype using a multi-omic approach. By evaluating both upper airway and acellular bronchoalveolar lavage samples from 49 subjects from three cohorts without known pulmonary disease, we observed that pneumotypeSPT was associated with a distinct metabolic profile, enhanced expression of inflammatory cytokines, a pro-inflammatory phenotype characterized by elevated Th-17 lymphocytes and, conversely, a blunted alveolar macrophage TLR4 response. The cellular immune responses observed in the lower airways of humans with pneumotypeSPT indicate a role for the aspiration-derived microbiota in regulating the basal inflammatory status at the pulmonary mucosal surface. PMID:27572644

  4. Association between XPD (Lys751G1n Polymorphism and Lung Cancer Risk: A Population-Based Study in Iran

    Directory of Open Access Journals (Sweden)

    Majid Motovali-Bashi

    2014-04-01

    Full Text Available Objective: People are usually susceptible to carcinogenic aromatic amines, present in cigarrette smoke and polluted environment, which can cause DNA damage. Therefore, maintenance of genomic DNA integrity is a direct result of proper function of DNA repair enzymes. Polymorphic diversity could affect the function of repair enzymes and thus augment the risk of different cancers. Xeroderma pigmentosum group D (XPD gene encodes one of the most prominent repair enzymes and the polymorphisms of this gene are thought to be of importance in lung cancer risk. This gene encodes the helicase, which is a component of transcription factor IIH and an important part of the nucleotide excision repair system. Studies reveal that individuals with Lys751Gln polymorphism of XPD gene have a low repairing capacity to delete the damages of ultraviolet light among other XPD polymorphisms. Materials and Methods: In this case-control study, first Lys751Gln polymorphism was genotyped, then its association with lung cancer risk was analyzed. Genomic DNA was extracted from the whole blood sample of 640 individuals from Iran (352 healthy individuals and 288 patients. Allele frequencies and heterozygosity of Lys751Gln polymorphism were determined using polymerase chain reaction-restriction fragment length polymorphism method. Results: According to statistical analyses, lung cancer risk in individuals with Lys751Gln polymorphism (Odd Ratio=1.8, 95% Confidence Interval 0.848-3.819 is approximately twice as high as that of Lys/Lys genotype, however 751Gln/Gln genotype did not relate to lung cancer risk (Odd Ratio=0.7, 95% Confidence Interval 0/307-1/595. Conclusion: This study suggests that heterozygous polymorphism (Lys/Gln increases the sensitivity of lung cancer risk, while homozygous polymorphism (Lys/Lys probably decreases its risk and C allele frequency shows no remarkable increase in the patients.

  5. Association between Lung Function and Vocal Affections Arising from Tobacco Consumption

    Directory of Open Access Journals (Sweden)

    Santos, Karoline Weber dos

    2014-01-01

    Full Text Available Introduction Smoking is a major risk factor for numerous diseases; it is necessary to analyze the impact that the habit can have on vocal health. Objectives To determine the influence of smoking on changes in vocal production and lung vital capacity compared with nonsmokers. Methods This cross-sectional study compared smokers and nonsmokers (24 subjects each. Each participant underwent a vocal and spirometric evaluation to measure vital lung capacity. Results The results showed a worsening in lung vital capacity and other parameters of voice in smokers compared with nonsmokers. Furthermore, the decreased pulmonary vital capacity affected the evaluated voice parameters, and decreased carrying capacity was closely related to smoking. The time and amount of consumption had a direct relationship with the vocal and maximum phonation time. Conclusions This study showed that smoking causes voice disorders due to lung weakness. Thus, voice changes are affected both directly by interference of smoking on vocal structures and indirectly by increased weakness, which impairs lung vocal production.

  6. Association between Lung Function and Vocal Affections Arising from Tobacco Consumption.

    Science.gov (United States)

    Santos, Karoline Weber Dos; Echeveste, Simone Soares; Vidor, Deisi Cristina Gollo Marques

    2014-01-01

    Introduction Smoking is a major risk factor for numerous diseases; it is necessary to analyze the impact that the habit can have on vocal health. Objectives To determine the influence of smoking on changes in vocal production and lung vital capacity compared with nonsmokers. Methods This cross-sectional study compared smokers and nonsmokers (24 subjects each). Each participant underwent a vocal and spirometric evaluation to measure vital lung capacity. Results The results showed a worsening in lung vital capacity and other parameters of voice in smokers compared with nonsmokers. Furthermore, the decreased pulmonary vital capacity affected the evaluated voice parameters, and decreased carrying capacity was closely related to smoking. The time and amount of consumption had a direct relationship with the vocal and maximum phonation time. Conclusions This study showed that smoking causes voice disorders due to lung weakness. Thus, voice changes are affected both directly by interference of smoking on vocal structures and indirectly by increased weakness, which impairs lung vocal production. PMID:25992056

  7. Respiratory Failure Associated with the Lipodystrophy Syndrome in an HIV-Positive Patient with Compromised Lung Function

    Directory of Open Access Journals (Sweden)

    Natasha Press

    2001-01-01

    Full Text Available Protease inhibitors, used as treatment in human immunodeficiency virus (HIV infection, are associated with a syndrome of peripheral lipodystrophy, central adiposity, hyperlipidemia and insulin resistance. An HIV-positive patient with chronic obstructive pulmonary disease is presented who developed the lipodystrophy syndrome that is associated with the use of protease inhibitors. It is postulated that the lipodystrophy syndrome further compromised his lung function, leading to respiratory failure. Patients who have pulmonary disease and are taking protease inhibitors require monitoring of clinical status and pulmonary function tests.

  8. Respiratory failure associated with the lipodystrophy syndrome in an HIV-positive patient with compromised lung function.

    Science.gov (United States)

    Press, N; Montessori, V; Bai, T R; Montaner, J

    2001-01-01

    Protease inhibitors, used as treatment in human immunodeficiency virus (HIV) infection, are associated with a syndrome of peripheral lipodystrophy, central adiposity, hyperlipidemia and insulin resistance. An HIV-positive patient with chronic obstructive pulmonary disease is presented who developed the lipodystrophy syndrome that is associated with the use of protease inhibitors. It is postulated that the lipodystrophy syndrome further compromised his lung function, leading to respiratory failure. Patients who have pulmonary disease and are taking protease inhibitors require monitoring of clinical status and pulmonary function tests. PMID:11521144

  9. Genetic variant in TP63 on locus 3q28 is associated with risk of lung adenocarcinoma among never-smoking females in Asia

    Science.gov (United States)

    Wang, Wen-Chang; Hong, Yun-Chul; Wang, Jiu-Cun; Chen, Kexin; Chang, I-Shou; Chen, Chien-Jen; Lu, Daru; Yin, Zhihua; Wu, Chen; Zheng, Wei; Qian, Biyun; Park, Jae Yong; Kim, Yeul Hong; Chatterjee, Nilanjan; Chen, Ying; Chang, Gee-Chen; Hsiao, Chin-Fu; Yeager, Meredith; Tsai, Ying-Huang; Wei, Hu; Kim, Young Tae; Wu, Wei; Zhao, Zhenhong; Chow, Wong-Ho; Zhu, Xiaoling; Lo, Yen-Li; Sung, Sook Whan; Chen, Kuan-Yu; Yuenger, Jeff; Kim, Joo Hyun; Huang, Liming; Chen, Ying-Hsiang; Gao, Yu-Tang; Kim, Jin Hee; Huang, Ming-Shyan; Jung, Tae Hoon; Caporaso, Neil; Zhao, Xueying; Huan, Zhang; Yu, Dianke; Kim, Chang Ho; Su, Wu-Chou; Shu, Xiao-Ou; Kim, In-San; Bassig, Bryan; Chen, Yuh-Min; Cha, Sung Ick; Tan, Wen; Chen, Hongyan; Yang, Tsung-Ying; Sung, Jae Sook; Wang, Chih-Liang; Li, Xuelian; Park, Kyong Hwa; Yu, Chong-Jen; Ryu, Jeong-Seon; Xiang, Yongbing; Hutchinson, Amy; Kim, Jun Suk; Cai, Qiuyin; Landi, Maria Teresa; Lee, Kyoung-Mu; Hung, Jen-Yu; Park, Ju-Yeon; Tucker, Margaret; Lin, Chien-Chung; Ren, Yangwu; Perng, Reury-Perng; Chen, Chih-Yi; Jin, Li; Chen, Kun-Chieh; Li, Yao-Jen; Chiu, Yu-Fang; Tsai, Fang-Yu; Yang, Pan-Chyr; Fraumeni, Joseph F.; Seow, Adeline; Lin, Dongxin; Zhou, Baosen; Chanock, Stephen; Hsiung, Chao Agnes; Rothman, Nathaniel; Lan, Qing

    2013-01-01

    A recent genome-wide association study (GWAS) of subjects from Japan and South Korea reported a novel association between the TP63 locus on chromosome 3q28 and risk of lung adenocarcinoma (p = 7.3 × 10−12); however, this association did not achieve genome-wide significance (p < 10−7) among never-smoking males or females. To determine if this association with lung cancer risk is independent of tobacco use, we genotyped the TP63 SNPs reported by the previous GWAS (rs10937405 and rs4488809) in 3,467 never-smoking female lung cancer cases and 3,787 never-smoking female controls from 10 studies conducted in Taiwan, Mainland China, South Korea, and Singapore. Genetic variation in rs10937405 was associated with risk of lung adenocarcinoma [n = 2,529 cases; p = 7.1 × 10−8; allelic risk = 0.80, 95% confidence interval (CI) = 0.74–0.87]. There was also evidence of association with squamous cell carcinoma of the lung (n = 302 cases; p = 0.037; allelic risk = 0.82, 95% CI = 0.67–0.99). Our findings provide strong evidence that genetic variation in TP63 is associated with the risk of lung adenocarcinoma among Asian females in the absence of tobacco smoking. PMID:22367405

  10. Evaluation of the American Heart Association 2015 revised Jones criteria versus existing guidelines

    Science.gov (United States)

    Kumar, Dinesh; Bhutia, Euden; Kumar, Pradeep; Shankar, Binoy; Juneja, Atul; Chandelia, Sudha

    2016-01-01

    Objectives To compare the diagnostic yield of acute rheumatic fever (ARF) by the American Heart Association/ American College of Cardiology (AHA/ACC) 2015 revised Jones criteria with the WHO 2004 and Australian guidelines 2012. Methods Retrospective observational study in 93 cases of suspected ARF admitted to the Division of Paediatric Cardiology between January 2012 and December 2014. WHO 2004, Australian guidelines and AHA/ACC 2015 Jones criteria were applied to assess definite and probable ARF. Results Of the 93 cases, 50 were diagnosed as the first episode of ARF and 43 as a recurrence of the condition. Subclinical carditis was a predominant presentation (38%) in the first episode group (p<0.01) whereas in the recurrence group carditis (88%) was the main presentation (p<0.01). Among the joint manifestations, the majority of patients in both the first episode group and the recurrence group presented with arthralgia. Of all the patients with suspected ARF (50), 34% of cases did not fulfil the standard Jones criteria 2004; however, 86% qualified as having ARF on applying the Australian and AHA/ACC 2015 criteria. Surprisingly in the recurrence group only 67% of the patients fulfilled AHA/ACC 2015 despite the modifications incorporated beyond WHO 2004; however, all the patients fulfilled the Australian guidelines either as definite (88.4%) or probable (11.6%). Inclusion of subclinical carditis, polyarthralgia and monoarthritis as major criteria influenced the diagnosis to definite ARF in 20%, 10% and 4% of patients, respectively. Conclusions The clinical manifestations of ARF, comprising subclinical carditis and arthralgia, are possibly milder in the Indian population; hence, inclusion of subclinical carditis, polyarthralgia and monoarthritis as major criteria in the newer guidelines has improved the diagnostic yield of ARF. In the absence of a gold standard for the diagnosis of ARF, it is not possible to comment on sensitivity and specificity. PMID:27326228

  11. Health insurance and household income associated with mammography utilization among American women, 2000-2008

    Institute of Scientific and Technical Information of China (English)

    ZHAO Da-hai; ZHANG Zhi-ruo; RAO Ke-qin

    2011-01-01

    Background National Breast and Cervical Cancer Early Detection Program (NBCCEDP) has provided free or low-costmammograms to low-income or no health insurance women in all of the states of the United States (US) since 1997.The objective of this study was to understand whether health insurance and annual household income impacted the mammography utilization since the implementation of NBCCEDP,in order to evaluate how the implementation of NBCCEDP impacted mammography utilization among American women.Methods Data were from the database of Behavioral Risk Factor Surveillance System (BRFSS) of the CDC in US.Mammography utilization was measured by whether the American woman aged 40 to 64 years had the mammography within the last two years.The chi square test and multivariate Logistic regression were used to evaluate the associations between mammography utilization and health insurance,annual household income,and other factors for any given year.Results From 2000 to 2008,the rate of mammography utilization among participants had a steady decrease on the whole from 86.7% to 83.8%.The results showed that the mammography utilization correlated significantly with health insurance and annual household income for any given year.The results also showed that compared with participants who were uninsured,those who were insured had a greater times higher rate of mammography in 2008 than any other year from 2000 to 2008,and compared with participants whose annual household income was below $15 000,those whose annual household income was above $50 000 had a greater times higher rate of mammography in 2008 than in 2004 and 2006.Conclusions Health insurance and annual household income impacted the mammography utilization for any given year from 2000 to 2008,and the implementation of NBCCEDP has not achieved its original goal on breast cancer screening.

  12. Position of the American Dietetic Association: use of nutritive and nonnutritive sweeteners.

    Science.gov (United States)

    2004-02-01

    Sweeteners elicit pleasurable sensations with (nutritive) or without (nonnutritive) energy. Nutritive sweeteners (eg, sucrose, fructose) are generally recognized as safe (GRAS) by the Food and Drug Administration (FDA), yet concern exists about increasing sweetener intakes relative to optimal nutrition and health. Dietary quality suffers at intakes above 25% of total energy (the Institutes of Medicine's suggested maximal intake level). In the United States, estimated intakes of nutritive sweeteners fall below this, although one in four children (ages 9 to 18 years) can surpass this level. Polyols (sugar alcohols), GRAS-affirmed or petitions filed for GRAS, add sweetness with reduced energy and functional properties to foods/beverages and promote dental health. Five nonnutritive sweeteners with intense sweetening power have FDA approval (acesulfame-K, aspartame, neotame, saccharin, sucralose) and estimated intakes below the Acceptable Daily Intake (level that a person can safely consume everyday over a lifetime without risk). By increasing palatability of nutrient-dense foods/beverages, sweeteners can promote diet healthfulness. Scientific evidence supports neither that intakes of nutritive sweeteners by themselves increase the risk of obesity nor that nutritive or nonnutritive sweeteners cause behavioral disorders. However, nutritive sweeteners increase risk of dental caries. High fructose intakes may cause hypertriglyceridemia and gastrointestinal symptoms in susceptible individuals. Thus, it is the position of The American Dietetic Association that consumers can safely enjoy a range of nutritive and nonnutritive sweeteners when consumed in a diet that is guided by current federal nutrition recommendations, such as the Dietary Guidelines for Americans and the Dietary References Intakes, as well as individual health goals. Dietetics professionals should provide consumers with science-based information about sweeteners and support research on the use of sweeteners

  13. New AP4B1 mutation in an African-American child associated with intellectual disability

    Science.gov (United States)

    Lamichhane, Dronacharya

    2013-01-01

    Prevalence of intellectual disability (ID) varies from 1–3%. Genetic causes of ID are being increasingly recognized. Although multiple mutations have been identified as a cause of syndromic ID, the genetic etiology of non-syndromic ID is poorly understood. However, more than 100 loci have been mapped that are associated with non-syndromic ID. There have been a couple of reports of AP4B1 gene mutation causing severe intellectual disability, absent speech, shy character, stereotypic laughter, muscular hypotonia that progressed to spastic paraplegia, microcephaly, foot deformity, decreased muscle mass of the lower limbs, inability to walk, and growth retardation. They had structural brain abnormalities and seizures. The reported cases were from Arab families where consanguineous marriage is common. We encountered an African-American child who presented first at the age of 24 mo with language difficulties and was subsequently found to have moderate to severe intellectual disability by standardized tests. Shortly, he started to have seizures and problems with ambulation. Although he was hypotonic at the time of presentation, legs slowly became spastic at the age of 4 yr. After a thorough work up, he was found to have heterozygous mutation in the AP4B1 gene along with another missense mutation in the same gene. There has been no report of mutation in this gene in the North American population. Although AP4B1 typically is said to be an autosomal recessive disease-causing gene, our case is different in the sense that there are two mutations in the same gene one of which has never been reported before and co-exists with a known disease causing mutation. Yet, the phenotype of the case closely resembles those published previously.

  14. Association of primary open-angle glaucoma with mitochondrial variants and haplogroups common in African Americans

    Science.gov (United States)

    Gudiseva, Harini V.; Trachtman, Benjamin; Bowman, Anita S.; Sagaser, Anna; Sankar, Prithvi; Miller-Ellis, Eydie; Lehman, Amanda; Addis, Victoria; O'Brien, Joan M.

    2016-01-01

    Purpose To estimate the population frequencies of all common mitochondrial variants and ancestral haplogroups among 1,999 subjects recruited for the Primary Open-Angle African American Glaucoma Genetics (POAAGG) Study, including 1,217 primary open-angle glaucoma (POAG) cases and 782 controls, and to identify ancestral subpopulations and mitochondrial mutations as potential risk factors for POAG susceptibility. Methods Subject classification by characteristic glaucomatous optic nerve findings and corresponding visual field defects, as defined by enrolling glaucoma specialists, stereo disc photography, phlebotomy, extraction of total DNA from peripheral blood or saliva, DNA quantification and normalization, PCR amplification of whole mitochondrial genomes, Ion Torrent deep semiconductor DNA sequencing on DNA pools (“Pool-seq”), Sanger sequencing of 3,479 individual mitochondrial DNAs, and bioinformatic analysis. Results The distribution of common African haplogroups within the POAAGG study population was broadly similar to prior surveys of African Americans. However, the POAG case population was found to be enriched in L1c2 haplogroups, which are defined in part by missense mutations m.6150G>A (Val83Ile, odds ratio [OR] 1.8, p=0.01), m.6253C>T (Met117Thr, rs200165736, OR 1.6, p=0.04), and m.6480G>A (Val193Ile, rs199476128, OR 4.6, p=0.04) in the cytochrome c oxidase subunit 1 (MT-CO1) gene and by a variant, m.2220A>G (OR 2.0, p=0.01), in MT-RNR2, which encodes the mitochondrial ribosomal 16s RNA gene. L2 haplogroups were predicted to be overrepresented in the POAG case population by Pool-seq, and the difference was confirmed to be significant with Sanger sequencing, that targeted the L2-associated variants m.2416T>C (rs28358580, OR 1.2, p=0.02) and m.2332C>T (OR 1.2, p=.02) in MT-RNR2. Another variant within MT-RNR2, m.3010G>A (rs3928306), previously implicated in sensitivity to the optic neuropathy-associated antibiotic linezolid, and arising on D4 and J1

  15. The relevance of "Nonsmoking-associated lung cancer" in India: A single-centre experience

    Directory of Open Access Journals (Sweden)

    A Krishnamurthy

    2012-01-01

    Full Text Available Background: Lung cancer remains a major cause of morbidity and mortality worldwide, accounting for more deaths than any other cancer cause. Aim: The aim of this study was to analyze the clinical profile and the epidemiological trends in lung cancer patients from a single centre with an emphasis on the smoking practices. Materials and Methods: This is a retrospective analysis of prospectively collected data of 258 consecutive hospital in-patients with a proven diagnosis of lung cancer at a tertiary care oncology centre between 2003 and 2007. Results: The median age of patients in our study was 56 years; the male to female ratio was approximately 3.5:1. Non-small-cell lung cancer (NSCLC was the predominant histology in 224 patients; the histology in the remaining 34 patients was small-cell carcinoma. Within NSCLC, the most common histology was adenocarcinoma followed by squamous cell carcinoma. One hundred and two patients were never-smokers as compared to 156 patients who were ever-smokers. Among the smokers, the majority of them were found to be cigarette smokers compared to 28.2% bidi smokers. There was a very significant correlation found with adenocarcinoma among nonsmokers, and with squamous cell carcinoma among the smokers compared to non-smokers. Conclusions: Our study suggests that the epidemiology of lung cancer in India is possibly changing, with close to 40% of our lung cancer patients being nonsmokers. More importantly, our study reflects the global trend of rise in adenocarcinoma histology. These observations need to be substantiated in similar studies of larger magnitude, preferably population-based.

  16. Detected troponin elevation is associated with high early mortality after lung resection for cancer

    Directory of Open Access Journals (Sweden)

    Van Tornout Fillip

    2006-10-01

    Full Text Available Abstract Background Myocardial infarction can be difficult to diagnose after lung surgery. As recent diagnostic criteria emphasize serum cardiac markers (in particular serum troponin we set out to evaluate its clinical utility and to establish the long term prognostic impact of detected abnormal postoperative troponin levels after lung resection. Methods We studied a historic cohort of patients with primary lung cancer who underwent intended surgical resection. Patients were grouped according to known postoperative troponin status and survival calculated by Kaplan Meier method and compared using log rank. Parametric survival analysis was used to ascertain independent predictors of mortality. Results From 2001 to 2004, a total of 207 patients underwent lung resection for primary lung cancer of which 14 (7% were identified with elevated serum troponin levels within 30 days of surgery, with 9 (64% having classical features of myocardial infarction. The median time to follow up (interquartile range was 22 (1 to 52 months, and the one and five year survival probabilities (95% CI for patients without and with postoperative troponin elevation were 92% (85 to 96 versus 60% (31 to 80 and 61% (51 to 71 versus 18% (3 to 43 respectively (p T stage and postoperative troponin elevation remained independent predictors of mortality in the final multivariable model. The acceleration factor for death of elevated serum troponin after adjusting for tumour stage was 9.19 (95% CI 3.75 to 22.54. Conclusion Patients with detected serum troponin elevation are at high risk of early mortality with or without symptoms of myocardial infarction after lung resection.

  17. The ethics of interrogation and the American Psychological Association: A critique of policy and process

    Directory of Open Access Journals (Sweden)

    Davis Martha

    2008-01-01

    Full Text Available Abstract The Psychological Ethics and National Security (PENS task force was assembled by the American Psychological Association (APA to guide policy on the role of psychologists in interrogations at foreign detention centers for the purpose of U.S. national security. The task force met briefly in 2005, and its report was quickly accepted by the APA Board of Directors and deemed consistent with the APA Ethics Code by the APA Ethics Committee. This rapid acceptance was unusual for a number of reasons but primarily because of the APA's long-standing tradition of taking great care in developing ethical policies that protected anyone who might be impacted by the work of psychologists. Many psychological and non-governmental organizations (NGOs, as well as reputable journalists, believed the risk of harm associated with psychologist participation in interrogations at these detention centers was not adequately addressed by the report. The present critique analyzes the assumptions of the PENS report and its interpretations of the APA Ethics Code. We demonstrate that it presents only one (and not particularly representative side of a complex set of ethical issues. We conclude with a discussion of more appropriate psychological contributions to national security and world peace that better respect and preserve human rights.

  18. Usability of American Nurses Association State Web Sites: A Follow-up Evaluation.

    Science.gov (United States)

    Koch, Gina; Wakefield, Bonnie J; Alexander, Gregory L; Wilson, Melissa A; Becker, Colleen

    2016-05-01

    The American Nurses Association supports professional nurses through Web sites administered by state nursing associations, providing important information for current and potential members. Optimal usability of these Web sites is critical for nurses to obtain the information they seek. Heuristic evaluations are general criteria used to evaluate the usability of technology such as Web sites. A study published in 2014, using heuristic criteria from Nielsen's 10 principles and Health on The Web, evaluated 27 state nursing Web sites to identify usability concerns that could prevent nurses from obtaining accurate information regarding state nursing practice. The purpose of this study is to conduct a second heuristic evaluation to assess for changes in a subset of 12 Web sites. The analysis comparing the evaluation from 2012 to 2014 found that mean scores increased and variance decreased; however, no statistically significant difference was found between the two studies. Scores increased in 2014 for "help users to diagnose, and recover from errors," "match between the system and real world," and "consistency and standards." Scores decreased due to absence of mission statements and identification of intended audience. Ideally, Web site designers will use the feedback from this study and make changes that improve their usability to provide information to nurses. PMID:26950090

  19. Bacterial communities associated with healthy and Acropora white syndrome-affected corals from American Samoa.

    Science.gov (United States)

    Wilson, Bryan; Aeby, Greta S; Work, Thierry M; Bourne, David G

    2012-05-01

    Acropora white syndrome (AWS) is characterized by rapid tissue loss revealing the white underlying skeleton and affects corals worldwide; however, reports of causal agents are conflicting. Samples were collected from healthy and diseased corals and seawater around American Samoa and bacteria associated with AWS characterized using both culture-dependent and culture-independent methods, from coral mucus and tissue slurries, respectively. Bacterial 16S rRNA gene clone libraries derived from coral tissue were dominated by the Gammaproteobacteria, and Jaccard's distances calculated between the clone libraries showed that those from diseased corals were more similar to each other than to those from healthy corals. 16S rRNA genes from 78 culturable coral mucus isolates also revealed a distinct partitioning of bacterial genera into healthy and diseased corals. Isolates identified as Vibrionaceae were further characterized by multilocus sequence typing, revealing that whilst several Vibrio spp. were found to be associated with AWS lesions, a recently described species, Vibrio owensii, was prevalent amongst cultured Vibrio isolates. Unaffected tissues from corals with AWS had a different microbiota than normal Acropora as found by others. Determining whether a microbial shift occurs prior to disease outbreaks will be a useful avenue of pursuit and could be helpful in detecting prodromal signs of coral disease prior to manifestation of lesions. PMID:22283330

  20. When in Rome: factors associated with changes in drinking behavior among American college students studying abroad.

    Science.gov (United States)

    Pedersen, Eric R; Larimer, Mary E; Lee, Christine M

    2010-09-01

    Study abroad programs have the potential to promote cultural, experiential, and personal development for escalating numbers of American college students each year. Despite reports that study abroad students may be at particular risk for increased and problematic alcohol use, there is limited empirical documentation of this risk. Thus, the present study used a longitudinal design to examine the factors associated with changes in alcohol use among college students studying in foreign countries. A sample of 177 students completed measures of demographics, drinking behavior, and perceived peer drinking behavior 1 month before departure and 1-month postreturn from study abroad trips. Analyses revealed that participants more than doubled their drinking during study abroad trips and those who drank at heavier levels while abroad returned home drinking at significantly elevated levels. This pattern of increased use while abroad was moderated by several factors, with participants studying abroad in Europe (e.g., Italy, France) and Oceania (e.g., Australia, New Zealand), those under the age of 21, those with higher intentions of drinking while abroad, and those with higher drinking perceptions of other study abroad students in their host country increased their alcohol consumption to a greater extent than other participants. Results suggest drinking while abroad is a concern warranting further investigation, especially regarding how changes in drinking may contribute to the experience of alcohol-related consequences abroad. Continued identification of the risk factors associated with increased drinking can help inform targeted predeparture preventive interventions with these students. PMID:20853940

  1. The ethics of interrogation and the American Psychological Association: a critique of policy and process.

    Science.gov (United States)

    Olson, Brad; Soldz, Stephen; Davis, Martha

    2008-01-01

    The Psychological Ethics and National Security (PENS) task force was assembled by the American Psychological Association (APA) to guide policy on the role of psychologists in interrogations at foreign detention centers for the purpose of U.S. national security. The task force met briefly in 2005, and its report was quickly accepted by the APA Board of Directors and deemed consistent with the APA Ethics Code by the APA Ethics Committee. This rapid acceptance was unusual for a number of reasons but primarily because of the APA's long-standing tradition of taking great care in developing ethical policies that protected anyone who might be impacted by the work of psychologists. Many psychological and non-governmental organizations (NGOs), as well as reputable journalists, believed the risk of harm associated with psychologist participation in interrogations at these detention centers was not adequately addressed by the report. The present critique analyzes the assumptions of the PENS report and its interpretations of the APA Ethics Code. We demonstrate that it presents only one (and not particularly representative) side of a complex set of ethical issues. We conclude with a discussion of more appropriate psychological contributions to national security and world peace that better respect and preserve human rights. PMID:18230171

  2. Bayesian inference of the lung alveolar spatial model for the identification of alveolar mechanics associated with acute respiratory distress syndrome

    Science.gov (United States)

    Christley, Scott; Emr, Bryanna; Ghosh, Auyon; Satalin, Josh; Gatto, Louis; Vodovotz, Yoram; Nieman, Gary F.; An, Gary

    2013-06-01

    Acute respiratory distress syndrome (ARDS) is acute lung failure secondary to severe systemic inflammation, resulting in a derangement of alveolar mechanics (i.e. the dynamic change in alveolar size and shape during tidal ventilation), leading to alveolar instability that can cause further damage to the pulmonary parenchyma. Mechanical ventilation is a mainstay in the treatment of ARDS, but may induce mechano-physical stresses on unstable alveoli, which can paradoxically propagate the cellular and molecular processes exacerbating ARDS pathology. This phenomenon is called ventilator induced lung injury (VILI), and plays a significant role in morbidity and mortality associated with ARDS. In order to identify optimal ventilation strategies to limit VILI and treat ARDS, it is necessary to understand the complex interplay between biological and physical mechanisms of VILI, first at the alveolar level, and then in aggregate at the whole-lung level. Since there is no current consensus about the underlying dynamics of alveolar mechanics, as an initial step we investigate the ventilatory dynamics of an alveolar sac (AS) with the lung alveolar spatial model (LASM), a 3D spatial biomechanical representation of the AS and its interaction with airflow pressure and the surface tension effects of pulmonary surfactant. We use the LASM to identify the mechanical ramifications of alveolar dynamics associated with ARDS. Using graphical processing unit parallel algorithms, we perform Bayesian inference on the model parameters using experimental data from rat lung under control and Tween-induced ARDS conditions. Our results provide two plausible models that recapitulate two fundamental hypotheses about volume change at the alveolar level: (1) increase in alveolar size through isotropic volume change, or (2) minimal change in AS radius with primary expansion of the mouth of the AS, with the implication that the majority of change in lung volume during the respiratory cycle occurs in the

  3. Bayesian inference of the lung alveolar spatial model for the identification of alveolar mechanics associated with acute respiratory distress syndrome

    International Nuclear Information System (INIS)

    Acute respiratory distress syndrome (ARDS) is acute lung failure secondary to severe systemic inflammation, resulting in a derangement of alveolar mechanics (i.e. the dynamic change in alveolar size and shape during tidal ventilation), leading to alveolar instability that can cause further damage to the pulmonary parenchyma. Mechanical ventilation is a mainstay in the treatment of ARDS, but may induce mechano-physical stresses on unstable alveoli, which can paradoxically propagate the cellular and molecular processes exacerbating ARDS pathology. This phenomenon is called ventilator induced lung injury (VILI), and plays a significant role in morbidity and mortality associated with ARDS. In order to identify optimal ventilation strategies to limit VILI and treat ARDS, it is necessary to understand the complex interplay between biological and physical mechanisms of VILI, first at the alveolar level, and then in aggregate at the whole-lung level. Since there is no current consensus about the underlying dynamics of alveolar mechanics, as an initial step we investigate the ventilatory dynamics of an alveolar sac (AS) with the lung alveolar spatial model (LASM), a 3D spatial biomechanical representation of the AS and its interaction with airflow pressure and the surface tension effects of pulmonary surfactant. We use the LASM to identify the mechanical ramifications of alveolar dynamics associated with ARDS. Using graphical processing unit parallel algorithms, we perform Bayesian inference on the model parameters using experimental data from rat lung under control and Tween-induced ARDS conditions. Our results provide two plausible models that recapitulate two fundamental hypotheses about volume change at the alveolar level: (1) increase in alveolar size through isotropic volume change, or (2) minimal change in AS radius with primary expansion of the mouth of the AS, with the implication that the majority of change in lung volume during the respiratory cycle occurs in the

  4. Cell type specificity of female lung cancer associated with sulfur dioxide from air pollutants in Taiwan: An ecological study

    Directory of Open Access Journals (Sweden)

    Tseng Ching-Yu

    2012-01-01

    Full Text Available Abstract Background Many studies have examined the association between air pollutants (including sulfur dioxide [SO2], carbon monoxide [CO], nitrogen dioxide [NO2], nitric oxide [NO], ozone [O3], and particulate matter 10] and lung cancer. However, data from previous studies on pathological cell types were limited, especially for SO2 exposure. We aimed to explore the association between SO2 exposure from outdoor air pollutants and female lung cancer incidence by cell type specificity. Methods We conducted an ecological study and calculated annual average concentration of 6 air pollutants (SO2, CO, NO2, NO, O3, and PM10 using data from Taiwan Environmental Protection Administration air quality monitoring stations. The Poisson regression models were used to evaluate the association between SO2 and age-standardized incidence rate of female lung cancer by two major pathological types (adenocarcinoma [AC] and squamous cell carcinoma [SCC]. In order to understand whether there is a dose-response relationship between SO2 and two major pathological types, we analyzed 4 levels of exposure based on quartiles of concentration of SO2. Results The Poisson regression results showed that with the first quartile of SO2 concentration as the baseline, the relative risks for AC/SCC type cancer among females were 1.20 (95% confidence interval [CI], 1.04-1.37/1.39 (95% CI, 0.96-2.01 for the second, 1.22 (95% CI, 1.04-1.43/1.58 (95% CI, 1.06-2.37 for the third, and 1.27 (95% CI, 1.06-1.52/1.80 (95% CI, 1.15-2.84 for the fourth quartile of SO2 concentration. The tests for trend were statistically significant for both AC and SCC at P = 0.0272 and 0.0145, respectively. Conclusion The current study suggests that SO2 exposure as an air pollutant may increase female lung cancer incidence and the associations with female lung cancer is much stronger for SCC than for AC. The findings of this study warrant further investigation on the role of SO2 in the etiology of SCC.

  5. The dose–response association of urinary metals with altered pulmonary function and risks of restrictive and obstructive lung diseases: a population-based study in China

    OpenAIRE

    Feng, Wei; Huang, Xiji; Zhang, Ce; Liu, Chuanyao; Cui, Xiuqing; Zhou, Yun; Sun, Huizhen; Qiu, Gaokun; Guo, Huan; He, Meian; Zhang, Xiaomin; Yuan, Jing; Chen, Weihong; WU, TANGCHUN

    2015-01-01

    Objective Reduced pulmonary function is an important predictor of environment-related pulmonary diseases; however, evidence of an association between exposures to various metals from all possible routes and altered pulmonary function is limited. We aimed to investigate the association of various metals in urine with pulmonary function, restrictive lung disease (RLD) and obstructive lung disease (OLD) risks in the general Chinese population. Design A cross-sectional investigation in the Wuhan ...

  6. Genetic Variation in BCL2 3′-UTR Was Associated with Lung Cancer Risk and Prognosis in Male Chinese Population

    OpenAIRE

    Xu, Ping; Liu, Li; Wang, Jianzhong; Zhang, Kai; Hong, Xiaohua; Deng, Qifei; Xiang, Jingjun; Zhang, Xiaomin; He, Meian; WU, TANGCHUN; Guo, Huan

    2013-01-01

    Objectives Bcl-2 is a critical apoptosis inhibitor with established carcinogenic potential, and can confer cancer cell resistance to therapeutic treatments by activating anti-apoptotic cellular defense. We hypothesized that genetic variants of BCL2 gene may be associated with lung cancer susceptibility and prognosis. Methods Three selected tagSNPs of BCL2 (rs2279115, rs1801018, and rs1564483) were genotyped in 1017 paired male Chinese lung cancer cases and controls by TaqMan assay. The associ...

  7. Is progression-free survival associated with a better health-related quality of life in patients with lung cancer? Evidence from two randomised trials with afatinib

    OpenAIRE

    Griebsch, Ingolf; Palmer, Michael; Fayers, Peter; Ellis, Stuart

    2014-01-01

    Objective: Progression-free survival (PFS) is frequently used as an efficacy end point in oncology clinical trials. However, there is limited evidence to support a positive association between improvement in PFS and improvement in health-related quality of life (HRQoL). The association between PFS and HRQoL was evaluated in two randomised trials. Materials and methods: Data from two randomised controlled trials in patients with non-small cell lung cancer (NSCLC; LUX-Lung 1 and LUX-Lung ...

  8. Down-Regulation of SIX3 is Associated with Clinical Outcome in Lung Adenocarcinoma

    OpenAIRE

    Min-Li Mo; Junichi Okamoto; Zhao Chen; Tomomi Hirata; Iwao Mikami; Geneviève Bosco-Clément; Hui Li; Hai-Meng Zhou; Jablons, David M; Biao He

    2013-01-01

    BACKGROUND: Lung cancer is a common cancer and the leading cause of cancer-related death worldwide. SIX3 is a human homologue of the highly conserved sine oculis gene family essential during embryonic development in vertebrates, and encodes a homeo-domain containing transcription factor. Little is known about the role of SIX3 in human tumorigenesis. This study is to assess the expression/function of SIX3 and the significance of SIX3 as a prognostic biomarker in lung adenocarcinoma. METHODS: Q...

  9. A genome-wide association study of serum uric acid in African Americans

    Directory of Open Access Journals (Sweden)

    Gerry Norman P

    2011-02-01

    Full Text Available Abstract Background Uric acid is the primary byproduct of purine metabolism. Hyperuricemia is associated with body mass index (BMI, sex, and multiple complex diseases including gout, hypertension (HTN, renal disease, and type 2 diabetes (T2D. Multiple genome-wide association studies (GWAS in individuals of European ancestry (EA have reported associations between serum uric acid levels (SUAL and specific genomic loci. The purposes of this study were: 1 to replicate major signals reported in EA populations; and 2 to use the weak LD pattern in African ancestry population to better localize (fine-map reported loci and 3 to explore the identification of novel findings cognizant of the moderate sample size. Methods African American (AA participants (n = 1,017 from the Howard University Family Study were included in this study. Genotyping was performed using the Affymetrix® Genome-wide Human SNP Array 6.0. Imputation was performed using MACH and the HapMap reference panels for CEU and YRI. A total of 2,400,542 single nucleotide polymorphisms (SNPs were assessed for association with serum uric acid under the additive genetic model with adjustment for age, sex, BMI, glomerular filtration rate, HTN, T2D, and the top two principal components identified in the assessment of admixture and population stratification. Results Four variants in the gene SLC2A9 achieved genome-wide significance for association with SUAL (p-values ranging from 8.88 × 10-9 to 1.38 × 10-9. Fine-mapping of the SLC2A9 signals identified a 263 kb interval of linkage disequilibrium in the HapMap CEU sample. This interval was reduced to 37 kb in our AA and the HapMap YRI samples. Conclusions The most strongly associated locus for SUAL in EA populations was also the most strongly associated locus in this AA sample. This finding provides evidence for the role of SLC2A9 in uric acid metabolism across human populations. Additionally, our findings demonstrate the utility of following-up EA

  10. Association between polymorphisms in DNA repair genes and survival of non-smoking female patients with lung adenocarcinoma

    International Nuclear Information System (INIS)

    Excision repair cross-complementing group 1 (ERCC1) and group 2 (ERCC2), and X-ray repair cross-complementing group 1 (XRCC1) proteins play important roles in the repair of DNA damage and adducts. Single nucleotide polymorphisms (SNPs) of DNA repair genes are suspected to influence treatment effect and survival of cancer patients. This study aimed to investigate the relationship between polymorphisms in ERCC2, ERCC1 and XRCC1 genes and survival of non-smoking female patients with lung adenocarcinoma. We used polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to evaluate SNPs in ERCC2, ERCC1 and XRCC1 genes among 257 patients. The overall median survival time (MST) was 13.07 months. Increasing numbers of either ERCC1 118 or XRCC1 399 variant alleles were associated with shorter survival of non-smoking female lung adenocarcinoma patients (Log-rank P < 0.001). The adjusted hazard ratios (HRs) for individuals with CT or TT genotype at ERCC1 Asn118Asn were 1.48 and 2.67 compared with those with CC genotype. For polymorphism of XRCC1 399, the HRs were 1.28 and 2.68 for GA and AA genotype. When variant alleles across both polymorphisms were combined to analysis, the increasing number of variant alleles was associated with decreasing overall survival. Using the stepwise Cox regression analysis, we found that the polymorphisms in ERCC1 and XRCC1, tumor stage and chemotherapy or radiotherapy status independently predicted overall survival of non-smoking female patients with lung adenocarcinoma. Genetic polymorphisms in ERCC1 and XRCC1 genes might be prognostic factors in non-smoking female patients with lung adenocarcinoma

  11. Human mesenchymal stromal cells reduce influenza A H5N1-associated acute lung injury in vitro and in vivo.

    Science.gov (United States)

    Chan, Michael C W; Kuok, Denise I T; Leung, Connie Y H; Hui, Kenrie P Y; Valkenburg, Sophie A; Lau, Eric H Y; Nicholls, John M; Fang, Xiaohui; Guan, Yi; Lee, Jae W; Chan, Renee W Y; Webster, Robert G; Matthay, Michael A; Peiris, J S Malik

    2016-03-29

    Influenza can cause acute lung injury. Because immune responses often play a role, antivirals may not ensure a successful outcome. To identify pathogenic mechanisms and potential adjunctive therapeutic options, we compared the extent to which avian influenza A/H5N1 virus and seasonal influenza A/H1N1 virus impair alveolar fluid clearance and protein permeability in an in vitro model of acute lung injury, defined the role of virus-induced soluble mediators in these injury effects, and demonstrated that the effects are prevented or reduced by bone marrow-derived multipotent mesenchymal stromal cells. We verified the in vivo relevance of these findings in mice experimentally infected with influenza A/H5N1. We found that, in vitro, the alveolar epithelium's protein permeability and fluid clearance were dysregulated by soluble immune mediators released upon infection with avian (A/Hong Kong/483/97, H5N1) but not seasonal (A/Hong Kong/54/98, H1N1) influenza virus. The reduced alveolar fluid transport associated with down-regulation of sodium and chloride transporters was prevented or reduced by coculture with mesenchymal stromal cells. In vivo, treatment of aged H5N1-infected mice with mesenchymal stromal cells increased their likelihood of survival. We conclude that mesenchymal stromal cells significantly reduce the impairment of alveolar fluid clearance induced by A/H5N1 infection in vitro and prevent or reduce A/H5N1-associated acute lung injury in vivo. This potential adjunctive therapy for severe influenza-induced lung disease warrants rapid clinical investigation. PMID:26976597

  12. Counselor Education Student Perceptions of the American Counseling Association Ethical Code as It Pertains to the Use of Facebook

    Science.gov (United States)

    Babb, Tanner A.

    2012-01-01

    Student use of online social networks has increased exponentially in the past five years. Facebook is one of the largest and most utilized by students. Many counseling students use Facebook on a regular basis to keep in touch with friends, family, and acquaintances. (Lenhart & Madden, 2007). Current American Counseling Association (ACA)…

  13. Teaching the Principles of Economics: Reconciling the Canon of the American Economics Association to Catholic Social Thought

    Science.gov (United States)

    Meador, Douglas

    2013-01-01

    The American Economics Association, through its Committee on Economic Education, has worked since 1950 to develop a set of standards for what is taught in introductory economics courses. The result is the Test for Understanding in College Economics. The TUCE has come to define a canon of expectations for students in college business schools. Some…

  14. Molecular phylogeny, diversity and bioprospecting of endophytic fungi associated with wild ethnomedicinal North American plant Echinacea purpurea (Asteraceae)

    Science.gov (United States)

    The endophytic fungal community associated with the wild ethnomedicinal North American plant Echinacea purpurea was investigated as well as its potential for providing antifungal compounds against plant pathogenic fungi. A total of 233 endophytic fungal isolates were obtained and classified into 42 ...

  15. School Public Relations and the Principalship: An Interview with Mark Bielang, President of American Association of School Administrators

    Science.gov (United States)

    Johnson, Paul

    2011-01-01

    From returning phone calls to traversing the political landscape to building trust, American Association of School Administrators (AASA) president Mark Bielang covers a lot of territory as he describes the public relations challenges confronting today's school administrators. Having just concluded his term as AASA president, Mr. Bielang has served…

  16. PROTECTING CHILDREN FROM ENVIRONMENTAL THREATS - A CONTINUING EDUCATION PROGRAM FOR NURSES OF THE AMERICAN NURSES FOUNDATION/ASSOCIATION

    Science.gov (United States)

    The American Nurses Association/Foundation will develop online, in print and pre conference continuing education (CE) children's environmental health protection programs to meet the objective of the program. The first CE program is on school environments, the second on home and ...

  17. American Bar Association Supplementary Guidelines for the Mitigation Function of Defense Teams in Death Penalty Cases: Implications for Social Work

    Science.gov (United States)

    Andrews, Arlene Bowers

    2012-01-01

    When a client faces a penalty of death, defense attorneys may call on social workers in many capacities: mitigation specialist, expert witness, consulting specialist, direct witness, or defense-initiated victim outreach worker. The American Bar Association set forth standards for capital defense attorneys, which led an interdisciplinary team to…

  18. Political Ideology and Its Relationship to Perceptions of Social Justice Advocacy among Members of the American Counseling Association (ACA)

    Science.gov (United States)

    Steele, Janee Marie

    2010-01-01

    Social justice has become an increasingly controversial topic among members of the American Counseling Association (ACA). Specifically, concerns have been raised over what is perceived to be: (a) the liberal political agenda of social justice advocates, (b) the marginalization of conservative counselors, and (c) the inappropriate use of ACA…

  19. Advancing Multicultural and Diversity Competence in Art Therapy: American Art Therapy Association Multicultural Committee 1990-2015

    Science.gov (United States)

    Potash, Jordan S.; Doby-Copeland, Cheryl; Stepney, Stella A.; Washington, Brittney N.; Vance, Lindsey D.; Short, Gwendolyn M.; Boston, Charlotte G.; Ballbé ter Maat, Mercedes

    2015-01-01

    For 25 years the Multicultural Committee of the American Art Therapy Association has provided education, networking, and mentoring activities for all art therapists, as well as support for art therapists of color. The formation of the committee demonstrates increasing cultural competence within the profession, and its continuation promises future…

  20. Daily Stress and Emotional Well-Being among Asian American Adolescents: Same-Day, Lagged, and Chronic Associations

    Science.gov (United States)

    Kiang, Lisa; Buchanan, Christy M.

    2014-01-01

    Daily-diary data from 180 Asian American 9th-10th graders (58% female, 75% second generation; "M" age = 14.97 years) were used to investigate how family, school, and peer stress are each associated with same-day and next-day (lagged) well-being, and vice versa. Hierarchical linear modeling provided support for reciprocal links when…