WorldWideScience

Sample records for american lung association

  1. American Lung Association

    Science.gov (United States)

    ... level] Creates the extension's prototype that in turn inherits Featherlight's prototype. Could be used to extend an ... in My Community Advocate Lung Diseases Lung Diseases > Asthma Lung Diseases > COPD Lung Diseases > Lung Cancer Lung ...

  2. American Lung Association's radon public information program

    International Nuclear Information System (INIS)

    The American Lung Association (ALA), the nation's oldest voluntary health organization, is dedicated to the conquest of lung disease and the promotion of lung health. The objective of the ALA Radon Public Information Program is to reduce public exposure to elevated indoor radon levels through implementing grassroots-based radon public awareness campaigns by 22 local ALA groups. The program, which is funded by a grant from the US Environmental Protection Agency (EPA), was initiated in December 1989; the first phase will continue until May, 1991. Activities of local Lung Associations include distribution of free or reduced-cost radon kits; presenting programs in elementary and secondary schools; presenting information on TV news series and talk shows, and on radio Public Service Announcements and talk shows; presenting articles and feature stories in the print media; holding conferences, workshops, and displays at fairs and other exhibitions; distributing radon fact sheets through libraries and utility company mailings; and distributing videos through video chains and libraries. The local Lung Associations also serve as promoters for the EPA/Advertising Council Radon Public Service Announcement Campaign. We will highlight the activities of the groups in communicating radon health risks to the public; we will describe the results obtained and will attempt to evaluate the merits of the various approaches on the basis of the initial results

  3. Comparative Evaluation of American Cancer Society and American Lung Association Smoking Cessation Clinics.

    Science.gov (United States)

    Lando, Harry A.; And Others

    1990-01-01

    Compared the effectiveness of the American Cancer Society's "FreshStart," the American Lung Association's "Freedom from Smoking," and a laboratory smoking cessation clinic. A one-year followup favored the more intensive laboratory and "Freedom from Smoking" clinics over the "FreshStart" method. (FMW)

  4. Adolescents' perceptions about smoking prevention strategies: a comparison of the programmes of the American Lung Association and the Tobacco Institute

    OpenAIRE

    DeBon, M.; Klesges, R. C.

    1996-01-01

    OBJECTIVE: To evaluate components of the teenage smoking prevention programmes of the American Lung Association (ALA) and the Tobacco Institute (TI). DESIGN: Group administration of written questionnaires in school. The components of the ALA's and TI's programmes were presented to students in seven strategy vignettes, covering the following topics: peer pressure/enhanced communication; parents as role models; health consequences of smoking; cost of smoking; smoking as an illegal act; ti...

  5. American College Health Association

    Science.gov (United States)

    ... Dollars at Work Recognizing Donors Find us on social media! Home Contact Us Marketplace Cart Copyright © 2016 American College Health Association | Privacy and Usage Policies | Spokesperson and ...

  6. American Sleep Association

    Science.gov (United States)

    ... Public Health Professionals Join ASA Press Room American Sleep Association Improving public health by increasing awareness about ... Members Username or Email Password Remember Me Register Sleep Blog Let’s Teach Our Children About Sleep How ...

  7. American Association of Orthodontists

    Science.gov (United States)

    ... step for patients wishing to resolve issues of crowding, misalignment and the burden of feeling self-conscious ... The American Association of Orthodontists does not provide funding for orthodontic treatment. There are several programs that ...

  8. American Music Therapy Association

    Science.gov (United States)

    American Music Therapy Association Home Contact News Help/FAQ Members Only Login Quick Links Facts About Music Therapy Qualifications ... with AMTA Sponsor AMTA Events Social Networking Support Music Therapy When you shop at AmazonSmile, Amazon will ...

  9. American Tinnitus Association

    Science.gov (United States)

    American Tinnitus Association Donate Become A Member Member Login Find A Provider Search form Search Menu Close Understanding The Facts Managing Your Tinnitus Research Toward A Cure About Us Initiatives News & ...

  10. International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society International Multidisciplinary Classification of Lung Adenocarcinoma

    OpenAIRE

    Travis, William,; Brambilla, Elisabeth; Noguchi, Masayuki; Nicholson, Andrew; Geisinger, Kim,; Yatabe, Yasushi; Beer, David; Powell, Charles; Riely, Gregory; Van Schil, Paul; Garg, Kavita; Austin, John; Asamura, Hisao; Rusch, Valerie; Hirsch, Fred,

    2011-01-01

    International audience This new classification strategy is based on a multidisciplinary approach to diagnosis of lung adenocarcinoma that incorporates clinical, molecular, radiologic, and surgical issues, but it is primarily based on histology. This classification is intended to support clinical practice, and research investigation and clinical trials. As EGFR mutation is a validated predictive marker for response and progression-free survival with EGFR tyrosine kinase inhibitors in advanc...

  11. Opportunities to address lung cancer disparities among African Americans

    OpenAIRE

    Coughlin, Steven S.; Matthews-Juarez, Patricia; Juarez, Paul D.; Melton, Courtnee E; King, Mario

    2014-01-01

    Race and socioeconomic status are well known to influence lung cancer incidence and mortality patterns in the U.S. Lung cancer incidence and mortality rates are higher among blacks than whites. In this article we review opportunities to address disparities in lung cancer incidence, mortality, and survivorship among African Americans. First, we summarize recent advances in the early detection and treatment of lung cancer. Then we consider black-white disparities in lung cancer treatment includ...

  12. Case-control assessment of diet and lung cancer risk in African Americans and Mexican Americans.

    Science.gov (United States)

    Pillow, P C; Hursting, S D; Duphorne, C M; Jiang, H; Honn, S E; Chang, S; Spitz, M R

    1997-01-01

    In this case-control study we determined whether dietary differences underlie some of the ethnic and sex differences in US lung cancer rates. We examined the relationship between diet and lung cancer development in 137 lung cancer cases (93 African Americans and 44 Mexican Americans) and 187 controls (78 African Americans and 109 Mexican Americans). Cases reported a higher daily mean total fat intake (p fruits (p = 0.02). Ethnic differences in diet were also observed: Mexican Americans consumed less total fat (p fruits (p lung cancer risk (p fruit consumption and lung cancer risk (p = 0.05). In conclusion, our findings support the hypothesis that diet, particularly high fat consumption and low fruit and vegetable consumption, contributes (independent of cigarette smoking) to the excess lung cancer risk in African-American men, who have the highest lung cancer rates in the United States.

  13. Gene by Environment Investigation of Incident Lung Cancer Risk in African-Americans

    Directory of Open Access Journals (Sweden)

    Sean P. David

    2016-02-01

    Interpretation: These results suggest that chromosome 15q25.1 variants are robustly associated with CPD and lung cancer in African-Americans and that the allelic dose effect of these polymorphisms on lung cancer risk is most pronounced in lighter smokers.

  14. Lung disease - resources

    Science.gov (United States)

    Resources - lung disease ... The following organizations are good resources for information on lung disease : American Lung Association -- www.lung.org National Heart, Lung, and Blood Institute -- www.nhlbi.nih.gov ...

  15. American Heart Association

    Science.gov (United States)

    ... American Heart area Search by State SELECT YOUR LANGUAGE Español (Spanish) 简体中文 (Traditional Chinese) 繁体中文 (Simplified Chinese) Tiếng Việt (Vietnamese) Healthy Living Conditions Caregiver ...

  16. American Diabetes Association

    Science.gov (United States)

    ... 2383) Give by Mail Close November is American Diabetes Month® Share your personal diabetes story and show ... Next » « Previous Our Mission: To prevent and cure diabetes and to improve the lives of all people ...

  17. American Association for Geriatric Psychiatry

    Science.gov (United States)

    ... in your area. Read more » AAGP Journal Official Journal of the American Association for Geriatric Psychiatry. Read more ... RESEARCHERS GMHF Scholars Since my program is so small and there is not much interest among my ...

  18. American Association Of State Climatologists

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Records documenting the business, membership, and meetings of the American Association of State Climatologists, from 1976-92. Material donated in 2008 by the estate...

  19. American Hospital Association

    Science.gov (United States)

    About AHA AHA Engaged Vision & Mission Organization Membership Careers Member Center The Value of Membership Constituency Sections Personal Membership Groups Associate Membership Regional Executives State Issues ...

  20. Radiation Therapy for Lung Cancer

    Science.gov (United States)

    ... are available to help. HELPFUL WEB SITES ON LUNG CANCER American Lung Association www.lung.org Lungcancer.org www.lungcancer.org Lung Cancer Alliance www.lungcanceralliance.org Lung Cancer Online www. ...

  1. Genetic ancestry-smoking interactions and lung function in African Americans: a cohort study.

    Directory of Open Access Journals (Sweden)

    Melinda C Aldrich

    Full Text Available BACKGROUND: Smoking tobacco reduces lung function. African Americans have both lower lung function and decreased metabolism of tobacco smoke compared to European Americans. African ancestry is also associated with lower pulmonary function in African Americans. We aimed to determine whether African ancestry modifies the association between smoking and lung function and its rate of decline in African Americans. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated a prospective ongoing cohort of 1,281 African Americans participating in the Health, Aging, and Body Composition (Health ABC Study initiated in 1997. We also examined an ongoing prospective cohort initiated in 1985 of 1,223 African Americans in the Coronary Artery Disease in Young Adults (CARDIA Study. Pulmonary function and tobacco smoking exposure were measured at baseline and repeatedly over the follow-up period. Individual genetic ancestry proportions were estimated using ancestry informative markers selected to distinguish European and West African ancestry. African Americans with a high proportion of African ancestry had lower baseline forced expiratory volume in one second (FEV₁ per pack-year of smoking (-5.7 ml FEV₁/ smoking pack-year compared with smokers with lower African ancestry (-4.6 ml in FEV₁/ smoking pack-year (interaction P value  = 0.17. Longitudinal analyses revealed a suggestive interaction between smoking, and African ancestry on the rate of FEV(1 decline in Health ABC and independently replicated in CARDIA. CONCLUSIONS/SIGNIFICANCE: African American individuals with a high proportion of African ancestry are at greater risk for losing lung function while smoking.

  2. American Association for Marriage and Family Therapy

    Science.gov (United States)

    ... My Account Find Members Benefits American Association for Marriage and Family Therapy 112 South Alfred Street Alexandria, ... Fax: (703) 838-9805 © 2002 - American Association for Marriage and Family Therapy Terms of Use | Privacy Policy | ...

  3. [Interstitial lung diseases associated with smoking].

    Science.gov (United States)

    Nová, Markéta; Hornychová, Helena; Matěj, Radoslav

    2016-01-01

    There are many different interstitial lung diseases associated with smoking. This short review describes officially recognized disorders (desquamative interstitial pneumonia, respiratory bronchiolitis and pulmonary Langerhans´cells histiocytosis) and entities with uncertain relationship to smoking, which have recently been published in the literature. Histopathological pictures and differential diagnosis of smoking-related diseases of the lungs are discussed. PMID:27223588

  4. Genetic variants associated with lung function

    DEFF Research Database (Denmark)

    Thyagarajan, Bharat; Wojczynski, Mary; Minster, Ryan L;

    2014-01-01

    BACKGROUND: Reduced forced expiratory volume in 1 second (FEV1) and the ratio of FEV1 to forced vital capacity (FVC) are strong predictors of mortality and lung function is higher among individuals with exceptional longevity. However, genetic factors associated with lung function in individuals...... with exceptional longevity have not been identified. METHOD: We conducted a genome wide association study (GWAS) to identify novel genetic variants associated with lung function in the Long Life Family Study (LLFS) (n = 3,899). Replication was performed using data from the CHARGE/SpiroMeta consortia...

  5. Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans.

    Science.gov (United States)

    Hansen, Helen M; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M; Wrensch, Margaret R; Sison, Jennette D; Chang, Jeffery S; Smirnov, Ivan V; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P; Kelsey, Karl T; Wiencke, John K

    2010-09-15

    Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10(-20)). In order to narrow the region of association and identify potential causal variations, we performed a fine-mapping study using 77 SNPs in a 194 kb segment of the 15q25.1 region in a sample of 448 African-American lung cancer cases and 611 controls. Four regions, two SNPs and two distinct haplotypes from sliding window analyses, were associated with lung cancer. CHRNA5 rs17486278 G had OR = 1.28, 95% CI 1.07-1.54 and P = 0.008, whereas CHRNB4 rs7178270 G had OR = 0.78, 95% CI 0.66-0.94 and P = 0.008 for lung cancer risk. Lung cancer associations remained significant after pack-year adjustment. Rs7178270 decreased lung cancer risk in women but not in men; gender interaction P = 0.009. For two SNPs (rs7168796 A/G and rs7164594 A/G) upstream of PSMA4, lung cancer risks for people with haplotypes GG and AA were reduced compared with those with AG (OR = 0.56, 95% CI 0.38-0.82; P = 0.003 and OR = 0.73, 95% CI 0.59-0.90, P = 0.004, respectively). A four-SNP haplotype spanning CHRNA5 (rs11637635 C, rs17408276 T, rs16969968 G) and CHRNA3 (rs578776 G) was associated with increased lung cancer risk (P = 0.002). The identified regions contain SNPs predicted to affect gene regulation. There are multiple lung cancer risk loci in the 15q25.1 region in African-Americans. PMID:20587604

  6. Nucleotide excision repair genes and risk of lung cancer among San Francisco bay area Latinos and African Americans

    Science.gov (United States)

    Chang, Jeffrey S.; Wrensch, Margaret R.; Hansen, Helen M.; Sison, Jennette D.; Aldrich, Melinda C.; Quesenberry, Charles P.; Seldin, Michael F.; Kelsey, Karl T.; Kittles, Rick A.; Silva, Gabriel; Wiencke, John K.

    2009-01-01

    Few studies on the association between nucleotide excision repair (NER) variants and lung cancer risk have included Latinos and African Americans. We examine variants in six NER genes (ERCC2, ERCC4, ERCC5, LIG1, RAD23B and XPC) in association with primary lung cancer risk among 113 Latino and 255 African American subjects newly diagnosed with primary lung cancer from 1998 to 2003 in the San Francisco Bay Area, and 579 healthy controls (299 Latinos and 280 African Americans). Individual single nucleotide polymorphism and haplotype analyses, multifactor dimensionality reduction, and principal components analysis were performed to assess the association between six genes in the NER pathway and lung cancer risk. Among Latinos, ERCC2 haplotype CGA (rs238406, rs11878644, rs6966) was associated with reduced lung cancer risk [odds ratio (OR) of 0.65 and 95% confidence interval (CI): 0.44-0.97], especially among non-smokers (OR=0.29; 95% CI: 0.12-0.67). From multifactor dimensionality reduction analysis, in Latinos, smoking and three SNPs (ERCC2 rs171140, ERCC5 rs17655, and LIG1 rs20581) together had a prediction accuracy of 67.4% (p=0.001) for lung cancer. Among African Americans, His/His genotype of ERCC5 His1104Asp (rs17655) was associated with increased lung cancer risk (OR=1.78; 95% CI: 1.09-2.91), and LIG1 haplotype GGGAA (rs20581, rs156641, rs3730931, rs20579, and rs439132) was associated with reduced lung cancer risk (OR=0.61; 95% CI: 0.42-0.88). Our study suggests different elements of the NER pathway may be important in the different ethnic groups resulting either from different linkage relationship, genetic backgrounds, and/or exposure histories. PMID:18709642

  7. Harmonizing the metabolic syndrome: a joint interim statement of the International Diabetes Federation Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute; American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity.

    Science.gov (United States)

    Alberti, K G M M; Eckel, Robert H; Grundy, Scott M; Zimmet, Paul Z; Cleeman, James I; Donato, Karen A; Fruchart, Jean-Charles; James, W Philip T; Loria, Catherine M; Smith, Sidney C

    2009-10-20

    A cluster of risk factors for cardiovascular disease and type 2 diabetes mellitus, which occur together more often than by chance alone, have become known as the metabolic syndrome. The risk factors include raised blood pressure, dyslipidemia (raised triglycerides and lowered high-density lipoprotein cholesterol), raised fasting glucose, and central obesity. Various diagnostic criteria have been proposed by different organizations over the past decade. Most recently, these have come from the International Diabetes Federation and the American Heart Association/National Heart, Lung, and Blood Institute. The main difference concerns the measure for central obesity, with this being an obligatory component in the International Diabetes Federation definition, lower than in the American Heart Association/National Heart, Lung, and Blood Institute criteria, and ethnic specific. The present article represents the outcome of a meeting between several major organizations in an attempt to unify criteria. It was agreed that there should not be an obligatory component, but that waist measurement would continue to be a useful preliminary screening tool. Three abnormal findings out of 5 would qualify a person for the metabolic syndrome. A single set of cut points would be used for all components except waist circumference, for which further work is required. In the interim, national or regional cut points for waist circumference can be used. PMID:19805654

  8. American Association of Occupational Health Nurses

    Science.gov (United States)

    ... Vision & Mission Board of Directors Fellows What is Occupational Health Nursing Public/Legislative Affairs AAOHN Alliances AAOHN Affiliates AAOHN ... Total Worker Health ® Agenda The American Association of Occupational ... nursing education by the American Nurses Credentialing Center’s Commission ...

  9. Noncompaction cardiomyopathy associated with hypogenetic lung

    Institute of Scientific and Technical Information of China (English)

    WU Chang-yan; ZHAO Jing; JIANG Teng-yong; HUANG Xiao-yong

    2007-01-01

    @@ Noncompaction of the ventricular myocardium is a rare form of congenital cardiomyopathy with a high incidence of cardiovascular complications. It frequently manifests in an isolated form, namely isolated noncompaction of the ventricular myocardium. Not only does noncompaction of the ventricular myocardium associate with other congenital cardiac malformations, but also with other neuromuscular disorders. The purpose of this study was to explore the correlation of hypogenetic lung with myocardial noncompaction in terms of the clinical course of one of our patients.

  10. American Evaluation Association Guiding Principles for Evaluators

    Energy Technology Data Exchange (ETDEWEB)

    None

    2009-01-18

    Five principles developed by American Evaluation Associ intended to guide professional practice of evaluators & to inform evaluation clients and the general public about principles they can expect to be upheld by professional evaluators.

  11. American Association of Critical-Care Nurses

    Science.gov (United States)

    ... of Certification APRN Resources Education State-of-the-art educational programs provide evidence- based knowledge, directly applicable to practice ... Policy Disclaimer © American Association of Critical-Care Nurses Learn ...

  12. American Speech-Language-Hearing Association

    Science.gov (United States)

    ... Practice Management Research American Speech-Language-Hearing Association (ASHA) Making effective communication, a human right, accessible and ... for focused information and more. Join a SIG ASHA Corporate Partners Become A Corporate Partner Policies  About ...

  13. American Association of Colleges of Nursing

    Science.gov (United States)

    ... Interprofessional Education Public Health Nursing QSEN Module Series NURSING SHORTAGE RESOURCES About the Nursing Shortage I mpact ... Social Media Communities American Association of Colleges of Nursing One Dupont Circle, NW Suite 530 Washington, DC ...

  14. American Evaluation Association: Guiding Principles for Evaluators

    Science.gov (United States)

    American Journal of Evaluation, 2009

    2009-01-01

    The American Evaluation Association (AEA) strives to promote ethical practice in the evaluation of programs, products, personnel, and policy. This article presents the list of principles which AEA developed to guide evaluators in their professional practice. These principles are: (1) Systematic Inquiry; (2) Competence; (3) Integrity/Honesty; (4)…

  15. American Telemedicine Association: 2014 Fall Forum

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2014-09-01

    Full Text Available The American Telemedicine Association (ATA will host its annual Fall Forum in Palm Desert, California, Sept. 6-9, 2014. In addition to two full days of programs related to managing and improving chronic conditions, ATA will host a full-day American-Chinese Telemedicine Forum on Sunday, Sept. 7, 2014. The forum, co-sponsored by the American International Telemedicine Council, will deliver the tools and information that are essential to building a successful telemedicine business abroad. Attendees will learn about the existing clinical and business landscape oftelemedicine in China, and how to establish key partnerships to help their respective health system, or business, grow in the international market.

  16. Joint effects of smoking and sedentary lifestyle on lung function in African Americans: the Jackson Heart Study cohort.

    Science.gov (United States)

    Campbell Jenkins, Brenda W; Sarpong, Daniel F; Addison, Clifton; White, Monique S; Hickson, Demarc A; White, Wendy; Burchfiel, Cecil

    2014-02-01

    This study examined: (a) differences in lung function between current and non current smokers who had sedentary lifestyles and non sedentary lifestyles and (b) the mediating effect of sedentary lifestyle on the association between smoking and lung function in African Americans. Sedentary lifestyle was defined as the lowest quartile of the total physical activity score. The results of linear and logistic regression analyses revealed that non smokers with non sedentary lifestyles had the highest level of lung function, and smokers with sedentary lifestyles had the lowest level. The female non-smokers with sedentary lifestyles had a significantly higher FEV1% predicted and FVC% predicted than smokers with non sedentary lifestyles (93.3% vs. 88.6%; p = 0.0102 and 92.1% vs. 86.9%; p = 0.0055 respectively). FEV1/FVC ratio for men was higher in non smokers with sedentary lifestyles than in smokers with non sedentary lifestyles (80.9 vs. 78.1; p = 0.0048). Though smoking is inversely associated with lung function, it seems to have a more deleterious effect than sedentary lifestyle on lung function. Physically active smokers had higher lung function than their non physically active counterparts. PMID:24477212

  17. Joint Effects of Smoking and Sedentary Lifestyle on Lung Function in African Americans: The Jackson Heart Study Cohort

    Directory of Open Access Journals (Sweden)

    Brenda W. Campbell Jenkins

    2014-01-01

    Full Text Available This study examined: (a differences in lung function between current and non current smokers who had sedentary lifestyles and non sedentary lifestyles and (b the mediating effect of sedentary lifestyle on the association between smoking and lung function in African Americans. Sedentary lifestyle was defined as the lowest quartile of the total physical activity score. The results of linear and logistic regression analyses revealed that non smokers with non sedentary lifestyles had the highest level of lung function, and smokers with sedentary lifestyles had the lowest level. The female non-smokers with sedentary lifestyles had a significantly higher FEV1% predicted and FVC% predicted than smokers with non sedentary lifestyles (93.3% vs. 88.6%; p = 0.0102 and 92.1% vs. 86.9%; p = 0.0055 respectively. FEV1/FVC ratio for men was higher in non smokers with sedentary lifestyles than in smokers with non sedentary lifestyles (80.9 vs. 78.1; p = 0.0048. Though smoking is inversely associated with lung function, it seems to have a more deleterious effect than sedentary lifestyle on lung function. Physically active smokers had higher lung function than their non physically active counterparts.

  18. Preventing Ventilator Associated Lung Injury: A Perioperative Perspective

    Directory of Open Access Journals (Sweden)

    Satoshi eKimura

    2016-05-01

    Full Text Available Introduction: Research into the prevention of ventilator-associated lung injury (VALI in patients with acute respiratory distress syndrome (ARDS in the intensive care unit (ICU has resulted in the development of a number of lung protective strategies, which have become commonplace in the treatment of critically ill patients. An increasing number of studies have applied lung protective ventilation in the operating room to otherwise healthy individuals. We review the history of lung protective strategies in patients with acute respiratory failure and explore their use patients undergoing mechanical ventilation during general anesthesia to provide context for a discussion of the benefits and drawbacks, as well as inform future areas of inquiry.Methods: We completed a database search and reviewed articles investigating lung protective ventilation in both the ICU and in patients receiving general anesthesia through May 2015. Results: Lung protective ventilation was associated with improved outcomes in patients with acute respiratory failure in the ICU. Clinical evidence is less clear regarding lung protective ventilation for patients undergoing surgery. Conclusion: Lung protective ventilation strategies including low tidal volume ventilation and moderate positive end-expiratory pressure (PEEP are well established therapies to minimize lung injury in critically ill patients with and without lung disease, and may provide benefit to patients undergoing general anesthesia.

  19. Rheumatoid arthritis-associated interstitial lung disease

    Directory of Open Access Journals (Sweden)

    Brown KK

    2012-03-01

    Full Text Available Joshua J Solomon, Kevin K BrownAutoimmune Lung Center and Interstitial Lung Disease Program, National Jewish Health, Denver, CO, USAAbstract: Rheumatoid arthritis (RA is a systemic inflammatory disorder affecting 1% of the US population. Patients can have extra-articular manifestations of their disease and the lungs are commonly involved. RA can affect any compartment of the respiratory system and high resolution computed tomography (HRCT of the lung is abnormal in over half of these patients. Interstitial lung disease is a dreaded complication of RA. It is more prevalent in smokers, males, and those with high antibody titers. The pathogenesis is unknown but data suggest an environmental insult in the setting of a genetic predisposition. Smoking may play a role in the pathogenesis of disease through citrullination of protein in the lung leading to the development of autoimmunity. Patients usually present in middle age with cough and dyspnea. Pulmonary function testing most commonly shows reduced diffusion capacity for carbon monoxide and HRCT reveals a combination of reticulation and ground glass abnormalities. The most common pattern on HRCT and histopathology is usual interstitial pneumonia (UIP, with nonspecific interstitial pneumonia seen less frequently. There are no large-scale well-controlled treatment trials. In severe or progressive cases, treatment usually consists of corticosteroids with or without a cytotoxic agent for 6 months or longer. RA interstitial lung disease is progressive; over half of patients show radiographic progression within 2 years. Patients with a UIP pattern on biopsy have a survival similar to idiopathic pulmonary fibrosis.Keywords: rheumatoid arthritis, interstitial lung disease, nonspecific interstitial pneumonia, usual interstitial pneumonia, anti-CCP

  20. Spontaneous pneumothorax associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Sung, Dong Wook; Jung, Seung Hyae; Yoon, Yup; Lim, Jae Hoon; Cho, Kyu Soek; Yang, Moon Ho [Kyung Hee University Hospital, Seoul (Korea, Republic of)

    1991-05-15

    Spontaneous pneumothorax is a rare manifestation of lung cancer. Eight cases of pneumothorax found in 1648 patients with lung cancer from 1979-1990 are reported. Histopathologic types of cancer were adenocarcinoma in three cases, squamous cell carcinoma in two cases, bronchioloalveolar carcinoma in two cases, and metastatic renal cell carcinoma in one case. The primary tumor mass was not found even after thoracotomy in two cases. Spontaneous pneumothorax occurred on the ipsilateral side of the cancer. All the patients were more than 40 years old with a history of smoking 1-2 packs a day for 20 to 50 years, and had chronic lung diseases. The authors emphasize that bronchogenic carcinoma may be one of the causes of spontaneous pneumothorax in appropriate clinical settings.

  1. Spontaneous pneumothorax associated with lung cancer

    International Nuclear Information System (INIS)

    Spontaneous pneumothorax is a rare manifestation of lung cancer. Eight cases of pneumothorax found in 1648 patients with lung cancer from 1979-1990 are reported. Histopathologic types of cancer were adenocarcinoma in three cases, squamous cell carcinoma in two cases, bronchioloalveolar carcinoma in two cases, and metastatic renal cell carcinoma in one case. The primary tumor mass was not found even after thoracotomy in two cases. Spontaneous pneumothorax occurred on the ipsilateral side of the cancer. All the patients were more than 40 years old with a history of smoking 1-2 packs a day for 20 to 50 years, and had chronic lung diseases. The authors emphasize that bronchogenic carcinoma may be one of the causes of spontaneous pneumothorax in appropriate clinical settings

  2. Diesel engine exhaust and lung cancer: an unproven association.

    OpenAIRE

    Muscat, J E; Wynder, E. L.

    1995-01-01

    The risk of lung cancer associated with diesel exhaust has been calculated from 14 case-control or cohort studies. We evaluated the findings from these studies to determine whether there is sufficient evidence to implicate diesel exhaust as a human lung carcinogen. Four studies found increased risks associated with long-term exposure, although two of the four studies were based on the same cohort of railroad workers. Six studies were inconclusive due to missing information on smoking habits, ...

  3. Early COPD patients with lung hyperinflation associated with poorer lung function but better bronchodilator responsiveness

    Directory of Open Access Journals (Sweden)

    Chen C

    2016-10-01

    75.7%.Conclusion: We demonstrated the novel finding that early COPD patients with lung hyperinflation are associated with poorer lung function but better bronchodilator responsiveness and established a simple method for detecting lung hyperinflation. Keywords: GOLD I, GOLD II, RV/TLC, bronchodilation test

  4. Individualized lung recruitment during high-frequency ventilation in preterm infants is not associated with lung hyperinflation and air leaks

    OpenAIRE

    De Jaegere, Anne P; Deurloo, Eline E.; van Rijn, Rick R.; Offringa, Martin; van Kaam, Anton H.

    2016-01-01

    Lung recruitment during high-frequency ventilation (HFV) in preterm infants with respiratory distress syndrome (RDS) has been associated with an increased risk of lung hyperinflation and air leaks. Individualizing the lung recruitment procedure to the severity of lung disease of each patient might reduce these risks. In this prospective cohort study, we evaluated chest X-ray (CXR) characteristics during individualized oxygenation-guided lung recruitment with HFV in preterm infants with RDS, b...

  5. Primary lung cancer associated with Werner syndrome.

    Science.gov (United States)

    Ohnishi, Shunichiro; Fujimoto, Masaki; Oide, Takashi; Nakatani, Yukio; Tsurutani, Yuya; Koshizaka, Masaya; Mezawa, Morito; Ishikawa, Takahiro; Takemoto, Minoru; Yokote, Koutaro

    2010-10-01

    A 52-year-old man with Werner Syndrome (WS) was admitted to our hospital for the treatment of skin ulcers on his thighs. Routine chest radiography revealed an abnormal shadow in the left upper lung field. Computed tomography (CT) revealed a poorly demarcated homogeneous mass (diameter, 4 cm) in the S1 + 2 lung area; no pleural effusion was observed. CT-guided percutaneous needle biopsy revealed the presence of an adenocarcinoma. Other imaging studies did not reveal any lymph-node involvement or presence of metastatic lesions. The patient was diagnosed with stage IB adenocarcinoma (T2N0M0), and a left upper lobectomy was successfully carried out; postoperative wound healing was steady and uneventful, with no obvious ulcer formation. Primary lung cancers very rarely develop in patients with WS; non-epithelial tumors are usually observed in such patients. Patients with WS usually develop severe skin problems, such as refractory skin ulcers in the extremities; however, our patient did not develop any skin-related complications after surgery. As the expected lifespan of patients with WS is increasing, we need to pay attention not only to the rare non-epithelial malignancy, but also cancer. Further, the expected short lifespan of patients with WS, as well as the possibility of skin-related problems after surgery, should not be considered while deciding whether to take the option of surgery in the case of malignancy. PMID:20887625

  6. [A case of humidifier lung associated with BHL].

    Science.gov (United States)

    Osaki, J; Nakano, H; Matsumoto, H; Yamazaki, Y; Sakai, H; Tsuji, T; Osaki, Y; Fujikane, T; Sasaki, N; Onodera, S

    1992-06-01

    We encountered a rare case of hypersensitivity pneumonitis associated with bilateral hilar lymphadenopathy (BHL). The patient was a 53-year-old male, who developed dry cough and shortness of breath when using a humidifier since 1982. He was admitted to our hospital for further evaluation in 1987. Chest X-ray films showed BHL and ground glass appearance in the bilateral lung fields. Pulmonary function test indicated disturbance of diffusing capacity. Transbronchial lung biopsy revealed interstitial pneumonitis, and lymph node biopsy by mediastinoscopy showed lymphoid sinus histiocytosis without noncaseating granuloma. Provocation test using the humidifier was positive, and the diagnosis of humidifier lung with BHL was made. PMID:1507691

  7. Rheumatoid arthritis associated interstitial lung disease: a review

    Directory of Open Access Journals (Sweden)

    Deborah Assayag

    2014-04-01

    Full Text Available Rheumatoid arthritis is a common inflammatory disease affecting about 1% of the population. Interstitial lung disease is a serious and frequent complication of rheumatoid arthritis. Rheumatoid arthritis associated interstitial lung disease (RA-ILD is characterized by several histopathologic subtypes. This article reviews the proposed pathogenesis and risk factors for RA-ILD. We also outline the important steps involved in the work-up of RA-ILD and review the evidence for treatment and prognosis.

  8. [Respiratory bronchiolitis-associated interstitial lung disease (RB-ILD)].

    Science.gov (United States)

    Goeckenjan, G

    2003-05-01

    Respiratory bronchiolitis-associated interstitial lung disease (RB-ILD) designates interstitial lung changes in smokers, characterized histologically by bronchiolocentric accumulation of pigmented alveolar macrophages and fibrotic or cellular inflammatory changes of pulmonary interstitium. The definition is nearly identical to that of condensate pneumopathy, smoker's pneumopathy or smoker's lung, defined by accumulation of pigmented alveolar macrophages with bland alveoloseptal or peribronchial fibrosis and cellular inflammation of the bronchial wall. In addition to respiratory bronchiolitis, which is found in nearly all smokers, RB-ILD comprises a broad spectrum of varying degrees of the interstitial reaction to the exogenous injury of inhalation smoking with gradual transition to desquamative interstitial pneumonia (DIP). In most cases RB-ILD manifestations are subclinical and detected coincidentally. Radiographic features are reticulonodular and ground glass opacities of the lung. The high resolution computed tomography reveals centrilobular nodules, ground glass opacities, thickening of bronchial walls, and in some cases a reticular pattern. Mild emphysema is frequent. Lung function analysis reveals only minor restrictive or obstructive defects in most cases, often combined with hyperinflation. CO diffusing capacity is slightly to moderately impaired. Pronounced interstitial lung diseases with serious restrictive defects and arterial hypoxemia have been reported infrequently. In differential diagnosis smoking related interstitial lung diseases (DIP, Langerhans cell histiocytosis, idiopathic pulmonary fibrosis) and other interstitial lung diseases have to be excluded. In most cases diagnosis can be achieved by bronchoalveolar lavage and transbronchial lung biopsy. In cases of pronounced interstitial lung disease or assumption of an additional interstitial lung disease besides RB-ILD a thoracoscopic or open lung biopsy can be necessary. RB-ILD has a favourable

  9. Association Between Interstitial Lung Abnormalities and All-Cause Mortality

    Science.gov (United States)

    Putman, Rachel K.; Hatabu, Hiroto; Araki, Tetsuro; Gudmundsson, Gunnar; Gao, Wei; Nishino, Mizuki; Okajima, Yuka; Dupuis, Josée; Latourelle, Jeanne C.; Cho, Michael H.; El-Chemaly, Souheil; Coxson, Harvey O.; Celli, Bartolome R.; Fernandez, Isis E.; Zazueta, Oscar E.; Ross, James C.; Harmouche, Rola; Estépar, Raúl San José; Diaz, Alejandro A.; Sigurdsson, Sigurdur; Gudmundsson, Elías F.; Eiríksdottír, Gudny; Aspelund, Thor; Budoff, Matthew J.; Kinney, Gregory L.; Hokanson, John E.; Williams, Michelle C; Murchison, John T.; MacNee, William; Hoffmann, Udo; O’Donnell, Christopher J.; Launer, Lenore J.; Harrris, Tamara B.; Gudnason, Vilmundur; Silverman, Edwin K.; O’Connor, George T.; Washko, George R.; Rosas, Ivan O.; Hunninghake, Gary M.

    2016-01-01

    IMPORTANCE Interstitial lung abnormalities have been associated with decreased six-minute walk distance, diffusion capacity for carbon monoxide and total lung capacity; however to our knowledge, an association with mortality has not been previously investigated. OBJECTIVE To investigate whether interstitial lung abnormalities are associated with increased mortality. DESIGN, SETTING, POPULATION Prospective cohort studies of 2633 participants from the Framingham Heart Study (FHS) (CT scans obtained 9/08–3/11), 5320 from the Age Gene/Environment Susceptibility (AGES)-Reykjavik (recruited 1/02–2/06), 2068 from COPDGene (recruited 11/07–4/10), and 1670 from the Evaluation of COPD Longitudinally to Identify Predictive Surrogate End-points (ECLIPSE) (between 12/05–12/06). EXPOSURES Interstitial lung abnormality status as determined by chest CT evaluation. MAIN OUTCOMES AND MEASURES All cause mortality over approximately 3 to 9 year median follow up time. Cause-of-death information was also examined in the AGES-Reykjavik cohort. RESULTS Interstitial lung abnormalities were present in 177 (7%) of the participants from FHS, 378 (7%) from AGES-Reykjavik, 156 (8%) from COPDGene, and in 157 (9%) from ECLIPSE. Over median follow-up times of ~3–9 years there were more deaths (and a greater absolute rate of mortality) among those with interstitial lung abnormalities compared to those without interstitial lung abnormalities in each cohort; 7% compared to 1% in FHS (6% difference, 95% confidence interval [CI] 2%, 10%), 56% compared to 33% in AGES-Reykjavik (23% difference, 95% CI 18%, 28%), 16% compared to 11% in COPDGene (5% difference, 95% CI −1%, 11%) and 11% compared to 5% in ECLIPSE (6% difference, 95% CI 1%, 11%). After adjustment for covariates, interstitial lung abnormalities were associated with an increase in the risk of death in the FHS (HR=2.7, 95% CI, 1.1–65, P=0.030), AGES-Reykjavik (HR 1.3, 95% CI 1.2–1.4, P<0.001), COPDGene (HR=1.8, 95% CI, 1.1, 2

  10. Association of genetic loci with sleep apnea in European Americans and African-Americans: the Candidate Gene Association Resource (CARe.

    Directory of Open Access Journals (Sweden)

    Sanjay R Patel

    Full Text Available Although obstructive sleep apnea (OSA is known to have a strong familial basis, no genetic polymorphisms influencing apnea risk have been identified in cross-cohort analyses. We utilized the National Heart, Lung, and Blood Institute (NHLBI Candidate Gene Association Resource (CARe to identify sleep apnea susceptibility loci. Using a panel of 46,449 polymorphisms from roughly 2,100 candidate genes on a customized Illumina iSelect chip, we tested for association with the apnea hypopnea index (AHI as well as moderate to severe OSA (AHI≥15 in 3,551 participants of the Cleveland Family Study and two cohorts participating in the Sleep Heart Health Study.Among 647 African-Americans, rs11126184 in the pleckstrin (PLEK gene was associated with OSA while rs7030789 in the lysophosphatidic acid receptor 1 (LPAR1 gene was associated with AHI using a chip-wide significance threshold of p-value<2×10(-6. Among 2,904 individuals of European ancestry, rs1409986 in the prostaglandin E2 receptor (PTGER3 gene was significantly associated with OSA. Consistency of effects between rs7030789 and rs1409986 in LPAR1 and PTGER3 and apnea phenotypes were observed in independent clinic-based cohorts.Novel genetic loci for apnea phenotypes were identified through the use of customized gene chips and meta-analyses of cohort data with replication in clinic-based samples. The identified SNPs all lie in genes associated with inflammation suggesting inflammation may play a role in OSA pathogenesis.

  11. Factors Associated with Hepatitis B Testing Among Vietnamese Americans

    OpenAIRE

    Tung T Nguyen; McPhee, Stephen J.; Stewart, Susan; Gildengorin, Ginny; Zhang, Lena; Wong, Ching; Maxwell, Annette E.; Bastani, Roshan; Taylor, Vicky M.; Chen, Moon S.

    2010-01-01

    BACKGROUND Chronic hepatitis B and hepatitis B-associated liver cancer is a major health disparity among Vietnamese Americans, who have a chronic hepatitis B prevalence rate of 7–14% and an incidence rate for liver cancer six times that of non-Latino whites. OBJECTIVE Describe factors associated with hepatitis B testing among Vietnamese Americans. DESIGN A population-based telephone survey conducted in 2007–2008. PARTICIPANTS Vietnamese Americans age 18–64 and living in the Northern Californi...

  12. Effect of primarily cultured human lung cancer-associated fibroblasts on radiosensitivity of lung cancer cells

    International Nuclear Information System (INIS)

    Objective: To investigate the effect of human lung cancer-associated fibroblasts (CAF) on the radiosensitivity of lung cancer cells when CAF is placed in direct contact co-culture with lung cancer cells. Methods: Human lung CAF was obtained from fresh human lung adenocarcinoma tissue specimens by primary culture and subculture and was then identified by immunofluorescence staining. The CAF was placed in direct contact co-culture with lung cancer A549 and H1299 cells, and the effects of CAF on the radiosensitivity of A549 and H1299 cells were evaluated by colony-forming assay. Results: The human lung CAF obtained by adherent culture could stably grow and proliferate, and it had specific expression of α-smooth muscle actin, vimentin, and fibroblast activation protein,but without expression of cytokeratin-18. The plating efficiency (PE, %) of A549 cells at 0 Gy irradiation was (20.0 ± 3.9)% when cultured alone versus (32.3 ± 5.5)% when co-cultured with CAF (t=3.16, P<0.05), and the PE of H1299 cells at 0 Gy irradiation was (20.6 ± 3.1)% when cultured alone versus (35.2 ± 2.3)% when co-cultured with CAF (t=6.55, P<0.05). The cell survival rate at 2 Gy irradiation (SF2) of A549 cells was 0.727 ±0.061 when cultured alone versus 0.782 ± 0.089 when co-cultured with CAF (t=0.88, P>0.05), and the SF2 of H1299 cells was 0.692 ±0.065 when cultured alone versus 0.782 ± 0.037 when co-cultured with CAF (t=2.08, P>0.05). The protection enhancement ratios of human lung CAF for A549 cells and H1299 cells were 1.29 and 1.25, respectively. Conclusions: Human lung CAF reduces the radiosensitivity of lung cancer cells when placed in direct contact co-culture with them, and the radioprotective effect may be attributed to CAF promoting the proliferation of lung cancer cells. (authors)

  13. Space radiation-associated lung injury in a murine model.

    Science.gov (United States)

    Christofidou-Solomidou, Melpo; Pietrofesa, Ralph A; Arguiri, Evguenia; Schweitzer, Kelly S; Berdyshev, Evgeny V; McCarthy, Maureen; Corbitt, Astrid; Alwood, Joshua S; Yu, Yongjia; Globus, Ruth K; Solomides, Charalambos C; Ullrich, Robert L; Petrache, Irina

    2015-03-01

    Despite considerable progress in identifying health risks to crewmembers related to exposure to galactic/cosmic rays and solar particle events (SPE) during space travel, its long-term effects on the pulmonary system are unknown. We used a murine risk projection model to investigate the impact of exposure to space-relevant radiation (SR) on the lung. C3H mice were exposed to (137)Cs gamma rays, protons (acute, low-dose exposure mimicking the 1972 SPE), 600 MeV/u (56)Fe ions, or 350 MeV/u (28)Si ions at the NASA Space Radiation Laboratory at Brookhaven National Laboratory. Animals were irradiated at the age of 2.5 mo and evaluated 23.5 mo postirradiation, at 26 mo of age. Compared with age-matched nonirradiated mice, SR exposures led to significant air space enlargement and dose-dependent decreased systemic oxygenation levels. These were associated with late mild lung inflammation and prominent cellular injury, with significant oxidative stress and apoptosis (caspase-3 activation) in the lung parenchyma. SR, especially high-energy (56)Fe or (28)Si ions markedly decreased sphingosine-1-phosphate levels and Akt- and p38 MAPK phosphorylation, depleted anti-senescence sirtuin-1 and increased biochemical markers of autophagy. Exposure to SR caused dose-dependent, pronounced late lung pathological sequelae consistent with alveolar simplification and cellular signaling of increased injury and decreased repair. The associated systemic hypoxemia suggested that this previously uncharacterized space radiation-associated lung injury was functionally significant, indicating that further studies are needed to define the risk and to develop appropriate lung-protective countermeasures for manned deep space missions. PMID:25526737

  14. Fine mapping of chromosome 15q25.1 lung cancer susceptibility in African-Americans

    OpenAIRE

    Hansen, Helen M.; Xiao, Yuanyuan; Rice, Terri; Bracci, Paige M.; Wrensch, Margaret R.; Sison, Jennette D.; Chang, Jeffery S.; Smirnov, Ivan V.; Patoka, Joseph; Seldin, Michael F; Quesenberry, Charles P.; Kelsey, Karl T.; Wiencke, John K.

    2010-01-01

    Several genome-wide association studies identified the chr15q25.1 region, which includes three nicotinic cholinergic receptor genes (CHRNA5-B4) and the cell proliferation gene (PSMA4), for its association with lung cancer risk in Caucasians. A haplotype and its tagging single nucleotide polymorphisms (SNPs) encompassing six genes from IREB2 to CHRNB4 were most strongly associated with lung cancer risk (OR = 1.3; P < 10−20). In order to narrow the region of association and identify potential c...

  15. Association of variations in HLA class II and other loci with susceptibility to EGFR-mutated lung adenocarcinoma.

    Science.gov (United States)

    Shiraishi, Kouya; Okada, Yukinori; Takahashi, Atsushi; Kamatani, Yoichiro; Momozawa, Yukihide; Ashikawa, Kyota; Kunitoh, Hideo; Matsumoto, Shingo; Takano, Atsushi; Shimizu, Kimihiro; Goto, Akiteru; Tsuta, Koji; Watanabe, Shun-Ichi; Ohe, Yuichiro; Watanabe, Yukio; Goto, Yasushi; Nokihara, Hiroshi; Furuta, Koh; Yoshida, Akihiko; Goto, Koichi; Hishida, Tomoyuki; Tsuboi, Masahiro; Tsuchihara, Katsuya; Miyagi, Yohei; Nakayama, Haruhiko; Yokose, Tomoyuki; Tanaka, Kazumi; Nagashima, Toshiteru; Ohtaki, Yoichi; Maeda, Daichi; Imai, Kazuhiro; Minamiya, Yoshihiro; Sakamoto, Hiromi; Saito, Akira; Shimada, Yoko; Sunami, Kuniko; Saito, Motonobu; Inazawa, Johji; Nakamura, Yusuke; Yoshida, Teruhiko; Yokota, Jun; Matsuda, Fumihiko; Matsuo, Keitaro; Daigo, Yataro; Kubo, Michiaki; Kohno, Takashi

    2016-01-01

    Lung adenocarcinoma driven by somatic EGFR mutations is more prevalent in East Asians (30-50%) than in European/Americans (10-20%). Here we investigate genetic factors underlying the risk of this disease by conducting a genome-wide association study, followed by two validation studies, in 3,173 Japanese patients with EGFR mutation-positive lung adenocarcinoma and 15,158 controls. Four loci, 5p15.33 (TERT), 6p21.3 (BTNL2), 3q28 (TP63) and 17q24.2 (BPTF), previously shown to be strongly associated with overall lung adenocarcinoma risk in East Asians, were re-discovered as loci associated with a higher susceptibility to EGFR mutation-positive lung adenocarcinoma. In addition, two additional loci, HLA class II at 6p21.32 (rs2179920; P =5.1 × 10(-17), per-allele OR=1.36) and 6p21.1 (FOXP4) (rs2495239; P=3.9 × 10(-9), per-allele OR=1.19) were newly identified as loci associated with EGFR mutation-positive lung adenocarcinoma. This study indicates that multiple genetic factors underlie the risk of lung adenocarcinomas with EGFR mutations. PMID:27501781

  16. Impact of Neuro-Psychological Factors on Smoking-Associated Lung Cancer

    International Nuclear Information System (INIS)

    Smoking has been extensively documented as a risk factor for all histological types of lung cancer and tobacco-specific nitrosamines and polycyclic aromatic hydrocarbons reproducibly cause lung cancer in laboratory rodents. However, the most common lung cancer, non-small cell lung cancer (NSCLC), frequently develops in never smokers and is particularly common in women and African Americans, suggesting that factors unrelated to smoking significantly impact this cancer. Recent experimental investigations in vitro and in animal models have shown that chronic psychological stress and the associated hyperactive signaling of stress neurotransmitters via β-adrenergic receptors significantly promote the growth and metastatic potential of NSCLC. These responses were caused by modulation in the expression and sensitization state of nicotinic acetylcholine receptors (nAChRs) that regulate the production of stress neurotransmitters and the inhibitory neurotransmitter γ-aminobutyric acid (GABA). Similar changes in nAChR-mediated neurotransmitter production were identified as the cause of NSCLC stimulation in vitro and in xenograft models by chronic nicotine. Collectively, these data suggest that hyperactivity of the sympathetic branch of the autonomic nervous system caused by chronic psychological stress or chronic exposure to nicotinic agonists in cigarette smoke significantly contribute to the development and progression of NSCLC. A recent clinical study that reported improved survival outcomes with the incidental use of β-blockers among patients with NSCLC supports this interpretation

  17. Impact of Neuro-Psychological Factors on Smoking-Associated Lung Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Schuller, Hildegard M. [Experimental Oncology Laboratory, Department of Biomedical and Diagnostic Sciences, College of Veterinary Medicine, University of Tennessee, 2407 River Drive, Knoxville, TN 37996 (United States)

    2014-03-13

    Smoking has been extensively documented as a risk factor for all histological types of lung cancer and tobacco-specific nitrosamines and polycyclic aromatic hydrocarbons reproducibly cause lung cancer in laboratory rodents. However, the most common lung cancer, non-small cell lung cancer (NSCLC), frequently develops in never smokers and is particularly common in women and African Americans, suggesting that factors unrelated to smoking significantly impact this cancer. Recent experimental investigations in vitro and in animal models have shown that chronic psychological stress and the associated hyperactive signaling of stress neurotransmitters via β-adrenergic receptors significantly promote the growth and metastatic potential of NSCLC. These responses were caused by modulation in the expression and sensitization state of nicotinic acetylcholine receptors (nAChRs) that regulate the production of stress neurotransmitters and the inhibitory neurotransmitter γ-aminobutyric acid (GABA). Similar changes in nAChR-mediated neurotransmitter production were identified as the cause of NSCLC stimulation in vitro and in xenograft models by chronic nicotine. Collectively, these data suggest that hyperactivity of the sympathetic branch of the autonomic nervous system caused by chronic psychological stress or chronic exposure to nicotinic agonists in cigarette smoke significantly contribute to the development and progression of NSCLC. A recent clinical study that reported improved survival outcomes with the incidental use of β-blockers among patients with NSCLC supports this interpretation.

  18. Impact of Neuro-Psychological Factors on Smoking-Associated Lung Cancer

    Directory of Open Access Journals (Sweden)

    Hildegard M. Schuller

    2014-03-01

    Full Text Available Smoking has been extensively documented as a risk factor for all histological types of lung cancer and tobacco-specific nitrosamines and polycyclic aromatic hydrocarbons reproducibly cause lung cancer in laboratory rodents. However, the most common lung cancer, non-small cell lung cancer (NSCLC, frequently develops in never smokers and is particularly common in women and African Americans, suggesting that factors unrelated to smoking significantly impact this cancer. Recent experimental investigations in vitro and in animal models have shown that chronic psychological stress and the associated hyperactive signaling of stress neurotransmitters via β-adrenergic receptors significantly promote the growth and metastatic potential of NSCLC. These responses were caused by modulation in the expression and sensitization state of nicotinic acetylcholine receptors (nAChRs that regulate the production of stress neurotransmitters and the inhibitory neurotransmitter γ-aminobutyric acid (GABA. Similar changes in nAChR-mediated neurotransmitter production were identified as the cause of NSCLC stimulation in vitro and in xenograft models by chronic nicotine. Collectively, these data suggest that hyperactivity of the sympathetic branch of the autonomic nervous system caused by chronic psychological stress or chronic exposure to nicotinic agonists in cigarette smoke significantly contribute to the development and progression of NSCLC. A recent clinical study that reported improved survival outcomes with the incidental use of β-blockers among patients with NSCLC supports this interpretation.

  19. Clinical features of rheumatoid arthritis-associated interstitial lung disease.

    Science.gov (United States)

    Wang, Ting; Zheng, Xing-Ju; Liang, Bin-Miao; Liang, Zong-An

    2015-10-07

    Interstitial lung disease (ILD) is the most common extra-articular manifestations of rheumatoid arthritis (RA) in the lung. This study aimed to identify clinical features of RA-associated ILD (RA-ILD). Patients with RA were retrospectively enrolled and sub-classified as RA-ILD or RA without ILD based on high-resolution computed tomography imaging. Pulmonary function testing parameters and levels of RA-related biomarkers, tumour markers, and acute-phase proteins were compared between the two groups. Logistic regression model was used to assess the strength of association between RA-ILD and clinical features of interest. Receiver operating characteristic analysis was performed to assess potential predictive value of clinical features for detecting RA-ILD. Comparison analysis indicated that the percentage of predicted value of total lung capacity, inspiratory capacity, and diffusion capacity of the lung for carbon monoxide (DLCO) were reduced in patients with RA-ILD. Tumour markers CA15-3 and CA125 were increased in patients with RA-ILD. Logistic regression analysis revealed that decreased DLCO was related to the increased likelihood of RA-ILD (OR = 0.94, 95%CI = [0.91, 0.98]). The cut-off point at 52.95 percent of predicted value could sensitively discriminate RA patients with or without ILD. Our study suggested that DLCO value could be a useful tool for detecting ILD in patients with RA.

  20. Susceptibility loci for lung cancer are associated with mRNA levels of nearby genes in the lung

    NARCIS (Netherlands)

    Nguyen, Justin Dang Uy; Lamontagne, Maxime; Couture, Christian; Conti, Massimo; Pare, Peter D.; Sin, Don D.; Hogg, James C.; Nickle, David; Postma, Dirkje S.; Timens, Wim; Laviolette, Michel; Bosse, Yohan

    2014-01-01

    Recent studies identified three genetic loci reproducibly associated with lung cancer in populations of European ancestry, namely 15q25, 5p15 and 6p21. The goals of this study are first to confirm whether these loci are associated with lung cancer in a French Canadian population and second to identi

  1. Faculty member receives American Agricultural Law Association highest honor

    OpenAIRE

    Sutphin, Michael D.

    2008-01-01

    L. Leon Geyer of Blacksburg, Va., professor of agricultural and applied economics in Virginia Tech's College of Agriculture and Life Sciences, has received the 2008 American Agricultural Law Association (AALA) Distinguished Service Award.

  2. Factors Associated with Hepatitis B Testing Among Vietnamese Americans

    OpenAIRE

    Tung T Nguyen; McPhee, Stephen J.; Stewart, Susan; Gildengorin, Ginny; Zhang, Lena; Wong, Ching; Maxwell, Annette E.; Bastani, Roshan; Taylor, Vicky M.; Chen, Moon S.

    2010-01-01

    Chronic hepatitis B and hepatitis B-associated liver cancer is a major health disparity among Vietnamese Americans, who have a chronic hepatitis B prevalence rate of 7–14% and an incidence rate for liver cancer six times that of non-Latino whites. Describe factors associated with hepatitis B testing among Vietnamese Americans. A population-based telephone survey conducted in 2007–2008. Vietnamese Americans age 18–64 and living in the Northern California and Washington, DC areas (N = ...

  3. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Science.gov (United States)

    Gueutin, Victor; Langlois, Anne-Lyse; Shehwaro, Nathalie; Elharraqui, Ryme; Rouvier, Philippe; Izzedine, Hassane

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported. PMID:24558629

  4. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    OpenAIRE

    Victor Gueutin; Anne-Lyse Langlois; Nathalie Shehwaro; Ryme Elharraqui; Philippe Rouvier; Hassane Izzedine

    2013-01-01

    Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  5. Nephrotic Syndrome Associated with Lung Cancer: A Rare Case of Malignancy Associated with AA Amyloidosis

    Directory of Open Access Journals (Sweden)

    Victor Gueutin

    2013-01-01

    Full Text Available Nonhematologic malignancies are rarely reported to be associated with AA amyloidosis. Although the association between renal cell carcinoma and systemic AA amyloidosis has been established, the evidence linking pulmonary cancer to AA amyloidosis is scarce. Here, a case of biopsy-proven renal AA amyloidosis complicated with nephrotic syndrome associated with lung carcinoma is reported.

  6. Association between lung function and airway wall density

    Science.gov (United States)

    Leader, J. Ken; Zheng, Bin; Fuhrman, Carl R.; Tedrow, John; Park, Sang C.; Tan, Jun; Pu, Jiantao; Drescher, John M.; Gur, David; Sciurba, Frank C.

    2009-02-01

    Computed tomography (CT) examination is often used to quantify the relation between lung function and airway remodeling in chronic obstructive pulmonary disease (COPD). In this preliminary study, we examined the association between lung function and airway wall computed attenuation ("density") in 200 COPD screening subjects. Percent predicted FVC (FVC%), percent predicted FEV1 (FEV1%), and the ratio of FEV1 to FVC as a percentage (FEV1/FVC%) were measured post-bronchodilator. The apical bronchus of the right upper lobe was manually selected from CT examinations for evaluation. Total airway area, lumen area, wall area, lumen perimeter and wall area as fraction of the total airway area were computed. Mean HU (meanHU) and maximum HU (maxHU) values were computed across pixels assigned membership in the wall and with a HU value greater than -550. The Pearson correlation coefficients (PCC) between FVC%, FEV1%, and FEV1/FVC% and meanHU were -0.221 (p = 0.002), -0.175 (p = 0.014), and -0.110 (p = 0.123), respectively. The PCCs for maxHU were only significant for FVC%. The correlations between lung function and the airway morphometry parameters were slightly stronger compared to airway wall density. MeanHU was significantly correlated with wall area (PCC = 0.720), airway area (0.498) and wall area percent (0.611). This preliminary work demonstrates that airway wall density is associated with lung function. Although the correlations in our study were weaker than a recent study, airway wall density initially appears to be an important parameter in quantitative CT analysis of COPD.

  7. An official American Thoracic Society workshop report: stem cells and cell therapies in lung biology and diseases.

    Science.gov (United States)

    Weiss, Daniel J; Chambers, Daniel; Giangreco, Adam; Keating, Armand; Kotton, Darrell; Lelkes, Peter I; Wagner, Darcy E; Prockop, Darwin J

    2015-04-01

    The University of Vermont College of Medicine and the Vermont Lung Center, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, European Respiratory Society, International Society for Cell Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, "Stem Cells and Cell Therapies in Lung Biology and Lung Diseases," held July 29 to August 1, 2013 at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This conference was a follow-up to four previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, and 2011. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and Respiratory Disease Foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields.

  8. 2009 Annual Report of the American Psychological Association

    Science.gov (United States)

    American Psychologist, 2010

    2010-01-01

    This annual report of the American Psychological Association (APA) describes the association's activities and accomplishments in 2009. It describes strides made toward the goal of infusing psychology into the health care marketplace and of bringing psychology--and the unique skills of psychologists--to the attention of the public. This report aims…

  9. International Association for the Study of Lung Cancer Computed Tomography Screening Workshop 2011 report

    DEFF Research Database (Denmark)

    Field, John K; Smith, Robert A; Aberle, Denise R;

    2011-01-01

    The International Association for the Study of Lung Cancer (IASLC) Board of Directors convened a computed tomography (CT) Screening Task Force to develop an IASLC position statement, after the National Cancer Institute press statement from the National Lung Screening Trial showed that lung cancer...... of suspicious nodules identified through lung cancer CT screening programs; and (vi) integration of smoking cessation practices into future national lung cancer CT screening programs.......The International Association for the Study of Lung Cancer (IASLC) Board of Directors convened a computed tomography (CT) Screening Task Force to develop an IASLC position statement, after the National Cancer Institute press statement from the National Lung Screening Trial showed that lung cancer...... deaths fell by 20%. The Task Force's Position Statement outlined a number of the major opportunities to further improve the CT screening in lung cancer approach, based on experience with cancer screening from other organ sites.The IASLC CT Screening Workshop 2011 further developed these discussions...

  10. Low cognitive ability in early adulthood is associated with reduced lung function in middle age

    DEFF Research Database (Denmark)

    Carroll, Douglas; Batty, G David; Mortensen, Laust Hvas;

    2011-01-01

    Reduced lung function has been linked to poorer cognitive ability later in life. In the present study, the authors examined the converse: whether there was a prospective association between cognitive ability in early adulthood and lung function in middle age.......Reduced lung function has been linked to poorer cognitive ability later in life. In the present study, the authors examined the converse: whether there was a prospective association between cognitive ability in early adulthood and lung function in middle age....

  11. An Association Perspective: Responding to the American Dental Association's Future of Dentistry Project.

    Science.gov (United States)

    Hutchinson, Rowland A.; Haden, N. Karl; Valachovic, Richard W.

    2000-01-01

    In response to the American Dental Association's (ADA) Future of Dentistry Project, the American Dental Education Association (ADEA) provided perspective on the most critical issues facing the dental profession. ADEA responded in six areas, each corresponding to areas of focus in the ADA project. This report reflects comments provided to the ADEA…

  12. European and North American lung cancer screening experience and implications for pulmonary nodule management

    Energy Technology Data Exchange (ETDEWEB)

    Nair, Arjun [St. Georges Hospital, Department of Radiology, London (United Kingdom); Hansell, David M. [Royal Brompton Hospital, Department of Radiology, London (United Kingdom)

    2011-12-15

    The potential for low dose computed tomography (LDCT) to act as an effective tool in screening for lung cancer is currently the subject of several randomised control trials. It has recently been given prominence by interim results released by the North American National Lung Screening Trial (NLST). Several other trials assessing LDCT as a screening tool are currently underway in Europe, and are due to report their final results in the next few years. These include the NELSON, DLSCT, DANTE, ITALUNG, MILD and LUSI trials. Although slow to instigate a trial of its own, the UK Lung Screen (UKLS) trial will shortly commence. The knowledge gained from the newer trials has mostly reinforced and refined previous concepts that have formed the basis of existing nodule management guidelines. This article takes the opportunity to summarise the main aspects and initial results of the trials presently underway, assess the status of current collaborative efforts and the scope for future collaboration, and analyse observations from these studies that may usefully inform the management of the indeterminate pulmonary nodule. (orig.)

  13. European and North American lung cancer screening experience and implications for pulmonary nodule management

    International Nuclear Information System (INIS)

    The potential for low dose computed tomography (LDCT) to act as an effective tool in screening for lung cancer is currently the subject of several randomised control trials. It has recently been given prominence by interim results released by the North American National Lung Screening Trial (NLST). Several other trials assessing LDCT as a screening tool are currently underway in Europe, and are due to report their final results in the next few years. These include the NELSON, DLSCT, DANTE, ITALUNG, MILD and LUSI trials. Although slow to instigate a trial of its own, the UK Lung Screen (UKLS) trial will shortly commence. The knowledge gained from the newer trials has mostly reinforced and refined previous concepts that have formed the basis of existing nodule management guidelines. This article takes the opportunity to summarise the main aspects and initial results of the trials presently underway, assess the status of current collaborative efforts and the scope for future collaboration, and analyse observations from these studies that may usefully inform the management of the indeterminate pulmonary nodule. (orig.)

  14. Reading and analysis on management guidelines for hyperthyroidism published in 2011 by American Thyroid Association and American Association of Clinical Endocrinologists

    International Nuclear Information System (INIS)

    Recently, the American Thyroid Association and American Association of Clinical Endocrinologists published 'Hyperthyroidism and other causes of thyrotoxicosis: management guidelines of the American Thyroid Association and American Association of Clinical Endocrinologists', and created 100 evidence-based recommendations. The guideline systematically introduced the diagnoses and therapies of hyperthyroidism, emphasizing the indications, contraindications, preparations, methodologies and follow-up strategies. The guideline also provided detailed management principles for hyperthyroidism in children and pregnancy, Graves' ophthalmopathy and some unusual causes of hyperthyroidism. (authors)

  15. An Official American Thoracic Society Workshop Report 2015. Stem Cells and Cell Therapies in Lung Biology and Diseases.

    Science.gov (United States)

    Wagner, Darcy E; Cardoso, Wellington V; Gilpin, Sarah E; Majka, Susan; Ott, Harald; Randell, Scott H; Thébaud, Bernard; Waddell, Thomas; Weiss, Daniel J

    2016-08-01

    The University of Vermont College of Medicine, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, Cystic Fibrosis Foundation, European Respiratory Society, International Society for Cellular Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, "Stem Cells and Cell Therapies in Lung Biology and Lung Diseases," held July 27 to 30, 2015, at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This 10th anniversary conference was a follow up to five previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, 2011, and 2013. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and respiratory disease foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields. PMID:27509163

  16. An Official American Thoracic Society Workshop Report 2015. Stem Cells and Cell Therapies in Lung Biology and Diseases.

    Science.gov (United States)

    Wagner, Darcy E; Cardoso, Wellington V; Gilpin, Sarah E; Majka, Susan; Ott, Harald; Randell, Scott H; Thébaud, Bernard; Waddell, Thomas; Weiss, Daniel J

    2016-08-01

    The University of Vermont College of Medicine, in collaboration with the NHLBI, Alpha-1 Foundation, American Thoracic Society, Cystic Fibrosis Foundation, European Respiratory Society, International Society for Cellular Therapy, and the Pulmonary Fibrosis Foundation, convened a workshop, "Stem Cells and Cell Therapies in Lung Biology and Lung Diseases," held July 27 to 30, 2015, at the University of Vermont. The conference objectives were to review the current understanding of the role of stem and progenitor cells in lung repair after injury and to review the current status of cell therapy and ex vivo bioengineering approaches for lung diseases. These are all rapidly expanding areas of study that both provide further insight into and challenge traditional views of mechanisms of lung repair after injury and pathogenesis of several lung diseases. The goals of the conference were to summarize the current state of the field, discuss and debate current controversies, and identify future research directions and opportunities for both basic and translational research in cell-based therapies for lung diseases. This 10th anniversary conference was a follow up to five previous biennial conferences held at the University of Vermont in 2005, 2007, 2009, 2011, and 2013. Each of those conferences, also sponsored by the National Institutes of Health, American Thoracic Society, and respiratory disease foundations, has been important in helping guide research and funding priorities. The major conference recommendations are summarized at the end of the report and highlight both the significant progress and major challenges in these rapidly progressing fields.

  17. Rare variant associations with waist-to-hip ratio in European-American and African-American women from the NHLBI-Exome Sequencing Project.

    Science.gov (United States)

    Kan, Mengyuan; Auer, Paul L; Wang, Gao T; Bucasas, Kristine L; Hooker, Stanley; Rodriguez, Alejandra; Li, Biao; Ellis, Jaclyn; Adrienne Cupples, L; Ida Chen, Yii-Der; Dupuis, Josée; Fox, Caroline S; Gross, Myron D; Smith, Joshua D; Heard-Costa, Nancy; Meigs, James B; Pankow, James S; Rotter, Jerome I; Siscovick, David; Wilson, James G; Shendure, Jay; Jackson, Rebecca; Peters, Ulrike; Zhong, Hua; Lin, Danyu; Hsu, Li; Franceschini, Nora; Carlson, Chris; Abecasis, Goncalo; Gabriel, Stacey; Bamshad, Michael J; Altshuler, David; Nickerson, Deborah A; North, Kari E; Lange, Leslie A; Reiner, Alexander P; Leal, Suzanne M

    2016-08-01

    Waist-to-hip ratio (WHR), a relative comparison of waist and hip circumferences, is an easily accessible measurement of body fat distribution, in particular central abdominal fat. A high WHR indicates more intra-abdominal fat deposition and is an established risk factor for cardiovascular disease and type 2 diabetes. Recent genome-wide association studies have identified numerous common genetic loci influencing WHR, but the contributions of rare variants have not been previously reported. We investigated rare variant associations with WHR in 1510 European-American and 1186 African-American women from the National Heart, Lung, and Blood Institute-Exome Sequencing Project. Association analysis was performed on the gene level using several rare variant association methods. The strongest association was observed for rare variants in IKBKB (P=4.0 × 10(-8)) in European-Americans, where rare variants in this gene are predicted to decrease WHRs. The activation of the IKBKB gene is involved in inflammatory processes and insulin resistance, which may affect normal food intake and body weight and shape. Meanwhile, aggregation of rare variants in COBLL1, previously found to harbor common variants associated with WHR and fasting insulin, were nominally associated (P=2.23 × 10(-4)) with higher WHR in European-Americans. However, these significant results are not shared between African-Americans and European-Americans that may be due to differences in the allelic architecture of the two populations and the small sample sizes. Our study indicates that the combined effect of rare variants contribute to the inter-individual variation in fat distribution through the regulation of insulin response. PMID:26757982

  18. Ventilator-associated lung injury during assisted mechanical ventilation.

    Science.gov (United States)

    Saddy, Felipe; Sutherasan, Yuda; Rocco, Patricia R M; Pelosi, Paolo

    2014-08-01

    Assisted mechanical ventilation (MV) may be a favorable alternative to controlled MV at the early phase of acute respiratory distress syndrome (ARDS), since it requires less sedation, no paralysis and is associated with less hemodynamic deterioration, better distal organ perfusion, and lung protection, thus reducing the risk of ventilator-associated lung injury (VALI). In the present review, we discuss VALI in relation to assisted MV strategies, such as volume assist-control ventilation, pressure assist-control ventilation, pressure support ventilation (PSV), airway pressure release ventilation (APRV), APRV with PSV, proportional assist ventilation (PAV), noisy ventilation, and neurally adjusted ventilatory assistance (NAVA). In summary, we suggest that assisted MV can be used in ARDS patients in the following situations: (1) Pao(2)/Fio(2) >150 mm Hg and positive end-expiratory pressure ≥ 5 cm H(2)O and (2) with modalities of pressure-targeted and time-cycled breaths including more or less spontaneous or supported breaths (A-PCV [assisted pressure-controlled ventilation] or APRV). Furthermore, during assisted MV, the following parameters should be monitored: inspiratory drive, transpulmonary pressure, and tidal volume (6 mL/kg). Further studies are required to determine the impact of novel modalities of assisted ventilation such as PAV, noisy pressure support, and NAVA on VALI. PMID:25105820

  19. International Association for the Study of Lung Cancer Computed Tomography Screening Workshop 2011 Report

    NARCIS (Netherlands)

    Field, John K.; Smith, Robert A.; Aberle, Denise R.; Oudkerk, Matthijs; Baldwin, David R.; Yankelevitz, David; Pedersen, Jesper Holst; Swanson, Scott James; Travis, William D.; Wisbuba, Ignacio I.; Noguchi, Masayuki; Mulshine, Jim L.

    2012-01-01

    The International Association for the Study of Lung Cancer (IASLC) Board of Directors convened a computed tomography (CT) Screening Task Force to develop an IASLC position statement, after the National Cancer Institute press statement from the National Lung Screening Trial showed that lung cancer de

  20. Obesity in American Indian and Mexican American Men and Women: Associations with Blood Pressure and Cardiovascular Autonomic Control

    OpenAIRE

    Criado, José R.; Gilder, David A.; Kalafut, Mary A.; Ehlers, Cindy L.

    2013-01-01

    Obesity is a serious public health problem, especially in some minority communities, and it has been associated with an increased risk of cardiovascular diseases. While obesity is a serious health concern in both American Indian and Mexican American populations, the relationship between obesity and cardiac autonomic control in these two populations is not well understood. The present study in a selected sample of American Indians and Mexican Americans assessed associations between obesity, bl...

  1. Undifferentiated connective tissue disease-associated interstitial lung disease: changes in lung function.

    Science.gov (United States)

    Kinder, Brent W; Shariat, Cyrus; Collard, Harold R; Koth, Laura L; Wolters, Paul J; Golden, Jeffrey A; Panos, Ralph J; King, Talmadge E

    2010-04-01

    Undifferentiated connective tissue disease (UCTD) is a distinct clinical entity that may be accompanied by interstitial lung disease (ILD). The natural history of UCTD-ILD is unknown. We hypothesized that patients with UCTD-ILD would be more likely to have improvement in lung function than those with idiopathic pulmonary fibrosis (IPF) during longitudinal follow-up. We identified subjects enrolled in the UCSF ILD cohort study with a diagnosis of IPF or UCTD. The primary outcome compared the presence or absence of a > or = 5% increase in percent predicted forced vital capacity (FVC) in IPF and UCTD. Regression models were used to account for potential confounding variables. Ninety subjects were identified; 59 subjects (30 IPF, 29 UCTD) had longitudinal pulmonary function data for inclusion in the analysis. After accounting for baseline pulmonary function tests, treatment, and duration between studies, UCTD was associated with substantial improvement in FVC (odds ratio = 8.23, 95% confidence interval, 1.27-53.2; p = 0.03) during follow-up (median, 8 months) compared with IPF. Patients with UCTD-ILD are more likely to have improved pulmonary function during follow-up than those with IPF. These findings demonstrate the clinical importance of identifying UCTD in patients presenting with an "idiopathic" interstitial pneumonia.

  2. Biomarkers in connective tissue disease-associated interstitial lung disease.

    Science.gov (United States)

    Bonella, Francesco; Costabel, Ulrich

    2014-04-01

    This article reviews major biomarkers in serum and bronchoalveolar lavage fluid (BALF) with respect to their diagnostic and prognostic value in connective tissue disease-associated interstitial lung disease (CTD-ILD). In some CTD such as systemic sclerosis (SSc), the incidence of ILD is up to two-third of patients, and currently ILD represents the leading cause of death in SSc. Because of the extremely variable incidence and outcome of ILD in CTD, progress in the discovery and validation of biomarkers for diagnosis, prognosis, patients' subtyping, response to treatment, or as surrogate endpoints in clinical trials is extremely important. In contrast to idiopathic interstitial pneumonias, autoantibodies play a crucial role as biomarkers in CTD-ILD because their presence is strictly linked to the pathogenesis and tissue damage. Patterns of autoantibodies, for instance, anticitrullinated peptide antibodies in rheumatoid arthritis or aminoacyl-tRNA synthetases (ARS) in polymyositis/dermatomyositis, have been found to correlate with the presence and occasionally with the course of ILD in CTD. Besides autoantibodies, an increase in serum or BALF of a biomarker of pulmonary origin may be able to predict or reflect the development of fibrosis, the impairment of lung function, and ideally also the prognosis. Promising biomarkers are lung epithelium-derived proteins such as KL-6 (Krebs von den Lungen-6), SP-D (surfactant protein-D), SP-A (surfactant protein-A), YKL-40 (chitinase-3-like protein 1 [CHI3L1] or cytokines such as CCL18 [chemokine (C-C) motif ligand 18]). In the future, genetic/epigenetic markers, such as human leukocyte antigen (HLA) haplotypes, single nucleotide polymorphisms, and micro-RNA, may help to identify subtypes of patients with different needs of management and treatment strategies. PMID:24668534

  3. Fatal interstitial lung disease associated with oral erlotinib therapy for lung cancer

    International Nuclear Information System (INIS)

    Erlotinib is a Human Epidermal Growth Factor Receptor Type 1/tyrosine kinase (EGFR) inhibitor which is used for non-small-cell lung cancer treatment. Despite that erlotinib is considered to have a favorable safety profile, adverse events such as interstitial lung disease (ILD) were reported in pivotal studies. The authors report the first histologically confirmed case of fatal ILD associated with erlotinib therapy. The medical record of a patient who developed fatal ILD after receiving erlotinib treatment was reviewed to identify the cause of death and other factors potentially contributive to this adverse outcome. A 55-year-old smoker with no evidence of pre-existing interstitial disease developed bilateral ILD and respiratory failure which could be explained only as a toxicity of erlotinib. He had a history of stage IV left upper lobe squamous-cell carcinoma for which he had received three successive regimens of chemotherapy (ifosfamide plus gemcitabine, docetaxel, mitomycin plus navelbine), followed five months later by erlotinib. At initiation of erlotinib treatment there were no radiological signs suggestive of ILD disease or apparent clinical signs of respiratory distress. While the patient completed two months with erlotinib therapy he developed bilateral interstitial infiltrates; despite discontinuation of erlotinib he was admitted with respiratory failure two weeks later. Diagnostic work up for other causes of pneumonitis including infectious diseases, congestive cardiac failure and pulmonary infraction was negative. Empiric treatment with oxygene, corticosteroids and later with cyclophosphamide was ineffective and the patient progressively deteriorated and died. The clinical and post-mortem examination findings are presented and the possible association relationship between erlotinib induced ILD and previous chemotherapy is discussed. Physicians should be alert to the fact that erlotinib related ILD, although infrequent, is potential fatal. The

  4. American Association of Dental Schools Curricular Guidelines for Oral Radiology.

    Science.gov (United States)

    Journal of Dental Education, 1980

    1980-01-01

    Oral radiology curricular guidelines developed by the American Association of Dental Schools are provided. The guidelines describe minimal conditions under which a satisfactory educational experience can be offered. Principles of x-radiation, radiobiological concepts, radiological health, radiographic technique, radiographic quality, and darkroom…

  5. American Association of Dental Schools Curricular Guidelines for Orthodontics.

    Science.gov (United States)

    Journal of Dental Education, 1980

    1980-01-01

    Guidelines reviewed and approved by the American Association of Dental Schools and sent to the Council on Dental Education in June 1979 are outlined. Educational goals and objectives and sequence of instruction (including growth and development, preclinical orthodontics, and clinical experience) are discussed. (MLW)

  6. Associations among Asian Americans' Enculturation, Emotional Experiences, and Depressive Symptoms

    Science.gov (United States)

    Wong, Y. Joel; Tran, Kimberly K.; Lai, Andre

    2009-01-01

    Using a computer-based text analysis of 218 Asian Americans' writing samples, the authors found that enculturation as well as use of negative emotion and positive emotion words were associated with depressive symptoms. Enculturation was also found to moderate the relation between use of negative emotion words and cognitive--affective depressive…

  7. Past and future American Psychological Association guidelines for statistical practice

    NARCIS (Netherlands)

    Finch, S; Thomason, N; Cumming, G

    2002-01-01

    We review the publication guidelines of the American Psychological Association (APA) since 1929 and document their advice for authors about statistical practice. Although the advice has been extended with each revision of the guidelines, it has largely focused on null hypothesis significance testing

  8. Genetic variants associated with lung function: the long life family study

    OpenAIRE

    Thyagarajan, Bharat; Wojczynski, Mary; Minster, Ryan L.; Sanders, Jason; Barral, Sandra; Christiansen, Lene; Barr, R Graham; ,; Newman, Anne

    2014-01-01

    Background Reduced forced expiratory volume in 1 second (FEV1) and the ratio of FEV1 to forced vital capacity (FVC) are strong predictors of mortality and lung function is higher among individuals with exceptional longevity. However, genetic factors associated with lung function in individuals with exceptional longevity have not been identified. Method We conducted a genome wide association study (GWAS) to identify novel genetic variants associated with lung function in the Long Life Family S...

  9. Structure-Activity Association of Flavonoids in Lung Diseases

    Directory of Open Access Journals (Sweden)

    João Henrique G. Lago

    2014-03-01

    Full Text Available Flavonoids are polyphenolic compounds classified into flavonols, flavones, flavanones, isoflavones, catechins, anthocyanidins, and chalcones according to their chemical structures. They are abundantly found in Nature and over 8,000 flavonoids have from different sources, mainly plant materials, have been described. Recently reports have shown the valuable effects of flavonoids as antiviral, anti-allergic, antiplatelet, antitumor, antioxidant, and anti-inflammatory agents and interest in these compounds has been increasing since they can be helpful to human health. Several mechanisms of action are involved in the biological properties of flavonoids such as free radical scavenging, transition metal ion chelation, activation of survival genes and signaling pathways, regulation of mitochondrial function and modulation of inflammatory responses. The anti-inflammatory effects of flavonoids have been described in a number of studies in the literature, but not frequently associated to respiratory disease. Thus, this review aims to discuss the effects of different flavonoids in the control of lung inflammation in some disorders such as asthma, lung emphysema and acute respiratory distress syndrome and the possible mechanisms of action, as well as establish some structure-activity relationships between this biological potential and chemical profile of these compounds.

  10. The association of systemic microvascular changes with lung function and lung density: a cross-sectional study.

    Directory of Open Access Journals (Sweden)

    Bianca Harris

    Full Text Available Smoking causes endothelial dysfunction and systemic microvascular disease with resultant end-organ damage in the kidneys, eyes and heart. Little is known about microvascular changes in smoking-related lung disease. We tested if microvascular changes in the retina, kidneys and heart were associated with obstructive spirometry and low lung density on computed tomography. The Multi-Ethnic Study of Atherosclerosis recruited participants age 45-84 years without clinical cardiovascular disease. Measures of microvascular function included retinal arteriolar and venular caliber, urine albumin-to-creatinine ratio and, in a subset, myocardial blood flow on magnetic resonance imaging. Spirometry was measured following ATS/ERS guidelines. Low attenuation areas (LAA were measured on lung fields of cardiac computed tomograms. Regression models adjusted for pulmonary and cardiac risk factors, medications and body size. Among 3,397 participants, retinal venular caliber was inversely associated with forced expiratory volume in one second (FEV(1 (P<0.001 and FEV(1/forced vital capacity (FVC ratio (P = 0.04. Albumin-to-creatinine ratio was inversely associated with FEV(1 (P = 0.002 but not FEV(1/FVC. Myocardial blood flow (n = 126 was associated with lower FEV(1 (P = 0.02, lower FEV(1/FVC (P = 0.001 and greater percentage LAA (P = 0.04. Associations were of greater magnitude among smokers. Low lung function was associated with microvascular changes in the retina, kidneys and heart, and low lung density was associated with impaired myocardial microvascular perfusion. These cross-sectional results suggest that microvascular damage with end-organ dysfunction in all circulations may pertain to the lung, that lung dysfunction may contribute to systemic microvascular disease, or that there may be a shared predisposition.

  11. Multi-walled carbon nanotube-induced gene expression in the mouse lung: Association with lung pathology

    International Nuclear Information System (INIS)

    Due to the fibrous shape and durability of multi-walled carbon nanotubes (MWCNT), concerns regarding their potential for producing environmental and human health risks, including carcinogenesis, have been raised. This study sought to investigate how previously identified lung cancer prognostic biomarkers and the related cancer signaling pathways are affected in the mouse lung following pharyngeal aspiration of well-dispersed MWCNT. A total of 63 identified lung cancer prognostic biomarker genes and major signaling biomarker genes were analyzed in mouse lungs (n = 80) exposed to 0, 10, 20, 40, or 80 μg of MWCNT by pharyngeal aspiration at 7 and 56 days post-exposure using quantitative PCR assays. At 7 and 56 days post-exposure, a set of 7 genes and a set of 11 genes, respectively, showed differential expression in the lungs of mice exposed to MWCNT vs. the control group. Additionally, these significant genes could separate the control group from the treated group over the time series in a hierarchical gene clustering analysis. Furthermore, 4 genes from these two sets of significant genes, coiled-coil domain containing-99 (Ccdc99), muscle segment homeobox gene-2 (Msx2), nitric oxide synthase-2 (Nos2), and wingless-type inhibitory factor-1 (Wif1), showed significant mRNA expression perturbations at both time points. It was also found that the expression changes of these 4 overlapping genes at 7 days post-exposure were attenuated at 56 days post-exposure. Ingenuity Pathway Analysis (IPA) found that several carcinogenic-related signaling pathways and carcinogenesis itself were associated with both the 7 and 11 gene signatures. Taken together, this study identifies that MWCNT exposure affects a subset of lung cancer biomarkers in mouse lungs. - Research highlights: → Multi-Walled Carbon Nanotubes affect lung cancer biomarkers in mouse lungs. → The results suggest potentially harmful effects of MWCNT exposure on human lungs. → The results could potentially be used

  12. Vitamin D intake is associated with insulin sensitivity in African American, but not European American, women

    Directory of Open Access Journals (Sweden)

    Oster Robert A

    2010-04-01

    Full Text Available Abstract Background The prevalence of type 2 diabetes is higher among African Americans (AA vs European Americans (EA, independent of obesity and other known confounders. Although the reason for this disparity is not known, it is possible that relatively low levels of vitamin D among AA may contribute, as vitamin D has been positively associated with insulin sensitivity in some studies. The objective of this study was to test the hypothesis that dietary vitamin D would be associated with a robust measure of insulin sensitivity in AA and EA women. Methods Subjects were 115 African American (AA and 137 European American (EA healthy, premenopausal women. Dietary intake was determined with 4-day food records; the insulin sensitivity index (SI with a frequently-sampled intravenous glucose tolerance test and minimal modeling; the Homeostasis Model Assessment of Insulin Resistance (HOMA-IR with fasting insulin and glucose; and body composition with dual-energy X-ray absorptiometry. Results Vitamin D intake was positively associated with SI (standardized β = 0.18, P = 0.05 and inversely associated with HOMA-IR (standardized β = -0.26, P = 0.007 in AA, and the relationships were independent of age, total body fat, energy intake, and % kcal from fat. Vitamin D intake was not significantly associated with indices of insulin sensitivity/resistance in EA (standardized β = 0.03, P = 0.74 and standardized β = 0.02, P = 0.85 for SI and HOMA-IR, respectively. Similar to vitamin D, dietary calcium was associated with SI and HOMA-IR among AA but not EA. Conclusions This study provides novel findings that dietary vitamin D and calcium were independently associated with insulin sensitivity in AA, but not EA. Promotion of these nutrients in the diet may reduce health disparities in type 2 diabetes risk among AA, although longitudinal and intervention studies are required.

  13. The American Library Association in Latin America: American Librarianship as a "Modern" Model during the Good Neighbor Policy Era.

    Science.gov (United States)

    Maymi-Sugranes, Hector J.

    2002-01-01

    Through American Library Association (ALA) projects in Latin America, American librarianship progressed from conceptualization to implementation as the model in modernizing Latin American library practices and societies. Development of library practices was fundamental to pursuit of a "modern" society. In fighting fascist propaganda, the United…

  14. Expression of metallothionein-3 gene associated with lung adenocarcinoma

    Institute of Scientific and Technical Information of China (English)

    LU Ji-zhong; HUANG Sheng-dong; LI Ji-xi; JI Chao-neng; YU Wei-yong; XU Zhi-yun

    2006-01-01

    Objective:To explore the role of metallothionein-3 gene in lung adenocarcinoma. Methods:cDNA microarray and northern blots analysis were used to study the expression of metallothionein-3 in lung adenocarcinoma. Results: The results of cDNA microarray showed that metallothionein-3 gene was expressed highly to normal lung tissues at the average ratio of 7.8 (Cy5/Cy3) in lung adenocarcinoma tissues. Northern blots confirmed the ratio changes detected from the microarray. Conclusion: Metallothionein-3 may play an important role in the lung adenocarcinoma development.

  15. Pilot study exploring lung allograft surfactant protein A (SP-A) expression in association with lung transplant outcome.

    Science.gov (United States)

    D'Ovidio, F; Kaneda, H; Chaparro, C; Mura, M; Lederer, D; Di Angelo, S; Takahashi, H; Gutierrez, C; Hutcheon, M; Singer, L G; Waddell, T K; Floros, J; Liu, M; Keshavjee, S

    2013-10-01

    Primary graft failure and chronic lung allograft dysfunction (CLAD) limit lung transplant long-term outcomes. Various lung diseases have been correlated with surfactant protein (SP) expression and polymorphisms. We sought to investigate the role of SP expression in lung allografts prior to implantation, in relation to posttransplant outcomes. The expression of SP-(A, B, C, D) mRNA was assayed in 42 allografts. Posttransplant assessments include pulmonary function tests, bronchoscopy, broncho-alveolar lavage fluid (BALF) and biopsies to determine allograft rejection. BALF was assayed for SP-A, SP-D in addition to cytokines IL-8, IL-12 and IL-2. The diagnosis of CLAD was evaluated 6 months after transplantation. Lung allografts with low SP-A mRNA expression prior to implantation reduced survival (Log-rank p < 0.0001). No association was noted for the other SPs. Allografts with low SP-A mRNA had greater IL-2 (p = 0.03) and IL-12 (p < 0.0001) in the BALF and a greater incidence of rejection episodes (p = 0.003). Levels of SP-A mRNA expression were associated with the SP-A2 polymorphisms (p = 0.015). Specifically, genotype 1A1A(0) was associated with lower SP-A mRNA expression (p < 0.05). Lung allografts with low levels of SP-A mRNA expression are associated with reduced survival. Lung allograft SP-A mRNA expression appears to be associated with SP-A gene polymorphisms.

  16. Multiple loci associated with renal function in African Americans.

    Directory of Open Access Journals (Sweden)

    Daniel Shriner

    Full Text Available The incidence of chronic kidney disease varies by ethnic group in the USA, with African Americans displaying a two-fold higher rate than European Americans. One of the two defining variables underlying staging of chronic kidney disease is the glomerular filtration rate. Meta-analysis in individuals of European ancestry has identified 23 genetic loci associated with the estimated glomerular filtration rate (eGFR. We conducted a follow-up study of these 23 genetic loci using a population-based sample of 1,018 unrelated admixed African Americans. We included in our follow-up study two variants in APOL1 associated with end-stage kidney disease discovered by admixture mapping in admixed African Americans. To address confounding due to admixture, we estimated local ancestry at each marker and global ancestry. We performed regression analysis stratified by local ancestry and combined the resulting regression estimates across ancestry strata using an inverse variance-weighted fixed effects model. We found that 11 of the 24 loci were significantly associated with eGFR in our sample. The effect size estimates were not significantly different between the subgroups of individuals with two copies of African ancestry vs. two copies of European ancestry for any of the 11 loci. In contrast, allele frequencies were significantly different at 10 of the 11 loci. Collectively, the 11 loci, including four secondary signals revealed by conditional analyses, explained 14.2% of the phenotypic variance in eGFR, in contrast to the 1.4% explained by the 24 loci in individuals of European ancestry. Our findings provide insight into the genetic basis of variation in renal function among admixed African Americans.

  17. Rheumatoid Arthritis (RA) associated interstitial lung disease (ILD).

    Science.gov (United States)

    O'Dwyer, David N; Armstrong, Michelle E; Cooke, Gordon; Dodd, Jonathan D; Veale, Douglas J; Donnelly, Seamas C

    2013-10-01

    Rheumatoid Arthritis (RA) is the most common Connective Tissue Disease (CTD) and represents an increasing burden on global health resources. Interstitial lung disease (ILD) has been recognised as a complication of RA but its potential for mortality and morbidity has arguably been under appreciated for decades. New studies have underscored a significant lifetime risk of ILD development in RA. Contemporary work has identified an increased risk of mortality associated with the Usual Interstitial Pneumonia (UIP) pattern which shares similarity with the most devastating of the interstitial pulmonary diseases, namely Idiopathic Pulmonary Fibrosis (IPF). In this paper, we discuss recent studies highlighting the associated increase in mortality in RA-UIP. We explore associations between radiological and histopathological features of RA-ILD and the prognostic implications of same. We emphasise the need for translational research in this area given the growing burden of RA-ILD. We highlight the importance of the respiratory physician as a key stakeholder in the multidisciplinary management of this disorder. RA-ILD focused research offers the opportunity to identify early asymptomatic disease and define the natural history of this extra articular manifestation. This may provide a unique opportunity to define key regulatory fibrotic events driving progressive disease. We also discuss some of the more challenging and novel aspects of therapy for RA-ILD.

  18. The association between combined non-cystic fibrosis bronchiectasis and lung cancer in patients with chronic obstructive lung disease

    Directory of Open Access Journals (Sweden)

    Kim YW

    2015-05-01

    Full Text Available Yeon Wook Kim,1 Kwang-Nam Jin,2 Eun Young Heo,3 Sung Soo Park,3 Hee Soon Chung,3 Deog Kyeom Kim31Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Seoul National University College of Medicine, Seoul, Republic of Korea; 2Department of Radiology, Seoul National University College of Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, Seoul, Republic of Korea; 3Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, Seoul National University College of Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, Seoul, Republic of KoreaBackground: Whereas the epidemiological association between lung cancer and chronic obstructive pulmonary disease (COPD, a chronic inflammatory respiratory disease, is well known, limited studies have examined the association between lung cancer and non-cystic fibrosis bronchiectasis, a representative chronic airway inflammatory disease. This study evaluated the association between bronchiectasis and lung cancer in patients with COPD.Methods: A matched case–control study was conducted in a referral hospital in South Korea. Among COPD patients with moderate to very severe airflow limitation (forced expiratory volume in one second/forced vital capacity <0.7 and forced expiratory volume in one second ≤70% [% predicted] who underwent chest computed tomography (CT between January 1, 2010 and May 30, 2013, patients with lung cancer and controls matched for age, sex, and smoking history were selected. The risk of lung cancer was assessed according to the presence of underlying bronchiectasis confirmed by chest CT.Results: The study enrolled 99 cases and 198 controls. Combined bronchiectasis on chest CT was inversely associated with the risk of lung cancer compared with controls (odds ratio [OR] 0.25, 95% confidence interval [CI] 0.12–0.52, P<0.001. Significant associations were found in

  19. Recommendations for responsible monitoring and regulation of clinical software systems. American Medical Informatics Association, Computer-based Patient Record Institute, Medical Library Association, Association of Academic Health Science Libraries, American Health Information Management Association, American Nurses Association.

    Science.gov (United States)

    Miller, R A; Gardner, R M

    1997-01-01

    In mid-1996, the FDA called for discussions on regulation of clinical software programs as medical devices. In response, a consortium of organizations dedicated to improving health care through information technology has developed recommendations for the responsible regulation and monitoring of clinical software systems by users, vendors, and regulatory agencies. Organizations assisting in development of recommendations, or endorsing the consortium position include the American Medical Informatics Association, the Computer-based Patient Record Institute, the Medical Library Association, the Association of Academic Health Sciences Libraries, the American Health Information Management Association, the American Nurses Association, the Center for Healthcare Information Management, and the American College of Physicians. The consortium proposes four categories of clinical system risks and four classes of measured monitoring and regulatory actions that can be applied strategically based on the level of risk in a given setting. The consortium recommends local oversight of clinical software systems, and adoption by healthcare information system developers of a code of good business practices. Budgetary and other constraints limit the type and number of systems that the FDA can regulate effectively. FDA regulation should exempt most clinical software systems and focus on those systems posing highest clinical risk, with limited opportunities for competent human intervention. PMID:9391932

  20. Recommendations for responsible monitoring and regulation of clinical software systems. American Medical Informatics Association, Computer-based Patient Record Institute, Medical Library Association, Association of Academic Health Science Libraries, American Health Information Management Association, American Nurses Association.

    Science.gov (United States)

    Miller, R A; Gardner, R M

    1997-01-01

    In mid-1996, the FDA called for discussions on regulation of clinical software programs as medical devices. In response, a consortium of organizations dedicated to improving health care through information technology has developed recommendations for the responsible regulation and monitoring of clinical software systems by users, vendors, and regulatory agencies. Organizations assisting in development of recommendations, or endorsing the consortium position include the American Medical Informatics Association, the Computer-based Patient Record Institute, the Medical Library Association, the Association of Academic Health Sciences Libraries, the American Health Information Management Association, the American Nurses Association, the Center for Healthcare Information Management, and the American College of Physicians. The consortium proposes four categories of clinical system risks and four classes of measured monitoring and regulatory actions that can be applied strategically based on the level of risk in a given setting. The consortium recommends local oversight of clinical software systems, and adoption by healthcare information system developers of a code of good business practices. Budgetary and other constraints limit the type and number of systems that the FDA can regulate effectively. FDA regulation should exempt most clinical software systems and focus on those systems posing highest clinical risk, with limited opportunities for competent human intervention.

  1. Two cases of liver alveolar echinococcosis associated with simultaneous lung and brain metastases

    Institute of Scientific and Technical Information of China (English)

    蒋次鹏

    2002-01-01

    @@ Alveolar echinococcosis (AE) of liver associated with simultaneous lung and brain metastases is rare clinically. During a period of 15 years (1985-2000), 2 (1.9%) of 103 cases with liver AE diagnosed at our laboratory were associated with simultaneous lung or brain metastases.1 They were confirmed pathologically through surgical biopsy or autopsy respectively, and reported as follows.

  2. SMC4, which is essentially involved in lung development, is associated with lung adenocarcinoma progression

    Science.gov (United States)

    Zhang, Chengli; Kuang, Manchao; Li, Meng; Feng, Lin; Zhang, Kaitai; Cheng, Shujun

    2016-01-01

    Structural maintenance of chromosome 4 (SMC4) is a core subunit of condensin complexes that mainly contributes to chromosome condensation and segregation. Our previous study demonstrated that the gene expression profile during lung development is of great values for the study of lung cancer. In this study, we identified SMC4 through co-expression network analysis and clique percolation clustering using genes that constant changes during four stages of lung development. Gene ontology and KEGG pathway enrichment analysis demonstrated that SMC4 is closely related to cell cycle, cell adhesion, and RNA processing in lung development and carcinogenesis. Moreover, SMC4 is overexpressed in lung adenocarcinoma tissues and acts as an independent prognostic factor. SMC4 knockdown significantly inhibits the proliferation and invasion of A549 cells. Furthermore, we found that SMC4 interacts with DDX46 (DEAD-box helicase 46). In conclusion, the pivotal role of SMC4 in lung development and carcinogenesis suggests that genes with a similar expression pattern to SMC4 in lung development may also contribute to lung cancer progression. The identification of genes that are essentially involved in development through a comparative study between development and cancer may be a practical strategy for discovering potential biomarkers and illuminating the mechanisms of carcinogenesis. PMID:27687868

  3. 76 FR 22709 - Medicare and Medicaid Programs; Approval of the American Association for Accreditation of...

    Science.gov (United States)

    2011-04-22

    ... HUMAN SERVICES Centers for Medicare & Medicaid Services Medicare and Medicaid Programs; Approval of the American Association for Accreditation of Ambulatory Surgery Facilities, Inc. for Deeming Authority for... decision to approve the American Association for Accreditation of Ambulatory Surgery Facilities...

  4. RELATED GENES IN LUNG CANCER TISSUES ASSOCIATED WITH RESIDENTIAL HIGH RADON EXPOSURE

    Institute of Scientific and Technical Information of China (English)

    夏英; 杨梅英; 张守志; 叶常青

    2002-01-01

    Objective: To investigate the related genes in lung cancer tissues associated with residential high radon exposure. Methods: Differentially expressed gene fragments in lung cancer and normal lung tissues were discovered by differential display and reverse Northern blot hybridization method. The fragments positive in lung cancer and negative in normal lung tissue were determined. Results: Seven differential displayed fragments were sequenced. One of them named NA7 is 95% homologous with AI208667 in EAT of Genbank. Another fragment named NG2 is up to 98% homologous with five fragments. The remained one CA1 may be a new gene fragment. Conclusion: 3 gene fragments were discovered from lung cancer and normal lung tissues of high radon exposure resident.

  5. A Rare Presentation of Right Lung Hypoplasia Associated with Dextrocardia and Visceral Malposition

    Directory of Open Access Journals (Sweden)

    Ayşe Yıldırım

    2012-08-01

    Full Text Available Lung hypoplasia is often associated with pulmonary venous return abnormalities, referred to as the Scimitar syndrome, in pediatric patients. A two day-old male patient presented to our clinic with respiratory distress and mild cyanosis. Diagnostic studies revealed dextrocardia, right sided hypoplasia of upper and middle lung lobes and enlargement of the left lung due to the compensation, midline liver, right sided stomach and right sided spleen. No pulmonary venous return abnormalities were detected. This is the first report of lung hypoplasia associated with heterotaxy, visceral malposition and normal pulmonary venous return.

  6. Donor surfactant protein D (SP-D) polymorphisms are associated with lung transplant outcome.

    Science.gov (United States)

    Aramini, B; Kim, C; Diangelo, S; Petersen, E; Lederer, D J; Shah, L; Robbins, H; Floros, J; Arcasoy, S M; Sonett, J R; D'Ovidio, F

    2013-08-01

    Chronic lung allograft dysfunction (CLAD) is the major factor limiting long-term success of lung transplantation. Polymorphisms of surfactant protein D (SP-D), an important molecule within lung innate immunity, have been associated with various lung diseases. We investigated the association between donor lung SP-D polymorphisms and posttransplant CLAD and survival in 191 lung transplant recipients consecutively transplanted. Recipients were prospectively followed with routine pulmonary function tests. Donor DNA was assayed by pyrosequencing for SP-D polymorphisms of two single-nucleotide variations altering amino acids in the mature protein N-terminal domain codon 11 (Met(11) Thr), and in codon 160 (Ala(160) Thr) of the C-terminal domain. CLAD was diagnosed in 88/191 patients, and 60/191 patients have died. Recipients of allografts that expressed the homozygous Met(11) Met variant of aa11 had significantly greater freedom from CLAD development and better survival compared to those with the homozygous Thr(11) Th variant of aa11. No significant association was noted for SP-D variants of aa160. Lung allografts with the SP-D polymorphic variant Thr(11) Th of aa11 are associated with development of CLAD and reduced survival. The observed genetic differences of the donor lung, potentially with their effects on innate immunity, may influence the clinical outcomes after lung transplantation.

  7. Palliative Care and Cardiovascular Disease and Stroke: A Policy Statement From the American Heart Association/American Stroke Association.

    Science.gov (United States)

    Braun, Lynne T; Grady, Kathleen L; Kutner, Jean S; Adler, Eric; Berlinger, Nancy; Boss, Renee; Butler, Javed; Enguidanos, Susan; Friebert, Sarah; Gardner, Timothy J; Higgins, Phil; Holloway, Robert; Konig, Madeleine; Meier, Diane; Morrissey, Mary Beth; Quest, Tammie E; Wiegand, Debra L; Coombs-Lee, Barbara; Fitchett, George; Gupta, Charu; Roach, William H

    2016-09-13

    The mission of the American Heart Association/American Stroke Association includes increasing access to high-quality, evidence-based care that improves patient outcomes such as health-related quality of life and is consistent with the patients' values, preferences, and goals. Awareness of and access to palliative care interventions align with the American Heart Association/American Stroke Association mission. The purposes of this policy statement are to provide background on the importance of palliative care as it pertains to patients with advanced cardiovascular disease and stroke and their families and to make recommendations for policy decisions. Palliative care, defined as patient- and family-centered care that optimizes health-related quality of life by anticipating, preventing, and treating suffering, should be integrated into the care of all patients with advanced cardiovascular disease and stroke early in the disease trajectory. Palliative care focuses on communication, shared decision making about treatment options, advance care planning, and attention to physical, emotional, spiritual, and psychological distress with inclusion of the patient's family and care system. Our policy recommendations address the following: reimbursement for comprehensive delivery of palliative care services for patients with advanced cardiovascular disease and stroke; strong payer-provider relationships that involve data sharing to identify patients in need of palliative care, identification of better care and payment models, and establishment of quality standards and outcome measurements; healthcare system policies for the provision of comprehensive palliative care services during hospitalization, including goals of care, treatment decisions, needs of family caregivers, and transition to other care settings; and health professional education in palliative care as part of licensure requirements. PMID:27503067

  8. Palliative Care and Cardiovascular Disease and Stroke: A Policy Statement From the American Heart Association/American Stroke Association.

    Science.gov (United States)

    Braun, Lynne T; Grady, Kathleen L; Kutner, Jean S; Adler, Eric; Berlinger, Nancy; Boss, Renee; Butler, Javed; Enguidanos, Susan; Friebert, Sarah; Gardner, Timothy J; Higgins, Phil; Holloway, Robert; Konig, Madeleine; Meier, Diane; Morrissey, Mary Beth; Quest, Tammie E; Wiegand, Debra L; Coombs-Lee, Barbara; Fitchett, George; Gupta, Charu; Roach, William H

    2016-09-13

    The mission of the American Heart Association/American Stroke Association includes increasing access to high-quality, evidence-based care that improves patient outcomes such as health-related quality of life and is consistent with the patients' values, preferences, and goals. Awareness of and access to palliative care interventions align with the American Heart Association/American Stroke Association mission. The purposes of this policy statement are to provide background on the importance of palliative care as it pertains to patients with advanced cardiovascular disease and stroke and their families and to make recommendations for policy decisions. Palliative care, defined as patient- and family-centered care that optimizes health-related quality of life by anticipating, preventing, and treating suffering, should be integrated into the care of all patients with advanced cardiovascular disease and stroke early in the disease trajectory. Palliative care focuses on communication, shared decision making about treatment options, advance care planning, and attention to physical, emotional, spiritual, and psychological distress with inclusion of the patient's family and care system. Our policy recommendations address the following: reimbursement for comprehensive delivery of palliative care services for patients with advanced cardiovascular disease and stroke; strong payer-provider relationships that involve data sharing to identify patients in need of palliative care, identification of better care and payment models, and establishment of quality standards and outcome measurements; healthcare system policies for the provision of comprehensive palliative care services during hospitalization, including goals of care, treatment decisions, needs of family caregivers, and transition to other care settings; and health professional education in palliative care as part of licensure requirements.

  9. A critical review of the American Journal of Physiology-Lung Cellular and Molecular Physiology: 2012-2015.

    Science.gov (United States)

    Matalon, Sadis

    2014-12-15

    I have had the privilege of serving as Editor-in-Chief of the American Journal of Physiology: Lung Cellular and Molecular Physiology from 1/1/2012 to 1/1/2015 and have been reappointed for another 3-year term. When I took over as editor, I published an editorial in AJP-Lung in which I highlighted my vision and outlined the tasks to be accomplished to transform AJP-Lung into "The best place to publish basic, translational, and hypothesis-driven clinical lung research." Herein I review our accomplishments during the first term. As promised, we review each article submitted to this journal and our reviews always help the quality and impact of every paper. We recognized the contributions of junior authors by establishing a number of awards and increased the visibility of AJP-Lung by establishing Facebook and Blog electronic pages and sponsoring symposia in scientific meetings. Our impact factor increased from 3.523 in 2011 to 4.041 in 2012 and, thanks to our calls for papers, we are receiving large numbers of high-quality papers in all aspects of pulmonary cell biology and lung diseases. The best is yet to come. PMID:25381028

  10. High procedure volume is strongly associated with improved survival after lung cancer surgery

    DEFF Research Database (Denmark)

    Lüchtenborg, Margreet; Riaz, Sharma P; Coupland, Victoria H;

    2013-01-01

    Studies have reported an association between hospital volume and survival for non-small-cell lung cancer (NSCLC). We explored this association in England, accounting for case mix and propensity to resect.......Studies have reported an association between hospital volume and survival for non-small-cell lung cancer (NSCLC). We explored this association in England, accounting for case mix and propensity to resect....

  11. Cystic changes in mucosa-associated lymphoid tissue lymphoma of lung: a case report

    Institute of Scientific and Technical Information of China (English)

    MIAO Li-yun; CAI Hou-rong

    2009-01-01

    @@ Mucosa-associated lymphoid tissue (MALT) is a term that describes lymphoid tissue in various sites of the body, such as the gastrointestinal tract, thyroid, breast, lung, salivary glands, eye, and skin. MALT lymphoma of the lung is a subset of primary pulmonary lymphomas which originates from the MALT. Previously reported computed tomographic (CT) features of MALT lymphoma are the presence of consolidation or nodules in the lungs. 1-4

  12. CT Air Trapping Is Independently Associated with Lung Function Reduction over Time

    OpenAIRE

    Mets, O.M.; de Jong, P. A.; van Ginneken, B.; Kruitwagen, C.L.J.J.; Prokop, M; Oudkerk, M; Lammers, J. W.; Zanen, P.

    2013-01-01

    Purpose We aimed to study the association between lung function decline and quantitative computed tomography (CT) air trapping. Materials and Methods Current and former heavy smokers in a lung cancer screening trial underwent volumetric low-dose CT in inspiration and expiration. Spirometry was obtained at baseline and after 3 years. The expiratory to inspiratory ratio of mean lung density (E/I-ratioMLD) was used to quantify air trapping. CT emphysema was defined as voxels in inspiratory CT be...

  13. Fatal pneumonitis associated with postoperative intensity-modulated radiotherapy in lung cancer: Case report and review

    OpenAIRE

    Hu, Yan; Li, Jingjing; SU, XIAOYAN

    2012-01-01

    Radiation pneumonitis (RP) is the most significant complication of acute treatment-related toxicities in lung cancer. Intensity-modulated radiotherapy (IMRT) with inverse planning enables us to achieve the desired dose distribution. However, there are many high-risk procedures associated with lung irradiation, including chemotherapy and surgery. We report a case of fatal treatment-related pneumonitis, where the patient had undergone postoperative IMRT for lung cancer. Following completion of ...

  14. Distribution and surfactant association of carcinoembryonic cell adhesion molecule 6 in human lung

    OpenAIRE

    Chapin, Cheryl; Bailey, Nicole A.; Gonzales, Linda W.; Lee, Jae-Woo; Gonzalez, Robert F.; Ballard, Philip L.

    2011-01-01

    Carcinoembryonic cell adhesion molecule 6 (CEACAM6) is a glycosylated, glycophosphatidylinositol-anchored protein expressed in epithelial cells of various primate tissues. It binds gram-negative bacteria and is overexpressed in human cancers. CEACAM6 is associated with lamellar bodies of cultured type II cells of human fetal lung and protects surfactant function in vitro. In this study, we characterized CEACAM6 expression in vivo in human lung. CEACAM6 was present in lung lavage of premature ...

  15. Pseudomonas aeruginosa vesicles associate with and are internalized by human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Kuehn Meta J

    2009-02-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is the major pathogen associated with chronic and ultimately fatal lung infections in patients with cystic fibrosis (CF. To investigate how P. aeruginosa-derived vesicles may contribute to lung disease, we explored their ability to associate with human lung cells. Results Purified vesicles associated with lung cells and were internalized in a time- and dose-dependent manner. Vesicles from a CF isolate exhibited a 3- to 4-fold greater association with lung cells than vesicles from the lab strain PAO1. Vesicle internalization was temperature-dependent and was inhibited by hypertonic sucrose and cyclodextrins. Surface-bound vesicles rarely colocalized with clathrin. Internalized vesicles colocalized with the endoplasmic reticulum (ER marker, TRAPα, as well as with ER-localized pools of cholera toxin and transferrin. CF isolates of P. aeruginosa abundantly secrete PaAP (PA2939, an aminopeptidase that associates with the surface of vesicles. Vesicles from a PaAP knockout strain exhibited a 40% decrease in cell association. Likewise, vesicles from PAO1 overexpressing PaAP displayed a significant increase in cell association. Conclusion These data reveal that PaAP promotes the association of vesicles with lung cells. Taken together, these results suggest that P. aeruginosa vesicles can interact with and be internalized by lung epithelial cells and contribute to the inflammatory response during infection.

  16. Evaluation and Diagnosis of HIV-Associated Lung Disease.

    Science.gov (United States)

    Maximous, Stephanie; Huang, Laurence; Morris, Alison

    2016-04-01

    There are myriad pulmonary conditions associated with HIV, ranging from acute infections to chronic noncommunicable diseases. The epidemiology of these diseases has changed significantly in the era of widespread antiretroviral therapy. Evaluation of the HIV-infected patient involves assessment of the severity of illness and a thorough yet efficient pursuit of definitive diagnosis, which may involve multiple etiologies simultaneously. Important clues to a diagnosis include medical and social history, demographic details such as travel and geography of residence, substance use, sexual practices, and domiciliary and incarceration status. CD4 cell count is a tremendously useful measure of immune function and risk for HIV-related diseases, and helps narrow down the differential. Careful history of current symptoms and physical examination with particular attention to extrapulmonary signs are crucial early steps. Many adjunctive laboratory studies can suggest or rule out particular diagnoses. Pulmonary function testing (PFT) may aid in characterization of several chronic noninfectious illnesses accelerated by HIV. Chest radiograph and computed tomography (CT) scan allow for classification of diseases by pathognomonic imaging patterns, although many infectious conditions present atypically, particularly with lower CD4 counts. Ultimately, definitive diagnosis with sputum, bronchoscopy with bronchoalveolar lavage, or lung tissue is often needed. It is of utmost importance to maintain a high degree of suspicion for HIV in otherwise undiagnosed patients, as the first presentation of HIV may be via an acute pulmonary illness. PMID:26974298

  17. Bleomycin-associated Lung Toxicity in Childhood Cancer Survivors.

    Science.gov (United States)

    Zorzi, Alexandra P; Yang, Connie L; Dell, Sharon; Nathan, Paul C

    2015-11-01

    Pulmonary disease is a significant morbidity among childhood cancer survivors. The aim of this study was to characterize the pulmonary dysfunction experienced by childhood cancer survivors treated with bleomycin. A cross-sectional analysis of pulmonary function testing (PFT) in survivors treated with bleomycin was preformed. The most recent posttherapy PFT was assessed. Spirometry and lung volumes were categorized as normal, restrictive, obstructive, or mixed. Diffusing capacity of carbon monoxide (DLCO) was categorized as normal or abnormal. PFT data of 143 survivors was analyzed. PFTs were performed a median of 2.3 years (interquartile range, 1.4 to 4.9) from completion of therapy. Spirometry was abnormal in 58 (41%), only 5 (9%) had respiratory symptoms. Forty-two (70%) had obstructive, 11 (18%) restrictive, and 5 (9%) mixed ventilatory defects. The majority of abnormalities were mild (91%). DLCO was abnormal in 27. Reductions were mild in 96%. Patients with a history of relapse were more likely to develop abnormalities in spirometry and/or DLCO (odds ratio=5.02, 95% confidence interval: 1.3-19.4, P=0.01; odds ratio=3.47, 95% confidence interval: 1.01-11.9, P=0.03). Asymptomatic abnormalities of PFT are common among childhood cancer survivors treated with bleomycin and associated with a history of relapse. Research studying the risk for clinical progression of this dysfunction is warranted. PMID:26422284

  18. A novel model of rheumatoid arthritis-associated interstitial lung disease in SKG mice.

    Science.gov (United States)

    Keith, Rebecca C; Powers, Jennifer L; Redente, Elizabeth F; Sergew, Amen; Martin, Richard J; Gizinski, Alison; Holers, V Michael; Sakaguchi, Shimon; Riches, David W H

    2012-03-01

    Rheumatoid arthritis-associated interstitial lung disease (RA-ILD) is associated with increased mortality in up to 10% of patients with rheumatoid arthritis. Lung exposure to cigarette smoke has been implicated in disease development. Little is known about the mechanisms underlying the development of RA-ILD, in part due to the lack of an appropriate mouse model. The objectives of this study were (i) to test the suitability of SKG mice as a model of cellular and fibrotic interstitial pneumonia in the setting of autoimmune arthritis, and (ii) to determine the role of lung injury in the development of arthritis in SKG mice. Lung tissues were evaluated in arthritic SKG mice by quantifying cell accumulation in bronchoalveolar lavage, static compliance, collagen levels, and infiltrating cell phenotypes by flow cytometry and histology. Lung injury was induced by exposure to cigarette smoke or bleomycin. Arthritic SKG mice developed a patchy cellular and fibrotic interstitial pneumonia associated with reduced static compliance, increased collagen levels, and accumulation of inflammatory cells. Infiltrating cells comprised CD4+ T cells, B cells, macrophages, and neutrophils. Chronic exposure to cigarette smoke or initiation of lung injury with bleomycin did not cause arthritis. The pattern of lung disease suggests that arthritic SKG mice represent an authentic model of nonspecific interstitial pneumonia in RA-ILD patients. The lack of arthritis development after cigarette smoke or lung injury suggests that a model where breaches in immunologic tolerance are induced by lung inflammation and injury alone may be overly simplistic.

  19. Factors Associated With Overweight and Obesity Among Mexican Americans and Central Americans: Results From the 2001 California Health Interview Survey

    Directory of Open Access Journals (Sweden)

    Janice V. Bowie, PhD, MPH

    2007-01-01

    Full Text Available IntroductionHispanics are the fastest growing demographic group in the United States; however, “Hispanic” is a broad term that describes people who are from or whose ancestors are from multiple countries of origin. This study examines, separately, the social, cultural, and behavioral factors associated with overweight and obesity among Mexican American adults and among Central American adults. MethodsTo estimate the prevalence of overweight and obesity among Mexican and Central Americans living in California, we conducted a cross-sectional analysis of data from the 2001 California Health Interview Survey using SUDAAN software to account for the survey’s multistage sampling design.ResultsOf the 8304 Mexican Americans participating in the survey, 36.8% were overweight and 26.2% were obese. Of the 1019 Central Americans, 39.2% were overweight and 22.2% were obese. Among Mexican American men, age and marital status were associated with overweight and obesity; and education, acculturation, health insurance status, health status, and use of vitamins were associated with obesity only. Among Mexican American women, age, education, number of children, health status, and health behavior were associated with overweight and obesity. Among Central American men, age, education, and access to health care were associated with overweight, whereas marital status, acculturation, health care, and binge drinking were associated with obesity. Among Central American women, number of children was associated with overweight and obesity; and age and education were associated with obesity only. ConclusionsOur findings of high rates of overweight and obesity among Mexican and Central Americans in California indicate the need for a wide variety of effective weight-loss interventions targeting these populations, and the differences we found in the factors associated with overweight and obesity may suggest the need for unique intervention strategies for different

  20. Association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury after intensity-modulated radiotherapy in lung cancer: a retrospective analysis

    OpenAIRE

    Chen, Jinmei; Hong, Jinsheng; Zou, Xi; Lv, Wenlong; Guo, Feibao; Hong, Hualan; Zhang, Weijian

    2015-01-01

    The aim of this study was to investigate the association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury (RILI) after intensity-modulated radiotherapy (IMRT) for lung cancer. The normal lung relative volumes receiving greater than 5, 10, 20 and 30 Gy (V5–30) mean lung dose (MLD), and absolute volumes spared from greater than 5, 10, 20 and 30 Gy (AVS5–30) for the bilateral and ipsilateral lungs of 83 patients were recorded. Any association of...

  1. American Thoracic Society and National Heart, Lung, and Blood Institute Implementation Research Workshop Report.

    Science.gov (United States)

    Bender, Bruce G; Krishnan, Jerry A; Chambers, David A; Cloutier, Michelle M; Riekert, Kristin A; Rand, Cynthia S; Schatz, Michael; Thomson, Carey C; Wilson, Sandra R; Apter, Andrea; Carson, Shannon S; George, Maureen; Gerald, Joe K; Gerald, Lynn; Goss, Christopher H; Okelo, Sande O; Mularski, Richard A; Nguyen, Huong Q; Patel, Minal R; Szefler, Stanley J; Weiss, Curtis H; Wilson, Kevin C; Freemer, Michelle

    2015-12-01

    To advance implementation research (IR) in respiratory, sleep, and critical care medicine, the American Thoracic Society and the Division of Lung Diseases from the NHLBI cosponsored an Implementation Research Workshop on May 17, 2014. The goals of IR are to understand the barriers and facilitators of integrating new evidence into healthcare practices and to develop and test strategies that systematically target these factors to accelerate the adoption of evidence-based care. Throughout the workshop, presenters provided examples of IR that focused on the rate of adoption of evidence-based practices, the feasibility and acceptability of interventions to patients and other stakeholders who make healthcare decisions, the fidelity with which practitioners use specific interventions, the effects of specific barriers on the sustainability of an intervention, and the implications of their research to inform policies to improve patients' access to high-quality care. During the discussions that ensued, investigators' experience led to recommendations underscoring the importance of identifying and involving key stakeholders throughout the research process, ensuring that those who serve as reviewers understand the tenets of IR, managing staff motivation and turnover, and tackling the challenges of scaling up interventions across multiple settings.

  2. VEGFA variants are associated with pre-school lung function, but not neonatal lung function

    DEFF Research Database (Denmark)

    Kreiner-Møller, E; Chawes, B L K; Vissing, N H;

    2013-01-01

    Vascular endothelial growth factor (VEGF) is implicated in airway remodelling and asthma development. We studied VEGFA gene variants and plasma levels and the development of lung function, bronchial hyperresponsiveness and asthma in childhood.......Vascular endothelial growth factor (VEGF) is implicated in airway remodelling and asthma development. We studied VEGFA gene variants and plasma levels and the development of lung function, bronchial hyperresponsiveness and asthma in childhood....

  3. A case of interstitial lung disease associated with clinically amyopathic dermatomyositis: radiologic-pathologic correlation.

    Science.gov (United States)

    Okubo, Gosuke; Noma, Satoshi; Nishimoto, Yuko; Sada, Ryuichi; Kobashi, Yoichiro

    2013-01-01

    This case report describes a 64-year-old woman with interstitial lung disease associated with clinically amyopathic dermatomyositis. Chest computed tomography revealed consolidations along bronchovascular bundles in the periphery of the lower lungs. Interstitial lung disease developed acutely, and the patient died 3 months after the clinical diagnosis. An autopsy was performed, and a large section of the lung specimen was prepared. Various interstitial lesions including organizing pneumonia, cellular and fibrotic nonspecific interstitial pneumonia, and diffuse alveolar damage were seen in the large section. Correlating the large section and computed tomography images was useful for determining the distribution of diffuse alveolar damage.

  4. Connective Tissue Disease-associated Interstitial Lung Disease: A review

    OpenAIRE

    Gutsche, Markus; Rosen, Glenn D.; Swigris, Jeffrey J.

    2012-01-01

    Interstitial lung disease (ILD) is commonly encountered in patients with connective tissue diseases (CTD). Besides the lung parenchyma, the airways, pulmonary vasculature and structures of the chest wall may all be involved, depending on the type of CTD. As a result of this so-called multi-compartment involvement, airflow limitation, pulmonary hypertension, vasculitis and extrapulmonary restriction can occur alongside fibro-inflammatory parenchymal abnormalities in CTD. Rheumatoid arthritis (...

  5. Factors Associated With Overweight and Obesity Among Mexican Americans and Central Americans: Results From the 2001 California Health Interview Survey

    OpenAIRE

    Bowie, Janice V.; Juon, Hee-Soon; Rodriguez, Elisa M.; Cho, Juhee

    2006-01-01

    Introduction Hispanics are the fastest growing demographic group in the United States; however, "Hispanic" is a broad term that describes people who are from or whose ancestors are from multiple countries of origin. This study examines, separately, the social, cultural, and behavioral factors associated with overweight and obesity among Mexican American adults and among Central American adults. Methods To estimate the prevalence of overweight and obesity among Mexican and Central Americans li...

  6. American Telemedicine Association: First China (Tianjin International Telemedicine Technology Exhibition

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2014-09-01

    Full Text Available With the support of Tianjin Municipal People’s Government and the People’s Government of Binhai New Area, the “First China (Tianjin International Telemedicine Technology Exhibition” hosted by the American Telemedicine Association (ATA, will be held October 28- 30, 2014 at the Tianjin Binhai International Convention and Exhibition Center. The three day event will feature keynote sessions, concurrent discussion forums, exhibits (e.g., telemedicine, information technology, mHealth, a venture summit, meet-and-greet sessions for international and domestic companies for potential business collaboration, and policy discussions on China healthcare. For registration information: http://www.atacn.org/en/

  7. Lung Adenocarcinomas and Lung Cancer Cell Lines Show Association of MMP-1 Expression With STAT3 Activation

    Directory of Open Access Journals (Sweden)

    Alexander Schütz

    2015-04-01

    Full Text Available Signal transducer and activator of transcription 3 (STAT3 is constitutively activated in the majority of lung cancer. This study aims at defining connections between STAT3 function and the malignant properties of non–small cell lung carcinoma (NSCLC cells. To address possible mechanisms by which STAT3 influences invasiveness, the expression of matrix metalloproteinase-1 (MMP-1 was analyzed and correlated with the STAT3 activity status. Studies on both surgical biopsies and on lung cancer cell lines revealed a coincidence of STAT3 activation and strong expression of MMP-1. MMP-1 and tyrosine-phosphorylated activated STAT3 were found co-localized in cancer tissues, most pronounced in tumor fronts, and in particular in adenocarcinomas. STAT3 activity was constitutive, although to different degrees, in the lung cancer cell lines investigated. Three cell lines (BEN, KNS62, and A549 were identified in which STAT3 activitation was inducible by Interleukin-6 (IL-6. In A549 cells, STAT3 activity enhanced the level of MMP-1 mRNA and stimulated transcription from the MMP-1 promoter in IL-6–stimulated A549 cells. STAT3 specificity of this effect was confirmed by STAT3 knockdown through RNA interference. Our results link aberrant activity of STAT3 in lung cancer cells to malignant tumor progression through up-regulation of expression of invasiveness-associated MMPs.

  8. 77 FR 35317 - Gruma Corporation, Spina Bifida Association, March of Dimes Foundation, American Academy of...

    Science.gov (United States)

    2012-06-13

    ..., March of Dimes Foundation, American Academy of Pediatrics, Royal DSM N.V., and National Council of La... Bifida Association, March of Dimes Foundation, American Academy of Pediatrics, Royal DSM N.V., and... Association, March of Dimes Foundation, American Academy of Pediatrics, Royal DSM N.V., and National...

  9. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea;

    2016-01-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials for...

  10. American woodcock (Scolopax minor) mortality associated with a reovirus

    Science.gov (United States)

    Docherty, D.E.; Converse, K.A.; Hansen, W.R.; Norman, G.W.

    1994-01-01

    A virus isolate associated with a 1989-90 die-off in American woodcock (Scolopax minor) was identified as a reovirus. Emaciation was a consistent necropsy finding in the woodcock involved in this die-off. This reovirus infection appeared to be systemic, had the potential for fecal-oral virus transmission, and was associated with deterioration of body condition. To our knowledge this is the first report of a virus isolate from wild American woodcock. A survey conducted in 1990-92 indicated that this virus was not present at detectable levels in the woodcock breeding and wintering population. /// Un virus asociado con la mortalidad de becadas o perdices americanas (Scolopax minor) en 1989-1990-fue identificado como reovirus. La emaciaci??n fue un resultado com??n a la necropsia de las aves que murieron. Esta infecci??n por reovirus pareci?? ser sist??mica, ten?-a el potencial de transmisi??n fecal-oral y estuvo asociada con el deterioro del ave. Creemos que este sea el primer reporte de aislamiento viral a partir de becadas americanas. Una encuesta hecha entre 1990 y 1992 indic?? que este virus no estaba presente en los niveles detectables en los reproductores y en las aves invernales.

  11. 2015 Annual Report of the American Psychological Association.

    Science.gov (United States)

    2016-01-01

    Presents the 2015 Annual Report of the American Psychological Association. In his introduction, President Barry Anton describes how 2015 was among APA's most challenging. Although 2015 ushered in an era of greater transparency within the association and enhanced communications to members and the public, it also required painful self-reflection stemming from the revelations of an independent review by an outside law firm. The review examined the question of whether APA played any role related to the Bush administration's use of abusive interrogation techniques during the war on terror. Anton's introduction also discusses (1) the APA convention, (2) representing APA at a White House meeting with health care providers and insurance companies, (3) APA's effort to increase the number of APA-accredited internships, (4) international activities, and (5) the global summit on psychology and integrated care. (PsycINFO Database Record

  12. 2015 Annual Report of the American Psychological Association.

    Science.gov (United States)

    2016-01-01

    Presents the 2015 Annual Report of the American Psychological Association. In his introduction, President Barry Anton describes how 2015 was among APA's most challenging. Although 2015 ushered in an era of greater transparency within the association and enhanced communications to members and the public, it also required painful self-reflection stemming from the revelations of an independent review by an outside law firm. The review examined the question of whether APA played any role related to the Bush administration's use of abusive interrogation techniques during the war on terror. Anton's introduction also discusses (1) the APA convention, (2) representing APA at a White House meeting with health care providers and insurance companies, (3) APA's effort to increase the number of APA-accredited internships, (4) international activities, and (5) the global summit on psychology and integrated care. (PsycINFO Database Record PMID:27504583

  13. Paraseptal emphysema: Prevalence and distribution on CT and association with interstitial lung abnormalities

    International Nuclear Information System (INIS)

    Highlights: • The prevalence of pure paraseptal emphysema was 3% (85/2633) in the Framingham Heart Study population, predominantly affects the upper lung zone, and contributes to slightly decreased pulmonary function. • There was significant association between paraseptal emphysema and interstitial lung abnormalities, which is a novel finding. • Prevalence of paraseptal emphysema and its impact on pulmonary function could have been underestimated in the previous reports. - Abstract: Objective: To investigate the prevalence and distribution of paraseptal emphysema on chest CT images in the Framingham Heart Study (FHS) population, and assess its impact on pulmonary function. Also pursued was the association with interstitial lung abnormalities. Materials and methods: We assessed 2633 participants in the FHS for paraseptal emphysema on chest CT. Characteristics of the participants, including age, sex, smoking status, clinical symptoms, and results of pulmonary function tests, were compared between those with and without paraseptal emphysema. The association between paraseptal emphysema and interstitial lung abnormalities was investigated. Results: Of the 2633 participants, 86 (3%) had pure paraseptal emphysema (defined as paraseptal emphysema with no other subtypes of emphysema other than paraseptal emphysema or a very few centrilobular emphysema involved) in at least one lung zone. The upper zone of the lungs was almost always involved. Compared to the participants without paraseptal emphysema, those with pure paraseptal emphysema were significantly older, and were more frequently male and smokers (mean 64 years, 71% male, mean 36 pack-years, P < 0.001) and had significantly decreased FEV1/FVC% (P = 0.002), and diffusion capacity of carbon monoxide (DLCO) (P = 0.002). There was a significant association between pure paraseptal emphysema and interstitial lung abnormalities (P < 0.001). Conclusions: The prevalence of pure paraseptal emphysema was 3% in the FHS

  14. Adverse childhood experiences are associated with the risk of lung cancer: A prospective cohort study

    NARCIS (Netherlands)

    D.W. Brown (David); R.F. Anda (Robert); V.J. Felitti (Vincent); V.J. Edwards (Valerie); A.M. Malarcher (Ann Marie); J.B. Croft (Janet); W.H. Giles (Wayne)

    2010-01-01

    textabstractBackground. Strong relationships between exposure to childhood traumatic stressors and smoking behaviours inspire the question whether these adverse childhood experiences (ACEs) are associated with an increased risk of lung cancer during adulthood. Methods. Baseline survey data on health

  15. Association of GSTM1 and GSTT1 deletion with lung cancer development in Pakistani population

    Directory of Open Access Journals (Sweden)

    Nosheen Masood

    2016-01-01

    Conclusion: Results revealed that certain environmental factors may be considered as a risk factor but deletion of GSTM1 and GSTT1 are not associated with the development of lung cancer; however, studies including >500 patient samples is suggested.

  16. Interleukin-22 ameliorates acute severe pancreatitis-associated lung injury in mice

    OpenAIRE

    Qiao, Ying-Ying; Liu, Xiao-Qin; Xu, Chang-Qin; Zhang, Zheng; Xu, Hong-wei

    2016-01-01

    AIM: To investigate the potential protective effect of exogenous recombinant interleukin-22 (rIL-22) on L-arginine-induced acute severe pancreatitis (SAP)-associated lung injury and the possible signaling pathway involved.

  17. Your Lung Operation: After Your Operation

    Medline Plus

    Full Text Available ... Stay Up to Date with ACS Association Management Jobs Events Find a Surgeon Patients and Family Contact My Profile Shop/Donate ( 0 ) Items American College of Surgeons Education Patients and Family Skills Programs Your Lung Operation ...

  18. Human lung tumor-associated antigen identified as an extracellular matrix adhesion molecule

    OpenAIRE

    1991-01-01

    A single chain glycoprotein with an estimated molecular mass of 160 kD (gp160) was previously identified as a human lung tumor-associated antigen. This tumor marker is shown here to be associated noncovalently with a second 130-kD protein. Sequential immunoprecipitation studies of surface iodinated lung tumor cell lysates reveal that this heterodimeric complex is indistinguishable serologically and structurally from the integrin VLA-2, found originally on activated T lymphocytes and platelets...

  19. Association of Body Mass Index with Chromosome Damage Levels and Lung Cancer Risk among Males

    OpenAIRE

    Li, Xiaoliang; Bai, Yansen; Wang, Suhan; Nyamathira, Samuel Mwangi; Zhang, Xiao; Zhang, Wangzhen; Wang, Tian; Deng, Qifei; He, Meian; Zhang, Xiaomin; Wu, Tangchun; Guo, Huan

    2015-01-01

    Epidemiological studies have shown an etiological link between body mass index (BMI) and cancer risk, but evidence supporting these observations is limited. This study aimed to investigate potential associations of BMI with chromosome damage levels and lung cancer risk. First, we recruited 1333 male workers from a coke-oven plant to examine their chromosome damage levels; and then, a cohort study of 12 052 males was used to investigate the association of BMI with lung cancer incidence. We fur...

  20. Clinical analysis of 64 patients with lung-cancer-associated hypercalcemia

    OpenAIRE

    Xu Li; Zhixin Bie; Zijin Zhang; Yuanming Li; Xueqing Hu; Wenbo Liu; Shuai Zhang; Gang Cheng; Bin Ai

    2015-01-01

    Objective: This study investigated the factors influencing survival time of patients with lung-cancer-associated hypercalcemia. Data and Methods: A total of 64 pathologically confirmed patients with Stage IV lung-cancer-associated hypercalcemia were enrolled from Beijing Hospitals between August 2010 and July 2015. Clinical materials included patients' gender, age, pathological type, highest albumin-corrected calcium level, serum alkaline phosphatase level, creatinine clearance rate, organ...

  1. Factors Associated with Pregnancy among Incarcerated African American Adolescent Girls.

    Science.gov (United States)

    Gray, Simone C; Holmes, Kristin; Bradford, Denise R

    2016-08-01

    The purpose of this study was to examine the social and behavioral factors associated with pregnancy history among a sample of African American adolescent girls recruited from a short-term juvenile detention center in order to better understand the needs of this vulnerable population. Data were collected from a sample of 188 detained African American, 13-17-year-old girls in Atlanta, Georgia, who participated in a larger HIV prevention study. An audio computer-assisted self-interviewing survey was completed by participants to obtain information on socioecological factors to include individual, parental/familial, sexual risk, psychosocial, and substance use factors. Among the 188 participants, 25.5 % reported a history of pregnancy. A multivariable logistic regression model showed that girls with a history of pregnancy were more likely to live in a household receiving government aid, use hormonal contraceptives at last sex, participate in sex trading, have casual sex partners, have condomless sex in the past 90 days, and have a history of physical abuse. Girls with no history of pregnancy were more likely to have been incarcerated at least twice and to have previously used alcohol. Detention-based interventions and pregnancy prevention programs for this vulnerable population may benefit by addressing factors related to sexual behavior and development, substance use, individual background, and psychosocial health. PMID:27271026

  2. Association of XPC polymorphisms and lung cancer risk: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Bo Jin

    Full Text Available BACKGROUND: Xeroderma pigmentosum complementation group C gene (XPC is a key member of nucleotide excision repair pathway and plays an important role in human DNA repair system. It is reported that several common polymorphisms of XPC are associated with susceptibility to lung cancer. However, the conclusion is still elusive. METHOD: This meta-analysis was performed to determine the relationship between XPC polymorphisms (Lys939Gln, Ala499Val, and PAT and lung cancer risk. Published literatures were identified by searching online databases and reference lists of relevant studies. Odds ratios (ORs and 95% confidence intervals (CIs were calculated to estimate the association strength. Publication bias were detected by Egger's and Begg's test. RESULT: After strict screening, we identified 14 eligible studies in this meta-analysis, including 5647 lung cancer cases and 6908 controls. By pooling all eligible studies, we found that the homozygote Gln939Gln genotype was associated with a significantly increased risk of lung cancer in Asian population (GlnGln vs LysLys, OR=1.229, 95% CI: 1.000-1.510; GlnGln vs LysLys/LysGln, OR=1.257, 95% CI: 1.038-1.522. As for the PAT polymorphism, in Caucasian population, we found carriers of the -/- genotype were associated significantly reduced risk of lung cancer in homozygote comparison model (-/- vs +/+, OR=0.735, 95% CI: 0.567-0.952. CONCLUSION: In this meta-analysis we found that Gln939Gln genotype was associated with significantly increased risk of lung cancer in Asian population; the PAT -/- genotype significantly reduced susceptibility to lung cancer in Caucasian population; while the XPC Ala499Val polymorphism was not associated with lung cancer risk.

  3. Association between chronic obstructive pulmonary disease and lung cancer: the missing link

    Institute of Scientific and Technical Information of China (English)

    WANG Zeng-li

    2013-01-01

    Objective This review focuses on current knowledge of specific processes that drive chronic airway inflammation which are important in the pathogenesis of both chronic obstructive pulmonary disease (COPD) and lung cancer.Data sources The data used in this review were obtained mainly from studies reported in the PubMed database (1997-2012) using the terms of COPD and lung cancer.Study selection Data from published articles about prevalence of COPD-lung cancer overlap and mechanism involved in lung cancer development in COPD were identified,retrieved and reviewed.Results COPD prevalence,morbidity and mortality vary and are directly related to the prevalence of tobacco smoking except in developing countries where air pollution resulting from the burning of biomass fuels is also important.COPD is characterized by a chronic inflammation of lower airway and,importantly,the presence of COPD increases the risk of lung cancer up to 4.5 fold among long-term smokers.COPD is by far the greatest risk factor for lung cancer amongst smokers and is found in 50%-90% of patients with lung cancer.Conclusions Both COPD and lung cancer are tobacco smoking-associated chronic diseases that cluster in families and aggravate with age,and 50%-70% of patients diagnosed with lung cancer have declined spirometric evidence of COPD.Understanding and targeting common pathogenic mechanisms for lung cancer and COPD would have potential diagnostic and therapeutic implications for patients with these lung diseases and for people at risk.

  4. Pyrosequencing Unveils Cystic Fibrosis Lung Microbiome Differences Associated with a Severe Lung Function Decline

    Science.gov (United States)

    Bacci, Giovanni; Paganin, Patrizia; Lopez, Loredana; Vanni, Chiara; Dalmastri, Claudia; Cantale, Cristina; Daddiego, Loretta; Perrotta, Gaetano; Dolce, Daniela; Morelli, Patrizia; Tuccio, Vanessa; De Alessandri, Alessandra; Fiscarelli, Ersilia Vita; Taccetti, Giovanni; Lucidi, Vincenzina; Mengoni, Alessio

    2016-01-01

    Chronic airway infection is a hallmark feature of cystic fibrosis (CF) disease. In the present study, sputum samples from CF patients were collected and characterized by 16S rRNA gene-targeted approach, to assess how lung microbiota composition changes following a severe decline in lung function. In particular, we compared the airway microbiota of two groups of patients with CF, i.e. patients with a substantial decline in their lung function (SD) and patients with a stable lung function (S). The two groups showed a different bacterial composition, with SD patients reporting a more heterogeneous community than the S ones. Pseudomonas was the dominant genus in both S and SD patients followed by Staphylococcus and Prevotella. Other than the classical CF pathogens and the most commonly identified non-classical genera in CF, we found the presence of the unusual anaerobic genus Sneathia. Moreover, the oligotyping analysis revealed the presence of other minor genera described in CF, highlighting the polymicrobial nature of CF infection. Finally, the analysis of correlation and anti-correlation networks showed the presence of antagonism and ecological independence between members of Pseudomonas genus and the rest of CF airways microbiota, with S patients showing a more interconnected community in S patients than in SD ones. This population structure suggests a higher resilience of S microbiota with respect to SD, which in turn may hinder the potential adverse impact of aggressive pathogens (e.g. Pseudomonas). In conclusion, our findings shed a new light on CF airway microbiota ecology, improving current knowledge about its composition and polymicrobial interactions in patients with CF. PMID:27355625

  5. American Telemedicine Association: 18th Annual International Meeting & Tradeshow

    Directory of Open Access Journals (Sweden)

    Benjamin Forstag

    2012-12-01

    Full Text Available For 18 years, the American Telemedicine Association (ATA Annual International Meeting & Exposition has been the premier forum for professionals in the telemedicine, telehealth and mHealth space -- one of the fastest growing meetings in the country. ATA 2013 is on course to be the largest ATA meeting ever, with over 6,000 projected attendees.  The program will include 500 educational sessions and posters, highlighting the latest innovations, applications and research in telemedicine. The 2013 exhibit hall will feature nearly 300 of the leading vendors in remote healthcare technologies. With over 6000 projected attendees, from all around the world, there's no better place to meet and network with your peers and thought leaders in the field. Detailed program information--including courses, sessions and CME information--will be available January 2013 at:http://www.americantelemed.org.

  6. American Telemedicine Association: 19th Annual International Meeting & Tradeshow

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2013-12-01

    Full Text Available The 2014 American Telemedicine Association (ATA 2014 Annual International Meeting & Exposition, will be held May 18-20, 2014 in Baltimore, Maryland. ATA 2014 will bring together healthcare professionals, leading telemedicine programs, and industry. This meeting has been the premier forum for professionals in the telemedicine, telehealth and mHealth space for over 19 years. ATA 2014 is on course to be the largest ATA meeting ever, with over 6,000 projected attendees. The exhibit hall will feature nearly 300 of the leading vendors in remote healthcare technologies. The program will include 500 educational sessions and posters highlighting the latest innovations, applications and research in telemedicine. The educational sessions at ATA 2014 will offer training, information, and updates on issues vital to the practice and industry of telemedicine.   Detailed program information--including courses, sessions and Continuing Medical Education (CME information--will be available January 2014 at: http://www.americantelemed.org.

  7. American Telemedicine Association: 20th Annual International Meeting & Tradeshow

    Directory of Open Access Journals (Sweden)

    Jordana Bernard

    2015-01-01

    Full Text Available The 2015 American Telemedicine Association (ATA 2015 Annual International Meeting & Tradeshow, will be held May 3-5, 2015 at the Los Angeles Convention Center. ATA 2015 will bring together healthcare professionals, leading telemedicine programs, and industry. This meeting has been the premier forum for professionals in the telemedicine, telehealth and mHealth space for over 20 years.  The world-class, peer reviewed program will include over 500 educational sessions and posters, highlighting the latest innovations, applications and delivery models in telemedicine. The expansive exhibit hall will host hundreds of leading vendors with groundbreaking remote healthcare technologies and services. The educational sessions at ATA 2015 will offer training, information, and updates on issues vital to the practice and industry of telemedicine.Detailed program information--including courses, sessions and Continuing Medical Education (CME information--will be available at: http://www.americantelemed.org/ata-2015/conference-overview

  8. Faculty application of the American Psychological Association style.

    Science.gov (United States)

    Morse, Gwen Goetz

    2009-10-01

    This article explores current faculty methods with the application and evaluation of the American Psychological Association (APA) style. Specific aims were to determine concerns related to APA style, review faculty grading practices, identify institutional resources, and report potential solutions for improving application of APA style. A survey with an exploratory descriptive research design was developed and distributed online to academic chairs and deans, requesting their support in distributing the survey to their faculty. Responses (N = 704) were grouped into five categories: departmental and personal concerns; faculty grading practices; institutional resources; format, writing style, and grammar; and suggestions and potential solutions. Sixty percent reported that application and evaluation of APA style is a concern in their department. Content analysis identified four categories as proposed solutions: consistency, education, resources, and dialogue. On the basis of the feedback of the participants, the CRED program is proposed for the issues that were identified.

  9. Depletion of tumor associated macrophages slows the growth of chemically-induced mouse lung adenocarcinomas

    Directory of Open Access Journals (Sweden)

    Jason M. Fritz

    2014-11-01

    Full Text Available Chronic inflammation is a risk factor for lung cancer, and low dose aspirin intake reduces lung cancer risk. However, the roles that specific inflammatory cells and their products play in lung carcinogenesis have yet to be fully elucidated. In mice, alveolar macrophage numbers increase as lung tumors progress, and pulmonary macrophage programming changes within 2 weeks of carcinogen exposure. To examine how macrophages specifically affect lung tumor progression, they were depleted in mice bearing urethane-induced lung tumors using clodronate-encapsulated liposomes. Alveolar macrophage populations decreased to ≤ 50% of control levels after 4-6 weeks of liposomal clodronate treatment. Tumor burden decreased by 50% compared to vehicle treated mice, and tumor cell proliferation, as measured by Ki67 staining, was also attenuated. Pulmonary fluid levels of IGF-I, CXCL1, IL-6 and CCL2 diminished with clodronate liposome treatment. Tumor associated macrophages expressed markers of both M1 and M2 programming in vehicle and clodronate liposome treated mice. Mice lacking CCR2 (the receptor for macrophage chemotactic factor CCL2 had comparable numbers of alveolar macrophages and showed no difference in tumor growth rates when compared to similarly treated wild-type mice suggesting that while CCL2 may recruit macrophages to lung tumor microenvironments, redundant pathways can compensate when CCL2/CCR2 signaling is inactivated. Depletion of pulmonary macrophages rather than inhibition of their recruitment may be an advantageous strategy for attenuating lung cancer progression.

  10. Association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury after intensity-modulated radiotherapy in lung cancer: a retrospective analysis.

    Science.gov (United States)

    Chen, Jinmei; Hong, Jinsheng; Zou, Xi; Lv, Wenlong; Guo, Feibao; Hong, Hualan; Zhang, Weijian

    2015-11-01

    The aim of this study was to investigate the association between absolute volumes of lung spared from low-dose irradiation and radiation-induced lung injury (RILI) after intensity-modulated radiotherapy (IMRT) for lung cancer. The normal lung relative volumes receiving greater than 5, 10, 20 and 30 Gy (V5-30) mean lung dose (MLD), and absolute volumes spared from greater than 5, 10, 20 and 30 Gy (AVS5-30) for the bilateral and ipsilateral lungs of 83 patients were recorded. Any association of clinical factors and dose-volume parameters with Grade ≥2 RILI was analyzed. The median follow-up was 12.3 months; 18 (21.7%) cases of Grade 2 RILI, seven (8.4%) of Grade 3 and two (2.4%) of Grade 4 were observed. Univariate analysis revealed the located lobe of the primary tumor. V5, V10, V20, MLD of the ipsilateral lung, V5, V10, V20, V30 and MLD of the bilateral lung, and AVS5 and AVS10 of the ipsilateral lung were associated with Grade ≥2 RILI (P lung was prognostic for Grade ≥2 RILI (P = 0.010, OR = 0.272, 95% CI: 0.102-0.729). Receiver operating characteristic curves indicated Grade ≥2 RILI could be predicted using AVS5 of the ipsilateral lung (area under curve, 0.668; cutoff value, 564.9 cm(3); sensitivity, 60.7%; specificity, 70.4%). The incidence of Grade ≥2 RILI was significantly lower with AVS5 of the ipsilateral lung ≥564.9 cm(3) than with AVS5 lung were associated with Grade ≥2 RILI, and AVS5 of the ipsilateral lung was prognostic for Grade ≥2 RILI for lung cancer after IMRT. PMID:26454068

  11. Association of arsenic exposure with lung cancer incidence rates in the United States.

    Directory of Open Access Journals (Sweden)

    Joseph J Putila

    Full Text Available Although strong exposure to arsenic has been shown to be carcinogenic, its contribution to lung cancer incidence in the United States is not well characterized. We sought to determine if the low-level exposures to arsenic seen in the U.S. are associated with lung cancer incidence after controlling for possible confounders, and to assess the interaction with smoking behavior.Measurements of arsenic stream sediment and soil concentration obtained from the USGS National Geochemical Survey were combined, respectively, with 2008 BRFSS estimates on smoking prevalence and 2000 U.S. Census county level income to determine the effects of these factors on lung cancer incidence, as estimated from respective state-wide cancer registries and the SEER database. Poisson regression was used to determine the association between each variable and age-adjusted county-level lung cancer incidence. ANOVA was used to assess interaction effects between covariates.Sediment levels of arsenic were significantly associated with an increase in incident cases of lung cancer (P<0.0001. These effects persisted after controlling for smoking and income (P<0.0001. Across the U.S., exposure to arsenic may contribute to up to 5,297 lung cancer cases per year. There was also a significant interaction between arsenic exposure levels and smoking prevalence (P<0.05.Arsenic was significantly associated with lung cancer incidence rates in the U.S. after controlling for smoking and income, indicating that low-level exposure to arsenic is responsible for excess cancer cases in many parts of the U.S. Elevated county smoking prevalence strengthened the association between arsenic exposure and lung cancer incidence rate, an effect previously unseen on a population level.

  12. Position of the American Dietetic Association: Food and water safety.

    Science.gov (United States)

    Albrecht, Julie A; Nagy-Nero, Debe

    2009-08-01

    It is the position of the American Dietetic Association that the public has the right to a safe food and water supply. The Association supports collaboration among food and nutrition professionals, academics, representatives of the agricultural and food industries, and appropriate government agencies to ensure the safety of the food and water supply by providing education to the public and industry, promoting technological innovation and applications, and supporting further research. New food and water safety issues evolve as the environment changes. Food and nutrition professionals should collaborate with food and agriculture industries and members of the medical community in a joint effort to address these issues. Recent food- and waterborne illnesses have occurred in new settings and/or unique foods not traditionally associated with foodborne illness outbreaks. New issues associated with food safety and security that have emerged support the need for continued education and research. Government programs have developed powerful tools such as FoodNet and PulseNet to detect food- and waterborne illness outbreaks in the United States. These government programs have provided the data to enhance public policy and educational programs such as FightBac! Mandatory and voluntary adoption of Hazard Analysis Critical Control Points in the foodservice and processing industries have contributed to a decrease in foodborne illness outbreaks from traditional foods and some microorganisms usually associated with foodborne illnesses. Food and nutrition professionals are positioned to provide food and water safety education in community, clinical settings, and foodservice operations and food industries. With an aging population and an increased number of people at risk due to medical conditions for food- and waterborne illness, food and nutrition professionals should be involved in collaborative food and water safety issues in educational, research, and policy agenda settings. As

  13. Variation in lung function is associated with worse clinical outcomes in cystic fibrosis

    OpenAIRE

    João Paulo Heinzmann-Filho; Leonardo Araujo Pinto; Paulo José Cauduro Marostica; Márcio Vinícius Fagundes Donadio

    2015-01-01

    ABSTRACT OBJECTIVE: To determine whether the variation in lung function over one year is associated with worse clinical outcomes, as well as with a decline in lung function in the following years, in patients with cystic fibrosis (CF). METHODS: This was a retrospective study involving CF patients (4-19 years of age), evaluated over a three-year period. We evaluated demographic characteristics, chronic Pseudomonas aeruginosa infection, antibiotic use, hospitalization, six-minute walk dista...

  14. Variation in lung function is associated with worse clinical outcomes in cystic fibrosis

    OpenAIRE

    Heinzmann-Filho, João Paulo; Pinto, Leonardo Araujo; Marostica, Paulo José Cauduro; Donadio, Márcio Vinícius Fagundes

    2015-01-01

    ABSTRACT OBJECTIVE: To determine whether the variation in lung function over one year is associated with worse clinical outcomes, as well as with a decline in lung function in the following years, in patients with cystic fibrosis (CF). METHODS: This was a retrospective study involving CF patients (4-19 years of age), evaluated over a three-year period. We evaluated demographic characteristics, chronic Pseudomonas aeruginosa infection, antibiotic use, hospitalization, six-minute walk distance ...

  15. Distress and alexithymia in lung recipients - psychosocial strains and associations with chronic allograft dysfunction

    OpenAIRE

    Goetzmann, L; Irani, S; Schwegler, K.; Stamm, M.; Bricman, R; Buddeberg, C; Schmid, C.; Benden, C; Klaghofer, R; Boehler, A

    2010-01-01

    QUESTIONS UNDER STUDY: In recent years, distress and alexithymia have been recognised as psychosocial factors related to both somatic and psychosomatic diseases. In this study distress and alexithymia and their associations with physical parameters were investigated in lung recipients. METHODS: The study, which included 76 patients after a lung transplant, measured psychological distress (Symptom Checklist, SCL-K-9) and alexithymia (Toronto Alexithymia Scale, TAS-20). Physical health was asse...

  16. Association between the XPG gene Asp1104His polymorphism and lung cancer risk.

    Science.gov (United States)

    Zhou, B; Hu, X M; Wu, G Y

    2016-01-01

    It has been suggested that the xeroderma pigmentosum complementation group G (XPG) gene Asp1104His polymorphism is linked to susceptibility to lung cancer. However, the results from the published studies are contradictory rather than conclusive. With this meta-analysis, we aimed to achieve a better understanding of the effects of the XPG gene Asp1104His polymorphism on lung cancer risk. We identified six eligible studies from five publications that included a total of 2293 lung cancer patients and 2586 controls. There was a significant association between the XPG gene Asp1104His polymorphism and lung cancer (His/His vs Asp/Asp: OR = 1.24, 95%CI = 1.04-1.48; Asp/His vs Asp/Asp: OR = 1.17, 95%CI = 1.03-1.34; the dominant model: OR = 1.18, 95%CI = 1.04-1.33; the recessive model: OR = 1.10, 95%CI = 0.94-1.28). In a subgroup analysis by nationality, we found a significant association between the XPG gene Asp1104His polymorphism and lung cancer risk in Asians. No publication bias was found in this study. The results from this meta-analysis indicate that the XPG gene Asp1104His polymorphism is associated with lung cancer risk, especially in Asians. PMID:27323149

  17. AGER -429T/C is associated with an increased lung disease severity in cystic fibrosis.

    Directory of Open Access Journals (Sweden)

    Julie Beucher

    Full Text Available The clinical course of cystic fibrosis (CF varies between patients bearing identical CFTR mutations, suggesting the involvement of modifier genes. We assessed the association of lung disease severity with the variant AGER -429 T/C, coding for RAGE, a pro-inflammatory protein, in CF patients from the French CF Gene Modifier Study. We analyzed the lung function of 967 CF patients p.Phe508del homozygous. FEV(1 was analyzed as CF-specific percentile adjusted on age, height and mortality. AGER -429T/C polymorphism was genotyped and its function was evaluated in vitro by measurement of the luciferase activity. AGER -429 minor allele (C was associated with poorer lung function (p = 0.03. In vitro, the promoter activity was higher in cells transfected with AGER -429C compared to cells transfected with the AGER -429T allele (p = 0.016 in BEAS-2B cells. AGER seems to be a modifier gene of lung disease severity in CF, and could be an interesting biomarker of CF airway inflammation. The functional promoter AGER -429C variant is associated with an increased RAGE expression that can lead to an increased lung inflammation and a more severe lung disease.

  18. Association of Body Mass Index with Chromosome Damage Levels and Lung Cancer Risk among Males

    Science.gov (United States)

    Li, Xiaoliang; Bai, Yansen; Wang, Suhan; Nyamathira, Samuel Mwangi; Zhang, Xiao; Zhang, Wangzhen; Wang, Tian; Deng, Qifei; He, Meian; Zhang, Xiaomin; Wu, Tangchun; Guo, Huan

    2015-01-01

    Epidemiological studies have shown an etiological link between body mass index (BMI) and cancer risk, but evidence supporting these observations is limited. This study aimed to investigate potential associations of BMI with chromosome damage levels and lung cancer risk. First, we recruited 1333 male workers from a coke-oven plant to examine their chromosome damage levels; and then, a cohort study of 12 052 males was used to investigate the association of BMI with lung cancer incidence. We further carried out a meta-analysis for BMI and male lung cancer risk based on cohort studies. We found that men workers with excess body weight (BMI ≥ 25 kg/m2) had lower levels of MN frequencies than men with normal-weight (BMI: 18.5–24.9). Our cohort study indicated that, the relative risk (RR) for men with BMI ≥ 25 to develop lung cancer was 35% lower than RR for normal-weight men. Further meta-analysis showed that, compared to normal-weight men, men with BMI ≥ 25 had decreased risk of lung cancer among both the East-Asians and others populations. These results indicate that men with excess body weight had significant decreased chromosome damage levels and lower risk of lung cancer than those with normal-weight. However, further biological researches were needed to validate these associations. PMID:25820198

  19. [Subclinical interstitial lung disease associated with rheumatoid arthritis].

    Science.gov (United States)

    Bestaev, D V

    2014-01-01

    Interstitial lung disease (ILD) in rheumatoid arthritis (RA) is its extra-articular manifestation. At the same time, ILD considerably worsens the prognosis of the disease. Mortality rates for interstitial pulmonary fibrosis are 6% of all-cause mortality in RA patients. ILD can be identified by clinical examination only in 2-6% of cases, by plain chest X-ray in 1-6%, and by high-resolution computed tomography in 50-60%. The paper deals with subclinical ILD and discusses the state-of-the-art of investigations in this area.

  20. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia.

    NARCIS (Netherlands)

    Lan, Q.; Hsiung, C.A.; Matsuo, K.; Hong, Y.C.; Seow, A.; Wang, Z.; Hosgood, H.D.; Chen, K.; Wang, J.C.; Chatterjee, N.; Hu, W.; Wong, M.P.; Zheng, W.; Caporaso, N.; Park, J.Y.; Chen, C.J.; Kim, Y.H.; Kim, Y.T.; Landi, M.T.; Shen, H.; Lawrence, C.; Burdett, L.; Yeager, M.; Yuenger, J.; Jacobs, K.B.; Chang, I.S.; Mitsudomi, T.; Kim, H.N.; Chang, G.C.; Bassig, B.A.; Tucker, M.; Wei, F.; Yin, Y.; Wu, C.; An, S.J.; Qian, B.; Lee, V.H.; Lu, D.; Liu, J.; Jeon, H.S.; Hsiao, C.F.; Sung, J.S.; Kim, J.H.; Gao, Y.T.; Tsai, Y.H.; Jung, Y.J.; Guo, H.; Hu, Z.; Hutchinson, A.; Wang, W.C.; Klein, R.; Chung, C.C.; Oh, I.J.; Chen, K.Y.; Berndt, S.I.; He, X.; Wu, W.; Chang, J.; Zhang, X.C.; Huang, M.S.; Zheng, H.; Wang, J.; Zhao, X.; Li, Y.; Choi, J.E.; Su, W.C.; Park, K.H.; Sung, S.W.; Shu, X.O.; Chen, Y.M.; Liu, L.; Kang, C.H.; Hu, L.; Chen, C.H.; Pao, W.; Kim, Y.C.; Yang, T.Y.; Xu, J.; Guan, P.; Tan, W.; Su, J.; Wang, C.L.; Li, H.; Sihoe, A.D.; Zhao, Z.; Chen, Y.; Choi, Y.Y.; Hung, J.Y.; Kim, J.S.; Yoon, H.I.; Cai, Q.; Lin, C.C.; Park, I.K.; Xu, P.; Dong, J.; Kim, C.; He, Q; Perng, R.P.; Kohno, T.; Kweon, S.S.; Chen, C.Y.; Vermeulen, R.; Wu, J.; Lim, W.Y.; Chen, K.C.; Chow, W.H.; Ji, B.T.; Chan, J.K.; Chu, M.; Li, Y.J.; Yokota, J.; Li, J.; Chen, H.; Xiang, Y.B.; Yu, C.J.; Kunitoh, H.; Wu, G.; Jin, L.; Lo, Y.L.; Shiraishi, K.; Chen, Y.H.; Lin, H.C.; Wu, T.; WU, Y.; Yang, P.C.; Zhou, B.; Shin, M.H.; Fraumeni, J.F.; Lin, D.; Chanock, S.J.; Rothman, N.

    2012-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland Ch

  1. Changes in cystic fibrosis airway microbial community associated with a severe decline in lung function.

    Directory of Open Access Journals (Sweden)

    Patrizia Paganin

    Full Text Available Cystic fibrosis (CF is a genetic disease resulting in chronic polymicrobial infections of the airways and progressive decline in lung function. To gain insight into the underlying causes of severe lung diseases, we aimed at comparing the airway microbiota detected in sputum of CF patients with stable lung function (S versus those with a substantial decline in lung function (SD. Microbiota composition was investigated by using culture-based and culture-independent methods, and by performing multivariate and statistical analyses. Culture-based methods identified some microbial species associated with a worse lung function, i.e. Pseudomonas aeruginosa, Rothia mucilaginosa, Streptococcus pneumoniae and Candida albicans, but only the presence of S. pneumoniae and R. mucilaginosa was found to be associated with increased severe decline in forced expiratory volume in 1 second (FEV1. Terminal-Restriction Fragment Length Polymorphism (T-RFLP analysis revealed a higher bacterial diversity than that detected by culture-based methods. Molecular signatures with a statistically significant odds ratio for SD status were detected, and classified as Pseudomonas, Burkholderia and Shewanella, while for other Terminal Restriction Fragments (T-RFs no species assignation was achieved. The analysis of T-RFLP data using ecological biodiversity indices showed reduced Evenness in SD patients compared to S ones, suggesting an impaired ecology of the bacterial community in SD patients. Statistically significant differences of the ecological biodiversity indices among the three sub-groups of FEV1 (normal/mild vs moderate vs severe were also found, suggesting that the patients with moderate lung disease experienced changes in the airway assembly of taxa. Overall, changes in CF airway microbial community associated with a severe lung function decline were detected, allowing us to define some discriminatory species as well as some discriminatory T-RFs that represent good

  2. The chemokine CXCL13 in lung cancers associated with environmental polycyclic aromatic hydrocarbons pollution.

    Science.gov (United States)

    Wang, Gui-Zhen; Cheng, Xin; Zhou, Bo; Wen, Zhe-Sheng; Huang, Yun-Chao; Chen, Hao-Bin; Li, Gao-Feng; Huang, Zhi-Liang; Zhou, Yong-Chun; Feng, Lin; Wei, Ming-Ming; Qu, Li-Wei; Cao, Yi; Zhou, Guang-Biao

    2015-11-13

    More than 90% of lung cancers are caused by cigarette smoke and air pollution, with polycyclic aromatic hydrocarbons (PAHs) as key carcinogens. In Xuanwei City of Yunnan Province, the lung cancer incidence is among the highest in China, attributed to smoky coal combustion-generated PAH pollution. Here, we screened for abnormal inflammatory factors in non-small cell lung cancers (NSCLCs) from Xuanwei and control regions (CR) where smoky coal was not used, and found that a chemokine CXCL13 was overexpressed in 63/70 (90%) of Xuanwei NSCLCs and 44/71 (62%) of smoker and 27/60 (45%) of non-smoker CR patients. CXCL13 overexpression was associated with the region Xuanwei and cigarette smoke. The key carcinogen benzo(a)pyrene (BaP) induced CXCL13 production in lung epithelial cells and in mice prior to development of detectable lung cancer. Deficiency in Cxcl13 or its receptor, Cxcr5, significantly attenuated BaP-induced lung cancer in mice, demonstrating CXCL13's critical role in PAH-induced lung carcinogenesis.

  3. Your Lung Operation: After Your Operation

    Medline Plus

    Full Text Available ... Stay Up to Date with ACS Association Management Jobs Events Find a Surgeon Patients and Family Contact My Profile Shop/Donate ( 0 ) Items American College of Surgeons Education Patients and Family Skills Programs Your Lung Operation Your Lung Operation DVD ...

  4. Elevated mortality from lung cancer associated with arsenic exposure for a limited duration.

    Science.gov (United States)

    Nakadaira, Hiroto; Endoh, Kazuo; Katagiri, Mikio; Yamamoto, Masaharu

    2002-03-01

    In 1959, arsenic poisoning was detected in the town of Nakajo in Japan. The cause was exposure to inorganic arsenic in well water during 1954 to 1959. To examine the long-term effects of limited-duration arsenic exposure, we conducted mortality and survival studies for patients with chronic arsenic exposure and for control subjects from 1959 to 1992. The ratio of observed deaths to expected deaths from lung cancer was significantly high (7:0.64) for male patients. The lung cancer mortality rate was elevated markedly in subgroups with higher clinical severities of symptoms. Small cell carcinoma was specific to the exposed patients. The cumulative change of survival declined significantly in the exposed patients compared with the controls. The decline disappeared when lung cancer deaths were treated as lost to follow-up. The results showed that a 5-year period of arsenic exposure was associated with risk of lung cancer.

  5. Individual and cumulative effects of GWAS susceptibility loci in lung cancer: associations after sub-phenotyping for COPD.

    Directory of Open Access Journals (Sweden)

    Robert P Young

    Full Text Available Epidemiological studies show that approximately 20-30% of chronic smokers develop chronic obstructive pulmonary disease (COPD while 10-15% develop lung cancer. COPD pre-exists lung cancer in 50-90% of cases and has a heritability of 40-77%, much greater than for lung cancer with heritability of 15-25%. These data suggest that smokers susceptible to COPD may also be susceptible to lung cancer. This study examines the association of several overlapping chromosomal loci, recently implicated by GWA studies in COPD, lung function and lung cancer, in (n = 1400 subjects sub-phenotyped for the presence of COPD and matched for smoking exposure. Using this approach we show; the 15q25 locus confers susceptibility to lung cancer and COPD, the 4q31 and 4q22 loci both confer a reduced risk to both COPD and lung cancer, the 6p21 locus confers susceptibility to lung cancer in smokers with pre-existing COPD, the 5p15 and 1q23 loci both confer susceptibility to lung cancer in those with no pre-existing COPD. We also show the 5q33 locus, previously associated with reduced FEV(1, appears to confer susceptibility to both COPD and lung cancer. The 6p21 locus previously linked to reduced FEV(1 is associated with COPD only. Larger studies will be needed to distinguish whether these COPD-related effects may reflect, in part, associations specific to different lung cancer histology. We demonstrate that when the "risk genotypes" derived from the univariate analysis are incorporated into an algorithm with clinical variables, independently associated with lung cancer in multivariate analysis, modest discrimination is possible on receiver operator curve analysis (AUC = 0.70. We suggest that genetic susceptibility to lung cancer includes genes conferring susceptibility to COPD and that sub-phenotyping with spirometry is critical to identifying genes underlying the development of lung cancer.

  6. High-sensitive C-reactive protein is associated with reduced lung function in young adults

    DEFF Research Database (Denmark)

    Rasmussen, F; Mikkelsen, D; Hancox, R J;

    2009-01-01

    Systemic inflammation has been associated with reduced lung function. However, data on the interrelationships between lung function and inflammation are sparse, and it is not clear if low-grade inflammation leads to reduced lung function. Associations between high-sensitive C-reactive protein (CR...... inflammation in young adulthood may lead to impaired lung function independently of the effects of smoking, obesity, cardiorespiratory fitness, asthma and eosinophilic inflammation....... decline was 6.2 mL.yr(-1) in the highest CRP quintile versus an increase of 1.8 mL.yr(-1) in the lowest CRP quintile. In a multiple regression analysis adjusted for sex, body mass index, cardiorespiratory fitness, smoking, asthma, airway hyperresponsiveness and serum eosinophil cationic protein, higher...... levels of CRP at age 20 yrs were associated with a greater reduction in both FEV(1) and forced vital capacity between ages 20 and 29 yrs. The findings show that higher levels of C-reactive protein in young adults are associated with subsequent decline in lung function, suggesting that low-grade systemic...

  7. A genome-wide association search for type 2 diabetes genes in African Americans

    DEFF Research Database (Denmark)

    Palmer, Nicholette D; McDonough, Caitrin W; Hicks, Pamela J;

    2012-01-01

    African Americans are disproportionately affected by type 2 diabetes (T2DM) yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wid...

  8. Association of Donor and Recipient Telomere Length with Clinical Outcomes following Lung Transplantation

    Science.gov (United States)

    Courtwright, Andrew M.; Fried, Sabrina; Villalba, Julian A.; Moniodis, Anna; Guleria, Indira; Wood, Isabelle; Milford, Edgar; Mallidi, Hari H.; Hunninghake, Gary M.; Raby, Benjamin A.; Agarwal, Suneet; Camp, Philip C.; Rosas, Ivan O.; Goldberg, Hilary J.; El-Chemaly, Souheil

    2016-01-01

    Background Patients with short telomere syndromes and pulmonary fibrosis have increased complications after lung transplant. However, the more general impact of donor and recipient telomere length in lung transplant has not been well characterized. Methods This was an observational cohort study of patients who received lung transplant at a single center between January 1st 2012 and January 31st 2015. Relative donor lymphocyte telomere length was measured and classified into long (third tertile) and short (other tertiles). Relative recipient lung telomere length was measured and classified into short (first tertile) and long (other tertiles). Outcome data included survival, need for modification of immunosuppression, liver or kidney injury, cytomegalovirus reactivation, and acute rejection. Results Recipient lung tissue telomere lengths were measured for 54 of the 79 patients (68.3%) who underwent transplant during the study period. Donor lymphocyte telomeres were measured for 45 (83.3%) of these recipients. Neither long donor telomere length (hazard ratio [HR] = 0.58, 95% confidence interval [CI], 0.12–2.85, p = 0.50) nor short recipient telomere length (HR = 1.01, 95% CI = 0.50–2.05, p = 0.96) were associated with adjusted survival following lung transplant. Recipients with short telomeres were less likely to have acute cellular rejection (23.5% vs. 58.8%, p = 0.02) but were not more likely to have other organ dysfunction. Conclusions In this small cohort, neither long donor lymphocyte telomeres nor short recipient lung tissue telomeres were associated with adjusted survival after lung transplantation. Larger studies are needed to confirm these findings. PMID:27589328

  9. Rheumatoid Arthritis-Associated Interstitial Lung Disease: Diagnostic Dilemma

    Directory of Open Access Journals (Sweden)

    Mark J. Hamblin

    2011-01-01

    Full Text Available Interstitial lung disease (ILD is an increasingly recognized complication of rheumatoid arthritis (RA contributing to significantly increased morbidity and mortality. Diagnosis can be challenging since patients are unlikely to report dyspnea due to an overall decrease in physical activity with advanced arthritic symptoms. Additionally, infections, drug toxicity, and environmental toxins can mimic ILD, creating significant diagnostic dilemmas for the clinician. In this paper we will explore an effective clinical algorithm for the diagnosis of RA-ILD. We will also discuss features of drug-related toxicities, infections, and environmental toxins that comprise the main entities in the differential diagnosis of RA-ILD. Finally, we will explore the known and experimental treatment options that may have some benefit in the treatment of RA-ILD.

  10. SIRT1 expression is associated with poor prognosis of lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Li C

    2015-04-01

    Full Text Available Chong Li,1,2,* Lingling Wang,3,* Liang Zheng,4 Xianghong Zhan,4 Bin Xu,1,2 Jingting Jiang,1,2 Changping Wu1,2 1Department of Tumor Biological Treatment, the Third Affiliated Hospital, Soochow University, Changzhou, 2Cancer Immunotherapy Engineering Research Center of Jiangsu Province, Changzhou, 3Department of Medical Education, Jinling Hospital, Medical School of Nanjing University, Nanjing, 4Department of Thoracic Surgery, the Third Affiliated Hospital, Soochow University, Changzhou, Jiangsu, People’s Republic of China *These authors contributed equally to this work Abstract: Several studies have reported that the overexpression of Sirtuin 1 (SIRT1 was associated with poor prognosis in various human cancers. However, little is known regarding the prognostic value of SIRT1 in lung adenocarcinoma. Therefore, the aim of this study is to evaluate the role of SIRT1 in the prognosis of lung adenocarcinoma patients. Using a tissue microarray, we detected SIRT1 expression by immunohistochemistry in lung adenocarcinoma tissue, as well as in corresponding noncancerous tissues (NCTs. A high expression level of SIRT1 was observed in 74.7% (56/75 of patients with lung adenocarcinoma and 6.7% (5/75 of NCTs (P<0.001. SIRT1 expression was significantly associated with high pathological stage. Importantly, we found that SIRT1 expression was associated with worse overall survival in these lung adenocarcinoma patients (67.0 months vs 104.5 months; P=0.005. In addition, anaplastic lymphoma kinase, epidermal growth factor receptor, vascular endothelial growth factor (VEGF, and Survivin expression were evaluated by fluorescent in situ hybridization or immunohistochemistry, respectively. We found that VEGF and Survivin were both highly expressed in the lung adenocarcinoma tissues, as compared to NCTs. Moreover, the SIRT1 and VEGF expression statuses were significantly positively correlated (r=0.238, P=0.039, while SIRT1 and Survivin expression status were not

  11. Inadequate glucose control in type 2 diabetes is associated with impaired lung function and systemic inflammation: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Rondón Martin

    2010-07-01

    Full Text Available Abstract Background Inadequate glucose control may be simultaneously associated with inflammation and decreased lung function in type 2 diabetes. We evaluated if lung function is worse in patients with inadequate glucose control, and if inflammatory markers are simultaneously increased in these subjects. Methods Subjects were selected at the Colombian Diabetes Association Center in Bogotá. Pulmonary function tests were performed and mean residual values were obtained for forced expiratory volume (FEV1, forced vital capacity (FVC and FEV1/FVC, with predicted values based on those derived by Hankinson et al. for Mexican-Americans. Multiple least-squares regression was used to adjust for differences in known determinants of lung function. We measured blood levels of glycosylated hemoglobin (HBA1c, interleukin 6 (IL-6, tumor necrosis factor (TNF-α, fibrinogen, ferritin, and C-reactive protein (C-RP. Results 495 diabetic patients were studied, out of which 352 had inadequate control (HBA1c > 7%. After adjusting for known determinants of lung function, those with inadequate control had lower FEV1 (-75.4 mL, IC95%: -92, -59; P 1/FVC (0.013%, IC95%: 0.009, 0.018, P Conclusions Subjects with type 2 diabetes and inadequate control had lower FVC and FEV1 than predicted and than those of subjects with adequate control. It is postulated that poorer pulmonary function may be associated with increased levels of inflammatory mediators.

  12. Paraseptal emphysema: Prevalence and distribution on CT and association with interstitial lung abnormalities

    Energy Technology Data Exchange (ETDEWEB)

    Araki, Tetsuro, E-mail: taraki@partners.org [Department of Radiology, Center for Pulmonary Functional Imaging, Brigham and Women' s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215 (United States); Department of Radiology, Kinki University Faculty of Medicine, Osaka-Sayama (Japan); Nishino, Mizuki [Department of Radiology, Center for Pulmonary Functional Imaging, Brigham and Women' s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215 (United States); Zazueta, Oscar E. [The Pulmonary and Critical Care Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Gao, Wei [Department of Biostatistics, Boston University School of Public Health, Boston, MA (United States); Dupuis, Josée [Department of Biostatistics, Boston University School of Public Health, Boston, MA (United States); The National Heart Lung and Blood Institute' s Framingham Heart Study, Framingham, MA (United States); Okajima, Yuka [Department of Radiology, Center for Pulmonary Functional Imaging, Brigham and Women' s Hospital, Harvard Medical School, 75 Francis Street, Boston, MA 02215 (United States); Latourelle, Jeanne C. [Department of Medicine and Neurology, Boston University School of Medicine, Boston, MA (United States); Rosas, Ivan O. [The Pulmonary and Critical Care Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); Murakami, Takamichi [Department of Radiology, Kinki University Faculty of Medicine, Osaka-Sayama (Japan); O’Connor, George T. [The National Heart Lung and Blood Institute' s Framingham Heart Study, Framingham, MA (United States); Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, MA (United States); Washko, George R.; Hunninghake, Gary M. [The Pulmonary and Critical Care Division, Brigham and Women' s Hospital, Harvard Medical School, Boston, MA (United States); and others

    2015-07-15

    Highlights: • The prevalence of pure paraseptal emphysema was 3% (85/2633) in the Framingham Heart Study population, predominantly affects the upper lung zone, and contributes to slightly decreased pulmonary function. • There was significant association between paraseptal emphysema and interstitial lung abnormalities, which is a novel finding. • Prevalence of paraseptal emphysema and its impact on pulmonary function could have been underestimated in the previous reports. - Abstract: Objective: To investigate the prevalence and distribution of paraseptal emphysema on chest CT images in the Framingham Heart Study (FHS) population, and assess its impact on pulmonary function. Also pursued was the association with interstitial lung abnormalities. Materials and methods: We assessed 2633 participants in the FHS for paraseptal emphysema on chest CT. Characteristics of the participants, including age, sex, smoking status, clinical symptoms, and results of pulmonary function tests, were compared between those with and without paraseptal emphysema. The association between paraseptal emphysema and interstitial lung abnormalities was investigated. Results: Of the 2633 participants, 86 (3%) had pure paraseptal emphysema (defined as paraseptal emphysema with no other subtypes of emphysema other than paraseptal emphysema or a very few centrilobular emphysema involved) in at least one lung zone. The upper zone of the lungs was almost always involved. Compared to the participants without paraseptal emphysema, those with pure paraseptal emphysema were significantly older, and were more frequently male and smokers (mean 64 years, 71% male, mean 36 pack-years, P < 0.001) and had significantly decreased FEV{sub 1}/FVC% (P = 0.002), and diffusion capacity of carbon monoxide (DLCO) (P = 0.002). There was a significant association between pure paraseptal emphysema and interstitial lung abnormalities (P < 0.001). Conclusions: The prevalence of pure paraseptal emphysema was 3% in the

  13. Position of the American Dietetic Association: vegetarian diets.

    Science.gov (United States)

    Craig, Winston J; Mangels, Ann Reed

    2009-07-01

    It is the position of the American Dietetic Association that appropriately planned vegetarian diets, including total vegetarian or vegan diets, are healthful, nutritionally adequate, and may provide health benefits in the prevention and treatment of certain diseases. Well-planned vegetarian diets are appropriate for individuals during all stages of the life cycle, including pregnancy, lactation, infancy, childhood, and adolescence, and for athletes. A vegetarian diet is defined as one that does not include meat (including fowl) or seafood, or products containing those foods. This article reviews the current data related to key nutrients for vegetarians including protein, n-3 fatty acids, iron, zinc, iodine, calcium, and vitamins D and B-12. A vegetarian diet can meet current recommendations for all of these nutrients. In some cases, supplements or fortified foods can provide useful amounts of important nutrients. An evidence- based review showed that vegetarian diets can be nutritionally adequate in pregnancy and result in positive maternal and infant health outcomes. The results of an evidence-based review showed that a vegetarian diet is associated with a lower risk of death from ischemic heart disease. Vegetarians also appear to have lower low-density lipoprotein cholesterol levels, lower blood pressure, and lower rates of hypertension and type 2 diabetes than nonvegetarians. Furthermore, vegetarians tend to have a lower body mass index and lower overall cancer rates. Features of a vegetarian diet that may reduce risk of chronic disease include lower intakes of saturated fat and cholesterol and higher intakes of fruits, vegetables, whole grains, nuts, soy products, fiber, and phytochemicals. The variability of dietary practices among vegetarians makes individual assessment of dietary adequacy essential. In addition to assessing dietary adequacy, food and nutrition professionals can also play key roles in educating vegetarians about sources of specific nutrients

  14. Position of the American Dietetic Association: vegetarian diets.

    Science.gov (United States)

    Craig, Winston J; Mangels, Ann Reed

    2009-07-01

    It is the position of the American Dietetic Association that appropriately planned vegetarian diets, including total vegetarian or vegan diets, are healthful, nutritionally adequate, and may provide health benefits in the prevention and treatment of certain diseases. Well-planned vegetarian diets are appropriate for individuals during all stages of the life cycle, including pregnancy, lactation, infancy, childhood, and adolescence, and for athletes. A vegetarian diet is defined as one that does not include meat (including fowl) or seafood, or products containing those foods. This article reviews the current data related to key nutrients for vegetarians including protein, n-3 fatty acids, iron, zinc, iodine, calcium, and vitamins D and B-12. A vegetarian diet can meet current recommendations for all of these nutrients. In some cases, supplements or fortified foods can provide useful amounts of important nutrients. An evidence- based review showed that vegetarian diets can be nutritionally adequate in pregnancy and result in positive maternal and infant health outcomes. The results of an evidence-based review showed that a vegetarian diet is associated with a lower risk of death from ischemic heart disease. Vegetarians also appear to have lower low-density lipoprotein cholesterol levels, lower blood pressure, and lower rates of hypertension and type 2 diabetes than nonvegetarians. Furthermore, vegetarians tend to have a lower body mass index and lower overall cancer rates. Features of a vegetarian diet that may reduce risk of chronic disease include lower intakes of saturated fat and cholesterol and higher intakes of fruits, vegetables, whole grains, nuts, soy products, fiber, and phytochemicals. The variability of dietary practices among vegetarians makes individual assessment of dietary adequacy essential. In addition to assessing dietary adequacy, food and nutrition professionals can also play key roles in educating vegetarians about sources of specific nutrients

  15. 77 FR 70446 - Medicare and Medicaid Programs; Approval of the American Association for Accreditation of...

    Science.gov (United States)

    2012-11-26

    ... American Association for Accreditation of Ambulatory Surgery Facilities (AAAASF) for Continuing CMS Approval of Its Ambulatory Surgical Center Accreditation Program AGENCY: Centers for Medicare & Medicaid... Association for Accreditation of Ambulatory Surgery Facilities (AAAASF) for continued recognition as...

  16. Epigenomic analysis of lung adenocarcinoma reveals novel DNA methylation patterns associated with smoking

    Directory of Open Access Journals (Sweden)

    Tan Q

    2013-10-01

    Full Text Available Qiang Tan,1,* Guan Wang,1,* Jia Huang,1 Zhengping Ding,1 Qingquan Luo,1 Tony Mok,2 Qian Tao,2 Shun Lu1 1Department of Shanghai Lung Cancer Center, Shanghai Chest Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, People's Republic of China; 2Cancer Epigenetics Laboratory, Department of Clinical Oncology, State Key Laboratory of Oncology in South China, Sir YK Pao Center for Cancer and Li Ka Shing Institute of Health Sciences, The Chinese University of Hong Kong, Hong Kong *These authors contributed equally to this paper Abstract: The importance of epigenetic regulation has been increasingly recognized in the development of cancer. In this study, we investigated the impact of smoking, a major risk factor of lung cancer, on DNA methylation by comparing the genome-wide DNA methylation patterns between lung adenocarcinoma samples from six smokers and six nonsmokers. We identified that smoking-induced DNA methylations were enriched in the calcium signaling and neuroactive ligand receptor signaling pathways, which are closely related to smoking-induced lung cancers. Interestingly, we discovered that two genes in the mitogen-activated protein kinase signaling pathway (RPS6KA3 and ARAF were hypomethylated in smokers but not in nonsmokers. In addition, we found that the smoking-induced lung cancer-specific DNA methylations were mostly enriched in nuclear activities, including regulation of gene expression and chromatin remodeling. Moreover, the smoking-induced hypermethylation could only be seen in lung adenocarcinoma tissue but not in adjacent normal lung tissue. We also used differentially methylated DNA loci to construct a diagnostic model to distinguish smoking-associated lung cancer from nonsmoking lung cancer with a sensitivity of 88.9% and specificity of 83.2%. Our results provided novel evidence to support that smoking can cause dramatic changes in the DNA methylation landscape of lung cancer, suggesting that epigenetic

  17. Adverse childhood experiences are associated with the risk of lung cancer: a prospective cohort study

    Directory of Open Access Journals (Sweden)

    Edwards Valerie J

    2010-01-01

    Full Text Available Abstract Background Strong relationships between exposure to childhood traumatic stressors and smoking behaviours inspire the question whether these adverse childhood experiences (ACEs are associated with an increased risk of lung cancer during adulthood. Methods Baseline survey data on health behaviours, health status and exposure to adverse childhood experiences (ACEs were collected from 17,337 adults during 1995-1997. ACEs included abuse (emotional, physical, sexual, witnessing domestic violence, parental separation or divorce, or growing up in a household where members with mentally ill, substance abusers, or sent to prison. We used the ACE score (an integer count of the 8 categories of ACEs as a measure of cumulative exposure to traumatic stress during childhood. Two methods of case ascertainment were used to identify incident lung cancer through 2005 follow-up: 1 hospital discharge records and 2 mortality records obtained from the National Death Index. Results The ACE score showed a graded relationship to smoking behaviors. We identified 64 cases of lung cancer through hospital discharge records (age-standardized risk = 201 × 100,000-1 population and 111 cases of lung cancer through mortality records (age-standardized mortality rate = 31.1 × 100,000-1 person-years. The ACE score also showed a graded relationship to the incidence of lung cancer for cases identified through hospital discharge (P = 0.0004, mortality (P = 0.025, and both methods combined (P = 0.001. Compared to persons without ACEs, the risk of lung cancer for those with ≥ 6 ACEs was increased approximately 3-fold (hospital records: RR = 3.18, 95%CI = 0.71-14.15; mortality records: RR = 3.55, 95%CI = 1.25-10.09; hospital or mortality records: RR = 2.70, 95%CI = 0.94-7.72. After a priori consideration of a causal pathway (i.e., ACEs → smoking → lung cancer, risk ratios were attenuated toward the null, although not completely. For lung cancer identified through hospital

  18. AMERICAN COLLEGE OF CARDIOLOGY, AMERICAN HEART ASSOCIATION AND EUROPEAN SOCIETY OF CARDIOLOGY GUIDELINES (2006 FOR THE MANAGEMENT OF PATIENTS WITH ATRIAL FIBRILLATION (ENDING

    Directory of Open Access Journals (Sweden)

    V. Fuster

    2015-12-01

    Full Text Available A report of the American College of Cardiology, American Heart Association Task Force on practice guidelines and the European Society of Cardiology Committee for practice guidelines.

  19. AMERICAN COLLEGE OF CARDIOLOGY, AMERICAN HEART ASSOCIATION AND EUROPEAN SOCIETY OF CARDIOLOGY GUIDELINES (2006 FOR THE MANAGEMENT OF PATIENTS WITH ATRIAL FIBRILLATION (ENDING

    Directory of Open Access Journals (Sweden)

    V. Fuster

    2007-01-01

    Full Text Available A report of the American College of Cardiology, American Heart Association Task Force on practice guidelines and the European Society of Cardiology Committee for practice guidelines.

  20. Profusion of opacities in simple coal workers’ pneumoconiosis is associated with reduced lung function

    Science.gov (United States)

    Blackley, David J.; Laney, A. Scott; Halldin, Cara N.; Cohen, Robert A.

    2015-01-01

    Background A large body of evidence demonstrates dose-response relationships of cumulative coal mine dust exposure with lung function impairment and with small opacity profusion. However, medical literature generally holds that simple coal workers’ pneumoconiosis (CWP) is not associated with lung function impairment. This study examines the relationship between small opacity profusion and lung function in U.S. underground coal miners with simple CWP. Methods Miners were examined during 2005–2013 as part of the Enhanced Coal Workers’ Health Surveillance Program. Work histories were obtained, and chest radiographs and spirometry were administered. For those with multiple Program encounters, the most recent visit was used. Lung parenchymal abnormalities consistent with CWP were classified according to International Labour Organization guidelines, and reference values for FEV1 and FVC were calculated using reference equations derived from the 3rd National Health and Nutrition Examination Survey. Differences in lung function were evaluated by opacity profusion, and regression models were fit to characterize associations between profusion and lung function. Results A total of 8,230 miners were eligible for analysis; 269 had category 1 or 2 simple CWP. Decrements in FEV1 percent predicted were nearly consistent across profusion subcategories. Clear decrements in FVC percent predicted and FEV1/FVC were also observed, although these were less consistent. Controlling for smoking status, BMI, and mining tenure, each one-unit subcategory increase in profusion was associated with decreases of 1.5% (95% CI 1.0% to 1.9%), 1.0% (95% CI 0.6% to 1.3%), and 0.6% (95% CI 0.4% to 0.8%) in FEV1 percent predicted, FVC percent predicted, and FEV1/FVC, respectively. Conclusions We observed progressively lower lung function across the range of small opacity profusion. These findings address a longstanding question in occupational medicine, and point to the importance of medical

  1. Association of Patient-Provider Communication Domains with Lung Cancer Treatment

    Science.gov (United States)

    Lin, Jenny J.; Lake, Jessica; Wall, Melanie M.; Berman, Andrew R.; Salazar-Schicchi, John; Powell, Charles; Keller, Steven M.; Halm, Ethan A.; Leventhal, Howard; Wisnivesky, Juan P.

    2014-01-01

    Background Patient-physician communication is critical for helping patients understand and complete the complex steps needed to diagnose stage and treat lung cancer. We assessed which domains of patient-physician communication about lung cancer and its treatment are associated with receipt of disease-directed, stage-appropriate treatment. Methods Patients with recently-diagnosed lung cancer were recruited from four medical centers in New York City from 2008 to 2011. Participants were surveyed about discussions with physicians regarding treatment, symptoms and needs. Multiple regression analysis and structural equation modeling were used to assess which communication factors were associated with disease treatment. Results Of the 352 participants, 191 (54%) received disease-directed, stage-appropriate treatment. Unadjusted associations between communication items and treatment found that participants who felt that their physicians explained the risks and disadvantages of lung cancer treatment (P0.05 for both comparisons). Conclusions These data suggest that treatment information is particularly important for increasing the probability of cancer-directed therapy among lung cancer patients. Clinicians should ensure that they clearly discuss treatment goals and options with patients while maintaining empathy, supporting patient needs, and addressing symptoms. PMID:25122421

  2. Lung

    International Nuclear Information System (INIS)

    At present no simple statement can be made relative to the role of radionuclidic lung studies in the pediatric population. It is safe to assume that they will be used with increasing frequency for research and clinical applications because of their sensitivity and ready applicability to the pediatric patient. Methods comparable to those used in adults can be used in children older than 4 years. In younger children, however, a single injection of 133Xe in solution provides an index of both regional perfusion and ventilation which is easier to accomplish. This method is particularly valuable in infants and neonates because it is rapid, requires no patient cooperation, results in a very low radiation dose, and can be repeated in serial studies. Radionuclidic studies of ventilation and perfusion can be performed in almost all children if the pediatrician and the nuclear medicine specialist have motivation and ingenuity. S

  3. The American Urological Association symptom index for benign prostatic hyperplasia. The Measurement Committee of the American Urological Association.

    Science.gov (United States)

    Barry, M J; Fowler, F J; O'Leary, M P; Bruskewitz, R C; Holtgrewe, H L; Mebust, W K; Cockett, A T

    1992-11-01

    A symptom index for benign prostatic hyperplasia (BPH) was developed and validated by a multidisciplinary measurement committee of the American Urological Association (AUA). Validation studies were conducted involving a total of 210 BPH patients and 108 control subjects. The final AUA symptom index includes 7 questions covering frequency, nocturia, weak urinary stream, hesitancy, intermittence, incomplete emptying and urgency. On revalidation, the index was internally consistent (Cronbach's alpha = 0.86) and the score generated had excellent test-retest reliability (r = 0.92). Scores were highly correlated with subjects' global ratings of the magnitude of their urinary problem (r = 0.65 to 0.72) and powerfully discriminated between BPH and control subjects (receiver operating characteristic area 0.85). Finally, the index was sensitive to change, with preoperative scores decreasing from a mean of 17.6 to 7.1 by 4 weeks after prostatectomy (p < 0.001). The AUA symptom index is clinically sensible, reliable, valid and responsive. It is practical for use in practice and for inclusion in research protocols.

  4. The mediating role of maternal warmth in the associations between harsh parental practices and externalizing and internalizing behaviors in Hispanic American, African American, and European American families.

    Science.gov (United States)

    Yildirim, Elif Dede; Roopnarine, Jaipaul L

    2015-07-01

    Using data from the add-on 5-year cohort of In-Home Longitudinal Study of preschool aged Children of the Fragile Families and Child Well-Being Study (FFCWS), we examined the mediating role of maternal warmth in the associations between positive and harsh maternal practices and children's externalizing and internalizing behaviors. The sample consisted of 1,922 low-income Hispanic American, African American, and European American families. For European Americans, the links between maternal psychological aggression and hostility and children's externalizing behaviors were direct. Similarly, for Hispanic Americans, the links between maternal psychological aggression, physical assault, and hostility and externalizing behaviors were direct, as was the link between maternal physical assault and internalizing behaviors. For African Americans, maternal warmth partially mediated the links between maternal hostility and physical assault and externalizing behaviors. However, the associations between psychological aggression and externalizing and internalizing behaviors were direct. The data are discussed with respect to similarities in cultural pathways of influence between harsh maternal treatment and children's behavioral difficulties across ethnic groups.

  5. The mediating role of maternal warmth in the associations between harsh parental practices and externalizing and internalizing behaviors in Hispanic American, African American, and European American families.

    Science.gov (United States)

    Yildirim, Elif Dede; Roopnarine, Jaipaul L

    2015-07-01

    Using data from the add-on 5-year cohort of In-Home Longitudinal Study of preschool aged Children of the Fragile Families and Child Well-Being Study (FFCWS), we examined the mediating role of maternal warmth in the associations between positive and harsh maternal practices and children's externalizing and internalizing behaviors. The sample consisted of 1,922 low-income Hispanic American, African American, and European American families. For European Americans, the links between maternal psychological aggression and hostility and children's externalizing behaviors were direct. Similarly, for Hispanic Americans, the links between maternal psychological aggression, physical assault, and hostility and externalizing behaviors were direct, as was the link between maternal physical assault and internalizing behaviors. For African Americans, maternal warmth partially mediated the links between maternal hostility and physical assault and externalizing behaviors. However, the associations between psychological aggression and externalizing and internalizing behaviors were direct. The data are discussed with respect to similarities in cultural pathways of influence between harsh maternal treatment and children's behavioral difficulties across ethnic groups. PMID:25364834

  6. Rare Case of Unilateral Hypoplasia of Lung with Associated Ventricular Mass in an Adult

    Science.gov (United States)

    Alam, Azad; Iyer, Aparna; Kutty, Jayalakshmi Thelapurath

    2016-01-01

    Hypoplasia of the lung is a rare congenital condition which can be: a) primary i.e. no apparent cause is found; or b) secondary i.e. associated with other congenital anomalies that are implicated in its pathogenesis. These anomalies may involve the diaphragm, cardiovascular, central nervous, urogenital and musculoskeletal system. Patients usually present in neonatal, infancy or childhood period and very rarely in adulthood. Our patient was an adult having a unilateral hypoplastic lung associated with a ventricular mass and to our knowledge this rare combination has never been reported in the English literature; though there are reports of prenatal or newborns with hypoplastic lung and rhabdomyoma of ventricle who did not survive.

  7. Parental Factors Associated with Mexican American Adolescent Alcohol Use

    Directory of Open Access Journals (Sweden)

    Cristina Mogro-Wilson

    2013-01-01

    Full Text Available The purpose of this study is to further the understanding of how parenting and the relationship between the parent and the youth influence adolescent alcohol use in Mexican American families, with particular attention to acculturation. Results indicated that parental warmth is a strong factor in predicting adolescent alcohol use among Mexican adolescents. The parent-youth relationship played an important role in lowering alcohol use for Mexican American youth. Acculturation has an impact on the level of warmth, control, and the parent-youth relationship for Mexican American families. Findings indicate that there are unique family mechanisms for Mexican American families that should be considered when developing prevention and treatment options.

  8. Genomewide association study of lung lesions in cattle using sample pooling.

    Science.gov (United States)

    Keele, J W; Kuehn, L A; McDaneld, T G; Tait, R G; Jones, S A; Smith, T P L; Shackelford, S D; King, D A; Wheeler, T L; Lindholm-Perry, A K; McNeel, A K

    2015-03-01

    Bovine respiratory disease complex (BRDC) is the most expensive disease in beef cattle in the United States costing the industry at least US$1 billion annually. Bovine respiratory disease complex causes damage to lung tissue resulting in persistent lung lesions observable at slaughter. Severe lung lesions at harvest have been associated with decreased preharvest ADG and increased clinical BRDC in the feedlot. Our objective was to identify SNP that are associated with severe lung lesions observed at harvest in feedlot cattle. We conducted a genomewide association study (GWAS) using a case-control design for severe lung lesions in fed cattle at slaughter using the Illumina Bovine HD array (approximately 770,000 SNP) and sample pooling. Lung samples were collected from 11,520 young cattle, a portion of which had not been treated with antibiotics (participating in a "natural" marketing program), at a large, commercial beef processing plant in central Nebraska. Lung samples with lesions (cases) and healthy lungs (controls) were collected when both phenotypes were in close proximity on the viscera (offal) table. We constructed 60 case and 60 control pools with 96 animals per pool. Pools were constructed by sampling sequence to ensure that case and control pool pairs were matched by proximity on the processing line. The Bovine HD array (770,000 SNP) was run on all pools. Fourteen SNP on BTA 2, 3, 4, 9, 11, 14, 15, 22, 24, and 25 were significant at the genomewide experiment-wise error rate of 5% ( ≤ 1.49 × 10). Eighty-five SNP on 28 chromosomes achieved a false discovery rate of 5% ( ≤ 5.38 × 10). Significant SNP were near (±100 kb) genes involved in tissue repair and regeneration, tumor suppression, cell proliferation, apoptosis, control of organ size, and immunity. Based on 85 significantly associated SNP in or near a collection of genes with diverse function on 28 chromosomes, we conclude that the genomic footprint of lung lesions is complex. A complex genomic

  9. Your Lung Operation: After Your Operation

    Medline Plus

    Full Text Available ... About the ACS Catalog Find a Product Contribute Education Journal of the American College of Surgeons About JACS ... News Stay Up to Date with ACS Association ... ( 0 ) Items American College of Surgeons Education Patients and Family Skills Programs Your Lung Operation ...

  10. Changes in the lung microbiome following lung transplantation include the emergence of two distinct Pseudomonas species with distinct clinical associations.

    Directory of Open Access Journals (Sweden)

    Robert P Dickson

    Full Text Available BACKGROUND: Multiple independent culture-based studies have identified the presence of Pseudomonas aeruginosa in respiratory samples as a positive risk factor for bronchiolitis obliterans syndrome (BOS. Yet, culture-independent microbiological techniques have identified a negative association between Pseudomonas species and BOS. Our objective was to investigate whether there may be a unifying explanation for these apparently dichotomous results. METHODS: We performed bronchoscopies with bronchoalveolar lavage (BAL on lung transplant recipients (46 procedures in 33 patients and 26 non-transplant control subjects. We analyzed bacterial communities in the BAL fluid using qPCR and pyrosequencing of 16S rRNA gene amplicons and compared the culture-independent data with the clinical metadata and culture results from these subjects. FINDINGS: Route of bronchoscopy (via nose or via mouth was not associated with changes in BAL microbiota (p = 0.90. Among the subjects with positive Pseudomonas bacterial culture, P. aeruginosa was also identified by culture-independent methods. In contrast, a distinct Pseudomonas species, P. fluorescens, was often identified in asymptomatic transplant subjects by pyrosequencing but not detected via standard bacterial culture. The subject populations harboring these two distinct pseudomonads differed significantly with respect to associated symptoms, BAL neutrophilia, bacterial DNA burden and microbial diversity. Despite notable differences in culturability, a global database search of UM Hospital Clinical Microbiology Laboratory records indicated that P. fluorescens is commonly isolated from respiratory specimens. INTERPRETATION: We have reported for the first time that two prominent and distinct Pseudomonas species (P. fluorescens and P. aeruginosa exist within the post-transplant lung microbiome, each with unique genomic and microbiologic features and widely divergent clinical associations, including presence during

  11. Dramatic improvement of anti-SS-A/Ro-associated interstitial lung disease after immunosuppressive treatment.

    Science.gov (United States)

    Paola, Caramaschi; Giuliana, Festi; Giovanni, Orsolini; Cristian, Caimmi; Domenico, Biasi

    2016-07-01

    The aim of the study was to report three patients affected by interstitial lung disease associated with positive anti-SS-A/Ro autoantibody who showed a dramatic improvement after immunosuppressive treatment. Medical charts were reviewed to obtain clinical data, laboratory parameters, lung function tests, high-resolution computed tomography results and response to immunosuppressive treatment. The three patients showed a clinical picture of a lung-dominant connective tissue disease characterized by a sudden onset with dyspnea, cough and subtle extrathoracic features together with positive anti-SS-A/Ro antibody and weak titer antinuclear antibodies. All three patients responded favorably to immunosuppressive therapy: Two cases were treated with a combination of corticosteroid and cyclophosphamide followed by mycophenolate mofetil; in the third patient, clinical benefit was obtained after rituximab was added to corticosteroid and immunosuppressant drug. In spite of an abrupt onset with significant lung function impairment, all three patients had a favorable clinical response to immunosuppressive therapy. This report may be useful in making therapeutic decisions in case of interstitial lung disease associated with anti-SS-A antibody.

  12. The Association Between Alcohol Consumption and Lung Carcinoma by Histological Subtype.

    Science.gov (United States)

    Troche, Jose Ramon; Mayne, Susan T; Freedman, Neal D; Shebl, Fatma M; Abnet, Christian C

    2016-01-15

    Alcohol is a carcinogen suspected of increasing lung cancer risk. Therefore, we prospectively evaluated the relationship between alcohol consumption and lung carcinoma in 492,902 persons from the National Institutes of Health-AARP Diet and Health Study. We used Cox models to calculate hazard ratios and 95% confidence intervals, adjusting for tobacco smoking and other potential confounders. Between 1995/1996 and December 31, 2006, there were 10,227 incident cases of lung carcinoma, classified as adenocarcinoma (n = 4,036), squamous cell carcinoma (n = 1,998), small cell carcinoma (n = 1,524), undifferentiated carcinoma (n = 559), and other (n = 2,110). Compared with nondrinking, alcohol consumption was associated with a modest nonlinear reduction in total lung carcinoma risk at lower levels of consumption (for 0.5-drink/day, HR = 0.89, 95% confidence interval: 0.82, 0.96) but a modest increase in risk in the highest category (for ≥7 drinks/day, HR = 1.11, 95% confidence interval: 1.00, 1.24). Regarding histological type, alcohol was associated with a nonlinear reduction in squamous cell carcinoma that became attenuated as consumption increased and a modest increase in adenocarcinoma among heavier drinkers. Cubic spline models confirmed these findings. Our data suggest that the relationship between alcohol consumption and lung carcinoma differs by histological subtype. PMID:26672017

  13. Physical activity is not associated with spirometric indices in lung-healthy German youth.

    Science.gov (United States)

    Smith, Maia P; von Berg, Andrea; Berdel, Dietrich; Bauer, Carl-Peter; Hoffmann, Barbara; Koletzko, Sibylle; Nowak, Dennis; Heinrich, Joachim; Schulz, Holger

    2016-08-01

    In lung disease, physical activity improves lung function and reduces morbidity. However, healthy populations are not well studied. We estimate the relationship between spirometric indices and accelerometric physical activity in lung-healthy adolescents.895 nonsmoking German adolescents without chronic lung disease (45% male, mean±sd age 15.2±0.26 years) from the GINIplus and LISAplus cohorts completed questionnaires, spirometry, 7-day accelerometry and an activity diary. Physical activity was measured as minutes, quintiles and regularity of daily moderate, vigorous and moderate-to-vigorous physical activity (MVPA), participation in sport and active commuting to school. Primary outcomes were forced expiratory volume in 1 s (FEV1), forced vital capacity (FVC), FEV1/FVC and forced expiratory flow at 25-75% of FVC; they were separately correlated with physical activity and adjusted for confounders of respiratory function, including early-life exposures.Adolescents averaged 40 min MVPA per day, typical for European youth. 79% participated in sports and 51% commuted actively. An association was suggested between 3% higher FVC (∼100 mL) and either extreme MVPA quintile or percentage of days with >30 min MVPA (plifestyle and physical activity were nonsignificant.Spirometric indices were not significantly associated with active lifestyle or measures of activity in lung-healthy adolescents after adjustment for confounding and multiple-comparison artefacts. PMID:27009173

  14. Proteomic Analysis of Cytokeratin Isoforms Uncovers Association with Survival in Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Tarek G. Gharib

    2002-01-01

    Full Text Available Cytokeratins. (CK are intermediate filaments whose expression is often altered in epithelial cancer. Systematic identification of lung adenocarcinoma proteins using two-dimensional polyacrylamide gel electrophoresis and mass spectrometry has uncovered numerous CK isoforms. In this study, 93 lung adenocarcinomas. (64 stage I and 29 stage III and 10 uninvolved lung samples were quantitatively examined for protein expression. Fourteen of 21 isoforms of CK 7, 8, 18, 19 occurred at significantly higher levels. (P<.05 in tumors compared to uninvolved adjacent tissue. Specific isoforms of the four types of CK identified correlated with either clinical outcome or individual clinical-pathological parameters. All five of the CK7 isoforms associated with patient survival represented cleavage products. Two of five CK7 isoforms. (nos. 2165 and 2091, one of eight CK8 isoforms. (no. 439, one of three CK19 isoforms. (no. 1955 were associated with survival and significantly correlated to their mRNA levels, suggesting that transcription underlies overexpression of these CK isoforms. Our data indicate substantial heterogeneity among CK in lung adenocarcinomas resulting from posttranslational modifications, some of which correlated with patient survival and other clinical parameters. Therefore, specific isoforms of individual CK may have utility as diagnostic or predictive markers in lung adenocarcinomas.

  15. Educational activities of the American Association of Physicists in Medicine

    International Nuclear Information System (INIS)

    Full text: The American Association of Physicists in Medicine (AAPM) was incorporated in 1958. Among the main purposes of the Association as specified in its Articles of Incorporation is to 'promote the application of physics to medicine and biology, to encourage interest and training in medical physics and related fields, and to prepare and to disseminate technical information in medical physics and related fields'. AAPM's activities in education emanate primarily from its Educational and Science Councils, International Affairs Committee (IAC), Annual Meeting, Annual Summer School, Medical Physics journal, and Website (www.aapm.org). AAPM devotes nearly one third of its total budget to educational activities not only in the United States but also internationally, with many of the international activities being co-sponsored and/or in conjunction and cooperation with the International Organization of Medical Physics, International Atomic Energy Agency, and other international societies. The AAPM's IAC has subcommittees devoted to all regions of the earth including subcommittees for African Affairs, Asian Oceanic Affairs, European Affairs, Latin American Affairs, Middle East Affairs, and the Exchange Scientist Program. The AAPM includes under its umbrella of Education the creation of Task Group Reports on various training and standard of practice documents, teaching syllabi, slide sets, PowerPoint presentations, support of continuing educational meetings throughout the world including meetings in developing countries, and free access to most of the educational and professional modules on its website. The AAPM's Education Council oversees the activities of several committees and task groups dedicated to national and international educational activities for medical physicists as well as other health professional (such as physicians and medical technologists) via the activities of our committees on Continuing Professional Development, Education and Training of Medical

  16. Reduced lung function is independently associated with increased risk of type 2 diabetes in Korean men

    Directory of Open Access Journals (Sweden)

    Kwon Chang-Hee

    2012-04-01

    Full Text Available Abstract Background Reduced lung function is associated with incident insulin resistance and diabetes. The aim of this study was to assess the relationship between lung function and incident type 2 diabetes in Korean men. Methods This study included 9,220 men (mean age: 41.4 years without type 2 diabetes at baseline who were followed for five years. Subjects were divided into four groups according to baseline forced vital capacity (FVC (% predicted and forced expiratory volume in one second (FEV1 (% predicted quartiles. The incidence of type 2 diabetes at follow-up was compared according to FVC and FEV1 quartiles. Results The overall incidence of type 2 diabetes was 2.2%. Reduced lung function was significantly associated with the incidence of type 2 diabetes after adjusting for age, BMI, education, smoking, exercise, alcohol, and HOMA-IR. Both FVC and FEV1 were negatively associated with type 2 diabetes (P 1 had a significantly higher odds ratio for type 2 diabetes compared with the highest quartile after adjusting for age and BMI (2.15 [95% CI 1.02-4.57] and 2.19 [95% CI 1.09-4.42]. Conclusions Reduced lung function is independently associated with the incidence of type 2 diabetes in Korean men.

  17. Dietary patterns associated with male lung cancer risk in the Netherlands Cohort Study

    NARCIS (Netherlands)

    Balder, H.F.; Goldbohm, R.A.; Brandt, P.A. van den

    2005-01-01

    The objective of this article was to study the association between dietary patterns and lung cancer incidence in the Netherlands Cohort Study on Diet and Cancer. The baseline measurement of this prospective case cohort study that was completed by 58,279 men in 1986 included a self-administered quest

  18. Clinical analysis of 64 patients with lung-cancer-associated hypercalcemia

    Directory of Open Access Journals (Sweden)

    Xu Li

    2015-01-01

    Conclusions: Patients with Stage IV lung-cancer-associated moderate and severe hypercalcemia exhibited shorter survival time and poor prognosis. After correction, moderate and severe elevations of hypercalcemia and abnormal elevation of alkaline phosphatase levels were shown to be significant factors shortening patients' survival time.

  19. Variants in the 15q24/25 locus associate with lung function decline in active smokers

    NARCIS (Netherlands)

    Hoesein, Firdaus A. A. Mohamed; Wauters, Els; Janssens, Wim; Groen, Hendricus; Smolonska, Joanna; Wijmenga, Cisca; Postma, Dirkje S.; Boezen, H. Marike; De Jong, Pim A.; Decramer, Marc; Lammers, Jan-Willem J.; Lambrechts, Diether; Zanen, Pieter

    2013-01-01

    Genetic variation in nicotinic acetylcholine receptor subunit genes (nAChRs) is associated with lung function level and chronic obstructive pulmonary disease (COPD). It is unknown whether these variants also predispose to an accelerated lung function decline. We investigated the association of nAChR

  20. Genome wide association identifies PPFIA1 as a candidate gene for acute lung injury risk following major trauma.

    Directory of Open Access Journals (Sweden)

    Jason D Christie

    Full Text Available Acute Lung Injury (ALI is a syndrome with high associated mortality characterized by severe hypoxemia and pulmonary infiltrates in patients with critical illness. We conducted the first investigation to use the genome wide association (GWA approach to identify putative risk variants for ALI. Genome wide genotyping was performed using the Illumina Human Quad 610 BeadChip. We performed a two-stage GWA study followed by a third stage of functional characterization. In the discovery phase (Phase 1, we compared 600 European American trauma-associated ALI cases with 2266 European American population-based controls. We carried forward the top 1% of single nucleotide polymorphisms (SNPs at p<0.01 to a replication phase (Phase 2 comprised of a nested case-control design sample of 212 trauma-associated ALI cases and 283 at-risk trauma non-ALI controls from ongoing cohort studies. SNPs that replicated at the 0.05 level in Phase 2 were subject to functional validation (Phase 3 using expression quantitative trait loci (eQTL analyses in stimulated B-lymphoblastoid cell lines (B-LCL in family trios. 159 SNPs from the discovery phase replicated in Phase 2, including loci with prior evidence for a role in ALI pathogenesis. Functional evaluation of these replicated SNPs revealed rs471931 on 11q13.3 to exert a cis-regulatory effect on mRNA expression in the PPFIA1 gene (p = 0.0021. PPFIA1 encodes liprin alpha, a protein involved in cell adhesion, integrin expression, and cell-matrix interactions. This study supports the feasibility of future multi-center GWA investigations of ALI risk, and identifies PPFIA1 as a potential functional candidate ALI risk gene for future research.

  1. Opsoclonus-myoclonus syndrome associated with non-small cell lung cancer.

    Science.gov (United States)

    Karasaki, Takahiro; Tanaka, Makoto

    2015-11-01

    A 68-year-old man developed progressive vertigo, saccadic eye movements, and tremors. Computed tomography showed multiple lung nodules. Surgery was performed and the pathological diagnosis was large cell neuroendocrine carcinoma in the left upper lobe with ipsilobar metastases, and adenocarcinoma in the left lower lobe. The neurological symptoms resolved dramatically after complete resection of the tumors. Opsoclonus-myoclonus syndrome associated with non-small-cell lung carcinoma is extremely rare. Surgery should not be delayed if a complete resection is expected.

  2. Metformin therapy associated with survival benefit in lung cancer patients with diabetes

    Science.gov (United States)

    Wan, Guoxing; Yu, Xiongjie; Chen, Ping; Wang, Xianhe; Pan, Dongfeng; Wang, Xuanbin; Li, Linjun; Cai, Xiaojun; Cao, Fengjun

    2016-01-01

    The purpose of this study is to summarize the currently available evidence regarding the concerned issue by performing a comprehensive meta-analysis. Relevant publications reporting the association of metformin use with survival of lung cancer patients with diabetes were electronically searched to identify eligible studies. The meta-analysis was performed with hazard ratios (HRs) and 95% confidence intervals (95% CIs) as effect measures for disease-free survival(DFS) and overall survival(OS) estimates. A total of 17 individual studies from 10 publications were included in the meta-analysis. Overall, the results revealed a significant association of metformin use with a better survival of lung cancer patients with diabetes(for DFS: HR = 0.65, 95%CI = 0.52-0.83; for OS: HR = 0.78, 95%CI = 0.64-0.93). The subgroup analyses showed similar association in Asian region(for DFS:HR = 0.69, 95%CI = 0.59-0.80; for OS: HR = 0.55, 95%CI = 0.46-0.67) but not in Western region. Such association was also presented in small cell lung cancer (for DFS: HR = 0.54, 95%CI = 0.38-0.77; for OS: HR = 0.52, 95%CI = 0.39-0.69) and in non-small cell lung cancer(for DFS: HR = 0.70, 95%CI = 0.51-0.96; for OS: HR = 0.75, 95%CI = 0.58-0.97). Analyses stratified by treatment strategy showed a reduction in the risk of cancer-related mortality in patients receiving chemotherapy(for DFS: HR = 0.71, 95%CI = 0.64-0.83; for OS: HR = 0.58, 95%CI = 0.47-0.71) but not in patients receiving chemoradiotherapy. The meta-analysis demonstrated that metformin use was significantly associated with a favorable survival outcome of lung cancer patients with diabetes. PMID:27105507

  3. Acute fibrinous and organising pneumonia following lung transplantation is associated with severe allograft dysfunction and poor outcome: a case series

    Directory of Open Access Journals (Sweden)

    Keith Meyer

    2015-01-01

    Full Text Available   Acute fibrinous and organising pneumonia (AFOP is a histopathologic variant of acute lung injury that has been associated with infection and inflammatory disorders and has been reported as a complication of lung transplantation. A retrospective chart review was performed for all patients transplanted at the University of Wisconsin Hospital and Clinics from January 1995 to December 2013 (n = 561. We identified 6 recipients whose clinical course was complicated by AFOP. All recipients were found to have AFOP on lung biopsy or at post-mortem examination, and 5 of the 6 patients suffered progressive allograft dysfunction that led to fatal outcome. Only 1 of the 6 patients stabilised with augmented immunosuppression and had subsequent improvement and stabilisation of allograft function. We could not clearly identify any specific cause of AFOP, such as drug toxicity or infection. Lung transplantation can be complicated by lung injury with an AFOP pattern on histopathologic examination of lung biopsy specimens. The presence of an AFOP pattern was associated with irreversible decline in lung function that was refractory to therapeutic interventions in 5 of our 6 cases and was associated with severe allograft dysfunction and death in these 5 individuals. AFOP should be considered as a potential diagnosis when lung transplant recipients develop progressive decline in lung function that is consistent with a clinical diagnosis of chronic lung allograft dysfunction.  

  4. 77 FR 42229 - Gruma Corporation, Spina Bifida Association, March of Dimes Foundation, American Academy of...

    Science.gov (United States)

    2012-07-18

    ..., March of Dimes Foundation, American Academy of Pediatrics, Royal DSM N.V., and National Council of La... that appeared in the Federal Register of June 13, 2012 (77 FR 35317). The document announced that Gruma Corporation, Spina Bifida Association, March of Dimes Foundation, American Academy of Pediatrics, Royal DSM...

  5. EGFR mutations in patients with brain metastases from lung cancer: Association with the efficacy of gefitinib

    OpenAIRE

    Shimato, Shinji; Mitsudomi, Tetsuya; Kosaka, Takayuki; Yatabe, Yasushi; Wakabayashi, Toshihiko; Mizuno, Masaaki; NAKAHARA, NORIMOTO; Hatano, Hisashi; Natsume, Atsushi; Ishii, Dai; YOSHIDA, Jun

    2006-01-01

    Gefitinib—a specific inhibitor of epidermal growth factor receptor (EGFR)-associated tyrosine kinase—has demonstrated efficacy in a subgroup of patients with non-small-cell lung carcinoma (NSCLC) who fail conventional chemotherapy. It is also reported to have an antitumor effect in brain metastases from NSCLC. Additionally, EGFR mutations have shown a strong association with gefitinib sensitivity for NSCLC. Here, we assessed the efficacy of gefitinib in brain metastases from NSCLC and evaluat...

  6. Carcinosarcoma of the Lung Associated with Neurofibromatosis Type 1: A Case Re

    Directory of Open Access Journals (Sweden)

    Rana ÇİTİL

    2012-01-01

    Full Text Available Neurofibromatosis or von Recklinghausen's disease is the most common inherited syndrome predisposing to neoplasia. Carcinosarcoma is a rare malignant mixed tumor of the lung. Association of carcinosarcoma of lung with Neurofibromatosis-1 is not common. A 57-year-old man presented with history of fever, cough, hemoptysis, breathlessness, weight loss, chest pain. Multiple cutaneous neurofibromas and café au lait spots were revealed by physical examination. A homogeneous opacity was found in the right middle and right upper zone on posterior-anterior chest radiography. A 8x8x7 cm mass that had irregular borders in right upper posterior and apical segment was seen on contrast enhanced chest computed tomography. On bronchoscopy, the lumen of right upper apical segment was obstructed with vegetating tumoral lesion. The biopsy taken from this region was diagnosed as carcinosarcoma by histopathological and immunohistochemical examination.A rare case with carcinosarcoma of the lung and Neurofibromatosis-1 was reported.

  7. Matrix-Gla protein promotes osteosarcoma lung metastasis and associates with poor prognosis.

    Science.gov (United States)

    Zandueta, Carolina; Ormazábal, Cristina; Perurena, Naiara; Martínez-Canarias, Susana; Zalacaín, Marta; Julián, Mikel San; Grigoriadis, Agamemnon E; Valencia, Karmele; Campos-Laborie, Francisco J; Rivas, Javier De Las; Vicent, Silvestre; Patiño-García, Ana; Lecanda, Fernando

    2016-08-01

    Osteosarcoma (OS) is the most prevalent osseous tumour in children and adolescents and, within this, lung metastases remain one of the factors associated with a dismal prognosis. At present, the genetic determinants driving pulmonary metastasis are poorly understood. We adopted a novel strategy using robust filtering analysis of transcriptomic profiling in tumour osteoblastic cell populations derived from human chemo-naive primary tumours displaying extreme phenotypes (indolent versus metastatic) to uncover predictors associated with metastasis and poor survival. We identified MGP, encoding matrix-Gla protein (MGP), a non-collagenous matrix protein previously associated with the inhibition of arterial calcification. Using different orthotopic models, we found that ectopic expression of Mgp in murine and human OS cells led to a marked increase in lung metastasis. This effect was independent of the carboxylation of glutamic acid residues required for its physiological role. Abrogation of Mgp prevented lung metastatic activity, an effect that was rescued by forced expression. Mgp levels dramatically altered endothelial adhesion, trans-endothelial migration in vitro and tumour cell extravasation ability in vivo. Furthermore, Mgp modulated metalloproteinase activities and TGFβ-induced Smad2/3 phosphorylation. In the clinical setting, OS patients who developed lung metastases had high serum levels of MGP at diagnosis. Thus, MGP represents a novel adverse prognostic factor and a potential therapeutic target in OS. Microarray datasets may be found at: http://bioinfow.dep.usal.es/osteosarcoma/ Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. PMID:27172275

  8. Reading and analysis on management guidelines for hypothyroidism published in 2012 by American thyroid association and American association of clinical endocrinologists

    International Nuclear Information System (INIS)

    Recently, American Thyroid Association and American Association of Clinical Endocrinologists published Clinical Guideline for Hypothyroidism. The authors took an evidence-based medicine approach, and created 52 recommendations on 15 issues. The guideline emphasized that serum thyrotropin is the single best screening test for primary thyroid dysfunction for the vast majority of outpatient clinical situations. The standard treatment for hypothyroidism is replacement with L-thyroxine. The decision to treat subclinical hypothyroidism when the serum thyrotropin is less than 10 mIU/L should be tailored to the individual patient. (authors)

  9. CUEDC2 down-regulation is associated with tumor growth and poor prognosis in lung adenocarcinoma.

    Science.gov (United States)

    Sun, Longhua; Bai, Lihong; Lin, Gengpeng; Wang, Ran; Liu, Yangli; Cai, Jinghuang; Guo, Yubiao; Zhu, Zhiwen; Xie, Canmao

    2015-08-21

    CUE domain-containing 2 (CUEDC2) is a multi-functional protein, which regulates cell cycle, growth factor signaling and inflammation. We found that CUEDC2 was low in lung adenocarcinoma cell lines and lung adenocarcinoma tissues at both mRNA and protein levels. Low levels of CUEDC2 were correlated with a shorter survival time in patients with lung adenocarcinoma (p = 0.004). CUEDC2 expression was correlated with tumor T classification (P = 0.001) at clinical stage (P = 0.001) and tumor size (P = 0.033). Multivariate analysis suggested that CUEDC2 expression is an independent prognostic indicator for patients with lung adenocarcinoma. Ectopic expression of CUEDC2 decreased cell proliferation in vitro and inhibited tumor growth in nude mice in vivo. Knockdown of endogenous CUEDC2 by short hairpin RNAs (shRNAs) increased tumor growth. Inhibition of proliferation by CUEDC2 was associated with inactivation of the PI3K/Akt pathway, induction of p21 and down-regulation of cyclin D1. Our results suggest that decreased expression of CUEDC2 contributes to tumor growth in lung adenocarcinoma, leading to a poor clinical outcome.

  10. Spectrum of fibrosing diffuse parenchymal lung disease.

    Science.gov (United States)

    Morgenthau, Adam S; Padilla, Maria L

    2009-02-01

    The interstitial lung diseases are a heterogeneous group of disorders characterized by inflammation and/or fibrosis of the pulmonary interstitium. In 2002, the American Thoracic Society and the European Respiratory Society revised the classification of interstitial lung diseases and introduced the term diffuse parenchymal lung disease. The idiopathic interstitial pneumonias are a subtype of diffuse parenchymal lung disease. The idiopathic interstitial pneumonias are subdivided into usual interstitial pneumonia (with its clinical counterpart idiopathic interstitial pneumonia), nonspecific interstitial pneumonia, cryptogenic organizing pneumonia, acute interstitial pneumonia, desquamative interstitial pneumonia, respiratory bronchiolitis interstitial lung disease, and lymphocytic pneumonia. Sarcoidosis and hypersensitivity pneumonitis are the 2 most common granulomatous diffuse parenchymal lung diseases. Rheumatoid arthritis, systemic sclerosis, and dermatomyositis/polymyositis (causing antisynthetase syndrome) are diffuse parenchymal lung diseases of known association because these conditions are associated with connective tissue disease. Hermansky-Pudlak syndrome is a rare genetic diffuse parenchymal lung disease characterized by the clinical triad of pulmonary disease, oculocutaneous albinism, and bleeding diathesis. This review provides an overview of the chronic fibrosing diffuse parenchymal lung diseases. Its primary objective is to illuminate the clinical challenges encountered by clinicians who manage the diffuse parenchymal lung diseases regularly and to offer potential solutions to those challenges. Treatment for the diffuse parenchymal lung diseases is limited, and for many patients with end-stage disease, lung transplantation remains the best option. Although much has been learned about the diffuse parenchymal lung diseases during the past decade, research in these diseases is urgently needed. PMID:19170214

  11. Novel variation at chr11p13 associated with cystic fibrosis lung disease severity

    Science.gov (United States)

    Dang, Hong; Gallins, Paul J; Pace, Rhonda G; Guo, Xue-liang; Stonebraker, Jaclyn R; Corvol, Harriet; Cutting, Garry R; Drumm, Mitchell L; Strug, Lisa J; Knowles, Michael R; O’Neal, Wanda K

    2016-01-01

    Published genome-wide association studies (GWASs) identified an intergenic region with regulatory features on chr11p13 associated with cystic fibrosis (CF) lung disease severity. Targeted resequencing in n=377, followed by imputation to n=6,365 CF subjects, was used to identify unrecognized genetic variants (including indels and microsatellite repeats) associated with phenotype. Highly significant associations were in strong linkage disequilibrium and were seen only in Phe508del homozygous CF subjects, indicating a CFTR genotype-specific mechanism. PMID:27408752

  12. Ishwar Puri elected a Fellow of the American Association for the Advancement of Science

    OpenAIRE

    Crumbley, Liz

    2005-01-01

    The American Association for the Advancement of Science (AAAS) has awarded the distinction of Fellow to Ishwar Puri, head of the Department of Engineering Science and Mechanics in the Virginia Tech College of Engineering.

  13. 77 FR 17068 - Medicare and Medicaid Programs; Approval of the Application by the American Association for...

    Science.gov (United States)

    2012-03-23

    ... HUMAN SERVICES Centers for Medicare & Medicaid Services Medicare and Medicaid Programs; Approval of the Application by the American Association for Accreditation of Ambulatory Surgery Facilities for Deeming... Accreditation of Ambulatory Surgery Facilities ] (AAAASF) for recognition as a national accreditation...

  14. 75 FR 51464 - Medicare and Medicaid Programs; Approval of the American Association for Accreditation of...

    Science.gov (United States)

    2010-08-20

    ... American Association for Accreditation of Ambulatory Surgery Facilities for Continued Deeming Authority for Ambulatory Surgical Centers AGENCY: Centers for Medicare & Medicaid Services (CMS). ACTION: Final notice... for Accreditation of Ambulatory Surgery Facilities' (AAAASF) request for continued recognition as...

  15. American Association of Dental Schools Curricular Guidelines for Practice Management and for Preventive Dentistry.

    Science.gov (United States)

    Journal of Dental Education, 1980

    1980-01-01

    Curricular guidelines developed by the American Association of Dental Schools for use by individual educational institutions as curriculum development aids are provided. The guidelines were developed by the Sections on Community and Preventive Dentistry and Practice Administration. (MLW)

  16. American Urological Association survey of transurethral prostatectomy and the impact of changing medicare reimbursement.

    Science.gov (United States)

    Holtgrewe, H L

    1990-08-01

    The American Urological Association, in a survey of all American urologists, found that TURP accounts for 38 per cent of their major surgery and also found that activities associated with the operation account for nearly 25 per cent of their total patient workload. American urologists regard TURP as complex, and they believe proficiency requires more practical case experience during residency training than is required for any other urologic operation. American urologists assign TURP a significantly higher relative value than that proposed in the pending national Medicare Fee Schedule formulated by medical economists and the Physician Payment Review Commission. The legislated reductions in allowable Medicare fees for TURP and the possible shift in management of benign prostatic hyperplasia to nonsurgical methods create a financial vulnerability for American urologists who remain economically dependent on this dominant operation. Adjustments in practice patterns and manpower policy planning may well be required.

  17. Bronchial anthracofibrosis with interstitial lung disease: an association yet to be highlighted.

    Science.gov (United States)

    Kunal, Shekhar; Pilaniya, Vikas; Shah, Ashok

    2016-01-01

    Bronchial anthracofibrosis (BAF), an emerging pulmonary disease due to long-standing exposure to biomass fuel smoke, is predominantly seen in females from developing nations. BAF is known to be associated with tuberculosis, pneumonia, chronic obstructive pulmonary disease and lung cancer, but the association of BAF with interstitial lung disease (ILD) is rare and yet to be highlighted. A 72-year-old woman with a 30-year history of exposure to biomass fuel smoke presented with dry cough and exertional dyspnoea. Imaging demonstrated interlobular, intralobular and peribronchovascular interstitial thickening and honeycombing adjoining the subpleural regions, suggestive of the usual interstitial pneumonia pattern. A restrictive pattern with diffusion defect was noted. Fibrebronchoscopy revealed a bluish-black anthracotic pigmentation with a narrowed and distorted left upper lobe, and apical segment of left lower lobe bronchus, confirming BAF. A diagnosis of BAF with ILD was made. To the best of our knowledge, this is the first detailed description of this association. PMID:26759407

  18. Association Between Asthma and Obesity Among Immigrant Asian Americans, California Health Interview Survey, 2001–2011

    OpenAIRE

    Benjamin J. Becerra; Scroggins, Christy M.; Monideepa B. Becerra

    2014-01-01

    Our objective was to study the comorbidity of asthma and obesity among foreign-born Asian Americans, by subgroups. Public data from the California Health Interview Survey, 2001–2011, were analyzed by using independent logistic regressions, yielding the association between asthma and obesity (Asian and standard cutoffs for body mass index [BMIs]) of 19,841 Asian American immigrant respondents. Chinese, Filipino, South Asian, and Japanese immigrants had a positive association between lifetime a...

  19. Tumor-associated neutrophils stimulate T cell responses in early-stage human lung cancer

    Science.gov (United States)

    Eruslanov, Evgeniy B.; Bhojnagarwala, Pratik S.; Quatromoni, Jon G.; Stephen, Tom Li; Ranganathan, Anjana; Deshpande, Charuhas; Akimova, Tatiana; Vachani, Anil; Litzky, Leslie; Hancock, Wayne W.; Conejo-Garcia, José R.; Feldman, Michael; Albelda, Steven M.; Singhal, Sunil

    2014-01-01

    Infiltrating inflammatory cells are highly prevalent within the tumor microenvironment and mediate many processes associated with tumor progression; however, the contribution of specific populations remains unclear. For example, the nature and function of tumor-associated neutrophils (TANs) in the cancer microenvironment is largely unknown. The goal of this study was to provide a phenotypic and functional characterization of TANs in surgically resected lung cancer patients. We found that TANs constituted 5%–25% of cells isolated from the digested human lung tumors. Compared with blood neutrophils, TANs displayed an activated phenotype (CD62LloCD54hi) with a distinct repertoire of chemokine receptors that included CCR5, CCR7, CXCR3, and CXCR4. TANs produced substantial quantities of the proinflammatory factors MCP-1, IL-8, MIP-1α, and IL-6, as well as the antiinflammatory IL-1R antagonist. Functionally, both TANs and neutrophils isolated from distant nonmalignant lung tissue were able to stimulate T cell proliferation and IFN-γ release. Cross-talk between TANs and activated T cells led to substantial upregulation of CD54, CD86, OX40L, and 4-1BBL costimulatory molecules on the neutrophil surface, which bolstered T cell proliferation in a positive-feedback loop. Together our results demonstrate that in the earliest stages of lung cancer, TANs are not immunosuppressive, but rather stimulate T cell responses. PMID:25384214

  20. A case of anti-nuclear matrix protein 2 antibody positive myopathy associated with lung cancer.

    Science.gov (United States)

    Ohta, Shin; Unoda, Ki-Ichi; Nakajima, Hideto; Ikeda, Soichiro; Hamaguchi, Yasuhito; Kimura, Fumiharu

    2016-08-31

    Myositis-specific autoantibodies (MSAs) are associated with myositis. Anti-nuclear matrix protein 2 (NXP-2) antibody was recently identified as a major MSA and was observed mostly in juvenile dermatomyositis. We report the case of a 44-year-old man who presented with myopathy with anti-NXP-2 antibody and large cell carcinoma of the lung. He was hospitalized because of myalgia and edema of limbs. Neurological examination revealed mild proximal-dominant weakness in all four extremities, and laboratory studies showed elevated creatine kinase level (6,432 IU/l). Needle electromyography showed myogenic patterns. MRI of the lower limbs demonstrated inflammatory lesions in the thighs. Biopsied specimen from the left quadriceps femoris muscle showed mild mononuclear inflammatory infiltrate surrounding muscle fibres but no fiber necrosis. He was diagnosed with myopathy based on neurological examinations and clinical symptoms. His chest X-ray and CT showed tumor shadow on the right upper lung field, but CT didn't indicate the findings of interstitial lung disease. This was surgically removed, and a histological diagnosis of non-small cell lung cancer was suspected. He was also treated with definitive chemoradiotherapy before and after operation. His symptoms of myopathy promptly remitted with the preoperative chemotherapy. His serum analysis was positive for the anti-NXP-2. Further investigation and experience of MSAs are necessary to evaluate the therapeutic strategy against cancer-associated myopathy/myositis. PMID:27477574

  1. Efficacy of immunosoppressive therapy and steroid sparing effect in interstitial lung disease associated to antisynthetase syndrome

    Directory of Open Access Journals (Sweden)

    G. De Marchi

    2011-09-01

    Full Text Available Objective: To evaluate the role of bronchoalveolar lavage (BAL in patients with interstitial lung disease associated to antisynthetase syndrome. Methods: We describe 5 patients, anti-Jo1 positive, with interstitial lung disease (lung fibrosis and/or diffusion capacity of CO <80%. Patients were monitored with lung function tests every 6 months, with high-resolution computed tomography (HRCT every 12 months, and with bronchoalveolar lavage (BAL at baseline and in the subsequent follow-up. Patients were treated as follows: a azathioprine with colchicine, or cyclosporine alone b cyclophosphamide when high neutrophil or eosinophil count on BAL was observed. Only low-dose steroids were used for mild muscular or articular involvement. Results: Pulmonary involvement remained stable in all patients at months +24. Lung function remained unchanged compared to the baseline evaluation; HRCT was stable in patients with fibrosis and no progression into fibrosis was observed in patients with ground glass areas at baseline. Bacterial pneumonia occurred in one patient treated with cyclophosphamide and resolved after antibiotic therapy. Conclusions: Clinical manifestations, instrumental tests and BAL may be of value to choice the best immunosuppressive therapy in the single case. An early less aggressive approach (azathioprine with colchicine, or cyclosporine alone may be useful. BAL could be performed when a progression of the lung involvement is demonstrated in the subsequent follow-up. Cyclophosphamide may be a valid alternative treatment in the presence of a neutrophilic or eosinophilic alveolitis. Efficacy and safety of the aforementioned immunosuppressive approach were observed in our series, avoiding prolonged high-dose steroid administration.

  2. Role of Kupffer cells in acute hemorrhagic necrotizing pancreatitis-associated lung injury of rats

    Institute of Scientific and Technical Information of China (English)

    Hong-Bin Liu; Nai-Qiang Cui; Dong-Hua Li; Chang Chen

    2006-01-01

    AIM: To investigate the role of Kupffer cells (KCs) in acute hemorrhagic necrotizing pancreatitis-associated lung injury (AHNP-LI).METHODS: Forty-two rats were allocated to four groups [sham operation, AHNP model, gadolinium chloride (GdCl3) pretreatment, GdCl3 control]. In GdCl3pretreatment group, GdCl3 was administered by caudal vein injection 24 h before the AHNP model induction.Blood from the iliac artery, alveolar macrophages and tissues from the pancreas and lung, were collected in six animals per group 3 and 6 h after acute pancreatitis induction. TNF-α, IL-1 of serum, myeloperoxidase (MPO)of lung tissue, NF-κB activation of alveolar macrophages were detected. Serum AST and ALT in sham operation group and GdCl3 control group were tested. In addition,histopathological changes of the pancreas and lung were observed under light microscope.RESULTS: MPO of lung tissue and TNF-α, IL-1 levels of serum were all reduced significantly in GdCl3pretreatment group compared to those in AHNP group(P<0.01). NF-κB activation of alveolar macrophages was also attenuated significantly in GdCl3 pretreatment group compared to that in AHNP group (P<0.01). The pathological injury of the lung was ameliorated obviously in GdCl3 pretreatment group compared to that in AHNP group. Nevertheless, the serum amylase level did not reduce and injury of the pancreas was not prevented in GdCl3 pretreatment group.CONCLUSION: Pulmonary injury induced by AHNP is mediated by KC activation and AHNP-LI can be significantly ameliorated by pretreatment with GdCl3 and KCs play a vital role in AHNP-LI.

  3. Association of P53 codon 72 polymorphism and lung cancer in an ethnic Iranian population.

    Science.gov (United States)

    Eydian, Z; Asna'ashari, A M H; Behravan, J; Sharifi-Rad, J; Entezari Heravi, R

    2016-01-01

    Lung cancer is one of the most common causes of cancer death worldwide. Molecular genetic studies indicated that activation of dominant oncogenes or inactivation of tumor suppressor genes and the presence of polymorphism in these genes correlated with prevalence of new lung cancers. P53 as a tumor suppressor gene located at 17p13 chromosome and it is one of the most well-known mutant genes in all cancer types. Mutation in P53 can disturb the transcriptional function and suppression of cell cycle control and increase in cell division and amplification. We can predict the susceptibility of people inside a society to lung cancer with evaluation of P53 gene polymorphism. A total of 200 patients with lung cancer and 200 healthy controls participated in this case-control study. Genomic DNA was extracted from blood samples and PCR-RFLP analyses were used to genotype the P53 gene polymorphism in codon 72 of exon 4, chromosome 17. Among 200 lung cancer patients and 200 controls, there was no significant correlation between sexuality and cigarette smoking status. We did not find any relationship between cigarette smoking status and genotypes or pack-years but there was a significant correlation between cigarette smoking status and adenocarcinoma patients (P=0.03). The results of the present study revealed that there is no association between P53 codon 72 polymorphism and increased risk of lung cancer in patients and controls but according to results of adenocarcinoma in never-smoker patients, it seems that environmental factors may have more important role than genetic susceptibility in our ethnic Iranian population. PMID:27585259

  4. Systemic inflammation in young adults is associated with abnormal lung function in middle age.

    Directory of Open Access Journals (Sweden)

    Ravi Kalhan

    Full Text Available BACKGROUND: Systemic inflammation is associated with reduced lung function in both healthy individuals and those with chronic obstructive pulmonary disease (COPD. Whether systemic inflammation in healthy young adults is associated with future impairment in lung health is uncertain. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the association between plasma fibrinogen and C-reactive protein (CRP in young adults and lung function in the Coronary Artery Risk Development in Young Adults cohort study. Higher year 7 fibrinogen was associated with greater loss of forced vital capacity (FVC between years 5 and 20 (439 mL in quartile 4 vs. 398 mL in quartile 1, P<0.001 and forced expiratory volume in 1 second (FEV(1 (487 mL in quartile 4 vs. 446 mL in quartile 1, P<0.001 independent of cigarette smoking, body habitus, baseline lung function and demographic factors. Higher year 7 CRP was also associated with both greater loss of FVC (455 mL in quartile 4 vs. 390 mL in quartile 1, P<0.001 and FEV(1 (491 mL in quartile 4 vs. 442 mL in quartile 1, P = 0.001. Higher year 7 fibrinogen and CRP were associated with abnormal FVC at year 20 (odds ratio (OR per standard deviation 1.51 (95% confidence interval (CI: 1.30-1.75 for fibrinogen and 1.35 (95% CI: 1.14-1.59 for CRP. Higher year 5 fibrinogen was additionally associated with abnormal FEV(1. A positive interaction was observed between pack-years cigarette smoking and year 7 CRP for the COPD endpoint, and among participants with greater than 10 pack-years of cigarette exposure, year 7 CRP was associated with greater odds of COPD at year 20 (OR per standard deviation 1.53 (95% CI: 1.08-2.16. CONCLUSION/SIGNIFICANCE: Systemic inflammation in young adults is associated with abnormal lung function in middle age. In particular, elevated CRP may identify vulnerability to COPD among individuals who smoke. TRIAL REGISTRATION: ClinicalTrials.gov NCT00005130.

  5. Gene by Environment Interaction Linking the Chromosome 15q25 Locus With Cigarette Consumption and Lung Cancer Susceptibility--Are African American Affected Differently?

    Science.gov (United States)

    Hopkins, R J; Young, R P

    2016-02-01

    The majority of lung cancer cases result from complex interactions between smoking exposure, genetic susceptibility and a person's immune response to chronic inflammation or lung remodelling. Epidemiological studies confirm that susceptibility to developing chronic obstructive pulmonary disease (COPD), especially emphysema, is also closely linked to lung cancer susceptibility. Genetic epidemiology studies have consistently reported associations between the chromosome 15q25 locus with lung cancer and COPD. In addition, studies show this locus to be independently associated with cigarette consumption and nicotine addiction in a dose-response manner, primarily at lower levels of cigarette consumption. Studies that measure both cigarette consumption and lung function, together with extensive genotype analysis, will be needed to further unravel these complex relationships. PMID:27014742

  6. Gene by Environment Interaction Linking the Chromosome 15q25 Locus With Cigarette Consumption and Lung Cancer Susceptibility — Are African American Affected Differently?

    Directory of Open Access Journals (Sweden)

    R.J. Hopkins

    2016-02-01

    Full Text Available The majority of lung cancer cases result from complex interactions between smoking exposure, genetic susceptibility and a person's immune response to chronic inflammation or lung remodelling. Epidemiological studies confirm that susceptibility to developing chronic obstructive pulmonary disease (COPD, especially emphysema, is also closely linked to lung cancer susceptibility. Genetic epidemiology studies have consistently reported associations between the chromosome 15q25 locus with lung cancer and COPD. In addition, studies show this locus to be independently associated with cigarette consumption and nicotine addiction in a dose-response manner, primarily at lower levels of cigarette consumption. Studies that measure both cigarette consumption and lung function, together with extensive genotype analysis, will be needed to further unravel these complex relationships.

  7. Lung cancer stage at diagnosis: Individual associations in the prospective VITamins and lifestyle (VITAL cohort

    Directory of Open Access Journals (Sweden)

    Au David H

    2011-06-01

    Full Text Available Abstract Background Lung cancer is the leading cause of cancer death in the United States. Identifying factors associated with stage of diagnosis can improve our understanding of biologic and behavioral pathways of lung cancer development and detection. We used data from a prospective cohort study to evaluate associations of demographic, health history, and health behaviors with early versus late stage at diagnosis of non-small cell lung cancer (NSCLC. Methods We calculated odds ratios (ORs for the association of patient-level characteristics with advanced stage of diagnosis for NSCLC. The OR's were then adjusted for age, gender, race/ethnicity, smoking status, income, education, chronic obstructive pulmonary disease, and a comorbidity index. Results We identified 612 cases of NSCLC among 77,719 adults, aged 50 to 76 years from Washington State recruited in 2000-2002, with followup through December 2007. In univariate analyses, subjects who quit smoking Conclusions Smoking status, education, and a screening activity were associated with stage at diagnosis of NSCLC. These results may guide future studies of the underlying mechanisms that influence how NSCLC is detected and diagnosed.

  8. Usual interstitial pneumonia in rheumatoid arthritis-associated interstitial lung disease.

    Science.gov (United States)

    Kim, E J; Elicker, B M; Maldonado, F; Webb, W R; Ryu, J H; Van Uden, J H; Lee, J S; King, T E; Collard, H R

    2010-06-01

    Interstitial lung disease is a common manifestation of rheumatoid arthritis; however, little is known about factors that influence its prognosis. The aim of the present study was to determine whether or not the usual interstitial pneumonia pattern found on high-resolution computed tomography (HRCT) is of prognostic significance in rheumatoid arthritis-associated interstitial lung disease (RA-ILD). Patients with RA-ILD were identified retrospectively (n = 82). The relationship of a definite usual interstitial pneumonia pattern on HRCT to survival was determined and compared to that in a cohort of patients with radiologically diagnosed idiopathic pulmonary fibrosis (n = 51). A definite usual interstitial pneumonia pattern was seen in 20 (24%) out of 82 patients with RA-ILD. These patients showed worse survival than those without this pattern (median survival 3.2 versus 6.6 yrs), and a similar survival to those with idiopathic pulmonary fibrosis. On multivariate analysis, a definite usual interstitial pneumonia pattern on HRCT was associated with worse survival (hazard ratio of 2.3). Analysis of specific HRCT features demonstrated that traction bronchiectasis and honeycomb fibrosis were associated with worse survival (hazard ratio of 2.6 and 2.1, respectively). Female sex (hazard ratio of 0.30) and a higher baseline diffusing capacity of the lung for carbon monoxide (hazard ratio of 0.96) were associated with better survival. A definite usual interstitial pneumonia pattern on HRCT has important prognostic implications in RA-ILD.

  9. Rheumatoid lung disease

    Science.gov (United States)

    Lung disease - rheumatoid arthritis; Rheumatoid nodules; Rheumatoid lung ... Lung problems are common in rheumatoid arthritis. They often cause no symptoms. The cause of lung disease associated with rheumatoid arthritis is unknown. Sometimes, the medicines used to ...

  10. Pulmonary Artery Agenesis Associated With Emphysema and Multiple Invasive Non-Small Cell Lung Cancers.

    Science.gov (United States)

    Makdisi, George; Edell, Eric S; Maleszewski, Joseph J; Molina, Julian R; Deschamps, Claude

    2015-06-01

    Pulmonary artery (PA) agenesis in the absence of associated cardiac abnormalities is a rare congenital abnormality. It may remain undiagnosed until adulthood when patients present with respiratory symptoms such as hemoptysis, dyspnea, repeated respiratory infections, or pulmonary hypertension. Herein we present a case of a 50-year-old woman who was found to have multiple, morphologically distinct non-small cell lung cancers in association with agenesis of the PA. This instance represents the fourth reported case of such association in the English literature. PMID:26046873

  11. Genetic variants in chromatin-remodeling pathway associated with lung cancer risk in a Chinese population.

    Science.gov (United States)

    Geng, Liguo; Zhu, Meng; Wang, Yuzhuo; Cheng, Yang; Liu, Jia; Shen, Wei; Li, Zhihua; Zhang, Jiahui; Wang, Cheng; Jin, Guangfu; Ma, Hongxia; Shen, Hongbing; Hu, Zhibin; Dai, Juncheng

    2016-08-10

    Chromatin remodeling complexes utilize the energy of ATP hydrolysis to remodel nucleosomes and have essential roles in transcriptional modulation. Increasing evidences indicate that these complexes directly interact with numerous proteins and regulate the formation of cancer. However, few studies reported the association of polymorphisms in chromatin remodeling genes and lung cancer. We hypothesized that variants in critical genes of chromatin remodeling pathway might contribute to the susceptibility of lung cancer. To validate this hypothesis, we systematically screened 40 polymorphisms in six key chromatin remodeling genes (SMARCA5, SMARCC2, SMARCD2, ARID1A, NR3C1 and SATB1) and evaluated them with a case-control study including 1341 cases and 1982 controls. Logistic regression revealed that four variants in NR3C1 and SATB1 were significantly associated with lung cancer risk after false discovery rate (FDR) correction [For NR3C1, rs9324921: odds ratio (OR)=1.23, P for FDR=0.029; rs12521436: OR=0.85, P for FDR=0.040; rs4912913: OR=1.17, P for FDR=0.040; For SATB1, rs6808523: OR=1.33, P for FDR=0.040]. Combing analysis presented a significant allele-dosage tendency for the number of risk alleles and lung cancer risk (Ptrendlung tumor and adjacent normal tissues in the database of The Cancer Genome Atlas (TCGA) (P=0.009 for rs6808523). These findings suggested that genetic variants in key chromatin remodeling genes may contribute to lung cancer risk in Chinese population. Further large and well-designed studies are warranted to validate our results. PMID:27179949

  12. Association between 8-oxo-7,8-dihydroguanine excretion and risk of lung cancer in a prospective study

    DEFF Research Database (Denmark)

    Loft, Steffen; Svoboda, Peter; Kawai, Kazuaki;

    2012-01-01

    detection. There was no significant effect of smoking or OGG1 genotype on the excretion of 8-oxoGua. Overall the incidence rate ratio (IRR) (95% confidence interval) of lung cancer was 1.06 (0.97-1.15) per doubling of 8-oxoGua excretion. The association between lung cancer risk and 8-oxoGua excretion...

  13. Position of the American Dietetic Association, School Nutrition Association, and Society for Nutrition Education: Comprehensive School Nutrition Services

    Science.gov (United States)

    Briggs, Marilyn; Mueller, Constance G.; Fleischhacker, Sheila

    2010-01-01

    It is the position of the American Dietetic Association (ADA), School Nutrition Association (SNA), and Society for Nutrition Education (SNE) that comprehensive, integrated nutrition services in schools, kindergarten through grade 12, are an essential component of coordinated school health programs and will improve the nutritional status, health,…

  14. Association of genetic variation with systolic and diastolic blood pressure among African Americans : the Candidate Gene Association Resource study

    NARCIS (Netherlands)

    Fox, Ervin R.; Young, J. Hunter; Li, Yali; Dreisbach, Albert W.; Keating, Brendan J.; Musani, Solomon K.; Liu, Kiang; Morrison, Alanna C.; Ganesh, Santhi; Kutlar, Abdullah; Ramachandran, Vasan S.; Polak, Josef F.; Fabsitz, Richard R.; Dries, Daniel L.; Farlow, Deborah N.; Redline, Susan; Adeyemo, Adebowale; Hirschorn, Joel N.; Sun, Yan V.; Wyatt, Sharon B.; Penman, Alan D.; Palmas, Walter; Rotter, Jerome I.; Townsend, Raymond R.; Doumatey, Ayo P.; Tayo, Bamidele O.; Mosley, Thomas H.; Lyon, Helen N.; Kang, Sun J.; Rotimi, Charles N.; Cooper, Richard S.; Franceschini, Nora; Curb, J. David; Martin, Lisa W.; Eaton, Charles B.; Kardia, Sharon L. R.; Taylor, Herman A.; Caulfield, Mark J.; Ehret, Georg B.; Johnson, Toby; Chakravarti, Aravinda; Zhu, Xiaofeng; Levy, Daniel

    2011-01-01

    The prevalence of hypertension in African Americans (AAs) is higher than in other US groups; yet, few have performed genome-wide association studies (GWASs) in AA. Among people of European descent, GWASs have identified genetic variants at 13 loci that are associated with blood pressure. It is unkno

  15. Association between MGMT Promoter Methylation and Non-Small Cell Lung Cancer: A Meta-Analysis

    OpenAIRE

    Changmei Gu; Jiachun Lu; Tianpen Cui; Cheng Lu; Hao Shi; Wenmao Xu; Xueli Yuan; Xiaobo Yang; Yangxin Huang; Meixia Lu

    2013-01-01

    BACKGROUND: O(6)-methylguanine-DNA methyltransferase (MGMT) is one of most important DNA repair enzyme against common carcinogens such as alkylate and tobacco. Aberrant promoter methylation of the gene is frequently observed in non-small cell lung cancer (NSCLC). However, the importance of epigenetic inactivation of the gene in NSCLC published in the literature showed inconsistence. We quantified the association between MGMT promoter methylation and NSCLC using a meta-analysis method. METHODS...

  16. miR-638 regulates gene expression networks associated with emphysematous lung destruction

    OpenAIRE

    Christenson, Stephanie A; Brandsma, Corry-Anke; Campbell, Joshua D; Knight, Darryl A.; Pechkovsky, Dmitri V.; James C Hogg; Timens, Wim; Dirkje S Postma; Lenburg, Marc; Spira, Avrum

    2013-01-01

    Background Chronic obstructive pulmonary disease (COPD) is a heterogeneous disease characterized by varying degrees of emphysematous lung destruction and small airway disease, each with distinct effects on clinical outcomes. There is little known about how microRNAs contribute specifically to the emphysema phenotype. We examined how genome-wide microRNA expression is altered with regional emphysema severity and how these microRNAs regulate disease-associated gene expression networks. Methods ...

  17. Association between Image Characteristics on Chest CT and Severe Pleural Adhesion during Lung Cancer Surgery.

    Directory of Open Access Journals (Sweden)

    Kwang Nam Jin

    Full Text Available The aim of this study was to investigate the association between image characteristics on preoperative chest CT and severe pleural adhesion during surgery in lung cancer patients. We included consecutive 124 patients who underwent lung cancer surgeries. Preoperative chest CT was retrospectively reviewed to assess pleural thickening or calcification, pulmonary calcified nodules, active pulmonary inflammation, extent of emphysema, interstitial pneumonitis, and bronchiectasis in the operated thorax. The extent of pleural thickening or calcification was visually estimated and categorized into two groups: localized and diffuse. We measured total size of pulmonary calcified nodules. The extent of emphysema, interstitial pneumonitis, and bronchiectasis was also evaluated with a visual scoring system. The occurrence of severe pleural adhesion during lung cancer surgery was retrospectively investigated from the electrical medical records. We performed logistic regression analysis to determine the association of image characteristic on chest CT with severe pleural adhesion. Localized pleural thickening was found in 8 patients (6.5%, localized pleural calcification in 8 (6.5%, pulmonary calcified nodules in 28 (22.6%, and active pulmonary inflammation in 22 (17.7%. There was no patient with diffuse pleural thickening or calcification in this study. Trivial, mild, and moderate emphysema was found in 31 (25.0%, 21 (16.9%, and 12 (9.7% patients, respectively. Severe pleural adhesion was found in 31 (25.0% patients. The association of localized pleural thickening or calcification on CT with severe pleural adhesion was not found (P = 0.405 and 0.107, respectively. Size of pulmonary calcified nodules and extent of emphysema were significant variables in a univariate analysis (P = 0.045 and 0.005, respectively. In a multivariate analysis, moderate emphysema was significantly associated with severe pleural adhesion (odds ratio of 11.202, P = 0.001. In conclusion

  18. Thoracic dust exposure is associated with lung function decline in cement production workers.

    Science.gov (United States)

    Nordby, Karl-Christian; Notø, Hilde; Eduard, Wijnand; Skogstad, Marit; Fell, Anne Kristin; Thomassen, Yngvar; Skare, Øivind; Bergamaschi, Antonio; Pietroiusti, Antonio; Abderhalden, Rolf; Kongerud, Johny; Kjuus, Helge

    2016-08-01

    We hypothesised that exposure to workplace aerosols may lead to lung function impairment among cement production workers.Our study included 4966 workers in 24 cement production plants. Based on 6111 thoracic aerosol samples and information from questionnaires we estimated arithmetic mean exposure levels by plant and job type. Dynamic lung volumes were assessed by repeated spirometry testing during a mean follow-up time of 3.5 years (range 0.7-4.6 years). The outcomes considered were yearly change of dynamic lung volumes divided by the standing height squared or percentage of predicted values. Statistical modelling was performed using mixed model regression. Individual exposure was classified into quintile levels limited at 0.09, 0.89, 1.56, 2.25, 3.36, and 14.6 mg·m(-3), using the lowest quintile as the reference. Employees that worked in administration were included as a second comparison group.Exposure was associated with a reduction in forced expiratory volume in 1 s (FEV1), forced expiratory volume in 6 s and forced vital capacity. For FEV1 % predicted a yearly excess decline of 0.84 percentage points was found in the highest exposure quintile compared with the lowest.Exposure at the higher levels found in this study may lead to a decline in dynamic lung volumes. Exposure reduction is therefore warranted. PMID:27103386

  19. Promoter methylation is not associated with FLCN irregulation in lung cyst lesions of primary spontaneous pneumothorax.

    Science.gov (United States)

    Ding, Yibing; Zou, Wei; Zhu, Chengchu; Min, Haiyan; Ma, Dehua; Chen, Baofu; Ye, Minhua; Pan, Yanqing; Cao, Lei; Wan, Yueming; Zhu, Qiuxiang; Xia, Haizhen; Zhang, Wenwen; Feng, Ying; Gao, Qian; Yi, Long

    2015-11-01

    Germline mutations in FLCN are responsible for ~10% of patients with primary spontaneous pneumothorax (PSP), characterized by multiple lung cysts in the middle/lower lobes and recurrent pneumothorax. These clinical features are also observed in a substantial portion of patients with sporadic PSP exhibiting no FLCN coding mutations. To assess the potential underlying mechanisms, 71 patients with PSP were selected, including 69 sporadic and 2 familial cases, who bared FLCN mutation‑like lung cysts, however, harbored no FLCN protein‑altering mutations. Notably, in a significant proportion of the patients, FLCN irregulation was observed at the transcript and protein levels. Genetic analyses of the cis‑regulatory region of FLCN were performed by sequencing and multiplex ligation‑dependent probe amplification assay. No inheritable DNA defect was detected, with the exception of a heterozygous deletion spanning the FLCN promoter, which was identified in a family with PSP. This mutation caused a reduction in the expression of FLCN in the lung cysts. Pedigree analysis demonstrated that haploinsufficiency of FLCN was pathogenic. To determine whether epigenetic mechanisms may be involved in the irregulation of FLCN, the promoter methylation status was measured in the remainder of the patients. No evidence of FLCN promoter methylation was demonstrated. The present study suggested that FLCN irregulation in lung cysts of PSP is not associated with promoter methylation.

  20. CHARACTER OF TUMOR ASSOCIATED PROTEIN RECOGNIZED BY MONOCLONAL ANTIBODY AGAINST YUNNAN GEJIU LUNG CANCER

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Objectives: To identify and characterize lung cancer associated protein N35 and attempt to learn the prospective possibility of the clinical application of the protein N35. Methods: Immunoprecipitation, immunoblotting, differential centrifigation and subcellular assay, immunohistochemistry, N-glycanase digestion, mitotic cell immunoflourescence and multiple methods of affinity chromatography have been used with the monoclonal antibody N-35 to detect the distribution of the protein N35 among the various cancer cell lines and normal human tissue, the relationship between the protein N35 and glycoprotein, the location of the subcellular structure and chromosomal domain of the protein N35,the most effective way of purification of tumor associated protein N35. Results: The protein N35 is a glycoprotein, distributes to the human lung cancer cell line GLC-82, human cervical cancer cell line Hela, human hepatic cancer cell line HepG-2 and human breast cancer cell line PMC with different relative molecular mass(Mr), but no expression of the protein ingredient in normal human fresh tissue; concentrates at the nuclei significantly ,much more than at the mitochondrail and membrane, locates at the centriole of the chromosomal domain. Conclusions: The lung cancer associated protein N35 might be expressed only by the cancer cells and related with the proliferation of cancer cells as a role of tumor cell growth regulator.

  1. Subpleural lung cysts in Down syndrome: prevalence and association with coexisting diagnoses

    Energy Technology Data Exchange (ETDEWEB)

    Biko, David M. [Pennsylvania Hospital, Department of Radiology, Philadelphia, PA (United States); Schwartz, Michael; Anupindi, Sudha A. [Children' s Hospital of Philadelphia, Philadelphia, PA (United States); Altes, Talissa A. [Children' s Hospital of Philadelphia, Philadelphia, PA (United States); University of Virginia, Charlottesville, VA (United States)

    2008-03-15

    Although subpleural cysts are known to be associated with Down syndrome, their etiology and prevalence remains unknown. To determine the prevalence of subpleural cysts in children with Down syndrome and the association with prematurity, congenital heart disease (CHD), extracorporeal membrane oxygenation (ECMO), and chronic ventilator support. A review of the CT examinations of 25 children with Down syndrome was performed to determine the presence, location, and distribution of cysts along with associated abnormalities. Charts were reviewed and coexistent diagnoses and past treatments were recorded. The prevalence of subpleural cysts was 36% with no significant association with CHD, ECMO, or chronic ventilator support. An association was found in the two children with a history of prematurity. The cysts were most commonly found in the anteromedial portion of the lung. Subpleural cysts are common in Down syndrome and should not be confused with another pathological process. An association with prematurity was found, but the low number of children in this study makes the connection uncertain. The etiology remains unclear, but it has been hypothesized that the cysts are associated with lung hypoplasia. (orig.)

  2. Timing and tempo: Exploring the complex association between pubertal development and depression in African American and European American girls.

    Science.gov (United States)

    Keenan, Kate; Culbert, Kristen M; Grimm, Kevin J; Hipwell, Alison E; Stepp, Stephanie D

    2014-11-01

    The relative contribution of pubertal timing and tempo to the development of depression has not been tested in a large, representative sample, nor has the interface among pubertal maturation, depression, and race been tested. Participants were a community-based sample of 2,450 girls from the Pittsburgh Girls Study who were interviewed annually from ages 9 to 17 years. Pubertal timing and tempo were characterized as a unitary construct and also separately for pubic hair and breast development using child and maternal report. Depression symptoms were assessed annually. African American girls had higher depression symptoms and progressed through puberty earlier, but at a slower tempo than European American girls. Girls with earlier timing had higher levels of depression symptoms at age 10 years. Slower tempo was associated with higher depression symptoms at age 10, and faster tempo was associated with increases in depression from ages 10 to 13. As well, race moderated the associations among timing, tempo, and depression symptoms, and the association between race and depression was partially mediated by pubertal timing and tempo. Pubertal timing and tempo and race contribute to the developmental course of depression from early to late adolescence. The pattern of association varies as a function of the developmental window within which depression is assessed. Thus, repeated measures of depression symptoms and puberty across the span of pubertal development are necessary for exploring the relative importance of dimensions of pubertal development to depression etiology. PMID:25314262

  3. Lung carcinoma with rhabdoid component. A series of seven cases associated with uncommon types of non-small cell lung carcinomas and alveolar entrapment.

    Science.gov (United States)

    Izquierdo-Garcia, Francisco M; Moreno-Mata, Nicolás; Herranz-Aladro, María Luisa; Cañizares, Miguel Angel; Alvarez-Fernandez, Emilio

    2010-10-01

    Rhabdoid tumor, included in the WHO classification among large cell carcinomas of the lung, is an uncommon type of lung carcinoma with poor prognosis. We report a series of 7 cases of lung carcinomas with rhabdoid component in 10% and 80% of the tumor. The associated tumor was adenocarcinoma in 3 cases--one of them with focal micropapillary pattern--large cell carcinoma in 2 cases, squamous cell carcinoma in 1 case and pleomorphic carcinoma in 1 case. Two adenocarcinomas showed a focal spindle cell component. Micropapillary and pleomorphic types had not been reported before as a component associated with rhabdoid carcinomas. All cases were positive for vimentin, and AE1/AE3 cytokeratin and 5 cases for cytokeratin 7. All cases were negative for muscle and endothelial markers and for chromogranin A. Synaptophysin was focally positive only in one case. Alveolar trapping inside the tumor was present in 3 cases--a phenomenon not well studied in lung carcinomas and also not reported in tumors with rhabdoid component. Five patients died because of the tumor within 2 to 31 months after diagnosis, one of myocardial infarction and only one is alive and disease free 123 months after the diagnosis. In summary, we describe 7 new cases of this uncommon lung tumor with aggressive clinical course, associated with infrequent histological types in nonrhabdoid component and with alveolar trapping, a nondescribed finding.

  4. Workplace wellness recognition for optimizing workplace health: a presidential advisory from the American Heart Association.

    Science.gov (United States)

    Fonarow, Gregg C; Calitz, Chris; Arena, Ross; Baase, Catherine; Isaac, Fikry W; Lloyd-Jones, Donald; Peterson, Eric D; Pronk, Nico; Sanchez, Eduardo; Terry, Paul E; Volpp, Kevin G; Antman, Elliott M

    2015-05-19

    The workplace is an important setting for promoting cardiovascular health and cardiovascular disease and stroke prevention in the United States. Well-designed, comprehensive workplace wellness programs have the potential to improve cardiovascular health and to reduce mortality, morbidity, and disability resulting from cardiovascular disease and stroke. Nevertheless, widespread implementation of comprehensive workplace wellness programs is lacking, and program composition and quality vary. Several organizations provide worksite wellness recognition programs; however, there is variation in recognition criteria, and they do not specifically focus on cardiovascular disease and stroke prevention. Although there is limited evidence to suggest that company performance on employer health management scorecards is associated with favorable healthcare cost trends, these data are not currently robust, and further evaluation is needed. As a recognized national leader in evidence-based guidelines, care systems, and quality programs, the American Heart Association/American Stroke Association is uniquely positioned and committed to promoting the adoption of comprehensive workplace wellness programs, as well as improving program quality and workforce health outcomes. As part of its commitment to improve the cardiovascular health of all Americans, the American Heart Association/American Stroke Association will promote science-based best practices for comprehensive workplace wellness programs and establish benchmarks for a national workplace wellness recognition program to assist employers in applying the best systems and strategies for optimal programming. The recognition program will integrate identification of a workplace culture of health and achievement of rigorous standards for cardiovascular health based on Life's Simple 7 metrics. In addition, the American Heart Association/American Stroke Association will develop resources that assist employers in meeting these rigorous

  5. HPV Literacy and Associated Factors Among Hmong American Immigrants: Implications for Reducing Cervical Cancer Disparity.

    Science.gov (United States)

    Beltran, Raiza; Simms, Tina; Lee, Hee Yun; Kwon, Melissa

    2016-06-01

    Previous studies show that certain minority and ethnic communities experience low human papillomavirus (HPV) vaccination rates despite a higher cervical cancer burden. HPV is known to be responsible for almost all cervical cancer cases. Hmong Americans, a growing Asian American population, appear to be at increased risk. The cervical cancer incidence rate among Hmong American women is three times higher than other Asian/Pacific Islanders and more than four times higher than Non-Hispanic Whites. Despite such alarming statistics, there is limited research focusing on HPV literacy and its associated factors in the Hmong American community. This study's objectives are to investigate: (1) the level of HPV knowledge among Hmong Americans; (2) HPV vaccination initiation and completion rates of Hmong Americans; and (3) factors associated with HPV literacy in the Hmong American community. Andersen's Behavioral Model of Health Services Use was used as the study's theoretical framework. A self-administered paper and online health survey was completed by192 Hmong Americans living in a major metropolitan area in Minnesota. Results revealed a mean score of 4.76 (SD 1.67) for the 7-item questionnaire measuring HPV knowledge. The HPV vaccination initiation rate was 46.3 % (n = 56), with 32.7 % completing the recommended three doses. Multiple regression analysis found that participants' level of education, number of doctor visits, and cervical cancer screening literacy were significantly associated with HPV knowledge. This study's results indicate the important role of health providers in educating Hmong Americans patients about HPV and cervical cancer prevention to decrease the cervical cancer burden in this high-risk population. PMID:26696118

  6. Metagenes Associated with Survival in Non-Small Cell Lung Cancer

    Science.gov (United States)

    Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres

    2011-01-01

    NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068

  7. Paraneoplastic Syndromes of Hypercalcemia and Leukocytosis Associated with Colonic Metastases from Squamous Cell Carcinoma of the Lung: a Case Report

    Institute of Scientific and Technical Information of China (English)

    Xiangtao Ma; Xu Wang; Liwei Yu; Jing Fu; Shan Wang; Ruyu Du; Zhirong Cui

    2006-01-01

    @@ Lung cancer is the most common cancer-related death in both men and women in the world. Approximately 25% of all cancer deaths are attributable to lung carcinoma. Moreover, about one-half of patients with lung cancer have metastases at the time of initial diagnosis, most frequently of lymph nodes, adrenals, liver, bone and brain.However metastasis to the colon is very rare. Over the past 25 years about 13 cases of symptomatic colonic metastases from lung malignancies of all types have been reported in the literature. Hypercalcemia and leukocytosis are two of the most common paraneoplastic syndromes associated with various malignancies. However, concomitant manifestation of hypercalcemia and leukocytosis are occasionally observed in the same cancer patients. Here, we present a rare case of colonic metastasis from a squamous cell carcinoma of the lung associated with paraneoplastic syndromes of hypercalcemia and leukocytosis.

  8. Polymorphic allele of human IRGM1 is associated with susceptibility to tuberculosis in African Americans.

    Directory of Open Access Journals (Sweden)

    Katherine Y King

    Full Text Available An ancestral polymorphic allele of the human autophagy-related gene IRGM1 is associated with altered gene expression and a genetic risk for Crohn's Disease (CD. We used the single nucleotide polymorphism rs10065172C/T as a marker of this polymorphic allele and genotyped 370 African American and 177 Caucasian tuberculosis (TB cases and 180 African American and 110 Caucasian controls. Among African Americans, the TB cases were more likely to carry the CD-related T allele of rs10065172 (odds ratio of 1.54; 95% confidence interval, 1.17-2.02; P<0.01 compared to controls. Our finding suggests that this CD-related IRGM1 polymorphic allele is also associated with human susceptibility to TB disease among African Americans.

  9. Genetic variants in ABCG1 are associated with survival of nonsmall-cell lung cancer patients.

    Science.gov (United States)

    Wang, Yanru; Liu, Hongliang; Ready, Neal E; Su, Li; Wei, Yongyue; Christiani, David C; Wei, Qingyi

    2016-06-01

    Cell membrane transporters and metabolic enzymes play a crucial role in the transportation of a wide variety of substrates that maintain homeostasis in biological processes. We explored associations between genetic variants in these genes and survival of nonsmall-cell lung cancer (NSCLC) patients by reanalyzing two datasets from published genome-wide association studies (GWASs). In the discovery by using the GWAS dataset of the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial, we evaluated associations of 1,245 single-nucleotide polymorphisms (SNPs) in genes of four transporter families and two metabolic enzyme families with survival of 1,185 NSCLC patients. We then performed a replication analysis in the Harvard University Lung Cancer study (LCS) with 984 NSCLC patients. Multivariate Cox proportional hazards regression and false discovery rate (FDR) corrections were performed to evaluate the associations. We identified that 21 genotyped SNPs in eight gene regions were significantly associated with survival with FDR ≤ 0.1 in the discovery dataset. Subsequently, we confirmed six SNPs, which were putative functional, in ABCG1 of the ATP-binding cassette transporter family in the replication dataset. In the pooled analysis, two tagging (at r(2)  > 0.8 for linkage disequilibrium with other replicated SNPs)/functional SNPs were independently associated with survival: rs225388 G > A [adjusted hazards ratio (HR) = 1.12, 95% confidence interval (CI) = 1.03-1.20, Ptrend  = 4.6 × 10(-3)] and rs225390 A > G (adjusted HR = 1.16, 95% CI = 1.07-1.25, Ptrend  = 3.8 × 10(-4) ). Our results indicated that genetic variants of ABCG1 may be predictors of survival of NSCLC patients.

  10. Characterization of genome-wide association-identified variants for atrial fibrillation in African Americans.

    Directory of Open Access Journals (Sweden)

    Jessica T Delaney

    Full Text Available BACKGROUND: Despite a greater burden of risk factors, atrial fibrillation (AF is less common among African Americans than European-descent populations. Genome-wide association studies (GWAS for AF in European-descent populations have identified three predominant genomic regions associated with increased risk (1q21, 4q25, and 16q22. The contribution of these loci to AF risk in African American is unknown. METHODOLOGY/PRINCIPAL FINDINGS: We studied 73 African Americans with AF from the Vanderbilt-Meharry AF registry and 71 African American controls, with no history of AF including after cardiac surgery. Tests of association were performed for 148 SNPs across the three regions associated with AF, and 22 SNPs were significantly associated with AF (P<0.05. The SNPs with the strongest associations in African Americans were both different from the index SNPs identified in European-descent populations and independent from the index European-descent population SNPs (r(2<0.40 in HapMap CEU: 1q21 rs4845396 (odds ratio [OR] 0.30, 95% confidence interval [CI] 0.13-0.67, P = 0.003, 4q25 rs4631108 (OR 3.43, 95% CI 1.59-7.42, P = 0.002, and 16q22 rs16971547 (OR 8.1, 95% CI 1.46-45.4, P = 0.016. Estimates of European ancestry were similar among cases (23.6% and controls (23.8%. Accordingly, the probability of having two copies of the European derived chromosomes at each region did not differ between cases and controls. CONCLUSIONS/SIGNIFICANCE: Variable European admixture at known AF loci does not explain decreased AF susceptibility in African Americans. These data support the role of 1q21, 4q25, and 16q22 variants in AF risk for African Americans, although the index SNPs differ from those identified in European-descent populations.

  11. Higher Mobility Scores in Patients with Cystic Fibrosis Are Associated with Better Lung Function

    Directory of Open Access Journals (Sweden)

    Aneesha Thobani

    2015-01-01

    Full Text Available Objective. The purpose of this study was to determine whether mobility and physical activity were associated with lung function in adults with cystic fibrosis (CF. Design. This was a prospective cohort observational study in an urban, academic, specialized care center. Participants were ambulatory, nonhospitalized adults with CF. Main Outcome Measures. Mobility was assessed monthly by the Life-Space Assessment (LSA questionnaire and quarterly by pedometer. Lung function was assessed by spirometry. Results. Twenty-seven subjects participated. Subjects recorded mean pedometer steps of 20,213 ± 11,331 over three days and FEV1% predicted of 77.48% ± 22.60% over one year. The LSA score at enrollment was correlated with initial pedometer steps (r=0.42 and P=0.03, and mean LSA score over one year was correlated with mean number of steps (r=0.51 and P=0.007. LSA mobility and pedometer scores were correlated with FEV1% predicted at enrollment and throughout the study. Conclusions. Mobility and physical activity measured by LSA questionnaire and pedometer are positively associated with lung function in adults with CF. This study confirms the importance of mobility and physical activity and supports the utility of a simple office-based questionnaire as a measure of mobility in adults with CF.

  12. Quantitative computed tomographic descriptors associate tumor shape complexity and intratumor heterogeneity with prognosis in lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Olya Grove

    Full Text Available Two CT features were developed to quantitatively describe lung adenocarcinomas by scoring tumor shape complexity (feature 1: convexity and intratumor density variation (feature 2: entropy ratio in routinely obtained diagnostic CT scans. The developed quantitative features were analyzed in two independent cohorts (cohort 1: n = 61; cohort 2: n = 47 of patients diagnosed with primary lung adenocarcinoma, retrospectively curated to include imaging and clinical data. Preoperative chest CTs were segmented semi-automatically. Segmented tumor regions were further subdivided into core and boundary sub-regions, to quantify intensity variations across the tumor. Reproducibility of the features was evaluated in an independent test-retest dataset of 32 patients. The proposed metrics showed high degree of reproducibility in a repeated experiment (concordance, CCC≥0.897; dynamic range, DR≥0.92. Association with overall survival was evaluated by Cox proportional hazard regression, Kaplan-Meier survival curves, and the log-rank test. Both features were associated with overall survival (convexity: p = 0.008; entropy ratio: p = 0.04 in Cohort 1 but not in Cohort 2 (convexity: p = 0.7; entropy ratio: p = 0.8. In both cohorts, these features were found to be descriptive and demonstrated the link between imaging characteristics and patient survival in lung adenocarcinoma.

  13. Valuation and the American Evaluation Association: Helping 100 Flowers Bloom, or at Least Be Understood?

    Science.gov (United States)

    Morris, Michael

    2012-01-01

    The author explores the challenges encountered when organizations attempt to facilitate evaluation and improvement through policy statements of professional associations. The American Evaluation Association (AEA) is used as an example. Various AEA statements are described as general and avoiding particular value preferences. The author concludes…

  14. 78 FR 17679 - Implementation of the Updated American Veterinary Medical Association Guidelines for the...

    Science.gov (United States)

    2013-03-22

    ... Association Guidelines for the Euthanasia of Animals: 2013 Edition SUMMARY: The National Institutes of Health... the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals: 2013... updated Guidelines. DATES: Public concerns regarding the updated AVMA Guidelines for the Euthanasia...

  15. Association of the XRCC1 c.1178G>A genetic polymorphism with lung cancer risk in Chinese.

    Science.gov (United States)

    Wang, Lei; Lin, Yong; Qi, Cong-Cong; Sheng, Bao-Wei; Fu, Tian

    2014-01-01

    The X-ray repair cross-complementing group 1 protein (XRCC1) plays important roles in the DNA base excision repair pathway which may influence the development of lung cancer. This study aimed to evaluate the potential association of the XRCC1 c.1178G>A genetic polymorphism with lung cancer risk. The created restriction site-polymerase chain reaction (CRS-PCR) and DNA sequencing methods were utilized to evaluate the XRCC1 c.1178G>A genetic polymorphism among 376 lung cancer patients and 379 controls. Associations between the genetic polymorphism and lung cancer risk were determined with an unconditional logistic regression model. Our data suggested that the distribution of allele and genotype in lung cancer patients was significantly different from that of controls. The XRCC1 c.1178G>A genetic polymorphism was associated with an increased risk of lung cancer (AA vs GG: OR=2.91, 95%CI 1.70-4.98, pA genetic polymorphism is statistically associated with lung cancer risk in the Chinese population.

  16. [Lung diseases in children associated with inherited disorders of surfactant metabolism].

    Science.gov (United States)

    Delestrain, C; Flamein, F; Jonard, L; Couderc, R; Guillot, L; Fanen, P; Epaud, R

    2013-08-01

    Pulmonary surfactant is a unique mixture of lipids and specific proteins that reduces surface tension at the air-liquid interface, preventing collapse of the lung at the end of expiration. Recessive loss-of-function mutations of pulmonary surfactant protein B (SP-B) was initially described in infants who develop respiratory failure at birth. More recently, mutations in other constitutive surfactant proteins like surfactant protein C or implied in its metabolism like ATP-binding cassette, sub-family A, member 3 (ABCA3) or NK2 homeobox (NKX2-1) were identified in newborn with respiratory distress but also in children with diffuse infiltrative pneumonia. Intra-alveolar accumulation of protein related to surfactant dysfunction leads to cough, hypoxemia and radiological abnormalities including ground-glass opacities and lung cysts. The clinical and radiological features associated with these genetic disorders, along with their treatment and outcome, are reviewed. PMID:23856024

  17. Interstitial pneumonia associated to peginterferon alpha-2a: A focus on lung function

    Directory of Open Access Journals (Sweden)

    Arturo Cortés-Telles

    2016-01-01

    Full Text Available Pulmonary toxicity related to the use of pegylated interferon alpha-2a during treatment of hepatitis C infections is rare; nonetheless, some cases with fatal outcomes have been reported. Evaluating patients' pulmonary function is a key to diagnosis, follow-up and prognosis of several respiratory diseases, but case reports of respiratory manifestations related to the use of pegylated interferon alpha-2a have limited their findings to only baseline measurements. This paper examines the case of a 65-year-old woman with chronic hepatitis C virus infection who developed interstitial pneumonitis associated with pegylated interferon alpha-2a. Initial lung function evaluation revealed a marked reduction compared to an earlier assessment; the results were consistent with a moderate restricted pattern. Fortunately, over the ensuing 8 weeks of follow-up after discontinuing the drug, the patient recovered her lung function and experienced an overall improvement in her respiratory symptoms.

  18. Interstitial pneumonia associated to peginterferon alpha-2a: A focus on lung function.

    Science.gov (United States)

    Cortés-Telles, Arturo

    2016-01-01

    Pulmonary toxicity related to the use of pegylated interferon alpha-2a during treatment of hepatitis C infections is rare; nonetheless, some cases with fatal outcomes have been reported. Evaluating patients' pulmonary function is a key to diagnosis, follow-up and prognosis of several respiratory diseases, but case reports of respiratory manifestations related to the use of pegylated interferon alpha-2a have limited their findings to only baseline measurements. This paper examines the case of a 65-year-old woman with chronic hepatitis C virus infection who developed interstitial pneumonitis associated with pegylated interferon alpha-2a. Initial lung function evaluation revealed a marked reduction compared to an earlier assessment; the results were consistent with a moderate restricted pattern. Fortunately, over the ensuing 8 weeks of follow-up after discontinuing the drug, the patient recovered her lung function and experienced an overall improvement in her respiratory symptoms. PMID:27051119

  19. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia

    OpenAIRE

    Lan, Qing; Hsiung, Chao A.; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wang, Zhaoming; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Chatterjee, Nilanjan; Hu, Wei; Wong, Maria Pik; Zheng, Wei; Caporaso, Neil; PARK, JAE YONG

    2012-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland China, South Korea, Japan, Singapore, Taiwan, and Hong Kong. We genotyped the most promising variants (associated at P < 5 × 10-6) in an additional 1,099 cases and 2,913 controls. We identified three...

  20. Associations between housing conditions, smoking habits and ventilatory lung function in men with clean jobs.

    Science.gov (United States)

    Rasmussen, F V; Borchsenius, L; Winsløw, J B; Ostergaard, E R

    1978-10-01

    In 218 men, who had minimal occupational exposure to dusts, fumes, temperature variability, or physical exercise, the relation between housing conditions throughout life and lung function was analysed. The number of years spend in dwellings without central heating was significantly inversely associated with the level of FEV1 and MMEF, and significantly directly associated with closing capacity in per cent of TLC, CC%. Significant dose-response relationships between smoking habits and FEV1, MMEF, CC% and slope of the alveolar plateau (phase III) were found, whereas closing volume, CV%, was only correlated to age. The association between dwelling conditions and ventilatory capacity was independent of smoking habits. Tobacco smoking, however, moderated the association in as much as it was strengthened after standardisation for tobacco consumption. These data support the hypothesis that poor dwelling conditions during childhood and adolescence are associated with development of peripheral airways disease and expiratory airflow obstruction at middle age, and that comparisons of lung function between different occupational categories are incomplete and may be misleading if lifelong housing conditions or other factors reflecting socio-economic status are not taken into consideration. PMID:734386

  1. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  2. Predicting the Risk of Secondary Lung Malignancies Associated With Whole-Breast Radiation Therapy

    International Nuclear Information System (INIS)

    Purpose: The risk of secondary lung malignancy (SLM) is a significant concern for women treated with whole-breast radiation therapy after breast-conserving surgery for early-stage breast cancer. In this study, a biologically based secondary malignancy model was used to quantify the risk of secondary lung malignancies (SLMs) associated with several common methods of delivering whole-breast radiation therapy (RT). Methods and Materials: Both supine and prone computed tomography simulations of 15 women with early breast cancer were used to generate standard fractionated and hypofractionated whole-breast RT treatment plans for each patient. Dose–volume histograms (DVHs) of the ipsilateral breast and lung were calculated for each patient on each plan. A model of spontaneous and radiation-induced carcinogenesis was used to determine the relative risks of SLMs for the different treatment techniques. Results: A higher risk of SLMs was predicted for supine breast irradiation when compared with prone breast irradiation for both the standard fractionation and hypofractionation schedules (relative risk [RR] = 2.59, 95% confidence interval (CI) = 2.30–2.88, and RR = 2.68, 95% CI = 2.39–2.98, respectively). No difference in risk of SLMs was noted between standard fractionation and hypofractionation schedules in either the supine position (RR = 1.05, 95% CI = 0.97–1.14) or the prone position (RR = 1.01, 95% CI = 0.88–1.15). Conclusions: Compared with supine whole-breast irradiation, prone breast irradiation is associated with a significantly lower predicted risk of secondary lung malignancy. In this modeling study, fractionation schedule did not have an impact on the risk of SLMs in women treated with whole-breast RT for early breast cancer.

  3. Airway CD8(+) T Cells Are Associated with Lung Injury during Infant Viral Respiratory Tract Infection.

    Science.gov (United States)

    Connors, Thomas J; Ravindranath, Thyyar M; Bickham, Kara L; Gordon, Claire L; Zhang, Feifan; Levin, Bruce; Baird, John S; Farber, Donna L

    2016-06-01

    Infants and young children are disproportionately susceptible to severe complications from respiratory viruses, although the underlying mechanisms remain unknown. Recent studies show that the T cell response in the lung is important for protective responses to respiratory infections, although details on the infant/pediatric respiratory immune response remain sparse. The objectives of the present study were to characterize the local versus systemic immune response in infants and young children with respiratory failure from viral respiratory tract infections and its association to disease severity. Daily airway secretions were sampled from infants and children 4 years of age and younger receiving mechanical ventilation owing to respiratory failure from viral infection or noninfectious causes. Samples were examined for immune cell composition and markers of T cell activation. These parameters were then correlated with clinical disease severity. Innate immune cells and total CD3(+) T cells were present in similar proportions in airway aspirates derived from infected and uninfected groups; however, the CD8:CD4 T cell ratio was markedly increased in the airways of patients with viral infection compared with uninfected patients, and specifically in infected infants with acute lung injury. T cells in the airways were phenotypically and functionally distinct from those in blood with activated/memory phenotypes and increased cytotoxic capacity. We identified a significant increase in airway cytotoxic CD8(+) T cells in infants with lung injury from viral respiratory tract infection that was distinct from the T cell profile in circulation and associated with increasing disease severity. Airway sampling could therefore be diagnostically informative for assessing immune responses and lung damage. PMID:26618559

  4. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  5. An examination of the association between demographic and educational factors and African American achievement in science

    Science.gov (United States)

    Cottledge, Michael Christopher

    Objective of the Study: The objective of this research study was to investigate whether an association exists between teacher demographic factors (years of teaching experience and gender), 2 educational factors (certification type and certification pathway) and the percent passing rate of tenth grade African American male students on the 2010 science TAKS. Answers to the following questions were sought: 1. Is there an association between teacher demographic factors and the percent passing rate of their tenth grade African American male students on the 2010 science TAKS? 2. Is there an association between teacher educational factors and the percent passing rate of their tenth grade African American male students on the 2010 science TAKS? 3. Is there an association between teacher demographic factors, educational factors and the percent passing rate of their tenth grade African American male students on the 2010 science TAKS? Status of the Question: According to the Bureau of Labor Statistics (BLS), science and engineering jobs in the U.S. have increased steadily over recent years and by the year 2016 the number of STEM (Science, Technology, Engineering and Math) jobs will have grown by more than 21 percent. This increase in science and engineering jobs will double the growth rate of all other workforce sectors combined. The BLS also reports that qualified minority applicants needed to fill these positions will be few and far between. African Americans, Latinos, and other minorities constitute 24 percent of the U.S. population but only 13 percent of college graduates and just 10 percent of people with college degrees who work in science and engineering (Education Trust, 2009). Drawing on the above information, I proposed the following hypotheses to the research questions: H01: There will be no significant statistical association between the demographic factors teacher gender and years of teaching experience and the percent passing rate of their tenth grade African

  6. 2011 New lung adenocarcinoma multidisciplinary classification: imaging aspects

    International Nuclear Information System (INIS)

    The new classification of lung adenocarcinoma has been proposed by International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society in 2011. This new classification proposes a series of new concepts, such as lung adenocarcinoma in situ replacing the old term bronchioloalveolar carcinoma, minimally invasive adenocarcinoma and subtypes of invasive adenocarcinoma. This paper reviews the major advances of this new classification and its effect on imaging evaluation of lung adenocarcinoma and CT appearances of various subtypes of lung adenocarcinoma. (authors)

  7. The number and microlocalization of tumor-associated immune cells are associated with patient's survival time in non-small cell lung cancer

    OpenAIRE

    Zhang Shangfu; Ma Junliang; Pu Qiang; Yu Nanbin; Che Guowei; Liu Lunxu; Dai Fuqiang; Ma Lin; You Zongbing

    2010-01-01

    Abstract Background Tumor microenvironment is composed of tumor cells, fibroblasts, endothelial cells, and infiltrating immune cells. Tumor-associated immune cells may inhibit or promote tumor growth and progression. This study was conducted to determine whether the number and microlocalization of macrophages, mature dendritic cells and cytotoxic T cells in non-small cell lung cancer are associated with patient's survival time. Methods Ninety-nine patients with non-small cell lung cancer (NSC...

  8. Association between household income and overweight of Korean and American children: trends and differences.

    Science.gov (United States)

    Kwon, Yongju; Oh, Sangwoo; Park, Sangshin; Park, Yongsoon

    2010-07-01

    The prevalence of overweight in children has been dramatically increasing worldwide, and socioeconomic status is an important risk factor. The purpose of this study was to examine the hypothesis that household income is negatively associated with overweight in Korean and American girls and boys. In the study, 2117 children 7 to 12 years of age from the Korean National Health and Nutrition Examination Survey between 2001 and 2007 and 3016 children from the US National Health and Nutrition Examination Survey between 2001 and 2006 were included. Overweight is defined as the sex- and age-specific body mass index cutoffs recommended by the International Obesity Task Force. Lower household income significantly increased the risk for overweight in Korean boys, irrespective of adjustments. The negative association between household income and overweight of American boys disappeared after adjusting for the frequency of dining out and TV viewing time. There was no significant association between household income and overweight of Korean and American girls. As household income increased, the intake of energy from protein was increased, but energy from carbohydrates was decreased in Korean boys. On the other hand, as household income increased, energy intake from carbohydrates was increased and energy intake from proteins decreased in American boys. In conclusion, positive association between household income and overweight was found in Korean boys, but not in Korean girls and American boys and girls. Effects solely targeting reduction in income disparities cannot effectively reduce sex disparities in overweight of children. PMID:20797479

  9. The association between ambient temperature and children's lung function in Baotou, China

    Science.gov (United States)

    Li, Shanshan; Guo, Yuming; Williams, Gail; Baker, Peter; Ye, Xiaofang; Madaniyazi, Lina; Kim, Dae-Seon; Pan, Xiaochuan

    2015-07-01

    The objective of this study is to examine the association between ambient temperature and children's lung function in Baotou, China. We recruited 315 children (8-12 years) from Baotou, China in the spring of 2004, 2005, and 2006. They performed three successive forced expiratory measurements three times daily (morning, noon, and evening) for about 5 weeks. The highest peak expiratory flow (PEF) was recorded for each session. Daily data on ambient temperature, relative humidity, and air pollution were monitored during the same period. Mixed models with a distributed lag structure were used to examine the effects of temperature on lung function while adjusting for individual characteristics and environmental factors. Low temperatures were significantly associated with decreases in PEF. The effects lasted for lag 0-2 days. For all participants, the cumulative effect estimates (lag 0-2 days) were -1.44 (-1.93, -0.94) L/min, -1.39 (-1.92, -0.86) L/min, -1.40 (-1.97, -0.82) L/min, and -1.28 (-1.69, -0.88) L/min for morning, noon, evening, and daily mean PEF, respectively, associated with 1 °C decrease in daily mean temperature. Generally, the effects of temperature were slightly stronger in boys than in girls for noon, evening, and daily mean PEF, while the effects were stronger in girls for morning PEF. PM2.5 had joint effects with temperature on children's PEF. Higher PM2.5 increased the impacts of low temperature. Low ambient temperatures are associated with lower lung function in children in Baotou, China. Preventive health policies will be required for protecting children from the cold weather.

  10. HLA disease association and protection in HIV infection among African Americans and Caucasians.

    Science.gov (United States)

    Cruse, J M; Brackin, M N; Lewis, R E; Meeks, W; Nolan, R; Brackin, B

    1991-01-01

    In a previous investigation, we demonstrated an increased progression of overt AIDS in the African American population compared to the Caucasian population as reflected by the significantly lower absolute number of CD4+ lymphocytes detected in the African American population in an earlier study. The present study elucidates some of the possible genetic factors which may contribute to disease association or protection against HIV infection. The HLA phenotypes expressed as A, B, C, DR and DQw antigens were revealed by the Amos-modified typing procedure. NIH scoring was utilized to designate positive cells taking up trypan blue. A test of proportion equivalent to the chi 2 approximation was used to compare the disease population (n = 62; 38 African Americans, 24 Caucasians) to race-matched normal heterosexual local controls (323 African Americans, 412 Caucasians). Significant p values were corrected for the number of HLA antigens tested. HLA markers associated with possible protection from infection for African Americans were Cw4 and DRw6, whereas Caucasians expressed none. Disease association markers present in the African American population were A31, B35, Cw6, Cw7, DR5, DR6, DRw11, DRw12, DQw6 and DQw7, whereas in the Caucasian population A28, Aw66, Aw48, Bw65, Bw70, Cw7, DRw10, DRw12, DQw6 and DQw7 were demonstrated. The highest phenotypic frequency for a disease association marker in the study was for HLA-DR5 (62.9%) in the HIV-infected African American population without Kaposi's sarcoma compared to a frequency of 28.9% for the regional control group (p = 0.0012). We conclude that genetic factors do have a role in HIV infection since only 50-60% of those exposed to the AIDS virus will become infected. PMID:1910527

  11. The use of abatacept in debilitating cavitating lung disease associated with rheumatoid arthritis, bronchocentric granulomatosis and aspergillosis.

    LENUS (Irish Health Repository)

    Neff, K

    2010-06-01

    A case of debilitating cavitating lung disease associated with rheumatoid arthritis and bronchocentric granulomatosis, which failed to respond to conventional medical or surgical treatment, is described. The patient was treated over 10 years with steroids, antimicrobial agents, disease-modifying antirheumatoid drugs and surgery. Lung function continued to decline and the patient presented for admission with recurrent pneumonia. Abatacept was initiated to modify the underlying immunopathology. Following 12 months of treatment with abatacept the patient has demonstrable improvement in lung function and lung anatomy, and has not presented to hospital with pneumonia. She has tolerated the treatment without complication. The use of abatacept has stabilised the lung disease in this case in the medium term and prevented readmission to hospital. These results suggest a larger role for abatacept in those with such disease in the future and may warrant further investigation.

  12. Respiratory failure following anti-lung serum: study on mechanisms associated with surfactant system damage

    International Nuclear Information System (INIS)

    Within 2 minutes intravenous anti-lung serum (ALS) into guinea pig induces a respiratory failure that is fatal within 30 min. The relationship between surfactant, alveolar-capillary permeability and respiratory failure was studied. Within two minutes ALS induced a leak in the alveolar-capillary barrier. Within 30 minutes 28.3% (controls, given normal rabbit serum: 0.7%) of iv 131I-albumin, and 0.5% (controls 0.02%) of iv surfactant phospholipid tracer were recovered in bronchoalveolar lavage. Furthermore, 57% (controls 32%) of the endotracheally administered surfactant phospholipid became associated with lung tissue and only less than 0.5% left the lung. The distribution of proteins and phospholipids between the in vivo small volume bronchoalveolar lavages and the ex vivo bronchoalveolar lavages were dissimilar: 84% (controls 20%) of intravenously injected, lavageable 131I-albumin and 23% (controls 18%) of total lavageable phospholipid were recovered in the in vivo small volume bronchoalveolar lavages. ALS also decreased lavageable surfactant phospholipid by 41%. After ALS the minimum surface tension increased. The supernatant of the lavage increased the minimum surface tension of normal surfactant. In addition, the sediment fraction of the lavage had slow surface adsorption, and a marked reduction in 35,000 and 10,000 MW peptides. Exogenous surfactant ameliorated the ALS-induced respiratory failure. We propose that inhibition, altered intrapulmonary distribution, and dissociation of protein and phospholipid components of surfactant are important in early pathogenesis of acute respiratory failure

  13. Anxiety, Alexithymia, and Depression as Mediators of the Association between Childhood Abuse and Eating Disordered Behavior in African American and European American Women

    Science.gov (United States)

    Mazzeo, Suzanne E.; Mitchell, Karen S.; Williams, Larry J.

    2008-01-01

    This study evaluated structural equation models of the associations among family functioning, childhood abuse, depression, anxiety, alexithymia, and eating disorder symptomatology in a sample of 412 European American and 192 African American female undergraduates. Additionally, the specific roles of anxiety, depression, and alexithymia as…

  14. Bibliographic Services of the American Historical Association: Recently Published Articles and Writings on American History. A Report of the ABH/AHA Task Force.

    Science.gov (United States)

    McCrank, Lawrence J.; And Others

    The American Historical Association (AHA) has been providing bibliographic services for its membership by reviewing the monographic literature in the "American Historical Review" (AHR), using a list of books the AHA receives, and employing its periodical current awareness service comprised of "Recently Published Articles" (RPA) and its spinoff,…

  15. Prevalence and Clinical Characteristics Associated with Pulmonary Hypertension in African-Americans

    OpenAIRE

    Choudhary, Gaurav; Jankowich, Matthew; Wu, Wen-Chih

    2013-01-01

    Background Pulmonary hypertension (PH) is associated with increased mortality and morbidity. It is frequently associated with cardiopulmonary diseases that are prevalent in African Americans (AAs). However, the prevalence or determinants of PH in the AA population is not known. Methods We conducted a cross-sectional study to estimate the prevalence of PH (defined as trans-tricuspid gradient ≥ 35 mm Hg) and associated clinical characteristics in AAs using the Jackson Heart Study cohort (n=3,28...

  16. 2011 Annual Report of the American Psychological Association

    Science.gov (United States)

    American Psychologist, 2012

    2012-01-01

    As we have throughout the association's history, we focused in 2011 on multiple initiatives--all designed to further, support, and communicate the important work that psychologists do. This year we had the benefit of APA's first-ever strategic plan as well as funding for the following seven initiatives that are specifically designed to execute the…

  17. Lung cancer associated hypercalcemia: An analysis of factors influencing survival and prognosis in 34 cases

    Directory of Open Access Journals (Sweden)

    Su-jie ZHANG

    2012-06-01

    Full Text Available Objectives  To explore the factors influencing survival time in lung cancer associated hypercalcemia patients. Methods  Thirty-four patients with pathologically confirmed lung cancer complicated with hypercalcemia, who were treated at the Department of Oncology in General Hospital of PLA from Jan. 2001 to Dec. 2010, were enrolled in this study. The clinical data analyzed included sex, age, pathological type of the malignancies, organ metastasis (bone, lung, liver, kidney, brain, number of distal metastatic site, mental status, interval between final diagnosis of lung cancer and of hypercalcemia, peak value of blood calcium during the disease course, treatment methods and so on. Survival analysis was performed with the Kaplan-Meier method and Cox analysis with statistic software SPSS 18.0 to identify the potential prognostic factors. Results  The highest blood calcium level ranged from 2.77 to 4.87mmol/L, and the median value was 2.94mmol/L. The patients' survival time after diagnosis of hypercalcemia varied from 1 day to 1067 days, and the median survival time was 92 days. With the log-rank test, age above 50 years old, hypercalcemia occurring over 90 days after diagnosis of cancer, central nervous system symptoms and renal metastasis were predictors for poor survival (P=0.048, P=0.001, P=0.000, P=0.003. In the COX proportional hazard model analysis, age above 50 years old, hypercalcemia occurring over 90 days after cancer diagnosis, central nervous system symptoms and renal metastasis were significant prognostic factors for poor survival (HR=11.483, P=0.006; HR=4.371, P=0.002; HR=6.064, P=0.026; HR=8.502, P=0.011. Conclusions  Patients with lung cancer associated hypercalcemia have a shorter survival time and poor prognosis. Age above 50 years old, hypercalcemia occurring over 90 days after cancer diagnosis, central nervous system symptoms and renal metastasis are significant factors of poor prognosis.

  18. Dose–Volume Metrics Associated With Radiation Pneumonitis After Stereotactic Body Radiation Therapy for Lung Cancer

    International Nuclear Information System (INIS)

    Purpose: To identify dose–volume factors associated with radiation pneumonitis (RP) after stereotactic body radiation therapy (SBRT) for lung cancer. Methods and Materials: This study analyzed 74 patients who underwent SBRT for primary lung cancer. The prescribed dose for SBRT was uniformly 48 Gy in four fractions at the isocenter. RP was graded according to the Common Terminology Criteria for Adverse Events (CTCAE) v.3. Symptomatic RP was defined as grade 2 or worse. Optimal cut-offs dividing the patient population into two subgroups based on the incidence of symptomatic RP were sought using the following dose–volume metrics: PTV volume (ml), mean lung dose (Gy), and V5, V10, V15, V20, V25, V30, V35, and V40 (%) of both lungs excluding the PTV. Results: With a median follow-up duration of 31.4 months, symptomatic RP was observed in 15 patients (20.3%), including 1 patient with grade 3. Optimal cut-offs for pulmonary dose–volume metrics were V25 and V20. These two factors were highly correlated with each other, and V25 was more significant. Symptomatic RP was observed in 14.8% of the patients with V25 <4.2%, and the rate was 46.2% in the remainder (p = 0.019). PTV volume was another significant factor. The symptomatic RP rate was significantly lower in the group with PTV <37.7 ml compared with the larger PTV group (11.1% vs. 34.5%, p = 0.020). The patients were divided into three subgroups (patients with PTV <37.7 ml; patients with, PTV ≥37.7 ml and V25 <4.2%; and patients with PTV ≥37.7 ml and V25 ≥4.2%); the incidence of RP grade 2 or worse was 11.1%, 23.5%, and 50.0%, respectively (p = 0.013). Conclusions: Lung V25 and PTV volume were significant factors associated with RP after SBRT.

  19. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    Energy Technology Data Exchange (ETDEWEB)

    Chu, Tianqing; Teng, Jiajun; Jiang, Liyan; Zhong, Hua; Han, Baohui, E-mail: baohuihan1@163.com

    2014-01-17

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates β-catenin and RUNX2. -- Abstract: Wnt/β-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of β-catenin and RUNX2, as well as inhibiting the nuclear translocation of β-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC.

  20. Lung cancer-derived Dickkopf1 is associated with bone metastasis and the mechanism involves the inhibition of osteoblast differentiation

    International Nuclear Information System (INIS)

    Highlights: •DKK1 level was associated with NSCLC bone metastases. •Lung tumor cells derived DKK1 inhibited osteoblast differentiation. •Lung tumor cells derived DKK1 modulates β-catenin and RUNX2. -- Abstract: Wnt/β-catenin signaling and Dickkopf1 (DKK1) play important roles in the progression of lung cancer, which preferably metastasizes to skeleton. But the role of them in bone dissemination is poorly understood. This study aims to define the role of DKK1 in lung cancer bone metastases and investigate the underlying mechanism. Our results demonstrated that DKK1 over-expression was a frequent event in non-small-cell lung cancer (NSCLC) blood samples, and serous DKK1 level was much higher in bone metastatic NSCLC compared to non-bone metastatic NSCLC. We also found that conditioned medium from DKK1 over-expressing lung cancer cells inhibited the differentiation of osteoblast, determined by alkaline phosphatase activity and osteocalcin secretion, whereas the conditioned medium from DKK1 silencing lung cancer cells exhibited the opposite effects. Mechanistically, DKK1 reduced the level of β-catenin and RUNX2, as well as inhibiting the nuclear translocation of β-catenin. Taken together, these results suggested that lung cancer-produced DKK1 may be an important mechanistic link between NSCLC and bone metastases, and targeting DKK1 may be an effective method to treat bone metastase of NSCLC

  1. Factors associated with willingness to participate in biospecimen research among Chinese Americans.

    Science.gov (United States)

    Gao, Wanzhen; Ma, Grace X; Tan, Yin; Fang, Carolyn; Weaver, JoEllen; Jin, Ming; Lai, Philip

    2014-04-01

    A paucity of information exists on the recruitment of Asian Americans for biospecimen research. Although studies show that Chinese Americans are at high risk for hepatitis B virus (HBV) infection, little is known about their willingness to participate in HBV-related biospecimen research and how knowledge, attitudes, and cultural factors impact their willingness to participate. The study was guided by Community-Based Participatory Research principles. Data were derived from an assessment study on HBV-related biospecimen research participation among Chinese Americans in the Philadelphia region. The assessment was conducted with 415 Chinese Americans recruited from eight Chinese community-based organizations. Cultural beliefs, knowledge, and attitudes toward biospecimen research were examined for associations with their willingness to participate in biospecimen banking research. Overall, 192 (46.3%) of 415 participants who completed the assessment indicated they were willing to participate if they were invited to donate blood to be frozen and stored for future HBV biospecimen studies. Cultural variables significant in bivariate analysis included collectivism, knowledge about biospecimen research, and Yin-Yang beliefs. Fatalism and individualism were not associated with participation willingness. In multivariate analysis, age, health care attitudes, and trust were significantly associated with willingness to participate in biospecimen banking research. Asian American communities have little knowledge of biospecimen banking and will benefit from educational campaigns that emphasize collective benefits and attitudes towards and trust in the health care system. Understanding cultural factors is important for improving Chinese Americans' knowledge, awareness, and intentions of participation in biospecimen research. Similar efforts need to be undertaken to develop culturally appropriate educational intervention programs to increase participation in biospecimen research

  2. Pericardial tamponade masking associated pulmonary thrombo embolism in a case of adeno carcinoma of lung

    Directory of Open Access Journals (Sweden)

    Srinivasan Kandasamy

    2015-08-01

    Full Text Available This case report describes a patient admitted with shortness of breath of 15 days duration and found to have cardiac tamponade, which masked concomitant pulmonary embolism that was diagnosed by echocardiographic signs of dilate RA/RV with PAH only after successful pericardiocentesis. Subsequently patient was found to have widely metastatic adenocarcinoma of lungs. This case emphasizes the diagnostic challenge when cardiac tamponade is associated with pulmonary thromboembolism and requires high index of clinical suspicion in patients with underlying malignancy. [Int J Res Med Sci 2015; 3(8.000: 2126-2128

  3. The association of race with timeliness of care and survival among Veterans Affairs health care system patients with late-stage non-small cell lung cancer

    Directory of Open Access Journals (Sweden)

    Zullig LL

    2013-07-01

    Full Text Available Leah L Zullig,1,2 William R Carpenter,2 Dawn T Provenzale,1,3 Morris Weinberger,1,2 Bryce B Reeve,2 Christina D Williams,1 George L Jackson1,4 1Center of Excellence for Health Services Research in Primary Care, Durham Veterans Affairs Medical Center, Durham, NC, USA; 2Department of Health Policy and Management, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA; 3Division of Gastroenterology, Duke University, Durham, NC, USA; 4Division of General Internal Medicine, Duke University, Durham, NC, USA Background: Non-small cell lung cancer is the leading cause of cancer-related mortality in the United States. Patients with late-stage disease (stage 3/4 have five-year survival rates of 2%–15%. Care quality may be measured as time to receiving recommended care and, ultimately, survival. This study examined the association between race and receipt of timely non-small cell lung cancer care and survival among Veterans Affairs health care system patients. Methods: Data were from the External Peer Review Program, a nationwide Veterans Affairs quality-monitoring program. We included Caucasian or African American patients with pathologically confirmed late-stage non-small cell lung cancer in 2006 and 2007. We examined three quality measures: time from diagnosis to (1 treatment initiation, (2 palliative care or hospice referral, and (3 death. Unadjusted analyses used log-rank and Wilcoxon tests. Adjusted analyses used Cox proportional hazard models. Results: After controlling for patient and disease characteristics using Cox regression, there were no racial differences in time to initiation of treatment (72 days for African American versus 65 days for Caucasian patients, hazard ratio 1.04, P = 0.80 or palliative care or hospice referral (129 days versus 116 days, hazard ratio 1.10, P = 0.34. However, the adjusted model found longer survival for African American patients than for Caucasian patients (133 days versus 117 days, hazard ratio 0

  4. Longitudinal association of hemostatic factors with risk for cancers of the breast, colorectum, and lung among postmenopausal women.

    Science.gov (United States)

    Kabat, Geoffrey C; Salazar, Christian R; Zaslavsky, Oleg; Lane, Dorothy S; Rohan, Thomas E

    2016-09-01

    The aim of this study was to examine whether hemostatic factors associated with coagulation and inflammation pathways are associated with cancer risk in postmenopausal women. We used data from the Women's Health Initiative study to examine the association of plasma fibrinogen levels, factor VII antigen activity, and factor VII concentration measured at baseline and during follow-up with the risk for cancers of the breast, colorectum, and lung. Among 5287 women who were followed up for a median of 11.4 years, 275 cases of breast cancer, 102 cases of colorectal cancer, and 90 cases of lung cancer were identified. Cox proportional hazards models were used to estimate hazard ratios and 95% confidence intervals for the association of hemostatic factors with each cancer. Hemostatic factors were not associated with breast cancer in either baseline or longitudinal analyses. Baseline hemostatic factors showed weak associations with colorectal cancer; however, no association was seen in longitudinal analyses. Fibrinogen was positively associated with lung cancer in both baseline and longitudinal analyses; the association was seen only in never and former smokers, not in current smokers. We found no evidence of an association between hemostatic factors and breast or colorectal cancer in postmenopausal women. The positive association of fibrinogen levels with lung cancer requires confirmation in larger studies. PMID:26317383

  5. Rates and factors associated with falls in older European Americans, Afro-Caribbeans, African-Americans, and Hispanics

    Directory of Open Access Journals (Sweden)

    Vieira ER

    2015-10-01

    Full Text Available Edgar Ramos Vieira,1,2 Ruth Tappen,3 Gabriella Engstrom,3 Bruno R da Costa11Department of Physical Therapy, 2Department of Neuroscience, Florida International University, Miami, FL, USA; 3Christine E. Lynn College of Nursing, Florida Atlantic University, Boca Raton, FL, USAPurpose: To evaluate rates and factors associated with older adult falls in different ethnic groups.Participants and methods: Information on demographics, medical and falls history, and pain and physical activity levels was collected from 550 community-dwelling older adults (75±9 years old, 222 European Americans, 109 Afro-Caribbeans, 106 African-Americans, and 113 Hispanics.Results: Taking medications for anxiety (risk ratio [RR] =1.4, 95% confidence interval [CI] =1.1–2.0, having incontinence (RR =1.4, 95% CI =1.1–1.8, P=0.013, back pain (RR =1.4, 95% CI =1.0–1.8, feet swelling (RR =1.3, 95% CI =1.1–1.7, and age ≥75 years (RR =1.3, 95% CI =1.0–1.6 were associated with falls. The associations were stronger for Afro-Caribbeans, but they presented approximately 40% lower prevalence of falls than the other groups.Conclusion: Taking anxiety medication, incontinence, back pain, feet swelling, and age ≥75 years were associated with falls, and Afro-Caribbeans presented lower prevalence of falls. These findings need to be taken into consideration in clinical interventions in aging.Keywords: ethnicity, falls, risks, community dwelling, older adults

  6. Cruciferous vegetable intake is inversely associated with lung cancer risk among smokers: a case-control study

    Directory of Open Access Journals (Sweden)

    Zhang Yuesheng

    2010-04-01

    Full Text Available Abstract Background Inverse associations between cruciferous vegetable intake and lung cancer risk have been consistently reported. However, associations within smoking status subgroups have not been consistently addressed. Methods We conducted a hospital-based case-control study with lung cancer cases and controls matched on smoking status, and further adjusted for smoking status, duration, and intensity in the multivariate models. A total of 948 cases and 1743 controls were included in the analysis. Results Inverse linear trends were observed between intake of fruits, total vegetables, and cruciferous vegetables and risk of lung cancer (ORs ranged from 0.53-0.70, with P for trend Conclusions Our findings are consistent with the smoking-related carcinogen-modulating effect of isothiocyanates, a group of phytochemicals uniquely present in cruciferous vegetables. Our data support consumption of a diet rich in cruciferous vegetables may reduce the risk of lung cancer among smokers.

  7. Cost-effectiveness analysis on the results of screening of lung cancer using helical CT conducted by the anti-lung cancer association (ALCA)

    International Nuclear Information System (INIS)

    To compare Yen/person saved in lung cancer screening using helical CT with Yen/person in the screening using conventional direct chest X-rays conducted under the Anti-lung cancer association program of the Tokyo Health Service Association. A mathematical model for cancer screening was used to estimate net number of person relieved from lung cancer by the screening and net cost required for the screening. Finally cost-effectiveness ratios in terms of Yen/person saved were calculated and compared between the two programs. Several important variables employed in the model were as follows: 5 year survival rate in chest X-ray group was 50%, and the rate in helical CT group was 75%. Cost of screening in the chest X-ray group was 15,000 Yen, and that in the helical CT group was 25,000 Yen. Cost/person screened was 14,470 Yen for chest X-ray and 21,890 Yen for helical CT. Cost/person saved was 267 x 105 Yen in X-ray group and 112 x 105 Yen in CT group. Thus the cost was higher, but cost-effectiveness ratio was better in the CT screening group. Helical CT can be adopted for lung cancer screening in stead of chest X-ray if total cost is affordable. (author)

  8. Highly variable response to cytotoxic chemotherapy in carcinoma-associated fibroblasts (CAFs) from lung and breast

    International Nuclear Information System (INIS)

    Carcinoma-associated fibroblasts (CAFs) can promote carcinogenesis and tumor progression. Only limited data on the response of CAFs to chemotherapy and their potential impact on therapy outcome are available. This study was undertaken to analyze the influence of chemotherapy on carcinoma-associated fibroblasts (CAFs) in vitro and in vivo. The in vivo response of stromal cells to chemotherapy was investigated in 22 neoadjuvant treated breast tumors on tissue sections before and after chemotherapy. Response to chemotherapy was analyzed in vitro in primary cultures of isolated CAFs from 28 human lung and 9 breast cancer tissues. The response was correlated to Mdm2, ERCC1 and TP53 polymorphisms and TP53 mutation status. Additionally, the cytotoxic effects were evaluated in an ex vivo experiment using cultured tissue slices from 16 lung and 17 breast cancer specimens. Nine of 22 tumors showed a therapy-dependent reduction of stromal activity. Pathological response of tumor or stroma cells did not correlate with clinical response. Isolated CAFs showed little sensitivity to paclitaxel. In contrast, sensitivity of CAFs to cisplatinum was highly variable with a GI50 ranging from 2.8 to 29.0 μM which is comparable to the range observed in tumor cell lines. No somatic TP53 mutation was detected in any of the 28 CAFs from lung cancer tissue. In addition, response to cisplatinum was not significantly associated with the genotype of TP53 nor Mdm2 and ERCC1 polymorphisms. However, we observed a non-significant trend towards decreased sensitivity in the presence of TP53 variant genotype. In contrast to the results obtained in isolated cell culture, in tissue slice culture breast cancer CAFs responded to paclitaxel within their microenvironment in the majority of cases (9/14). The opposite was observed in lung cancer tissues: only few CAFs were sensitive to cisplatinum within their microenvironment (2/15) whereas a higher proportion responded to cisplatinum in isolated culture

  9. Improved pulmonary function following pirfenidone treatment in a patient with progressive interstitial lung disease associated with systemic sclerosis

    Directory of Open Access Journals (Sweden)

    Zarir F Udwadia

    2015-01-01

    Full Text Available Pirfenidone is an anti-fibrotic drug which has been approved for the management of patients with Idiopathic Pulmonary Fibrosis (IPF. However, its role in interstitial lung disease (ILD due to other causes such as systemic sclerosis (SSc is not clear. We present a case of a patient with SSc associated ILD who showed a subjective as well as objective improvement in lung function with pirfenidone.

  10. IGFBP2/FAK pathway is causally associated with dasatinib resistance in non-small Cell Lung Cancer Cells

    OpenAIRE

    Lu, Haibo; Wang, Li; Gao, Wen; Meng, Jieru; Dai, Bingbing; Wu, Shuhong; Minna, John; Roth, Jack A.; Hofstetter, Wayne L.; Swisher, Stephen G.; Fang, Bingliang

    2013-01-01

    IGFBP2 expression is increased in various types of cancers, including in a subset of lung cancer patients. Because IGFBP2 is involved in signal transduction of some critical cancer related pathways, we analyzed the association between IGFBP2 and response to pathway-targeted agents in seven human non–small cell lung cancer (NSCLC) cell lines. Western blot analysis and enzyme-linked immunosorbent assay (ELISA) showed that four of the seven NSCLC cell lines analyzed expressed high levels of IGFB...

  11. Macrophage phenotype is associated with disease severity in preterm infants with chronic lung disease.

    Directory of Open Access Journals (Sweden)

    Lynne R Prince

    Full Text Available BACKGROUND: The etiology of persistent lung inflammation in preterm infants with chronic lung disease of prematurity (CLD is poorly characterized, hampering efforts to stratify prognosis and treatment. Airway macrophages are important innate immune cells with roles in both the induction and resolution of tissue inflammation. OBJECTIVES: To investigate airway innate immune cellular phenotypes in preterm infants with respiratory distress syndrome (RDS or CLD. METHODS: Bronchoalveolar lavage (BAL fluid was obtained from term and preterm infants requiring mechanical ventilation. BAL cells were phenotyped by flow cytometry. RESULTS: Preterm birth was associated with an increase in the proportion of non-classical CD14(+/CD16(+ monocytes on the day of delivery (58.9 ± 5.8% of total mononuclear cells in preterm vs 33.0 ± 6.1% in term infants, p = 0.02. Infants with RDS were born with significantly more CD36(+ macrophages compared with the CLD group (70.3 ± 5.3% in RDS vs 37.6 ± 8.9% in control, p = 0.02. At day 3, infants born at a low gestational age are more likely to have greater numbers of CD14(+ mononuclear phagocytes in the airway (p = 0.03, but fewer of these cells are functionally polarized as assessed by HLA-DR (p = 0.05 or CD36 (p = 0.05 positivity, suggesting increased recruitment of monocytes or a failure to mature these cells in the lung. CONCLUSIONS: These findings suggest that macrophage polarization may be affected by gestational maturity, that more immature macrophage phenotypes may be associated with the progression of RDS to CLD and that phenotyping mononuclear cells in BAL could predict disease outcome.

  12. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: A report from the Female Lung Cancer Consortium in Asia

    Science.gov (United States)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2016-01-01

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of 7 telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a previously reported genome-wide association study. Using a group of 1,536 individuals with phenotypically measured telomere length in WBCs in the prospective Shanghai Women’s Health study, we demonstrated the utility of a genetic risk score (GRS) of 7 telomere-length associated variants to predict telomere length in an Asian population. We then found that GRSs used as instrumental variables to predict longer telomere length were associated with increased lung cancer risk (OR = 1.51 (95% CI=1.34–1.69) for upper vs. lower quartile of the weighted GRS, P-value=4.54×10−14) even after removing rs2736100 (P-value=4.81×10−3), a SNP in the TERT locus robustly associated with lung cancer risk in prior association studies. Stratified analyses suggested the effect of the telomere-associated GRS is strongest among younger individuals. We found no difference in GRS effect between adenocarcinoma and squamous cell subtypes. Our results indicate that a genetic background that favors longer telomere length may increase lung cancer risk, which is consistent with earlier prospective studies relating longer telomere length with increased lung cancer risk. PMID:25516442

  13. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: a report from the female lung cancer consortium in Asia.

    Science.gov (United States)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2015-07-15

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of seven telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a previously reported genome-wide association study. Using a group of 1,536 individuals with phenotypically measured telomere length in WBCs in the prospective Shanghai Women's Health study, we demonstrated the utility of a genetic risk score (GRS) of seven telomere-length associated variants to predict telomere length in an Asian population. We then found that GRSs used as instrumental variables to predict longer telomere length were associated with increased lung cancer risk (OR = 1.51 (95% CI = 1.34-1.69) for upper vs. lower quartile of the weighted GRS, p value = 4.54 × 10(-14) ) even after removing rs2736100 (p value = 4.81 × 10(-3) ), a SNP in the TERT locus robustly associated with lung cancer risk in prior association studies. Stratified analyses suggested the effect of the telomere-associated GRS is strongest among younger individuals. We found no difference in GRS effect between adenocarcinoma and squamous cell subtypes. Our results indicate that a genetic background that favors longer telomere length may increase lung cancer risk, which is consistent with earlier prospective studies relating longer telomere length with increased lung cancer risk. PMID:25516442

  14. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: a report from the female lung cancer consortium in Asia.

    Science.gov (United States)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2015-07-15

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of seven telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a previously reported genome-wide association study. Using a group of 1,536 individuals with phenotypically measured telomere length in WBCs in the prospective Shanghai Women's Health study, we demonstrated the utility of a genetic risk score (GRS) of seven telomere-length associated variants to predict telomere length in an Asian population. We then found that GRSs used as instrumental variables to predict longer telomere length were associated with increased lung cancer risk (OR = 1.51 (95% CI = 1.34-1.69) for upper vs. lower quartile of the weighted GRS, p value = 4.54 × 10(-14) ) even after removing rs2736100 (p value = 4.81 × 10(-3) ), a SNP in the TERT locus robustly associated with lung cancer risk in prior association studies. Stratified analyses suggested the effect of the telomere-associated GRS is strongest among younger individuals. We found no difference in GRS effect between adenocarcinoma and squamous cell subtypes. Our results indicate that a genetic background that favors longer telomere length may increase lung cancer risk, which is consistent with earlier prospective studies relating longer telomere length with increased lung cancer risk.

  15. Female genital mutilation. Council on Scientific Affairs, American Medical Association.

    Science.gov (United States)

    1995-12-01

    Female genital mutilation is the medically unnecessary modification of female genitalia. Female genital mutilation typically occurs at about 7 years of age, but mutilated women suffer severe medical complications throughout their adult lives. Female genital mutilation most frequently occurs in Africa, the Middle East, and Muslim parts of Indonesia and Malaysia, and it is generally part of a ceremonial induction into adult society. Recent political and economic problems in these regions, however, have increased the numbers of students and refugees to the United States. Consequently, US physicians are treating an increasing number of mutilated patients. The Council on Scientific Affairs recommends that US physicians join the World Health Organization, the World Medical Association, and other major health care organizations in opposing all forms of medically unnecessary surgical modification of the female genitalia. PMID:7474278

  16. AERA Code of Ethics: American Educational Research Association Approved by the AERA Council February 2011

    Science.gov (United States)

    Educational Researcher, 2011

    2011-01-01

    The Code of Ethics of the American Educational Research Association (AERA) articulates a common set of values upon which education researchers build their professional and scientific work. The Code is intended to provide both the principles and the rules to cover professional situations encountered by education researchers. It has as its primary…

  17. The American Bar Association and Legislatively Mandated Treatment for Sex Offenders.

    Science.gov (United States)

    Pallone, Nathanial J.

    1991-01-01

    Offers historical overview of "criminal sexual psychopath" legislation, which customarily prescribes confinement for treatment (rather than incarceration for punishment) for offenders whose sex crimes are attributed to sexual psychopathology. Discusses desire of American Bar Association and Group for the Advancement of Psychiatry to repeal extant…

  18. Neuropsychological Training in American Psychological Association-Accredited and Nonaccredited School Psychology Programs.

    Science.gov (United States)

    D'Amato, Rik Carl; And Others

    1992-01-01

    Examines whether American Psychological Association (APA)-accredited and nonaccredited programs differ in views and offerings of neuropsychological training. Of 72 programs surveyed, 59 percent of APA-accredited programs and 53 percent of nonaccredited programs offered course work in neuropsychology. Found that students viewed neuropsychological…

  19. University of Central Florida and the American Association of State Colleges and Universities: Blended Learning Toolkit

    Science.gov (United States)

    EDUCAUSE, 2014

    2014-01-01

    The Blended Learning Toolkit supports the course redesign approach, and interest in its openly available clearinghouse of online tools, strategies, curricula, and other materials to support the adoption of blended learning continues to grow. When the resource originally launched in July 2011, 20 AASCU [American Association of State Colleges and…

  20. American Association for Dental Schools Curricular Guidelines for Microscopic Anatomy (General and Oral).

    Science.gov (United States)

    Susi, Frank; Mundell, Robert

    1980-01-01

    Guidelines developed by the Section on Anatomical Sciences of the American Association for Dental Schools are presented. These guidelines were drawn up as an effort to provide a general criterion-referenced standard against which a school can measure its course content in histology. (MLW)

  1. American Association for Health Education (AAHE) 2011 Membership Survey: Summary of Findings

    Science.gov (United States)

    Chaney, Elizabeth H.; Chavarria, Enmanuel; Stellefson, Michael L.; Birch, David A.; Spear, Caile

    2012-01-01

    The American Association for Health Education (AAHE), a national health education organization with the mission of advancing the profession of health education, launched the 2011 AAHE membership survey between October 13, 2011 and November 1, 2011, under the leadership of the AAHE Board of Directors and AAHE Staff. The primary objective of the…

  2. The Asian American Psychological Association: Parallels and Intersections with Counseling Psychology

    Science.gov (United States)

    Alvarez, Alvin N.; Singh, Anneliese A.; Wu, Jenny

    2012-01-01

    This article provides an overview of the Asian American Psychological Association (AAPA). A brief history is provided, followed by current status and resources, connections to counseling psychology, and implications for the Society of Counseling Psychology and for the future of the AAPA. AAPA was created in 1972 in response to psychology's neglect…

  3. Expanding the Epistemological Terrain: Increasing Equity and Diversity within the American Educational Research Association

    Science.gov (United States)

    Banks, James A.

    2016-01-01

    During the civil rights movement of the 1960s and 1970s, the quest for civil rights by African Americans and other groups of color reverberated throughout the United States and the world, including within educational professional and research organizations, such as the Association for Supervision and Curriculum Development, the National Council of…

  4. Tobacco industry influence on the definition of tobacco related disorders by the American Psychiatric Association

    OpenAIRE

    Neuman, M; Bitton, A; Glantz, S

    2005-01-01

    Objective: The Diagnostic and statistical manual of mental disorders, third edition (DSM-III), published by the American Psychiatric Association (APA) in 1980, included the first official definitions by the APA of tobacco dependence and tobacco withdrawal. Tobacco industry efforts to influence the DSM-III were investigated.

  5. Importation of Hybrid Human-Associated Trypanosoma cruzi Strains of Southern South American Origin, Colombia.

    Science.gov (United States)

    Messenger, Louisa A; Ramirez, Juan David; Llewellyn, Martin S; Guhl, Felipe; Miles, Michael A

    2016-08-01

    We report the characterization of Trypanosoma cruzi of southern South American origin among humans, domestic vectors, and peridomestic hosts in Colombia using high-resolution nuclear and mitochondrial genotyping. Expanding our understanding of the geographic range of lineage TcVI, which is associated with severe Chagas disease, will help clarify risk of human infection for improved disease control. PMID:27434772

  6. Spirituality and Counselor Competence: A National Survey of American Counseling Association Members

    Science.gov (United States)

    Young, J. Scott; Wiggins-Frame, Marsha; Cashwell, Craig S.

    2007-01-01

    A random sample of 505 American Counseling Association (ACA) members completed a questionnaire that evaluated respondents' ratings of the importance of 9 competencies developed at the Summit on Spirituality (G. Miller, 1999; "Summit Results," 1995) meetings to effectively address spiritual and religious issues in counseling practice. Results…

  7. Albinism in the american mink (Neovison vison) is associated with a tyrosinase nonsense mutation

    DEFF Research Database (Denmark)

    Anistoroaei, Razvan Marian; Fredholm, Merete; Christensen, Knud;

    2008-01-01

    Albino phenotypes are documented in various species including the American mink. In other species the albino phenotypes are associated with tyrosinase (TYR) gene mutations; therefore TYR was considered the candidate gene for albinism in mink. Four microsatellite markers were chosen in the prodicted...

  8. Longitudinal associations between social support and physical and mental health in African American adults

    Science.gov (United States)

    African Americans report a greater number of modifiable risk factors, such as overweight/obesity, physical inactivity and poor dietary habits, putting them at increased risk of developing and dying from chronic diseases. These risk factors are also associated with poorer health-related quality of li...

  9. A Meta-analysis of Association between MGMT Gene 
Promoter Methylation and Non-small Cell Lung Cancer

    Directory of Open Access Journals (Sweden)

    Nianzhen FANG

    2014-08-01

    Full Text Available Backgroud and objective DNA promoter methylation of the tumor suppressor genes was one of the key mechanism for gene silence. The aim of this study is to investigate the difference of MGMT gene promoter methylation rate in tumor tissue and autologous controls (serum, normal lung tissue and bronchial lavage fluid in patients with non-small cell lung cancer (NSCLC. Methods The databases of Medline, EMBSE, CNKI and Wanfang were searched for selection of published articles of MGMT gene promoter methylation and non-small cell lung carcinoma risk. The pooled odds ratio (OR and percentage of MGMT for lung cancer tissue of NSCLC patients compared with normal lung tissue, plasma and the bronchial lavage fluid were pooled. Results 15 articles of association between MGMT gene promoter methylation and non small cell lung carcinoma risk were included in this meta-analysis. The combined results demonstrated the methylation rate of MGMT in NSCLC cancer tissue was 38% (95%CI: 23%-53%. For normal lung tissue, plasma and the bronchial lavage fluid were 16% (95%CI: 5%-27%, 23% (95%CI: 10%-34% and 39% (95%CI: 23%-55% respectively. The OR in cancer tissue was much higher than that in normal lung tissue and plasma odds ratio (OR 3.98 (95%CI: 2.71-5.84, P0.05. Conclusions Mehtylation rate in MGMT gene promoter of cancer tissue in NSCLC patients was much higher than that in normal lung tissue and plasma, which showed a close association between NSCLC cancer and MGMT gene promoter methylation.

  10. Report of a National Heart, Lung, And Blood Institute Workshop: heterogeneity in cardiometabolic risk in Asian Americans In the U.S. Opportunities for research.

    Science.gov (United States)

    Narayan, K M Venkat; Aviles-Santa, Larissa; Oza-Frank, Reena; Pandey, Mona; Curb, J David; McNeely, Marguerite; Araneta, Maria Rosario G; Palaniappan, Latha; Rajpathak, Swapnil; Barrett-Connor, Elizabeth

    2010-03-01

    The Asian and Pacific Islander population (Asian Americans) in the U.S. has increased dramatically in the last few decades. Yet, data on cardiovascular disease (CVD) in this population are scarce. The National Heart, Lung, and Blood Institute (NHLBI) of the National Institutes of Health conducted an Expert Workshop to: 1) assess the importance of studying CVD in Asian Americans in the U.S.; and 2) consider strategic options for further investigations of CVD in this population. There is considerable geographical, ethnic, cultural, and genetic diversity within this population. Limited data also suggest striking differences in the risk of CVD, obesity, type 2 diabetes mellitus, and other CVD risk factors across the Asian-American population. The Asian-American population is a new diverse pool with less contemporary genetic and cultural admixture relative to groups that have lived in the U.S. for generations, plus it is diverse in lifestyle including culture, diet, and family structure. This diversity provides a window of opportunity for research on genes and gene-environment interactions and also to investigate how acculturation/assimilation to U.S. lifestyles affects health and CVD risk among relatively homogenous groups of recent immigrants. Given the heterogeneity in body weight, body size, and CVD risk, the Asian-American population in the U.S. offers a unique model to study the interaction and relationships between visceral adiposity and adipose tissue distribution and beta cell function, insulin resistance, and atherosclerosis. PMID:20202512

  11. Evidence for chronic inflammation as a component of the interstitial lung disease associated with progressive systemic sclerosis

    International Nuclear Information System (INIS)

    Progressive systemic sclerosis (PSS) is a generalized disorder characterized by fibrosis of many organs including the lung parenchyma. Unlike most other interstitial disorders, traditional concepts of the interstitial lung disease associated with PSS have held it to be a ''pure'' fibrotic disorder without a significant inflammatory component. To directly evaluate whether an active alveolitis is associated with this disorder, patients with chronic interstitial lung disease and PSS were studied by open lung biopsy, gallium-67 scanning, and bronchoalveolar lavage. Histologic evaluation of the biopsies demonstrated that the interstitial fibrosis of PSS is clearly associated with the presence of macrophages, lymphocytes, and polymorphonuclear leukocytes, both in the interstitium and on the alveolar epithelial surface. Gallium-67 scans were positive in 77% of the patients, showing diffuse, primarily lower zone uptake, suggestive of active inflammation. Consistent with the histologic findings, bronchoalveolar lavage studies demonstrated a mild increase in the proportions of neutrophils and eosinophils with occasional increased numbers of lymphocytes. Importantly, alveolar macrophages from patients with PSS showed increased release of fibronectin and alveolar-macrophage-derived growth factor, mediators that together stimulate lung fibroblasts to proliferate, thus suggesting at least one mechanism modulating the lung fibrosis of these patients

  12. Association with Amino Acids Does Not Enhance Efficacy of Polymerized Liposomes As a System for Lung Gene Delivery.

    Science.gov (United States)

    Bandeira, Elga; Lopes-Pacheco, Miquéias; Chiaramoni, Nadia; Ferreira, Débora; Fernandez-Ruocco, Maria J; Prieto, Maria J; Maron-Gutierrez, Tatiana; Perrotta, Ramiro M; de Castro-Faria-Neto, Hugo C; Rocco, Patricia R M; Alonso, Silvia Del Valle; Morales, Marcelo M

    2016-01-01

    Development of improved drug and gene delivery systems directly into the lungs is highly desirable given the important burden of respiratory diseases. We aimed to evaluate the safety and efficacy of liposomes composed of photopolymerized lipids [1,2-bis-(tricosa-10,12-diynoyl)-sn-glycero-3-phosphocholine] associated with amino acids as vectors for gene delivery into the lungs of healthy animals. Lipopolymer vesicles, in particular, are more stable than other types of liposomes. In this study, lipopolymers were associated with l-arginine, l-tryptophan, or l-cysteine. We hypothesized that the addition of these amino acids would enhance the efficacy of gene delivery to the lungs by the lipopolymers. l-Arginine showed the highest association efficiency due to its positive charge and better surface interactions. None of the formulations caused inflammation or altered lung mechanics, suggesting that these lipopolymers can be safely administered as aerosols. All formulations were able to induce eGFP mRNA expression in lung tissue, but the addition of amino acids reduced delivery efficacy when compared with the simple lipopolymer particle. These results indicate that this system could be further explored for gene or drug delivery targeting lung diseases. PMID:27199766

  13. Association with amino acids does not enhance efficacy of polymerized liposomes as a system for lung gene delivery

    Directory of Open Access Journals (Sweden)

    Elga eBernardo Bandeira De Melo

    2016-04-01

    Full Text Available Development of improved drug and gene delivery systems directly into the lungs is highly desirable given the important burden of respiratory diseases. We aimed to evaluate the safety and efficacy of liposomes composed of photopolymerized lipids (1,2-bis-(tricosa-10,12-diynoyl-sn-glycero-3-phosphocholine associated with amino acids as vectors for gene delivery into the lungs of healthy animals. Lipopolymer vesicles, in particular, are more stable than other types of liposomes. In this study, lipopolymers were associated with L-arginine, L-tryptophan, or L-cysteine. We hypothesized that the addition of these amino acids would enhance the efficacy of gene delivery to the lungs by the lipopolymers. L-Arginine showed the highest association efficiency due to its positive charge and better surface interactions. None of the formulations caused inflammation or altered lung mechanics, suggesting that these lipopolymers can be safely administered as aerosols. All formulations were able to induce eGFP mRNA expression in lung tissue, but the addition of amino acids reduced delivery efficacy when compared with the simple lipopolymer particle. These results indicate that this system could be further explored for gene or drug delivery targeting lung diseases.

  14. Association with Amino Acids Does Not Enhance Efficacy of Polymerized Liposomes As a System for Lung Gene Delivery

    Science.gov (United States)

    Bandeira, Elga; Lopes-Pacheco, Miquéias; Chiaramoni, Nadia; Ferreira, Débora; Fernandez-Ruocco, Maria J.; Prieto, Maria J.; Maron-Gutierrez, Tatiana; Perrotta, Ramiro M.; de Castro-Faria-Neto, Hugo C.; Rocco, Patricia R. M.; Alonso, Silvia del Valle; Morales, Marcelo M.

    2016-01-01

    Development of improved drug and gene delivery systems directly into the lungs is highly desirable given the important burden of respiratory diseases. We aimed to evaluate the safety and efficacy of liposomes composed of photopolymerized lipids [1,2-bis-(tricosa-10,12-diynoyl)-sn-glycero-3-phosphocholine] associated with amino acids as vectors for gene delivery into the lungs of healthy animals. Lipopolymer vesicles, in particular, are more stable than other types of liposomes. In this study, lipopolymers were associated with l-arginine, l-tryptophan, or l-cysteine. We hypothesized that the addition of these amino acids would enhance the efficacy of gene delivery to the lungs by the lipopolymers. l-Arginine showed the highest association efficiency due to its positive charge and better surface interactions. None of the formulations caused inflammation or altered lung mechanics, suggesting that these lipopolymers can be safely administered as aerosols. All formulations were able to induce eGFP mRNA expression in lung tissue, but the addition of amino acids reduced delivery efficacy when compared with the simple lipopolymer particle. These results indicate that this system could be further explored for gene or drug delivery targeting lung diseases. PMID:27199766

  15. Source apportionment of particulate matter in the US and associations with lung inflammatory markers

    Energy Technology Data Exchange (ETDEWEB)

    Duvall, R.M.; Norris, G.A.; Dailey, L.A.; Burke, J.M.; McGee, J.K.; Gilmour, M.I.; Gordon, T.; Devlin, R.B. [US EPA, Research Triangle Park, NC (United States). National Exposure Research Laboratory

    2008-07-01

    Size-fractionated particulate matter (PM) samples were collected from six U.S. cities and chemically analyzed as part of the Multiple Air Pollutant Study. Particles were administered to cultured lung cells and the production of three different proinflammatory markers was measured to explore the association between the health effect markers and PM. Ultrafine, fine, and coarse PM samples were collected between December 2003 and May 2004 over a 4-wk period in each city. Filters were pooled for each city and the PM samples were extracted then analyzed for trace metals, ions, and elemental carbon. Particle extracts were applied to cultured human primary airway epithelial cells, and the secreted levels of interleukin-8 (IL-8), heme oxygenase-1, and cyclooxygenase-2 were measured 1 and 24 h following exposure. Fine PM sources were quantified by the chemical mass balance (CMB) model. The relationship between toxicological measures, PM sources, and individual species were evaluated using linear regression. Ultrafine and fine PM mass were associated with increases in IL-8 (r{sup 2} = .80 for ultrafine and r{sup 2} = .52 for fine). Sources of fine PM and their relative contributions varied across the sampling sites and a strong linear association was observed between IL-8 and secondary sulfate from coal combustion (r{sup 2} = .79). Ultrafine vanadium, lead, copper, and sulfate were also associated with increases in IL-8. Increases in inflammatory markers were not observed for coarse PM mass and source markers. These findings suggest that certain PM size fractions and sources are associated with markers of lung injury or inflammation.

  16. Proteasome inhibitor ameliorates severe acute pancreatitis and associated lung injury of rats

    Institute of Scientific and Technical Information of China (English)

    Xi Chen; Shun-Le Li; Tao Wu; Ji-Dong Liu

    2008-01-01

    AIM:To observe the effect of proteasome inhibitor MG-132 on severe acute pancreatitis (SAP) and associated lung injury of rats.METHODS:Male adult SD rats were randomly divided into SAP group,sham-operation group,and MG-132 treatment group.A model of SAP was established by injection of 5% sodium taurocholate into the biliarypancreatic duct of rats.The MG-132 group was pretreated with 10 mg/kg MG-132 intraperitoneally (ip) 30 rnin before the induction of pancreatitis.The changes in serum amylase,myeloperoxidase (MPO) activity of pancreatic and pulmonary tissue were measured.The TNF-α level in pancreatic cytosolic fractions was assayed with an enzyme-linked immunosorbent assay (ELISA) kit.Meanwhile,the pathological changes in both pancreatic and pulmonary tissues were also observed.RESULTS:MG-132 significantly decreased serum amylase,pancreatic weight/body ratio,pancreatic TNF-α level,pancreatic and pulmonary MPO activity (P < 0.05).Histopathological examinations revealed that pancreatic and pulmonary samples from rats pretreated with MG-132 demonstrated milder edema,cellular damage,and inflammatory activity (P < 0.05).CONCLUSION:The proteasome inhibitor MG-132shows a protective effect on severe acute pancreatitis and associated lung injury of rats.

  17. Gene Co-Expression Analysis Predicts Genetic Variants Associated with Drug Responsiveness in Lung Cancer.

    Science.gov (United States)

    Shroff, Sanaya; Zhang, Jie; Huang, Kun

    2016-01-01

    Responsiveness to drugs is an important concern in designing personalized treatment for cancer patients. Currently genetic markers are often used to guide targeted therapy. However, deeper understanding of the molecular basis for drug responses and discovery of new predictive biomarkers for drug sensitivity are much needed. In this paper, we present a workflow for identifying condition-specific gene co-expression networks associated with responses to the tyrosine kinase inhibitor, Erlotinib, in lung adenocarcinoma cell lines using data from the Cancer Cell Line Encyclopedia by combining network mining and statistical analysis. Particularly, we have identified multiple gene modules specifically co-expressed in the drug responsive cell lines but not in the unresponsive group. Interestingly, most of these modules are enriched on specific cytobands, suggesting potential copy number variation events on these loci. Our results therefore imply that there are multiple genetic loci with copy number variations associated with the Erlotinib responses. The existence of CNVs in these loci is also confirmed in lung cancer tissue samples using the TCGA data. Since these structural variations are inferred from functional genomics data, these CNVs are functional variations. These results suggest the condition specific gene co- expression network mining approach is an effective approach in predicting candidate biomarkers for drug responses. PMID:27570645

  18. Genetic variants in inducible nitric oxide synthase gene are associated with the risk of radiation-induced lung injury in lung cancer patients receiving definitive thoracic radiation

    International Nuclear Information System (INIS)

    Background and purpose: Nitric oxide (NO), mainly synthesized by inducible nitric oxide synthase (NOS2) in pathological conditions, plays an important role in cytotoxicity, inflammation and fibrosis. Elevations in exhaled NO after thoracic radiation have been reported to predict radiation-induced lung injury (RILI). This study examined whether genetic variations in NOS2 gene is associated with the risk of RILI. Material and methods: A cohort of 301 patients between 2009 and 2011 were genotyped for 21 single nucleotide polymorphisms (SNPs) in the NOS2 gene by the Sequenom MassArray system. Kaplan–Meier cumulative probability was used to assess RILI risk and Cox proportional hazards analyses were performed to evaluate the effect of NOS2 genotypes on RILI. Results: Multivariate analysis found that three SNPs (rs2297518, rs1137933 and rs16949) in NOS2 were significantly associated with risk of RILI ⩾ 2 (P value = 0.001, 0.000092, 0.001, respectively) after adjusting for other covariates. Their associations were independent of radiation dose and mean lung dose. Further haplotype analysis indicated that the ATC haplotype of three SNPs is associated with reducing the risk of developing RILI. Conclusion: Our results demonstrate that genetic variants of NOS2 may serve as a reliable predictor of RILI in lung cancer patients treated with thoracic radiation

  19. Lymphopenia Association With Gross Tumor Volume and Lung V5 and Its Effects on Non-Small Cell Lung Cancer Patient Outcomes

    International Nuclear Information System (INIS)

    Purpose: Radiation therapy (RT) can both suppress and stimulate the immune system. We sought to investigate the mechanisms underlying radiation-induced lymphopenia and its associations with patient outcomes in non-small cell lung cancer (NSCLC). Methods and Materials: Subjects consisted of 711 patients who had received definitive RT for NSCLC. A lymphocyte nadir was calculated as the minimum lymphocyte value measured during definitive RT. Associations between gross tumor volumes (GTVs) and lung dose-volume histogram (DVH) parameters with lymphocyte nadirs were assessed with Spearman correlation coefficients. Relationships between lymphocyte nadirs with overall survival (OS) and event free survival (EFS) were evaluated with Kaplan-Meier analysis and compared with log-rank test results. Multivariate regressions were conducted with linear and Cox regression analyses. All variables were analyzed as continuous if possible. Results: Larger GTVs were correlated with lower lymphocyte nadirs regardless of concurrent chemotherapy receipt (with concurrent: r = −0.26, P<.0001; without: r = −0.48, P<.0001). Analyses of lung DVH parameters revealed significant correlations at lower doses (lung V5-V10: P<.0001) that incrementally decreased and became nonsignificant at higher doses (lung V60-V70: P>.05). Of note, no significant associations were detected between GTV and lung DVH parameters with total leukocyte, neutrophil, or monocyte nadirs during RT or with lymphocyte count prior to RT. Multivariate analysis revealed larger GTV (P<.0001), receipt of concurrent chemotherapy (P<.0001), twice-daily radiation fractionation (P=.02), and stage III disease (P=.05) to be associated with lower lymphocyte nadirs. On univariate analysis, patients with higher lymphocyte nadirs exhibited significantly improved OS (hazard ratio [HR] = 0.51 per 103 lymphocytes/μL, P=.01) and EFS (HR = 0.46 per 103 lymphocytes/μL, P<.0001). These differences held on multivariate analyses, controlling

  20. Lymphopenia Association With Gross Tumor Volume and Lung V5 and Its Effects on Non-Small Cell Lung Cancer Patient Outcomes

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Chad [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao, Zhongxing, E-mail: zliao@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Gomez, Daniel; Levy, Lawrence; Zhuang, Yan; Gebremichael, Rediet A. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Hong, David S. [Department of Investigational Cancer Therapeutics, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Komaki, Ritsuko; Welsh, James W. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2014-08-01

    Purpose: Radiation therapy (RT) can both suppress and stimulate the immune system. We sought to investigate the mechanisms underlying radiation-induced lymphopenia and its associations with patient outcomes in non-small cell lung cancer (NSCLC). Methods and Materials: Subjects consisted of 711 patients who had received definitive RT for NSCLC. A lymphocyte nadir was calculated as the minimum lymphocyte value measured during definitive RT. Associations between gross tumor volumes (GTVs) and lung dose-volume histogram (DVH) parameters with lymphocyte nadirs were assessed with Spearman correlation coefficients. Relationships between lymphocyte nadirs with overall survival (OS) and event free survival (EFS) were evaluated with Kaplan-Meier analysis and compared with log-rank test results. Multivariate regressions were conducted with linear and Cox regression analyses. All variables were analyzed as continuous if possible. Results: Larger GTVs were correlated with lower lymphocyte nadirs regardless of concurrent chemotherapy receipt (with concurrent: r = −0.26, P<.0001; without: r = −0.48, P<.0001). Analyses of lung DVH parameters revealed significant correlations at lower doses (lung V5-V10: P<.0001) that incrementally decreased and became nonsignificant at higher doses (lung V60-V70: P>.05). Of note, no significant associations were detected between GTV and lung DVH parameters with total leukocyte, neutrophil, or monocyte nadirs during RT or with lymphocyte count prior to RT. Multivariate analysis revealed larger GTV (P<.0001), receipt of concurrent chemotherapy (P<.0001), twice-daily radiation fractionation (P=.02), and stage III disease (P=.05) to be associated with lower lymphocyte nadirs. On univariate analysis, patients with higher lymphocyte nadirs exhibited significantly improved OS (hazard ratio [HR] = 0.51 per 10{sup 3} lymphocytes/μL, P=.01) and EFS (HR = 0.46 per 10{sup 3} lymphocytes/μL, P<.0001). These differences held on multivariate analyses

  1. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink.

    Science.gov (United States)

    Cirera, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea; Vissenberg, Kris; Fredholm, Merete; Christensen, Knud; Anistoroaei, Razvan

    2016-04-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials for amplifying the genomic DNA and cDNA at the beginning of intron 2 of AP TYRP1 revealed the presence of a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene. In AP RNAseq data indicate, however, the presence of the wild-type (wt) transcript at very low levels and Western blot reveals three products when using an antibody raised against middle part of the TYRP1 protein. One individual from another brown mink phenotype-commercially named Dawn-was also investigated at the molecular level by long-range PCR and the same size insertion appears to be present. By this we suggest that certain modifiers of TYRP1 would induce different brown colour degradation, which results in at least two different phases of brown. PMID:26886941

  2. Adjuvant and Salvage Radiation Therapy After Prostatectomy: American Society for Radiation Oncology/American Urological Association Guidelines

    International Nuclear Information System (INIS)

    Purpose: The purpose of this guideline was to provide a clinical framework for the use of radiation therapy after radical prostatectomy as adjuvant or salvage therapy. Methods and Materials: A systematic literature review using PubMed, Embase, and Cochrane database was conducted to identify peer-reviewed publications relevant to the use of radiation therapy after prostatectomy. The review yielded 294 articles; these publications were used to create the evidence-based guideline statements. Additional guidance is provided as Clinical Principles when insufficient evidence existed. Results: Guideline statements are provided for patient counseling, use of radiation therapy in the adjuvant and salvage contexts, defining biochemical recurrence, and conducting a restaging evaluation. Conclusions: Physicians should offer adjuvant radiation therapy to patients with adverse pathologic findings at prostatectomy (ie, seminal vesicle invastion, positive surgical margins, extraprostatic extension) and salvage radiation therapy to patients with prostate-specific antigen (PSA) or local recurrence after prostatectomy in whom there is no evidence of distant metastatic disease. The offer of radiation therapy should be made in the context of a thoughtful discussion of possible short- and long-term side effects of radiation therapy as well as the potential benefits of preventing recurrence. The decision to administer radiation therapy should be made by the patient and the multidisciplinary treatment team with full consideration of the patient's history, values, preferences, quality of life, and functional status. The American Society for Radiation Oncology and American Urological Association websites show this guideline in its entirety, including the full literature review

  3. Adjuvant and Salvage Radiation Therapy After Prostatectomy: American Society for Radiation Oncology/American Urological Association Guidelines

    Energy Technology Data Exchange (ETDEWEB)

    Valicenti, Richard K., E-mail: Richard.valicenti@ucdmc.ucdavis.edu [Department of Radiation Oncology, University of California, Davis School of Medicine, Davis, California (United States); Thompson, Ian [Department of Urology, University of Texas Health Science Center at San Antonio, San Antonio, Texas (United States); Albertsen, Peter [Division of Urology, University of Connecticut Health Center, Farmington, Connecticut (United States); Davis, Brian J. [Department of Radiation Oncology, Mayo Medical School, Rochester, Minnesota (United States); Goldenberg, S. Larry [Department of Urologic Sciences, University of British Columbia, Vancouver, British Columbia (Canada); Wolf, J. Stuart [Department of Urology, University of Michigan, Ann Arbor, Michigan (United States); Sartor, Oliver [Department of Medicine and Urology, Tulane Medical School, New Orleans, Louisiana (United States); Klein, Eric [Glickman Urological Kidney Institute, Cleveland Clinic, Cleveland, Ohio (United States); Hahn, Carol [Department of Radiation Oncology, Duke University Medical Center, Durham, North Carolina (United States); Michalski, Jeff [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, Missouri (United States); Roach, Mack [Department of Radiation Oncology, University of California, San Francisco, San Francisco, California (United States); Faraday, Martha M. [Four Oaks, Inc (United States)

    2013-08-01

    Purpose: The purpose of this guideline was to provide a clinical framework for the use of radiation therapy after radical prostatectomy as adjuvant or salvage therapy. Methods and Materials: A systematic literature review using PubMed, Embase, and Cochrane database was conducted to identify peer-reviewed publications relevant to the use of radiation therapy after prostatectomy. The review yielded 294 articles; these publications were used to create the evidence-based guideline statements. Additional guidance is provided as Clinical Principles when insufficient evidence existed. Results: Guideline statements are provided for patient counseling, use of radiation therapy in the adjuvant and salvage contexts, defining biochemical recurrence, and conducting a restaging evaluation. Conclusions: Physicians should offer adjuvant radiation therapy to patients with adverse pathologic findings at prostatectomy (ie, seminal vesicle invastion, positive surgical margins, extraprostatic extension) and salvage radiation therapy to patients with prostate-specific antigen (PSA) or local recurrence after prostatectomy in whom there is no evidence of distant metastatic disease. The offer of radiation therapy should be made in the context of a thoughtful discussion of possible short- and long-term side effects of radiation therapy as well as the potential benefits of preventing recurrence. The decision to administer radiation therapy should be made by the patient and the multidisciplinary treatment team with full consideration of the patient's history, values, preferences, quality of life, and functional status. The American Society for Radiation Oncology and American Urological Association websites show this guideline in its entirety, including the full literature review.

  4. Insulin Promoter Factor 1 variation is associated with type 2 diabetes in African Americans

    Directory of Open Access Journals (Sweden)

    Wang Xiaoqin

    2005-10-01

    Full Text Available Abstract Background Defective insulin secretion is a key defect in the pathogenesis of type 2 diabetes (T2DM. The β-cell specific transcription factor, insulin promoter factor 1 gene (IPF1, is essential to pancreatic development and the maintenance of β-cell mass. We hypothesized that regulatory or coding variants in IPF1 contribute to defective insulin secretion and thus T2DM. Methods We screened 71 Caucasian and 69 African American individuals for genetic variants in the promoter region, three highly conserved upstream regulatory sequences (PH1, PH2 and PH3, the human β-cell specific enhancer, and the two exons with adjacent introns. We tested for an association of each variant with T2DM Caucasians (192 cases and 192 controls and African Americans (341 cases and 186 controls. Results We identified 8 variants in the two populations, including a 3 bp insertion in exon 2 (InsCCG243 in African Americans that resulted in an in-frame proline insertion in the transactivation domain. No variant was associated with T2DM in Caucasians, but polymorphisms at -3766 in the human β-cell enhancer, at -2877 bp in the PH1 domain, and at -108 bp in the promoter region were associated with T2DM in African American subjects (p Conculsion The common alleles of regulatory variants in the 5' enhancer and promoter regions of the IPF1 gene increase susceptibility to type 2 diabetes among African American individuals, likely as a result of gene-gene or gene-environment interactions. In contrast, IPF1 is not a cause of type 2 diabetes in Caucasians. A previously described InsCCG243 variant may contribute to diabetes susceptibility in African American individuals, but is of low penetrance.

  5. The Association Between Self-Efficacy and Hypertension Self-Care Activities Among African American Adults

    OpenAIRE

    Warren-Findlow, Jan; Seymour, Rachel B.; Brunner Huber, Larissa R.

    2012-01-01

    Chronic disease management requires the individual to perform varying forms of self-care behaviors. Self-efficacy, a widely used psychosocial concept, is associated with the ability to manage chronic disease. In this study, we examine the association between self-efficacy to manage hypertension and six clinically prescribed hypertension self-care behaviors. We interviewed 190 African Americans with hypertension who resided in the greater metropolitan Charlotte area about their self-efficacy a...

  6. Associations Between Epidermal Growth Factor Receptor Gene Mutation and Serum Tumor Markers in Advanced Lung Adenocarcinomas:A Retrospective Study

    Institute of Scientific and Technical Information of China (English)

    Ying-qiu Pan; Wei-wu Shi; Dan-ping Xu; Hui-hui Xu; Mei-ying Zhou; Wei-hua Yan

    2014-01-01

    Objective To investigate the associations between epidermal growth factor receptor (EGFR) gene mutations and serum tumor markers in advanced lung adenocarcinomas. Methods We investigated the association between EGFR gene mutations and clinical features, including serum tumor marker levels, in 97 advanced lung adenocarcinomas patients who did not undergo the treatment of EGFR tyrosine kinase inhibitors. EGFR gene mutation was detected by real-time PCR at exons 18, 19, 20, and 21. Serum tumor marker concentrations were analyzed by chemiluminescence assay kit at the same time. Results EGFR gene mutations were detected in 42 (43%) advanced lung adenocarcinoma patients. Gender (P=0.003), smoking status (P=0.001), and abnormal serum status of carcinoembryonic antigen (CEA, P=0.028) were significantly associated with EGFR gene mutation incidence. Multivariate analysis showed the abnormal CEA level in serum was independently associated with the incidence of EGFR gene mutation (P=0.046) with an odds ratio of 2.613 (95%CI:1.018-6.710). However, receiver operating characteristic (ROC) curve analysis revealed CEA was not an ideal predictive marker for EGFR gene mutation status in advanced lung adenocarcinoma (the area under the ROC curve was 0.608, P=0.069). Conclusions EGFR gene mutation status is significantly associated with serum CEA status in advanced lung adenocarcinmoas. However, serum CEA is not an ideal predictor for EGFR mutation.

  7. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia

    Science.gov (United States)

    Lan, Qing; Hsiung, Chao A; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wang, Zhaoming; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Chatterjee, Nilanjan; Hu, Wei; Wong, Maria Pik; Zheng, Wei; Caporaso, Neil; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Yuenger, Jeffrey; Jacobs, Kevin B; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; Wu, Chen; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; He, Xingzhou; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Shu, Xiao-Ou; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li1, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel

    2014-01-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland China, South Korea, Japan, Singapore, Taiwan, and Hong Kong. We genotyped the most promising variants (associated at P < 5 × 10-6) in an additional 1,099 cases and 2,913 controls. We identified three new susceptibility loci at 10q25.2 (rs7086803, P = 3.54 × 10-18), 6q22.2 (rs9387478, P = 4.14 × 10-10) and 6p21.32 (rs2395185, P = 9.51 × 10-9). We also confirmed associations reported for loci at 5p15.33 and 3q28 and a recently reported finding at 17q24.3. We observed no evidence of association for lung cancer at 15q25 in never-smoking women in Asia, providing strong evidence that this locus is not associated with lung cancer independent of smoking. PMID:23143601

  8. Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia.

    Science.gov (United States)

    Lan, Qing; Hsiung, Chao A; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wang, Zhaoming; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Chatterjee, Nilanjan; Hu, Wei; Wong, Maria Pik; Zheng, Wei; Caporaso, Neil; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Yuenger, Jeffrey; Jacobs, Kevin B; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; Wu, Chen; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; He, Xingzhou; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Shu, Xiao-Ou; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel

    2012-12-01

    To identify common genetic variants that contribute to lung cancer susceptibility, we conducted a multistage genome-wide association study of lung cancer in Asian women who never smoked. We scanned 5,510 never-smoking female lung cancer cases and 4,544 controls drawn from 14 studies from mainland China, South Korea, Japan, Singapore, Taiwan and Hong Kong. We genotyped the most promising variants (associated at P < 5 × 10(-6)) in an additional 1,099 cases and 2,913 controls. We identified three new susceptibility loci at 10q25.2 (rs7086803, P = 3.54 × 10(-18)), 6q22.2 (rs9387478, P = 4.14 × 10(-10)) and 6p21.32 (rs2395185, P = 9.51 × 10(-9)). We also confirmed associations reported for loci at 5p15.33 and 3q28 and a recently reported finding at 17q24.3. We observed no evidence of association for lung cancer at 15q25 in never-smoking women in Asia, providing strong evidence that this locus is not associated with lung cancer independent of smoking. PMID:23143601

  9. Race and sex differences in associations of vegetables, fruits, and carotenoids with lung cancer risk in New Jersey (United States).

    Science.gov (United States)

    Dorgan, J F; Ziegler, R G; Schoenberg, J B; Hartge, P; McAdams, M J; Falk, R T; Wilcox, H B; Shaw, G L

    1993-05-01

    We used data from a case-control study conducted in New Jersey between 1980 and 1983 to evaluate race and sex differences in associations of vegetable, fruit, and carotenoid consumption with lung cancer. Cases included 736 White males, 860 White females, 269 Black males, and 86 Black females with incident, histologically confirmed, primary cancer of the trachea, bronchus, or lung. Controls were identified through drivers' license and Health Care Financing Administration files and included 548 White males, 473 White females, 170 Black males, and 47 Black females. Usual intakes of vegetables (predominantly yellow/green) and fruit (predominantly yellow/orange) as well as other food sources of carotenoids were ascertained by a food frequency questionnaire. White females showed significant inverse associations of lung cancer with vegetables, fruit, and carotenoids. White males showed nonsignificant inverse associations with vegetables and carotenoids, and Black females just with vegetables. No inverse associations were found for Black males. Vegetable consumption was associated with risk of all histologic types of lung cancer, but the pattern of increasing risk with decreasing intake was limited to smokers. We infer that consumption of yellow/green vegetables and carotenoids may confer protection from lung cancer to White male and White female smokers. Further studies are needed to clarify the effect in Blacks.

  10. Characterization of human lung cancer-associated fibroblasts in three-dimensional in vitro co-culture model

    International Nuclear Information System (INIS)

    Highlights: ► We established three patient-paired sets of CAFs and NFs. ► CAFs and NFs were analyzed using three-dimensional co-culture experiments. ► CAFs clearly enhanced collagen gel contraction. ► CAFs showed higher α-SMA expression than NFs. ► CAFs were implicated in invasion and differentiation of lung cancer cells. -- Abstract: Lung cancer is the most common cause of cancer-related death worldwide. Stromal cancer-associated fibroblasts (CAFs) play crucial roles in carcinogenesis, proliferation, invasion, and metastasis of non-small cell lung carcinoma, and targeting of CAFs could be a novel strategy for cancer treatment. However, the characteristics of human CAFs still remain to be better defined. In this study, we established patient-matched CAFs and normal fibroblasts (NFs), from tumoral and non-tumoral portions of resected lung tissue from lung cancer patients. CAFs showed higher α-smooth muscle actin (α-SMA) expression than NFs, and CAFs clearly enhanced collagen gel contraction. Furthermore, we employed three-dimensional co-culture assay with A549 lung cancer cells, where CAFs were more potent in inducing collagen gel contraction. Hematoxylin and eosin staining of co-cultured collagen gel revealed that CAFs had the potential to increase invasion of A549 cells compared to NFs. These observations provide evidence that lung CAFs have the tumor-promoting capacity distinct from NFs.

  11. Characterization of human lung cancer-associated fibroblasts in three-dimensional in vitro co-culture model

    Energy Technology Data Exchange (ETDEWEB)

    Horie, Masafumi [Department of Respiratory Medicine, Graduate School of Medicine, University of Tokyo (Japan); Saito, Akira, E-mail: asaitou-tky@umin.ac.jp [Department of Respiratory Medicine, Graduate School of Medicine, University of Tokyo (Japan); Mikami, Yu [Department of Respiratory Medicine, Graduate School of Medicine, University of Tokyo (Japan); Ohshima, Mitsuhiro [Department of Biochemistry, Ohu University School of Pharmaceutical Sciences (Japan); Morishita, Yasuyuki [Department of Molecular Pathology, Graduate School of Medicine, University of Tokyo (Japan); Nakajima, Jun [Department of Thoracic Surgery, Graduate School of Medicine, University of Tokyo (Japan); Kohyama, Tadashi; Nagase, Takahide [Department of Respiratory Medicine, Graduate School of Medicine, University of Tokyo (Japan)

    2012-06-22

    Highlights: Black-Right-Pointing-Pointer We established three patient-paired sets of CAFs and NFs. Black-Right-Pointing-Pointer CAFs and NFs were analyzed using three-dimensional co-culture experiments. Black-Right-Pointing-Pointer CAFs clearly enhanced collagen gel contraction. Black-Right-Pointing-Pointer CAFs showed higher {alpha}-SMA expression than NFs. Black-Right-Pointing-Pointer CAFs were implicated in invasion and differentiation of lung cancer cells. -- Abstract: Lung cancer is the most common cause of cancer-related death worldwide. Stromal cancer-associated fibroblasts (CAFs) play crucial roles in carcinogenesis, proliferation, invasion, and metastasis of non-small cell lung carcinoma, and targeting of CAFs could be a novel strategy for cancer treatment. However, the characteristics of human CAFs still remain to be better defined. In this study, we established patient-matched CAFs and normal fibroblasts (NFs), from tumoral and non-tumoral portions of resected lung tissue from lung cancer patients. CAFs showed higher {alpha}-smooth muscle actin ({alpha}-SMA) expression than NFs, and CAFs clearly enhanced collagen gel contraction. Furthermore, we employed three-dimensional co-culture assay with A549 lung cancer cells, where CAFs were more potent in inducing collagen gel contraction. Hematoxylin and eosin staining of co-cultured collagen gel revealed that CAFs had the potential to increase invasion of A549 cells compared to NFs. These observations provide evidence that lung CAFs have the tumor-promoting capacity distinct from NFs.

  12. TREM2 is associated with increased risk for Alzheimer’s disease in African Americans

    OpenAIRE

    Jin, Sheng Chih; Carrasquillo, Minerva M.; Benitez, Bruno A.; Skorupa, Tara; Carrell, David; Patel, Dwani; Lincoln, Sarah; Krishnan, Siddharth; Kachadoorian, Michaela; Reitz, Christiane; Mayeux, Richard; Wingo, Thomas S.; Lah, James J.; Levey, Allan I.; Murrell, Jill

    2015-01-01

    Background TREM2 encodes for triggering receptor expressed on myeloid cells 2 and has rare, coding variants that associate with risk for late-onset Alzheimer’s disease (LOAD) in Caucasians of European and North-American origin. This study evaluated the role of TREM2 in LOAD risk in African-American (AA) subjects. We performed exonic sequencing and validation in two independent cohorts of >800 subjects. We selected six coding variants (p.R47H, p.R62H, p.D87N, p.E151K, p.W191X, and p.L211P) for...

  13. Available Interventions for Prevention of Cotton Dust-Associated Lung Diseases Among Textile Workers.

    Science.gov (United States)

    Nafees, Asaad Ahmed; Fatmi, Zafar

    2016-08-01

    The authors reviewed literature on interventions for cotton dust-associated lung diseases among textile workers. Internet sources (PubMed, Cochrane Library, Google and Google Scholar) were accessed and interventions were categorized into: Engineering or administrative controls, or personal protective equipment (PPE). Ten relevant articles were shortlisted, five related to engineering controls (pre-processing, bactericidal treatment of cotton, improved workplace design, machinery and dust control measures). Administrative controls may involve setting standards, environmental surveillance, periodic medical examinations, and workers training. Although specific guidelines are available regarding the use of PPEs, but there was little literature on their effectiveness. It was concluded that there is a dearth of literature regarding field-based assessment of interventions for control of cotton dust associated respiratory diseases and the available studies primarily focus on pre-processing of cotton. This review highlights the uncertainties that remain; and recommends several areas for future research on respiratory health of textile workers. PMID:27539764

  14. Mushroom β-Glucan May Immunomodulate the Tumor-Associated Macrophages in the Lewis Lung Carcinoma

    Directory of Open Access Journals (Sweden)

    Wan-Jhen Wang

    2015-01-01

    Full Text Available The present study showed that oral mushroom beta-glucan treatment significantly increased IFN-γ mRNA expression but significantly reduced COX-2 mRNA expression within the lung. For LLC tumor model, oral Ganoderma lucidum or Antrodia camphorata polysaccharides treatments significantly reduced TGF-β production in serum. In addition, IL-12 and IFN-γ mRNA expression were significantly increased, but IL-6, IL-10, COX-2, and TGF-β mRNA expression were substantially following oral mushroom polysaccharides treatments. The study highlights the efficacious effect of mushroom polysaccharides for ameliorating the immune suppression in the tumor microenvironment. Increased M1 phenotype of tumor-associated macrophages and attenuated M2 phenotype of tumor-associated macrophages could be achieved by ingesting mushroom polysaccharides.

  15. Available Interventions for Prevention of Cotton Dust-Associated Lung Diseases Among Textile Workers.

    Science.gov (United States)

    Nafees, Asaad Ahmed; Fatmi, Zafar

    2016-08-01

    The authors reviewed literature on interventions for cotton dust-associated lung diseases among textile workers. Internet sources (PubMed, Cochrane Library, Google and Google Scholar) were accessed and interventions were categorized into: Engineering or administrative controls, or personal protective equipment (PPE). Ten relevant articles were shortlisted, five related to engineering controls (pre-processing, bactericidal treatment of cotton, improved workplace design, machinery and dust control measures). Administrative controls may involve setting standards, environmental surveillance, periodic medical examinations, and workers training. Although specific guidelines are available regarding the use of PPEs, but there was little literature on their effectiveness. It was concluded that there is a dearth of literature regarding field-based assessment of interventions for control of cotton dust associated respiratory diseases and the available studies primarily focus on pre-processing of cotton. This review highlights the uncertainties that remain; and recommends several areas for future research on respiratory health of textile workers.

  16. Correlation of spicule sign on computed tomography scans with peripheral lung cancers associated with interstitial lung disease and chronic obstructive pulmonary disease.

    Science.gov (United States)

    Chen, L; Gao, L; Wu, W L

    2015-03-27

    The objective of this study was to investigate the correlation between spicular signs on computed tomography (CT) scans and peripheral lung cancer (PLC) that is associated with interstitial lung disease (ILD) and chronic obstructive pulmonary disease (COPD). We analyzed clinical data from 96 PLC cases and grouped patients based on whether they had interstitial pneumonia into either ILD/COPD group or non-ILD/COPD group. The occurrence rate of spicule sign was 90.3% in the ILD/COPD group and 61.8% in the non-ILD/COPD group, respectively. There was a significant difference between these groups (P < 0.05). There were no significant differences in the occurrence rate of spicular signs among patients with different pathological types of PLC. The severity of ILD affected the spicular morphology on CT scans directly. There was a significant correlation between the appearance of spicule sign on CT scans and PLC that was associated with ILD/COPD.

  17. Cross-Cancer Genome-Wide Analysis of Lung, Ovary, Breast, Prostate, and Colorectal Cancer Reveals Novel Pleiotropic Associations

    NARCIS (Netherlands)

    Fehringer, Gordon; Kraft, Peter; Pharoah, Paul D.; Eeles, Rosalind A.; Chatterjee, Nilanjan; Schumacher, Fredrick R.; Schildkraut, Joellen M.; Lindstrom, Sara; Brennan, Paul; Bickeboller, Heike; Houlston, Richard S.; Landi, Maria Teresa; Caporaso, Neil; Risch, Angela; Al Olama, Ali Amin; Berndt, Sonja I.; Giovannucci, Edward L.; Gronberg, Henrik; Kote-Jarai, Zsofia; Ma, Jing; Muir, Kenneth; Stampfer, Meir J.; Stevens, Victoria L.; Wiklund, Fredrik; Willett, Walter C.; Goode, Ellen L.; Permuth, Jennifer B.; Risch, Harvey A.; Reid, Brett M.; Bezieau, Stephane; Brenner, Hermann; Chan, Andrew T.; Chang-Claude, Jenny; Hudson, Thomas J.; Kocarnik, Jonathan K.; Newcomb, Polly A.; Schoen, Robert E.; Slattery, Martha L.; White, Emily; Adank, Muriel A.; Ahsan, Habibul; Aittomaki, Kristiina; Baglietto, Laura; Blomquist, Carl; Canzian, Federico; Czene, Kamila; dos-Santos-Silva, Isabel; Eliassen, A. Heather; Figueroa, Jonine D.; Flesch-Janys, Dieter; Fletcher, Olivia; Garcia-Closas, Montserrat; Gaudet, Mia M.; Johnson, Nichola; Hall, Per; Hazra, Aditi; Hein, Rebecca; Hofman, Albert; Hopper, John L.; Irwanto, Astrid; Johansson, Mattias; Kaaks, Rudolf; Kibriya, Muhammad G.; Lichtner, Peter; Liu, Jianjun; Lund, Eiliv; Makalic, Enes; Meindl, Alfons; Muller-Myhsok, Bertram; Muranen, Taru A.; Nevanlinna, Heli; Peeters, Petra H.; Peto, Julian; Prentice, Ross L.; Rahman, Nazneen; Sanchez, Maria Jose; Schmidt, Daniel F.; Schmutzler, Rita K.; Southey, Melissa C.; Tamimi, Rulla; Travis, Ruth C.; Turnbull, Clare; Uitterlinden, Andre G.; Wang, Zhaoming; Whittemore, Alice S.; Yang, Xiaohong R.; Zheng, Wei; Buchanan, Daniel D.; Casey, Graham; Conti, David V.; Edlund, Christopher K.; Gallinger, Steven; Haile, Robert W.; Jenkins, Mark; Le Marchand, Loic; Li, Li; Lindor, Noralene M.; Schmit, Stephanie L.; Thibodeau, Stephen N.; Woods, Michael O.; Rafnar, Thorunn; Gudmundsson, Julius; Stacey, Simon N.; Stefansson, Kari; Sulem, Patrick; Chen, Y. Ann; Tyrer, Jonathan P.; Christiani, David C.; Wei, Yongyue; Shen, Hongbing; Hu, Zhibin; Shu, Xiao-Ou; Shiraishi, Kouya; Takahashi, Atsushi; Bosse, Yohan; Obeidat, Ma'en; Nickle, David; Timens, Wim; Freedman, Matthew L.; Li, Qiyuan; Seminara, Daniela; Chanock, Stephen J.; Gong, Jian; Peters, Ulrike; Gruber, Stephen B.; Amos, Christopher I.; Sellers, Thomas A.; Easton, Douglas F.; Hunter, David J.; Haiman, Christopher A.; Henderson, Brian E.; Hung, Rayjean J.

    2016-01-01

    Identifying genetic variants with pleiotropic associations can uncover common pathways influencing multiple cancers. We took a two-stage approach to conduct genome-wide association studies for lung, ovary, breast, prostate, and colorectal cancer from the GAME-ON/GECCO Network (61,851 cases, 61,820 c

  18. Cross-cancer genome-wide analysis of lung, ovary, breast, prostate and colorectal cancer reveals novel pleiotropic associations

    NARCIS (Netherlands)

    Fehringer, Gordon; Kraft, Peter; Pharoah, Paul D P; Eeles, Rosalind A; Chatterjee, Nilanjan; Schumacher, Fredrick R; Schildkraut, Joellen M; Lindstrom, Sara; Brennan, Paul; Bickeböller, Heike; Houlston, Richard S; Landi, Maria Teresa; Caporaso, Neil E; Risch, Angela; Amin Al Olama, Ali; Berndt, Sonja I; Giovannucci, Edward; Gronberg, Henrik; Kote-Jarai, Zsofia; Ma, Jing; Muir, Kenneth; Stampfer, Meir J; Stevens, Victoria L; Wiklund, Fredrik; Willett, Walter C; Goode, Ellen L; Permuth, Jennifer B; Risch, Harvey A; Reid, Brett M; Bezieau, Stéphane; Brenner, Hermann; Chan, Andrew T; Chang-Claude, Jenny; Hudson, Thomas J; Kocarnik, Jonathan; Newcomb, Polly A; Schoen, Robert E; Slattery, Martha L; White, Emily; Adank, Muriel A; Ahsan, Habibul; Aittomaki, Kristiina; Baglietto, Laura; Blomquist, Carl; Canzian, Federico; Czene, Kamila; Dos Santos Silva, Isabel; Eliassen, A Heather; Figueroa, Jonine D; Flesch-Janys, Dieter; Fletcher, Olivia; Garcia-Closas, Montserrat; Gaudet, Mia M; Johnson, Nichola; Hall, Per; Hazra, Aditi; Hein, Rebecca; Hofman, Albert; Hopper, John L; Irwanto, Astrid; Johansson, Mattias; Kaaks, Rudolf; Kibriya, Muhammad G; Lichtner, Peter; Liu, Jian Jun; Lund, Eiliv; Makalic, Enes; Meindl, Alfons; Müller-Myhsok, Bertram; Muranen, Taru A; Nevanlinna, Heli; Peeters, Petra H; Peto, Julian; Prentice, Ross L; Rahman, Nazneen; Sanchez, Maria-Jose; Schmidt, Daniel F; Schmutzler, Rita K; Southey, Melissa C; Tamimi, Rulla M; Travis, Ruth C; Turnbull, Clare; Uitterlinden, Andre G; Wang, Zhaoming; Whittemore, Alice S; Yang, Xiaohong R; Zheng, Wei; Rafnar, Thorunn; Gudmundsson, Julius; Stacey, Simon N; Stefansson, Kari; Sulem, Patrick; Chen, Y Ann; Tyrer, Jonathan P; Christiani, David C; Wei, Yongyue; Shen, Hongbing; Hu, Zhibin; Shu, Xiao-Ou; Shiraishi, Kouya; Takahashi, Atsushi; Bossé, Yohan; Obeidat, Ma'en; Nickle, David; Timens, Wim; Freedman, Matthew L; Li, Qiyuan; Seminara, Daniela; Chanock, Stephen J; Gong, Jian; Peters, Ulrike; Gruber, Stephen B; Amos, Christopher I; Sellers, Thomas A; Easton, Douglas F; Hunter, David J; Haiman, Christopher A; Henderson, Brian E; Hung, Rayjean J

    2016-01-01

    Identifying genetic variants with pleiotropic associations can uncover common pathways influencing multiple cancers. We took a two-staged approach to conduct genome-wide association studies for lung, ovary, breast, prostate and colorectal cancer from the GAME-ON/GECCO Network (61,851 cases, 61,820 c

  19. Association of ambient air quality with children`s lung function in urban and rural Iran

    Energy Technology Data Exchange (ETDEWEB)

    Asgari, M.M.; Dubois, A.; Beckett, W.S. [Yale Univ. School of Medicine, New Haven, CT (United States); Asgari, M. [Shaheed Beheshti Univ., Tehran (Iran, Islamic Republic of); Gent, J. [John B. Pierce Lab., New Haven, CT (United States)

    1998-05-01

    During the summer of 1994, a cross-sectional epidemiological study, in which the pulmonary function of children in Tehran was compared with pulmonary function in children in a rural town in Iran, was conducted. Four hundred children aged 5--11 y were studied. Daytime ambient nitrogen dioxide, sulfur dioxide, and particulate matter were measured with portable devices, which were placed in the children`s neighborhoods on the days of study. Levels of these ambient substances were markedly higher in urban Tehran than in rural areas. Children`s parents were questioned about home environmental exposures (including heating source and environmental tobacco smoke) and the children`s respiratory symptoms. Pulmonary function was assessed, both by spirometry and peak expiratory flow meter. Forced expiratory volume in 1 s and forced vital capacity--as a percentage of predicted for age, sex and height--were significantly lower in urban children than in rural children. Both measurements evidenced significant reverse correlations with levels of sulfur dioxide, nitrogen dioxide, and particulate matter. Differences in spirometric lung function were not explained by nutritional status, as assessed by height and weight for age, or by home environmental exposures. Reported airway symptoms were higher among rural children, whereas reported physician diagnosis of bronchitis and asthma were higher among urban children. The association between higher pollutant concentrations and reduced pulmonary function in this urban-rural comparison suggests that there is an effect of urban air pollution on short-term lung function and/or lung growth and development during the preadolescent years.

  20. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia: A report from the Female Lung Cancer Consortium in Asia

    OpenAIRE

    Machiela, Mitchell J.; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan

    2014-01-01

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by examining a panel of 7 telomere-length associated genetic variants in a large study of 5,457 never-smoking female Asian lung cancer cases and 4,493 never-smoking female Asian controls using data from a...

  1. Gender-associated Differences of Lung Cancer and Mechanism%肺癌的性别差异及机制

    Institute of Scientific and Technical Information of China (English)

    邢昕; 廖永德; 唐和孝; 陈广; 具晟; 游良琨

    2011-01-01

    Lung cancer has been viewed as the most common malignant cancer with high incidence, mortality and poor survival all over the world. A lot of investigations indicated there are significant gender-associated differences in lung cancer in several characteristics such as epidemiology, pathology, clinical outcome and prognosis. The insight into these differences may help to clarify the gender-associated characteristics of lung cancer, and to drawn out new approach for treatment and prevent of lung cancer depending on gender-associated characteristics. Furthmore, study on mechanism of gender-associated characteristics may even help to illuminate the pathogenesis of lung cancer.%肺癌是全球发病率、死亡率最高、治疗效果差的恶性肿瘤.肺癌在流行病学、病理类型、疗效和预后、甚至发病机制等多方面均表现出明显性别差异.对这些差异的深入剖析能更好地认识男女性别肺癌各自的特点,为肺癌防治采用不同的性别化措施提供新线索和思路;而对导致性别差异的具体机制进行深入研究,有助于阐明肺癌的发病机制.

  2. Inhibition of TGF-β signaling and decreased apoptosis in IUGR-associated lung disease in rats.

    Directory of Open Access Journals (Sweden)

    Miguel Angel Alejandre Alcázar

    Full Text Available Intrauterine growth restriction is associated with impaired lung function in adulthood. It is unknown whether such impairment of lung function is linked to the transforming growth factor (TGF-β system in the lung. Therefore, we investigated the effects of IUGR on lung function, expression of extracellular matrix (ECM components and TGF-β signaling in rats. IUGR was induced in rats by isocaloric protein restriction during gestation. Lung function was assessed with direct plethysmography at postnatal day (P 70. Pulmonary activity of the TGF-β system was determined at P1 and P70. TGF-β signaling was blocked in vitro using adenovirus-delivered Smad7. At P70, respiratory airway compliance was significantly impaired after IUGR. These changes were accompanied by decreased expression of TGF-β1 at P1 and P70 and a consistently dampened phosphorylation of Smad2 and Smad3. Furthermore, the mRNA expression levels of inhibitors of TGF-β signaling (Smad7 and Smurf2 were reduced, and the expression of TGF-β-regulated ECM components (e.g. collagen I was decreased in the lungs of IUGR animals at P1; whereas elastin and tenascin N expression was significantly upregulated. In vitro inhibition of TGF-β signaling in NIH/3T3, MLE 12 and endothelial cells by adenovirus-delivered Smad7 demonstrated a direct effect on the expression of ECM components. Taken together, these data demonstrate a significant impact of IUGR on lung development and function and suggest that attenuated TGF-β signaling may contribute to the pathological processes of IUGR-associated lung disease.

  3. A case of lung cancer associated with acute respiratory distress syndrome after thoracic radiotherapy

    International Nuclear Information System (INIS)

    A 73-year-old man presented with dyspnea, cough, fever, appetite loss and stridor due to bronchial stenosis. Fiber-optic bronchoscopy revealed an endobronchial lesion in the right main bronchus and biopsy specimens showed poorly differentiated squamous cell carcinoma. The clinical stage of lung cancer was IIIB (T4N2M0). The patient received 60 Gy in 30 fractions over 43 days to a field including the right hilum and mediastinum. The tumor decreased in size and stenosis of the bronchus disappeared. A week after completion of radiation the patient began to have high grade fever and dyspnea, and progressive hypoxia developed. A chest radiograph showed diffuse bilateral interstitial infiltrates. Despite mechanical ventilation with PEEP and the administration of steroids, he died of respiratory failure three weeks after completion of radiation. Necropsy specimens obtained from the left lung revealed massive deposition of fibrin in the alveolar airspaces associated with hyaline membranes and hyperplasia of type II cells indicating diffuse alveolar damage. The patient had mild pulmonary fibrosis on a CT scan taken before the start of radiotherapy. We conclude that care should be taken if the case has pulmonary fibrosis because radiation therapy can precipitate severe radiation pneumonitis and acute respiratory distress syndrome in such cases. (author)

  4. Selenoprotein N deficiency in mice is associated with abnormal lung development.

    Science.gov (United States)

    Moghadaszadeh, Behzad; Rider, Branden E; Lawlor, Michael W; Childers, Martin K; Grange, Robert W; Gupta, Kushagra; Boukedes, Steve S; Owen, Caroline A; Beggs, Alan H

    2013-04-01

    Mutations in the human SEPN1 gene, encoding selenoprotein N (SepN), cause SEPN1-related myopathy (SEPN1-RM) characterized by muscle weakness, spinal rigidity, and respiratory insufficiency. As with other members of the selenoprotein family, selenoprotein N incorporates selenium in the form of selenocysteine (Sec). Most selenoproteins that have been functionally characterized are involved in oxidation-reduction (redox) reactions, with the Sec residue located at their catalytic site. To model SEPN1-RM, we generated a Sepn1-knockout (Sepn1(-/-)) mouse line. Homozygous Sepn1(-/-) mice are fertile, and their weight and lifespan are comparable to wild-type (WT) animals. Under baseline conditions, the muscle histology of Sepn1(-/-) mice remains normal, but subtle core lesions could be detected in skeletal muscle after inducing oxidative stress. Ryanodine receptor (RyR) calcium release channels showed lower sensitivity to caffeine in SepN deficient myofibers, suggesting a possible role of SepN in RyR regulation. SepN deficiency also leads to abnormal lung development characterized by enlarged alveoli, which is associated with decreased tissue elastance and increased quasi-static compliance of Sepn1(-/-) lungs. This finding raises the possibility that the respiratory syndrome observed in patients with SEPN1 mutations may have a primary pulmonary component in addition to the weakness of respiratory muscles. PMID:23325319

  5. DNA methylation profiles at precancerous stages associated with recurrence of lung adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Takashi Sato

    Full Text Available The aim of this study was to clarify the significance of DNA methylation alterations at precancerous stages of lung adenocarcinoma. Using single-CpG resolution Infinium array, genome-wide DNA methylation analysis was performed in 36 samples of normal lung tissue obtained from patients without any primary lung tumor, 145 samples of non-cancerous lung tissue (N obtained from patients with lung adenocarcinomas, and 145 samples of tumorous tissue (T. Stepwise progression of DNA methylation alterations from normal lung tissue to non-cancerous lung tissue obtained from patients with lung adenocarcinomas, and then tumorous tissue samples, was observed at 3,270 CpG sites, suggesting that non-cancerous lung tissue obtained from patients with lung adenocarcinomas was at precancerous stages with DNA methylation alterations. At CpG sites of 2,083 genes, DNA methylation status in samples of non-cancerous lung tissue obtained from patients with lung adenocarcinomas was significantly correlated with recurrence after establishment of lung adenocarcinomas. Among such recurrence-related genes, 28 genes are normally unmethylated (average β-values based on Infinium assay in normal lung tissue samples was less than 0.2 and their DNA hypermethylation at precancerous stages was strengthened during progression to lung adenocarcinomas (Δβ(T-N>0.1. Among these 28 genes, we focused on 6 for which implications in transcription regulation, apoptosis or cell adhesion had been reported. DNA hypermethylation of the ADCY5, EVX1, GFRA1, PDE9A, and TBX20 genes resulted in reduced mRNA expression in tumorous tissue samples. 5-Aza-2'-deoxycytidine treatment of lung cancer cell lines restored the mRNA expression levels of these 5 genes. Reduced mRNA expression in tumorous tissue samples was significantly correlated with tumor aggressiveness. These data suggest that DNA methylation alterations at precancerous stages determine tumor aggressiveness and outcome through silencing of

  6. DNA Methylation Profiles at Precancerous Stages Associated with Recurrence of Lung Adenocarcinoma

    Science.gov (United States)

    Sato, Takashi; Arai, Eri; Kohno, Takashi; Tsuta, Koji; Watanabe, Shun-ichi; Soejima, Kenzo; Betsuyaku, Tomoko; Kanai, Yae

    2013-01-01

    The aim of this study was to clarify the significance of DNA methylation alterations at precancerous stages of lung adenocarcinoma. Using single-CpG resolution Infinium array, genome-wide DNA methylation analysis was performed in 36 samples of normal lung tissue obtained from patients without any primary lung tumor, 145 samples of non-cancerous lung tissue (N) obtained from patients with lung adenocarcinomas, and 145 samples of tumorous tissue (T). Stepwise progression of DNA methylation alterations from normal lung tissue to non-cancerous lung tissue obtained from patients with lung adenocarcinomas, and then tumorous tissue samples, was observed at 3,270 CpG sites, suggesting that non-cancerous lung tissue obtained from patients with lung adenocarcinomas was at precancerous stages with DNA methylation alterations. At CpG sites of 2,083 genes, DNA methylation status in samples of non-cancerous lung tissue obtained from patients with lung adenocarcinomas was significantly correlated with recurrence after establishment of lung adenocarcinomas. Among such recurrence-related genes, 28 genes are normally unmethylated (average β-values based on Infinium assay in normal lung tissue samples was less than 0.2) and their DNA hypermethylation at precancerous stages was strengthened during progression to lung adenocarcinomas (ΔβT–N>0.1). Among these 28 genes, we focused on 6 for which implications in transcription regulation, apoptosis or cell adhesion had been reported. DNA hypermethylation of the ADCY5, EVX1, GFRA1, PDE9A, and TBX20 genes resulted in reduced mRNA expression in tumorous tissue samples. 5-Aza-2′-deoxycytidine treatment of lung cancer cell lines restored the mRNA expression levels of these 5 genes. Reduced mRNA expression in tumorous tissue samples was significantly correlated with tumor aggressiveness. These data suggest that DNA methylation alterations at precancerous stages determine tumor aggressiveness and outcome through silencing of specific genes

  7. Association of incidental emphysema with annual lung function decline and future development of airflow limitation

    Directory of Open Access Journals (Sweden)

    Koo HK

    2016-01-01

    Full Text Available Hyeon-Kyoung Koo,1 Kwang Nam Jin,2 Deog Kyeom Kim,3 Hee Soon Chung,3 Chang-Hoon Lee3,4 1Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, College of Medicine, Ilsan Paik Hospital, Inje University, Goyang-si, Gyeonggi-Do, 2Department of Radiology, Seoul Metropolitan Government – Seoul National University Boramae Medical Center, 3Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, Seoul Metropolitan Government-Seoul National University Boramae Medical Center, 4Department of Internal Medicine, Division of Pulmonary and Critical Care Medicine, Seoul National University College of Medicine, Seoul National University Hospital, Seoul, Republic of Korea Objectives: Emphysema is one of the prognostic factors for rapid lung function decline in patients with COPD, but the impact of incidentally detected emphysema on population without spirometric abnormalities has not been evaluated. This study aimed to determine whether emphysema detected upon computed tomography (CT screening would accelerate the rate of lung function decline and influence the possibility of future development of airflow limitation in a population without spirometric abnormalities.Materials and methods: Subjects who participated in a routine screening for health checkup and follow-up pulmonary function tests for at least 3 years between 2004 and 2010 were retrospectively enrolled. The percentage of low-attenuation area below −950 Hounsfield units (%LAA−950 was calculated automatically. A calculated value of %LAA−950 that exceeded 10% was defined as emphysema. Adjusted annual lung function decline was analyzed using random-slope, random-intercept mixed linear regression models.Results: A total of 628 healthy subjects within the normal range of spriometric values were included. Multivariable analysis showed that the emphysema group exhibited a faster decline in forced vital capacity (−33.9 versus −18.8

  8. Association between folate intake, serum folate levels and the risk of lung cancer: a systematic review and meta-analysis

    Institute of Scientific and Technical Information of China (English)

    DAI Wei-min; YANG Bo; CHU Xiang-yang; WANG Yu-qi; ZHAO Ming; CHEN Li; ZHANG Guo-qing

    2013-01-01

    Background Folate plays a critical role in nucleotide synthesis and DNA methylation,and was considered to be associated with anti-carcinogenesis.Results from studies that concern the relationship between the folate intake or serum folate levels and lung cancer risk showed no consistency,which requires our further comprehensive metaanalysis.Methods Systematic literature search was conducted to identify the relevant studies (published prior to February 2013)according to standard protocol.Estimated effects were calculated under both random-effects and fixed-effects models.Heterogeneity between studies and publication bias were also evaluated.Results A total of 4390 cases and 6138 controls from 6 case-control studies revealed a significant overall inverse association between folate intake and lung cancer risk (OR =0.74,95% Cl =0.65-0.84,P< 0.001).Summary of 1438 cases and 2582 controls from 4 case-control studies and 44 cases out of a cohort of 1988 participants suggested a marginal association without significance (OR =0.78,95% Cl =0.60-1.02,P =0.075) between high serum folate levels and less lung cancer susceptibility; however,subgroup analysis about population-based case-control studies showed that high serum folate levels significantly associated with the reduced lung cancer risk (OR =0.76,95% Cl =0.58-1.00,P =0.048).Conclusion Higher folate intake can be a protective factor against lung cancer risk,and higher serum folate level is probably associated with reduced lung cancer risk in marginal manner,though more studies are warranted to confirm these associations.

  9. A comprehensive evaluation of potential lung function associated genes in the SpiroMeta general population sample.

    Directory of Open Access Journals (Sweden)

    Ma'en Obeidat

    Full Text Available Lung function measures are heritable traits that predict population morbidity and mortality and are essential for the diagnosis of chronic obstructive pulmonary disease (COPD. Variations in many genes have been reported to affect these traits, but attempts at replication have provided conflicting results. Recently, we undertook a meta-analysis of Genome Wide Association Study (GWAS results for lung function measures in 20,288 individuals from the general population (the SpiroMeta consortium.To comprehensively analyse previously reported genetic associations with lung function measures, and to investigate whether single nucleotide polymorphisms (SNPs in these genomic regions are associated with lung function in a large population sample.We analysed association for SNPs tagging 130 genes and 48 intergenic regions (+/-10 kb, after conducting a systematic review of the literature in the PubMed database for genetic association studies reporting lung function associations.The analysis included 16,936 genotyped and imputed SNPs. No loci showed overall significant association for FEV(1 or FEV(1/FVC traits using a carefully defined significance threshold of 1.3×10(-5. The most significant loci associated with FEV(1 include SNPs tagging MACROD2 (P = 6.81×10(-5, CNTN5 (P = 4.37×10(-4, and TRPV4 (P = 1.58×10(-3. Among ever-smokers, SERPINA1 showed the most significant association with FEV(1 (P = 8.41×10(-5, followed by PDE4D (P = 1.22×10(-4. The strongest association with FEV(1/FVC ratio was observed with ABCC1 (P = 4.38×10(-4, and ESR1 (P = 5.42×10(-4 among ever-smokers.Polymorphisms spanning previously associated lung function genes did not show strong evidence for association with lung function measures in the SpiroMeta consortium population. Common SERPINA1 polymorphisms may affect FEV(1 among smokers in the general population.

  10. Blood cadmium levels are associated with a decline in lung function in males

    International Nuclear Information System (INIS)

    Background: Cadmium exposure was found to cause a decline in lung function among the general population, but these findings were limited to smokers and gender differences were not explored. Objectives: To examine the relationship between cadmium and chronic obstructive pulmonary disease (COPD) according to gender and smoking status in Korea. Methods: Cross-sectional data from the Korean National Health and Nutrition Examination Survey from 2008 to 2011 were analyzed. COPD was defined by a pre-bronchodilator forced expiratory volume in 1 s divided by forced vital capacity of <0.70. A logistic regression model was used to elucidate the association between blood cadmium levels and COPD according to gender and smoking status. Results: Among 3861 eligible participants, 3622 were included in the analysis. The prevalence of COPD demonstrated an increasing trend in males (P for trend<0.001), but not in females (P for trend=0.67). After adjusting for covariates, a higher blood cadmium level, but within the normal range, was associated with COPD in males, including those who had never-smoked (P for trend <0.001 and P for trend=0.008). However, a higher blood cadmium level was not significantly associated with COPD in females, including those who had never smoked (P for trend=0.39 and P for trend=0.43). Conclusions: A higher blood cadmium level, within the normal range, was associated with COPD in males, including those who had never smoked. However, there was no significant association between blood cadmium levels and COPD in females. - Highlights: • Elevated blood cadmium level is associated with chronic obstructive pulmonary disease in male. • This association can be seen even in never smoked male. • However, this association is present only in male, but not in female

  11. Blood cadmium levels are associated with a decline in lung function in males

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Chang-Mo [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of); The Korea Central Cancer Registry, National Cancer Center, Goyang (Korea, Republic of); Oh, In-Hwan; Lee, Jong-Keun [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Park, Yoon Hyung [Departments of Preventive Medicine, School of Medicine, Soonchunhyang University, Seoul (Korea, Republic of); Choe, Bong-Keun; Yoon, Tai-Young [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of); Choi, Joong-Myung, E-mail: jmchoi@khu.ac.kr [Department of Preventive Medicine, School of Medicine, Kyung Hee University, Seoul 130-701 (Korea, Republic of)

    2014-07-15

    Background: Cadmium exposure was found to cause a decline in lung function among the general population, but these findings were limited to smokers and gender differences were not explored. Objectives: To examine the relationship between cadmium and chronic obstructive pulmonary disease (COPD) according to gender and smoking status in Korea. Methods: Cross-sectional data from the Korean National Health and Nutrition Examination Survey from 2008 to 2011 were analyzed. COPD was defined by a pre-bronchodilator forced expiratory volume in 1 s divided by forced vital capacity of <0.70. A logistic regression model was used to elucidate the association between blood cadmium levels and COPD according to gender and smoking status. Results: Among 3861 eligible participants, 3622 were included in the analysis. The prevalence of COPD demonstrated an increasing trend in males (P for trend<0.001), but not in females (P for trend=0.67). After adjusting for covariates, a higher blood cadmium level, but within the normal range, was associated with COPD in males, including those who had never-smoked (P for trend <0.001 and P for trend=0.008). However, a higher blood cadmium level was not significantly associated with COPD in females, including those who had never smoked (P for trend=0.39 and P for trend=0.43). Conclusions: A higher blood cadmium level, within the normal range, was associated with COPD in males, including those who had never smoked. However, there was no significant association between blood cadmium levels and COPD in females. - Highlights: • Elevated blood cadmium level is associated with chronic obstructive pulmonary disease in male. • This association can be seen even in never smoked male. • However, this association is present only in male, but not in female.

  12. Knowledge Gaps in Cardiovascular Care of the Older Adult Population: A Scientific Statement From the American Heart Association, American College of Cardiology, and American Geriatrics Society.

    Science.gov (United States)

    Rich, Michael W; Chyun, Deborah A; Skolnick, Adam H; Alexander, Karen P; Forman, Daniel E; Kitzman, Dalane W; Maurer, Mathew S; McClurken, James B; Resnick, Barbara M; Shen, Win K; Tirschwell, David L

    2016-05-24

    The incidence and prevalence of most cardiovascular disorders increase with age, and cardiovascular disease is the leading cause of death and major disability in adults ≥75 years of age; however, despite the large impact of cardiovascular disease on quality of life, morbidity, and mortality in older adults, patients aged ≥75 years have been markedly underrepresented in most major cardiovascular trials, and virtually all trials have excluded older patients with complex comorbidities, significant physical or cognitive disabilities, frailty, or residence in a nursing home or assisted living facility. As a result, current guidelines are unable to provide evidence-based recommendations for diagnosis and treatment of older patients typical of those encountered in routine clinical practice. The objectives of this scientific statement are to summarize current guideline recommendations as they apply to older adults, identify critical gaps in knowledge that preclude informed evidence-based decision making, and recommend future research to close existing knowledge gaps. To achieve these objectives, we conducted a detailed review of current American College of Cardiology/American Heart Association and American Stroke Association guidelines to identify content and recommendations that explicitly targeted older patients. We found that there is a pervasive lack of evidence to guide clinical decision making in older patients with cardiovascular disease, as well as a paucity of data on the impact of diagnostic and therapeutic interventions on key outcomes that are particularly important to older patients, such as quality of life, physical function, and maintenance of independence. Accordingly, there is a critical need for a multitude of large population-based studies and clinical trials that include a broad spectrum of older patients representative of those seen in clinical practice and that incorporate relevant outcomes important to older patients in the study design. The

  13. Ex vivo adenoviral vector gene delivery results in decreased vector-associated inflammation pre- and post-lung transplantation in the pig.

    Science.gov (United States)

    Yeung, Jonathan C; Wagnetz, Dirk; Cypel, Marcelo; Rubacha, Matthew; Koike, Terumoto; Chun, Yi-Min; Hu, Jim; Waddell, Thomas K; Hwang, David M; Liu, Mingyao; Keshavjee, Shaf

    2012-06-01

    Acellular normothermic ex vivo lung perfusion (EVLP) is a novel method of donor lung preservation for transplantation. As cellular metabolism is preserved during perfusion, it represents a potential platform for effective gene transduction in donor lungs. We hypothesized that vector-associated inflammation would be reduced during ex vivo delivery due to isolation from the host immune system response. We compared ex vivo with in vivo intratracheal delivery of an E1-, E3-deleted adenoviral vector encoding either green fluorescent protein (GFP) or interleukin-10 (IL-10) to porcine lungs. Twelve hours after delivery, the lung was transplanted and the post-transplant function assessed. We identified significant transgene expression by 12 hours in both in vivo and ex vivo delivered groups. Lung function remained excellent in all ex vivo groups after viral vector delivery; however, as expected, lung function decreased in the in vivo delivered adenovirus vector encoding GFP (AdGFP) group with corresponding increases in IL-1β levels. Transplanted lung function was excellent in the ex vivo transduced lungs and inferior lung function was seen in the in vivo group after transplantation. In summary, ex vivo delivery of adenoviral gene therapy to the donor lung is superior to in vivo delivery in that it leads to less vector-associated inflammation and provides superior post-transplant lung function. PMID:22453765

  14. Ex Vivo Adenoviral Vector Gene Delivery Results in Decreased Vector-associated Inflammation Pre- and Post–lung Transplantation in the Pig

    Science.gov (United States)

    Yeung, Jonathan C; Wagnetz, Dirk; Cypel, Marcelo; Rubacha, Matthew; Koike, Terumoto; Chun, Yi-Min; Hu, Jim; Waddell, Thomas K; Hwang, David M; Liu, Mingyao; Keshavjee, Shaf

    2012-01-01

    Acellular normothermic ex vivo lung perfusion (EVLP) is a novel method of donor lung preservation for transplantation. As cellular metabolism is preserved during perfusion, it represents a potential platform for effective gene transduction in donor lungs. We hypothesized that vector-associated inflammation would be reduced during ex vivo delivery due to isolation from the host immune system response. We compared ex vivo with in vivo intratracheal delivery of an E1-, E3-deleted adenoviral vector encoding either green fluorescent protein (GFP) or interleukin-10 (IL-10) to porcine lungs. Twelve hours after delivery, the lung was transplanted and the post-transplant function assessed. We identified significant transgene expression by 12 hours in both in vivo and ex vivo delivered groups. Lung function remained excellent in all ex vivo groups after viral vector delivery; however, as expected, lung function decreased in the in vivo delivered adenovirus vector encoding GFP (AdGFP) group with corresponding increases in IL-1β levels. Transplanted lung function was excellent in the ex vivo transduced lungs and inferior lung function was seen in the in vivo group after transplantation. In summary, ex vivo delivery of adenoviral gene therapy to the donor lung is superior to in vivo delivery in that it leads to less vector-associated inflammation and provides superior post-transplant lung function. PMID:22453765

  15. Surfactant Protein A Suppresses Lung Cancer Progression by Regulating the Polarization of Tumor-Associated Macrophages

    OpenAIRE

    Mitsuhashi, Atsushi; Goto, Hisatsugu; Kuramoto, Takuya; Tabata, Sho; Yukishige, Sawaka; Abe, Shinji; Hanibuchi, Masaki; Kakiuchi, Soji; Saijo, Atsuro; Aono, Yoshinori; Uehara, Hisanori; Yano, Seiji; Ledford, Julie G.; Sone, Saburo; Nishioka, Yasuhiko

    2013-01-01

    Surfactant protein A (SP-A) is a large multimeric protein found in the lungs. In addition to its immunoregulatory function in infectious respiratory diseases, SP-A is also used as a marker of lung adenocarcinoma. Despite the finding that SP-A expression levels in cancer cells has a relationship with patient prognosis, the function of SP-A in lung cancer progression is unknown. We investigated the role of SP-A in lung cancer progression by introducing the SP-A gene into human lung adenocarcino...

  16. Carcass Quality and Hematological Alterations Associated with Lung Lesions in Slaughter Pigs

    Directory of Open Access Journals (Sweden)

    Nikola Dj Čobanović

    2016-05-01

    Full Text Available The aim of this study was to examine effects of lung lesions on carcass quality and hematological parameters of slaughter pigs. The group of pigs with lung lesion score 2 had significantly lower live weight, hot carcass weight and cold carcass weight compared to the group of pigs with lung lesion score 0 (P0.05. The total number of red blood cells, concentrations of hemoglobin and hematocrit showed significantly lower mean values in the group of pigs with lung lesions score 2 (P0.05. In conclusion, the results showed that lung lesions in fattening pigs had negative impact on carcass quality and hematological parameters.

  17. Large-Scale Genome-Wide Association Studies and Meta-Analyses of Longitudinal Change in Adult Lung Function

    Science.gov (United States)

    Tang, Wenbo; Kowgier, Matthew; Loth, Daan W.; Soler Artigas, María; Joubert, Bonnie R.; Hodge, Emily; Gharib, Sina A.; Smith, Albert V.; Ruczinski, Ingo; Gudnason, Vilmundur; Mathias, Rasika A.; Harris, Tamara B.; Hansel, Nadia N.; Launer, Lenore J.; Barnes, Kathleen C.; Hansen, Joyanna G.; Albrecht, Eva; Aldrich, Melinda C.; Allerhand, Michael; Barr, R. Graham; Brusselle, Guy G.; Couper, David J.; Curjuric, Ivan; Davies, Gail; Deary, Ian J.; Dupuis, Josée; Fall, Tove; Foy, Millennia; Franceschini, Nora; Gao, Wei; Gläser, Sven; Gu, Xiangjun; Hancock, Dana B.; Heinrich, Joachim; Hofman, Albert; Imboden, Medea; Ingelsson, Erik; James, Alan; Karrasch, Stefan; Koch, Beate; Kritchevsky, Stephen B.; Kumar, Ashish; Lahousse, Lies; Li, Guo; Lind, Lars; Lindgren, Cecilia; Liu, Yongmei; Lohman, Kurt; Lumley, Thomas; McArdle, Wendy L.; Meibohm, Bernd; Morris, Andrew P.; Morrison, Alanna C.; Musk, Bill; North, Kari E.; Palmer, Lyle J.; Probst-Hensch, Nicole M.; Psaty, Bruce M.; Rivadeneira, Fernando; Rotter, Jerome I.; Schulz, Holger; Smith, Lewis J.; Sood, Akshay; Starr, John M.; Strachan, David P.; Teumer, Alexander; Uitterlinden, André G.; Völzke, Henry; Voorman, Arend; Wain, Louise V.; Wells, Martin T.; Wilk, Jemma B.; Williams, O. Dale; Heckbert, Susan R.; Stricker, Bruno H.; London, Stephanie J.; Fornage, Myriam; Tobin, Martin D.; O′Connor, George T.; Hall, Ian P.; Cassano, Patricia A.

    2014-01-01

    Background Genome-wide association studies (GWAS) have identified numerous loci influencing cross-sectional lung function, but less is known about genes influencing longitudinal change in lung function. Methods We performed GWAS of the rate of change in forced expiratory volume in the first second (FEV1) in 14 longitudinal, population-based cohort studies comprising 27,249 adults of European ancestry using linear mixed effects model and combined cohort-specific results using fixed effect meta-analysis to identify novel genetic loci associated with longitudinal change in lung function. Gene expression analyses were subsequently performed for identified genetic loci. As a secondary aim, we estimated the mean rate of decline in FEV1 by smoking pattern, irrespective of genotypes, across these 14 studies using meta-analysis. Results The overall meta-analysis produced suggestive evidence for association at the novel IL16/STARD5/TMC3 locus on chromosome 15 (P  =  5.71 × 10-7). In addition, meta-analysis using the five cohorts with ≥3 FEV1 measurements per participant identified the novel ME3 locus on chromosome 11 (P  =  2.18 × 10-8) at genome-wide significance. Neither locus was associated with FEV1 decline in two additional cohort studies. We confirmed gene expression of IL16, STARD5, and ME3 in multiple lung tissues. Publicly available microarray data confirmed differential expression of all three genes in lung samples from COPD patients compared with controls. Irrespective of genotypes, the combined estimate for FEV1 decline was 26.9, 29.2 and 35.7 mL/year in never, former, and persistent smokers, respectively. Conclusions In this large-scale GWAS, we identified two novel genetic loci in association with the rate of change in FEV1 that harbor candidate genes with biologically plausible functional links to lung function. PMID:24983941

  18. Large-scale genome-wide association studies and meta-analyses of longitudinal change in adult lung function.

    Directory of Open Access Journals (Sweden)

    Wenbo Tang

    Full Text Available Genome-wide association studies (GWAS have identified numerous loci influencing cross-sectional lung function, but less is known about genes influencing longitudinal change in lung function.We performed GWAS of the rate of change in forced expiratory volume in the first second (FEV1 in 14 longitudinal, population-based cohort studies comprising 27,249 adults of European ancestry using linear mixed effects model and combined cohort-specific results using fixed effect meta-analysis to identify novel genetic loci associated with longitudinal change in lung function. Gene expression analyses were subsequently performed for identified genetic loci. As a secondary aim, we estimated the mean rate of decline in FEV1 by smoking pattern, irrespective of genotypes, across these 14 studies using meta-analysis.The overall meta-analysis produced suggestive evidence for association at the novel IL16/STARD5/TMC3 locus on chromosome 15 (P  =  5.71 × 10(-7. In addition, meta-analysis using the five cohorts with ≥3 FEV1 measurements per participant identified the novel ME3 locus on chromosome 11 (P  =  2.18 × 10(-8 at genome-wide significance. Neither locus was associated with FEV1 decline in two additional cohort studies. We confirmed gene expression of IL16, STARD5, and ME3 in multiple lung tissues. Publicly available microarray data confirmed differential expression of all three genes in lung samples from COPD patients compared with controls. Irrespective of genotypes, the combined estimate for FEV1 decline was 26.9, 29.2 and 35.7 mL/year in never, former, and persistent smokers, respectively.In this large-scale GWAS, we identified two novel genetic loci in association with the rate of change in FEV1 that harbor candidate genes with biologically plausible functional links to lung function.

  19. Association between atherosclerosis and female lung cancer--a Danish cohort study

    DEFF Research Database (Denmark)

    Dreyer, Lene; Prescott, Eva; Gyntelberg, Finn

    2003-01-01

    identified 2261 1-year survivors of atherosclerotic diseases through 1977 and 1993, while 26150 of the study subjects had no record of an atherosclerotic diagnosis. After linkage to the Danish Cancer Registry associations between atherosclerosis and cancer were analysed for each sex separately by means...... risk of male lung cancer, RR=1.12 (95% CI: 0.77-1.64), or other smoking-related cancers in either sex was observed after multivariate adjustment. Atherosclerosis did not predict non-smoking-related cancers in general in either men, RR=0.91 (95% CI 0.69-1.20), or women, RR=0.93 (95% CI: 0.64-1.35). We...

  20. Tumor-Derived CXCL1 Promotes Lung Cancer Growth via Recruitment of Tumor-Associated Neutrophils

    Directory of Open Access Journals (Sweden)

    Ming Yuan

    2016-01-01

    Full Text Available Neutrophils have a traditional role in inflammatory process and act as the first line of defense against infections. Although their contribution to tumorigenesis and progression is still controversial, accumulating evidence recently has demonstrated that tumor-associated neutrophils (TANs play a key role in multiple aspects of cancer biology. Here, we detected that chemokine CXCL1 was dramatically elevated in serum from 3LL tumor-bearing mice. In vitro, 3LL cells constitutively expressed and secreted higher level of CXCL1. Furthermore, knocking down CXCL1 expression in 3LL cells significantly hindered tumor growth by inhibiting recruitment of neutrophils from peripheral blood into tumor tissues. Additionally, tumor-infiltrated neutrophils expressed higher levels of MPO and Fas/FasL, which may be involved in TAN-mediated inhibition of CD4+ and CD8+ T cells. These results demonstrate that tumor-derived CXCL1 contributes to TANs infiltration in lung cancer which promotes tumor growth.

  1. Association of GWAS-identified lung cancer susceptibility loci with survival length in patients with small-cell lung cancer treated with platinum-based chemotherapy.

    Directory of Open Access Journals (Sweden)

    Dong Li

    Full Text Available Genetic variants have been shown to affect length of survival in cancer patients. This study explored the association between lung cancer susceptibility loci tagged by single-nucleotide polymorphisms (SNPs identified in the genome-wide association studies and length of survival in small-cell lung cancer (SCLC. Eighteen SNPs were genotyped among 874 SCLC patients and Cox proportional hazards regression was used to examine the effects of genotype on survival length under an additive model with age, sex, smoking status and clinical stage as covariates. We identified 3 loci, 20q13.2 (rs4809957G >A, 22q12.2 (rs36600C >T and 5p15.33 (rs401681C >T, significantly associated with the survival time of SCLC patients. The adjusted hazard ratio (HR for patients with the rs4809957 GA or AA genotype was 0.80 (95% CI, 0.66-0.96; P = 0.0187 and 0.73 (95% CI, 0.55-0.96; P = 0.0263 compared with the GG genotype. Using the dominant model, the adjusted HR for patients carrying at least one T allele at rs36600 or rs401681 was 0.78 (95% CI, 0.63-0.96; P = 0.0199 and 1.29 (95% CI, 1.08-1.55; P = 0.0047, respectively, compared with the CC genotype. Stratification analyses showed that the significant associations of these 3 loci were only seen in smokers and male patients. The rs4809957 SNP was only significantly associated with length of survival of patients with extensive-stage but not limited-stage tumor. These results suggest that some of the lung cancer susceptibility loci might also affect the prognosis of SCLC.

  2. Lys751Gln polymorphism in ERCC2 gene is associated with lung cancer susceptibility in the Chinese population

    Institute of Scientific and Technical Information of China (English)

    Liang Geyu; Pu Yuepu; Yin Lihong

    2007-01-01

    The excision repair cross-complementing group 2 (ERCC2) gene encodes a DNA repair protein, which is absolutely necessary in nucleotide excision repair. A polymorphism in codon 751 that induces a Lys→Gln substitution has been suggested to reduce the DNA repair capacity. Therefore, we conducted a matched case-control study to investigate the role of ERCC2 Lys751Gln polymorphism in the development of lung cancer in the Chinese population. The genotype of ERCC2 gene was analyzed by di-allele-specific-amplification with artificially modified primers (diASA-AMP) in 200 original lung cancer cases and 200 controls. The results showed that carriers of Lys/Gln and Gln/Gln genotypes had a 3.32-fold higher risk of lung cancer compared with carriers of Lys/Lys genotype. Furthermore,the mutant genotype of 751Gln allele was found to be associated with an increased risk in both lung squamous cell carcinoma and lung adenocarcinoma. However, no significant interaction between 751Gln variants and smoking was observed after stratifying according to the smoking status in this study. The results suggest that the Lys751Gln polymorphism in ERCC2 gene is a potential biomarker for susceptibility of lung cancer in the Chinese population.

  3. Association between cooking oil fume exposure and lung cancer among Chinese nonsmoking women: a meta-analysis.

    Science.gov (United States)

    Xue, Yingbo; Jiang, Ying; Jin, Shan; Li, Yong

    2016-01-01

    Lung cancer has been the main cause of cancer death around the world. Cigarette smoking has been identified as a risk factor for lung cancer in males. However, the etiological factors in nonsmoking women remain elusive. A meta-analysis was conducted to evaluate the relationship between cooking oil fume exposure and lung cancer among Chinese nonsmoking women. Thirteen articles containing three population-based case-control and ten hospital-based case-control studies were included in this meta-analysis. These studies with a total of 3,596 lung cancer women and 6,082 healthy controls were analyzed by RevMan 5.3. Fixed effects model or random effects model was used to obtain pooled estimates of risk ratio. The risk ratios with a 95% CI were 1.74 (95% CI =1.57-1.94) and 2.11 (95% CI =1.54-2.89), respectively. Cooking oil fume exposure as well as not using a kitchen ventilator when cooking was significantly associated with lung cancer among nonsmoking women (Z=10.07, P<0.00001; Z=4.65, P<0.00001). Cooking oil fume exposure, especially lacking a fume extractor, may increase the risk of lung cancer among Chinese nonsmoking women. PMID:27284248

  4. Treatment of rheumatoid arthritis-associated interstitial lung disease: a perspective review.

    Science.gov (United States)

    Iqbal, Kundan; Kelly, Clive

    2015-12-01

    Rheumatoid arthritis (RA) is a systemic autoimmune disease affecting 0.5-1% of the worldwide population. Whilst predominantly causing chronic pain and inflammation in synovial joints, it is also associated with significant extra-articular manifestations in a large proportion of patients. Among the various pulmonary manifestations, interstitial lung disease (ILD), a progressive fibrotic disease of the lung parenchyma, is the commonest and most important, contributing significantly to increased morbidity and mortality. The most frequent patterns of RA-associated ILD (RA-ILD) are usual interstitial pneumonia and nonspecific interstitial pneumonia. New insights during the past several years have highlighted the epidemiological impact of RA-ILD and have begun to identify factors contributing to its pathogenesis. Risk factors include smoking, male sex, human leukocyte antigen haplotype, rheumatoid factor and anticyclic citrullinated protein antibodies (ACPAs). Combined with clinical information, chest examination and pulmonary function testing, high-resolution computed tomography of the chest forms the basis of investigation and allows assessment of subtype and disease extent. The management of RA-ILD is a challenge. Several therapeutic agents have been suggested in the literature but as yet no large randomized controlled trials have been undertaken to guide clinical management. Therapy is further complicated by commonly prescribed drugs of proven articular benefit such as methotrexate, leflunomide (LEF) and anti-tumour necrosis factor α agents having been implicated in both ex novo occurrence and acceleration of existing ILD. Agents that offer promise include immunomodulators such as mycophenolate and rituximab as well as newly studied antifibrotic agents. In this review, we discuss the current literature to evaluate recommendations for the management of RA-ILD and discuss key gaps in our knowledge of this important disease.

  5. Association of TERT Polymorphisms with Clinical Outcome of Non-Small Cell Lung Cancer Patients.

    Directory of Open Access Journals (Sweden)

    Xueying Zhao

    Full Text Available TERT is of great importance in cancer initiation and progression. Many studies have demonstrated the TERT polymorphisms as risk factors for many cancer types, including lung cancer. However, the impacts of TERT variants on cancer progression and treatment efficacy have remained controversial. This study aimed to investigate the association of TERT polymorphisms with clinical outcome of advanced non-small cell lung cancer (NSCLC patients receiving first-line platinum-based chemotherapy, including response rate, clinical benefit, progression-free survival (PFS, overall survival (OS, and grade 3 or 4 toxicity. Seven polymorphisms of TERT were assessed, and a total of 1004 inoperable advanced NSCLC patients treated with platinum-based chemotherapy were enrolled. It is exhibited that the variant heterozygote of rs4975605 showed significant association with a low rate of clinical benefit, and displayed a much stronger effect in never-smoking female subset, leading to the clinical benefit rate decreased from 82.9% (C/C genotype to 56.4% (C/A genotype; adjusted OR, 3.58; P=1.40×10(-4. It is also observed that the polymorphism rs2736109 showed significant correlation with PFS (log-rank P=0.023. In age > 58 subgroup, patients carrying the heterozygous genotype had a longer median PFS than those carrying the wild-type genotypes (P=0.002. The results from the current study, for the first time to our knowledge, provide suggestive evidence of an effect of TERT polymorphisms on disease progression variability among Chinese patients with platinum-treated advanced NSCLC.

  6. A genome-wide association search for type 2 diabetes genes in African Americans.

    Directory of Open Access Journals (Sweden)

    Nicholette D Palmer

    Full Text Available African Americans are disproportionately affected by type 2 diabetes (T2DM yet few studies have examined T2DM using genome-wide association approaches in this ethnicity. The aim of this study was to identify genes associated with T2DM in the African American population. We performed a Genome Wide Association Study (GWAS using the Affymetrix 6.0 array in 965 African-American cases with T2DM and end-stage renal disease (T2DM-ESRD and 1029 population-based controls. The most significant SNPs (n = 550 independent loci were genotyped in a replication cohort and 122 SNPs (n = 98 independent loci were further tested through genotyping three additional validation cohorts followed by meta-analysis in all five cohorts totaling 3,132 cases and 3,317 controls. Twelve SNPs had evidence of association in the GWAS (P<0.0071, were directionally consistent in the Replication cohort and were associated with T2DM in subjects without nephropathy (P<0.05. Meta-analysis in all cases and controls revealed a single SNP reaching genome-wide significance (P<2.5×10(-8. SNP rs7560163 (P = 7.0×10(-9, OR (95% CI = 0.75 (0.67-0.84 is located intergenically between RND3 and RBM43. Four additional loci (rs7542900, rs4659485, rs2722769 and rs7107217 were associated with T2DM (P<0.05 and reached more nominal levels of significance (P<2.5×10(-5 in the overall analysis and may represent novel loci that contribute to T2DM. We have identified novel T2DM-susceptibility variants in the African-American population. Notably, T2DM risk was associated with the major allele and implies an interesting genetic architecture in this population. These results suggest that multiple loci underlie T2DM susceptibility in the African-American population and that these loci are distinct from those identified in other ethnic populations.

  7. Genetic variants associated with longer telomere length are associated with increased lung cancer risk among never-smoking women in Asia : a report from the female lung cancer consortium in Asia

    NARCIS (Netherlands)

    Machiela, Mitchell J; Hsiung, Chao Agnes; Shu, Xiao-Ou; Seow, Wei Jie; Wang, Zhaoming; Matsuo, Keitaro; Hong, Yun-Chul; Seow, Adeline; Wu, Chen; Hosgood, H Dean; Chen, Kexin; Wang, Jiu-Cun; Wen, Wanqing; Cawthon, Richard; Chatterjee, Nilanjan; Hu, Wei; Caporaso, Neil E; Park, Jae Yong; Chen, Chien-Jen; Kim, Yeul Hong; Kim, Young Tae; Landi, Maria Teresa; Shen, Hongbing; Lawrence, Charles; Burdett, Laurie; Yeager, Meredith; Chang, I-Shou; Mitsudomi, Tetsuya; Kim, Hee Nam; Chang, Gee-Chen; Bassig, Bryan A; Tucker, Margaret; Wei, Fusheng; Yin, Zhihua; An, She-Juan; Qian, Biyun; Lee, Victor Ho Fun; Lu, Daru; Liu, Jianjun; Jeon, Hyo-Sung; Hsiao, Chin-Fu; Sung, Jae Sook; Kim, Jin Hee; Gao, Yu-Tang; Tsai, Ying-Huang; Jung, Yoo Jin; Guo, Huan; Hu, Zhibin; Hutchinson, Amy; Wang, Wen-Chang; Klein, Robert J; Chung, Charles C; Oh, In-Jae; Chen, Kuan-Yu; Berndt, Sonja I; Wu, Wei; Chang, Jiang; Zhang, Xu-Chao; Huang, Ming-Shyan; Zheng, Hong; Wang, Junwen; Zhao, Xueying; Li, Yuqing; Choi, Jin Eun; Su, Wu-Chou; Park, Kyong Hwa; Sung, Sook Whan; Chen, Yuh-Min; Liu, Li; Kang, Chang Hyun; Hu, Lingmin; Chen, Chung-Hsing; Pao, William; Kim, Young-Chul; Yang, Tsung-Ying; Xu, Jun; Guan, Peng; Tan, Wen; Su, Jian; Wang, Chih-Liang; Li, Haixin; Sihoe, Alan Dart Loon; Zhao, Zhenhong; Chen, Ying; Choi, Yi Young; Hung, Jen-Yu; Kim, Jun Suk; Yoon, Ho-Il; Cai, Qiuyin; Lin, Chien-Chung; Park, In Kyu; Xu, Ping; Dong, Jing; Kim, Christopher; He, Qincheng; Perng, Reury-Perng; Kohno, Takashi; Kweon, Sun-Seog; Chen, Chih-Yi; Vermeulen, Roel C H; Wu, Junjie; Lim, Wei-Yen; Chen, Kun-Chieh; Chow, Wong-Ho; Ji, Bu-Tian; Chan, John K C; Chu, Minjie; Li, Yao-Jen; Yokota, Jun; Li, Jihua; Chen, Hongyan; Xiang, Yong-Bing; Yu, Chong-Jen; Kunitoh, Hideo; Wu, Guoping; Jin, Li; Lo, Yen-Li; Shiraishi, Kouya; Chen, Ying-Hsiang; Lin, Hsien-Chih; Wu, Tangchun; Wong, Maria Pik; Wu, Yi-Long; Yang, Pan-Chyr; Zhou, Baosen; Shin, Min-Ho; Fraumeni, Joseph F; Zheng, Wei; Lin, Dongxin; Chanock, Stephen J; Rothman, Nathaniel; Lan, Qing

    2015-01-01

    Recent evidence from several relatively small nested case-control studies in prospective cohorts shows an association between longer telomere length measured phenotypically in peripheral white blood cell (WBC) DNA and increased lung cancer risk. We sought to further explore this relationship by exam

  8. Delegation of China-Latin America Friendship Association Visits Four Latin American Countries

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    <正>Cheng Siwei,former Vice Chairman of the Standing Committee of the National People’s Congress and President of the China -Latin America Friendship Association (CLAFA),led a CLAFA delegation on a visit to four Central and South American countries from October 25 to November 11,2009 during which they met national leaders and other influential persons in the fields of foreign and cul-

  9. How Planners Deal with Uncomfortable Knowledge: The Dubious Ethics of the American Planning Association

    OpenAIRE

    Bent Flyvbjerg

    2013-01-01

    With a point of departure in the concept "uncomfortable knowledge," this article presents a case study of how the American Planning Association (APA) deals with such knowledge. APA was found to actively suppress publicity of malpractice concerns and bad planning in order to sustain a boosterish image of planning. In the process, APA appeared to disregard and violate APA's own Code of Ethics. APA justified its actions with a need to protect APA members' interests, seen as preventing planning a...

  10. Multi-modality Imaging: Bird's eye view from the 2015 American Heart Association Scientific Sessions.

    Science.gov (United States)

    Einstein, Andrew J; Lloyd, Steven G; Chaudhry, Farooq A; AlJaroudi, Wael A; Hage, Fadi G

    2016-04-01

    Multiple novel studies were presented at the 2015 American Heart Association Scientific Sessions which was considered a successful conference at many levels. In this review, we will summarize key studies in nuclear cardiology, cardiac magnetic resonance, echocardiography, and cardiac computed tomography that were presented at the Sessions. We hope that this bird's eye view will keep readers updated on the newest imaging studies presented at the meeting whether or not they were able to attend the meeting.

  11. The Policy Views of American Economic Association Members: The Results of a New Survey

    OpenAIRE

    Robert Whaples

    2009-01-01

    This article presents the results of a 2007 policy-views survey of a random sample of members of the American Economic Association. The new survey contains questions about many policy issues not treated by previous surveys. The questions treat such issues as trade restrictions, social insurance for those put out of work by international competition, genetically modified foods, curbside recycling, health insurance (several questions), medical malpractice, barriers to entering the medical profe...

  12. Genome-wide association study of age at menarche in African-American women

    OpenAIRE

    Demerath, Ellen W; Liu, Ching-Ti; Franceschini, Nora; Chen, Gary; Palmer, Julie R.; Smith, Erin N.; Chen, Christina T. L.; Ambrosone, Christine B.; Arnold, Alice M.; Bandera, Elisa V.; Berenson, Gerald S.; Bernstein, Leslie; Britton, Angela; Cappola, Anne R.; Carlson, Christopher S.

    2013-01-01

    African-American (AA) women have earlier menarche on average than women of European ancestry (EA), and earlier menarche is a risk factor for obesity and type 2 diabetes among other chronic diseases. Identification of common genetic variants associated with age at menarche has a potential value in pointing to the genetic pathways underlying chronic disease risk, yet comprehensive genome-wide studies of age at menarche are lacking for AA women. In this study, we tested the genome-wide associati...

  13. Cardiac Arrest in Pregnancy: A Scientific Statement From the American Heart Association.

    Science.gov (United States)

    Jeejeebhoy, Farida M; Zelop, Carolyn M; Lipman, Steve; Carvalho, Brendan; Joglar, Jose; Mhyre, Jill M; Katz, Vern L; Lapinsky, Stephen E; Einav, Sharon; Warnes, Carole A; Page, Richard L; Griffin, Russell E; Jain, Amish; Dainty, Katie N; Arafeh, Julie; Windrim, Rory; Koren, Gideon; Callaway, Clifton W

    2015-11-01

    This is the first scientific statement from the American Heart Association on maternal resuscitation. This document will provide readers with up-to-date and comprehensive information, guidelines, and recommendations for all aspects of maternal resuscitation. Maternal resuscitation is an acute event that involves many subspecialties and allied health providers; this document will be relevant to all healthcare providers who are involved in resuscitation and specifically maternal resuscitation.

  14. Clinical analysis of interstitial lung disease associated with lung cancer%间质性肺病合并肺癌的临床分析

    Institute of Scientific and Technical Information of China (English)

    陈美芳; 施举红; 刘鸿瑞; 许文兵; 肖毅

    2013-01-01

    目的 探讨间质性肺病合并肺癌患者的临床特点,以提高临床诊治水平.方法 对8例经病理确诊的间质性肺病合并肺癌患者的临床表现、影像学、病理进行分析,治疗后随访.结果 8例患者中男性6例,女性2例,6例有吸烟史,中位年龄64岁.主要临床症状为咯血、刺激性于咳、咳大量泡沫痰、胸闷气短加重.3例有免疫学指标阳性.影像学表现为沿胸膜下分布为主的细网格及蜂窝肺,伴肺内结节.间质性肺病类型为非特异性间质性肺炎及寻常型间质性肺炎;肺癌以腺癌为主.2例ANCA阳性的患者给予糖皮质激素治疗;5例患者行肺癌根治术,其中3例患者无法耐受术后化疗,2例患者术后给予辅助化疗,1例行单纯化疗后出现重度骨髓抑制死亡.另2例患者放弃进一步治疗,分别于确诊后8个月及10个月死亡.结论 间质性肺炎合并肺癌起病隐匿,容易误诊、漏诊,临床应引起高度重视.%Objective To investigate the clinical features of interstitial lung disease associated with lung cancer.Methods The clinical manifestations,chest radiography,and pathology of eight interstitial lung disease associated with lung cancer patients were analyzed.All cases were followed up after treatment.Results The patients included six males and two females,six cases had history of smoking,three cases had positive immunological markers.The main clinical symptoms were hemoptysis,dry cough,frothy sputum,and shortness of breath.The pathological types of interstitial lung disease were usual interstitial pneumonia and nonspecific interstitial pneumonia.The pathological type of lung cancer was mainly adenocarcinoma.Five cases were treated with radical resection,three cases of them were unable to tolerate postoperative chemotherapy,two cases of them were given adjuvant chemotherapy.One case was died of severe bone marrow suppression after chemotherapy.The other two cases abandoned further treatment and died at

  15. Genome-wide association study identifies novel loci association with fasting insulin and insulin resistance in African Americans.

    Science.gov (United States)

    Chen, Guanjie; Bentley, Amy; Adeyemo, Adebowale; Shriner, Daniel; Zhou, Jie; Doumatey, Ayo; Huang, Hanxia; Ramos, Edward; Erdos, Michael; Gerry, Norman; Herbert, Alan; Christman, Michael; Rotimi, Charles

    2012-10-15

    Insulin resistance (IR) is a key determinant of type 2 diabetes (T2D) and other metabolic disorders. This genome-wide association study (GWAS) was designed to shed light on the genetic basis of fasting insulin (FI) and IR in 927 non-diabetic African Americans. 5 396 838 single-nucleotide polymorphisms (SNPs) were tested for associations with FI or IR with adjustments for age, sex, body mass index, hypertension status and first two principal components. Genotyped SNPs (n = 12) with P KLF14 and PPARG) which exert their action via IR. In summary, variants in/near SC4MOL, and TCERG1L were associated with FI and IR in this cohort of African Americans and were replicated in West Africans. SC4MOL is under-expressed in an animal model of T2D and plays a key role in lipid biosynthesis, with implications for the regulation of energy metabolism, obesity and dyslipidemia. TCERG1L is associated with plasma adiponectin, a key modulator of obesity, inflammation, IR and diabetes. PMID:22791750

  16. Target Therapy in Lung Cancer.

    Science.gov (United States)

    Cafarotti, Stefano; Lococo, Filippo; Froesh, Patrizia; Zappa, Francesco; Andrè, Dutly

    2016-01-01

    Lung cancer is an extremely heterogeneous disease, with well over 50 different histological variants recognized under the fourth revision of the World Health Organization (WHO) typing system. Because these variants have differing genetic and biological properties correct classification of lung cancer is necessary to assure that lung cancer patients receive optimum management. Due to the recent understanding that histologic typing and EGFR mutation status are important for target the therapy in lung adenocarcinoma patients there was a great need for a new classification that addresses diagnostic issues and strategic management to allow for molecular testing in small biopsy and cytology specimens. For this reason and in order to address advances in lung cancer treatment an international multidisciplinary classification was proposed by the International Association for the Study of Lung Cancer (IASLC), American Thoracic Society (ATS), and European Respiratory Society (ERS), further increasing the histological heterogeneity and improving the existing WHO-classification. Is now the beginning of personalized therapy era that is ideally finalized to treat each individual case of lung cancer in different way. PMID:26667341

  17. Circulating alpha1-antitrypsin in the general population: Determinants and association with lung function

    Directory of Open Access Journals (Sweden)

    Berger Wolfgang

    2008-04-01

    Full Text Available Abstract Background Severe alpha1-antitrypsin (AAT deficiency associated with low AAT blood concentrations is an established genetic COPD risk factor. Less is known about the respiratory health impact of variation in AAT serum concentrations in the general population. We cross-sectionally investigated correlates of circulating AAT concentrations and its association with FEV1. Methods In 5187 adults (2669 females with high-sensitive c-reactive protein (CRP levels ≤ 10 mg/l from the population-based Swiss SAPALDIA cohort, blood was collected at the time of follow-up examination for measuring serum AAT and CRP. Results Female gender, hormone intake, systolic blood pressure, age in men and in postmenopausal women, as well as active and passive smoking were positively, whereas alcohol intake and BMI inversely correlated with serum AAT levels, independent of CRP adjustment. We observed an inverse association of AAT with FEV1 in the total study population (p Conclusion The results of this population-based study reflect a complex interrelationship between tobacco exposure, gender related factors, circulating AAT, systemic inflammatory status and lung function.

  18. The human mineral dust-induced gene, mdig, is a cell growth regulating gene associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Y.D.; Lu, Y.J.; Yuan, B.Z.; Castranova, V.; Shi, X.L.; Stauffer, J.L.; Demers, L.M.; Chen, F. [NIOSH, Morgantown, WV (US). Health Effects Laboratory Division

    2005-07-21

    Environmental or occupational exposure to mineral dusts, mainly silica and asbestos, is associated with an increased incidence of lung inflammation, fibrosis, and/or cancer. To better understand the molecular events associated with these pulmonary diseases, we attempted to identify genes that are regulated by mineral dusts. Using a differential display reverse transcription polymerase chain reaction technique and mRNAs of alveolar macrophages from both normal individuals and coal miners, we identified a novel mineral dust-induced gene named mdig, which had not been fully characterized. The expression of mdig mRNA was detected in alveolar macrophages from coal miners but not from normal subjects. The inducible expression of mdig could be observed in A549 cells exposed to silica particles in a time-dependent manner. The full-length mdig mRNA was expressed in human lung cancer tissues but was barely detectable in the adjacent normal tissues. In addition, a number of lung cancer cell lines constitutively express mdig. Alternative spliced transcripts of mdig were detected in some lung cancer cell lines. Silencing mdig mRNA expression in A549 lung cancer cells by siRNA-mediated RNA interference inhibits cell proliferation and sensitizes the cells to silica-induced cytotoxicity. These results suggest that the mdig gene may be involved in the regulation of cell growth and possibly the development of cancer.

  19. Genome-wide association studies of the PR interval in African Americans.

    Directory of Open Access Journals (Sweden)

    J Gustav Smith

    Full Text Available The PR interval on the electrocardiogram reflects atrial and atrioventricular nodal conduction time. The PR interval is heritable, provides important information about arrhythmia risk, and has been suggested to differ among human races. Genome-wide association (GWA studies have identified common genetic determinants of the PR interval in individuals of European and Asian ancestry, but there is a general paucity of GWA studies in individuals of African ancestry. We performed GWA studies in African American individuals from four cohorts (n = 6,247 to identify genetic variants associated with PR interval duration. Genotyping was performed using the Affymetrix 6.0 microarray. Imputation was performed for 2.8 million single nucleotide polymorphisms (SNPs using combined YRI and CEU HapMap phase II panels. We observed a strong signal (rs3922844 within the gene encoding the cardiac sodium channel (SCN5A with genome-wide significant association (p<2.5 x 10⁻⁸ in two of the four cohorts and in the meta-analysis. The signal explained 2% of PR interval variability in African Americans (beta  = 5.1 msec per minor allele, 95% CI  = 4.1-6.1, p = 3 x 10⁻²³. This SNP was also associated with PR interval (beta = 2.4 msec per minor allele, 95% CI = 1.8-3.0, p = 3 x 10⁻¹⁶ in individuals of European ancestry (n = 14,042, but with a smaller effect size (p for heterogeneity <0.001 and variability explained (0.5%. Further meta-analysis of the four cohorts identified genome-wide significant associations with SNPs in SCN10A (rs6798015, MEIS1 (rs10865355, and TBX5 (rs7312625 that were highly correlated with SNPs identified in European and Asian GWA studies. African ancestry was associated with increased PR duration (13.3 msec, p = 0.009 in one but not the other three cohorts. Our findings demonstrate the relevance of common variants to African Americans at four loci previously associated with PR interval in European and

  20. Lung cancer in Hodgkin's disease: association with previous radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    List, A.F.; Doll, D.C.; Greco, F.A.

    1985-02-01

    Seven cases of lung cancer were observed in patients with Hodgkin's disease (HD) since 1970. The risk ratio for the development of lung cancer among HD patients was 5.6 times that expected in the general population. The pertinent clinical data from these patients are described and compared to 28 additional patients reported from other institutions. Small-cell lung cancer represented the predominant histologic type of lung cancer encountered in both smoking and nonsmoking patients with HD, accounting for 42% of cases overall and greater than 55% of cases reported in reviews of second malignancies. Tobacco use was noted in only 53% of patients. Twenty-eight (94%) of 30 patients developing metachronous lung cancer received supradiaphragmatic irradiation as primary therapy for HD. Nineteen (68%) of these patients received subsequent chemotherapy salvage. The median age at diagnosis of HD and lung cancer was 39 and 45 years, respectively. The interval between diagnosis of HD and metachronous lung cancer averaged seven years but appeared to vary inversely with age. HD patients treated with supradiaphragmatic irradiation or combined modality therapy may be at increased risk for developing lung cancer. The high frequency of in-field malignancies that the authors observed and the prevalence of small-cell lung cancer in both smoking and nonsmoking patients suggests that chest irradiation may influence the development of metachronous lung cancer in these patients. The finding of a mean latent interval in excess of seven years emphasizes the need for close long-term observation.

  1. The Association of Academic Health Sciences Libraries' collaboration with the Association of American Medical Colleges, Medical Library Association, and other organizations.

    Science.gov (United States)

    Jenkins, Carol G; Bader, Shelley A

    2003-04-01

    The Association of Academic Health Sciences Libraries has made collaboration with other organizations a fundamental success strategy throughout its twenty-five year history. From the beginning its relationships with Association of American Medical Colleges and with the Medical Library Association have shaped its mission and influenced its success at promoting academic health sciences libraries' roles in their institutions. This article describes and evaluates those relationships. It also describes evolving relationships with other organizations including the National Library of Medicine and the Association of Research Libraries.

  2. Fatal interstitial lung disease associated with high erlotinib and metabolite levels. A case report and a review of the literature.

    NARCIS (Netherlands)

    Heine, R. ter; Bosch, R.T. van den; Schaefer-Prokop, C.M.; Lankheet, N.A.; Beijnen, J.H.; Staaks, G.H.; Westerlaken, M.M. van der; Malingre, M.M.; Brand, J.J. van den

    2012-01-01

    INTRODUCTION: Erlotinib is an agent in the class of oral epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors. Although this class of agents is considered to be relatively safe, the most serious, but rare, adverse reaction is drug-associated interstitial lung disease (ILD). This potent

  3. Living near a Major Road in Beijing: Association with Lower Lung Function, Airway Acidification, and Chronic Cough

    Directory of Open Access Journals (Sweden)

    Zhan-Wei Hu

    2016-01-01

    Conclusions: Long-term exposure to traffic-related air pollution in people who live near major roads in Beijing is associated with lower lung function, airway acidification, and a higher prevalence of chronic cough. EBC pH is a potential useful biomarker for evaluating air pollution exposure.

  4. The 15q24/25 Susceptibility Variant for Lung Cancer and Chronic Obstructive Pulmonary Disease Is Associated with Emphysema

    NARCIS (Netherlands)

    Lambrechts, Diether; Buysschaert, Ian; Zanen, Pieter; Coolen, Johan; Lays, Natacha; Cuppens, Harry; Groen, Harry J. M.; Dewever, Walter; van Klaveren, Rob J.; Verschakelen, Johny; Wijmenga, Cisca; Postma, Dirkje S.; Decramer, Marc; Janssens, Wim

    2010-01-01

    Rationale: Genome-wide association studies have identified genetic variants in the nicotinic acetylcholine receptor (nAChR) on chromosome 15q24/25 as a risk for nicotine dependence, lung cancer, and chronic obstructive pulmonary disease (COPD). Assessment of bronchial obstruction by spirometry, typi

  5. Prospective associations of coronary heart disease loci in African Americans using the MetaboChip : The PAGE study

    NARCIS (Netherlands)

    N. Franceschini (Nora); Hu, Y. (Yijuan); A. Reiner (Alexander); Buyske, S. (Steven); M.A. Nalls (Michael); L.R. Yanek (Lisa); Y. Li (Yun); Hindorff, L.A. (Lucia A.); Cole, S.A. (Shelley A.); Howard, B.V. (Barbara V.); Stafford, J.M. (Jeanette M.); C. Carty (Cara); P. Sethupathy (Praveen); Martin, L.W. (Lisa W.); D.Y. Lin (Dan); Johnson, K.C. (Karen C.); L.C. Becker (Lewis); K.E. North (Kari); A. Dehghan (Abbas); J.C. Bis (Joshua); Y. Liu (Yongmei); P. Greenland (Philip); J.E. Manson (Joann); Maeda, N. (Nobuyo); M.E. Garcia (M.); T.B. Harris (Tamara); D.M. Becker (Diane); C.J. O'Donnell (Christopher); G. Heiss (Gerardo); Kooperberg, C. (Charles); E. Boerwinkle (Eric)

    2014-01-01

    textabstractBackground: Coronary heart disease (CHD) is a leading cause of morbidity and mortality in African Americans. However, there is a paucity of studies assessing genetic determinants of CHD in African Americans. We examined the association of published variants in CHD loci with incident CHD,

  6. An Analysis of Independent, Non-Academic Characteristics of Chinese and American Business Students Associated with Emotional Intelligence

    Science.gov (United States)

    Margavio, Thomas M.; Margavio, Geanie W.; Hignite, Michael A.; Moses, Duane R.

    2014-01-01

    In a continuation of their prior research which focused on the differences in Emotional Intelligence (EI) levels between Chinese and American business students and the academic variables associated with those scores, the authors extend their efforts to investigate those personal (non-academic) characteristics of both American and Chinese business…

  7. Up-to-Date Information on Rheumatoid Arthritis-Associated Interstitial Lung Disease.

    Science.gov (United States)

    Suda, Takafumi

    2015-01-01

    Pulmonary involvement is common in rheumatoid arthritis (RA) and affects all the components of the lung. Interstitial lung disease (ILD) is the most predominant pulmonary manifestation and has been identified as the main cause of morbidity and mortality in RA. Clinically significant RA-ILD occurs in approximately 10% of RA patients. Several risk factors, such as old age, male gender, and smoking, have been reported to date. Histologically, the proportion of the usual interstitial pneumonia (UIP) pattern is higher in RA-ILD than in ILD associated with other connective tissue diseases, and RA-ILD also shows nonspecific interstitial pneumonia and organizing pneumonia patterns. High-resolution computed tomography scans are highly predictive of the histological UIP pattern with a specificity of 96%-100%. Acute exacerbation, which is the acute deterioration of the respiratory status characterized by newly developed bilateral infiltrates with unknown etiologies, has been reported in RA-ILD. Although acute exacerbation of RA-ILD has high mortality, similar to that of idiopathic pulmonary fibrosis, its incidence is lower in RA-ILD than in idiopathic pulmonary fibrosis. A consensus treatment has not yet been established. Current therapeutic regimens typically include corticosteroids with or without cytotoxic agents. Recent large longitudinal studies reported that the prognosis of RA-ILD was poor with a median survival of 2.6-3.0 years. Furthermore, histological and/or radiological patterns, such as UIP or non-UIP, have significant prognostic implications. RA-ILD patients with histological or radiological UIP patterns have poorer prognoses than those with non-UIP patterns. This review assessed the characteristics of RA-ILD by overviewing recent studies in the field and focused on the clinical significance of histological and/or radiological patterns in RA-ILD.

  8. Optimal management of interstitial lung disease associated with dermatomyositis/polymyositis: lessons from the Japanese experience

    Directory of Open Access Journals (Sweden)

    Kurasawa K

    2014-11-01

    Full Text Available Kazuhiro Kurasawa,1,2 Satoko Arai2 1Center of Rheumatic Diseases, Dokkyo Medical University, Mibu, Tochigi, Japan; 2Department of Clinical Immunology, Dokkyo Medical University, Mibu, Tochigi, Japan Abstract: Interstitial lung disease (ILD is a serious complication in dermatomyositis (DM and polymyositis (PM. In Japan, patients with DM/PM develop acute life-threatening ILD with high frequency. Physicians in Japan have shown the following: refractory acute/subacute (A/S-ILD is not a rare complication in DM and amyopathic DM (ADM; anti-anti-melanoma differentiation-associated gene 5 (anti-MDA5 antibody (Ab is closely related to A/S-ILD with poor outcomes in DM/ADM; and poor prognostic factors in A/S-ILD in DM/PM are ADM, DM with low creatine kinase elevation, positivity for anti-MDA5 Ab, serum ferritin elevation, and consolidation with ground-glass opacities on high-resolution computed tomography. There are subtypes in DM/PM-ILD: refractory DM/ADM A/S-ILD positive for anti-MDA5 Ab with poor prognosis; DM A/S-ILD with glucocorticoid (GC resistance; PM A/S-ILD with GC sensitivity; chronic ILD positive for anti-aminoacyl-tRNA-synthetases (anti-ARS Abs with GC responsiveness; and C-ILD negative for anti-ARS Abs. For patients with A/S-ILD with poor prognosis, initial combination therapy with cyclosporine and cyclophosphamide in addition to GC has been developed, which rescues 50%–80% of the patients, although elucidation of the efficacy of the combination therapy is required. A/S-ILD with potentially fatal outcomes is found worldwide, not only in Japan. Clinicians caring for patients with DM/PM should be cautious when dealing with A/S-ILD and treat the patients based on clinical subtypes. Keywords: interstitial lung disease, dermatomyositis, polymyositis, management, cyclosporine, cyclophosphamide

  9. [A case of lymphocytic adenohypophysitis associated with sarcoidosis of the lung and eye].

    Science.gov (United States)

    Tokunaga, T; Shigemori, M; Katayama, M; Kuramoto, S; Hayashi, H; Yamada, K; Nonaka, K; Sasaguri, Y

    1990-02-01

    Lymphocytic adenohypophysitis is considered to be an inflammatory disease of the adenohypophysis that is commonly present with visual disturbance and hypopituitarism. Its etiology remains unclear but it is often related to an autoimmune disorder involving other organs, such as the thyroid, parathyroid, or adrenal glands. We encountered a rare case of lymphocytic adenohypophysitis associated with sarcoidosis of the lung and eye during the follow-up period. A 23-year-old woman was hospitalized in July 1986, with a one-month history of headache and visual disturbances which began three days after her second normal delivery. On admission, she showed slight visual impairment and had a left temporal superior quadrantanopia. Endocrinological evaluation revealed thyroid and adrenal hypofunction, and low response of human growth hormone to the loading test. A skull X-ray showed normal shaped sella with some erosion of the dorsum. CT scan showed a rounded contrast-enhanced intrasellar mass extending into the suprasellar cistern. MRI (SR: 500/30) showed a homogeneous low intensity mass which contained a small high intensity area on the relative T2-weighted image (2000/50). A biopsy was performed via right frontotemporal craniotomy. The consistency of the resected tissue was firmer than that of pituitary adenoma. Histologically, the tissue showed diffuse lymphocytic infiltration with some normal adenohypophysis. Her postoperative course was uneventful and the visual impairment improved two months later after the operation. Six months after the operation, she was readmitted with complaints of general fatigue and breathlessness. Chest X-ray showed diffuse infiltration throughout both lung fields, but there was no bilateral hilar lymphadenopathy.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:2186292

  10. Association between Traffic-Related Black Carbon Exposure and Lung Function among Urban Women

    OpenAIRE

    Suglia, Shakira Franco; Gryparis, Alexandros; Schwartz, Joel David; Wright, Rosalind Jo

    2008-01-01

    Background: Although a number of studies have documented the relationship between lung function and traffic-related pollution among children, few have focused on adult lung function or examined community-based populations. Objective: We examined the relationship between black carbon (BC), a surrogate of traffic-related particles, and lung function among women in the Maternal–Infant Smoking Study of East Boston, an urban cohort in Boston, Massachusetts. Methods: We estimated local BC levels us...

  11. The American Association of Plastic Surgeons Recent History, with a Review of the Past.

    Science.gov (United States)

    Lawrence, W Thomas

    2016-07-01

    The American Association of Plastic Surgeons was founded in 1921 and is the oldest of the plastic surgery societies. It was born out of the enthusiasm of reconstructive surgeons who had recently increased in numbers and expanded the scope of their activities as a result of the challenges posed by battle-injured soldiers during World War I. Early meetings were small, focused exclusively on the head and neck, and often included live surgical demonstrations. The Association has grown in size and scope with time, but it has maintained its academic focus. This article focuses on the most recent 15 years of the Association's history, as prior publications have chronicled the history of the organization up to 2000. The organization has remained robust in the new millennium, with the national meetings being its most prominent activity. The format of the meetings has continually been improved to remain relevant and of interest to the membership and other attendees. The organization continues to support the development of young academic plastic surgeons through the Academic Scholars Program. It has established new programs such as the Constable Fellowship to support international exchange and has also sponsored two consensus conferences to help define standards of care in plastic surgery-related issues. The Association annually recognizes significant contributors to the field through the variety of awards that it bestows as well. The mission of the American Association of Plastic Surgeons is to provide scholarly leadership in plastic surgery, and the organization continues to successfully accomplish this mission. PMID:27348660

  12. Position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine: Nutrition and athletic performance.

    Science.gov (United States)

    Rodriguez, Nancy R; DiMarco, Nancy M; Langley, Susie

    2009-03-01

    It is the position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine that physical activity, athletic performance, and recovery from exercise are enhanced by optimal nutrition. These organizations recommend appropriate selection of foods and fluids, timing of intake, and supplement choices for optimal health and exercise performance. This updated position paper couples a rigorous, systematic, evidence-based analysis of nutrition and performance-specific literature with current scientific data related to energy needs, assessment of body composition, strategies for weight change, nutrient and fluid needs, special nutrient needs during training and competition, the use of supplements and ergogenic aids, nutrition recommendations for vegetarian athletes, and the roles and responsibilities of sports dietitians. Energy and macronutrient needs, especially carbohydrate and protein, must be met during times of high physical activity to maintain body weight, replenish glycogen stores, and provide adequate protein to build and repair tissue. Fat intake should be sufficient to provide the essential fatty acids and fat-soluble vitamins, as well as contribute energy for weight maintenance. Although exercise performance can be affected by body weight and composition, these physical measures should not be a criterion for sports performance and daily weigh-ins are discouraged. Adequate food and fluid should be consumed before, during, and after exercise to help maintain blood glucose concentration during exercise, maximize exercise performance, and improve recovery time. Athletes should be well hydrated before exercise and drink enough fluid during and after exercise to balance fluid losses. Sports beverages containing carbohydrates and electrolytes may be consumed before, during, and after exercise to help maintain blood glucose concentration, provide fuel for muscles, and decrease risk of dehydration and hyponatremia. Vitamin

  13. Position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine: Nutrition and athletic performance.

    Science.gov (United States)

    Rodriguez, Nancy R; DiMarco, Nancy M; Langley, Susie

    2009-03-01

    It is the position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine that physical activity, athletic performance, and recovery from exercise are enhanced by optimal nutrition. These organizations recommend appropriate selection of foods and fluids, timing of intake, and supplement choices for optimal health and exercise performance. This updated position paper couples a rigorous, systematic, evidence-based analysis of nutrition and performance-specific literature with current scientific data related to energy needs, assessment of body composition, strategies for weight change, nutrient and fluid needs, special nutrient needs during training and competition, the use of supplements and ergogenic aids, nutrition recommendations for vegetarian athletes, and the roles and responsibilities of sports dietitians. Energy and macronutrient needs, especially carbohydrate and protein, must be met during times of high physical activity to maintain body weight, replenish glycogen stores, and provide adequate protein to build and repair tissue. Fat intake should be sufficient to provide the essential fatty acids and fat-soluble vitamins, as well as contribute energy for weight maintenance. Although exercise performance can be affected by body weight and composition, these physical measures should not be a criterion for sports performance and daily weigh-ins are discouraged. Adequate food and fluid should be consumed before, during, and after exercise to help maintain blood glucose concentration during exercise, maximize exercise performance, and improve recovery time. Athletes should be well hydrated before exercise and drink enough fluid during and after exercise to balance fluid losses. Sports beverages containing carbohydrates and electrolytes may be consumed before, during, and after exercise to help maintain blood glucose concentration, provide fuel for muscles, and decrease risk of dehydration and hyponatremia. Vitamin

  14. Position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine: Nutrition and athletic performance.

    Science.gov (United States)

    2000-12-01

    It is the position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine that physical activity, athletic performance, and recovery from exercise are enhanced by optimal nutrition. These organizations recommend appropriate selection of food and fluids, timing of intake, and supplement choices for optimal health and exercise performance. This position paper reviews the current scientific data related to the energy needs of athletes, assessment of body composition, strategies for weight change, the nutrient and fluid needs of athletes, special nutrient needs during training, the use of supplements and nutritional ergogenic aids, and the nutrition recommendations for vegetarian athletes. During times of high physical activity, energy and macronutrient needs--especially carbohydrate and protein intake--must be met in order to maintain body weight, replenish glycogen stores, and provide adequate protein for building and repair of tissue. Fat intake should be adequate to provide the essential fatty acids and fat-soluble vitamins, as well as to help provide adequate energy for weight maintenance. Overall, diets should provide moderate amounts of energy from fat (20% to 25% of energy); however, there appears to be no health or performance benefit to consuming a diet containing less than 15% of energy from fat. Body weight and composition can affect exercise performance, but should not be used as the sole criterion for sports performance; daily weigh-ins are discouraged. Consuming adequate food and fluid before, during, and after exercise can help maintain blood glucose during exercise, maximize exercise performance, and improve recovery time. Athletes should be well-hydrated before beginning to exercise; athletes should also drink enough fluid during and after exercise to balance fluid losses. Consumption of sport drinks containing carbohydrates and electrolytes during exercise will provide fuel for the muscles, help

  15. Position of Dietitians of Canada, the American Dietetic Association, and the American College of Sports Medicine: Nutrition and Athletic Performance.

    Science.gov (United States)

    2000-01-01

    It is the position of Dietitians of Canada, the American Dietetic Association, and the American College of Sports Medicine that physical activity, athletic performance, and recovery from exercise are enhanced by optimal nutrition. These organizations recommend appropriate selection of food and fluids, timing of intake, and supplement choices for optimal health and exercise performance. This position paper reviews the current scientific data related to athletes' energy needs, assessment of body composition, strategies for weight change, athletes' nutrient and fluid needs, special nutrient needs during training, the use of supplements and nutritional ergogenic aids, and nutrition recommendations for vegetarian athletes. During times of high physical activity, energy and macronutrient needs - especially carbohydrate and protein intake - must be met in order to maintain body weight, replenish glycogen stores, and provide adequate protein for building and repairing tissue. Fat intake should be adequate to provide essential fatty acids and fat-soluble vitamins, as well as to help provide adequate energy for weight maintenance. Overall, diets should provide moderate amounts of energy from fat (20-25% of energy); there appears to be no health or performance benefit to consuming a diet containing less than 15% of energy from fat. Body weight and composition can affect exercise performance, but should not be used as the sole criterion for sports performance; daily weigh-ins are discouraged. Consuming adequate food and fluid before, during, and after exercise can help maintain blood glucose levels during exercise, maximize exercise performance, and improve recovery time. Athletes should be well hydrated before beginning exercise; they should also drink enough fluid during and after exercise to balance fluid losses. Consumption of sport drinks containing carbohydrates and electrolytes during exercise will provide fuel for the muscles, help maintain blood glucose levels and the

  16. Joint Position Statement: nutrition and athletic performance. American College of Sports Medicine, American Dietetic Association, and Dietitians of Canada.

    Science.gov (United States)

    2000-12-01

    It is the position of the American Dietetic Association, Dietitians of Canada, and the American College of Sports Medicine that physical activity, athletic performance, and recovery from exercise are enhanced by optimal nutrition. These organizations recommend appropriate selection of food and fluids, timing of intake, and supplement choices for optimal health and exercise performance. This position paper reviews the current scientific data related to the energy needs of athletes, assessment of body composition, strategies for weight change, the nutrient and fluid needs of athletes, special nutrient needs during training, the use of supplements and nutritional ergogenic aids, and the nutrition recommendations for vegetarian athletes. During times of high physical activity, energy and macronutrient needs-especially carbohydrate and protein intake-must be met in order to maintain body weight, replenish glycogen stores, and provide adequate protein for building and repair of tissue. Fat intake should be adequate to provide the essential fatty acids and fat-soluble vitamins, as well as to help provide adequate energy for weight maintenance. Overall, diets should provide moderate amounts of energy from fat (20% to 25% of energy); however, there appears to be no health or performance benefit to consuming a diet containing less than 15% of energy from fat. Body weight and composition can affect exercise performance, but should not be used as the sole criterion for sports performance; daily weigh-ins are discouraged. Consuming adequate food and fluid before, during, and after exercise can help maintain blood glucose during exercise, maximize exercise performance, and improve recovery time. Athletes should be well-hydrated before beginning to exercise; athletes should also drink enough fluid during and after exercise to balance fluid losses. Consumption of sport drinks containing carbohydrates and electrolytes during exercise will provide fuel for the muscles, help maintain

  17. Lung hyperpermeability and asthma prevalence in schoolchildren: unexpected associations with the attendance at indoor chlorinated swimming pools

    OpenAIRE

    Bernard, Alfred; Carbonnelle, Sylviane; Michel, O; Higuet, S; de Burbure, Claire; Buchet, Jean-Pierre; Hermans, Cédric; Dumont, Xavier; Doyle, I

    2003-01-01

    AIMS: To study whether exposure to nitrogen trichloride in indoor chlorinated pools may affect the respiratory epithelium of children and increase the risk of some lung diseases such as asthma. METHODS: In 226 healthy children, serum surfactant associated proteins A and B (SP-A and SP-B), 16 kDa Clara cell protein (CC16), and IgE were measured. Lung specific proteins were measured in the serum of 16 children and 13 adults before and after exposure to NCl(3) in an indoor chlorinated pool. Rela...

  18. Interstitial lung abnormalities in treatment-naïve advanced non-small-cell lung cancer patients are associated with shorter survival

    International Nuclear Information System (INIS)

    Highlights: • Interstitial lung abnormalities were present in 14% of stage IV NSCLC patients. • ILA was more common in older patients with heavier smoking history. • ILA was associated with shorter survival after adjusting for smoking and therapy. • ILA could be an additional independent marker for survival in advanced NSCLC. - Abstract: Objective: Interstitial lung diseases are associated with increased risk of lung cancer. The prevalence of ILA at diagnosis of advanced non-small-cell lung cancer (NSCLC) and its impact on overall survival (OS) remain to be investigated. Materials and method: The study included 120 treatment-naïve stage IV NSCLC patients (53 males, 67 females). ILA was scored on CT prior to any systemic therapy using a 4-point scale [0 = no evidence of ILA, 1 = equivocal for ILA, 2 = suspicious for ILA, 3 = ILA] by a sequential reading method previously reported. ILA scores of 2 or 3 indicated the presence of ILA. Results: ILA was present in 17 patients (14%) with advanced NSCLC prior to any treatment (score3: n = 2, score2: n = 15). These 17 patients were significantly older (median age: 69 vs. 63, p = 0.04) and had a heavier smoking history (median: 40 vs. 15.5 pack-year, p = 0.003) than those with ILA score 0 or 1. Higher ILA scores were associated with shorter OS (p = 0.001). Median OS of the 17 patients with ILA was 7.2 months [95%CI: 2.9–9.4] compared to 14.8 months [95%CI: 11.1–18.4] in patients with ILA score 0 or 1 (p = 0.002). In a multivariate model, the presence of ILA remained significant for increased risk for death (HR = 2.09, p = 0.028) after adjusting for first-line systemic therapy (chemotherapy, p < 0.001; TKI, p < 0.001; each compared to no therapy) and pack years of smoking (p = 0.40). Conclusion: Radiographic ILA was present in 14% of treatment-naïve advanced NSCLC patients. Higher ILA scores were associated with shorter OS, indicating that ILA could be a marker of shorter survival in advanced NSCLC

  19. Interstitial lung abnormalities in treatment-naïve advanced non-small-cell lung cancer patients are associated with shorter survival

    Energy Technology Data Exchange (ETDEWEB)

    Nishino, Mizuki, E-mail: Mizuki_Nishino@DFCI.HARVARD.EDU [Department of Radiology, Brigham and Women' s Hospital, 75 Francis St., Boston, MA 02115 (United States); Department of Imaging, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215 (United States); Cardarella, Stephanie [Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215, (United States); Dahlberg, Suzanne E. [Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215 (United States); Araki, Tetsuro [Department of Radiology, Brigham and Women' s Hospital, 75 Francis St., Boston, MA 02115 (United States); Lydon, Christine; Jackman, David M.; Rabin, Michael S. [Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215, (United States); Hatabu, Hiroto [Department of Radiology, Brigham and Women' s Hospital, 75 Francis St., Boston, MA 02115 (United States); Johnson, Bruce E. [Department of Medical Oncology, Dana-Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215, (United States)

    2015-05-15

    Highlights: • Interstitial lung abnormalities were present in 14% of stage IV NSCLC patients. • ILA was more common in older patients with heavier smoking history. • ILA was associated with shorter survival after adjusting for smoking and therapy. • ILA could be an additional independent marker for survival in advanced NSCLC. - Abstract: Objective: Interstitial lung diseases are associated with increased risk of lung cancer. The prevalence of ILA at diagnosis of advanced non-small-cell lung cancer (NSCLC) and its impact on overall survival (OS) remain to be investigated. Materials and method: The study included 120 treatment-naïve stage IV NSCLC patients (53 males, 67 females). ILA was scored on CT prior to any systemic therapy using a 4-point scale [0 = no evidence of ILA, 1 = equivocal for ILA, 2 = suspicious for ILA, 3 = ILA] by a sequential reading method previously reported. ILA scores of 2 or 3 indicated the presence of ILA. Results: ILA was present in 17 patients (14%) with advanced NSCLC prior to any treatment (score3: n = 2, score2: n = 15). These 17 patients were significantly older (median age: 69 vs. 63, p = 0.04) and had a heavier smoking history (median: 40 vs. 15.5 pack-year, p = 0.003) than those with ILA score 0 or 1. Higher ILA scores were associated with shorter OS (p = 0.001). Median OS of the 17 patients with ILA was 7.2 months [95%CI: 2.9–9.4] compared to 14.8 months [95%CI: 11.1–18.4] in patients with ILA score 0 or 1 (p = 0.002). In a multivariate model, the presence of ILA remained significant for increased risk for death (HR = 2.09, p = 0.028) after adjusting for first-line systemic therapy (chemotherapy, p < 0.001; TKI, p < 0.001; each compared to no therapy) and pack years of smoking (p = 0.40). Conclusion: Radiographic ILA was present in 14% of treatment-naïve advanced NSCLC patients. Higher ILA scores were associated with shorter OS, indicating that ILA could be a marker of shorter survival in advanced NSCLC.

  20. Living near a Major Road in Beijing: Association with Lower Lung Function, Airway Acidification, and Chronic Cough

    Science.gov (United States)

    Hu, Zhan-Wei; Zhao, Yan-Ni; Cheng, Yuan; Guo, Cui-Yan; Wang, Xi; Li, Nan; Liu, Jun-Qing; Kang, Hui; Xia, Guo-Guang; Hu, Ping; Zhang, Ping-Ji; Ma, Jing; Liu, Ying; Zhang, Cheng; Su, Li; Wang, Guang-Fa

    2016-01-01

    Background: The effects of near-road pollution on lung function in China have not been well studied. We aimed to investigate the effects of long-term exposure to traffic-related air pollution on lung function, airway inflammation, and respiratory symptoms. Methods: We enrolled 1003 residents aged 57.96 ± 8.99 years living in the Shichahai Community in Beijing. Distances between home addresses and the nearest major roads were measured to calculate home-road distance. We used the distance categories 1, 2, and 3, representing 200 m, respectively, as the dose indicator for traffic-related air pollution exposure. Lung function, exhaled breath condensate (EBC) pH, and interleukin 6 levels were measured. As a follow-up, 398 participants had a second lung function assessment about 3 years later, and lung function decline was also examined as an outcome. We used regression analysis to assess the impacts of home-road distance on lung function and respiratory symptoms. As the EBC biomarker data were not normally distributed, we performed correlation analysis between home-road distance categories and EBC biomarkers. Results: Participants living a shorter distance from major roads had lower percentage of predicted value of forced expiratory volume in 1 s (FEV1% −1.54, 95% confidence interval [CI]: −0.20 to −2.89). The odds ratio for chronic cough was 2.54 (95% CI: 1.57–4.10) for category 1 and 1.97 (95% CI: 1.16–3.37) for category 2, compared with category 3. EBC pH was positively correlated with road distance (rank correlation coefficient of Spearman [rs] = 0.176, P air pollution in people who live near major roads in Beijing is associated with lower lung function, airway acidification, and a higher prevalence of chronic cough. EBC pH is a potential useful biomarker for evaluating air pollution exposure. PMID:27625090

  1. MiR-200b regulates autophagy associated with chemoresistance in human lung adenocarcinoma.

    Science.gov (United States)

    Pan, Banzhou; Feng, Bing; Chen, Yitian; Huang, Guichun; Wang, Rui; Chen, Longbang; Song, Haizhu

    2015-10-20

    Chemoresistance remains a major clinical problem in combating human lung adenocarcinoma (LAD), and abnormal autophagy is closely associated with this phenomenon. In the present study, an inverse correlation between miR-200b and autophagy-associated gene 12 (ATG12) expressions was observed in docetaxel-resistant (SPC-A1/DTX and H1299/DTX) and sensitive (SPC-A1 and H1299) LAD cells as well as in tissue samples. Further study showed that miR-200b directly targeted ATG12 in LAD. Moreover, miR-200b-dependent ATG12 downregulation inhibited autophagy and enhanced the chemosensitivity of SPC-A1/DTX and H1299/DTX cells both in vivo and in vitro. LAD chemoresistance is therefore closely related to downregulation of miR-200b and the corresponding upregulation of ATG12. These results provide new evidence for the mechanisms governing the microRNA (miRNA)-ATG12 network and their possible contribution to autophagy modulation and LAD chemoresistance.

  2. Acute Myocardial Infarction in Women: A Scientific Statement From the American Heart Association.

    Science.gov (United States)

    Mehta, Laxmi S; Beckie, Theresa M; DeVon, Holli A; Grines, Cindy L; Krumholz, Harlan M; Johnson, Michelle N; Lindley, Kathryn J; Vaccarino, Viola; Wang, Tracy Y; Watson, Karol E; Wenger, Nanette K

    2016-03-01

    Cardiovascular disease is the leading cause of mortality in American women. Since 1984, the annual cardiovascular disease mortality rate has remained greater for women than men; however, over the last decade, there have been marked reductions in cardiovascular disease mortality in women. The dramatic decline in mortality rates for women is attributed partly to an increase in awareness, a greater focus on women and cardiovascular disease risk, and the increased application of evidence-based treatments for established coronary heart disease. This is the first scientific statement from the American Heart Association on acute myocardial infarction in women. Sex-specific differences exist in the presentation, pathophysiological mechanisms, and outcomes in patients with acute myocardial infarction. This statement provides a comprehensive review of the current evidence of the clinical presentation, pathophysiology, treatment, and outcomes of women with acute myocardial infarction.

  3. Gastrin-releasing peptide receptor expression in non-cancerous bronchial epithelia is associated with lung cancer: a case-control study

    Directory of Open Access Journals (Sweden)

    Egloff Ann Marie

    2012-02-01

    Full Text Available Abstract Background Normal bronchial tissue expression of GRPR, which encodes the gastrin-releasing peptide receptor, has been previously reported by us to be associated with lung cancer risk in 78 subjects, especially in females. We sought to define the contribution of GRPR expression in bronchial epithelia to lung cancer risk in a larger case-control study where adjustments could be made for tobacco exposure and sex. Methods We evaluated GRPR mRNA levels in histologically normal bronchial epithelial cells from 224 lung cancer patients and 107 surgical cancer-free controls. Associations with lung cancer were tested using logistic regression models. Results Bronchial GRPR expression was significantly associated with lung cancer (OR = 4.76; 95% CI = 2.32-9.77 in a multivariable logistic regression (MLR model adjusted for age, sex, smoking status and pulmonary function. MLR analysis stratified by smoking status indicated that ORs were higher in never and former smokers (OR = 7.74; 95% CI = 2.96-20.25 compared to active smokers (OR = 1.69; 95% CI = 0.46-6.33. GRPR expression did not differ by subject sex, and lung cancer risk associated with GRPR expression was not modified by sex. Conclusions GRPR expression in non-cancerous bronchial epithelium was significantly associated with the presence of lung cancer in never and former smokers. The association in never and former smokers was found in males and females. Association with lung cancer did not differ by sex in any smoking group.

  4. Sedentary Behavior and Cardiovascular Morbidity and Mortality: A Science Advisory From the American Heart Association.

    Science.gov (United States)

    Young, Deborah Rohm; Hivert, Marie-France; Alhassan, Sofiya; Camhi, Sarah M; Ferguson, Jane F; Katzmarzyk, Peter T; Lewis, Cora E; Owen, Neville; Perry, Cynthia K; Siddique, Juned; Yong, Celina M

    2016-09-27

    Epidemiological evidence is accumulating that indicates greater time spent in sedentary behavior is associated with all-cause and cardiovascular morbidity and mortality in adults such that some countries have disseminated broad guidelines that recommend minimizing sedentary behaviors. Research examining the possible deleterious consequences of excess sedentary behavior is rapidly evolving, with the epidemiology-based literature ahead of potential biological mechanisms that might explain the observed associations. This American Heart Association science advisory reviews the current evidence on sedentary behavior in terms of assessment methods, population prevalence, determinants, associations with cardiovascular disease incidence and mortality, potential underlying mechanisms, and interventions. Recommendations for future research on this emerging cardiovascular health topic are included. Further evidence is required to better inform public health interventions and future quantitative guidelines on sedentary behavior and cardiovascular health outcomes.

  5. Associations of Pet Ownership with Wheezing and Lung Function in Childhood: Findings from a UK Birth Cohort.

    Directory of Open Access Journals (Sweden)

    Simon M Collin

    Full Text Available Asthma is a heterogeneous condition and differential effects of pet ownership on non-atopic versus atopic asthma have been reported. The aim of this study was to investigate whether pet ownership during pregnancy and early childhood was associated with wheezing from birth to age 7 years and with lung function at age 8 years in a UK population-based birth cohort.Data from the Avon Longitudinal Study of Parents and Children (ALSPAC were used to investigate associations of pet ownership at six time-points from pregnancy to age 7 years with concurrent episodes of wheezing, wheezing trajectories (phenotypes and lung function at age 8 years using logistic regression models adjusted for child's sex, maternal history of asthma/atopy, maternal smoking during pregnancy, and family adversity.4,706 children had complete data on pet ownership and wheezing. From birth to age 7 years, cat ownership was associated with an overall 6% lower odds of wheezing (OR=0.94 (0.89-0.99. Rabbit and rodent ownership was associated with 21% (OR=1.21 (1.12-1.31 and 11% (OR=1.11 (1.02-1.21 higher odds of wheezing, respectively, with strongest effects evident during infancy. Rabbit and rodent ownership was positively associated with a 'persistent wheeze' phenotype. Pet ownership was not associated with lung function at age 8 years, with the exception of positive associations of rodent and bird ownership with better lung function.Cat ownership was associated with reduced risk, and rabbit and rodent ownership with increased risk, of wheezing during childhood. The mechanisms behind these differential effects warrant further investigation.

  6. Intravenous pamidronate in the treatment of osteoporosis associated with corticosteroid dependent lung disease: an open pilot study.

    OpenAIRE

    Gallacher, S. J.; Fenner, J A; Anderson, K.; Bryden, F M; Banham, S W; Logue, F C; Cowan, R. A.; Boyle, I T

    1992-01-01

    BACKGROUND: Bisphosphonates have been shown to be effective agents in the treatment of postmenopausal osteoporosis. Because corticosteroid associated osteoporosis is often associated with increased bone turnover, the effect of intermittent intravenous infusions of pamidronate on this condition has been investigated. METHODS: Seventeen patients (five male) with chronic corticosteroid dependent lung disease (15 asthma, two sarcoidosis) were treated with infusions of 30 mg pamidronate once every...

  7. Oestrogen receptor beta over expression in males with non-small cell lung cancer is associated with better survival

    DEFF Research Database (Denmark)

    Skov, Birgit Guldhammer; Sode, Birgitte M Fischer; Pappot, H.

    2008-01-01

    of the clinical variables, including survival. None of the 104 patients had tumours positive for progesterone. CONCLUSION: The presence of ERbeta in a tumour seems to be a positive prognostic factor for men with non-small cell lung cancer. The finding confirms another recent study and suggests that the relation......BACKGROUND: Adenocarcinoma of the lung is more frequent in females than in males and the association with smoking is less pronounced than for the other histological subtypes of lung cancer. Oestrogen induction of cell proliferation has been found in breast adenocarcinomas, and since oestrogen...... the results to gender and survival. METHODS: Paraffin embedded, histological material was collected from 104 patients (71 men and 33 women), operated in the period 1989-1992 for NSCLC (56 squamous cell carcinomas, 40 adenocarcinomas and 8 large cell carcinomas). ERalpha, ERbeta and progesterone were...

  8. IgG4-related Lung Disease Associated with Autoimmune Hemolytic Anemia: A Case Report and a Literature Review.

    Science.gov (United States)

    Noguchi, Shingo; Yatera, Kazuhiro; Jinbo, Mitsutaka; Yamada, Sohsuke; Shimabukuro, Ikuko; Yamasaki, Kei; Kido, Takashi; Ishimoto, Hiroshi; Yoshii, Chiharu; Mukae, Hiroshi

    2016-01-01

    We herein report a case of IgG4-related lung disease (IgG4-RLD) associated with autoimmune hemolytic anemia (AIHA). A 73-year-old Japanese female visited our hospital for an examination following an abnormal chest X-ray in 1999. She was diagnosed with bronchiolitis and AIHA, and treatment with prednisolone was started. After seven years, she visited our department due to a cough. Chest computed tomography (CT) demonstrated focal consolidation with ground-glass attenuations and thickened bronchial walls in the bilateral lungs. She was clinically diagnosed and treated for bronchial asthma. CT findings had shown no changes, and a lung biopsy was performed using video-assisted thoracic surgery at eleven years from the first diagnosis of AIHA. The pathological findings demonstrated the presence of peribronchovascular lymphoplasmacytic infiltrates with stromal fibrotic changes, admixed with many IgG4-positive plasma cells. Furthermore, the patient's serum IgG4 level was high, and her CT findings did not show any obvious abnormal findings in the any organs other than the lungs. She was diagnosed with IgG4-RLD based on the findings. We believe that this case report of IgG4-RLD associated with AIHA is clinically helpful for a better understanding of these diseases, although there are five reported cases of IgG4-related disease associated with AIHA. PMID:27580552

  9. Genome-wide association meta-analysis identifies five modifier loci of lung disease severity in cystic fibrosis.

    Science.gov (United States)

    Corvol, Harriet; Blackman, Scott M; Boëlle, Pierre-Yves; Gallins, Paul J; Pace, Rhonda G; Stonebraker, Jaclyn R; Accurso, Frank J; Clement, Annick; Collaco, Joseph M; Dang, Hong; Dang, Anthony T; Franca, Arianna; Gong, Jiafen; Guillot, Loic; Keenan, Katherine; Li, Weili; Lin, Fan; Patrone, Michael V; Raraigh, Karen S; Sun, Lei; Zhou, Yi-Hui; O'Neal, Wanda K; Sontag, Marci K; Levy, Hara; Durie, Peter R; Rommens, Johanna M; Drumm, Mitchell L; Wright, Fred A; Strug, Lisa J; Cutting, Garry R; Knowles, Michael R

    2015-09-29

    The identification of small molecules that target specific CFTR variants has ushered in a new era of treatment for cystic fibrosis (CF), yet optimal, individualized treatment of CF will require identification and targeting of disease modifiers. Here we use genome-wide association analysis to identify genetic modifiers of CF lung disease, the primary cause of mortality. Meta-analysis of 6,365 CF patients identifies five loci that display significant association with variation in lung disease. Regions on chr3q29 (MUC4/MUC20; P=3.3 × 10(-11)), chr5p15.3 (SLC9A3; P=6.8 × 10(-12)), chr6p21.3 (HLA Class II; P=1.2 × 10(-8)) and chrXq22-q23 (AGTR2/SLC6A14; P=1.8 × 10(-9)) contain genes of high biological relevance to CF pathophysiology. The fifth locus, on chr11p12-p13 (EHF/APIP; P=1.9 × 10(-10)), was previously shown to be associated with lung disease. These results provide new insights into potential targets for modulating lung disease severity in CF.

  10. Integrative proteomics and tissue microarray profiling indicate the association between overexpressed serum proteins and non-small cell lung cancer.

    Directory of Open Access Journals (Sweden)

    Yansheng Liu

    Full Text Available Lung cancer is the leading cause of cancer deaths worldwide. Clinically, the treatment of non-small cell lung cancer (NSCLC can be improved by the early detection and risk screening among population. To meet this need, here we describe the application of extensive peptide level fractionation coupled with label free quantitative proteomics for the discovery of potential serum biomarkers for lung cancer, and the usage of Tissue microarray analysis (TMA and Multiple reaction monitoring (MRM assays for the following up validations in the verification phase. Using these state-of-art, currently available clinical proteomic approaches, in the discovery phase we confidently identified 647 serum proteins, and 101 proteins showed a statistically significant association with NSCLC in our 18 discovery samples. This serum proteomic dataset allowed us to discern the differential patterns and abnormal biological processes in the lung cancer blood. Of these proteins, Alpha-1B-glycoprotein (A1BG and Leucine-rich alpha-2-glycoprotein (LRG1, two plasma glycoproteins with previously unknown function were selected as examples for which TMA and MRM verification were performed in a large sample set consisting about 100 patients. We revealed that A1BG and LRG1 were overexpressed in both the blood level and tumor sections, which can be referred to separate lung cancer patients from healthy cases.

  11. Comments to guidelines for the treatment of hypothyroidism prepared by the American thyroid association task force on thyroid hormone replacement

    Directory of Open Access Journals (Sweden)

    Valentin Viktorovich Fadeev

    2015-02-01

    Full Text Available The article is dedicated to the discussion about to guidelines for the treatment of hypothyroidism prepared by the American thyroid association task force on thyroid hormone replacement.

  12. Lack of association between IL-6 -174G>C polymorphism and lung cancer: a meta-analysis.

    Science.gov (United States)

    Liu, Y; Song, X L; Zhang, G L; Peng, A M; Fu, P F; Li, P; Tan, M; Li, X; Li, M; Wang, C H

    2015-01-01

    The results of previous case-control studies examining the relationship between the interleukin (IL)-6 gene -174G>C polymorphism and lung cancer are controversial. In this study, we evaluated the relationship between the IL-6 gene -174G>C polymorphism and lung cancer. We selected 5 case-control studies related to the IL-6 gene -174G>C polymorphism and lung cancer by searching the PubMed, EMBase, Chinese Biomedical Literature Database, and Wanfang database. We utilized the Q-test and I2 test to determine heterogeneity between each study. To merge the odds ratios (OR) and 95% confidence intervals (CI), we utilized the fixed effects model and random effect model for analyses. The present study included 2801 patients with lung cancer and 3234 cancer-free control subjects. The meta-analysis revealed no association between the IL-6 gene -174G>C polymorphism and lung cancer in either genotype or allele distribution [CC+GC vs GG: OR = 1.04, 95%CI (0.86-1.26), P = 0.70; GG+GC vs CC: OR = 0.93, 95%CI (0.82-1.05), P = 0. 23; CC vs GG: OR = 1.08, 95%CI (0.95-1.23), P = 0.23; C allele vs D allele: OR = 1.03, 95%CI (0.96-1.11), P = 0.44]. We concluded that the IL-6 gene -174G>C polymorphism was not associated with lung cancer. PMID:25729947

  13. IL-17A-producing T cells are associated with the progression of lung adenocarcinoma.

    Science.gov (United States)

    Bao, Zhang; Lu, Guohua; Cui, Dawei; Yao, Yinan; Yang, Guangdie; Zhou, Jianying

    2016-08-01

    Accumulating evidence has shown that T cells are crucial in shaping the tumor microenvironment and regulating tumor development. However, the roles of IL-17A‑producing T cells (IL-17A+CD4+ Th17, IL-17A+CD8+ Tc17 and IL-17A+ γδT17 cells) and related cytokines in the progression of lung cancer (LC) remain uncertain. Here, we found that the frequencies of both Th17 and γδT17 cells in the peripheral blood of patients with lung adenocarcinoma (LA) were higher than those in healthy controls (HCs), whereas the frequency of Tc17 cells in the patients with LA was decreased. In addition, the frequencies of circulating Th17 and γδT17 cells, but not Tc17 cells, were positively associated with tumor invasion and metastasis. Furthermore, the major source of IL-17A production was Th17 cells, followed by Tc17 and γδT17 cells, in peripheral blood from patients with LA and HCs; but the percentages of Th17 and γδT17 cells in total intracellular IL-17A+ cells obtained from the patients with LC were higher than those from HCs. Moreover, the protein and corresponding mRNA levels of IL-17A, IL-23, IL-1β, and TGF-β1 were much higher in the patients with LA than those in HCs, and the levels of IL-17A in patients were positively correlated with numbers of both Th17 and γδT17 cells, but not Tc17 cells. Finally, the frequencies of circulating Th17 and γδT17 cells, along with the levels of IL-17A, IL-23, IL-1β, and TGF-β1 were decreased in the patients with LA after tumor resection, whereas the frequency of circulating Tc17 cells was inversely increased in these patients. Our findings indicate that Th17, Tc17, γδT17 cells, and IL-17A-associated cytokines contribute to the development of LA and thus represent promising targets for therapeutic strategies. PMID:27277161

  14. Association by Spatial Interpolation between Ozone Levels and Lung Function of Residents at an Industrial Complex in South Korea

    Science.gov (United States)

    Jung, Soon-Won; Lee, Kyoungho; Cho, Yong-Sung; Choi, Ji-Hee; Yang, Wonho; Kang, Tack-Shin; Park, Choonghee; Kim, Geun-Bae; Yu, Seung-Do; Son, Bu-Soon

    2016-01-01

    Spatial interpolation is employed to improve exposure estimates and to assess adverse health effects associated with environmental risk factors. Since various studies have reported that high ozone (O3) concentrations can give rise to adverse effects on respiratory symptoms and lung function, we investigated the association between O3 levels and lung function using a variety of spatial interpolation techniques and evaluated how different methods for estimating exposure may influence health results for a cohort from an industrial complex (Gwangyang Bay) in South Korea in 2009. To estimate daily concentrations of O3 in each subject, four different methods were used, which include simple averaging, nearest neighbor, inverse distance weighting, and kriging. Also, to compare the association between O3 levels and lung function by age-groups, we explored ozone’s impacts on three age-related groups: children (9–14 years), adults (15–64 years), and the elderly (≥65 years). The overall change of effect size on lung function in each age group tended to show similar patterns for lag and methods for estimating exposure. A significant negative association was only observed between O3 levels and FVC and FEV1 for most of the lag and methods in children. The largest effect of O3 levels was found at the average for the lung function test day and last 2 days (0–2 days). In conclusions, the spatial interpolation methods may benefit in providing individual-level exposure with appropriate temporal resolution from ambient monitors. However, time-activity patterns of residents, monitoring site locations, methodological choices, and other factors should be considered to minimize exposure misclassification. PMID:27447653

  15. Superoxide Dismutase 3 Polymorphism Associated with Reduced Lung Function in Two Large Populations

    DEFF Research Database (Denmark)

    Dahl, Morten; Bowler, Russell P; Juul, Klaus;

    2008-01-01

    Rationale: Superoxide dismutase (SOD) 3 inhibits oxidative fragmentation of lung matrix components Collagen 1, hyaluronan, and heparan sulfate. Inherited change in SOD3 expression or function could affect lung matrix homeostasis and influence pulmonary function. Objectives: To identify novel SOD3...

  16. Gas cooking is associated with small reductions in lung function in children.

    NARCIS (Netherlands)

    Moshammer, H.; Fletcher, T.; Heinrich, J.; Hoek, G.; Hruba, F.; Pattenden, S.; Rudnai, P.; Slachtova, H.; Speizer, F.E.; Zlotkowska, R.; Neuberger, M.

    2010-01-01

    Inconsistent effects of gas cooking on lung function have been reported. In a previous study from Austria, we demonstrated a significant, though small, reduction of lung function parameters in children living in homes with gas stoves. We used a larger international database to check if this finding

  17. Novel therapeutic strategies for lung disorders associated with airway remodelling and fibrosis.

    Science.gov (United States)

    Royce, Simon G; Moodley, Yuben; Samuel, Chrishan S

    2014-03-01

    Inflammatory cell infiltration, cytokine release, epithelial damage, airway/lung remodelling and fibrosis are central features of inflammatory lung disorders, which include asthma, chronic obstructive pulmonary disease, acute respiratory distress syndrome and idiopathic pulmonary fibrosis. Although the lung has some ability to repair itself from acute injury, in the presence of ongoing pathological stimuli and/or insults that lead to chronic disease, it no longer retains the capacity to heal, resulting in fibrosis, the final common pathway that causes an irreversible loss of lung function. Despite inflammation, genetic predisposition/factors, epithelial-mesenchymal transition and mechanotransduction being able to independently contribute to airway remodelling and fibrosis, current therapies for inflammatory lung diseases are limited by their ability to only target the inflammatory component of the disease without having any marked effects on remodelling (epithelial damage and fibrosis) that can cause lung dysfunction independently of inflammation. Furthermore, as subsets of patients suffering from these diseases are resistant to currently available therapies (such as corticosteroids), novel therapeutic approaches are required to combat all aspects of disease pathology. This review discusses emerging therapeutic approaches, such as trefoil factors, relaxin, histone deacetylase inhibitors and stem cells, amongst others that have been able to target airway inflammation and airway remodelling while improving related lung dysfunction. A better understanding of the mode of action of these therapies and their possible combined effects may lead to the identification of their clinical potential in the setting of lung disease, either as adjunct or alternative therapies to currently available treatments. PMID:24513131

  18. Prognostic Implication of Predominant Histologic Subtypes of Lymph Node Metastases in Surgically Resected Lung Adenocarcinoma

    OpenAIRE

    Kenichi Suda; Katsuaki Sato; Shigeki Shimizu; Kenji Tomizawa; Toshiki Takemoto; Takuya Iwasaki; Masahiro Sakaguchi; Tetsuya Mitsudomi

    2014-01-01

    The International Association for the Study of Lung Cancer, American Thoracic Society, and European Respiratory Society (IASLC/ATS/ERS) proposed a new classification for lung adenocarcinoma (AD) based on predominant histologic subtypes, such as lepidic, papillary, acinar, solid, and micropapillary; this system reportedly reflects well outcomes of patients with surgically resected lung AD. However, the prognostic implication of predominant histologic subtypes in lymph nodes metastases is uncle...

  19. Genetic variation in BCL2 3'-UTR was associated with lung cancer risk and prognosis in male Chinese population.

    Directory of Open Access Journals (Sweden)

    Ping Xu

    Full Text Available OBJECTIVES: Bcl-2 is a critical apoptosis inhibitor with established carcinogenic potential, and can confer cancer cell resistance to therapeutic treatments by activating anti-apoptotic cellular defense. We hypothesized that genetic variants of BCL2 gene may be associated with lung cancer susceptibility and prognosis. METHODS: Three selected tagSNPs of BCL2 (rs2279115, rs1801018, and rs1564483 were genotyped in 1017 paired male Chinese lung cancer cases and controls by TaqMan assay. The associations of these variants with risk of lung cancer and overall survival of 242 male advanced non-small-cell lung cancer (NSCLC patients were separately investigated. RESULTS: Compared with the BCL2 3'UTR rs1564483GG genotype, the rs1564483GA, AA, and GA+AA genotypes were associated with significantly decreased susceptibilities of lung cancer in male Chinese (adjusted OR = 0.78, 0.73, and 0.76, P = 0.016, 0.038, and 0.007, respectively, while rs1564483A allele has a inverse dose-response relationship with lung cancer risk (P trend = 0.010. These effects were more evident in the elders, smokers, and subjects without family history of cancer (P trend = 0.017, 0.043 and 0.005, respectively. Furthermore, advanced NSCLC males carrying BCL2 rs1564483 GA+AA genotypes had significantly longer median survival time (Long-rank P = 0.036 and decreased death risk (adjusted HR = 0.69, P = 0.027 than patients with rs1564483GG genotype. These effects were more obvious in patients with smoking, stage IIIA, and in patients without surgery but underwent chemotherapy or radiotherapy (adjusted HR = 0.68, 0.49, 0.67, 0.69, 0.50, respectively, all P<0.05. CONCLUSION: The BCL2 3'UTR rs1564483A allele was associated with a decreased lung cancer risk and better survival for advanced NSCLC in male Chinese, which may offer a novel biomarker for identifying high-risk population and predicting clinical outcomes.

  20. Reverse-migrated neutrophils regulated by JAM-C are involved in acute pancreatitis-associated lung injury.

    Science.gov (United States)

    Wu, Deqing; Zeng, Yue; Fan, Yuting; Wu, Jianghong; Mulatibieke, Tunike; Ni, Jianbo; Yu, Ge; Wan, Rong; Wang, Xingpeng; Hu, Guoyong

    2016-01-01

    Junctional adhesion molecule-C (JAM-C) plays a key role in the promotion of the reverse transendothelial migration (rTEM) of neutrophils, which contributes to the dissemination of systemic inflammation and to secondary organ damage. During acute pancreatitis (AP), systemic inflammatory responses lead to distant organ damage and typically result in acute lung injury (ALI). Here, we investigated the role of rTEM neutrophils in AP-associated ALI and the molecular mechanisms by which JAM-C regulates neutrophil rTEM in this disorder. In this study, rTEM neutrophils were identified in the peripheral blood both in murine model of AP and human patients with AP, which elevated with increased severity of lung injury. Pancreatic JAM-C was downregulated during murine experimental pancreatitis, whose expression levels were inversely correlated with both increased neutrophil rTEM and severity of lung injury. Knockout of JAM-C resulted in more severe lung injury and systemic inflammation. Significantly greater numbers of rTEM neutrophils were present both in the circulation and pulmonary vascular washout in JAM-C knockout mice with AP. This study demonstrates that during AP, neutrophils that are recruited to the pancreas may migrate back into the circulation and then contribute to ALI. JAM-C downregulation may contribute to AP-associated ALI via promoting neutrophil rTEM. PMID:26841848

  1. Associations of racial discrimination and parental discrimination coping messages with African American adolescent racial identity.

    Science.gov (United States)

    Richardson, Bridget L; Macon, Tamarie A; Mustafaa, Faheemah N; Bogan, Erin D; Cole-Lewis, Yasmin; Chavous, Tabbye M

    2015-06-01

    Research links racial identity to important developmental outcomes among African American adolescents, but less is known about the contextual experiences that shape youths' racial identity. In a sample of 491 African American adolescents (48% female), associations of youth-reported experiences of racial discrimination and parental messages about preparation for racial bias with adolescents' later racial identity were examined. Cluster analysis resulted in four profiles of adolescents varying in reported frequency of racial discrimination from teachers and peers at school and frequency of parental racial discrimination coping messages during adolescents' 8th grade year. Boys were disproportionately over-represented in the cluster of youth experiencing more frequent discrimination but receiving fewer parental discrimination coping messages, relative to the overall sample. Also examined were clusters of adolescents' 11th grade racial identity attitudes about the importance of race (centrality), personal group affect (private regard), and perceptions of societal beliefs about African Americans (public regard). Girls and boys did not differ in their representation in racial identity clusters, but 8th grade discrimination/parent messages clusters were associated with 11th grade racial identity cluster membership, and these associations varied across gender groups. Boys experiencing more frequent discrimination but fewer parental coping messages were over-represented in the racial identity cluster characterized by low centrality, low private regard, and average public regard. The findings suggest that adolescents who experience racial discrimination but receive fewer parental supports for negotiating and coping with discrimination may be at heightened risk for internalizing stigmatizing experiences. Also, the findings suggest the need to consider the context of gender in adolescents' racial discrimination and parental racial socialization. PMID:25300508

  2. Association of body mass index with lung function in pre- pubertal girls in Vadodara District

    Directory of Open Access Journals (Sweden)

    Rajeshri K Bodat

    2015-09-01

    Full Text Available Introduction: Among the various investigations available, pulmonary function test (PFT is a one of the important tool for the assessment of pulmonary function. There must be differences in reference values in India between different state, different region for spirometric parameters. Methodology: The present study was conducted among normal healthy pre pubertal girl in Vadodara region. The study was conducted among pre pubertal girls (10-12 yrs. Standard anthropometric measurements weight (kg, height (cm, was measured in a beam balance. Minimum three readings were given and best of the three was chosen for analysis, based on standardization of spirometry study based on ATS/ERS task force series and various other studies. Results: Mean age of the participants was 11.36 (+/-0.69 years. Similarly mean height, weight, BMI and BSA was 134.8(+/-8.91 cm, 28(+/-5.9 kg, 15.29(+/-2.02 (Kg/m2, and 1.02(+/-0.13 (m2 respectively. There were 27(60 % participants with BMI 18. There was significant statistical association between BMI and FEV1 (%, FEV1/FVC (%, PEFR (% (P < 0.05. Conclusion: There is significant relation between pulmonary function and BMI in pre pubertal girls. As BMI increase lung function tends to be decrease as compared to those who have low BMI. [Natl J Med Res 2015; 5(3.000: 256-258

  3. Workforce and Salary Survey Trends: Opportunities and Challenges for the American Association of Medical Dosimetrists

    Energy Technology Data Exchange (ETDEWEB)

    Mills, Michael D., E-mail: mdmill03@exchange.louisville.edu

    2015-07-01

    The American Association of Medical Dosimetrists (AAMD) designed and directed 2 surveys of the AAMD membership. The first was in 2011 and the second in 2014. There were a number of questions common to both surveys, and this article seeks to evaluate these common questions to determine trends among the professional membership of the AAMD. It is demonstrated that the observed trends are consistent with the goals and objectives established by the leadership of the AAMD and the Medical Dosimetry Certification Board (MDCB) for the medical dosimetry community. In addition, certain challenges and opportunities involving the scope of practice for the medical dosimetry profession are discussed.

  4. Homophobic Attitudes and Associated Factors Among Adolescents: A Comparison of Six Latin American Countries.

    Science.gov (United States)

    Chaux, Enrique; León, Manuela

    2016-09-01

    Homophobic attitudes are still very common in the world, although there are large differences between countries. This study analyzed the responses of almost 30,000 8th- and 9th-grade students from six countries who participated in the Latin American component of the International Civic and Citizenship Education Study. Higher levels of homophobia were found in the Dominican Republic, Guatemala, and Paraguay than in Chile, Colombia, and Mexico. Homophobic attitudes were positively associated with being male, having lower levels of empathy, spending less time with friends and the media, having aggressive attitudes, and being more religious, in particular non-Catholic Christian. PMID:26861958

  5. The American Association for Thoracic Surgery Consensus Guidelines: Reasons and purpose.

    Science.gov (United States)

    Svensson, Lars G; Gillinov, A Marc; Weisel, Richard D; Keshavjee, Shaf; Bacha, Emile A; Moon, Marc R; Cameron, Duke E; Sugarbaker, David J; Adams, David H; Gaynor, J William; Coselli, Joseph S; Del Nido, Pedro J; Jones, David; Sundt, Thoralf M; Cohn, Lawrence H; Pomar, Jose L; Lytle, Bruce W; Schaff, Hartzell V

    2016-04-01

    The time interval for the doubling of medical knowledge continues to decline. Physicians, patients, administrators, government officials, and payors are struggling to keep up to date with the waves of new information and to integrate the knowledge into new patient treatment protocols, processes, and metrics. Guidelines, Consensus Guidelines, and Consensus Statements, moderated by seasoned content experts, offer one method to rapidly distribute new information in a timely manner and also guide minimal standards of treatment of clinical care pathways as they are developed as part of bundled care programs. These proposed Consensus Guidelines advance The American Association for Thoracic Surgery's mission of leading in cardiothoracic health care, education, innovation, and modeling excellence.

  6. Association studies of ERCC1 polymorphisms with lung cancer susceptibility: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Jinhong Zhu

    Full Text Available BACKGROUND: Excision repair cross-complimentary group 1 (ERCC1 is an essential component of the nucleotide excision repair system that is responsible for repairing damaged DNA. Functional genetic variations in the ERCC1 gene may alter DNA repair capacity and modulate cancer risk. The putative roles of ERCC1 gene polymorphisms in lung cancer susceptibility have been widely investigated. However, the results remain controversial. OBJECTIVES: An updated meta-analysis was conducted to explore whether lung cancer risk could be attributed to the following ERCC1 polymorphisms: rs11615 (T>C, rs3212986 (C>A, rs3212961 (A>C, rs3212948 (G>C, rs2298881 (C>A. METHODS: Several major databases (MEDLINE, EMBASE and Scopus and the Chinese Biomedical database were searched for eligible studies. Crude odds ratios (ORs with 95% confidence intervals (CIs were used to measure the strength of associations. RESULTS: Sixteen studies with 10,106 cases and 13,238 controls were included in this meta-analysis. Pooled ORs from 11 eligible studies (8,215 cases vs. 11,402 controls suggested a significant association of ERCC1 rs11615 with increased risk for lung cancer (homozygous: CC versus TT, OR = 1.24, 95% CI: 1.04-1.48, P = 0.02. However, such an association was disproportionately driven by a single study. Removal of that study led to null association. Moreover, initial analyses suggested that ERCC1 rs11615 exerts a more profound effect on the susceptibility of non-smokers to lung cancer than that of smokers. Moreover, no statistically significant association was found between remaining ERCC1 polymorphisms of interest and lung cancer risk, except for rs3212948 variation (heterozygous: CG vs.GG, OR = 0.78, 95% CI: 0.67-0.90, P = 0.001; dominant: CG/CC vs.GG, OR = 0.79, 95% CI: 0.69-0.91, P = 0.001. CONCLUSION: Overall, this meta-analysis suggests that ERCC1 rs3212948 G>C, but not others, is a lung cancer risk-associated polymorphism. Carefully

  7. Genetic Association Analysis of 30 Genes Related to Obesity in a European American Population

    Science.gov (United States)

    Li, Peng; Tiwari, Hemant K.; Lin, Wan-Yu; Allison, David B.; Chung, Wendy K.; Leibel, Rudolph L.; Yi, Nengjun; Liu, Nianjun

    2013-01-01

    Objective Obesity, which is frequently associated with diabetes, hypertension, and cardiovascular diseases, is primarily the result of a net excess of caloric intake over energy expenditure. Human obesity is highly heritable, but the specific genes mediating susceptibility in non-syndromic obesity remain unclear. We tested candidate genes in pathways related to food intake and energy expenditure for association with body mass index (BMI). Methods We re-analyzed 355 common genetic variants of 30 candidate genes in 7 molecular pathways related to obesity in 1,982 unrelated European Americans from the New York Health Project. Data were analyzed by using a Bayesian hierarchical generalized linear model. The BMIs were log-transformed and then adjusted for covariates including age, age2, gender, and diabetes status. The single nucleotide polymorphisms (SNPs) were modeled as additive effects. Results With the stipulated adjustments, nine SNPs in eight genes were significantly associated with BMI: GHRL (rs35683), AGRP (rs5030980), CPE (rs1946816 and rs4481204), GLP1R (rs2268641), HTR2A (rs912127), NPY5R (Y5R1c52), SOCS3 (rs4969170), and STAT3 (rs4796793). We also found a gender-by-SNP interaction (rs1745837 in HTR2A), which indicated that variants in the gene HTR2A had a stronger association with BMI in males. In addition, NPY1R was detected as having a significant gene effect even though none of the SNPs in this gene was significant. Conclusion Variations in genes AGRP, CPE, GHRL, GLP1R, HTR2A, NPY1R, NPY5R, SOCS3, and STAT3 showed modest associations with BMI in European Americans. The pathways in which these genes participate regulate energy intake and thus these associations are mechanistically plausible in this context. PMID:23900445

  8. Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer

    International Nuclear Information System (INIS)

    Highlights: • Expression of MMD is increased in lung cancer tissues. • Knockdown of MMD inhibits growth of A549 and LLC cells in vitro and in vivo. • MMD is a direct functional target of miR-140-5p. • MiR-140-5p/MMD axis regulates Erk1/2 signaling. - Abstract: Monocyte to macrophage differentiation-associated (MMD) is identified in macrophages as a gene associated with the differentiation from monocytes to macrophages. Recent microarray analysis for non-small cell lung cancer (NSCLC) suggests that MMD is an important signature associated with relapse and survival among patients with NSCLC. Therefore, we speculate that MMD likely plays a role in lung cancer. In this study, we found that the protein level of MMD was increased in lung cancer compared to benign lung tissues, and knockdown of MMD inhibited the growth of A549 and Lewis lung cancer cells (LLC) in vitro and in vivo. Integrated analysis demonstrated that MMD was a direct functional target of miR-140-5p. Furthermore, we found that miR-140-5p/MMD axis could affect the cell proliferation of lung cancer cells by regulating Erk signaling. Together, our results highlight the significance of miR-140-5p/MMD axis in lung cancer, and miR-140-5p/MMD axis could serve as new molecular targets for the therapy against lung cancer

  9. Monocyte to macrophage differentiation-associated (MMD) targeted by miR-140-5p regulates tumor growth in non-small cell lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weina, E-mail: liweina228@163.com [Department of Biomedical Engineering, Fourth Military Medical University, Xi’an 710032 (China); He, Fei, E-mail: hesili1027@163.com [Department of Hepatic Surgery, Xijing Hospital, Fourth Military Medical University, Xi’an 710032 (China)

    2014-07-18

    Highlights: • Expression of MMD is increased in lung cancer tissues. • Knockdown of MMD inhibits growth of A549 and LLC cells in vitro and in vivo. • MMD is a direct functional target of miR-140-5p. • MiR-140-5p/MMD axis regulates Erk1/2 signaling. - Abstract: Monocyte to macrophage differentiation-associated (MMD) is identified in macrophages as a gene associated with the differentiation from monocytes to macrophages. Recent microarray analysis for non-small cell lung cancer (NSCLC) suggests that MMD is an important signature associated with relapse and survival among patients with NSCLC. Therefore, we speculate that MMD likely plays a role in lung cancer. In this study, we found that the protein level of MMD was increased in lung cancer compared to benign lung tissues, and knockdown of MMD inhibited the growth of A549 and Lewis lung cancer cells (LLC) in vitro and in vivo. Integrated analysis demonstrated that MMD was a direct functional target of miR-140-5p. Furthermore, we found that miR-140-5p/MMD axis could affect the cell proliferation of lung cancer cells by regulating Erk signaling. Together, our results highlight the significance of miR-140-5p/MMD axis in lung cancer, and miR-140-5p/MMD axis could serve as new molecular targets for the therapy against lung cancer.

  10. NAC is associated with additional alleviation of lung injury induced by invasive pulmonary aspergillosis in a neutropenic model

    Institute of Scientific and Technical Information of China (English)

    Peng XU; Jie-ming QU; Jin-fu XU; Jing ZHANG; Hong-ni JIANG; Hui-jun ZHANG

    2009-01-01

    Aim:Neutropenic individuals are at high risk for invasive pulmonary aspergillosis (IPA),a life-threatening infection.To evaluate the therapeutic potential of antioxidants,IPA was induced in neutropenic mice and the effect of N-acetyl-l-cysteine (NAC) on oxidative stress levels and lung injury was analyzed.Methods:Mice were pretreated with three daily intraperitoneal injections of 150 mg/kg cyclophosphamide,followed by intratracheal inoculation with 4.5×106 conidia of Aspergillus fumigatus.The infected mice were then randomly assigned to an amphotericin B (AMB) group,an AMB plus NAC group,or an untreated control (C) group.In each group,the duration of treatment was 24,48,or 72 h,and activities such as appearance,feeding,and dermal temperature were observed throughout the experiment.Sera and lung tissues were collected and analyzed by quantitative enzyme-linked immunosorbent assay (ELISA) for total protein,superoxide dismutase(SOD),malondialdehyde (MDA),tumor necrosis factor-α (TNF-α),and interleukin-lO (IL-10) levels.The wet/dry weight ratio of the lung was also calculated and lung sections were stained with hematoxylin-eosin for pathological examination and with methenamine silver stain for fungus detection.Results:Compared with the mice untreated with NAC,mice in the AMB plus NAC group had increased SOD and reduced MDA levels both systemically and locally at 24,48,and 72 h after inoculation with conidia.NAC treatment also decreased the pulmonary protein content at 48 and 72 h and the lung wet/dry weight ratio at 24 and 48 h.Additionally,NAC enhanced pulmonary production of TNF-α and IL-10 at 24 h and 48 h.Conclusion:In combination with antifungal therapy,NAC treatment can alleviate oxidative stress and lung injury associated with IPA in neutropenic mice.

  11. Incidental gastrointestinal 18F-Fluorodeoxyglucose uptake associated with lung cancer

    OpenAIRE

    Vella-Boucaud, Juliette; Papathanassiou, Dimitri; Bouche, Olivier; Prevost, Alain; Lestra, Thibault; Dury, Sandra; Vallerand, Hervé; Perotin, Jeanne-Marie; Launois, Claire; Boissiere, Louis; Brasseur, Mathilde; Lebargy, François; Deslee, Gaëtan

    2015-01-01

    Background F-Fluorodeoxyglucose positron emission tomography/computed tomography (18F-FDG PET/CT) is increasingly used for the initial staging and restaging of lung cancer. Incidental gastrointestinal findings are often observed on 18F-FDG PET/CT. The objective of this study was to assess incidental 18F-FDG uptake by the gastrointestinal tract (GIT) in patients with lung cancer. Methods Two hundred thirty consecutive 18F-FDG PET/CT examinations performed for lung cancer over a 3-year period w...

  12. Genome-wide association study of coronary and aortic calcification in lung cancer screening CT

    Science.gov (United States)

    de Vos, Bob D.; van Setten, Jessica; de Jong, Pim A.; Mali, Willem P.; Oudkerk, Matthijs; Viergever, Max A.; Išgum, Ivana

    2016-03-01

    Arterial calcification has been related to cardiovascular disease (CVD) and osteoporosis. However, little is known about the role of genetics and exact pathways leading to arterial calcification and its relation to bone density changes indicating osteoporosis. In this study, we conducted a genome-wide association study of arterial calcification burden, followed by a look-up of known single nucleotide polymorphisms (SNPs) for coronary artery disease (CAD) and myocardial infarction (MI), and bone mineral density (BMD) to test for a shared genetic basis between the traits. The study included a subcohort of the Dutch-Belgian lung cancer screening trial comprised of 2,561 participants. Participants underwent baseline CT screening in one of two hospitals participating in the trial. Low-dose chest CT images were acquired without contrast enhancement and without ECG-synchronization. In these images coronary and aortic calcifications were identified automatically. Subsequently, the detected calcifications were quantified using coronary artery calcium Agatston and volume scores. Genotype data was available for these participants. A genome-wide association study was conducted on 10,220,814 SNPs using a linear regression model. To reduce multiple testing burden, known CAD/MI and BMD SNPs were specifically tested (45 SNPs from the CARDIoGRAMplusC4D consortium and 60 SNPS from the GEFOS consortium). No novel significant SNPs were found. Significant enrichment for CAD/MI SNPs was observed in testing Agatston and coronary artery calcium volume scores. Moreover, a significant enrichment of BMD SNPs was shown in aortic calcium volume scores. This may indicate genetic relation of BMD SNPs and arterial calcification burden.

  13. Modification by antioxidant supplementation of changes in human lung function associated with air pollutant exposure: A systematic review

    Directory of Open Access Journals (Sweden)

    Chow Katherine S

    2011-07-01

    Full Text Available Abstract Background Outdoor air pollution, given its demonstrated negative effects on the respiratory system, is a growing public health concern worldwide, particularly in urban cities. Human exposure to pollutants such as ozone, nitrogen oxides, combustion-related particulate matter and oxides of sulfur is responsible for significant cardiopulmonary morbidity and mortality in both adults and children. Several antioxidants have shown an ability to partially attenuate the negative physiological and functional impacts of air pollutants. This study systematically presents current data on the potential benefits of antioxidant supplementation on lung function outcomes associated with air pollutant exposures in intact humans. Methods Electronic databases (MEDLINE, EMBASE, BIOSIS Previews, Web of Sciences, Environmental Sciences & Pollution Management and TOXNET were systematically searched for all studies published up to April 2009. Search terms relating to the concepts of respiratory tract diseases, respiratory function tests, air pollution, and antioxidants were used. Data was systematically abstracted from original articles that satisfied selection criteria for inclusion. For inclusion, the studies needed to have evaluated human subjects, given supplemental antioxidants, under conditions of known levels of air pollutants with measured lung function before and after antioxidant administration and/or air pollution exposure. Selected studies were summarized and conclusions presented. Results Eight studies investigated the role of antioxidant supplementation on measured lung function outcomes after subject exposure to air pollutants under controlled conditions; 5 of these studies concluded that pollutant-induced airway hyper-responsiveness and diminution in lung function measurements were attenuated by antioxidant supplementation. The remaining five studies took place under ambient (uncontrolled exposures and unanimously concluded that antioxidant

  14. A genetic polymorphism in the CAV1 gene associates with the development of bronchiolitis obliterans syndrome after lung transplantation

    Directory of Open Access Journals (Sweden)

    Kastelijn Elisabeth A

    2011-11-01

    Full Text Available Abstract Background Caveolin 1 (Cav-1 is the primary structural component of cell membrane invaginations called 'caveolae'. Expression of Cav-1 is implicated in the pathogenesis of pulmonary fibrosis. Genetic polymorphisms in the CAV1 gene influence the function of Cav-1 in malignancies and associate with renal allograft fibrosis. Chronic allograft rejection after lung transplantation, called 'bronchiolitis obliterans syndrome' (BOS, is also characterised by the development of fibrosis. In this study, we investigated whether CAV1 genotypes associate with BOS and whether Cav-1 serum levels are influenced by the CAV1 genotype and can be used as a biomarker to predict the development of BOS. Methods Twenty lung transplant recipients with BOS (BOSpos, ninety without BOS (BOSneg and four hundred twenty-two healthy individuals donated DNA samples. Four SNPs in CAV1 were genotyped. Serial Cav-1 serum levels were measured in a matched cohort of 10 BOSpos patients and 10 BOSneg patients. Furthermore, single-time point Cav-1 serum levels were measured in 33 unmatched BOSneg patients and 60 healthy controls. Results Homozygosity of the minor allele of rs3807989 was associated with an increased risk for BOS (odds ratio: 6.13; P = 0.0013. The median Cav-1 serum level was significantly higher in the BOSpos patients than in the matched BOSneg patients (P = 0.026. Longitudinal analysis did not show changes in Cav-1 serum levels over time in both groups. The median Cav-1 serum level in the group of 43 BOSneg patients was lower than that in the healthy control group (P = 0.046. In lung transplant recipients, homozygosity of the minor allele of rs3807989 and rs3807994 was associated with increased Cav-1 serum levels. Conclusion In lung transplant recipients, the CAV1 SNP rs3807989 was associated with the development of BOS and Cav-1 serum levels were influenced by the CAV1 genotype.

  15. Association between MGMT Promoter Methylation and Non-Small Cell Lung Cancer: A Meta-Analysis

    Science.gov (United States)

    Gu, Changmei; Lu, Jiachun; Cui, Tianpen; Lu, Cheng; Shi, Hao; Xu, Wenmao; Yuan, Xueli; Yang, Xiaobo; Huang, Yangxin; Lu, Meixia

    2013-01-01

    Background O6-methylguanine-DNA methyltransferase (MGMT) is one of most important DNA repair enzyme against common carcinogens such as alkylate and tobacco. Aberrant promoter methylation of the gene is frequently observed in non-small cell lung cancer (NSCLC). However, the importance of epigenetic inactivation of the gene in NSCLC published in the literature showed inconsistence. We quantified the association between MGMT promoter methylation and NSCLC using a meta-analysis method. Methods We systematically reviewed studies of MGMT promoter methylation and NSCLC in PubMed, EMBASE, Ovid, ISI Web of Science, Elsevier and CNKI databases and quantified the association between MGMT promoter methylation and NSCLC using meta-analysis method. Odds ratio (OR) and corresponding 95% confidence interval (CI) were calculated to evaluate the strength of association. Potential sources of heterogeneity were assessed by subgroup analysis and meta-regression. Results A total of 18 studies from 2001 to 2011, with 1, 160 tumor tissues and 970 controls, were involved in the meta-analysis. The frequencies of MGMT promote methylation ranged from 1.5% to 70.0% (median, 26.1%) in NSCLC tissue and 0.0% to 55.0% (median, 2.4%) in non-cancerous control, respectively. The summary of OR was 4.43 (95% CI: 2.85, 6.89) in the random-effects model. With stratification by potential source of heterogeneity, the OR was 20.45 (95% CI: 5.83, 71.73) in heterogeneous control subgroup, while it was 4.16 (95% CI: 3.02, 5.72) in the autologous control subgroup. The OR was 5.31 (95% CI: 3.00, 9.41) in MSP subgroup and 3.06 (95% CI: 1.75, 5.33) in Q-MSP subgroup. Conclusion This meta-analysis identified a strong association between methylation of MGMT gene and NSCLC. Prospective studies should be required to confirm the results in the future. PMID:24086261

  16. Association between MGMT promoter methylation and non-small cell lung cancer: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Changmei Gu

    Full Text Available BACKGROUND: O(6-methylguanine-DNA methyltransferase (MGMT is one of most important DNA repair enzyme against common carcinogens such as alkylate and tobacco. Aberrant promoter methylation of the gene is frequently observed in non-small cell lung cancer (NSCLC. However, the importance of epigenetic inactivation of the gene in NSCLC published in the literature showed inconsistence. We quantified the association between MGMT promoter methylation and NSCLC using a meta-analysis method. METHODS: We systematically reviewed studies of MGMT promoter methylation and NSCLC in PubMed, EMBASE, Ovid, ISI Web of Science, Elsevier and CNKI databases and quantified the association between MGMT promoter methylation and NSCLC using meta-analysis method. Odds ratio (OR and corresponding 95% confidence interval (CI were calculated to evaluate the strength of association. Potential sources of heterogeneity were assessed by subgroup analysis and meta-regression. RESULTS: A total of 18 studies from 2001 to 2011, with 1, 160 tumor tissues and 970 controls, were involved in the meta-analysis. The frequencies of MGMT promote methylation ranged from 1.5% to 70.0% (median, 26.1% in NSCLC tissue and 0.0% to 55.0% (median, 2.4% in non-cancerous control, respectively. The summary of OR was 4.43 (95% CI: 2.85, 6.89 in the random-effects model. With stratification by potential source of heterogeneity, the OR was 20.45 (95% CI: 5.83, 71.73 in heterogeneous control subgroup, while it was 4.16 (95% CI: 3.02, 5.72 in the autologous control subgroup. The OR was 5.31 (95% CI: 3.00, 9.41 in MSP subgroup and 3.06 (95% CI: 1.75, 5.33 in Q-MSP subgroup. CONCLUSION: This meta-analysis identified a strong association between methylation of MGMT gene and NSCLC. Prospective studies should be required to confirm the results in the future.

  17. iASPP is over-expressed in human non-small cell lung cancer and regulates the proliferation of lung cancer cells through a p53 associated pathway

    International Nuclear Information System (INIS)

    iASPP is a key inhibitor of tumour suppressor p53 and is found to be up-regulated in certain malignant conditions. The present study investigated the expression of iASPP in clinical lung cancer, a leading cancer type in the world, and the biological impact of this molecule on lung cancer cells. iASPP protein levels in lung cancer tissues were evaluated using an immunohistochemical method. In vitro, iASPP gene expression was suppressed with a lentvirus-mediated shRNA method and the biological impact after knocking down iASSP on lung cancer cell lines was investigated in connection with the p53 expression status. We showed here that the expression of iASPP was significantly higher in lung cancer tissues compared with the adjacent normal tissues. iASPP shRNA treatment resulted in a down-regulation of iASPP in lung cancer cells. There was a subsequent reduction of cell proliferation of the two lung tumour cell lines A459 and 95D both of which had wild-type p53 expression. In contrast, reduction of iASPP in H1229 cells, a cell with little p53 expression, had no impact on its growth rate. iASPP regulates the proliferation and motility of lung cancer cells. This effect is intimately associated with the p53 pathway. Together with the pattern of the over-expression in clinical lung cancers, it is concluded that iASPP plays an pivotal role in the progression of lung cancer and is a potential target for lung cancer therapy

  18. Health seeking behavioral analysis associated with breast cancer screening among Asian American women

    Directory of Open Access Journals (Sweden)

    Ma GX

    2012-05-01

    Full Text Available Grace X Ma,1 Wanzhen Gao,1 Sunmin Lee,2 MinQi Wang,3 Yin Tan,1 Steven E Shive,1,41Department of Public Health, Center for Asian Health, College of Health Professions, Temple University, Philadelphia, PA, USA; 2Department of Epidemiology and Biostatistics, School of Public Health, University of Maryland, College Park, MD, USA; 3Department of Public and Community Health, University of Maryland, College Park, Maryland, MD, USA; 4East Stroudsburg University, East Stroudsburg, PA, USAObjective: The purpose of this community-based study was to apply a Sociocultural Health Behavior Model to determine the association of factors proposed in the model with breast cancer screening behaviors among Asian American women.Methods: A cross-sectional design included a sample of 682 Chinese, Korean, and Vietnamese women aged 40 years and older. The frequency distribution analysis and Chi-square analysis were used for the initial screening of the following variables: sociodemographic, cultural, enabling, environmental, and social support. Univariate and multivariate analyses were conducted on factors for breast cancer screening using multinomial logistic regression analysis.Results: Correlates to positive breast cancer screening included demographics (ethnicity, cultural factors (living in the United States for 15 years or more, speaking English well, enabling factors (having a regular physician to visit, health insurance covering the screening, and family/social support factors (those who had a family/friend receiving a mammogram.Conclusions: The results of this study suggest that breast cancer screening programs will be more effective if they include the cultural and health beliefs, enabling, and social support factors associated with breast cancer screening. The use of community organizations may play a role in helping to increase breast cancer screening rates among Asian American women.Keywords: breast cancer screening, Vietnamese, Korean, Chinese, breast

  19. International Association for the Study of Lung Cancer Computed Tomography Screening Workshop 2011 report

    DEFF Research Database (Denmark)

    Field, John K; Smith, Robert A; Aberle, Denise R;

    2011-01-01

    , which are summarized in this report. The recommendation from the workshop, and supported by the IASLC Board of Directors, was to set up the Strategic CT Screening Advisory Committee (IASLC-SSAC). The Strategic CT Screening Advisory Committee is currently engaging professional societies and organizations...... who are stakeholders in lung cancer CT screening implementation across the globe, to focus on delivering guidelines and recommendations in six specific areas: (i) identification of high-risk individuals for lung cancer CT screening programs; (ii) develop radiological guidelines for use in developing...... of suspicious nodules identified through lung cancer CT screening programs; and (vi) integration of smoking cessation practices into future national lung cancer CT screening programs....

  20. CD5-positive marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT of the lung

    Directory of Open Access Journals (Sweden)

    Terada Tadashi

    2012-02-01

    Full Text Available Abstract CD5-positive marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT of the lung is very rare. An 82-year-old Japanese woman was found to have an abnormal lung shadow on chest X-ray photography, and was admitted to our hospital. Imaging modalities including X-ray photography, computed tomography, and magnetic resonance imaging showed a small (2 × 1 × 1 cm opacity of the right upper lobe. Transbronchial lung biopsy was performed. It showed severe proliferation of small lymphocytes. The small lymphocytes were centrocytes-like, and minor plasma cell differentiation was recognized. Lymphoepithelial lesions were scattered. Immunohistochemically, the tumor cells were positive for CD5, CD20, CD43, CD45, CD79α, bcl-2, and κ-chain, but negative for CD2, CD3, CD10, CD21, CD23, CD35, CD45RO, CD56, IgA, IgG, IgM, IgD, λ-chain, TdT, and cyclin D1. The Ki-67 labeling was 10%. CD3-positive and CD45RO-positive inflammatory T-cells were scattered in small amount. The pathological diagnosis was CD5-positive marginal zone B-cell lymphoma of the mucosa-associated lymphoid tissue (MALT of the lung. The patient was treated with chemotherapy (CHOP: cyclophosphamide, hydroxydaunorbicin, vincristine, and predonisone, and the lung tumor disappeared. The patient is now free of the lymphoma 10 years after the first manifestation. Virtual slides The virtual slide(s for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1541653085652296

  1. Metagenes Associated with Survival in Non-Small Cell Lung Cancer

    OpenAIRE

    Egon Urgard; Tõnu Vooder; Urmo Võsa; Kristjan Välk; Mingming Liu; Cheng Luo; Fabian Hoti; Retlav Roosipuu; Tarmo Annilo; Jukka Laine; Frenz, Christopher M.; Liqing Zhang; Andres Metspalu

    2011-01-01

    NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expressio...

  2. Association of DNA repair gene XRCC1 and lung cancer susceptibility among nonsmoking Chinese women

    DEFF Research Database (Denmark)

    Yin, J.; Vogel, Ulla Birgitte; Ma, Y.;

    2009-01-01

    predisposition to cancer risk. To address this question in more detail, we conducted a hospital-based case-control study consisting of 55 lung cancer cases and 74 cancer-free controls matched on age and ethnicity among nonsmoking Chinese women. We analyzed five coding single-nucleotide polymorphisms in the XRCC1...... the haplotype encompassing the variant alleles may contribute to susceptibility of lung cancer in a Chinese population....

  3. Expression of the GLI family genes is associated with tumor progression in advanced lung adenocarcinoma

    OpenAIRE

    Ishikawa, Masashi; Sonobe, Makoto; Imamura, Naoto; Sowa, Terumasa; Shikuma, Kei; Date, Hiroshi

    2014-01-01

    Background The hedgehog (Hh) signaling pathway is aberrantly activated in various cancers. Expression of the GLI family of genes, which encode for transcriptional factors of the Hh pathway, has not been fully assessed in clinical samples of advanced lung adenocarcinoma. In this study, we retrospectively evaluated the expression of the GLI family of genes in advanced stage lung adenocarcinoma samples and determined their relation to patient survival. Methods The levels of GLI1, GLI2, and GLI3 ...

  4. The International Association for the Study of Lung Cancer Consensus Statement on Optimizing Management of EGFR Mutation-Positive Non-Small Cell Lung Cancer: Status in 2016.

    Science.gov (United States)

    Tan, Daniel S W; Yom, Sue S; Tsao, Ming S; Pass, Harvey I; Kelly, Karen; Peled, Nir; Yung, Rex C; Wistuba, Ignacio I; Yatabe, Yasushi; Unger, Michael; Mack, Philip C; Wynes, Murry W; Mitsudomi, Tetsuya; Weder, Walter; Yankelevitz, David; Herbst, Roy S; Gandara, David R; Carbone, David P; Bunn, Paul A; Mok, Tony S K; Hirsch, Fred R

    2016-07-01

    Mutations in the epidermal growth factor receptor gene (EGFR) represent one of the most frequent "actionable" alterations in non-small cell lung cancer (NSCLC). Typified by high response rates to targeted therapies, EGFR tyrosine kinase inhibitors (TKIs) are now established first-line treatment options and have transformed the treatment paradigm for NSCLC. With the recent breakthrough designation and approval of the third-generation EGFR TKI osimertinib, available systemic and local treatment options have expanded, requiring new clinical algorithms that take into account individual patient molecular and clinical profiles. In this International Association for the Study of Lung Cancer commissioned consensus statement, key pathologic, diagnostic, and therapeutic considerations, such as optimal choice of EGFR TKI and management of brain metastasis, are discussed. In addition, recommendations are made for clinical guidelines and research priorities, such as the role of repeat biopsies and use of circulating free DNA for molecular studies. With the rapid pace of progress in treating EGFR-mutant NSCLC, this statement provides a state-of-the-art review of the contemporary issues in managing this unique subgroup of patients. PMID:27229180

  5. Autosomal Recessive Congenital Ichthyosis in American Bulldogs Is Associated With NIPAL4 (ICHTHYIN) Deficiency.

    Science.gov (United States)

    Mauldin, E A; Wang, P; Evans, E; Cantner, C A; Ferracone, J D; Credille, K M; Casal, M L

    2015-07-01

    A minority of patients with nonsyndromic autosomal recessive congenital ichthyosis (ARCI) display mutations in NIPAL4 (ICHTHYIN). This protein plays a role in epidermal lipid metabolism, although the mechanism is unknown. The study describes a moderate form of ARCI in an extended pedigree of American Bulldogs that is linked to the gene encoding ichthyin. The gross phenotype was manifest as a disheveled pelage shortly after birth, generalized scaling, and adherent brown scale with erythema of the abdominal skin. Pedigree analysis indicated an autosomal recessive mode of inheritance. Ultrastructurally, the epidermis showed discontinuous lipid bilayers, unprocessed lipid within corneocytes, and abnormal lamellar bodies. Linkage analysis, performed by choosing simple sequence repeat markers and single-nucleotide polymorphisms near genes known to cause ACRI, revealed an association with NIPAL4. NIPAL4 was identified and sequenced using standard methods. No mutation was identified within the gene, but affected dogs had a SINE element 5' upstream of exon 1 in a highly conserved region. Of 545 DNA samples from American Bulldogs, 32 dogs (17 females, 15 males) were homozygous for the polymerase chain reaction fragment. All affected dogs were homozygous, with parents heterozygous for the insertion. Immunolabeling revealed an absence of ichthyin in the epidermis. This is the first description of ARCI associated with decreased expression of NIPAL4 in nonhuman species. PMID:25322746

  6. Association of acculturative stress, Islamic practices, and internalizing symptoms among Arab American adolescents.

    Science.gov (United States)

    Goforth, Anisa N; Pham, Andy V; Chun, Heejung; Castro-Olivo, Sara M; Yosai, Erin R

    2016-06-01

    Although the numbers of Arab American immigrant youth in schools is increasing, there is little understanding of their mental health and the sociocultural factors that might influence it. This study examined the relationship between 2 sociocultural factors (i.e., acculturative stress and religious practices) and internalizing symptoms in first- and second-generation Muslim Arab American adolescents. Adolescents (n = 88) ages 11 to 18 completed measures related to acculturative stress, religious practices, internalizing symptoms, and general demographic information. Results of multiple regression analyses found that acculturative stress significantly predicted internalizing symptoms. Gender was found to moderate this association. No differences in the reported acculturative stress and internalizing symptoms were found between youth of different generational status (i.e., first- vs. second-generation). Finally, adolescents' organizational religious practices, but not their private religious practices, were found to be associated with lower acculturative stress. Implications are discussed related to how school psychologists can provide culturally responsive services to this population. (PsycINFO Database Record PMID:27243243

  7. Association of CYP2A6*4 with susceptibility of lung cancer: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Lishan Wang

    Full Text Available To assess the association between the variant of Cytochrome P450 2A6 whole gene deletion (CYP2A6*4 polymorphism and risk of lung cancer.Two investigators independently searched the PubMed, Elsevier, EMBASE, Web of Science, Wiley Online Library and Chinese National Knowledge Infrastructure (CNKI. Pooled odds ratios (ORs and 95% confidence intervals (95% CIs for CYP2A6*4 and lung cancer were calculated in a fixed-effects model (the Mantel-Haenszel method and a random-effects model (the DerSimonian and Laird method when appropriate.This meta-analysis included seven eligible studies, which included 2524 lung cancer cases and 2258 controls (cancer-free. Overall, CYP2A6*4 was associated with the risk of lung cancer (allele*4 vs. allele non-*4, pooled OR  = 0.826, 95% CI  = 0.725-0.941, P-value  = 0.004. When stratifying for population, significant association was observed in Asian (additive model, pooled OR  = 0.794, 95% CI  = 0.694-0.909, P-value  = 0.001; dominant model, pooled OR  = 0.827, 95% CI  = 0.709-0.965, P-value  = 0.016; recessive model (pooled OR  = 0.444, 95% CI  = 0.293-0.675, P-value <0.0001. In the overall analysis, a comparably significant decrease in the frequency of *4/*4 genotype was detected between cases and controls in Asian while no *4/*4 genotype was detected in Caucasian in collected data.This meta-analysis suggests that the CYP2A6*4 polymorphism is associated with susceptibility of lung cancer in Asian. The whole gene deletion of CYP2A6 may decrease the risk of lung cancer in Asian samples.

  8. Reverse-migrated neutrophils regulated by JAM-C are involved in acute pancreatitis-associated lung injury

    OpenAIRE

    Deqing Wu; Yue Zeng; Yuting Fan; Jianghong Wu; Tunike Mulatibieke; Jianbo Ni; Ge Yu; Rong Wan; Xingpeng Wang; Guoyong Hu

    2016-01-01

    Junctional adhesion molecule-C (JAM-C) plays a key role in the promotion of the reverse transendothelial migration (rTEM) of neutrophils, which contributes to the dissemination of systemic inflammation and to secondary organ damage. During acute pancreatitis (AP), systemic inflammatory responses lead to distant organ damage and typically result in acute lung injury (ALI). Here, we investigated the role of rTEM neutrophils in AP-associated ALI and the molecular mechanisms by which JAM-C regula...

  9. Screening Metastasis-associated Genes from Anoikis Resistant A549 Lung Cancer Cells by Human Genome Array

    Directory of Open Access Journals (Sweden)

    Xiaoping WANG

    2010-01-01

    Full Text Available Background and objective As a barrier to metastases, cells normally undergo apoptosis after they lose contact with their extra cellular matrix (ECM. This process has been termed “anoikis”. Tumour cells that acquire malignant potential have developed mechanisms to resist anoikis and thereby survive after detachment from their primary site while traveling through the lymphatic and circulatory systems. This “anoikis resistance” is considered the first step to tumor metastases. The aim of this study was to screen metastasis-associated genes from anoikis resistant and adherent growth A549 lung cancer cell by Human Genome Array. Methods Establish anoikis resistant A549 lung cancer cell lines by using poly-hydroxyethyl methacrylate resin processed petri dishes, which causes cell free from adherent. The different expressed gene between anoikis resistant A549 cell and adherent growth A549 cell was tested using human V2.0 whole-genome oligonucleotide microarray, a product of Capitalbio Corporation, Beijing. Screen metastasis-associated genes. Results 745 different expressed genes were screened, including 63 highly metastasis-associated genes. Conclusion The successfully established anoikis resistant A549 cell lines and screened different expressed genes provide us basis for further research on metastasis of lung cancer.

  10. Radiation dose is associated with prognosis of small cell lung cancer with superior vena cava syndrome

    Science.gov (United States)

    Wang, Zhen-Bo; Ning, Fang-Ling; Wang, Xiao-Le; Cheng, Yu-Feng; Dong, Xin-Jun; Liu, Chang-Min; Chen, Shao-Shui

    2015-01-01

    Approximately 10% of small cell lung cancer (SCLC) cases develop superior vena cava syndrome (SVCS). Many SCLC patients with SVCS have relatively limited disease, requiring curative rather than palliative treatment. Besides chemotherapy, radiotherapy is important for treating SCLC with SVCS. We retrospectively evaluated the influence of radiotherapy dose on the prognosis of 57 patients with SCLC with SVCS treated with concurrent chemoradiotherapy. The mean biological equivalent radiation dose was 71.5 Gy. We administered etoposide/cisplatin as sequential and concurrent chemotherapy. All patients received at least one cycle of concurrent chemotherapy. All patients had partial or complete response; SVCS-associated symptoms were reduced in 87.7% (50/57) of patients within 3-10 days after treatment. Radiation dose did not affect 2-year local control (74.2% vs. 80.8%). Patients who received high-dose radiation had a lower 2-year overall survival rate than those who received low-dose radiation (11.6 vs. 33%; P = 0.024). The high dose group median survival was 15.0 months (95% confidence interval [CI]: 11.2-19.0) compared with 18.7 months (95% CI: 13.9-23.6) in the low dose group. Grade 3/4 neutropenia occurred in 22/26 high dose patients (84.6%) and 21/31 low dose patients (67.7%). In the high dose group, 30.8% of patients had grade 3/4 esophagitis compared with 19.4% of low dose patients. Only 29.0% of low dose patients received < 4 cycles of chemotherapy in the first 12 weeks after treatment began compared with 46.2% of high dose patients. Concurrent chemoradiotherapy is a tolerable modality for treating stage IIIA/IIIB SCLC with SVCS. Moderate-dose radiotherapy is preferable. PMID:26064339

  11. Association Between White Blood Cell Count Following Radiation Therapy With Radiation Pneumonitis in Non-Small Cell Lung Cancer

    International Nuclear Information System (INIS)

    Purpose: Radiation pneumonitis (RP) is an inflammatory response to radiation therapy (RT). We assessed the association between RP and white blood cell (WBC) count, an established metric of systemic inflammation, after RT for non-small cell lung cancer. Methods and Materials: We retrospectively analyzed 366 patients with non-small cell lung cancer who received ≥60 Gy as definitive therapy. The primary endpoint was whether WBC count after RT (defined as 2 weeks through 3 months after RT completion) was associated with grade ≥3 or grade ≥2 RP. Median lung volume receiving ≥20 Gy (V20) was 31%, and post-RT WBC counts ranged from 1.7 to 21.2 × 103 WBCs/μL. Odds ratios (ORs) associating clinical variables and post-RT WBC counts with RP were calculated via logistic regression. A recursive-partitioning algorithm was used to define optimal post-RT WBC count cut points. Results: Post-RT WBC counts were significantly higher in patients with grade ≥3 RP than without (P3/μL for grade ≥3 and ≥2 RP, respectively. Univariate analysis revealed significant associations between post-RT WBC count and grade ≥3 (n=46, OR=2.6, 95% confidence interval [CI] 1.4‒4.9, P=.003) and grade ≥2 RP (n=164, OR=2.0, 95% CI 1.2‒3.4, P=.01). This association held in a stepwise multivariate regression. Of note, V20 was found to be significantly associated with grade ≥2 RP (OR=2.2, 95% CI 1.2‒3.4, P=.01) and trended toward significance for grade ≥3 RP (OR=1.9, 95% CI 1.0-3.5, P=.06). Conclusions: Post-RT WBC counts were significantly and independently associated with RP and have potential utility as a diagnostic or predictive marker for this toxicity

  12. Polymorphisms in GEMIN4 and AGO1 Genes Are Associated with the Risk of Lung Cancer: A Case-Control Study in Chinese Female Non-Smokers

    Directory of Open Access Journals (Sweden)

    Xue Fang

    2016-09-01

    Full Text Available MicroRNA biosynthesis genes can affect the regulatory effect of global microRNAs to target mRNA and hence influence the genesis and development of human cancer. Here, we selected five single nucleotide polymorphisms (SNPs (rs7813, rs2740349, rs2291778, rs910924, rs595961 in two key microRNA biosynthesis genes (GEMIN4 and AGO1 and systematically evaluated the association between these SNPs, the gene-environment interaction and lung cancer risk. To control the impact of cigarette smoking on lung cancer, we recruited Chinese female non-smokers for the study. The total number of lung cancer cases and cancer-free controls were 473 and 395 in the case-control study. Four SNPs showed statistically significant associations with lung cancer risk. After Bonferroni correction, rs7813 and rs595961 were evidently still associated with lung cancer risk. In the stratified analysis, our results revealed that all five SNPs were associated with the risk of lung adenocarcinoma; after Bonferroni correction, significant association was maintained for rs7813, rs910924 and rs595961. Haplotype analysis showed GEMIN4 haplotype C-A-G-T was a protective haplotype for lung cancer. In the combined unfavorable genotype analysis, with the increasing number of unfavorable genotypes, a progressively increased gene-dose effect was observed in lung adenocarcinoma. We also found that individuals exposed to cooking oil fumes showed a relatively high risk of lung cancer, but no interactions were found between cooking oil fume exposure or passive smoking exposure with these SNPs, either on an additive scale or a multiplicative scale. Overall, this is the first study showing that rs7813 and rs595961 could be meaningful as genetic markers for lung cancer risk.

  13. Global DNA methylation loss associated with mercury contamination and aging in the American alligator (Alligator mississippiensis).

    Science.gov (United States)

    Nilsen, Frances M; Parrott, Benjamin B; Bowden, John A; Kassim, Brittany L; Somerville, Stephen E; Bryan, Teresa A; Bryan, Colleen E; Lange, Ted R; Delaney, J Patrick; Brunell, Arnold M; Long, Stephen E; Guillette, Louis J

    2016-03-01

    Mercury is a widespread environmental contaminant with exposures eliciting a well-documented catalog of adverse effects. Yet, knowledge regarding the underlying mechanisms by which mercury exposures are translated into biological effects remains incomplete. DNA methylation is an epigenetic modification that is sensitive to environmental cues, and alterations in DNA methylation at the global level are associated with a variety of diseases. Using a liquid chromatography tandem mass spectrometry-based (LC-MS/MS) approach, global DNA methylation levels were measured in red blood cells of 144 wild American alligators (Alligator mississippiensis) from 6 sites with variable levels of mercury contamination across Florida's north-south axis. Variation in mercury concentrations measured in whole blood was highly associated with location, allowing the comparison of global DNA methylation levels across different "treatments" of mercury. Global DNA methylation in alligators across all locations was weakly associated with increased mercury exposure. However, a much more robust relationship was observed in those animals sampled from locations more highly contaminated with mercury. Also, similar to other vertebrates, global DNA methylation appears to decline with age in alligators. The relationship between age-associated loss of global DNA methylation and varying mercury exposures was examined to reveal a potential interaction. These findings demonstrate that global DNA methylation levels are associated with mercury exposure, and give insights into interactions between contaminants, aging, and epigenetics.

  14. Meta-analysis of loci associated with age at natural menopause in African-American women.

    Science.gov (United States)

    Chen, Christina T L; Liu, Ching-Ti; Chen, Gary K; Andrews, Jeanette S; Arnold, Alice M; Dreyfus, Jill; Franceschini, Nora; Garcia, Melissa E; Kerr, Kathleen F; Li, Guo; Lohman, Kurt K; Musani, Solomon K; Nalls, Michael A; Raffel, Leslie J; Smith, Jennifer; Ambrosone, Christine B; Bandera, Elisa V; Bernstein, Leslie; Britton, Angela; Brzyski, Robert G; Cappola, Anne; Carlson, Christopher S; Couper, David; Deming, Sandra L; Goodarzi, Mark O; Heiss, Gerardo; John, Esther M; Lu, Xiaoning; Le Marchand, Loic; Marciante, Kristin; Mcknight, Barbara; Millikan, Robert; Nock, Nora L; Olshan, Andrew F; Press, Michael F; Vaiyda, Dhananjay; Woods, Nancy F; Taylor, Herman A; Zhao, Wei; Zheng, Wei; Evans, Michele K; Harris, Tamara B; Henderson, Brian E; Kardia, Sharon L R; Kooperberg, Charles; Liu, Yongmei; Mosley, Thomas H; Psaty, Bruce; Wellons, Melissa; Windham, Beverly G; Zonderman, Alan B; Cupples, L Adrienne; Demerath, Ellen W; Haiman, Christopher; Murabito, Joanne M; Rajkovic, Aleksandar

    2014-06-15

    Age at menopause marks the end of a woman's reproductive life and its timing associates with risks for cancer, cardiovascular and bone disorders. GWAS and candidate gene studies conducted in women of European ancestry have identified 27 loci associated with age at menopause. The relevance of these loci to women of African ancestry has not been previously studied. We therefore sought to uncover additional menopause loci and investigate the relevance of European menopause loci by performing a GWAS meta-analysis in 6510 women with African ancestry derived from 11 studies across the USA. We did not identify any additional loci significantly associated with age at menopause in African Americans. We replicated the associations between six loci and age at menopause (P-value < 0.05): AMHR2, RHBLD2, PRIM1, HK3/UMC1, BRSK1/TMEM150B and MCM8. In addition, associations of 14 loci are directionally consistent with previous reports. We provide evidence that genetic variants influencing reproductive traits identified in European populations are also important in women of African ancestry residing in USA.

  15. Global DNA methylation loss associated with mercury contamination and aging in the American alligator (Alligator mississippiensis).

    Science.gov (United States)

    Nilsen, Frances M; Parrott, Benjamin B; Bowden, John A; Kassim, Brittany L; Somerville, Stephen E; Bryan, Teresa A; Bryan, Colleen E; Lange, Ted R; Delaney, J Patrick; Brunell, Arnold M; Long, Stephen E; Guillette, Louis J

    2016-03-01

    Mercury is a widespread environmental contaminant with exposures eliciting a well-documented catalog of adverse effects. Yet, knowledge regarding the underlying mechanisms by which mercury exposures are translated into biological effects remains incomplete. DNA methylation is an epigenetic modification that is sensitive to environmental cues, and alterations in DNA methylation at the global level are associated with a variety of diseases. Using a liquid chromatography tandem mass spectrometry-based (LC-MS/MS) approach, global DNA methylation levels were measured in red blood cells of 144 wild American alligators (Alligator mississippiensis) from 6 sites with variable levels of mercury contamination across Florida's north-south axis. Variation in mercury concentrations measured in whole blood was highly associated with location, allowing the comparison of global DNA methylation levels across different "treatments" of mercury. Global DNA methylation in alligators across all locations was weakly associated with increased mercury exposure. However, a much more robust relationship was observed in those animals sampled from locations more highly contaminated with mercury. Also, similar to other vertebrates, global DNA methylation appears to decline with age in alligators. The relationship between age-associated loss of global DNA methylation and varying mercury exposures was examined to reveal a potential interaction. These findings demonstrate that global DNA methylation levels are associated with mercury exposure, and give insights into interactions between contaminants, aging, and epigenetics. PMID:26748003

  16. Global DNA methylation loss associated with mercury contamination and aging in the American alligator (Alligator mississippiensis)

    Science.gov (United States)

    Nilsen, Frances M.; Parrott, Benjamin B.; Bowden, John A.; Kassim, Brittany L.; Somerville, Stephen E.; Bryan, Teresa A.; Bryan, Colleen E.; Lange, Ted R.; Delaney, J. Patrick; Brunell, Arnold M.; Long, Stephen E.; Guillette, Louis J.

    2016-01-01

    Mercury is a widespread environmental contaminant with exposures eliciting a well-documented catalog of adverse effects. Yet, knowledge regarding the underlying mechanisms by which mercury exposures are translated into biological effects remains incomplete. DNA methylation is an epigenetic modification that is sensitive to environmental cues, and alterations in DNA methylation at the global level are associated with a variety of diseases. Using a liquid chromatography tandem mass spectrometry-based (LC-MS/MS) approach, global DNA methylation levels were measured in red blood cells of 144 wild American alligators (Alligator mississippiensis) from 6 sites with variable levels of mercury contamination across Florida’s north-south axis. Variation in mercury concentrations measured in whole blood was highly associated with location, allowing the comparison of global DNA methylation levels across different “treatments” of mercury. Global DNA methylation in alligators across all locations was weakly associated with increased mercury exposure. However, a much more robust relationship was observed in those animals sampled from locations more highly contaminated with mercury. Also, similar to other vertebrates, global DNA methylation appears to decline with age in alligators. The relationship between age-associated loss of global DNA methylation and varying mercury exposures was examined to reveal a potential interaction. These findings demonstrate that global DNA methylation levels are associated with mercury exposure, and give insights into interactions between contaminants, aging, and epigenetics. PMID:26748003

  17. Daily School Peer Victimization Experiences Among Mexican-American Adolescents: Associations with Psychosocial, Physical and School Adjustment

    OpenAIRE

    Espinoza, Guadalupe; Gonzales, Nancy A.; Fuligni, Andrew J.

    2012-01-01

    School bullying incidents, particularly experiences with victimization, are a significant social and health concern among adolescents. The current study extended past research by examining the daily peer victimization experiences of Mexican-American adolescents and examining how chronic (mean-level) and episodic (daily-level) victimization incidents at school are associated with psychosocial, physical and school adjustment. Across a two-week span, 428 ninth and tenth grade Mexican-American st...

  18. Gender and the Association between Discrimination and Psychological Distress Amongst African Americans in the California Quality of Life Survey

    OpenAIRE

    Glenn, Matthew

    2013-01-01

    Racial discrimination serves as a psychosocial stressor with implications for health, including mental health. Previous research indicates that while African American men report more discrimination events, African American women are at greater risk for some psychiatric conditions. The responses from Black respondents to the California Quality of Life Survey (Cal-QOL) in 2005 and 2007 were analyzed to test the hypothesis that gender moderates the association between discrimination and distres...

  19. AEA Ideology: Campaign Contributions of American Economic Association Members, Committee Members, Officers, Editors, Referees, Authors, and Acknowledgees

    OpenAIRE

    William A. McEachern

    2006-01-01

    This paper investigates the 2004-election-cycle campaign contributions of the leadership of the American Economic Association. By cross-checking a name with an occupation, employer, and address, I develop a contribution profile for a sample of 2,000 AEA members, then use this profile as a benchmark to examine contributions of editors, referees, authors, and acknowledgees of the 2003 and 2004 issues of the American Economic Review, Journal of Economic Literature, and Journal of Economic Perspe...

  20. Examining the Associations of Racism, Sexism, and Stressful Life Events on Psychological Distress among African American Women

    OpenAIRE

    Stevens-Watkins, Danelle; Perry, Brea; Pullen, Erin; Jewell, Jennifer; Oser, Carrie B.

    2014-01-01

    African American women may be susceptible to stressful events and adverse health outcomes as a result of their distinct social location at the intersection of gender and race. Here, racism and sexism are examined concurrently using survey data from 204 African American women residing in a southeastern U.S. urban city. Associations between racism, sexism, and stressful events across social roles and contexts (i.e., social network loss, motherhood and childbirth, employment and finances, person...

  1. Enrichment of the lung microbiome with oral taxa is associated with lung inflammation of a Th17 phenotype.

    Science.gov (United States)

    Segal, Leopoldo N; Clemente, Jose C; Tsay, Jun-Chieh J; Koralov, Sergei B; Keller, Brian C; Wu, Benjamin G; Li, Yonghua; Shen, Nan; Ghedin, Elodie; Morris, Alison; Diaz, Phillip; Huang, Laurence; Wikoff, William R; Ubeda, Carles; Artacho, Alejandro; Rom, William N; Sterman, Daniel H; Collman, Ronald G; Blaser, Martin J; Weiden, Michael D

    2016-01-01

    Microaspiration is a common phenomenon in healthy subjects, but its frequency is increased in chronic inflammatory airway diseases, and its role in inflammatory and immune phenotypes is unclear. We have previously demonstrated that acellular bronchoalveolar lavage samples from half of the healthy people examined are enriched with oral taxa (here called pneumotypeSPT) and this finding is associated with increased numbers of lymphocytes and neutrophils in bronchoalveolar lavage. Here, we have characterized the inflammatory phenotype using a multi-omic approach. By evaluating both upper airway and acellular bronchoalveolar lavage samples from 49 subjects from three cohorts without known pulmonary disease, we observed that pneumotypeSPT was associated with a distinct metabolic profile, enhanced expression of inflammatory cytokines, a pro-inflammatory phenotype characterized by elevated Th-17 lymphocytes and, conversely, a blunted alveolar macrophage TLR4 response. The cellular immune responses observed in the lower airways of humans with pneumotypeSPT indicate a role for the aspiration-derived microbiota in regulating the basal inflammatory status at the pulmonary mucosal surface. PMID:27572644

  2. Genome-wide interrogation identifies YAP1 variants associated with survival of small-cell lung cancer patients.

    Science.gov (United States)

    Wu, Chen; Xu, Binghe; Yuan, Peng; Miao, Xiaoping; Liu, Yu; Guan, Yin; Yu, Dianke; Xu, Jian; Zhang, Tongwen; Shen, Hongbing; Wu, Tangchun; Lin, Dongxin

    2010-12-01

    Although most patients with small-cell lung cancer respond to chemotherapy, the survival time is highly diverse. We conducted a genome-wide analysis to examine whether germline genetic variations are prognostic factors in small-cell lung cancer patients treated with the same chemotherapy regimen. Genome-wide scan of single nucleotide polymorphisms (SNP) was performed using blood DNA to identify genotypes associated with overall survival in 245 patients treated with platinum-based chemotherapy, and the results were replicated in another independent set of 305 patients. Associations were estimated by Cox models and function of the variants was examined by biochemical assays. We found that rs1820453 T>G SNP within the promoter region of YAP1 on chromosome 11q22 and rs716274 A>G SNP in the region of downstream of DYNC2H1 on chromosome 11q22.3 are associated with small-cell lung cancer survival. In pooled analysis of 2 independent cohorts, the adjusted hazard ratio for patients with the rs1820453 TG or GG genotype was 1.49 (95% CI, 1.19-1.85; P = 0.0004) and 1.65 (95% CI, 1.36-2.01; P = 4.76 × 10(-7)), respectively, compared with the TT genotype; and for patients with the rs716274 AG or GG genotype was 1.83 (95% CI, 1.47-2.29; P = 8.74 × 10(-8)) and 2.96 (95% CI, 1.90-4.62; P = 1.59 × 10(-6)), respectively, compared with the AA genotype. Functional analysis showed that the rs1820453 T>G change creates a transcriptional factor binding site and results in downregulation of YAP1 expression. These results suggest that YAP1 may play an important role in prognosis of small-cell lung cancer patients treated with platinum-based chemotherapy.

  3. The Association of Resilience with Mental and Physical Health among Older American Indians: The Native Elder Care Study

    Science.gov (United States)

    Schure, Marc B.; Odden, Michelle; Goins, R. Turner

    2013-01-01

    We examined the association of resilience with measures of mental and physical health in a sample of older American Indians (AIs). A validated scale measuring resilience was administered to 185 noninstitutionalized AIs aged greater than or equal to 55 years. Unadjusted analyses revealed that higher levels of resilience were associated with lower…

  4. Association between XPD (Lys751G1n Polymorphism and Lung Cancer Risk: A Population-Based Study in Iran

    Directory of Open Access Journals (Sweden)

    Majid Motovali-Bashi

    2014-04-01

    Full Text Available Objective: People are usually susceptible to carcinogenic aromatic amines, present in cigarrette smoke and polluted environment, which can cause DNA damage. Therefore, maintenance of genomic DNA integrity is a direct result of proper function of DNA repair enzymes. Polymorphic diversity could affect the function of repair enzymes and thus augment the risk of different cancers. Xeroderma pigmentosum group D (XPD gene encodes one of the most prominent repair enzymes and the polymorphisms of this gene are thought to be of importance in lung cancer risk. This gene encodes the helicase, which is a component of transcription factor IIH and an important part of the nucleotide excision repair system. Studies reveal that individuals with Lys751Gln polymorphism of XPD gene have a low repairing capacity to delete the damages of ultraviolet light among other XPD polymorphisms. Materials and Methods: In this case-control study, first Lys751Gln polymorphism was genotyped, then its association with lung cancer risk was analyzed. Genomic DNA was extracted from the whole blood sample of 640 individuals from Iran (352 healthy individuals and 288 patients. Allele frequencies and heterozygosity of Lys751Gln polymorphism were determined using polymerase chain reaction-restriction fragment length polymorphism method. Results: According to statistical analyses, lung cancer risk in individuals with Lys751Gln polymorphism (Odd Ratio=1.8, 95% Confidence Interval 0.848-3.819 is approximately twice as high as that of Lys/Lys genotype, however 751Gln/Gln genotype did not relate to lung cancer risk (Odd Ratio=0.7, 95% Confidence Interval 0/307-1/595. Conclusion: This study suggests that heterozygous polymorphism (Lys/Gln increases the sensitivity of lung cancer risk, while homozygous polymorphism (Lys/Lys probably decreases its risk and C allele frequency shows no remarkable increase in the patients.

  5. Occupational and environmental hazards associated with lung cancer; Risques professionnels et environnementaux associes au cancer du poumon

    Energy Technology Data Exchange (ETDEWEB)

    Jokel, K.H.; Ahrens, W.; Wichmann, H.E.; Becher, H.; Bolm-Audorff, U.; Jahn, I.; Molik, B.; Greiser, E.; Timm, J.

    1999-06-01

    The authors evaluate the feasibility of a study about the relation between the lung cancer risk assessment and the atmospheric pollution. Many factors are taking into account: the occupational exposure, the nature of the profession, the age but also the nicotinism. The results don't allow conclusions on a possible effect of the atmospheric pollution.

  6. Socioeconomic and nutritional factors account for the association of gastric cancer with Amerindian ancestry in a Latin American admixed population.

    Directory of Open Access Journals (Sweden)

    Latife Pereira

    Full Text Available Gastric cancer is one of the most lethal types of cancer and its incidence varies worldwide, with the Andean region of South America showing high incidence rates. We evaluated the genetic structure of the population from Lima (Peru and performed a case-control genetic association study to test the contribution of African, European, or Native American ancestry to risk for gastric cancer, controlling for the effect of non-genetic factors. A wide set of socioeconomic, dietary, and clinic information was collected for each participant in the study and ancestry was estimated based on 103 ancestry informative markers. Although the urban population from Lima is usually considered as mestizo (i.e., admixed from Africans, Europeans, and Native Americans, we observed a high fraction of Native American ancestry (78.4% for the cases and 74.6% for the controls and a very low African ancestry (<5%. We determined that higher Native American individual ancestry is associated with gastric cancer, but socioeconomic factors associated both with gastric cancer and Native American ethnicity account for this association. Therefore, the high incidence of gastric cancer in Peru does not seem to be related to susceptibility alleles common in this population. Instead, our result suggests a predominant role for ethnic-associated socioeconomic factors and disparities in access to health services. Since Native Americans are a neglected group in genomic studies, we suggest that the population from Lima and other large cities from Western South America with high Native American ancestry background may be convenient targets for epidemiological studies focused on this ethnic group.

  7. An update on the regional organizations of the american burn association.

    Science.gov (United States)

    Harrington, David; Holmes, James; Conlon, Kathe; Jeng, James

    2014-01-01

    In 1985, the American Burn Association (ABA) created 10 regions in the United States and charged the Chiefs of these regions with the development of regional disaster plans. Now more than 25 years after this mandate, the ABA's Organizational and Delivery of Burn Care Committee assessed the status of regional development. The extant region leaders were contacted by email and queried as to the activities of their region and their opinion as to the success or failure of the regionalization initiative. Several regional organizational meetings were attended at the annual ABA meeting and many phone interviews were conducted to clear up any conflicting information. The original map of the burn regions was based on the American College of Surgeons Committee on Trauma regions, but these have undergone significant redistricting. The organizational structure, age, and activities of the regions vary significantly. The financial costs of maintaining a regional organization and holding an annual meeting are a major concern for most regions. For the most part the regional organizations are a good source of professional networking and a cost-effective source of continuing medical education/continuing education units for burn centers. The regionalization experiment of the ABA been reasonably successful in its first 25 years, but the ABA and the regions should take this opportunity to consider the next steps for the regions in the coming 25 years. PMID:23799483

  8. Careers in Medical Physics and the American Association of Physicists in Medicine

    Science.gov (United States)

    Amols, Howard

    2006-03-01

    The American Association of Physicists in Medicine (AAPM), a member society of the AIP is the largest professional society of medical physicists in the world with nearly 5700 members. Members operate in medical centers, university and community hospitals, research laboratories, industry, and private practice. Medical physics specialties include radiation therapy physics, medical diagnostic and imaging physics, nuclear medicine physics, and medical radiation safety. The majority of AAPM members is based in hospital departments of radiation oncology or radiology and provide technical support for patient diagnosis and treatment in a clinical environment. Job functions include support of clinical care, calibration and quality assurance of medical devices such as linear accelerators for cancer therapy, CT, PET, MRI, and other diagnostic imaging devices, research, and teaching. Pathways into a career in medical physics require an advanced degree in medical physics, physics, engineering, or closely related field, plus clinical training in one or more medical physics specialties (radiation therapy physics, imaging physics, or radiation safety). Most clinically based medical physicists also obtain certification from the American Board of Radiology, and some states require licensure as well.

  9. Position of the American Dietetic Association: total diet approach to communicating food and nutrition information.

    Science.gov (United States)

    Freeland-Graves, Jeanne; Nitzke, Susan

    2002-01-01

    It is the position of the American Dietetic Association that all foods can fit into a healthful eating style. The ADA strives to communicate healthful eating messages to the public that emphasize the total diet, or overall pattern of food eaten, rather than any one food or meal. If consumed in moderation with appropriate portion size and combined with regular physical activity, all foods can fit into a healthful diet. Public policies that support the total diet approach include Reference Dietary Intakes, Food Guide Pyramid, Dietary Guidelines for Americans, Nutrition Labeling and Healthy People 2010. The value of a food should be determined within the context of the total diet because classifying foods as "good" or "bad" may foster unhealthy eating behaviors. Eating practices are influenced by taste and food preferences, concerns about nutrition and weight control, physiology, lifestyle, environment, and food product safety. To increase the effectiveness of nutrition education in promoting sensible food choices, dietetics professionals plan communications and educational programs that utilize theories and models related to human behavior. Communication campaigns/programs should implement an active, behaviorally focused approach within the larger context of food choices. Nutrition confusion can be reduced by emphasizing moderation, appropriate portion size, balance and adequacy of the total diet over time, the importance of obtaining nutrients from foods, and physical activity. PMID:11794489

  10. Respiratory Failure Associated with the Lipodystrophy Syndrome in an HIV-Positive Patient with Compromised Lung Function

    Directory of Open Access Journals (Sweden)

    Natasha Press

    2001-01-01

    Full Text Available Protease inhibitors, used as treatment in human immunodeficiency virus (HIV infection, are associated with a syndrome of peripheral lipodystrophy, central adiposity, hyperlipidemia and insulin resistance. An HIV-positive patient with chronic obstructive pulmonary disease is presented who developed the lipodystrophy syndrome that is associated with the use of protease inhibitors. It is postulated that the lipodystrophy syndrome further compromised his lung function, leading to respiratory failure. Patients who have pulmonary disease and are taking protease inhibitors require monitoring of clinical status and pulmonary function tests.

  11. TRANSCULTURALIZATION RECOMMENDATIONS FOR DEVELOPING LATIN AMERICAN CLINICAL PRACTICE ALGORITHMS IN ENDOCRINOLOGY--PROCEEDINGS OF THE 2015 PAN-AMERICAN WORKSHOP BY THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY.

    Science.gov (United States)

    Mechanick, Jeffrey I; Harrell, R Mack; Allende-Vigo, Myriam Z; Alvayero, Carlos; Arita-Melzer, Onix; Aschner, Pablo; Camacho, Pauline M; Castillo, Rogelio Zacarias; Cerdas, Sonia; Coutinho, Walmir F; Davidson, Jaime A; Garber, Jeffrey R; Garvey, W Timothy; González, Fernando Javier Lavalle; Granados, Denis O; Hamdy, Osama; Handelsman, Yehuda; Jiménez-Navarrete, Manuel Francisco; Lupo, Mark A; Mendoza, Enrique J; Jiménez-Montero, José G; Zangeneh, Farhad

    2016-04-01

    The American Association of Clinical Endocrinologists (AACE) and American College of Endocrinology (ACE) convened their first Workshop for recommendations to optimize Clinical Practice Algorithm (CPA) development for Latin America (LA) in diabetes (focusing on glycemic control), obesity (focusing on weight loss), thyroid (focusing on thyroid nodule diagnostics), and bone (focusing on postmenopausal osteoporosis) on February 28, 2015, in San Jose, Costa Rica. A standardized methodology is presented incorporating various transculturalization factors: resource availability (including imaging equipment and approved pharmaceuticals), health care professional and patient preferences, lifestyle variables, socio-economic parameters, web-based global accessibility, electronic implementation, and need for validation protocols. A standardized CPA template with node-specific recommendations to assist the local transculturalization process is provided. Participants unanimously agreed on the following five overarching principles for LA: (1) there is only one level of optimal endocrine care, (2) hemoglobin A1C should be utilized at every level of diabetes care, (3) nutrition education and increased pharmaceutical options are necessary to optimize the obesity care model, (4) quality neck ultrasound must be part of an optimal thyroid nodule care model, and (5) more scientific evidence is needed on osteoporosis prevalence and cost to justify intervention by governmental health care authorities. This 2015 AACE/ACE Workshop marks the beginning of a structured activity that assists local experts in creating culturally sensitive, evidence-based, and easy-to-implement tools for optimizing endocrine care on a global scale. PMID:27031655

  12. Genetic variant in TP63 on locus 3q28 is associated with risk of lung adenocarcinoma among never-smoking females in Asia

    Science.gov (United States)

    Wang, Wen-Chang; Hong, Yun-Chul; Wang, Jiu-Cun; Chen, Kexin; Chang, I-Shou; Chen, Chien-Jen; Lu, Daru; Yin, Zhihua; Wu, Chen; Zheng, Wei; Qian, Biyun; Park, Jae Yong; Kim, Yeul Hong; Chatterjee, Nilanjan; Chen, Ying; Chang, Gee-Chen; Hsiao, Chin-Fu; Yeager, Meredith; Tsai, Ying-Huang; Wei, Hu; Kim, Young Tae; Wu, Wei; Zhao, Zhenhong; Chow, Wong-Ho; Zhu, Xiaoling; Lo, Yen-Li; Sung, Sook Whan; Chen, Kuan-Yu; Yuenger, Jeff; Kim, Joo Hyun; Huang, Liming; Chen, Ying-Hsiang; Gao, Yu-Tang; Kim, Jin Hee; Huang, Ming-Shyan; Jung, Tae Hoon; Caporaso, Neil; Zhao, Xueying; Huan, Zhang; Yu, Dianke; Kim, Chang Ho; Su, Wu-Chou; Shu, Xiao-Ou; Kim, In-San; Bassig, Bryan; Chen, Yuh-Min; Cha, Sung Ick; Tan, Wen; Chen, Hongyan; Yang, Tsung-Ying; Sung, Jae Sook; Wang, Chih-Liang; Li, Xuelian; Park, Kyong Hwa; Yu, Chong-Jen; Ryu, Jeong-Seon; Xiang, Yongbing; Hutchinson, Amy; Kim, Jun Suk; Cai, Qiuyin; Landi, Maria Teresa; Lee, Kyoung-Mu; Hung, Jen-Yu; Park, Ju-Yeon; Tucker, Margaret; Lin, Chien-Chung; Ren, Yangwu; Perng, Reury-Perng; Chen, Chih-Yi; Jin, Li; Chen, Kun-Chieh; Li, Yao-Jen; Chiu, Yu-Fang; Tsai, Fang-Yu; Yang, Pan-Chyr; Fraumeni, Joseph F.; Seow, Adeline; Lin, Dongxin; Zhou, Baosen; Chanock, Stephen; Hsiung, Chao Agnes; Rothman, Nathaniel; Lan, Qing

    2013-01-01

    A recent genome-wide association study (GWAS) of subjects from Japan and South Korea reported a novel association between the TP63 locus on chromosome 3q28 and risk of lung adenocarcinoma (p = 7.3 × 10−12); however, this association did not achieve genome-wide significance (p < 10−7) among never-smoking males or females. To determine if this association with lung cancer risk is independent of tobacco use, we genotyped the TP63 SNPs reported by the previous GWAS (rs10937405 and rs4488809) in 3,467 never-smoking female lung cancer cases and 3,787 never-smoking female controls from 10 studies conducted in Taiwan, Mainland China, South Korea, and Singapore. Genetic variation in rs10937405 was associated with risk of lung adenocarcinoma [n = 2,529 cases; p = 7.1 × 10−8; allelic risk = 0.80, 95% confidence interval (CI) = 0.74–0.87]. There was also evidence of association with squamous cell carcinoma of the lung (n = 302 cases; p = 0.037; allelic risk = 0.82, 95% CI = 0.67–0.99). Our findings provide strong evidence that genetic variation in TP63 is associated with the risk of lung adenocarcinoma among Asian females in the absence of tobacco smoking. PMID:22367405

  13. Overexpression of CHD1L is positively associated with metastasis of lung adenocarcinoma and predicts patients poor survival.

    Science.gov (United States)

    He, Li-Ru; Ma, Ning-Fang; Chen, Jie-Wei; Li, Bin-Kui; Guan, Xin-Yuan; Liu, Meng-Zhong; Xie, Dan

    2015-10-13

    CHD1L (chromodomain helicase/ATPase DNA binding protein 1-like gene) has been demonstrated as an oncogene in hepatocellular carcinoma (HCC), however, the role of CHD1L in non-small-cell lung cancer (NSCLC) tumorigenesis hasn't been elucidated. In this study, the expression and amplification status of CHD1L were examined by immunohistochemistry and fluorescence in situ hybridization respectively in 248 surgically resected NSCLCs. The associations between CHD1L expression and clinicopathologic features and the prognostic value of CHD1L were analyzed. Overexpression and amplification of CHD1L was found in 42.1% and 17.7% of NSCLCs, respectively. The frequency of CHD1L overexpression (53.2% vs. 28.1%, P = 0.002) and amplification (25.2% vs. 8.2%, P = 0.020) in adenocarcinoma (ADC), was much higher than that in squamous cell carcinoma (SCC). CHD1L overexpression was associated closely with ascending pN status (P lung ADC, and might serve as a novel prognostic biomarker and potential therapeutic target for lung ADC patients.

  14. Altered gene expression profiles of NIH3T3 cells regulated by human lung cancer associated gene CT120

    Institute of Scientific and Technical Information of China (English)

    Xiang Huo HE; Jin Jun LI; Yi Hu XIE; Yun Tian TANG; Gen Fu YAO; Wen Xin QIN; Da Fang WAN; Jian Ren GU

    2004-01-01

    CT120, a novel membrane-associated gene implicated in lung carcinogenesis, was previously identified from chromosome 17p13.3 locus, a hot mutation spot involved in human malignancies. In the present study, we further determined that CT120 ectopic expression could promote cell proliferation activity of NIH3T3 cells using MTS assay, and monitored the downstream effects of CT120 in NIH3T3 cells with Atlas mouse cDNA expression arrays. Among 588known genes, 133 genes were found to be upregulated or downregulated by CT120. Two major signaling pathways involved in cell proliferation, cell survival and anti-apoptosis were overexpressed and activated in response to CT120:One is the Raf/MEK/Erk signal cascades and the other is the PI3K/Akt signal cascades, suggesting that CT120 might contribute, at least in part, to the constitutively activation of Erk and Akt in human lung caner cells. In addition, some tumor metastasis associated genes cathepsin B, cathepsin D, cathepsin L, MMP-2/TIMP-2 were also upregulated by CT120, upon which CT120 might be involved in tumor invasiveness and metastasis. In addition, CT120 might play an important role in tumor progression through modulating the expression of some candidate "Lung Tumor Progression"genes including B-Raf, Rab-2, BAX, BAG-1, YB-1, and Cdc42.

  15. Association between HLA-C*04 and American cutaneous leishmaniasis in endemic region of southern Brazil.

    Science.gov (United States)

    Ribas-Silva, R C; Ribas, A D; Ferreira, E C; Silveira, T G V; Borelli, S D

    2015-11-23

    Leishmaniasis is a parasitic infectious disease with global repercussions. American cutaneous leishmaniasis (ACL) is endemic in southern Brazil and its pathogenesis varies according to parasite species, immune response, and host genetics. In terms of immunogenetics, many host genes, including HLA (human leukocyte antigen), could be involved in susceptibility to and protection against ACL. Accordingly, the aim of this study was to investigate the association between HLA class I genes (HLA-A, -B, and -C) and ACL in an endemic region of southern Brazil. The allele frequencies of 186 patients diagnosed with ACL and 278 healthy individuals were compared. HLA class I (HLA-A, -B, and -C) typing was carried out by PCR-SSO using Luminex technology. The results revealed an association between the HLA-C*04 allele and the patient study group, in which it appeared more frequently than in the control group [21.5 vs 13.49% (P = 0.0016 and Pc = 0.0258; OR = 1.7560; 95%CI = 1.2227-2.5240)], thereby suggesting an increased susceptibility to ACL. Additional allelic groups such as HLA-A*02, HLA-B*35, HLA-B*45, HLA-C*01, and HLA-C*15 were also implicated; however, further investigation is necessary to confirm their association with ACL. Therefore, the results obtained in this study demonstrate the involvement of HLA class I genes in the susceptibility or resistance to ACL, with significant association between HLA-C*04 and ACL susceptibility.

  16. The relevance of "Nonsmoking-associated lung cancer" in India: A single-centre experience

    Directory of Open Access Journals (Sweden)

    A Krishnamurthy

    2012-01-01

    Full Text Available Background: Lung cancer remains a major cause of morbidity and mortality worldwide, accounting for more deaths than any other cancer cause. Aim: The aim of this study was to analyze the clinical profile and the epidemiological trends in lung cancer patients from a single centre with an emphasis on the smoking practices. Materials and Methods: This is a retrospective analysis of prospectively collected data of 258 consecutive hospital in-patients with a proven diagnosis of lung cancer at a tertiary care oncology centre between 2003 and 2007. Results: The median age of patients in our study was 56 years; the male to female ratio was approximately 3.5:1. Non-small-cell lung cancer (NSCLC was the predominant histology in 224 patients; the histology in the remaining 34 patients was small-cell carcinoma. Within NSCLC, the most common histology was adenocarcinoma followed by squamous cell carcinoma. One hundred and two patients were never-smokers as compared to 156 patients who were ever-smokers. Among the smokers, the majority of them were found to be cigarette smokers compared to 28.2% bidi smokers. There was a very significant correlation found with adenocarcinoma among nonsmokers, and with squamous cell carcinoma among the smokers compared to non-smokers. Conclusions: Our study suggests that the epidemiology of lung cancer in India is possibly changing, with close to 40% of our lung cancer patients being nonsmokers. More importantly, our study reflects the global trend of rise in adenocarcinoma histology. These observations need to be substantiated in similar studies of larger magnitude, preferably population-based.

  17. Bayesian inference of the lung alveolar spatial model for the identification of alveolar mechanics associated with acute respiratory distress syndrome

    Science.gov (United States)

    Christley, Scott; Emr, Bryanna; Ghosh, Auyon; Satalin, Josh; Gatto, Louis; Vodovotz, Yoram; Nieman, Gary F.; An, Gary

    2013-06-01

    Acute respiratory distress syndrome (ARDS) is acute lung failure secondary to severe systemic inflammation, resulting in a derangement of alveolar mechanics (i.e. the dynamic change in alveolar size and shape during tidal ventilation), leading to alveolar instability that can cause further damage to the pulmonary parenchyma. Mechanical ventilation is a mainstay in the treatment of ARDS, but may induce mechano-physical stresses on unstable alveoli, which can paradoxically propagate the cellular and molecular processes exacerbating ARDS pathology. This phenomenon is called ventilator induced lung injury (VILI), and plays a significant role in morbidity and mortality associated with ARDS. In order to identify optimal ventilation strategies to limit VILI and treat ARDS, it is necessary to understand the complex interplay between biological and physical mechanisms of VILI, first at the alveolar level, and then in aggregate at the whole-lung level. Since there is no current consensus about the underlying dynamics of alveolar mechanics, as an initial step we investigate the ventilatory dynamics of an alveolar sac (AS) with the lung alveolar spatial model (LASM), a 3D spatial biomechanical representation of the AS and its interaction with airflow pressure and the surface tension effects of pulmonary surfactant. We use the LASM to identify the mechanical ramifications of alveolar dynamics associated with ARDS. Using graphical processing unit parallel algorithms, we perform Bayesian inference on the model parameters using experimental data from rat lung under control and Tween-induced ARDS conditions. Our results provide two plausible models that recapitulate two fundamental hypotheses about volume change at the alveolar level: (1) increase in alveolar size through isotropic volume change, or (2) minimal change in AS radius with primary expansion of the mouth of the AS, with the implication that the majority of change in lung volume during the respiratory cycle occurs in the

  18. Bayesian inference of the lung alveolar spatial model for the identification of alveolar mechanics associated with acute respiratory distress syndrome

    International Nuclear Information System (INIS)

    Acute respiratory distress syndrome (ARDS) is acute lung failure secondary to severe systemic inflammation, resulting in a derangement of alveolar mechanics (i.e. the dynamic change in alveolar size and shape during tidal ventilation), leading to alveolar instability that can cause further damage to the pulmonary parenchyma. Mechanical ventilation is a mainstay in the treatment of ARDS, but may induce mechano-physical stresses on unstable alveoli, which can paradoxically propagate the cellular and molecular processes exacerbating ARDS pathology. This phenomenon is called ventilator induced lung injury (VILI), and plays a significant role in morbidity and mortality associated with ARDS. In order to identify optimal ventilation strategies to limit VILI and treat ARDS, it is necessary to understand the complex interplay between biological and physical mechanisms of VILI, first at the alveolar level, and then in aggregate at the whole-lung level. Since there is no current consensus about the underlying dynamics of alveolar mechanics, as an initial step we investigate the ventilatory dynamics of an alveolar sac (AS) with the lung alveolar spatial model (LASM), a 3D spatial biomechanical representation of the AS and its interaction with airflow pressure and the surface tension effects of pulmonary surfactant. We use the LASM to identify the mechanical ramifications of alveolar dynamics associated with ARDS. Using graphical processing unit parallel algorithms, we perform Bayesian inference on the model parameters using experimental data from rat lung under control and Tween-induced ARDS conditions. Our results provide two plausible models that recapitulate two fundamental hypotheses about volume change at the alveolar level: (1) increase in alveolar size through isotropic volume change, or (2) minimal change in AS radius with primary expansion of the mouth of the AS, with the implication that the majority of change in lung volume during the respiratory cycle occurs in the

  19. New cholesterol guidelines for the management of atherosclerotic cardiovascular disease risk: a comparison of the 2013 American College of Cardiology/American Heart Association cholesterol guidelines with the 2014 National Lipid Association recommendations for patient-centered management of dyslipidemia.

    Science.gov (United States)

    Adhyaru, Bhavin B; Jacobson, Terry A

    2015-05-01

    This review discusses the 2013 American College of Cardiology (ACC)/American Heart Association (AHA) Guideline on the Treatment of Blood Cholesterol to Reduce Atherosclerotic Cardiovascular Risk in Adults and compares it with the 2014 National Lipid Association (NLA) Recommendations for Patient-Centered Management of Dyslipidemia. The review discusses some of the distinctions between the guidelines, including how to determine a patient's atherosclerotic cardiovascular disease risk, the role of lipoprotein treatment targets, the importance of moderate- and high-intensity statin therapy, and the use of nonstatin therapy in light of the IMProved Reduction of Outcomes: Vytorin Efficacy International Trial (IMPROVE-IT) trial.

  20. Chemoradiotherapy for lung cancer

    International Nuclear Information System (INIS)

    Lung cancer remains a disease associated with a poor prognosis. Chemoradiotherapy is performed for unresectable stage 3 non-small cell lung cancer (NSCLC) and inoperable limited-disease small cell lung cancer. In this lecture, chemoradiotherapy for lung cancer is outlined primary according to the 2014 edition of the Clinical Practice Guidelines for Lung Cancer, and also referring to molecular targeted drugs, radiation pneumonitis, and particle radiotherapy. (author)

  1. Down-Regulation of SIX3 is Associated with Clinical Outcome in Lung Adenocarcinoma

    OpenAIRE

    Min-Li Mo; Junichi Okamoto; Zhao Chen; Tomomi Hirata; Iwao Mikami; Geneviève Bosco-Clément; Hui Li; Hai-Meng Zhou; Jablons, David M; Biao He

    2013-01-01

    BACKGROUND: Lung cancer is a common cancer and the leading cause of cancer-related death worldwide. SIX3 is a human homologue of the highly conserved sine oculis gene family essential during embryonic development in vertebrates, and encodes a homeo-domain containing transcription factor. Little is known about the role of SIX3 in human tumorigenesis. This study is to assess the expression/function of SIX3 and the significance of SIX3 as a prognostic biomarker in lung adenocarcinoma. METHODS: Q...

  2. Smoking is associated with increased levels of extracellular peptidylarginine deiminase 2 (PAD2) in the lungs

    DEFF Research Database (Denmark)

    Damgaard, Dres; Friberg Bruun Nielsen, Michael; Quisgaard Gaunsbaek, Maria;

    2015-01-01

    lavage (BAL) fluid from smokers, but intracellularly located PAD cannot be responsible for citrullination of extracellular self-antigens. We aimed to establish a link between smoking and extracellular PAD2 in the lungs. METHODS: BAL fluid samples were obtained from 13 smokers and 11 nonsmoking controls...... fluids from smokers as compared to non-smokers (p=0.018). The PAD2 content correlated with the overall CRP levels (p=0.009) and cell count (p=0.016). CONCLUSIONS: This first demonstration of increased levels of extracellular PAD2 in the lungs of smokers supports the hypothesis that smoking promotes...

  3. Targeted therapies and radiotherapy in lung cancer; Les therapeutiques ciblees en association avec la radiotherapie dans le cancer bronchique

    Energy Technology Data Exchange (ETDEWEB)

    Hennequin, C. [Hopital Saint-Louis (APHP), Serv. de Cancerologie-radiotherapie, 75 - Paris (France); Institut Curie-Orsay, Unite Inserm 612, Centre Universitaire, 91 - Orsay (France)

    2007-01-15

    Targeted therapies are now more often used in lung cancer. Inhibitors of EGFR and of angiogenesis have demonstrated a certain activity in this disease. Some experimental in vitro or in vivo studies are in favour of combined targeted therapies and radiation. For example, additive or supra-additive effects have been shown when inhibitors of the EGFR tyrosine kinase were given with radiation. In advanced lung cancer, the combination of bevacizumab with chemotherapy was demonstrated to produce better survival outcomes. But a high rate of fatal hemoptysis was reported with this drug, particularly for central and squamous tumors. This could be a limitation for its use in combination with radiation. Drugs with multiple targets are becoming available; their association with radiation seems to be promising. (author)

  4. Cell type specificity of female lung cancer associated with sulfur dioxide from air pollutants in Taiwan: An ecological study

    Directory of Open Access Journals (Sweden)

    Tseng Ching-Yu

    2012-01-01

    Full Text Available Abstract Background Many studies have examined the association between air pollutants (including sulfur dioxide [SO2], carbon monoxide [CO], nitrogen dioxide [NO2], nitric oxide [NO], ozone [O3], and particulate matter 10] and lung cancer. However, data from previous studies on pathological cell types were limited, especially for SO2 exposure. We aimed to explore the association between SO2 exposure from outdoor air pollutants and female lung cancer incidence by cell type specificity. Methods We conducted an ecological study and calculated annual average concentration of 6 air pollutants (SO2, CO, NO2, NO, O3, and PM10 using data from Taiwan Environmental Protection Administration air quality monitoring stations. The Poisson regression models were used to evaluate the association between SO2 and age-standardized incidence rate of female lung cancer by two major pathological types (adenocarcinoma [AC] and squamous cell carcinoma [SCC]. In order to understand whether there is a dose-response relationship between SO2 and two major pathological types, we analyzed 4 levels of exposure based on quartiles of concentration of SO2. Results The Poisson regression results showed that with the first quartile of SO2 concentration as the baseline, the relative risks for AC/SCC type cancer among females were 1.20 (95% confidence interval [CI], 1.04-1.37/1.39 (95% CI, 0.96-2.01 for the second, 1.22 (95% CI, 1.04-1.43/1.58 (95% CI, 1.06-2.37 for the third, and 1.27 (95% CI, 1.06-1.52/1.80 (95% CI, 1.15-2.84 for the fourth quartile of SO2 concentration. The tests for trend were statistically significant for both AC and SCC at P = 0.0272 and 0.0145, respectively. Conclusion The current study suggests that SO2 exposure as an air pollutant may increase female lung cancer incidence and the associations with female lung cancer is much stronger for SCC than for AC. The findings of this study warrant further investigation on the role of SO2 in the etiology of SCC.

  5. Position of the American Dietetic Association, School Nutrition Association, and Society for Nutrition Education: comprehensive school nutrition services.

    Science.gov (United States)

    Briggs, Marilyn; Mueller, Constance G; Fleischhacker, Sheila

    2010-11-01

    It is the position of the American Dietetic Association (ADA), School Nutrition Association (SNA), and Society for Nutrition Education (SNE) that comprehensive, integrated nutrition services in schools, kindergarten through grade 12, are an essential component of coordinated school health programs and will improve the nutritional status, health, and academic performance of our nation's children. Local school wellness policies may strengthen comprehensive nutrition services by encouraging multidisciplinary wellness teams, composed of school and community members, to work together in identifying local school needs, developing feasible strategies to address priority areas, and integrating comprehensive nutrition services with a coordinated school health program. This joint position paper affirms schools as an important partner in health promotion. To maximize the impact of school wellness policies on strengthening comprehensive, integrated nutrition services in schools nationwide, ADA, SNA, and SNE recommend specific strategies in the following key areas: nutrition education and promotion, food and nutrition programs available on the school campus, school-home-community partnerships, and nutrition-related health services. PMID:21061737

  6. The Revised 2016 Korean Thyroid Association Guidelines for Thyroid Nodules and Cancers: Differences from the 2015 American Thyroid Association Guidelines

    Science.gov (United States)

    2016-01-01

    Increased detection of thyroid nodules using high-resolution ultrasonography has resulted in a world-wide increase in the incidence of differentiated thyroid cancer (DTC). Despite the steep increase in its incidence, the age-standardized mortality rate of thyroid cancer has remained stable, which leads toward a trend of more conservative treatment. The latest American Thyroid Association (ATA) guidelines for thyroid nodules and thyroid cancer revised in 2015 suggested that fine needle aspiration biopsy should be performed for thyroid nodules larger than 1 cm and lobectomy might be sufficient for 1 to 4 cm intrathyroidal DTC. In addition, active surveillance instead of immediate surgical treatment was also recommended as a treatment option for papillary thyroid microcarcinoma based on the results of a few observational studies from Japan. The Korean Thyroid Association (KTA) has organized a task force team to develop revised guidelines for thyroid nodules and DTC after an extensive review of articles and intense discussion on whether we should accept the changes in the 2015 ATA guidelines. This paper introduces and discusses the updated major issues and differences in the ATA and the KTA guidelines. PMID:27704738

  7. Genetic Variation in BCL2 3′-UTR Was Associated with Lung Cancer Risk and Prognosis in Male Chinese Population

    OpenAIRE

    Xu, Ping; Liu, Li; Wang, Jianzhong; Zhang, Kai; Hong, Xiaohua; Deng, Qifei; Xiang, Jingjun; Zhang, Xiaomin; He, Meian; WU, TANGCHUN; Guo, Huan

    2013-01-01

    Objectives Bcl-2 is a critical apoptosis inhibitor with established carcinogenic potential, and can confer cancer cell resistance to therapeutic treatments by activating anti-apoptotic cellular defense. We hypothesized that genetic variants of BCL2 gene may be associated with lung cancer susceptibility and prognosis. Methods Three selected tagSNPs of BCL2 (rs2279115, rs1801018, and rs1564483) were genotyped in 1017 paired male Chinese lung cancer cases and controls by TaqMan assay. The associ...

  8. The dose–response association of urinary metals with altered pulmonary function and risks of restrictive and obstructive lung diseases: a population-based study in China

    OpenAIRE

    Feng, Wei; Huang, Xiji; Zhang, Ce; Liu, Chuanyao; Cui, Xiuqing; Zhou, Yun; Sun, Huizhen; Qiu, Gaokun; Guo, Huan; He, Meian; Zhang, Xiaomin; Yuan, Jing; Chen, Weihong; WU, TANGCHUN

    2015-01-01

    Objective Reduced pulmonary function is an important predictor of environment-related pulmonary diseases; however, evidence of an association between exposures to various metals from all possible routes and altered pulmonary function is limited. We aimed to investigate the association of various metals in urine with pulmonary function, restrictive lung disease (RLD) and obstructive lung disease (OLD) risks in the general Chinese population. Design A cross-sectional investigation in the Wuhan ...

  9. Human mesenchymal stromal cells reduce influenza A H5N1-associated acute lung injury in vitro and in vivo.

    Science.gov (United States)

    Chan, Michael C W; Kuok, Denise I T; Leung, Connie Y H; Hui, Kenrie P Y; Valkenburg, Sophie A; Lau, Eric H Y; Nicholls, John M; Fang, Xiaohui; Guan, Yi; Lee, Jae W; Chan, Renee W Y; Webster, Robert G; Matthay, Michael A; Peiris, J S Malik

    2016-03-29

    Influenza can cause acute lung injury. Because immune responses often play a role, antivirals may not ensure a successful outcome. To identify pathogenic mechanisms and potential adjunctive therapeutic options, we compared the extent to which avian influenza A/H5N1 virus and seasonal influenza A/H1N1 virus impair alveolar fluid clearance and protein permeability in an in vitro model of acute lung injury, defined the role of virus-induced soluble mediators in these injury effects, and demonstrated that the effects are prevented or reduced by bone marrow-derived multipotent mesenchymal stromal cells. We verified the in vivo relevance of these findings in mice experimentally infected with influenza A/H5N1. We found that, in vitro, the alveolar epithelium's protein permeability and fluid clearance were dysregulated by soluble immune mediators released upon infection with avian (A/Hong Kong/483/97, H5N1) but not seasonal (A/Hong Kong/54/98, H1N1) influenza virus. The reduced alveolar fluid transport associated with down-regulation of sodium and chloride transporters was prevented or reduced by coculture with mesenchymal stromal cells. In vivo, treatment of aged H5N1-infected mice with mesenchymal stromal cells increased their likelihood of survival. We conclude that mesenchymal stromal cells significantly reduce the impairment of alveolar fluid clearance induced by A/H5N1 infection in vitro and prevent or reduce A/H5N1-associated acute lung injury in vivo. This potential adjunctive therapy for severe influenza-induced lung disease warrants rapid clinical investigation. PMID:26976597

  10. Overview of the 2015 American Thyroid Association guidelines for managing thyroid nodules and differentiated thyroid cancer.

    Science.gov (United States)

    Matti, Bashar; Cohen-Hallaleh, Ruben

    2016-01-01

    The last few years have witnessed numerous publications addressing the management of thyroid nodules and differentiated thyroid cancers. The purpose of this review is to provide a simplified summary of the newly released guidelines by the American Thyroid Association. A systematic approach has been recommended to evaluate a thyroid nodule through clinical assessment, measurement of serum Thyroid Stimulating Hormone, neck ultrasonography and Fine Needle Aspiration where appropriate. This is followed by cytology analysis using the Bethesda scoring system to detect malignancy. Once diagnosed, thyroid cancers need to be staged and risk stratification needs to be applied to develop further treatment plans. Lastly, several recommendations have been presented to assure proper follow-up and support for thyroid cancer patients regardless of the treatment received. PMID:27607088

  11. American Dietetic Association's Standardized Nutrition Language: Project logic model and current status.

    Science.gov (United States)

    Jenkins, Melinda; Myers, Esther; Charney, Pam; Escott-Stump, Sylvia

    2006-01-01

    Standardized terminology and digital sources of evidence are essential for evidence-based practice. Dieticians desire concise and consistent documentation of nutrition diagnoses, interventions and outcomes that will be fit for electronic health records. Building on more than 5 years of work to generate the Nutrition Care Process and Model as a road map to quality nutrition care and outcomes, and recognizing existing standardized languages serving other health professions, a task force of the American Dietetic Association (ADA) has begun to develop and disseminate standardized nutrition language. This paper will describe the group's working logic model, the Nutrition Care Process, and the current status of the nutrition language with comparisons to nursing process and terminology.

  12. Introducing DVM: DiVersity Matters (an Association of American Veterinary Medical Colleges Initiative).

    Science.gov (United States)

    Greenhill, Lisa M

    2007-01-01

    Now more than ever, colleges of veterinary medicine (CVMs) are challenged to improve the educational experience, build environments that support long-term student and faculty success, and create a diverse and competitive workforce. Additionally, the nation's fast-evolving racial and ethnic demographics demand that the veterinary medical profession be responsive to the emerging needs of this changing population. In March 2005, during the 15th Iverson Bell Symposium, the Association of American Veterinary Medical Colleges (AAVMC) unveiled its DiVersity Matters (DVM) initiative, designed to bring the CVMs closer to achieving these goals. Several key objectives of the initiative and their possible long-term significance to success of the DiVersity Matters initiative are explored here, and CVMs are encouraged to expand efforts to increase racial and ethnic diversity in academic veterinary medicine.

  13. Report from the American Nurses' Association council on psychiatric and mental health nursing.

    Science.gov (United States)

    Joel, L A; Baldwin, B; Stevens, G

    1989-01-01

    Society has demonstrated a major need for expanded gerontological and geropsychiatric nursing services. Current needs have not yet been met and the call for service will increase throughout the balance of this century and beyond. Social responsiveness demands that nurses: (1) formally establish their clinical authority in care of the aged; (2) lobby for public policy which enables the provider professional to control the practice environment, rather than be controlled by it; (3) improve the educational preparation of nurses to care for the aged; and (4) expand the professions' scientific and research base in this area. The national professional organization of registered nurses, the American Nurses' Association, provides leadership to influence the course of nursing as it continues to provide vital services in a dramatically changing environment. PMID:2744491

  14. Report of the American Heart Association (AHA) Scientific Sessions 2013, Dallas.

    Science.gov (United States)

    Ishimori, Naoki; Kinugawa, Shintaro; Yamada, Satoshi; Yokoshiki, Hisashi; Mitsuyama, Hirofumi; Tsutsui, Hiroyuki

    2014-01-01

    The American Heart Association (AHA) Scientific Sessions were held in Dallas on November 16-20, 2013. The meeting is one of the most leading conferences of cardiology in the world, with over 18,000 professional attendees from more than 105 countries. There were 315 invited sessions and 443 abstract sessions, comprising more than 5,000 presentations. The sessions were expanded to 26 program tracks, which included and integrated basic, translational, clinical, and population science. In the series of late-breaking sessions, updates of results from 20 clinical trials were disclosed. Japanese scientists submitted the second most abstracts to the Scientific Sessions in 2013. We appreciate the significant contribution to the sessions by Japanese cardiologists as well as the Japanese Circulation Society.

  15. American Burn Association consensus conference to define sepsis and infection in burns.

    Science.gov (United States)

    Greenhalgh, David G; Saffle, Jeffrey R; Holmes, James H; Gamelli, Richard L; Palmieri, Tina L; Horton, Jureta W; Tompkins, Ronald G; Traber, Daniel L; Mozingo, David W; Deitch, Edwin A; Goodwin, Cleon W; Herndon, David N; Gallagher, James J; Sanford, Art P; Jeng, James C; Ahrenholz, David H; Neely, Alice N; O'Mara, Michael S; Wolf, Steven E; Purdue, Gary F; Garner, Warren L; Yowler, Charles J; Latenser, Barbara A

    2007-01-01

    Because of their extensive wounds, burn patients are chronically exposed to inflammatory mediators. Thus, burn patients, by definition, already have "systemic inflammatory response syndrome." Current definitions for sepsis and infection have many criteria (fever, tachycardia, tachypnea, leukocytosis) that are routinely found in patients with extensive burns, making these current definitions less applicable to the burn population. Experts in burn care and research, all members of the American Burn Association, were asked to review the literature and prepare a potential definition on one topic related to sepsis or infection in burn patients. On January 20, 2007, the participants met in Tucson, Arizona to develop consensus for these definitions. After review of the definitions, a summary of the proceedings was prepared. The goal of the consensus conference was to develop and publish standardized definitions for sepsis and infection-related diagnoses in the burn population. Standardized definitions will improve the capability of performing more meaningful multicenter trials among burn centers.

  16. Comparison and combination of blood DNA methylation at smoking-associated genes and at lung cancer-related genes in prediction of lung cancer mortality.

    Science.gov (United States)

    Zhang, Yan; Breitling, Lutz P; Balavarca, Yesilda; Holleczek, Bernd; Schöttker, Ben; Brenner, Hermann

    2016-12-01

    Epigenome-wide association studies have established methylation patterns related to smoking, the major risk factor of lung cancer (LC), which are distinct from methylation profiles disclosed in LC patients. This study simultaneously investigated associations of smoking-associated and LC-related methylation markers with LC mortality. DNA methylation was determined by HM450K assay in baseline blood samples of 1,565 older adults in a population-based case-cohort study. The associations of 151 smoking-associated CpGs (smoCpGs) and 3,806 LC-related CpGs (caCpGs) with LC mortality were assessed by weighted Cox regression models, controlling for potential confounders. Multi-loci methylation scores were separately constructed based on smoCpGs and caCpGs. During a median follow-up of 13.8 years, 60 participants who had a first diagnosis of LC died from LC. The average time between sample collection and LC diagnosis was 5.8 years. Hypomethylation at 77 smoCpGs and 121 caCpGs, and hypermethylation at 4 smoCpGs and 66 caCpGs were associated with LC mortality. The associations were much stronger for smoCpGs than for caCpGs. Hazard ratios (95% CI) were 7.82 (2.91-21.00) and 2.27 (0.75-6.85), respectively, for participants in highest quartile of Score I (based on 81 smoCpGs) and Score II (based on 187 caCpGs), compared with participants in the corresponding lower three quartiles. Score I outperformed Score II, with an optimism-corrected C-index of 0.87 vs. 0.77. In conclusion, although methylation changes of both smoking-associated and LC-related genes are associated with LC mortality, only smoking-associated methylation markers predict LC mortality with high accuracy, and may thus serve as promising candidates to identify high risk populations for LC screening. PMID:27503000

  17. Fourth joint meeting of the American Urological Association and the Japanese Urological Association Specialty Society program at the 104th annual meeting of the American Urological Association at Chicago 2009.

    Science.gov (United States)

    Cooperberg, Matthew R; Hinotsu, Shiro; Chancellor, Michael B; Homma, Yukio; Nelson, Peter S; Matsuyama, Hideyasu; Menon, Mani; Kucuk, Omer; Hara, Isao; Egawa, Shin; Uzzo, Robert G; Kanayama, Hiro-Omi; Okuyama, Akihiko; Akaza, Hideyuki

    2009-08-01

    We are heartily grateful for the warm support of all of the people concerned, including the moderators and panelists of both societies for giving us the opportunity to hold the 4th American Urological Association/Japanese Urological Association (AUA/JUA) Joint Meeting, held once again at the 104th Annual Meeting of the American Urological Association (25-30 April 2009, Chicago, Illinois, USA). 2009 is a memorable year, being the start of new collaborations between AUA and JUA. The JUA in collaboration with AUA is promoting an academic exchange program whereby outstanding and promising Japanese and American junior faculty members will be given the opportunity to work in the USA and Japan for one month. The program not only allows the sharing of knowledge and experience, but is designed to foster a closer alliance between the AUA and JUA, and assists in identifying future leaders within both organizations. The JUA will have an exhibit booth at the AUA annual meeting, promoting our new joint activities. The Journal of Urology and International Journal of Urology will share reviewers. The JUA will participate in developing AUA guidelines. With all of these activities, the JUA hopes it will provide greater opportunities to young Japanese urologists to participate in educational projects in the US. We would like to thank Professor Robert C. Flanigan, the Secretary General of AUA, Professor Glenn M. Preminger, the Chairman of the AUA Office of Education and the staff of AUA and JUA for supporting our program. We hope to keep holding the joint meeting and have plenty of ideas on themes and forums. We believe that this international program helps to establish a closer relationship between JUA and AUA in the scientific field. PMID:19682110

  18. Juan Comas's summary history of the American association of physical anthropologists (1928-1968).

    Science.gov (United States)

    Alfonso, Marta P; Little, Michael A

    2005-01-01

    This translation of Juan Comas's Summary History of the American Association of Physical Anthropologists was originally published in Spanish by the Instituto Nacional de Antropología e Historia, Mexico, in 1969 (Departamento de Investigaciones Antropológicas, Publication 22). Physical anthropologists from North America and members of the American Association of Physical Anthropologists owe Juan Comas a debt of gratitude for having labored to produce this Summary History of the AAPA. There is much useful and interesting material in this document: extensive endnotes that are helpful to the historian of the profession; an appendix of the Journal issues where the proceedings of annual meetings can be found; a detailed listing of contributors of papers to annual meetings from 1930-1968; a warm acknowledgment and history of the contributions of the Wenner-Gren Foundation to biological anthropology; a history of the Yearbook of Physical Anthropology; and comments on the short-lived PA Newsletter. In addition, there are appendices with the founding AAPA Constitution and By-Laws from 1930 and as they existed in 1968. All of this synoptic information saves the reader with interests in the history of the AAPA considerable effort, especially when few university and college libraries have the full (old and new) series of the AJPA on their shelves. We have tried to provide a translation of Comas's history that is faithful to the original Spanish-language publication. In a few cases, we shortened sentences and applied a slightly more modern usage than was popular in the late 1960s.

  19. Management of Differentiated Thyroid Cancer in Children: Focus on the American Thyroid Association Pediatric Guidelines.

    Science.gov (United States)

    Parisi, Marguerite T; Eslamy, Hedieh; Mankoff, David

    2016-03-01

    First introduced in 1946, radioactive iodine (I-131) produces short-range beta radiation with a half-life of 8 days. The physical properties of I-131 combined with the high degree of uptake in the differentiated thyroid cancers (DTCs) led to the use of I-131 as a therapeutic agent for DTC in adults. There are two indications for the potential use of I-131 therapy in pediatric thyroid disorders: nonsurgical treatment of hyperthyroidism owing to Graves' disease and the treatment of children with intermediate- and high-risk DTC. However, children are not just miniature adults. Not only are children and the pediatric thyroid gland more sensitive to radiation than adults but also the biologic behavior of DTC differs between children and adults as well. As opposed to adults, children with DTC typically present with advanced disease at diagnosis; yet, they respond rapidly to therapy and have an excellent prognosis that is significantly better than that in adult counterparts with advanced disease. Unfortunately, there are also higher rates of local and distant disease recurrence in children with DTC compared with adults, mandating lifelong surveillance. Further, children have a longer life expectancy during which the adverse effects of I-131 therapy may become manifest. Recognizing the differences between adults and children with DTC, the American Thyroid Association commissioned a task force of experts who developed and recently published a guideline to address the unique issues related to the management of thyroid nodules and DTC in children. This article revie