WorldWideScience

Sample records for amendoinzeiro arachis hypogaea

  1. (Arachis hypogaea) and Sorghum (Sorghum bicolor)

    African Journals Online (AJOL)

    ADOWIE PERE

    as enzyme activities of Arachis hypogaea and Sorghum bicolor in crude oil contaminated soil. Crude oil ... Treatments without crude oil were ... replicates were made for each treatment. .... dead sections of leaf margins, burning and stunted or.

  2. Nutritional chemistry of the peanut (Arachis hypogaea)

    Science.gov (United States)

    Peanuts, Arachis hypogaea, are one of the most widely consumed legume globally due to its nutrition, taste and affordability. Peanuts are protein and energy-rich and has been utilized worldwide to address the nutritional needs in developing countries. Currently, its role in a heart-healthy diet ha...

  3. Two-dimensional partitioning of groundnut (Arachis hypogaea L ...

    African Journals Online (AJOL)

    YCA) was evaluated using a groundnut, (Arachis hypogaea L.) crop at four plant population densities or five thinning intensities (%) after flowering. The experiments were carried out during the 1989/90 cropping season at the University of ...

  4. Assessing the genetic diversity of 48 groundnut (Arachis hypogaea L.)

    African Journals Online (AJOL)

    Richard

    2015-08-12

    Aug 12, 2015 ... genetic variations in cultivated crops, especially groundnut. Key words: Phenotypic traits, DNA extraction, PCR amplification, simple sequence repeats ..... of N2 fixation in groundnut (Arachis hypogaea L.) and cowpea (Vigna.

  5. Assessing the genetic diversity of 48 groundnut ( Arachis hypogaea ...

    African Journals Online (AJOL)

    Assessing the genetic diversity of 48 groundnut ( Arachis hypogaea L. ) ... both at the phenotypic and molecular level is important in all plant breeding programs. ... other and could therefore serve as effective parental material for future work.

  6. Molecular marker screening of peanut ( Arachis hypogaea L ...

    African Journals Online (AJOL)

    Molecular marker screening of peanut (Arachis hypogaea L.) germplasm for Meloidogyne arenaria resistance. V Carpentieri-Pipolo, M Gallo-Meagher, DW Dickson, DW Gorbet, M de Lurdes Mendes, SG Hulse de Souza ...

  7. Chemical composition of groundnut, Arachis hypogaea (L) landraces

    African Journals Online (AJOL)

    STORAGESEVER

    2008-07-04

    Jul 4, 2008 ... purpose. Key words: Arachis hypogaea, groundnut, protein, oil, minerals. INTRODUCTION ... absence of flowers on main stem, flower arrangement on leaf axils: (1) hypogaea ..... growing location and their interaction on the fatty acid composition of peanuts. J. Food Sci. ... Analysis of groundnuts content by ...

  8. Peanut (Arachis hypogaea L.): Origin and botanical descriptions

    Science.gov (United States)

    Since the first description of the cultivated peanut, Arachis hypogaea L. by Linneaus in 1753, to the recent monograph on the taxonomy of genus Arachis (Krapovickas and Gregory 1994 and 2007), our knowledge of the genetic structure of the genus including its origin, variability, and geographical dis...

  9. De beinvloeding van de bloei bij Arachis hypogaea L.

    NARCIS (Netherlands)

    Fortanier, E.J.

    1957-01-01

    The effect of light (intensity, duration and spectral composition), temperature (different day and night temperature) and water (different humidities of the soil and the air) on flowering of groundnut Arachis hypogaea L. var. Schwarz 21) was investigated. Because growth and fruit formation were also

  10. Isolation of Arachis hypogaea Na /H antiporter and its expression ...

    African Journals Online (AJOL)

    Jane

    2011-10-24

    Oct 24, 2011 ... /H. + antiporter and its expression analysis under salt stress ... Xinguo Li2,3*. 1College of Life Science, Linyi University, Linyi 276005, China. ... gene was isolated from peanut (Arachis hypogaea) in the present work. The full-length ..... balance (Rausch et al., 1996), with the vacuolar Na+/H+ antiporter gene ...

  11. Isolation of Arachis hypogaea Na + /H + antiporter and its ...

    African Journals Online (AJOL)

    The plant Na+/H+ antiporter gene plays a major role in salt tolerance. ... gene was isolated from peanut (Arachis hypogaea) in the present work. ... These results implied that the AhNHX1 plays an important role under salt stress in peanut.

  12. A recirculating hydroponic system for studying peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Mackowiak, C. L.; Wheeler, R. M.; Stutte, G. W.; Yorio, N. C.; Ruffe, L. M.; Sager, J. C. (Principal Investigator)

    1998-01-01

    Peanut (Arachis hypogaea L.) plants were grown hydroponically, using continuously recirculating nutrient solution. Two culture tray designs were tested; one tray design used only nutrient solution, while the other used a sphagnum-filled pod development compartment just beneath the cover and above the nutrient solution. Both trays were fitted with slotted covers to allow developing gynophores to reach the root zone. Peanut seed yields averaged 350 gm-2 dry mass, regardless of tray design, suggesting that substrate is not required for hydroponic peanut production.

  13. Population structure of Cylindrocladium parasiticum infecting peanuts (Arachis hypogaea) in Georgia, USA

    NARCIS (Netherlands)

    Wright, L.P.; Davis, A.J.; Wingfield, B.D.; Crous, P.W.; Brenneman, T.; Wingfield, M.J.

    2010-01-01

    Cylindrocladium parasiticum is an important pathogen of peanut (Arachis hypogaea) causing the disease Cylindrocladium black rot. The genetic structure of this haploid pathogen was determined for populations associated with peanut in Georgia, USA. Ten polymorphic microsatellite markers were used to

  14. Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea

    Directory of Open Access Journals (Sweden)

    Palmieri Dario A

    2007-02-01

    Full Text Available Abstract Background The genus Arachis includes Arachis hypogaea (cultivated peanut and wild species that are used in peanut breeding or as forage. Molecular markers have been employed in several studies of this genus, but microsatellite markers have only been used in few investigations. Microsatellites are very informative and are useful to assess genetic variability, analyze mating systems and in genetic mapping. The objectives of this study were to develop A. hypogaea microsatellite loci and to evaluate the transferability of these markers to other Arachis species. Results Thirteen loci were isolated and characterized using 16 accessions of A. hypogaea. The level of variation found in A. hypogaea using microsatellites was higher than with other markers. Cross-transferability of the markers was also high. Sequencing of the fragments amplified using the primer pair Ah11 from 17 wild Arachis species showed that almost all wild species had similar repeated sequence to the one observed in A. hypogaea. Sequence data suggested that there is no correlation between taxonomic relationship of a wild species to A. hypogaea and the number of repeats found in its microsatellite loci. Conclusion These results show that microsatellite primer pairs from A. hypogaea have multiple uses. A higher level of variation among A. hypogaea accessions can be detected using microsatellite markers in comparison to other markers, such as RFLP, RAPD and AFLP. The microsatellite primers of A. hypogaea showed a very high rate of transferability to other species of the genus. These primer pairs provide important tools to evaluate the genetic variability and to assess the mating system in Arachis species.

  15. Nutritional composition of new peanut (Arachis hypogaea L.) cultivars

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Mondragon, M. G.; Calderon de la Barca, A. M.; Duran-Prado, A.; Campos-Reyes, L. C.; Oliart-Ros, R. M.; Ortega-Garcia, J.; Medina-Juarez, L. A.; Angulo, O.

    2009-07-01

    Six peanut (Arachis hypogaea L.) cultivars (Col-24-Gro, Col-61-Gto, VA-81-B, Ranferi Diaz, NC-2 and Florunner) were studied for agricultural yield, chemical composition (protein, fat, carbohydrates, fiber and ash), amino acid profile, digestibility, fatty acid profile, tocopherol and sterol contents. Results indicated that Ranferi Diaz and Col-61-Gto presented the highest yield (6.3 Ton/ha). Protein content was from 23.5 to 26.6% and fat content ranged from 49.8-53.4%. Mean digestibility was 86%. Lysine and threonine levels in all cultivars were sufficient to meet human requirements. Total saturated fatty acids ranged from 15-18%. The oleic/linoleic ratio was estimated 1.3-1.4. Tocopherol levels varied from 390 to 706 ppm. The highest tocopherol levels corresponded to the cultivars with the lowest yield. The alpha tocopherol content was estimated at 90-150 ppm, while gamma tocopherol was 270-570 ppm. The main sterol present was A- sitosterol (approx. 65%). Ranferi Diaz variety presented the highest agronomic yield and the highest protein content but low oleic acid, low sterols and low total tocopherols. The differences among cultivars suggest differences in their applications. (Author) 40 refs.

  16. Nutritional composition of new Peanut (Arachis hypogaea L. cultivars

    Directory of Open Access Journals (Sweden)

    2009-06-01

    Full Text Available Six peanut (Arachis hypogaea L. cultivars (Col-24-Gro, Col-61-Gto, VA-81-B, Ranferi Díaz, NC-2 and Florunner were studied for agricultural yield, chemical composition (protein, fat, carbohydrates, fiber and ash, amino acid profile, digestibility, fatty acid profile, tocopherol and sterol contents. Results indicated that Ranferi Díaz and Col-61-Gto presented the highest yield (6.3 Ton/ha. Protein content was from 23.5 to 26.6% and fat content ranged from 49.8-53.4%. Mean digestibility was 86%. Lysine and threonine levels in all cultivars were sufficient to meet human requirements. Total saturated fatty acids ranged from 15-18%. The oleic/linoleic ratio was estimated 1.3-1.4. Tocopherol levels varied from 390 to 706 ppm. The highest tocopherol levels corresponded to the cultivars with the lowest yield. The alpha tocopherol content was estimated at 90-150 ppm, while gamma tocopherol was 270-570 ppm.The main sterol present was βsitosterol (approx. 65%. Ranferi Diaz variety presented the highest agronomic yield and the highest protein content but low oleic acid, low sterols and low total tocopherols. The differences among cultivars suggest differences in their applications.

    Se estudio el rendimiento agrícola y composición química (proteína, grasa, carbohidratos, fibra y cenizas, perfil de amino ácidos, digestibilidad, perfil de ácidos grasos, contenido de tocoferol y de esteroles de seis variedades de cacahuate (Arachis hypogaea L. Col-24-Gro, Col-61-Gto, VA-81B, Ranferi Díaz, NC-2 y Florunner. Los resultados mostraron que el mayor rendimiento se logró en las variedades Ranferi Díaz y Col-61-Gto (6.3 Ton/ha. El contenido de proteína fue de 23.5 a 26.6% y el contenido de grasa en un intervalo de 49.8 a 53.4%. La digestibilidad promedio de las seis variedades fue de 86%. El contenido de lisina y treonina en la proteína de todas las variedades fue suficiente para satisfacer los requerimientos del humano. La composición del aceite

  17. The nutritional value of peanut hay (Arachis hypogaea L.) as an alternate forage source for sheep

    NARCIS (Netherlands)

    Khan, M.T.; Khan, N.A.; Bezabih, M.; Qureshi, M.S.; Rahman, A.

    2013-01-01

    The aim of this study was to evaluate the nutritional and feeding value of peanut hay (Arachis hypogaea L.) produced under tropical environment as an alternate forage resource for sheep. Peanut hay was appreciably high in crude protein [CP; 105 g/kg dry matter (DM)] and lower in neutral detergent

  18. LAS PROTEINAS SEMINALES DEL MANI (ARACHIS HYPOGAEA, LEGUMINOSAE y SU RELACION CON LAS CATEGORIAS INFRAESPECIFICAS

    Directory of Open Access Journals (Sweden)

    N R Grosso

    1994-01-01

    Full Text Available Las proteínas seminales de 122 muestras diferentes de Arachis hypogaea L. originarios de Bolivia, Perú y Ecuador fueron estudiadas por electroforesis en gel de poliacrilamida.Se detectaron siete bandas constantes y 27 bandas inconstantes. Los resultados de las últimas se utilizaron para analizar las similitudes entre las muestras empleando el coeficiente de Jaccard y el método de ligamiento promedio de la media aritmética no ponderada(UPGMA.Las proteínas seminales permitieron separar totalmente la subespecies de A.hypogaea y las variedades en menor medida.

  19. The genome structure of Arachis hypogaea (Linnaeus, 1753 and an induced Arachis allotetraploid revealed by molecular cytogenetics

    Directory of Open Access Journals (Sweden)

    Eliza F. de M. B. do Nascimento

    2018-03-01

    Full Text Available Peanut, Arachis hypogaea (Linnaeus, 1753 is an allotetraploid cultivated plant with two subgenomes derived from the hybridization between two diploid wild species, A. duranensis (Krapovickas & W. C. Gregory, 1994 and A. ipaensis (Krapovickas & W. C. Gregory, 1994, followed by spontaneous chromosomal duplication. To understand genome changes following polyploidy, the chromosomes of A. hypogaea, IpaDur1, an induced allotetraploid (A. ipaensis × A. duranensis4x and the diploid progenitor species were cytogenetically compared. The karyotypes of the allotetraploids share the number and general morphology of chromosomes; DAPI+ bands pattern and number of 5S rDNA loci. However, one 5S rDNA locus presents a heteromorphic FISH signal in both allotetraploids, relative to corresponding progenitor. Whilst for A. hypogaea the number of 45S rDNA loci was equivalent to the sum of those present in the diploid species, in IpaDur1, two loci have not been detected. Overall distribution of repetitive DNA sequences was similar in both allotetraploids, although A. hypogaea had additional CMA3+ bands and few slight differences in the LTR-retrotransposons distribution compared to IpaDur1. GISH showed that the chromosomes of both allotetraploids had preferential hybridization to their corresponding diploid genomes. Nevertheless, at least one pair of IpaDur1 chromosomes had a clear mosaic hybridization pattern indicating recombination between the subgenomes, clear evidence that the genome of IpaDur1 shows some instability comparing to the genome of A. hypogaea that shows no mosaic of subgenomes, although both allotetraploids derive from the same progenitor species. For some reasons, the chromosome structure of A. hypogaea is inherently more stable, or, it has been at least, partially stabilized through genetic changes and selection.

  20. Chemical composition of groundnut, Arachis hypogaea (L) landraces

    African Journals Online (AJOL)

    49.7%) than the Spanish and Valencia market types, which belong to subspecies fastigiata (47.3%). The mean protein content of subspecies fastigiata was however higher (25.69%) than subspecies hypogaea (22.78%). The mineral elements ...

  1. Effect of gamma irradiation on the grain yield of Nigerian Zea mays and Arachis hypogaea

    Energy Technology Data Exchange (ETDEWEB)

    Mokobia, C E; Okpakorese, E M; Analogbei, C; Agbonwanegbe, J [Department of Physics, Delta State University, Abraka, Delta State (Nigeria)

    2006-12-15

    As a follow-up to our earlier investigation on the effect of gamma radiation on the germination and growth of certain Nigerian agricultural crops, the present study sought to determine the effect of gamma radiation on the grain yield of Zea mays (maize) and Arachis hypogaea (groundnut). The seeds were planted after irradiation without the application of fertiliser. The results show that for maize, grain yield for irradiated samples is increased to levels above the unirradiated yield at doses up to about 250 Gy with the optimum yield occurring at 150 Gy. The corresponding increase for groundnut is observed at doses up to about 930 Gy with optimum yield at a dose of 300 Gy. Inhibition in yield was observed to set in at a dose greater than 250 Gy for maize and 930 Gy for groundnut. The actual relationship between mean yield of these crops and gamma radiation dose was obtained using sixth-degree polynomial equations. (note)

  2. Effect of gamma irradiation on the grain yield of Nigerian Zea mays and Arachis hypogaea

    International Nuclear Information System (INIS)

    Mokobia, C E; Okpakorese, E M; Analogbei, C; Agbonwanegbe, J

    2006-01-01

    As a follow-up to our earlier investigation on the effect of gamma radiation on the germination and growth of certain Nigerian agricultural crops, the present study sought to determine the effect of gamma radiation on the grain yield of Zea mays (maize) and Arachis hypogaea (groundnut). The seeds were planted after irradiation without the application of fertiliser. The results show that for maize, grain yield for irradiated samples is increased to levels above the unirradiated yield at doses up to about 250 Gy with the optimum yield occurring at 150 Gy. The corresponding increase for groundnut is observed at doses up to about 930 Gy with optimum yield at a dose of 300 Gy. Inhibition in yield was observed to set in at a dose greater than 250 Gy for maize and 930 Gy for groundnut. The actual relationship between mean yield of these crops and gamma radiation dose was obtained using sixth-degree polynomial equations. (note)

  3. Characterization of genotypic variability associated to the phosphorus bioavailability in peanut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Mohamed Kraimat

    2017-06-01

    Full Text Available In order to assess genotypic variability in some peanut genotypes depending on phosphorus availability, both effects of tri-calcium phosphate (TCP and inoculation by Bradyrhizobium strain (BR on morphological and physiological parameters were studied in five peanut genotypes (Arachis hypogaea L., originated from two Algerian areas (Northern and Southern. The results obtained during the flowering stage of crop development, confirmed the positive effect of the contribution of tri-calcium phosphate (TCP with Bradyrhizobium strains on the morphological characters (shoot biomass, root biomass, nodular biomass and leaf and the physiological (nitrogenase activity, phosphorus absorption efficiency by roots (RPAE and phosphorus use efficiency (PUE for the peanut genotypes cultivated in this experiment. Among five genotypes tested, it was noted that the Southern genotypes were more efficient to use TCP in the presence of Bradyrhizobium strain after a screening of these local genotypes, in particular, with phosphorus use efficiency (PUE and shoot biomass production.

  4. In vitro propagation of peanut (Arachis hypogaea L.) by shoot tip culture.

    Science.gov (United States)

    Ozudogru, Elif Aylin; Kaya, Ergun; Lambardi, Maurizio

    2013-01-01

    Peanut (Arachis hypogaea L.), also known as groundnut, is the most important species of Arachis genus, originating from Brazil and Peru. Peanut seeds contain high seed oil, proteins, amino acids, and vitamin E, and are consumed worldwide as edible nut, peanut butter, or candy, and peanut oil extracted from the seeds. The meal remaining after oil extraction is also used for animal feed. However, its narrow germplasm base, together with susceptibility to diseases, pathogens, and weeds, decreases yield and seed quality and causes great economic losses annually. Hence, the optimization of efficient in vitro propagation procedures would be highly effective for peanut propagation, as it would raise yield and improve seed quality and flavor. Earlier reports on traditional micropropagation methods, based on axillary bud proliferation which guarantees the multiplication of true-to-type plants, are still limited. This chapter describes a micropropagation protocol to improve multiple shoot formation from shoot-tip explants by using AgNO(3) in combination with plant growth regulators.

  5. Cloning and characterization of the promoter of the 9-cis-epoxycarotenoid dioxygenase gene in Arachis hypogaea L.

    Science.gov (United States)

    Liang, Jianhua; Yang, Lixia; Chen, Xiong; Li, Ling; Guo, Dongliang; Li, Haihang; Zhang, Biyu

    2009-09-01

    We cloned the promoter of the 9-cis-epoxycarotenoid dioxygenase gene from Arachis hypogaea L. beta-Glucuronidase (GUS) histochemical staining and GUS activity assay indicated that the activity of the promoter was exhibited predominantly in the leaves and enhanced by water and NaCl stresses, and by application of abscisic acid (ABA) and salicylic acid (SA) in transgenic Arabidopsis. Moreover, two novel ABRE-like (abscisic acid response element) elements were identified in the promoter region.

  6. Agrobacterium rhizogenes-mediated transformation of Arachis hypogaea: an efficient tool for functional study of genes

    Directory of Open Access Journals (Sweden)

    Shuai Liu

    2016-09-01

    Full Text Available We have developed a technique for efficient transformation of hairy roots of Arachis hypogaea L. using Agrobacterium rhizogenes K599, and have validated this approach for the investigation of gene function. As a model transgene, AhAREB1, a drought-resistance gene from peanut, was fused to green fluorescent protein, and four parameters that might influence the transformation efficiency were tested. The optimal procedure involved the use of petioles with four expanded leaves as explants, infection by K599 at optical density (OD600 of 0.6 for 15 min and co-cultivation for 2 d, giving transformation efficiencies of up to 91%. Hairy roots from transgenic peanut plants overexpressing AhAREB1 were unaffected by treatment with polyethylene glycol (PEG, demonstrating increased drought tolerance, whereas control roots showed clear signs of plasmolysis. Transgenic roots accumulated less superoxide anion (O2− than control roots under drought conditions. Additionally, transgenic roots displayed upregulation of four stress-response genes encoding WRKY transcription factor (WRKY33, MYB transcription factor (MYB92, abscisic acid receptor (PYL5 and dehydrin 2 (DHN2.

  7. Regeneration and acclimatization of salt-tolerant arachis hypogaea plants through tissue culture

    International Nuclear Information System (INIS)

    Ghauri, E.G.

    2006-01-01

    Excised embryos of Arachis hypogaea were cultured on Murashige and Skoog's medium (MS medium) supplemented with different combinations of growth hormones. The highest frequency of callus proliferation (80%) was recorded on MS medium mixed with 1.0 mg/1 of 2,4-D and 0.5 mg/1 of BAP. These cultures were treated with 0.65 mg/l of trans-4-hydroxy-L-proline (HyP) a:1d various concentrations (0.1-0.5%) of NaCl. In all cases the presence of salt reduced the fresh mass of callus. Shoot regeneration in the cultures took place when transferred to MS medium supplemented with 1.0 mg/1 of kinetin (Kin) and 0.5 mg/1 of 6-benzyl aminopurine (BAP). Percentage of shoot regeneration decreased with the increase of NaCl (0.1- 0.5%) in the shoot regeneration medium. Root formation in these cultures took place when the cultures were nurtured on MS medium free of growth hormones. Regeneration, hardening and acclimatization of the salt tolerant plants was conducted. (author)

  8. Thermal Degradation of Complexes Derived from Cu (II) Groundnut (Arachis hypogaea) and Sesame (Sesamum indicum) Soaps

    Science.gov (United States)

    Joram, Anju; Sharma, Rashmi; Sharma, Arun kumar

    2018-05-01

    The complexes have been synthesized from Cu (II) soaps of groundnut (Arachis hypogaea) and sesame (Sesamum indicum) oils, with ligand containing nitrogen and sulfur atoms like 2-amino-6-methyl benzothiazole. The complexes were greenish brown in color. In order to study TGA, first characterized them by elemental analysis, and spectroscopic technique such as IR, NMR and ESR. From the analytical data, the stoichiometry's of the complexes have been observed to be 1:1 (metal:ligand). These complexes have been thermally analyzed using TGA techniques to determine their energy of activation. These complexes show three step thermal degradation corresponding to fatty acid components of the edible oils and each complex has three decomposition steps in the range of 439-738 K. Various equations like Coats-Redfern (CR), Horowitz-Metzger (HM) and Broido equations (BE) were applied to evaluate the energy of activation. The values of energy of activation are observed to be in the following order for both copper groundnut benzothiazole (CGB) and copper sesame benzothiazole (CSeB) complexes: CGB > CSeB. CGB is observed to be more stable than CSeB due to its higher activation energy. The above studies would provide significant information regarding the applications of synthesized agrochemicals and their safe removal through parameters obtained in degradation curves and its relation with energy.

  9. Sensitization of Radioresistant Prostate Cancer Cells by Resveratrol Isolated from Arachis hypogaea Stems.

    Science.gov (United States)

    Chen, Yu-An; Lien, Hsiu-Man; Kao, Min-Chuan; Lo, U-Ging; Lin, Li-Chiung; Lin, Chun-Jung; Chang, Sheau-Jiun; Chen, Chia-Chang; Hsieh, Jer-Tsong; Lin, Ho; Tang, Chih-Hsin; Lai, Chih-Ho

    2017-01-01

    Resveratrol (RV, 3,4',5-trihydroxystilbene) is naturally produced by a wide variety of plants including grapes and peanuts (Arachis hypogaea). However, the yield of RV from peanut stem and its potential radiosensitizing effects in prostate cancer (PCa) have not been well investigated. In this study, we characterized RV in peanut stem extract (PSE) for the first time and showed that both RV and PSE dose-dependently induced cell death in DOC-2/DAB2 interactive protein (DAB2IP)-deficient PCa cells with the radioresistant phenotype. Furthermore, the combination of radiation with either RV or PSE induced the death of radioresistant PCa cells through delayed repair of radiation-induced DNA double-strand break (DSB) and prolonged G2/M arrest, which induced apoptosis. The administration of RV and PSE effectively enhanced radiation therapy in the shDAB2IP PCa xenograft mouse model. These results demonstrate the promising synergistic effect of RV and PSE combined with radiation in the treatment of radioresistant PCa.

  10. Yield Potential of Ten Peanut Introgression Lines derived from Crosses between Arachis cardenassii and A. hypogaea

    Directory of Open Access Journals (Sweden)

    AHMAD RIDUAN

    2005-09-01

    Full Text Available Diploid species of peanut (Arachis cardenasii showed no symptoms of PStV infection when mechanically inoculated with PStV. Some introgression lines derived from A. cardenasii and A. hypogaea hybridization have been introduced to Indonesia. Evaluation of their adaptability and yield potential were necessary before pursuing further utilization of these introgression lines. The objectives of this research were to determine yield potential of the introgression lines of peanut in green house and field conditions and to evaluate incidence of PStV infection in the field. Peanut plants were grown in the green house and in the field according to standard procedures for raising peanut. Results of the experiments showed that growth and developmental characters of the tested lines were similar between field and green house grown plants. The introgression lines generally exhibited higher secondary branches and longer to flower and harvest as compared to peanut cv. Gajah and Kelinci. The NC-CS30 line was identfied as having higher yield and bigger seed size as compared to standard peanut cultivars (Gajah and Kelinci. Therefore, NC-CS30 germplasm may be further developed as commercial peanut cultivar or be used as donor for peanut breeding in Indonesia.

  11. Genetic analysis of some agronomic traits in groundnut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    M.K. Alam

    2013-12-01

    Full Text Available A 10×10 half diallel experiment was conducted on groundnut (Arachis hypogaea L. to ascertain the gene action and genetic parameters of ten traits including 50% flowering, no. of pods per plant, plant height, harvest index, pod index, 100 pod weight, 100 kernel weight, pod size, diseases infection and yield per plot. The experiments were carried out in the Department of Genetics and Plant Breeding, Bangladesh Agricultural University (BAU, Mymensingh during the cropping season of 2010-2011. The estimates of gene effects indicated that significance of both additive and non-additive variance for pod size, 100 pod weight and diseases infection among the traits and presence of over dominance satisfying assumptions of diallel except dormancy. However, both the additive and non-additive gene affects together importance to control of most quantitative traits in the groundnut. The average degree of dominance (H1/D 1/2 (H1 = dominance variance, D = additive variance was higher than one, indicating over dominance for all the traits. The narrow-sense heritability was high for 50% flowering (38%, harvest index (35%, pod size (52%, 100 pod weight (35% and yield per plot (41% indicating that great genetic gain could be achieved for them.

  12. Integrated Management of Stem Rot Disease (Sclerotium rolfsii) of Groundnut (Arachis hypogaea L.) Using Rhizobium and Trichoderma harzianum (ITCC - 4572)

    OpenAIRE

    GANESAN, S.; KUPPUSAMY, R. GANESH; SEKAR, R.

    2014-01-01

    Soil-borne plant pathogenic fungi cause heavy crop losses all over the world. With variable climate from region to region, most crops grown in India are susceptible to diseases caused by soil-borne fungal pathogens. Among tropical and subtropical land crops, groundnut (Arachis hypogaea L.) is an important oil seed crop, providing vegetable oil as human food and oil cake meal as animal poultry feed. A large number of diseases attack groundnut plants in India; of these, stem rot (collar rot) ca...

  13. Nutrient composition of five varieties of commonly consumed Nigerian groundnut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Tayo, G. O.

    2012-03-01

    Full Text Available The nutrient composition of the five major varieties of groundnut (Arachis hypogaea L. commonly consumed in the south-western part of Nigeria was investigated. Raw dryshelled samples were analyzed for proximate (moisture, ash, protein, fat, fiber and carbohydrate, ‘vitamins’ (β-carotene, thiamine, niacin and tocopherol and minerals (Na, K, Ca, P, Mg, Fe, Mn, Zn, Cu, Se, Co, Al, As, Cd and Pb. Results showed that the groundnuts had 4.12-9.26% moisture, 2.77-3.31% ash, 24.26-26.35% protein, 45.41-48.14% fat, 2.51-2.94% fiber and 15.90-17.75% carbohydrate. All the varieties analyzed showed β-carotene (63.32-65.35mg/100g, thiamin (0.73-0.98mg/100g, niacin (14.00-16.03mg/100g and tocopherol (18.62-21.07mg/100g activities; with boro red having significantly (P P> Mg> Ca> Mn> Cu> Na> Zn> Fe> Al> Se in most of the varieties. Boro red also had the highest elemental contents in most of the minerals analyzed. Thus, these groundnuts can be considered useful foodstuffs in minimizing proteinenergy malnutrition (PEM and micronutrient deficiencies in Nigeria. However, the boro red variety is most recommended. The outcome of this research is a contribution to the food composition table.Se ha investigado la composición en nutrientes de las cinco principales variedades de maní (Arachis hypogaea L. de consumo habitual en la parte sur-occidental de Nigeria. A las muestras crudas con cáscara y secas se les analizó su composición proximal (humedad, ceniza, proteína, grasa, fibra e hidratos de carbono, vitaminas (β-caroteno, tiamina, niacina y tocoferol y minerales (Na, K, Ca, P, Mg, Fe, Mn, Zn, Cu, Se, Co, Al, As, Cd y Pb. Los resultados mostraron que el maní tenía entre 4.12 - 9.26% de humedad, 2.77- 3.31% de cenizas, 24.26 - 26.35% de proteína, 45.41 - 48.14% de materia grasa, 2.51 - 2.94% de fibra y 15.90 -17.75% de carbohidratos. Todas las variedades analizadas contenían β-caroteno (63.32-65.35mg/100g, tiamina (0.73-0.98mg/100g, niacina (14

  14. Isolation and expression analysis of glycerol-3-phosphate acyltransferase genes from peanuts (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Chi, X.

    2015-09-01

    Full Text Available sn-Glycerol-3-phosphate acyltransferase (GPAT catalyzes the committed step in the production of glycerolipids. The functions of GPAT genes have been intensively studied in Arabidopsis, but not in peanuts (Arachis hypogaea L.. In this study, six AhGPAT genes were isolated from peanuts. Quantitative real-time RT-PCR analysis indicated that the AhGPAT9 transcript was more abundant in the stems, flowers, and seeds, whereas the transcript abundances of five other genes were higher in the leaves or flowers than in the other tissues examined. During seed development, the transcript levels of AhGPAT9 gradually increased, whereas the transcript levels of the other five genes decreased. In addition, the levels of AhGPAT2 transcript were distinctly enhanced after exposure to all four kinds of stress treatments except for ABA-treated leaves. The transcripts of AhGPAT1, AhGPAT6, AhGPAT8 and AhATS1 increased substantially in roots exposed to salt, drought, and ABA stress. The expressions of AhGPAT6, AhGPAT8, AhGPAT9 and AhATS1 were slightly higher in leaves under certain stress conditions than under normal conditions. The present study provides significant information for modifying oil deposition and improving the abiotic stress resistance of peanuts through molecular breeding.La aciltransferasa sn-glicerol-3-fosfato (ATGP cataliza el comprometido paso de la producción de glicerolípidos. Las funciones de los genes AhATGP se han estudiado intensivamente en Arabidopsis, pero no en cacahuete (Arachis hypogaea L.. En este estudio, seis genes AhATGP se aislaron a partir de cacahuetes. El análisis a tiempo real RT-PCR cuantitativa indicó que la transcripción AhATGP9 fue más abundante en tallos, flores y semillas, mientras que la abundancia de la transcripción de los otros cinco genes fueron mayores en hojas o flores que en los otros tejidos examinados. Durante el desarrollo de la semilla, los niveles de transcripción de AhATGP9 aumentaron gradualmente

  15. Factors enhancing Agrobacterium tumefaciens-mediated gene transfer in peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Egnin, M.; Mora, A.; Prakash, C. S.; Mortley, D. G. (Principal Investigator)

    1998-01-01

    Parameters enhancing Agrobacterium-mediated transfer of foreign genes to peanut (Arachis hypogaea L.) cells were investigated. An intron-containing beta-glucuronidase uidA (gusA) gene under the transcriptional control of CaMV 35S promoter served as a reporter. Transformation frequency was evaluated by scoring the number of sectors expressing GUS activity on leaf and epicotyl explants. The 'Valencia Select' market type cv. New Mexico was more amenable to Agrobacterium transformation than the 'runner' market type cultivars tested (Florunner, Georgia Runner, Sunrunner, or South Runner). The disarmed Agrobacterium tumefaciens strain EHA101 was superior in facilitating the transfer of uidA gene to peanut cells compared to the disarmed strain C58. Rinsing of explants in half-strength Murashige-Skoog (MS) media prior to infection by Agrobacterium significantly increased the transformation efficiency. The use of cocultivation media containing high auxin [1.0 or 2.5 mg/l (4.53 micromolar or 11.31 micromolar) 2,4-D] and low cytokinin [0.25 or 0.5 mg/l (1.0 micromolar or 2.0 micromolar) BA] promoted higher transformation than either hormone-free or thidiazuron-containing medium. The polarity of the epicotyl during cocultivation was important; explants incubated in an inverted (vertically) manner followed by a vertically upright position resulted in improved transformation and shoot regeneration frequencies. Preculture of explants in MS basal medium or with 2.5 mg thidiazuron per l prior to infection drastically decreased the number of transformed zones. The optimized protocol was used to obtain transient transformation frequencies ranging from 12% to 36% for leaf explants, 15% to 42% for epicotyls. Initial evidence of transformation was obtained by polymerase chain reaction and subsequently confirmed by Southern analysis of regenerated plants.

  16. Groundnut (Arachis Hypogaea L. Cultivation in Türkiye and Osmaniye Peanut as a Geographical Indication

    Directory of Open Access Journals (Sweden)

    Güven Şahin

    2014-12-01

    Full Text Available Groundnut (Arachis hypogaea L. whose fatherland is South America outshines with its several aspects at agricultural field. First of all, even though the almost all of the harvest is consumed as food, since the seeds of this plant includes pretty much amount of oil, they constitute a highyl important raw material. The reason why demand of people for groundnut has been increasing as years go by, is the great quality degree of the oil handled and its benefits for human health. Another significant feature of this plant is that, as a member of bean family it has the ability of providing nitrogene fixation. From this point of view, groundnut is considered as the most essential plant of crop rotation technique. Most of the groundnut -also known as “araşit” in Türkiye- growth is done in Mediterranean Region, especially the zone of Adana. In our country, almost all of the harvest handled is consumed as sustenance in addition to that, remarkable increases are observed in the production of the plant mentioned above; furthermore by the year 2011, Türkiye has become the most important producer at his territory. In Türkiye, Osmaniye is now the center of groundnut generation and therefore the city is identical with its product. This could widely be understood from that the plant is secured by geographical indication patent in the name of “Groundnut of Osmaniye”. In that research, the main scope is agricultural geography and the highlighted topics are botanical properties, planting and the disrribution and commerce of the recommendations about the requirements follow. Moreover, the groundnut of Osmaniye, in terms of geographical indication is reconized to the reader

  17. Assessment of transpiration efficiency in peanut (Arachis hypogaea L.) under drought using a lysimetric system.

    Science.gov (United States)

    Ratnakumar, P; Vadez, V; Nigam, S N; Krishnamurthy, L

    2009-11-01

    Transpiration efficiency (TE) is an important trait for drought tolerance in peanut (Arachis hypogaea L.). The variation in TE was assessed gravimetrically using a long time interval in nine peanut genotypes (Chico, ICGS 44, ICGV 00350, ICGV 86015, ICGV 86031, ICGV 91114, JL 24, TAG 24 and TMV 2) grown in lysimeters under well-watered or drought conditions. Transpiration was measured by regularly weighing the lysimeters, in which the soil surface was mulched with a 2-cm layer of polythene beads. TE in the nine genotypes used varied from 1.4 to 2.9 g kg(-1) under well-watered and 1.7 to 2.9 g kg(-1) under drought conditions, showing consistent variation in TE among genotypes. A higher TE was found in ICGV 86031 in both well-watered and drought conditions and lower TE was found in TAG-24 under both water regimes. Although total water extraction differed little across genotypes, the pattern of water extraction from the soil profile varied among genotypes. High water extraction within 24 days following stress imposition was negatively related to pod yield (r(2) = 0.36), and negatively related to water extraction during a subsequent period of 32 days (r(2) = 0.73). By contrast, the latter, i.e. water extraction during a period corresponding to grain filling (24 to 56 days after flowering) was positively related to pod yield (r(2) = 0.36). TE was positively correlated with pod weight (r(2) = 0.30) under drought condition. Our data show that under an intermittent drought regime, TE and water extraction from the soil profile during a period corresponding to pod filling were the most important components.

  18. Development and characterization of BAC-end sequence derived SSRs, and their incorporation into a new higher density genetic map for cultivated peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Cultivated peanut (Arachis hypogaea L.) is an important crop worldwide, valued for its edible oil and digestible protein. It has a very narrow genetic base that may well derive from a relatively recent single polyploidization event. Accordingly molecular markers have low levels of polymorphism and t...

  19. Batch Scale Removal of an Organic Pollutant Amaranth Dye from Aqueous Solution using Pisum sativum Peels and Arachis hypogaea Shells as Adsorbents

    International Nuclear Information System (INIS)

    Rehman, R.; Afzal, A.

    2015-01-01

    The goal of this study was to utilize low cost and environmentally friendly adsorbents for batch scale removal of Amaranth dye from aqueous medium. Peels of Pisum sativum (Pea) and Arachis hypogaea (Peanut) were utilized to investigate their dye removing capacity. The optimized adsorption conditions for Pisum sativum (P.S.P) and Arachis hypogaea (A.H.S) were: adsorbent dose; 0.6 and 0.4 g, contact time; 45 and 10 minutes, pH; 2.0 for both, agitation speed; 150 and 100 rpm and temperature; 60 and 50 degree C for P.S.P and A.H.S respectively. The adsorption data well suited to Langmuir isotherm. Maximum adsorption capacities were found to be 144.93 and 10.53 mg/g for P.S.P and A.H.S respectively. Feasibility of the process was indicated by negative values of thermodynamic parameters delta G/sup 0/ for both adsorbents. Kinetic studies indicated that adsorption of Amaranth dye from aqueous medium by Pisum sativum peels and Arachis hypogaea shells followed pseudo-seconder order kinetics. It was concluded that Pisum sativum peels are more effective adsorbent for removal of Amaranth from aqueous solution as compared to Arachis hypogaea shells. (author)

  20. Recombinants from the crosses between amphidiploid and cultivated peanut (Arachis hypogaea for pest-resistance breeding programs.

    Directory of Open Access Journals (Sweden)

    Ailton Ferreira de Paula

    Full Text Available Peanut is a major oilseed crop worldwide. In the Brazilian peanut production, silvering thrips and red necked peanut worm are the most threatening pests. Resistant varieties are considered an alternative to pest control. Many wild diploid Arachis species have shown resistance to these pests, and these can be used in peanut breeding by obtaining hybrid of A and B genomes and subsequent polyploidization with colchicine, resulting in an AABB amphidiploid. This amphidiploid can be crossed with cultivated peanut (AABB to provide genes of interest to the cultivar. In this study, the sterile diploid hybrids from A. magna V 13751 and A. kempff-mercadoi V 13250 were treated with colchicine for polyploidization, and the amphidiploids were crossed with A. hypogaea cv. IAC OL 4 to initiate the introgression of the wild genes into the cultivated peanut. The confirmation of the hybridity of the progenies was obtained by: (1 reproductive characterization through viability of pollen, (2 molecular characterization using microsatellite markers and (3 morphological characterization using 61 morphological traits with principal component analysis. The diploid hybrid individual was polyploidized, generating the amphidiploid An 13 (A. magna V 13751 x A. kempff-mercadoi V 132504x. Four F1 hybrid plants were obtained from IAC OL 4 × An 13, and 51 F2 seeds were obtained from these F1 plants. Using reproductive, molecular and morphological characterizations, it was possible to distinguish hybrid plants from selfed plants. In the cross between A. hypogaea and the amphidiploid, as the two parents are polyploid, the hybrid progeny and selves had the viability of the pollen grains as high as the parents. This fact turns the use of reproductive characteristics impossible for discriminating, in this case, the hybrid individuals from selfing. The hybrids between A. hypogaea and An 13 will be used in breeding programs seeking pest resistance, being subjected to successive

  1. The antisense expression of AhPEPC1 increases seed oil production in peanuts (Arachis hypogaea L.)

    Energy Technology Data Exchange (ETDEWEB)

    Pan, L.; Zhang, J.; Chi, X.; Chen, N.; Chen, M.; Wang, M.; Wang, T.; Yang, Z.; Zhang, Z.; Wan, Y.; Yu, S.; Liu, F.

    2016-07-01

    Although phosphoenolpyruvate carboxylases (PEPCs) are reported to be involved in fatty acid accumulation, nitrogen assimilation, and salt and drought stresses, knowledge regarding PEPC gene functions is still limited, particularly in peanuts (Arachis hypogaea L.). In this study, the antisense expression of the peanut PEPC isoform 1 (AhPEPC1) gene increased the lipid content by 5.7%–10.3%. This indicated that AhPEPC1 might be related to plant lipid accumulation. The transgenic plants underwent more root elongation than the wild-type under salinity stress. Additionally, the specific down regulation of the AhPEPC1 gene improved the salt tolerance in peanuts. This is the first report on the role of PEPC in lipid accumulation and salt tolerance in peanuts.

  2. Data in support of proteome analysis of gynophores and early swelling pods of peanut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Han Xia

    2015-12-01

    Full Text Available Different from most of other plants, peanut (Arachis hypogaea L. is a typical geocarpic species which flowering and forming pegs (gynophores above the ground. Pegs penetrate into soil for embryo and pod development. To investigate the molecular mechanism of geocarpy feature of peanut, the proteome profiles of aerial grown gynophores (S1, subterranean unswollen gynophores (S2, and gynophores that had just started to swell into pods (S3 were analyzed by combining 1 DE with nano LC–MS/MS approaches. The proteomic data provided valuable information for understanding pod development of peanut. The data described here can be found in the PRIDE Archive using the reference number PXD002579-81. A more comprehensive analysis of this data may be obtained from the article in BMC Plant Biology (Zhao et al., 2015 [1].

  3. Allelopathic Activity of Extracts from Different Brazilian Peanut (Arachis hypogaea L.) Cultivars on Lettuce (Lactuca sativa) and Weed Plants.

    Science.gov (United States)

    Casimiro, G S; Mansur, E; Pacheco, G; Garcia, R; Leal, I C R; Simas, N K

    2017-01-01

    Peanut ( Arachis hypogaea L.) is the fourth most consumed oleaginous plant in the world, producing seeds with high contents of lipids, proteins, vitamins, and carbohydrates. Biological activities of different extracts of this species have already been evaluated by many researchers, including antioxidant, antitumoral, and antibacterial. In this work, the allelopathic activity of extracts from different Brazilian peanut cultivars against lettuce (Lactuca sativa) and two weed plants ( Commelina benghalensis and Ipomoea nil ) was studied. Aerial parts, roots, seeds, and seed coats were used for the preparation of crude extracts. Seed extract partitioning was performed with n -hexane, dichloromethane, ethyl acetate, n -butanol, and aqueous residue. Germination and growth of hypocotyls and rootlets were evaluated after one and five days of incubation with plant extracts, respectively. Crude seed extract and its dichloromethanic partition displayed highest allelopathic activity. These results contribute for the study of new potential natural herbicides.

  4. Allelopathic Activity of Extracts from Different Brazilian Peanut (Arachis hypogaea L.) Cultivars on Lettuce (Lactuca sativa) and Weed Plants

    Science.gov (United States)

    Garcia, R.; Simas, N. K.

    2017-01-01

    Peanut (Arachis hypogaea L.) is the fourth most consumed oleaginous plant in the world, producing seeds with high contents of lipids, proteins, vitamins, and carbohydrates. Biological activities of different extracts of this species have already been evaluated by many researchers, including antioxidant, antitumoral, and antibacterial. In this work, the allelopathic activity of extracts from different Brazilian peanut cultivars against lettuce (Lactuca sativa) and two weed plants (Commelina benghalensis and Ipomoea nil) was studied. Aerial parts, roots, seeds, and seed coats were used for the preparation of crude extracts. Seed extract partitioning was performed with n-hexane, dichloromethane, ethyl acetate, n-butanol, and aqueous residue. Germination and growth of hypocotyls and rootlets were evaluated after one and five days of incubation with plant extracts, respectively. Crude seed extract and its dichloromethanic partition displayed highest allelopathic activity. These results contribute for the study of new potential natural herbicides. PMID:28396881

  5. Isolation and characterization of novel microsatellite markers and their application for diversity assessment in cultivated groundnut (Arachis hypogaea

    Directory of Open Access Journals (Sweden)

    Crouch Jonathan H

    2008-05-01

    Full Text Available Abstract Background Cultivated peanut or groundnut (Arachis hypogaea L. is the fourth most important oilseed crop in the world, grown mainly in tropical, subtropical and warm temperate climates. Due to its origin through a single and recent polyploidization event, followed by successive selection during breeding efforts, cultivated groundnut has a limited genetic background. In such species, microsatellite or simple sequence repeat (SSR markers are very informative and useful for breeding applications. The low level of polymorphism in cultivated germplasm, however, warrants a need of larger number of polymorphic microsatellite markers for cultivated groundnut. Results A microsatellite-enriched library was constructed from the genotype TMV2. Sequencing of 720 putative SSR-positive clones from a total of 3,072 provided 490 SSRs. 71.2% of these SSRs were perfect type, 13.1% were imperfect and 15.7% were compound. Among these SSRs, the GT/CA repeat motifs were the most common (37.6% followed by GA/CT repeat motifs (25.9%. The primer pairs could be designed for a total of 170 SSRs and were optimized initially on two genotypes. 104 (61.2% primer pairs yielded scorable amplicon and 46 (44.2% primers showed polymorphism among 32 cultivated groundnut genotypes. The polymorphic SSR markers detected 2 to 5 alleles with an average of 2.44 per locus. The polymorphic information content (PIC value for these markers varied from 0.12 to 0.75 with an average of 0.46. Based on 112 alleles obtained by 46 markers, a phenogram was constructed to understand the relationships among the 32 genotypes. Majority of the genotypes representing subspecies hypogaea were grouped together in one cluster, while the genotypes belonging to subspecies fastigiata were grouped mainly under two clusters. Conclusion Newly developed set of 104 markers extends the repertoire of SSR markers for cultivated groundnut. These markers showed a good level of PIC value in cultivated germplasm

  6. Gamma radiation effects at color, antioxidant capacity and fatty acid profile in peanut (Arachis hypogaea L.); Efeitos da radiacao gama na cor, capacidade antioxidante e perfil de acidos graxos em amendoim (Arachis hypogaea L.)

    Energy Technology Data Exchange (ETDEWEB)

    Camargo, Adriano Costa de; Canniatti-Brazaca, Solange Guidolin; Mansi, Debora Niero; Domingues, Maria Antonia Calori [Escola Superior de Agricultura Luiz de Queiroz (ESALQ/USP), Piracicaba, SP (Brazil). Dept. de Agroindustria, Alimentos e Nutricao; Arthur, Valter, E-mail: arthur@cena.usp.b [Centro de Energia Nuclear na Agricultura (CENA/USP), Piracicaba, SP (Brazil)

    2011-01-15

    Irradiation is efficient at extinction fungi contamination in peanuts. Peanuts have high biologic value protein, minerals, vitamin E, complex B, and high concentration of lipids. The objective of this research is to evaluate the gamma irradiation effect on color, total phenolic, antioxidant activity, and fatty acid profile in peanuts (Arachis hypogaea L.). Cultivars IAC-Tatu ST and IAC-Runner 886 were submitted to gamma radiation with doses of 5.0; 7.5; 10.0, and 15.0 kGy and storage at room temperature. There was no significant difference in the color of IAC-Tatu ST. However, significant difference was found in the luminosity and Chroma in IAC-Runner 886. Total fenolics differed from the control with 33.27 mg.g{sup -1} and treatment dose of 10.0 kGy with 58.60 mg.g{sup -1} in IAC-Tatu ST. This parameter not had significant difference in IAC-Runner 886 and the control with 51.59 mg.g{sup -1}. The antioxidant activity did not present significant difference with a dose of 10.0 kGy, recommended for the elimination of fungi in peanuts. The dose of 10.0 kGy showed a decrease in saturated fatty acids, increase in unsaturated fatty acids, and an increase in linolleic acid. The oleic/linoleic relation decreased justifying further research correlating storage and oxidative stability. (author)

  7. Gas chromatography-mass spectrometry screening for phytochemical 4-desmethylsterols accumulated during development of Tunisian peanut kernels (Arachis hypogaea L.).

    Science.gov (United States)

    Cherif, Aicha O; Trabelsi, Hajer; Ben Messaouda, Mhamed; Kâabi, Belhassen; Pellerin, Isabelle; Boukhchina, Sadok; Kallel, Habib; Pepe, Claude

    2010-08-11

    4-Desmethylsterols, the main component of the phytosterol fraction, have been analyzed during the development of Tunisian peanut kernels ( Arachis hypogaea L.), Trabelsia (AraT) and Chounfakhi (AraC), which are monocultivar species, and Arbi (AraA), which is a wild species, by gas chromatography-mass spectrometry. Immature wild peanut (AraA) showed the highest contents of beta-sitosterol (554.8 mg/100 g of oil), campesterol (228.6 mg/100 g of oil), and Delta(5)-avenasterol (39.0 mg/100 g of oil) followed by peanut cultivar AraC with beta-sitosterol, campesterol, and Delta(5)-avenasterol averages of 267.7, 92.1, and 28.6 mg/100 g of oil, respectively, and similarly for AraT 309.1, 108.4, and 27.4 mg/100 g of oil, respectively, were found. These results suggest that, in immature stages, phytosterol contents can be important regulator factors for the functional quality of peanut oil for the agro-industry chain from plant to nutraceuticals.

  8. Overexpression of Arachis hypogaea AREB1 Gene Enhances Drought Tolerance by Modulating ROS Scavenging and Maintaining Endogenous ABA Content

    Directory of Open Access Journals (Sweden)

    Ling Li

    2013-06-01

    Full Text Available AhAREB1 (Arachis hypogaea Abscisic-acid Response Element Binding Protein 1 is a member of the basic domain leucine zipper (bZIP-type transcription factor in peanut. Previously, we found that expression of AhAREB1 was specifically induced by abscisic acid (ABA, dehydration and drought. To understand the drought defense mechanism regulated by AhAREB1, transgenic Arabidopsis overexpressing AhAREB1 was conducted in wild-type (WT, and a complementation experiment was employed to ABA non-sensitivity mutant abi5 (abscisic acid-insensitive 5. Constitutive expression of AhAREB1 confers water stress tolerance and is highly sensitive to exogenous ABA. Microarray and further real-time PCR analysis revealed that drought stress, reactive oxygen species (ROS scavenging, ABA synthesis/metabolism-related genes and others were regulated in transgenic Arabidopsis overexpressing AhAREB1. Accordingly, low level of ROS, but higher ABA content was detected in the transgenic Arabidopsis plants’ overexpression of AhAREB1. Taken together, it was concluded that AhAREB1 modulates ROS accumulation and endogenous ABA level to improve drought tolerance in transgenic Arabidopsis.

  9. Mapping Late Leaf Spot Resistance in Peanut (Arachis hypogaea Using QTL-seq Reveals Markers for Marker-Assisted Selection

    Directory of Open Access Journals (Sweden)

    Josh Clevenger

    2018-02-01

    Full Text Available Late leaf spot (LLS; Cercosporidium personatum is a major fungal disease of cultivated peanut (Arachis hypogaea. A recombinant inbred line population segregating for quantitative field resistance was used to identify quantitative trait loci (QTL using QTL-seq. High rates of false positive SNP calls using established methods in this allotetraploid crop obscured significant QTLs. To resolve this problem, robust parental SNPs were first identified using polyploid-specific SNP identification pipelines, leading to discovery of significant QTLs for LLS resistance. These QTLs were confirmed over 4 years of field data. Selection with markers linked to these QTLs resulted in a significant increase in resistance, showing that these markers can be immediately applied in breeding programs. This study demonstrates that QTL-seq can be used to rapidly identify QTLs controlling highly quantitative traits in polyploid crops with complex genomes. Markers identified can then be deployed in breeding programs, increasing the efficiency of selection using molecular tools.Key Message: Field resistance to late leaf spot is a quantitative trait controlled by many QTLs. Using polyploid-specific methods, QTL-seq is faster and more cost effective than QTL mapping.

  10. The Peanut (Arachis hypogaea L. Gene AhLPAT2 Increases the Lipid Content of Transgenic Arabidopsis Seeds.

    Directory of Open Access Journals (Sweden)

    Silong Chen

    Full Text Available Lysophosphatidic acid acyltransferase (LPAT, which converts lysophosphatidic acid (LPA to phosphatidic acid (PA, catalyzes the addition of fatty acyl moieties to the sn-2 position of the LPA glycerol backbone in triacylglycerol (TAG biosynthesis. We recently reported the cloning and temporal-spatial expression of a peanut (Arachis hypogaea AhLPAT2gene, showing that an increase in AhLPAT2 transcript levels was closely correlated with an increase in seed oil levels. However, the function of the enzyme encoded by the AhLPAT2 gene remains unclear. Here, we report that AhLPAT2 transcript levels were consistently higher in the seeds of a high-oil cultivar than in those of a low-oil cultivar across different seed developmental stages. Seed-specific overexpression of AhLPAT2 in Arabidopsis results in a higher percentage of oil in the seeds and greater-than-average seed weight in the transgenic plants compared with the wild-type plants, leading to a significant increase in total oil yield per plant. The total fatty acid (FA content and the proportion of unsaturated FAs also increased. In the developing siliques of AhLPAT2-overexpressing plants, the expression levels of genes encoding crucial enzymes involved in de novo FA synthesis, acetyl-CoA subunit (AtBCCP2 and acyl carrier protein 1 (AtACP1 were elevated. AhLPAT2 overexpression also promoted the expression of several key genes related to TAG assembly, sucrose metabolism, and glycolysis. These results demonstrate that the expression of AhLPAT2 plays an important role in glycerolipid production in peanuts.

  11. Growth performance and hematology of Djallonké rams fed haulms of four varieties of groundnut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Terry Ansah

    2017-12-01

    Full Text Available The study was conducted to assess the chemical composition of the haulms of 4 dual-purpose groundnut (Arachis hypogaea L. varieties and their effects on the growth and hematology of Djallonké rams. The groundnut varieties were ICGV 97049 (Obolo, ICGX SM 87057 (Yenyawoso, RMP 12 (Azivivi and Manipinta. Rams (live weight 15.0 ± 3.0 kg were randomly assigned to 4 sole groundnut haulm meal (GHM treatments, with 4 rams each in an individual pen per treatment (total n = 16 rams. Samples of the groundnut haulms were milled and analyzed for crude protein (CP, neutral detergent fiber (NDF and acid detergent fiber (ADF. The CP concentration was higher (P  0.05 when the Djallonké rams were fed the haulms. However, significant differences were observed in final live weight and average daily live weight gain. Rams fed the Yenyawoso variety had higher (P < 0.05 final live weight and average daily live weight gain compared with those fed Obolo and Azivivi varieties. Consumption of any of the 4 varieties of groundnut haulms by Djallonké rams did not have any harmful effect on their red and white blood cell numbers and hemoglobin concentration. The study revealed that the different varieties of groundnut haulms differ in nutrient composition and also affect the growth performance of the rams. The Yenyawoso variety may be used as a sole diet for fattening Djallonké rams.

  12. Identification and characterization of microRNAs from peanut (Arachis hypogaea L. by high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Xiaoyuan Chi

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are noncoding RNAs of approximately 21 nt that regulate gene expression in plants post-transcriptionally by endonucleolytic cleavage or translational inhibition. miRNAs play essential roles in numerous developmental and physiological processes and many of them are conserved across species. Extensive studies of miRNAs have been done in a few model plants; however, less is known about the diversity of these regulatory RNAs in peanut (Arachis hypogaea L., one of the most important oilseed crops cultivated worldwide. RESULTS: A library of small RNA from peanut was constructed for deep sequencing. In addition to 126 known miRNAs from 33 families, 25 novel peanut miRNAs were identified. The miRNA* sequences of four novel miRNAs were discovered, providing additional evidence for the existence of miRNAs. Twenty of the novel miRNAs were considered to be species-specific because no homolog has been found for other plant species. qRT-PCR was used to analyze the expression of seven miRNAs in different tissues and in seed at different developmental stages and some showed tissue- and/or growth stage-specific expression. Furthermore, potential targets of these putative miRNAs were predicted on the basis of the sequence homology search. CONCLUSIONS: We have identified large numbers of miRNAs and their related target genes through deep sequencing of a small RNA library. This study of the identification and characterization of miRNAs in peanut can initiate further study on peanut miRNA regulation mechanisms, and help toward a greater understanding of the important roles of miRNAs in peanut.

  13. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  14. Contribution of native phosphorous-solubilizing bacteria of acid soils on phosphorous acquisition in peanut (Arachis hypogaea L.).

    Science.gov (United States)

    Pradhan, Madhusmita; Sahoo, Ranjan Kumar; Pradhan, Chinmay; Tuteja, Narendra; Mohanty, Santanu

    2017-11-01

    The present investigation analyzes the in vitro P solubilization [Ca-P, Al-P, Fe(II)-P, and Fe(III)-P] efficiency of native PSB strains from acid soils of Odisha and exploitation of the same through biofertilization in peanut (Arachis hypogaea L.) growth and P acquisition. One hundred six numbers of soil samples with pH ≤ 5.50 were collected from five districts of Odisha viz., Balasore, Cuttack, Khordha, Keonjhar, and Mayurbhanj. One bacterial isolate from each district were selected and analyzed for their P solubilization efficiency in National Botanical Research Institute Phosphate broths with Ca, Al, and Fe-complexed phosphates. CTC12 and KHD08 transformed more amount of soluble P from Ca-P (CTC12 393.30 mg/L; KHD08 465.25 mg/L), Al-P (CTC12 40.00 mg/L; KHD08 34.50 mg/L), Fe(III)-P (CTC12 175.50 mg/L; KHD08 168.75 mg/L), and Fe(II)-P (CTC12 47.40 mg/L; KHD08 42.00 mg/L) after 8 days of incubation. The bioconversion of P by all the five strains in the broth medium followed the order Ca-P > Fe(III)-P > Fe(II)-P > Al-P. The identified five strains were Bacillus cereus BLS18 (KT582541), Bacillus amyloliquefaciens CTC12 (KT633845), Burkholderia cepacia KHD08 (KT717633), B. cepacia KJR03 (KT717634), and B. cepacia K1 (KM030037) and further studied for biofertilization effects on peanut. CTC12 and KHD08 enhanced the soil available P around 65 and 58% and reduced the amount of each Al 3+ about 79 and 81%, respectively, over the uninoculated control pots in the peanut rhizosphere. Moreover, all tested PSB strains could be able to successfully mobilize P from inorganic P fractions (non-occluded Al-P and Fe-P). The strains CTC12 and KHD08 increased the pod yield (114 and 113%), shoot P (92 and 94%), and kernel P (100 and 101%), respectively, over the control. However, B. amyloliquefaciens CTC12 and B. cepacia KHD08 proved to be the potent P solubilizers in promoting peanut growth and yield.

  15. Characterization of Arachis hypogaea L. oil obtained from different extraction techniques and in vitro antioxidant potential of supercritical fluid extraction extract

    Directory of Open Access Journals (Sweden)

    Rishika Chauhan

    2016-01-01

    Full Text Available Aim: The present investigation was aimed to characterize the fixed oil of Arachis hypogaea L. using five different extraction methods: Supercritical fluid extraction (SFE, ultrasound assistance extraction, soxhlet extraction, solvent extraction, and three phase partitioning method. Materials and Methods: The SFE conditions (temperature, pressure, and volume of CO 2 were optimized prior for better yield. The extracted oils were analyzed and compared for their physiochemical parameters, high-performance thin layer chromatography (HPTLC, gas chromatography-mass spectrometry (GC-MS, and Fourier transform infrared spectrometry (FT-IR fingerprinting. Anti-oxidant activity was also determined using DPPH and superoxide scavenging method. Results: The main fatty acids were oleic, linoleic, palmitic, and stearic acids as obtained by GC-MS. HPTLC analysis revealed the presence of similar major components in chromatograms. Similarly, the pattern of peaks as obtained in FT-IR and GC-MS spectra of same oils by different extraction methods was superimposable. Conclusion: Analysis reported that the fixed oil of A. hypogaea L. is a good source of unsaturated fatty acid, mainly n-6 and n-9 fatty acid with a significant antioxidant activity of oil obtained from SFE extraction method.

  16. An oxidative burst and its attenuation by bacterial peroxidase activity is required for optimal establishment of the Arachis hypogaea-Bradyrhizobium sp. symbiosis.

    Science.gov (United States)

    Muñoz, V; Ibáñez, F; Figueredo, M S; Fabra, A

    2016-07-01

    The main purpose of this study was to determine whether the Arachis hypogaea L. root oxidative burst, produced at early stages of its symbiotic interaction with Bradyrhizobium sp. SEMIA 6144, and the bacterial antioxidant system are required for the successful development of this interaction. Pharmacological approaches were used to reduce both plant oxidative burst and bacterial peroxidase enzyme activity. In plants whose H2 O2 levels were decreased, a low nodule number, a reduction in the proportion of red nodules (%) and an increase in the bacteroid density were found. The symbiotic phenotype of plants inoculated with a Bradyrhizobium sp. SEMIA 6144 culture showing decreased peroxidase activity was also affected, since the biomass production, nodule number and percentage of red nodules in these plants were lower than in plants inoculated with Bradyrhizobium sp. control cultures. We demonstrated for the first time that the oxidative burst triggered at the early events of the symbiotic interaction in peanut, is a prerequisite for the efficient development of root nodules, and that the antioxidant system of bradyrhizobial peanut symbionts, particularly the activity of peroxidases, is counteracting this oxidative burst for the successful establishment of the symbiosis. Our results provide new insights into the mechanisms involved in the development of the symbiotic interaction established in A. hypogaea L. a legume infected in an intercellular way. © 2016 The Society for Applied Microbiology.

  17. Arachis hypogaea L.

    African Journals Online (AJOL)

    Administrator

    2011-05-16

    May 16, 2011 ... leading to a high dependence of soil to N fertilizer for optimum yield ..... effect of salinity. drought stress and soil type on nodule activities of. Ngo Nkot et al. ... Plant mechanisms contributing to acid impairment of nodulation of ...

  18. Arachis hypogaea L.

    African Journals Online (AJOL)

    IBUKUN

    Low yields are mainly due to numerous diseases caused by fungi, viruses, bacteria and ... Peanut clump virus (PCV), Peanut mottle virus (PeMoV), Peanut stripe virus (PStV), Tobacco ... Seed borne infection of the virus has been detected with incidences ... The experimental field has been used for the cultivation of maize.

  19. Combinatorial efficacy of Trichoderma spp. and Pseudomonas fluorescens to enhance suppression of cell wall degrading enzymes produced by Fusarium wilt of Arachis hypogaea.L

    Directory of Open Access Journals (Sweden)

    P Rajeswari

    2017-12-01

    Full Text Available Fusarium oxysporum, the soil borne pathogen causes vascular wilt, on majority of crop plants. It has been demonstrated that two different species of Trichoderma and Pseudomonas fluorescens suppress disease by different mechanisms. Therefore, application of a mixture of these biocontrol agents, and thus of several suppressive mechanisms, may represent a viable control strategy. A necessity for biocontrol by combinations of biocontrol agents can be the compatibility of the co-inoculated micro-organisms. Hence, compatibility between Trichoderma spp. and Pseudomonas fluorescens that have the ability to suppress Fusarium oxysporum in vitro on the activity of pectinolytic enzymes of Fusarium oxysporum. The activity of pectinolytic enzymes, i.e. pectin methyl esterase, endo and exo polymethylgalacturonases and exo and endo pectin trans eliminases produced by Fusarium oxysporum (Control was higher. Maximum inhibition of pectin methylesterase, exo and endo polymethylgalacturonase and exo and endopectin trans eliminase was shown by culture filtrate of Trichoderma viride + Pseudomonas fluorescens (Tv+Pf (1+2%, followed by Trichoderma harzianum + Pseudomonas fluorescens, (Th +Pf (1.5+2% and Trichoderma viride + Trichoderma harzianum (Tv+Th (1+1.5%. However, pathogenecity suppression of Fusarium oxysporum, a causative of Arachis hypogaea. L by the compatible combination of Trichodema viride + Pseudomonas fluorescens (1+2% was significantly better as compared to the single bio-agent. This indicates that specific interactions between biocontrol agents influence suppression of pathogenicity factors directly by combinations of these compatible bio-agents.

  20. TALEN-mediated targeted mutagenesis of fatty acid desaturase 2 (FAD2) in peanut (Arachis hypogaea L.) promotes the accumulation of oleic acid.

    Science.gov (United States)

    Wen, Shijie; Liu, Hao; Li, Xingyu; Chen, Xiaoping; Hong, Yanbin; Li, Haifen; Lu, Qing; Liang, Xuanqiang

    2018-05-01

    A first creation of high oleic acid peanut varieties by using transcription activator-like effecter nucleases (TALENs) mediated targeted mutagenesis of Fatty Acid Desaturase 2 (FAD2). Transcription activator like effector nucleases (TALENs), which allow the precise editing of DNA, have already been developed and applied for genome engineering in diverse organisms. However, they are scarcely used in higher plant study and crop improvement, especially in allopolyploid plants. In the present study, we aimed to create targeted mutagenesis by TALENs in peanut. Targeted mutations in the conserved coding sequence of Arachis hypogaea fatty acid desaturase 2 (AhFAD2) were created by TALENs. Genetic stability of AhFAD2 mutations was identified by DNA sequencing in up to 9.52 and 4.11% of the regeneration plants at two different targeted sites, respectively. Mutation frequencies among AhFAD2 mutant lines were significantly correlated to oleic acid accumulation. Genetically, stable individuals of positive mutant lines displayed a 0.5-2 fold increase in the oleic acid content compared with non-transgenic controls. This finding suggested that TALEN-mediated targeted mutagenesis could increase the oleic acid content in edible peanut oil. Furthermore, this was the first report on peanut genome editing event, and the obtained high oleic mutants could serve for peanut breeding project.

  1. Stress-inducible expression of At DREB1A in transgenic peanut (Arachis hypogaea L.) increases transpiration efficiency under water-limiting conditions.

    Science.gov (United States)

    Bhatnagar-Mathur, Pooja; Devi, M Jyostna; Reddy, D Srinivas; Lavanya, M; Vadez, Vincent; Serraj, R; Yamaguchi-Shinozaki, K; Sharma, Kiran K

    2007-12-01

    Water deficit is the major abiotic constraint affecting crop productivity in peanut (Arachis hypogaea L.). Water use efficiency under drought conditions is thought to be one of the most promising traits to improve and stabilize crop yields under intermittent water deficit. A transcription factor DREB1A from Arabidopsis thaliana, driven by the stress inducible promoter from the rd29A gene, was introduced in a drought-sensitive peanut cultivar JL 24 through Agrobacterium tumefaciens-mediated gene transfer. The stress inducible expression of DREB1A in these transgenic plants did not result in growth retardation or visible phenotypic alterations. T3 progeny of fourteen transgenic events were exposed to progressive soil drying in pot culture. The soil moisture threshold where their transpiration rate begins to decline relative to control well-watered (WW) plants and the number of days needed to deplete the soil water was used to rank the genotypes using the average linkage cluster analysis. Five diverse events were selected from the different clusters and further tested. All the selected transgenic events were able to maintain a transpiration rate equivalent to the WW control in soils dry enough to reduce transpiration rate in wild type JL 24. All transgenic events except one achieved higher transpiration efficiency (TE) under WW conditions and this appeared to be explained by a lower stomatal conductance. Under water limiting conditions, one of the selected transgenic events showed 40% higher TE than the untransformed control.

  2. Morfologia da flor e formação do fruto no amendoim cultivado (Arachis hypogaea, L. Flower morphology and fruit development in the cultivated peanut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Candida H. T. M. Conagin

    1955-01-01

    Full Text Available O amendoim comum pertence à espécie Arachis hypogxa L. ; outras espécies não apresentam valor econômico algum. As variedades comerciais podem ser reunidas em três grupos - Virgínia, Spanish e Valência - de acôrdo com a distribuição das gemas vegetativas e reprodutivas e também com o número de sementes por fruto. Nêste trabalho é apresentado um estudo da morfologia, duração e fertilização da flor, mostrando que no amendoim não existe a suposta distinção de flôres férteis e estéreis. Também a formação do fruto é descrita, mostrando a interessante característica desta planta, que é ter flôres aéreas e frutos subterrâneos.This work is based mostly on the descriptions given in Smith's paper "Arachis hypogxa L. Aerial flower and Subterranean Fruit" (2 and in the symposium "The Peanut. The unpredictable Legume" (3, and also on some of the author's observations. All cultivated peanut varieties belong to the species Arachis hypogxa L.; other species of the genus are not used for commercial production and may be of interest only for breeding purposes. Commercial peanut varieties can be grouped into one of three types : Virginia, Spanish, and Valencia. This grouping is done according to the distribution of vegetative and reproductive buds on the plant, and to the number of seeds per fruit. Studies were made on flower morphology, its duration and fertilization ; they indicated that all peanut flowers are potentially fertile and cannot, therefore, be classed into fertile and infertile types. A description of how the aerial flowers produce subterranean fruits is given.

  3. A Novel WRKY Transcription Factor, MuWRKY3 (Macrotyloma uniflorum Lam. Verdc. Enhances Drought Stress Tolerance in Transgenic Groundnut (Arachis hypogaea L. Plants

    Directory of Open Access Journals (Sweden)

    Kurnool Kiranmai

    2018-03-01

    Full Text Available Drought stress has adverse effects on growth, water relations, photosynthesis and yield of groundnut. WRKY transcription factors (TFs are the plant-specific TFs which regulate several down-stream stress-responsive genes and play an essential role in plant biotic and abiotic stress responses. We found that WRKY3 gene is highly up-regulated under drought stress conditions and therefore isolated a new WRKY3TF gene from a drought-adapted horsegram (Macrotyloma uniflorum Lam. Verdc.. Conserved domain studies revealed that protein encoded by this gene contains highly conserved regions of two WRKY domains and two C2H2 zinc-finger motifs. The fusion protein localization studies of transient MuWRKY3-YFP revealed its nuclear localization. Overexpression of MuWRKY3 TF gene in groundnut (Arachis hypogaea L. showed increased tolerance to drought stress compared to wild-type (WT plants. MuWRKY3 groundnut transgenics displayed lesser and delayed wilting symptoms than WT plants after 10-days of drought stress imposition. The transgenic groundnut plants expressing MuWRKY3 showed less accumulation of malondialdehyde, hydrogen peroxide (H2O2, and superoxide anion (O2∙-, accompanied by more free proline, total soluble sugar content, and activities of antioxidant enzymes than WT plants under drought stress. Moreover, a series of stress-related LEA, HSP, MIPS, APX, SOD, and CAT genes found up-regulated in the transgenic groundnut plants. The study demonstrates that nuclear-localized MuWRKY3 TF regulates the expression of stress-responsive genes and the activity of ROS scavenging enzymes which results in improved drought tolerance in groundnut. We conclude that MuWRKY3 may serve as a new putative candidate gene for the improvement of stress resistance in plants.

  4. Translation Initiation Factor eIF4E and eIFiso4E Are Both Required for Peanut stripe virus Infection in Peanut (Arachis hypogaea L.).

    Science.gov (United States)

    Xu, Manlin; Xie, Hongfeng; Wu, Juxiang; Xie, Lianhui; Yang, Jinguang; Chi, Yucheng

    2017-01-01

    Peanut stripe virus (PStV) belongs to the genus Potyvirus and is the most important viral pathogen of cultivated peanut ( Arachis hypogaea L.). The eukaryotic translation initiation factor, eIF4E, and its isoform, eIF(iso)4E, play key roles during virus infection in plants, particularly Potyvirus . In the present study, we cloned the eIF4E and eIF(iso)4E homologs in peanut and named these as PeaeIF4E and PeaeIF(iso)4E , respectively. Quantitative real-time PCR (qRT-PCR) analysis showed that these two genes were expressed during all growth periods and in all peanut organs, but were especially abundant in young leaves and roots. These also had similar expression levels. Yeast two-hybrid analysis showed that PStV multifunctional helper component proteinase (HC-Pro) and viral protein genome-linked (VPg) both interacted with PeaeIF4E and PeaeIF(iso)4E. Bimolecular fluorescence complementation assay showed that there was an interaction between HC-Pro and PeaeIF4E/PeaeIF(iso)4E in the cytoplasm and between VPg and PeaeIF4E/PeaeIF(iso)4E in the nucleus. Silencing either PeaeIF4E or PeaeIF(iso)4E using a virus-induced gene silencing system did not significantly affect PStV accumulation. However, silencing both PeaeIF4E and PeaeIF(iso)4E genes significantly weakened PStV accumulation. The findings of the present study suggest that PeaeIF4E and PeaeIF(iso)4E play important roles in the PStV infection cycle and may potentially contribute to PStV resistance.

  5. A Novel WRKY Transcription Factor, MuWRKY3 (Macrotyloma uniflorum Lam. Verdc.) Enhances Drought Stress Tolerance in Transgenic Groundnut (Arachis hypogaea L.) Plants.

    Science.gov (United States)

    Kiranmai, Kurnool; Lokanadha Rao, Gunupuru; Pandurangaiah, Merum; Nareshkumar, Ambekar; Amaranatha Reddy, Vennapusa; Lokesh, Uppala; Venkatesh, Boya; Anthony Johnson, A M; Sudhakar, Chinta

    2018-01-01

    Drought stress has adverse effects on growth, water relations, photosynthesis and yield of groundnut. WRKY transcription factors (TFs) are the plant-specific TFs which regulate several down-stream stress-responsive genes and play an essential role in plant biotic and abiotic stress responses. We found that WRKY3 gene is highly up-regulated under drought stress conditions and therefore isolated a new WRKY3TF gene from a drought-adapted horsegram ( Macrotyloma uniflorum Lam. Verdc.). Conserved domain studies revealed that protein encoded by this gene contains highly conserved regions of two WRKY domains and two C2H2 zinc-finger motifs. The fusion protein localization studies of transient MuWRKY 3-YFP revealed its nuclear localization. Overexpression of MuWRKY3 TF gene in groundnut ( Arachis hypogaea L.) showed increased tolerance to drought stress compared to wild-type (WT) plants. MuWRKY3 groundnut transgenics displayed lesser and delayed wilting symptoms than WT plants after 10-days of drought stress imposition. The transgenic groundnut plants expressing MuWRKY3 showed less accumulation of malondialdehyde, hydrogen peroxide (H 2 O 2 ), and superoxide anion (O 2 ∙- ), accompanied by more free proline, total soluble sugar content, and activities of antioxidant enzymes than WT plants under drought stress. Moreover, a series of stress-related LEA, HSP, MIPS, APX, SOD , and CAT genes found up-regulated in the transgenic groundnut plants. The study demonstrates that nuclear-localized MuWRKY3 TF regulates the expression of stress-responsive genes and the activity of ROS scavenging enzymes which results in improved drought tolerance in groundnut. We conclude that MuWRKY3 may serve as a new putative candidate gene for the improvement of stress resistance in plants.

  6. Optimization of pretreatment, process performance, mass and energy balance in the anaerobic digestion of Arachis hypogaea (Peanut) hull

    International Nuclear Information System (INIS)

    Dahunsi, S.O.; Oranusi, S.; Efeovbokhan, V.E.

    2017-01-01

    Highlights: • Biogas was maximally produced from the anaerobic digestion of peanut hull. • Thermo-alkaline pretreatment enhanced enormous biogas yield from the biomass. • The optimal condition for maximal biogas yield were established. • The digestate has great potentials for usage as biofertilizers/soil conditioner. • The pretreatment is economical by converting the gas to heat and electric energies. - Abstract: The potential of a major bioresource (Peanut hull) for biogas generation was evaluated. A sample was pretreated using combinations of mechanical and thermo-alkaline procedures using the Central Composite Design (CCD) for the optimization of the pretreatment temperature and time while another sample was treated without thermo-alkaline methods. The physico-chemical and microbial characteristics of the A. hypogaea hull and the rumen contents were carried out using standard methods. The actual biogas yields were 1739.20 m"3/kg TSfed and 1100.50 m"3/kg TSfed with desirability values of 91 and 100% for the pretreated and untreated experiments respectively. The methane and carbon dioxide content of biogas from both experiments as revealed by Gas chromatography were 61.5 ± 2.5%; 24 ± 1% and 51 ± 2%; 25 ± 2% respectively. The optimization of important process parameters in the anaerobic digestion were done using CCD of Response Surface Methodology (RSM) and the Artificial Neural Networks (ANNs) and the optimal values for each of the five major parameters optimized are as follows: Temperature = 30.00 °C, pH = 7.50, Retention time = 30.00 day, Total solids = 12.00 g/kg and Volatile solids = 4.00 g/kg. Taking these values into account, the predicted biogas yield for RSM was 1819.89 m"3/kg TSfed and 1743.6 m"3/kg TSfed for ANNs in the thermo-alkaline pretreated experiment. For the experiment without pretreatment, the RSM predicted yield was 1119.54 m"3/kg TSfed while that of ANNs was 1103.40 m"3/kg TSfed. In all there was a 38.5% increase in predicted

  7. PRODUCTION ANALYSIS OF GROUNDNUT, ( ARACHIS ...

    African Journals Online (AJOL)

    Production analysis of groundnut (Arachis hypogaea) was carried out in Ezeagu local government Area of Enugu State. This was done by randomly sampling 105 groundnut farmers from seven autonomous communities in the local government area. The overall aim was to determine, specifically the profitability of groundnut ...

  8. Soil physical and hydraulic properties modification under Arachis ...

    African Journals Online (AJOL)

    A field study was carried out to determine the effects of 3 plant densities (33333, 66667 and 83333 plants/ha)on soil properties and water loss through evaporation from soils under 2 cultivars of Arachis hypogaeaL. (SAMNUT 10 and SAMNUT 21) and Arachis pintoi(PINTOI) in Ibadan, south western Nigeria. The experiment ...

  9. Genome-Wide Discovery of Microsatellite Markers from Diploid Progenitor Species, Arachis duranensis and A. ipaensis, and Their Application in Cultivated Peanut (A. hypogaea

    Directory of Open Access Journals (Sweden)

    Chuanzhi Zhao

    2017-07-01

    Full Text Available Despite several efforts in the last decade toward development of simple sequence repeat (SSR markers in peanut, there is still a need for more markers for conducting different genetic and breeding studies. With the effort of the International Peanut Genome Initiative, the availability of reference genome for both the diploid progenitors of cultivated peanut allowed us to identify 135,529 and 199,957 SSRs from the A (Arachis duranensis and B genomes (Arachis ipaensis, respectively. Genome sequence analysis showed uneven distribution of the SSR motifs across genomes with variation in parameters such as SSR type, repeat number, and SSR length. Using the flanking sequences of identified SSRs, primers were designed for 51,354 and 60,893 SSRs with densities of 49 and 45 SSRs per Mb in A. duranensis and A. ipaensis, respectively. In silico PCR analysis of these SSR markers showed high transferability between wild and cultivated Arachis species. Two physical maps were developed for the A genome and the B genome using these SSR markers, and two reported disease resistance quantitative trait loci (QTLs, qF2TSWV5 for tomato spotted wilt virus (TSWV and qF2LS6 for leaf spot (LS, were mapped in the 8.135 Mb region of chromosome A04 of A. duranensis. From this genomic region, 719 novel SSR markers were developed, which provide the possibility for fine mapping of these QTLs. In addition, this region also harbors 652 genes and 49 of these are defense related genes, including two NB-ARC genes, three LRR receptor-like genes and three WRKY transcription factors. These disease resistance related genes could contribute to resistance to viral (such as TSWV and fungal (such as LS diseases in peanut. In summary, this study not only provides a large number of molecular markers for potential use in peanut genetic map development and QTL mapping but also for map-based gene cloning and molecular breeding.

  10. Características agronômicas do amendoinzeiro sob irrigação com águas salinas em solo com biofertilizantes = Agronomics Characteristicsof Peanuts under irrigation with saline water on soil with biofertilizers.

    Directory of Open Access Journals (Sweden)

    Geocleber Gomes de Sousa

    2012-08-01

    Full Text Available Objetivou-se com esse trabalho avaliar o efeito da salinidade da água de irrigação nas características agronômicas do amendoinzeiro (Arachis hypogaea L. cultivado em solo sem e com biofertilizantes. O experimento foi conduzido em estufa telada na Estação Agrometereológica, Campus do Pici, Fortaleza, CE. A semeadura foi feita em vasos utilizando-se, como substrato, um Argissolo Vermelho-Amarelo, com uma planta por vaso. O experimento obedeceu a um delineamento inteiramente casualizado, em esquema fatorial 4 x 3, com cinco repetições. Os fatores referem-se aos valores de condutividadeelétrica da água de irrigação: 1,5; 3,0; 4,5 e 6,0 dS m-1 e sem e com biofertilizantes (sem biofertilizante -B0; com biofertilizanteanaeróbico-B1; e com biofertilizante aeróbico - B2. Foram avaliadas as seguintes variáveis: pH, condutividade elétrica do solo, crescimento inicial em número de folhas, altura de plantas, diâmetro do colmo, área foliar e matéria seca da parte aérea. O biofertilizante bovino diminuiu os efeitos negativos das concentrações crescentes de sais na água de irrigação nas variáveis estudadas. O nível salino do solo foi maior na presença do biofertilizante anaeróbico. O biofertilizante anaeróbico foi mais eficiente que o aeróbico na redução dos efeitos depressivos dos sais das águas de irrigação às plantas.This study evaluated the effects of irrigation water salinity on agronomics characteristics of peanut (Arachis hypogaea L., cultivated without and with biofertilizers. The experiment was conducted in a greenhouse in the Estação Agrometereológica, Campus do Pici, Fortaleza, CE. The seeds were sown in pots using, as substrate, a Red-Yellow Argisol, with one plant per pot. The experiment followed a completely randomized design set as a 4 x 3 factorial, referring to four irrigation water electrical conductivity values: 1.5, 3.0, 4.5 and 6.0 dS m-1 in three soil configurations: B0(without biofertilizer, B1

  11. Introgression of the SbASR-1 Gene Cloned from a Halophyte Salicornia brachiata Enhances Salinity and Drought Endurance in Transgenic Groundnut (Arachis hypogaea) and Acts as a Transcription Factor

    Science.gov (United States)

    Tiwari, Vivekanand; Chaturvedi, Amit Kumar; Mishra, Avinash; Jha, Bhavanath

    2015-01-01

    The SbASR-1 gene, cloned from a halophyte Salicornia brachiata, encodes a plant-specific hydrophilic and stress responsive protein. The genome of S. brachiata has two paralogs of the SbASR-1 gene (2549 bp), which is comprised of a single intron of 1611 bp, the largest intron of the  abscisic acid stress ripening [ASR] gene family yet reported. In silico analysis of the 843-bp putative promoter revealed the presence of ABA, biotic stress, dehydration, phytohormone, salinity, and sugar responsive cis-regulatory motifs. The SbASR-1 protein belongs to Group 7 LEA protein family with different amino acid composition compared to their glycophytic homologs. Bipartite Nuclear Localization Signal (NLS) was found on the C-terminal end of protein and localization study confirmed that SbASR-1 is a nuclear protein. Furthermore, transgenic groundnut (Arachis hypogaea) plants over-expressing the SbASR-1 gene constitutively showed enhanced salinity and drought stress tolerance in the T1 generation. Leaves of transgenic lines exhibited higher chlorophyll and relative water contents and lower electrolyte leakage, malondialdehyde content, proline, sugars, and starch accumulation under stress treatments than wild-type (Wt) plants. Also, lower accumulation of H2O2 and O2.- radicals was detected in transgenic lines compared to Wt plants under stress conditions. Transcript expression of APX (ascorbate peroxidase) and CAT (catalase) genes were higher in Wt plants, whereas the SOD (superoxide dismutase) transcripts were higher in transgenic lines under stress. Electrophoretic mobility shift assay (EMSA) confirmed that the SbASR-1 protein binds at the consensus sequence (C/G/A)(G/T)CC(C/G)(C/G/A)(A/T). Based on results of the present study, it may be concluded that SbASR-1 enhances the salinity and drought stress tolerance in transgenic groundnut by functioning as a LEA (late embryogenesis abundant) protein and a transcription factor. PMID:26158616

  12. A comprehensive look at the effect of processing on peanut (Arachis spp.) texture

    NARCIS (Netherlands)

    Lykomitros, Dimitrios; Boer, Den Lara; Hamoen, Remco; Fogliano, Vincenzo; Capuano, Edoardo

    2018-01-01

    BACKGROUND: Relationships between process and peanut texture have only been studied in Hypogaea species, and focused on very limited processing conditions. In this study, 94 samples were prepared from a combination of 12 raw materials (Arachis hypogaea and fastigiata cultivars) and 11 roasting

  13. Resveratrol production in hairy root culture of peanut, Arachis ...

    African Journals Online (AJOL)

    Five different strains of Agrobacterium rhizogenes differed in their ability to induce peanut (Arachis hypogaea L.) hairy roots and also showed varying effects on the growth and resveratrol production in hairy root cultures. A. rhizogenes R1601 is the most effective strain for the induction (75.8%), growth (7.6 g/l) and ...

  14. Effects of sodium azide on yield parameters of groundnut (Arachis ...

    African Journals Online (AJOL)

    GREGO

    2007-03-19

    Mar 19, 2007 ... Cowpea and mungbean improvement by mutation induction Mutation Breeding Newsletter, 21: 9. Gregory WC (1955). X-ray breeding of peanuts Arachis hypogaea L.,. Agron. J. 47: 394-399. Kleinhofs W, Sander C (1975). Azide mutagenesis in Barley. Third. Barley Genetics Symp. Garching. Proceedings of ...

  15. Inheritance of fresh seed dormancy in Spanish-type peanut ( Arachis ...

    African Journals Online (AJOL)

    Production and seed quality in peanut (Arachis hypogaea L.) can be reduced substantially by in situ germination under unpredictable rainfed environments. Inheritance of fresh seed dormancy in Spanish x Spanish crosses was studied with two sets of segregating populations, an F2 population derived from true F1 hybrids ...

  16. Genetic transformation of peanut (Arachis hypogaea L.) using ...

    Indian Academy of Sciences (India)

    Madhu

    tissue culture response and plant regeneration has driven researchers to develop alternate transformation systems that target axillary meristem in the cotyledonary nodes (Somers et al 2003). We report here for the first time the mode of genetic transformation using cotyledonary node (CN) as an explant in peanut mediated ...

  17. Genetic transformation of peanut (Arachis hypogaea L.) using ...

    Indian Academy of Sciences (India)

    Madhu

    polymerase chain reaction (PCR) and Southern blot analyses. Twenty-four plants were ..... Each mean value was an average calculated from three experi- ments ± SE. .... only because of the productive transcriptional fusions between the ...

  18. Conditions that impact artificial hybridization of Arachis hypogaea L.

    Science.gov (United States)

    Modern farming is dependent on continual development of improved cultivars and efficient cultural management practices. In addition, dissecting genetic components of heritable traits also relies on the development of large mapping populations. Artificial hybridization is the critical initial step ...

  19. Molecular marker screening of peanut (Arachis hypogaea L ...

    African Journals Online (AJOL)

    SAM

    2014-06-25

    Jun 25, 2014 ... the genomic DNA, the frozen samples were ground and DNA was extracted .... RFLP analysis, no evidence of segregation was found in ... Figure 1. RFLP locus R2430E linked to resistance to Meloidogyne arenaria in peanut.

  20. Biometric Indices of Arachis hypogaea Plant Grown in Kutchalli ...

    African Journals Online (AJOL)

    Kutchalli drilling waste pit materials (WPM) in the Nigerian National Petroleum Corporation, NNPC, exploration site in Borno State of Nigeria was evaluated for systemic toxicity to inhabitants (man, animal and plants) via the food chain. In this experiment, biometric indices were analysed using standard methods. Results ...

  1. Genetic modification of Arachis hypogaea for quality traits

    Science.gov (United States)

    TILLING, targeting induced local lesions in genomes, combines conventional mutagenesis with targeted screening of known genes. Advantages are that a series of alleles can be recovered to assist with functional analysis, and mutations can be identified in polyploids where a phenotype is likely to be...

  2. Biometric Indices of Arachis hypogaea Plant Grown in Kutchalli ...

    African Journals Online (AJOL)

    JTEkanem

    2009-08-10

    145-151. 11. Budak, N., Baenziger, P. S., Eskridge,. K. M. Baltensperger, D. D. and. Morenno-Sevilla. B. (1995) Plant Height. Response of Semi-dwarf and non Semi- dwarf Wheat to the environment. Crop. Science 35: 447-451.

  3. Genetic analysis of yield in peanut (Arachis hypogaea L.) using ...

    African Journals Online (AJOL)

    Jane

    2011-07-20

    Jul 20, 2011 ... only should the two major genes' effects be considered but also the polygene's effect should be considered in breeding to increase peanut yield. Key words: Peanut, yield, major gene plus polygene inheritance model, genetic analysis. INTRODUCTION. Peanut consists of diploid (2n = 2x = 20), tetraploid ...

  4. Genetic analysis of yield in peanut ( Arachis hypogaea L.) using ...

    African Journals Online (AJOL)

    The yield had significant major gene effect and the results implied that not only should the two major genes' effects be considered but also the polygene's effect should be considered in breeding to increase peanut yield. Key words: Peanut, yield, major gene plus polygene inheritance model, genetic analysis.

  5. Peanut (Arachis hypogaea Expressed Sequence Tag Project: Progress and Application

    Directory of Open Access Journals (Sweden)

    Suping Feng

    2012-01-01

    Full Text Available Many plant ESTs have been sequenced as an alternative to whole genome sequences, including peanut because of the genome size and complexity. The US peanut research community had the historic 2004 Atlanta Genomics Workshop and named the EST project as a main priority. As of August 2011, the peanut research community had deposited 252,832 ESTs in the public NCBI EST database, and this resource has been providing the community valuable tools and core foundations for various genome-scale experiments before the whole genome sequencing project. These EST resources have been used for marker development, gene cloning, microarray gene expression and genetic map construction. Certainly, the peanut EST sequence resources have been shown to have a wide range of applications and accomplished its essential role at the time of need. Then the EST project contributes to the second historic event, the Peanut Genome Project 2010 Inaugural Meeting also held in Atlanta where it was decided to sequence the entire peanut genome. After the completion of peanut whole genome sequencing, ESTs or transcriptome will continue to play an important role to fill in knowledge gaps, to identify particular genes and to explore gene function.

  6. Evaluation of nutritional quality of groundnut ( Arachis Hypogaea L ...

    African Journals Online (AJOL)

    Oil, fatty acids, protein, oleic/linoleic (O/L) acid ratio, iodine value and free soluble sugars were studied in 20 groundnut varieties grown in Ghana to determine their nutritional quality and to inform endusers which variety to choose for maximum benefit. Results indicated a significant difference (p<0.05) in oil content among ...

  7. Eficiência reprodutiva no amendoim cultivado (Arachis hypogaea L. Reproductive efficiency in the peanut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Cândida H. T. Mendes Conagin

    1960-01-01

    Full Text Available Cinco variedades de amendoim, abrangendo os três tipos vegetativos conhecidos, foram comparadas quanto à sua eficiência reprodutiva. Para conhecer o resultado final de porcentagem de frutos e sementes, foram estudadas a quantidade de flôres, a duração e as oscilações do florescimento; a formação de frutos e sementes também foi estudada com detalhes. Tendo variado o número de plantas observadas nos diversos itens, em diversos anos, tôdas as informações foram referidas a "uma planta" para poderem ser comparadas quando necessário. O período útil de florescimento dura as dez semanas medianas do ciclo vegetativo da planta, o máximo de flôres sendo atingido na 10.ª semana dêsse ciclo. Há, entretanto, a observar, que as variedades eretas são mais precoces do que as de porte decumbente; o florescimento apresenta bruscas oscilações diárias. É a variedade Tatuí a que produz mais flôres por planta, tendo, entretanto, a mais baixa eficiência reprodutiva. As outras variedades têm eficiência mais alta, mas, mesmo assim, ela é surpreendentemente baixa, em se tratando de uma planta de grande florescimento como é o amendoim. As informações obtidas nestes ensaios são fundamentais para qualquer trabalho de melhoramento por hibridação e já estão sendo utilizadas nos atuais cruzamentos, feitos pela Seção de Citologia.A study of the reproductive efficiency of five agronomical varieties of peanut was made. Determinations were made of fruit and seed percentages in relation to number of flowers procured, length of flowering period, alternation of high and low daily flower frequencies, and number of flowers which had no chance to become fruit?. Data obtained supported lhe following conclusions: (a Varieties of the erect vegetative type were early; they began and ended their vegetative am! flowering cycles before those of the decumbent type. (b The flowering curves showed an abrupt alternation of high and low frequencies. (c The highest flower frequency occurred on the same day for the five varieties tinder test. (d The erect varieties produced well located flowers (the writer calls them useful flowers during a few weeks. For the decumbent varieties this period was longer. (e Fruit percentages in relation to total flowering varied from 15.9% to 25.6%. Calculated in relation to the useful flowers these values varied from 25.4% to 51.3%. The seed percentages were from 12.7% to 21.5% in the first case, and from 21.7% to 38.4% in the second. (f The var. Tatuí and Roxo gave the best fruit percentages in relation to the number of useful flowers. Tatu and B-33 gave the highest seed percentages.

  8. Genetic relationships among Arachis species based on AFLP

    Directory of Open Access Journals (Sweden)

    Gimenes Marcos A.

    2002-01-01

    Full Text Available Amplified Fragment Length Polymorphism (AFLP was used to establish the genetic relationships among 20 species from seven of the nine sections of genus Arachis. The level of polymorphism among nine accessions of the cultivated peanut, A. hypogaea L., was also evaluated. Three combinations of primers were used to amplify the AFLPs. The fragments were separated in 6% denaturing acrylamide gels. A total of 408 fragments were analyzed. An average of 135.3 fragments per primer combination were scored, and the largest number of fragments was 169 using primer combination Eco RI - ACC / Mse I - CTG, while the lowest was 108, with Eco RI - ACT / Mse I - CTT. In general, the genetic relationships established using AFLPs agreed with the classification established using morphology and crossability data. The results indicated that AFLPs are good markers for establishing the relationships among Arachis species. The polymorphism detected in A. hypogaea by this method was higher than the one found with other markers, like RAPDs and RFLPs. However, our data suggest that the polymorphism detected be using AFLP with only three primer combinations is still too low to be used for any kind of genetic study in this species.

  9. Taxonomy of the genus Arachis (Leguminosae

    Directory of Open Access Journals (Sweden)

    Antonio Krapovickas

    2007-01-01

    Full Text Available Almost 100 years elapsed between Linnaeus’ naming the then lone species ofArachis (A. hypogaea L. known to Europeans, and the first taxonomic treatment of the genus by Bentham in 1841. During the next 100 years five to ten additional species descriptions appeared, assigning different species to the same names, and different names to the same species. By mid-20th Century, it was impossible to examine any herbarium collection of Arachis and assign any epithet with any assurance to any specimen (which was not a type collection except to A. hypogaea, A. guaranitica, A. tuberosa and A. villosulicarpa. In our treatment, the literature of this botanical chaos in Arachis is reviewed in detail and an assessment is made of the foundations for its occurrence. It is shown that the bases for the confusion lay in the combination of the esoteric nature of the differentiating morphological features of Arachis, the fragmentary early collections, and the representation of species by seedling specimens. Also, it is related how, in 1959, we decided to re-explore the type locality of each species then known, collect therein complete plant specimens and thereby resolve the problem. Thirty-five years, two generations of plant collectors and around 2000 collections later, we present here 69 species descriptions of Arachis, species distributed in South America east of the Andes, south of the Amazon, north of La Plata and from NW Argentina to NE Brazil. We soon discovered that the most significant characters ofArachis lay in their underground structures, including their fruits, rhizomatous stems, root systems and hypocotyls. We showed that these defining characters tended to cluster the collections into groups which were associated with generally different geographic areas and ecological features. We drew a sample of 100 collections representing these clusters, areas and features, and arranged them in a hybridization diallel and showed, in crosses between

  10. Caracteres estruturais foliares de espécies de Arachis e sua relação com a cercosporiose

    OpenAIRE

    Pablo Rodrigues Sanine; Roberto Antonio Rodella

    2017-01-01

    A cercosporiose, causada pelo fungo Cercosporidium personatum, é uma doença de grande importância para a cultura do amendoim (Arachis hypogaea). O objetivo deste trabalho foi quantificar caracteres estruturais do limbo foliar, em dois cultivares e quatro acessos de três espécies de Arachis, procurando relacioná-los com graus de resistência à cercosporiose. Foram amostradas porções do terço médio da região internvervural, do terceiro ou quarto folíolo da segunda folha contada a partir do ápice...

  11. A high-density genetic map of Arachis duranensis, a diploid ancestor of cultivated peanut

    Directory of Open Access Journals (Sweden)

    Nagy Ervin D

    2012-09-01

    Full Text Available Abstract Background Cultivated peanut (Arachis hypogaea is an allotetraploid species whose ancestral genomes are most likely derived from the A-genome species, A. duranensis, and the B-genome species, A. ipaensis. The very recent (several millennia evolutionary origin of A. hypogaea has imposed a bottleneck for allelic and phenotypic diversity within the cultigen. However, wild diploid relatives are a rich source of alleles that could be used for crop improvement and their simpler genomes can be more easily analyzed while providing insight into the structure of the allotetraploid peanut genome. The objective of this research was to establish a high-density genetic map of the diploid species A. duranensis based on de novo generated EST databases. Arachis duranensis was chosen for mapping because it is the A-genome progenitor of cultivated peanut and also in order to circumvent the confounding effects of gene duplication associated with allopolyploidy in A. hypogaea. Results More than one million expressed sequence tag (EST sequences generated from normalized cDNA libraries of A. duranensis were assembled into 81,116 unique transcripts. Mining this dataset, 1236 EST-SNP markers were developed between two A. duranensis accessions, PI 475887 and Grif 15036. An additional 300 SNP markers also were developed from genomic sequences representing conserved legume orthologs. Of the 1536 SNP markers, 1054 were placed on a genetic map. In addition, 598 EST-SSR markers identified in A. hypogaea assemblies were included in the map along with 37 disease resistance gene candidate (RGC and 35 other previously published markers. In total, 1724 markers spanning 1081.3 cM over 10 linkage groups were mapped. Gene sequences that provided mapped markers were annotated using similarity searches in three different databases, and gene ontology descriptions were determined using the Medicago Gene Atlas and TAIR databases. Synteny analysis between A. duranensis, Medicago

  12. Comparative analysis of NBS-LRR genes and their response to Aspergillus flavus in Arachis.

    Directory of Open Access Journals (Sweden)

    Hui Song

    Full Text Available Studies have demonstrated that nucleotide-binding site-leucine-rich repeat (NBS-LRR genes respond to pathogen attack in plants. Characterization of NBS-LRR genes in peanut is not well documented. The newly released whole genome sequences of Arachis duranensis and Arachis ipaënsis have allowed a global analysis of this important gene family in peanut to be conducted. In this study, we identified 393 (AdNBS and 437 (AiNBS NBS-LRR genes from A. duranensis and A. ipaënsis, respectively, using bioinformatics approaches. Full-length sequences of 278 AdNBS and 303 AiNBS were identified. Fifty-one orthologous, four AdNBS paralogous, and six AiNBS paralogous gene pairs were predicted. All paralogous gene pairs were located in the same chromosomes, indicating that tandem duplication was the most likely mechanism forming these paralogs. The paralogs mainly underwent purifying selection, but most LRR 8 domains underwent positive selection. More gene clusters were found in A. ipaënsis than in A. duranensis, possibly owing to tandem duplication events occurring more frequently in A. ipaënsis. The expression profile of NBS-LRR genes was different between A. duranensis and A. hypogaea after Aspergillus flavus infection. The up-regulated expression of NBS-LRR in A. duranensis was continuous, while these genes responded to the pathogen temporally in A. hypogaea.

  13. Ação de bioestimulante nas culturas do amendoinzeiro, sorgo e trigo e interações hormonais entre auxinas, citocininas e giberelinas

    OpenAIRE

    Stella Consorte Cáto

    2006-01-01

    Hormônios vegetais têm o papel de controlar os diversos processos do desenvolvimento vegetal. A aplicação tanto de biorreguladores quanto de bioestimulantes pode promover alterações durante o desenvolvimento vegetal e, têm sido utilizados com a finalidade de incrementar a produtividade de culturas de interesse econômico. Com o objetivo de avaliar o efeito sobre a germinação de sementes, vigor de plântulas, desenvolvimento radicular e produção de plantas de trigo, amendoinzeiro e sorgo, um bio...

  14. Caracteres estruturais foliares de espécies de Arachis e sua relação com a cercosporiose

    Directory of Open Access Journals (Sweden)

    Pablo Rodrigues Sanine

    2012-07-01

    Full Text Available A cercosporiose, causada pelo fungo Cercosporidium personatum, é uma doença de grande importância para a cultura do amendoim (Arachis hypogaea. O objetivo deste trabalho foi quantificar caracteres estruturais do limbo foliar, em dois cultivares e quatro acessos de três espécies de Arachis, procurando relacioná-los com graus de resistência à cercosporiose. Foram amostradas porções do terço médio da região internvervural, do terceiro ou quarto folíolo da segunda folha contada a partir do ápice caulinar, sendo as amostras infiltradas em historresina, seccionadas com 7 µm de espessura e coradas com azul de toluidina. Os caracteres quantificados foram: área da secção da região internervural; área, espessura, e porcentagem da epiderme das faces adaxial e abaxial, da hipoderme, e do parênquima; área e espessura do mesofilo; área do complexo estomático; espessura da folha; número de tricomas, estômatos, cristais de oxalato de cálcio e idioblastos de mucilagem; e comprimento dos ostíolos. Os dados foram submetidos aos testes estatísticos multivariados de Análise de Agrupamento e Análise de Componentes Principais. Os caracteres referentes à epiderme da face abaxial, hipoderme, parênquima, , tricomas, estômatos e idioblastos de mucilagem permitiram diferenciar A. hypogaea, A. magnae A. stenosperma. O cultivar IAC-Tatu de A. hypogaeae o acesso 9017 de A. stenospermacaracterizaram-se como suscetíveis à cercosporiose, enquanto o cultivar 850 de A. hypogaea, os acessos 30097 e 13748 de A. magna, e o acesso 10229 de A. stenospermaforam considerados resistentes.

  15. Genome re-assignment of Arachis trinitensis (Sect. Arachis, Leguminosae and its implications for the genetic origin of cultivated peanut

    Directory of Open Access Journals (Sweden)

    Germán Robledo

    2010-01-01

    Full Text Available The karyotype structure of Arachis trinitensis was studied by conventional Feulgen staining, CMA/DAPI banding and rDNA loci detection by fluorescence in situ hybridization (FISH in order to establish its genome status and test the hypothesis that this species is a genome donor of cultivated peanut. Conventional staining revealed that the karyotype lacked the small "A chromosomes" characteristic of the A genome. In agreement with this, chromosomal banding showed that none of the chromosomes had the large centromeric bands expected for A chromosomes. FISH revealed one pair each of 5S and 45S rDNA loci, located in different medium-sized metacentric chromosomes. Collectively, these results suggest that A. trinitensis should be removed from the A genome and be considered as a B or non-A genome species. The pattern of heterochromatic bands and rDNA loci of A. trinitensis differ markedly from any of the complements of A. hypogaea, suggesting that the former species is unlikely to be one of the wild diploid progenitors of the latter.

  16. Genome re-assignment of Arachis trinitensis (Sect. Arachis, Leguminosae) and its implications for the genetic origin of cultivated peanut

    Science.gov (United States)

    2010-01-01

    The karyotype structure of Arachis trinitensis was studied by conventional Feulgen staining, CMA/DAPI banding and rDNA loci detection by fluorescence in situ hybridization (FISH) in order to establish its genome status and test the hypothesis that this species is a genome donor of cultivated peanut. Conventional staining revealed that the karyotype lacked the small “A chromosomes” characteristic of the A genome. In agreement with this, chromosomal banding showed that none of the chromosomes had the large centromeric bands expected for A chromosomes. FISH revealed one pair each of 5S and 45S rDNA loci, located in different medium-sized metacentric chromosomes. Collectively, these results suggest that A. trinitensis should be removed from the A genome and be considered as a B or non-A genome species. The pattern of heterochromatic bands and rDNA loci of A. trinitensis differ markedly from any of the complements of A. hypogaea, suggesting that the former species is unlikely to be one of the wild diploid progenitors of the latter. PMID:21637581

  17. Molecular Detection of Aflatoxin Producing Strains of Aspergillus Flavus from Peanut (Arachis Hypogaea

    Directory of Open Access Journals (Sweden)

    Adeela Hussain

    2015-02-01

    Full Text Available Aflatoxins are the potential carcinogens produced as secondary metabolites by Aspergillus flavus. They have the ability to contaminate large number of food which ultimately affect the human population. Malt extract agar was selected for the growth of control stains of fungus. The aim of the study was to develop a reliable and quick method for the detection of aflatoxin producing strains in peanuts by using molecular approaches. Total 80 samples of infected peanuts were collected from four different cities of Punjab and checked for their aflatoxin contamination. For aflatoxin detection, three target genes nor1, ver1 and aflR were selected which was involved in the aflatoxin biosynthesis. In all examined cases, 24 out of 80 (30% samples successfully amplified all three genes indicating aflatoxigenic activity. Discrimination between aflatoxigenic and non-aflatoxigenic strains were also determined on the basis of amplification of these three target DNA fragments. In this study, it was also demonstrated that only specific strains were able to produce the aflatoxin contamination in peanuts.

  18. Flavor of roasted peanuts (Arachis hypogaea) - Part II: Correlation of volatile compounds to sensory characteristics

    NARCIS (Netherlands)

    Lykomitros, Dimitrios; Fogliano, Vincenzo; Capuano, Edoardo

    2016-01-01

    Flavor and color of roasted peanuts are important research areas due to their significant influence on consumer preference. The aim of the present study was to explore correlations between sensory attributes of peanuts, volatile headspace compounds and color parameters. Different raw peanuts were

  19. Assessment of active bacteria metabolizing phenolic acids in the peanut (Arachis hypogaea L.) rhizosphere.

    Science.gov (United States)

    Liu, Jinguang; Wang, Xingxiang; Zhang, Taolin; Li, Xiaogang

    2017-12-01

    Phenolic acids can enhance the mycotoxin production and activities of hydrolytic enzymes related to pathogenicity of soilborne fungus Fusarium oxysporum. However, characteristics of phenolic acid-degrading bacteria have not been investigated. The objectives of this study were to isolate and characterize bacteria capable of growth on benzoic and vanillic acids as the sole carbon source in the peanut rhizosphere. Twenty-four bacteria were isolated, and the identification based on 16S rRNA gene sequencing revealed that pre-exposure to phenolic acids before sowing shifted the dominant culturable bacterial degraders from Arthrobacter to Burkholderia stabilis-like isolates. Both Arthrobacter and B. stabilis-like isolates catalysed the aromatic ring cleavage via the ortho pathway, and Arthrobacter isolates did not exhibit higher C12O enzyme activity than B. stabilis-like isolates. The culture filtrate of Fusarium sp. ACCC36194 caused a strong inhibition of Arthrobacter growth but not B. stabilis-like isolates. Additionally, Arthrobacter isolates responded differently to the culture filtrates of B. stabilis-like isolates. The Arthrobacter isolates produced higher indole acetic acid (IAA) levels than B. stabilis-like isolates, but B. stabilis-like isolates were also able to produce siderophores, solubilize mineral phosphate, and exert an antagonistic activity against peanut root rot pathogen Fusarium sp. ACCC36194. Results indicate that phenolic acids can shift their dominant culturable bacterial degraders from Arthrobacter to Burkholderia species in the peanut rhizosphere, and microbial interactions might lead to the reduction of culturable Arthrobacter. Furthermore, increasing bacterial populations metabolizing phenolic acids in monoculture fields might be a control strategy for soilborne diseases caused by Fusarium spp. Copyright © 2017 Elsevier GmbH. All rights reserved.

  20. Success story of radiation based induced mutagenesis in groundnut (Arachis hypogaea L.)

    International Nuclear Information System (INIS)

    Badigannavar, Anand M.; Mondal, Suvendu; D'Souza, Stanislaus F.

    2009-01-01

    Genetic improvement of groundnut through sustained mutation and recombination breeding at Bhabha Atomic Research Centre, Mumbai resulted in the development of 260 new mutants and breeding lines having unique traits and desirable attributes. Among them, 14 Trombay groundnut (TG) varieties with superior agronomic features were released for commercial cultivation for different states across the country. Most of these varieties have significantly contributed towards the enhancement of groundnut production and productivity in the country. Majority of these varieties were also utilized as parents in the national and state groundnut breeding programmes. Additionally induced TG mutants are the source material for understanding the genetic and molecular basis of different traits. (author)

  1. Uptake of radiactive calcium by groundnut (Arachis hypogaea L. ) and efficiency of utilisation of applied calcium

    Energy Technology Data Exchange (ETDEWEB)

    Loganathan, S; Krishnamoorthy, K K [Tamil Nadu Agricultural Univ., Coimbatore (India). Dept. of Soil Science and Agricultural Chemistry

    1977-04-01

    A pot experiment was conducted with groundnut applying labelled calcium as its sulphate and carbonate at two levels namely 75 and 150 kg Ca per ha with varying levels of P, K and Mg. Plant samples were taken at different stages of crop growth and analysed for the content of radioactive calcium. Calcium sulphate treatment has resulted in larger uptake of calcium compared to calcium carbonate. An application of 150 kg Ca per ha has caused significantly higher uptake by groundnut plant than 75 kg Ca per ha. The percentage of utilisation of added calcium ranged from 2.2 to 5.4 Recovery of calcium by plants was more in calcium sulphate treatment rather than in calcium carbonate. The plants showed a preference for absorbing applied calcium rather than native calcium.

  2. Management of Stem-rot of Groundnut (Arachis hypogaea L. Cultivar in Field

    Directory of Open Access Journals (Sweden)

    Khirood DOLEY

    2013-08-01

    Full Text Available The present experiment was conducted at University of Pune for biocontrol of soil-borne plant pathogen Sclerotium rolfsii by incorporating arbuscular mycorrhizal fungi (Glomus fasciculatum and conventional system of cultivation with different spacing pattern (15 and 30 cm in field. Both mycorrhizal inoculation and 30 cm spacing pattern significantly increased growth and yield as compared to control or 15 cm spacing pattern. The pathogenic mycorrhizal groundnut plants in 30 as well as 15 cm spacing pattern showed better growth in terms of plant height, leaf and pod number, fresh and dry weight of whole groundnut plant in comparison to non-mycorrhizal pathogenic ones and the plant growth was better in 30 spacing than 15 cm. The colonization by AM fungi in both spacing pattern was higher in absence of pathogen S. rolfsii. However, pathogen’s presence decreased the mycorrhizal colonization considerably in 30 and 15 cm. The disease severity and incidence were recorded to be lowered when inoculated with mycorrhiza in pathogenic groundnut plants as compared to non-mycorrhizal pathogenic ones in both spacing pattern and incidence and severity was significantly lower in 30 cm as compared to 15 cm. Therefore, it was observed from our results that for management of soil-borne pathogens inoculation of AM fungi and spacing patterns are necessary.

  3. Phytosynthesis of intracellular and extracellular gold nanoparticles by living peanut plant (Arachis hypogaea L.).

    Science.gov (United States)

    Raju, Dugyala; Mehta, Urmil J; Ahmad, Absar

    2012-01-01

    Inorganic nanomaterials of different chemical compositions are conventionally synthesized under harsh environments such as extremes of temperature, pressure, and pH. Moreover, these methods are eco-unfriendly and cumbersome, yield bigger particles, and agglomerate because of not being capped by capping agents. In contrast, biological synthesis of inorganic nanomaterials occurs under ambient conditions, namely room temperature, atmospheric pressure, and physiological pH. These methods are reliable, eco-friendly, and cheap. In this paper, we report for the first time the extracellular and intracellular synthesis of gold nanoparticles (GNPs) using living peanut seedlings. The formed GNPs were highly stable in solution and inside the plant tissue. Transmission electron microscopy revealed that extracellular GNPs distributions were in the form of monodispersed nanoparticles. The nanoparticles ranged from 4 to 6 nm in size. The intercellular nanoparticles were of oval shape and size ranged from 5 to 50 nm. Both extracellular and intracellular nanoparticles were further characterized by standard techniques. The formed GNPs inside the plant tissue were estimated by inductively coupled plasma spectrometry. This opens up an exciting possibility of a plant-based nanoparticle synthesis strategy, wherein the nanoparticles may be entrapped in the biomass in the form of a film or produced in the solution, both of which have interesting applications. © 2012 International Union of Biochemistry and Molecular Biology, Inc.

  4. Influences of temperature on Arachis hypogaea L. : with special reference to its pollen viability

    NARCIS (Netherlands)

    Beer, de J.F.

    1963-01-01

    The influence was investigated of temperature on growth and development of groundnut, cv. Schwarz 21, Mallorca and Ukraine. Except where stated, all conclusions refer to Schwarz 21. Seed germination was not seriously influenced between 24° and 33°C, although the higher temperatures favoured

  5. Uptake of radiactive calcium by groundnut (Arachis hypogaea L.) and efficiency of utilisation of applied calcium

    International Nuclear Information System (INIS)

    Loganathan, S.; Krishnamoorthy, K.K.

    1977-01-01

    A pot experiment was conducted with groundnut applying labelled calcium as its sulphate and carbonate at two levels namely 75 and 150 kg Ca per ha with varying levels of P, K and Mg. Plant samples were taken at different stages of crop growth and analysed for the content of radioactive calcium. Calcium sulphate treatment has resulted in larger uptake of calcium compared to calcium carbonate. An application of 150 kg Ca per ha has caused significantly higher uptake by groundnut plant than 75 kg Ca per ha. The percentage of utilisation of added calcium ranged from 2.2 to 5.4 Recovery of calcium by plants was more in calcium sulphate treatment rather than in calcium carbonate. The plants showed a preference for absorbing applied calcium rather than native calcium

  6. Biological Activity of Peanut (Arachis hypogaea) Phytoalexins and Selected Natural and Synthetic Stilbenoids

    Science.gov (United States)

    2011-02-11

    prenylated flavonoids have been identified as constituents in plants, and display biological activities, such as anticancer, antiandrogen, anti-Leishmania, and...to opioid receptors was examined. ’MATERIALS AND METHODS General Experimental Procedures. HPLC -grade solvents used in the preparation of mobile phases...were obtained from Fisher (Suwanee, GA). HPLC -grade H2Owas prepared with a ZD20 four-bowl Milli-Q water system (Millipore). Deuterium oxide (99.9 atom

  7. Antiviral Activity of Peanut (Arachis hypogaea L.) Skin Extract Against Human Influenza Viruses.

    Science.gov (United States)

    Makau, Juliann Nzembi; Watanabe, Ken; Mohammed, Magdy M D; Nishida, Noriyuki

    2018-05-30

    The high propensity of influenza viruses to develop resistance to antiviral drugs necessitates the continuing search for new therapeutics. Peanut skins, which are low-value byproducts of the peanut industry, are known to contain high levels of polyphenols. In this study, we investigated the antiviral activity of ethanol extracts of peanut skins against various influenza viruses using cell-based assays. Extracts with a higher polyphenol content exhibited higher antiviral activities, suggesting that the active components are the polyphenols. An extract prepared from roasted peanut skins effectively inhibited the replication of influenza virus A/WSN/33 with a half maximal inhibitory concentration of 1.3 μg/mL. Plaque assay results suggested that the extract inhibits the early replication stages of the influenza virus. It demonstrated activity against both influenza type A and type B viruses. Notably, the extract exhibited a potent activity against a clinical isolate of the 2009 H1N1 pandemic, which had reduced sensitivity to oseltamivir. Moreover, a combination of peanut skin extract with the anti-influenza drugs, oseltamivir and amantadine, synergistically increased their antiviral activity. These data demonstrate the potential application of peanut skin extract in the development of new therapeutic options for influenza management.

  8. Aspergillus and aflatoxin in groundnut (Arachis hypogaea L.) and groundnut cake in Eastern Ethiopia.

    Science.gov (United States)

    Mohammed, Abdi; Chala, Alemayehu; Dejene, Mashilla; Fininsa, Chemeda; Hoisington, David A; Sobolev, Victor S; Arias, Renee S

    2016-12-01

    This study was conducted to assess major Aspergillus species and aflatoxins associated with groundnut seeds and cake in Eastern Ethiopia and evaluate growers' management practices. A total of 160 groundnut seed samples from farmers' stores and 50 groundnut cake samples from cafe and restaurants were collected. Fungal isolation was done from groundnut seed samples. Aspergillus flavus was the dominant species followed by Aspergillus parasiticus. Aflatoxin analyses of groundnut seed samples were performed using ultra performance liquid chromatography; 22.5% and 41.3% of samples were positive, with total aflatoxin concentrations of 786 and 3135 ng g -1 from 2013/2014 and 2014/2015 samples, respectively. The level of specific aflatoxin concentration varied between 0.1 and 2526 ng g -1 for B 2 and B 1 , respectively. Among contaminated samples of groundnut cake, 68% exhibited aflatoxin concentration below 20 ng g -1 , while as high as 158 ng g -1 aflatoxin B 1 was recorded. The study confirms high contamination of groundnut products in East Ethiopia.

  9. Suppression of Aflatoxin Production in Aspergillus Species by Selected Peanut (Arachis hypogaea) Stilbenoids.

    Science.gov (United States)

    Sobolev, Victor; Arias, Renee; Goodman, Kerestin; Walk, Travis; Orner, Valerie; Faustinelli, Paola; Massa, Alicia

    2018-01-10

    Aspergillus flavus is a soil fungus that commonly invades peanut seeds and often produces carcinogenic aflatoxins. Under favorable conditions, the fungus-challenged peanut plant produces and accumulates resveratrol and its prenylated derivatives in response to such an invasion. These prenylated stilbenoids are considered peanut antifungal phytoalexins. However, the mechanism of peanut-fungus interaction has not been sufficiently studied. We used pure peanut stilbenoids arachidin-1, arachidin-3, and chiricanine A to study their effects on the viability of and metabolite production by several important toxigenic Aspergillus species. Significant reduction or virtually complete suppression of aflatoxin production was revealed in feeding experiments in A. flavus, Aspergillus parasiticus, and Aspergillus nomius. Changes in morphology, spore germination, and growth rate were observed in A. flavus exposed to the selected peanut stilbenoids. Elucidation of the mechanism of aflatoxin suppression by peanut stilbenoids could provide strategies for preventing plant invasion by the fungi that produce aflatoxins.

  10. Rancang Bangun Alat Pengupas Kulit Ari Kacang Tanah (Arachis hypogaea Tipe Engkol

    Directory of Open Access Journals (Sweden)

    Agus Sutejo

    2012-10-01

    Full Text Available One cause of reduced productivity of peanut husk is peeled peeling process is still done manually, using the power of man. To overcome this, a system designed to cuticle peeling peanuts which facilitates mechanical stripping process peanut husk. Peeling epidermis is mechanically done by using two rubber-covered rollers are designed to be able to peel the peanut husk easily. Having conducted research, produced peeler bean husk, which consists of, Hopper, stringer system, the framework, dirt thrower fan / epidermis, and hoppers expenses. From the test results from test 10 times, each repetition is about 100 grams paring the results obtained about 70% whole shelled peanuts. Or can be calculated with engine capacity of about 35 kg / hr with a percentage split of about 35%, it is because the rubber on the roll is less balanced / less flashlight, so the workmanship is required with appropriate accuracy by using a lathe.

  11. Combining Ability of Pod Yield and Related Traits of Groundnut (Arachis hypogaea L. under Salinity Stress

    Directory of Open Access Journals (Sweden)

    Md. Abul Kalam Azad

    2014-01-01

    Full Text Available A study was performed using 6×6 F1 diallel population without reciprocals to assess the mode of inheritance of pod yield and related traits in groundnut with imposed salinity stress. Heterosis was found for pod number and yield. Data on general and specific combining ability (gca and sca indicated additive and nonadditive gene actions. The gca: sca ratios were much less than unity suggesting predominant role of nonadditive gene effects. Cultivars “Binachinabadam-2” and “Dacca-1” and mutant M6/25/64-82 had the highest, second highest, and third highest pod number, as well as gca values, respectively. These two cultivars and another mutant M6/15/70-19 also had the highest, second highest, and third highest pod yield, as well as gca values, respectively. Therefore, “Dacca-1”, “Binachinabadam-2”, M6/25/64-82, and M6/15/70-19 could be used as source of salinity tolerance. Cross combinations showing high sca effects arising from parents with high and low gca values for any trait indicate the influence of nonadditive genes on their expression. Parents of these crosses can be used for biparental mating or reciprocal recurrent selection for developing high yielding varieties. Crosses with high sca effects having both parents with good gca effects could be exploited by pedigree breeding to get transgressive segregants.

  12. Dynamic succession of soil bacterial community during continuous cropping of peanut (Arachis hypogaea L..

    Directory of Open Access Journals (Sweden)

    Mingna Chen

    Full Text Available Plant health and soil fertility are affected by plant-microbial interactions in soils. Peanut is an important oil crop worldwide and shows considerable adaptability, but growth and yield are negatively affected by continuous cropping. In this study, 16S rRNA gene clone library analyses were used to study the succession of soil bacterial communities under continuous peanut cultivation. Six libraries were constructed for peanut over three continuous cropping cycles and during its seedling and pod-maturing growth stages. Cluster analyses indicated that soil bacterial assemblages obtained from the same peanut cropping cycle were similar, regardless of growth period. The diversity of bacterial sequences identified in each growth stage library of the three peanut cropping cycles was high and these sequences were affiliated with 21 bacterial groups. Eight phyla: Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Gemmatimonadetes, Planctomycetes, Proteobacteria and Verrucomicrobia were dominant. The related bacterial phylotypes dynamic changed during continuous cropping progress of peanut. This study demonstrated that the bacterial populations especially the beneficial populations were positively selected. The simplification of the beneficial microbial communities such as the phylotypes of Alteromonadales, Burkholderiales, Flavobacteriales, Pseudomonadales, Rhizobiales and Rhodospirillales could be important factors contributing to the decline in peanut yield under continuous cropping. The microbial phylotypes that did not successively changed with continuous cropping, such as populations related to Rhizobiales and Rhodospirillales, could potentially resist stress due to continuous cropping and deserve attention. In addition, some phylotypes, such as Acidobacteriales, Chromatiales and Gemmatimonadales, showed a contrary tendency, their abundance or diversity increased with continuous peanut cropping progress. Some bacterial phylotypes including Acidobacteriales, Burkholderiales, Bdellovibrionales, and so on, also were affected by plant age.

  13. Genomic characterisation of Arachis porphyrocalyx (Valls & C.E. Simpson, 2005) (Leguminosae): multiple origin of Arachis species with x = 9

    Science.gov (United States)

    Celeste, Silvestri María; Ortiz, Alejandra Marcela; Robledo, Germán Ariel; Valls, José Francisco Montenegro; Lavia, Graciela Inés

    2017-01-01

    Abstract The genus Arachis Linnaeus, 1753 comprises four species with x = 9, three belong to the section Arachis: Arachis praecox (Krapov. W.C. Greg. & Valls, 1994), Arachis palustris (Krapov. W.C. Greg. & Valls, 1994) and Arachis decora (Krapov. W.C. Greg. & Valls, 1994) and only one belongs to the section Erectoides: Arachis porphyrocalyx (Valls & C.E. Simpson, 2005). Recently, the x = 9 species of section Arachis have been assigned to G genome, the latest described so far. The genomic relationship of Arachis porphyrocalyx with these species is controversial. In the present work, we carried out a karyotypic characterisation of Arachis porphyrocalyx to evaluate its genomic structure and analyse the origin of all x = 9 Arachis species. Arachis porphyrocalyx showed a karyotype formula of 14m+4st, one pair of A chromosomes, satellited chromosomes type 8, one pair of 45S rDNA sites in the SAT chromosomes, one pair of 5S rDNA sites and pericentromeric C-DAPI+ bands in all chromosomes. Karyotype structure indicates that Arachis porphyrocalyx does not share the same genome type with the other three x = 9 species and neither with the remaining Erectoides species. Taking into account the geographic distribution, morphological and cytogenetic features, the origin of species with x = 9 of the genus Arachis cannot be unique; instead, they originated at least twice in the evolutionary history of the genus. PMID:28919947

  14. Desenvolvimento dos frutos nas espécies selvagens de amendoim (Arachis spp. Fruit development in wild species of peanut

    Directory of Open Access Journals (Sweden)

    Cândida H. T. Mendes Conagin

    1959-01-01

    Full Text Available As espécies selvagens de amendoim apresentam frutos completamente diferentes dos frutos do amendoim cultivado (Arachis hypogaea L.. Nesta espécie os frutos têm duas a cinco sementes justapostas dentro de uma única loja; externamente são observadas constrições na casca do fruto as quais em alguns casos se acentuam não chegando, entretanto, a produzir unia separação entre as sementes. Nas espécies selvagens os frutos apresentam duas sementes apenas, completamente separadas uma da outra por uma constrição muito profunda ou mesmo por um istmo de comprimento variável. Para êsses frutos foi adotada a denominação de "frutos catenados" e o estudo de seu desenvolvimento foi feito nas espécies Arachis monticola Krapovickas et Rigoni e A. villosa Benth. var. correntina Burk. O ovário, unilocular, tem normalmente dois óvulos. A futura separação das duas sementes se origina num tecido intercalar que se forma em ovários ainda jovens e que separa em duas a cavidade inicial única. Êste tecido tem a estrutura de um "peg" e, como êle, desidrata-se durante o processo de amadurecimento do fruto, tomando-se sêco e quebradiço; por essa razão, ao colhêr os frutos, a maioria dêles se apresenta unisseminado. Em 50% dos casos os óvulos se desenvolvem igualmente, conduzindo à formação de frutos com duas sementes. Quando os dois óvulos não se desenvolvem ao mesmo tempo, é mais freqüente o colapso do óvulo apical, cujo crescimento é paralisado cm diversos estados de desenvolvimento; isto conduz à formação de frutos com apenas uma semente ou com uma semente abortada. Além dessas duas, as seguintes espécies apresentam frutos catenados: Arachis Diogoi Hoehne f. typica Hoehne, A. glabrata Benth., A. pusilla Benth., A. marginata Gardn. (segundo Burkart, A. prostrata Benth. (segundo Burkart, e mais três espécies ainda não identificadas, mas que constam da coleção da Seção de Citologia como V. 44, V. 82 e V. 85. A V. 44 deve

  15. Transcriptome Sequencing of Diverse Peanut (Arachis Wild Species and the Cultivated Species Reveals a Wealth of Untapped Genetic Variability

    Directory of Open Access Journals (Sweden)

    Ratan Chopra

    2016-12-01

    Full Text Available To test the hypothesis that the cultivated peanut species possesses almost no molecular variability, we sequenced a diverse panel of 22 Arachis accessions representing Arachis hypogaea botanical classes, A-, B-, and K- genome diploids, a synthetic amphidiploid, and a tetraploid wild species. RNASeq was performed on pools of three tissues, and de novo assembly was performed. Realignment of individual accession reads to transcripts of the cultivar OLin identified 306,820 biallelic SNPs. Among 10 naturally occurring tetraploid accessions, 40,382 unique homozygous SNPs were identified in 14,719 contigs. In eight diploid accessions, 291,115 unique SNPs were identified in 26,320 contigs. The average SNP rate among the 10 cultivated tetraploids was 0.5, and among eight diploids was 9.2 per 1000 bp. Diversity analysis indicated grouping of diploids according to genome classification, and cultivated tetraploids by subspecies. Cluster analysis of variants indicated that sequences of B genome species were the most similar to the tetraploids, and the next closest diploid accession belonged to the A genome species. A subset of 66 SNPs selected from the dataset was validated; of 782 SNP calls, 636 (81.32% were confirmed using an allele-specific discrimination assay. We conclude that substantial genetic variability exists among wild species. Additionally, significant but lesser variability at the molecular level occurs among accessions of the cultivated species. This survey is the first to report significant SNP level diversity among transcripts, and may explain some of the phenotypic differences observed in germplasm surveys. Understanding SNP variants in the Arachis accessions will benefit in developing markers for selection.

  16. Kandungan auksin asam (3-indol asetat pada tahap perkembangan buah kacang tanah (Arachis hypogea (L. Merr

    Directory of Open Access Journals (Sweden)

    Sulistiono Sulistiono

    2012-05-01

    Full Text Available Auxin has an important role to control both of the growth and tropism of gynophore and the development of fruit and embryo ofpeanut (Arachis hypogaea (L. Merr.. The experiment was carried out to examine the contents of auxin during peanut development,i.e. at the time of anthesis (day 0, at day 4, 7, 10, 15, 18, 23, and 31 after anthesis, using High Performance Liquid Chromatography(HPLC with fluorescence detector method.Between the day of anthesis to the day 31 after anthesis, the auxin contents changed according to fruit development stage. Thefree auxin contents in the developed fruit (entering the soil were higher than undeveloped fruit (not entering the soil, while the boundauxin content in the developed fruit were lower than undeveloped fruit. The lowest free auxin contents was found at the time of anthesis,then increased drastically when the gynophore grew fast and in the beginning of embryo development stage (day 7. Between the day7 to the day 15 after anthesis, the free auxin contents were decreased. In the development fruit, the free auxin contents increased whenthe fruit begin to grow (day 15-18, then decreased until the seed reached its full size (day 31. In the undeveloped fruit, the free auxincontents decreased at day 7 to day 31. The bound auxin contents in the developed fruit decreased until the day 18, and increasedgradually until day 31. In the undeveloped fruit, the bound auxin contents decreased at day 15 and afterward.

  17. ESTUDIOS CROMOSÓMICOS EN ARACHIS (LEGUMINOSAE

    Directory of Open Access Journals (Sweden)

    Graciela Inés Lavia

    1996-01-01

    Full Text Available Se presenta el número de cromosomas de 38 accesiones que representan 17 especies de cinco secciones del género Arachis. El primer conteo cromosómico informa de las siguientes ocho especies: Sect. Extranervosae: A.retusa, secc. Heteranthae: A. Giacomettii, secc. Procumbentes: A.vallsii, secc. Arachis: A.decora, A.microsperma, A.palustris, A.rinitensis y A.williamsii. En informes anteriores son confirmadas nueve especies. Todas las especies estudiadas tienen 2n = 2x = 20, con excepción de una adhesión de A.palustris, que tiene 2n = 2x = 18, que representa probablemente un nuevo número básico x = 9 para el género. Cromosomas satélites se analizan para la mayoría de las especies. "A" cromosomas se encuentran sólo en A.microsperma y A.trinitensis (Sect. Arachis

  18. Characterization of a pathogen induced thaumatin-like protein gene AdTLP from Arachis diogoi, a wild peanut.

    Directory of Open Access Journals (Sweden)

    Naveen Kumar Singh

    Full Text Available Peanut (Arachis hypogaea L is one of the widely cultivated and leading oilseed crops of the world and its yields are greatly affected by various biotic and abiotic stresses. Arachis diogoi, a wild relative of peanut, is an important source of genes for resistance against various stresses that affect peanut. In our previous study a thaumatin-like protein gene was found to be upregulated in a differential expression reverse transcription PCR (DDRT-PCR study using the conidial spray of the late leaf spot pathogen, Phaeoisariopsis personata. In the present study, the corresponding full length cDNA was cloned using RACE-PCR and has been designated as AdTLP. It carried an open reading frame of 726 bp potentially capable of encoding a polypeptide of 241 amino acids with 16 conserved cysteine residues. The semi-quantitative RT-PCR analysis showed that the transcript level of AdTLP increased upon treatment with the late leaf spot pathogen of peanut, P. personata and various hormone treatments indicating its involvement in both, biotic and abiotic stresses. The antifungal activity of the purified recombinant protein was checked against different fungal pathogens, which showed enhanced anti-fungal activity compared to many other reported TLP proteins. The recombinant AdTLP-GFP fusion protein was found to be predominantly localized to extracellular spaces. Transgenic tobacco plants ectopically expressing AdTLP showed enhanced resistance to fungal pathogen, Rhizoctonia solani. The seedling assays showed enhanced tolerance of AdTLP transgenic plants against salt and oxidative stress. The transcript analysis of various defense related genes highlighted constitutively higher level expression of PR1a, PI-I and PI-II genes in transgenic plants. These results suggest that the AdTLP is a good candidate gene for enhancing stress resistance in crop plants.

  19. Mechanical Oil Expression from Groundnut ( Arachid hypogaea L ...

    African Journals Online (AJOL)

    Micro and medium scale groundnut (Arachid hypogaea L) oil processors are earnestly struggling to increase their production capacity to meet market demands in terms of quantity and quality. The existing traditional method of extraction involves roasting of the kernels using firewood as a fuel; pounding and crushing of the ...

  20. Effects of leaf movement on radiation interception in field grown leguminous crops, 1: Peanut (Arachis hypogaea L.)

    International Nuclear Information System (INIS)

    Isoda, A.; Yoshimura, T.; Ishikawa, T.; Nojima, H.; Takasaki, Y.

    1993-01-01

    The effects of leaf movement of peanut on radiation interception were examined. A peanut cultivar (c.v. Nakateyutaka) was planted at three planting densities (20, 30 and 40 cm equidistant spacings). In the treatment plots, the upper layer of the canopy was covered horizontally with a nylon net to restrain the movement of the leaflets. Intercepted radiation of each leaflet was measured by integrated solarimeter films for two consecutive days. It was observed that the leaflets of the upper layer oriented paraheliotropically to the sun rays in midday. Intercepted radiation per unit leaf area and unit ground area of the control were larger in the 20 cm pacing, almost similar in the 30 cm spacing and smaller in the 40 cm spacing as compared with the treatment. The leaf movement of the upper layer of the canopy played a significant role in radiation interception in the 20 cm plot, no discernible effect in the 30 cm plot and a rather adverse role in the 40 cm plot. Leaf area of the 20 cm spacing was concentrated densely at the upper layer. Leaf area of the 30 and 40 cm spacing was larger at the middle layers. It was assumed that effectiveness of the leaf movement of the upper layer would depend mainly on spatial leaf area distribution and density

  1. Multilocation trial of potential selected mutant lines of groundnut (arachis hypogaea) at 3 location in Peninsular Malaysia

    International Nuclear Information System (INIS)

    Abdul Rahim Harun; Rusli Ibrahim; Khairuddin Abdul Rahim; Shuhaimi Shamsuddin

    2002-01-01

    Two fixed mutant lines of groundnut derived from cultivar Matjan were selected for their yield potential at M 1 0 generation. Multilocation trial of these mutants (MJ40/42 and MJ20/165-5) was carried out to evaluate genotype stability at different climate and soil types in Peninsular Malaysia. The mutant lines were planted and compared with their parent (Matjan) and control variety (MKT1). The identified locations were in Taiping (Perak), Machang (Kelantan), and Air Hitam (Johor). The soils at the locations were of the Serdang, Bungor and Rengam series, respectively. The trial was carried out simultaneously in the same year at each location. Mutant MJ20/165-5 showed stable performance at all location compared to other genotypes tested. Its yield was higher than the parent in Kelantan and Johor trial and showed similar performance in Perak. This mutant also showed better yield performance than the control varieties in the Kelantan trial. Meanwhile, mutant line MJ40/42 gave better yield in Kelantan and Johor but did not perform well in Perak as compared to its parent and control varieties. (Author)

  2. Quality index of oils extracted from {gamma}-irradiated peanuts (Arachis hypogaea L.) of the golden and bari varieties

    Energy Technology Data Exchange (ETDEWEB)

    Bhatti, Ijaz Ahmad, E-mail: ijazchem@yahoo.co [Department of Chemistry and Biochemistry, University of Agriculture, Faisalabad 38040 (Pakistan); Ashraf, Syra; Shahid, Muhammad [Department of Chemistry and Biochemistry, University of Agriculture, Faisalabad 38040 (Pakistan); Asi, Muhammad Rafique [Nuclear Institute for Agriculture and Biology (NIAB), Faisalabad (Pakistan); Mehboob, Shahid [Department of Zoology, GC University, Faisalabad (Pakistan)

    2010-12-15

    Two varieties of peanuts were irradiated to 4, 6 and 8 kGy with Co{sup 60}. Their proximate compositions remained unaffected, but microbes were eliminated completely after irradiation to 8 kGy. HPLC was used to study tocopherols of irradiated and unirradiated oil samples. There were dose-dependent differences in physico-chemical values between the control and irradiated samples. Significant changes in tocopherol concentrations and peroxide values in the oils were observed after irradiation to 8 kGy. Fatty acid compositions did not change significantly. The study has shown that irradiation is an effective tool in preservation of peanut oil.

  3. Induced resistance to Helicoverpa armigera through exogenous application of jasmonic acid and salicylic acid in groundnut, Arachis hypogaea.

    Science.gov (United States)

    War, Abdul Rashid; Paulraj, Michael Gabriel; Ignacimuthu, Savarimuthu; Sharma, Hari Chand

    2015-01-01

    Induced resistance to Helicoverpa armigera through exogenous application of jasmonic acid (JA) and salicylic acid (SA) was studied in groundnut genotypes (ICGV 86699, ICGV 86031, ICG 2271 and ICG 1697) with different levels of resistance to insects and the susceptible check JL 24 under greenhouse conditions. Activities of oxidative enzymes and the amounts of secondary metabolites and proteins were quantified at 6 days after JA and SA application/insect infestation. Data were also recorded on plant damage and H. armigera larval weights and survival. Higher levels of enzymatic activities and amounts of secondary metabolites were observed in the insect-resistant genotypes pretreated with JA and then infested with H. armigera than in JL 24. The insect-resistant genotypes suffered lower insect damage and resulted in poor survival and lower weights of H. armigera larvae than JL 24. In some cases, JA and SA showed similar effects. JA and SA induced the activity of antioxidative enzymes in groundnut plants against H. armigera, and reduced its growth and development. However, induced response to application of JA was greater than to SA, and resulted in reduced plant damage, and larval weights and survival, suggesting that induced resistance can be used as a component of pest management in groundnut. © 2014 Society of Chemical Industry.

  4. Identification of seed proteins associated with resistance to pre-harvested aflatoxin contamination in peanut (Arachis hypogaea L

    Directory of Open Access Journals (Sweden)

    Li Ling

    2010-11-01

    Full Text Available Abstract Background Pre-harvest infection of peanuts by Aspergillus flavus and subsequent aflatoxin contamination is one of the food safety factors that most severely impair peanut productivity and human and animal health, especially in arid and semi-arid tropical areas. Some peanut cultivars with natural pre-harvest resistance to aflatoxin contamination have been identified through field screening. However, little is known about the resistance mechanism, which has slowed the incorporation of resistance into cultivars with commercially acceptable genetic background. Therefore, it is necessary to identify resistance-associated proteins, and then to recognize candidate resistance genes potentially underlying the resistance mechanism. Results The objective of this study was to identify resistance-associated proteins in response to A. flavus infection under drought stress using two-dimensional electrophoresis with mass spectrometry. To identify proteins involved in the resistance to pre-harvest aflatoxin contamination, we compared the differential expression profiles of seed proteins between a resistant cultivar (YJ-1 and a susceptible cultivar (Yueyou 7 under well-watered condition, drought stress, and A. flavus infection with drought stress. A total of 29 spots showed differential expression between resistant and susceptible cultivars in response to A. flavus attack under drought stress. Among these spots, 12 protein spots that consistently exhibited an altered expression were screened by Image Master 5.0 software and successfully identified by MALDI-TOF MS. Five protein spots, including Oso7g0179400, PII protein, CDK1, Oxalate oxidase, SAP domain-containing protein, were uniquely expressed in the resistant cultivar. Six protein spots including low molecular weight heat shock protein precursor, RIO kinase, L-ascorbate peroxidase, iso-Ara h3, 50 S ribosomal protein L22 and putative 30 S ribosomal S9 were significantly up-regulated in the resistant cultivar challenged by A. flavus under drought stress. A significant decrease or down regulation of trypsin inhibitor caused by A. flavus in the resistant cultivar was also observed. In addition, variations in protein expression patterns for resistant and susceptible cultivars were further validated by real time RT-PCR analysis. Conclusion In summary, this study provides new insights into understanding of the molecular mechanism of resistance to pre-harvest aflatoxin contamination in peanut, and will help to develop peanut varieties with resistance to pre-harvested aflatoxin contamination.

  5. Genotype-independent and enhanced in planta Agrobacterium tumefaciens-mediated genetic transformation of peanut [Arachis hypogaea (L.)].

    Science.gov (United States)

    Karthik, Sivabalan; Pavan, Gadamchetty; Sathish, Selvam; Siva, Ramamoorthy; Kumar, Periyasamy Suresh; Manickavasagam, Markandan

    2018-04-01

    Agrobacterium infection and regeneration of the putatively transformed plant from the explant remains arduous for some crop species like peanut. Henceforth, a competent and reproducible in planta genetic transformation protocol is established for peanut cv. CO7 by standardizing various factors such as pre-culture duration, acetosyringone concentration, duration of co-cultivation, sonication and vacuum infiltration. In the present investigation, Agrobacterium tumefaciens strain EHA105 harboring the binary vector pCAMBIA1301- bar was used for transformation. The two-stage selection was carried out using 4 and 250 mg l -1 BASTA ® to completely eliminate the chimeric and non-transformed plants. The transgene integration into plant genome was evaluated by GUS histochemical assay, polymerase chain reaction (PCR), and Southern blot hybridization. Among the various combinations and concentrations analyzed, highest transformation efficiency was obtained when the 2-day pre-cultured explants were subjected to sonication for 6 min and vacuum infiltrated for 3 min in Agrobacterium suspension, and co-cultivated on MS medium supplemented with 150 µM acetosyringone for 3 days. The fidelity of the standardized in planta transformation method was assessed in five peanut cultivars and all the cultivars responded positively with a transformation efficiency ranging from minimum 31.3% (with cv. CO6) to maximum 38.6% (with cv. TMV7). The in planta transformation method optimized in this study could be beneficial to develop superior peanut cultivars with desirable genetic traits.

  6. Investigations into the agronomic and economic aspects of using peanut (Arachis hypogaea) as an on-farm biodiesel feedstock

    Science.gov (United States)

    Although farmers have benefited from the creation of transportation fuels from grain and oilseeds, little research has addressed single farm or community self-reliance on home-grown fuels. The Peanut Biodiesel Project is designed to determine if peanut is suitable for just such a concept through fi...

  7. Plant growth-promoting Methylobacterium induces defense responses in groundnut (Arachis hypogaea L.) compared with rot pathogens.

    Science.gov (United States)

    Madhaiyan, M; Suresh Reddy, B V; Anandham, R; Senthilkumar, M; Poonguzhali, S; Sundaram, S P; Sa, Tongmin

    2006-10-01

    This study, framed in two different phases, studied the plant-growth promotion and the induction of systemic resistance in groundnut by Methylobacterium. Seed imbibition with Methylobacterium sp. increased germination by 19.5% compared with controls. Combined inoculation of Methylobacterium sp. with Rhizobium sp. also significantly increased plant growth, nodulation, and yield attributes in groundnut compared with individual inoculation of Rhizobium sp. Methylobacterium sp. challenge-inoculated with Aspergillus niger/Sclerotium rolfsii in groundnut significantly enhanced germination percentage and seedling vigour and showed increased phenylalanine ammonia lyase (PAL), beta-1,3-glucanase, and peroxidase (PO) activities. Under pot-culture conditions, in Methylobacterium sp. seed-treated groundnut plants challenge-inoculated with A. niger/S. rolfsii through foliar sprays on day 30, the activities of enzymes PO, PAL, and beta-1,3-glucanase increased constantly from 24 to 72 hours, after which decreased activity was noted. Five isozymes of polyphenol oxidase and PO could be detected in Methylobacterium-treated plants challenged with A. niger/S. rolfsii. Induced systemic resistance activity in groundnut against rot pathogens in response to methylotrophic bacteria suggests the possibility that pink-pigmented facultative methylotrophic bacteria might be used as a means of biologic disease control.

  8. Wilting and biological additive effect on in situ degradability and chemical composition of Arachis pintoi cv Belomonte silage

    OpenAIRE

    Rosana Aparecida Possenti; Evaldo Ferrari Júnior; Valdinei Tadeu Paulino; Ivani Pozar Otsuk; Patrícia Brás

    2010-01-01

    The purpose of this work was to evaluate the effect of wilting and biological additive amendment on chemical composition, fermentation and ruminal degradability of Arachis pintoi cv Belmonte silage. The following treatments were analysed: T1- Arachis pintoi cv Belmonte fresh forage; T2 - Arachis pintoi cv Belmonte fresh forage plus bacterial additive added to the forage prior to the ensilage; T3- Arachis pintoi cv Belmonte wilted by the sun for 4 hours; T4- Arachis pintoi cv Belmonte wilted b...

  9. Resveratrol production in hairy root culture of peanut, Arachis ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-10-20

    Oct 20, 2008 ... hypogaea L.) hairy roots and also showed varying effects on the growth and resveratrol production in hairy root cultures. ... (7.6 g/l) and resveratrol production (1.5 mg/g) in hairy root of peanut. Our results demonstrate that the .... and proliferation of human retinal pigment epithelial cells via extracellular ...

  10. Cryopreservation of Arachis pintoi (leguminosae) somatic embryos.

    Science.gov (United States)

    Rey, H Y; Faloci, M; Medina, R; Dolce, N; Engelmann, F; Mroginski, L

    2013-01-01

    In this study, we successfully cryopreserved cotyledonary somatic embryos of diploid and triploid Arachis pintoi cytotypes using the encapsulation-dehydration technique. The highest survival rates were obtained when somatic embryos were encapsulated in calcium alginate beads and precultured in agitated (80 rpm) liquid establishment medium (EM) with daily increasing sucrose concentration (0.50, 0.75, and 1.0 M). The encapsulated somatic embryos were then dehydrated with silica gel for 5 h to 20% moisture content (fresh weight basis) and cooled either rapidly (direct immersion in liquid nitrogen, LN) or slowly (1 degree C per min from 25 degree C to -30 degree C followed by immersion in LN). Beads were kept in LN for a minimum of 1 h and then were rapidly rewarmed in a 30 degree C water-bath for 2 min. Finally, encapsulated somatic embryos were post-cultured in agitated (80 rpm) liquid EM with daily decreasing sucrose concentration (0.75 and 0.5 M) and transferred to solidified EM. Using this protocol, we obtained 26% and 30% plant regeneration from cryopreserved somatic embryos of diploid and triploid cytotypes. No morphological abnormalities were observed in any of the plants regenerated from cryopreserved embryos and their genetic stability was confirmed with 10 isozyme systems and nine RAPD profiles.

  11. The Effect of Molybdenum Fertilization on Arachis Glabrata Biomass ...

    African Journals Online (AJOL)

    The effect of molybdenum fertilization on biomass and the number of nodules of Arachis glabrata was assessed at the Teaching and Research Farm of the University of Dschang in 2011 at different periods of mowing. A factorial design comparing four doses of molybdenum as ammonium molybdate (0, 0.75, 1.5 and 2.25 ...

  12. Foliar disease assessment of groundnut ( Arachis hypogea L ...

    African Journals Online (AJOL)

    Groundnut (Arachis hypogea L.) is an important food and oil legume but its commercial production is often limited to some regions in Nigeria due to attack by pests ... rust) and insect pest damage under natural infection during the 2012 and 2013 cropping seasons in the forest/savanna transition agroecology of Osun State.

  13. The potential of Arachis pintoi biomass to improve quality of soil continuously used for cassava cropping

    OpenAIRE

    N. Muddarisna; S. Prijono

    2014-01-01

    A field experiment that was aimed to elucidate the effects of application of Arachis pintoi biomass and animal dung on quality of soil continuously used for cassava cropping was conducted at Jatikerto Village, Kromengan District of Malang Regency. Eight treatments tested were 100% NPK inorganic fertilizer, 100 kg N Arachis pintoi/ha, (3) 100 kg N chicken dung / ha, 100 kg N cow dung /ha, 100 kg N goat dung /ha, 100 kg N Arachis pintoi + chicken dung /ha, 100 kg N Arachis pintoi + cow dung /h...

  14. Tratamentos pré-germinativos em sementes de Arachis pintoi Arachis pintoi seeds as affect by pre-germination

    Directory of Open Access Journals (Sweden)

    Claudia Antonia Vieira Rossetto

    2008-02-01

    Full Text Available Neste Trabalho objetivou-se avaliar o efeito dos tratamentos prévios na germinação e no vigor de sementes de Arachis pintoi Krapov. & W. C. Greg.. O delineamento experimental adotado foi inteiramente casualizado, em esquema fatorial (2 lotes x 7 tratamentos, com quatro repetições. Para isto, foram utilizados dois lotes comerciais de sementes com o pericarpo (frutos de Arachis pintoi, da cv. Amarillo, que estavam armazenados por seis e 12 meses. Por lote, foram empregados os tratamentos de remoção ou não do pericarpo, de quebra do pericarpo, de exposição dos frutos íntegros ao aquecimento a 45º C por 48 e 72 horas e à hidratação por 24 e 48 horas. Posteriormente, por tratamento, foi realizada a avaliação do grau de umidade, da germinação e do vigor (primeira contagem e emergência de plântulas. A remoção do pericarpo tornou as sementes mais vulneráveis à ação dos microrganismos. O aquecimento a 45º C por 48 e 72 horas propiciou a redução das sementes não germinadas. A hidratação por 48 horas favoreceu a germinação e o vigor das sementes de Arachis pintoi.The aim was to evaluate the effects of previous treatments in the Arachis pintoi Krapov. & W. C. Greg. seeds germination and vigour. A completely randomized design with four replication arranged in a factorial scheme (2 lots x 7 treatments, was used. For this, two commercial lots of seeds with intact pods of Arachis pintoi, cv. Amarillo, stored by six and 12 months, were used. In each lot, the treatments were employed through pod removal or not, the pod breakage and the exposition of intact pods at 45ºC for 48 and 72 hours and to the hidratation for 24 and 48 hours. Further, for treatment, it was performed the evaluation of water content, germination and vigor (first count of germination and seedling emergency. The pod removal became the seeds vulnerable to the action of microorganism. Heating at 45ºC for 48 and 72 hours caused reduction of the nom

  15. Chemical composition of some wild peanut species (Arachis L.) seeds.

    Science.gov (United States)

    Grosso, N R; Nepote, V; Guzmán, C A

    2000-03-01

    Oil, protein, ash, and carbohydrate contents, iodine value, and fatty acid and sterol compositions were studied in seeds of Arachis trinitensis, A. chiquitana, A. kempff-mercadoi, A. diogoi, A. benensis, A. appressipila, A. valida, A. kretschmeri, A. helodes, A. kuhlmannii, A. williamsii, A. sylvestris, A. matiensis, A. pintoi, A. hoehnei, A. villosa, and A. stenosperma. Oil content was greatest in A.stenosperma (mean value = 51.8%). The protein level was higher in A. sylvestris (30.1%) and A. villosa (29.5%). Mean value of oleic acid varied between 30.6% (A. matiensis) and 46.8% (Arachis villosa), and linoleic acid oscillated between 34.1% (A. villosa) and 47.4% (A. appressipila). The better oleic-to-linoleic (O/L) ratio was exhibited by A. villosa (1.38). Some species showed higher concentration of behenic acid. The greatest level of this fatty acid was found in A. matiensis (6.2%). Iodine value was lower in A. valida (99.2). The sterol composition in the different peanut species showed higher concentration of beta-sitosterol (mean values oscillated between 55.7 and 60.2%) followed by campesterol (12.4-16. 5%), stigmasterol (9.7-13.3%), and Delta(5)-avenasterol (9.7-13.4%). The chemical quality and stability of oils (iodine value and O/L ratio) from wild peanut studied in this work are not better than those of cultivated peanut.

  16. Comparing genome guided assembly and phased variants based assembly approach to separate the homoeolog transcripts in tetraploid peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Homoeologous copies of transcripts are abundant in many self-pollinating species including tetraploid peanut, and can impose a challenge to build a transcriptome reference without the merging of homoeologs. De novo transcriptome assembly of tetraploid OLin with single kmer and multiple kmer approach...

  17. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L..

    Directory of Open Access Journals (Sweden)

    Ming Li Wang

    Full Text Available Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1 and linoleic acid (C18:2 accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0, stearic acid (C18:0, arachidic acid (C20:0, gadoleic acid (C20:1, behenic acid (C22:0, and lignoceric acid (C24:0 are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL populations namely S-population (high oleic line 'SunOleic 97R' × low oleic line 'NC94022' and T-population (normal oleic line 'Tifrunner' × low oleic line 'GT-C20' were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL analysis. As a result, a total of 164 main-effect (M-QTLs and 27 epistatic (E-QTLs QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE. Thirty four major QTLs (>10% of PVE mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition.

  18. Flavor of roasted peanuts (Arachis hypogaea) - Part I: Effect of raw material and processing technology on flavor, color and fatty acid composition of peanuts

    NARCIS (Netherlands)

    Lykomitros, Dimitrios; Fogliano, V.; Capuano, E.

    2016-01-01

    Flavor and color of roasted peanuts have a strong impact on consumer acceptability. They can be influenced by
    raw material and processing technology. Raw peanuts of various market types, origins and grades were processed
    by different technologies to produce 134 unique samples, which were

  19. Plant growth promoter effect of radiation degraded Kappa-carrageenan on mungbean (Vigna radiate [L.] R. Wilczek) and peanut (Arachis Hypogaea L.) plants

    International Nuclear Information System (INIS)

    Abad, L.V.; Magsino, G.; Aurigue, F.B.; Montefalcon, D.V.; Lopez, G.E.P.; Dela Cruz, R.M.M.

    2015-01-01

    Kappa Carrageenan are hydrophilic polymers that comprise the main structural polysaccharides of numerous species of seaweed Eucheuma. They are composed of D-galactose units linked alternately with α(1,3) D-galactose-4-sulfated and β(1-4)-3,6-anhydro-D-galactose. Earlier studies indicate that irradiated κ-carrageenan enchances the growth of some plants such as rice bokchoi, and mustard. This study aims to determine the effects of radiation modified κ-carrageenan solution on mungbean and peanut plants and to identify its effective molecular weight range as plants growth promoter. Oligomers from radiation modified κ-carrageenan solution on mungbean and peanut plants. Results on plants sprayed with PGP revealed improvement of the agronomic traits of mungbean and peanut plants. Best PGP effects were manisfested in oligo-carrageenan sprayed plants treated with inoculants + fertilizer with an increase in yield of 200% and 154% for mungbean and peanuts, respectively. Likewise, spraying with oligo-carrageenan alone increased yield by 127% and 140%. Recent studies conducted on the effect of radiation modified κ-carrageenan on rice plants indicated an average of 30% increase in yield of rice in three (3) multi-location sites (Laguna, Nueva Ecija and Bulacan). Plants indicated resistance against Tungro virus. It also showed improved stem strength, enhancing its lodging resistance. The radiation modified κ-carrageenan solution which had an Mw of 6.9 kDa was fractionated into different molecular weight cut-offs of 5 kDa, 3 kDa and 1 kDa. Analysis by gel permeation chromatography of these samples indicated Mw of 5.2 kDa, 4.0 kDa, and 3.8 kDa, respectively. Treatment of pechay by foliar spraying of these solution indicated that plant growth promoter effect increased in the order of 1kDa > 3kDa > 5kDa. (author)

  20. Quantifying N2-fixed by groundnut (Arachis hypogaea L.) as compared to some summer legumes using ''1''5N methodology with different reference crops

    International Nuclear Information System (INIS)

    Adlan, M. A. M.; Mukhtar, N. O.

    2004-01-01

    Using the ''1''5N methodology, one of the cultivar of groundnut repeated once (as groundnut 1 and 2) and one cultivar of each of the summer legumes guar, pigeon pea and mungbean were studied (a) to determine the amounts of nitrogen fixed by these legumes using different reference crops and (b) to compare N-fixation by groundnut to that of the above mentioned summer legumes. The reference crops used were, sorghum, soybean and a non-nodulating groundnut isoline. Each of the studied legumes and reference crops was grown at the Gezira Research Station Farm, in a microplot of 2.4 m''2 situated at one side of a main-plot of 24 m''2. The N 2 fixing legumes guar, mung bean, and pigeon pea and sorghum were given 20 kg N/ha as urea at 5.0% ''1''5N atom excess, and the reference crops of soybean and non -nodulating groundnut were given 100 kg N/ha at 1.0% ''1''5N atom excess. ''1''4N/''1''5N ratios were determined in plants sampled from the microplots. The results showed that pigeon pea and guar could compete well with groundnut as N 2 -fixers. Levels of fixation (%Ndfa) were 79% (108 kg N/ha), 77% (138 kg N/ha) and 80% (70 kg N/ha) of the total crop's N need for guar, groundnut and pigeon pea, respectively. Mungbean fixed about 12% (6 kg N/ha) of its N need. The variation in the amounts of N 2 fixed in kg/ha is dependent on the total plant N yield of each legume which was 160-180, 139, 87 and 68 for groundnut, guar, pigeon pea and mug bean, respectively. The non-nodulating groundnut was a superior reference crop over sorghum and soybean. Thus, the studied reference crops can be listed in a descending order of excellence as follows: non-nodulating groundnut, sorghum, soybean.(Author)

  1. Refining a major QTL controlling spotted wilt disease resistance in cultivated peanut (Arachis hypogaea L.)and evaluating its contribution to the resistance variations in peanut germplasm

    Science.gov (United States)

    Spotted wilt, caused by tomato spotted wilt virus (TSWV), has been one of major diseases in cultivated peanut grown in the southeastern United States (US) since 1990. Previously a major quantitative trait locus (QTL) controlling spotted wilt disease resistance was mapped to an interval of 2.55 cent...

  2. Systematic selection for increased fruit yield in populations derived from hybridization only, F1 irradiation, and hybridization following parental irradiation in peanuts (Arachis hypogaea L.)

    International Nuclear Information System (INIS)

    Emery, D.A.; Wynne, J.C.

    1976-01-01

    Three hybrid peanut populations involving a single pair of high yielding parents were developed to determine the effects of irradiation prior to and after hybridization on the response to selection for fruit yield. The control-hybrid population was produced by making reciprocal crosses between the two parents. The pre-hybrid-irradiated population was initiated by making reciprocal crosses between the M 1 plants of the two parents irradiated as seeds. The post-hybrid-irradiated population was developed by irradiating the mature F 1 embryos of crosses between the same parents. Each of the three original populations consisted of 55 F 1 plants. Ten F 2 plants were grown from each F 1 and one F 3 plant from each F 2 was used to initiate the yield tests. Selection for increased yield was practiced systematically and uniformly in each population over the F 3 to F 5 generations until the number of lines derived from single F 1 plants was reduced to five and the number of sublines descended from particular F 2 plants to three per line for yield trials in the F 6 generation. The mean yields of the F 1 derived lines of the irradiated populations were considerably below that of the control hybrid population when selection began but they reached 99% of the control mean in the F 6 generation. Selection gains in the irradiated populations appeared to result from the removal of inferior yielding sublines since greatest progress was made by raising the lower extremities of mean F 2 derived subline ranges rather than by extending the upper extremities of the ranges. The three highest yielding lines in the F6 generation occurred in the irradiated populations while the three highest yielding sublines were found in the hybrid-control population. No incidental association between size and yield of fruit was noted and a wide range of fruit sizes was found among the high yielding lines and sublines in all populations. (author)

  3. Exogenous Calcium Alleviates Photoinhibition of PSII by Improving the Xanthophyll Cycle in Peanut (Arachis Hypogaea) Leaves during Heat Stress under High Irradiance

    Science.gov (United States)

    Yang, Sha; Wang, Fang; Guo, Feng; Meng, Jing-Jing; Li, Xin-Guo; Dong, Shu-Ting; Wan, Shu-Bo

    2013-01-01

    Peanut is one of the calciphilous plants. Calcium (Ca) serves as a ubiquitous central hub in a large number of signaling pathways. The effect of exogenous calcium nitrate [Ca(NO3)2] (6 mM) on the dissipation of excess excitation energy in the photosystem II (PSII) antenna, especially on the level of D1 protein and the xanthophyll cycle in peanut plants under heat (40°C) and high irradiance (HI) (1 200 µmol m−2 s−1) stress were investigated. Compared with the control plants [cultivated in 0 mM Ca(NO3)2 medium], the maximal photochemical efficiency of PSII (Fv/Fm) in Ca2+-treated plants showed a slighter decrease after 5 h of stress, accompanied by higher non-photochemical quenching (NPQ), higher expression of antioxidative genes and less reactive oxygen species (ROS) accumulation. Meanwhile, higher content of D1 protein and higher ratio of (A+Z)/(V+A+Z) were also detected in Ca2+-treated plants under such stress. These results showed that Ca2+ could help protect the peanut photosynthetic system from severe photoinhibition under heat and HI stress by accelerating the repair of D1 protein and improving the de-epoxidation ratio of the xanthophyll cycle. Furthermore, EGTA (a chelant of Ca ion), LaCl3 (a blocker of Ca2+ channel in cytoplasmic membrane), and CPZ [a calmodulin (CaM) antagonist] were used to analyze the effects of Ca2+/CaM on the variation of (A+Z)/(V+A+Z) (%) and the expression of violaxanthin de-epoxidase (VDE). The results indicated that CaM, an important component of the Ca2+ signal transduction pathway, mediated the expression of the VDE gene in the presence of Ca to improve the xanthophyll cycle. PMID:23940721

  4. Exogenous calcium alleviates photoinhibition of PSII by improving the xanthophyll cycle in peanut (Arachis hypogaea leaves during heat stress under high irradiance.

    Directory of Open Access Journals (Sweden)

    Sha Yang

    Full Text Available Peanut is one of the calciphilous plants. Calcium (Ca serves as a ubiquitous central hub in a large number of signaling pathways. The effect of exogenous calcium nitrate [Ca(NO32] (6 mM on the dissipation of excess excitation energy in the photosystem II (PSII antenna, especially on the level of D1 protein and the xanthophyll cycle in peanut plants under heat (40°C and high irradiance (HI (1 200 µmol m(-2 s(-1 stress were investigated. Compared with the control plants [cultivated in 0 mM Ca(NO32 medium], the maximal photochemical efficiency of PSII (Fv/Fm in Ca(2+-treated plants showed a slighter decrease after 5 h of stress, accompanied by higher non-photochemical quenching (NPQ, higher expression of antioxidative genes and less reactive oxygen species (ROS accumulation. Meanwhile, higher content of D1 protein and higher ratio of (A+Z/(V+A+Z were also detected in Ca(2+-treated plants under such stress. These results showed that Ca(2+ could help protect the peanut photosynthetic system from severe photoinhibition under heat and HI stress by accelerating the repair of D1 protein and improving the de-epoxidation ratio of the xanthophyll cycle. Furthermore, EGTA (a chelant of Ca ion, LaCl3 (a blocker of Ca(2+ channel in cytoplasmic membrane, and CPZ [a calmodulin (CaM antagonist] were used to analyze the effects of Ca(2+/CaM on the variation of (A+Z/(V+A+Z (% and the expression of violaxanthin de-epoxidase (VDE. The results indicated that CaM, an important component of the Ca(2+ signal transduction pathway, mediated the expression of the VDE gene in the presence of Ca to improve the xanthophyll cycle.

  5. DROUGHT TOLERANCE OF LOCAL ROTE AND CHECK VARIETIES OF GROUNDNUT (Arachis hypogaea L. UNDER DRY SEASON IN TWO LOCATIONS IN EAST NUSA TENGGARA

    Directory of Open Access Journals (Sweden)

    Yosep S. Mau

    2014-10-01

    Full Text Available Groundnut is the most important pulse crop in East Nusa Tenggara (ENT; however, the crop yield in ENT is low due to erratic climatic condition, drought stress, and low yielding ability of most cultivated genotypes. Local Rote is a well-known local groundnut variety in ENT, which is a potential superior variety and parental source due its large seed size and high yielding ability. Information on its resistance to abiotic and biotic stresses is important for its future development. Five groundnut genotypes, Local Rote and check varieties were elucidated to identify drought resistant genotypes. The study was carried out in a split-plot design with three replicates in two locations during dry season 2013. Two irrigation regimes (optimum and stress conditions were assigned as main plot and 5 groundnut geno-types as sub-plot. Research results revealed significant effect of irrigation by genotype interaction on observed yield and yield compo-nent characters in both locations. Seed yields of most tested genotypes were below their yield potential. Local Rote yielded best over two locations (1.26 t.ha-1 seed yield. Yields of check varieties were below 1.0 t.ha-1. Local Rote was considered tolerant to drought based on STI, GMP, SSI and YL selection indices.

  6. Changes in growth and yield characters and in genetic variation of peanut (Arachis hypogaea L.) plants due to gamma ray irradiation

    International Nuclear Information System (INIS)

    Kassem, M.; Esawy, W.A.

    2003-01-01

    Air dried seeds of two peanut cultivars Giza 4 and Giza 5 were subjected to irradiation treatments of Co 6 0 gamma ray doses i.e. 0, 100, 150, 200, 250 Gy to study their effect on growth characters, yield components, genetic variation, heritability and genetic advance for election; during 2000 and 2001 summer seasons. Results indicated that, the 100 Gy treatment produced the highest means of most growth characters in M 1 and M 2 generations, however the 250 Gy treatment produced the highest means for No. of pods/plant, pod yield/plant, seed yield/plant and shelling percentage in M 1 generation, but the 200 Gy treatment produced the highest means of yield components in M 2 generation for the two cultivars Giza 4 Giza 5. In general, mean percentages of oil and protein were decreased by increasing gamma ray doses in M 1 and M 2 generations for both Giza 4 and Giza 5. The highest estimates of phenotypic and genotypic coefficient of variation, heritability and genetic advance under selection were obtained with 250 Gy dose for most growth characters and yield components as well as oil and protein percentages of the two cultivars in both M 1 and M 2 generations

  7. Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).

    Science.gov (United States)

    Singh, Natwar; Mishra, Avinash; Jha, Bhavanath

    2014-08-15

    Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Genotypic Regulation of Aflatoxin Accumulation but Not Aspergillus Fungal Growth upon Post-Harvest Infection of Peanut (Arachis hypogaea L. Seeds

    Directory of Open Access Journals (Sweden)

    Walid Ahmed Korani

    2017-07-01

    Full Text Available Aflatoxin contamination is a major economic and food safety concern for the peanut industry that largely could be mitigated by genetic resistance. To screen peanut for aflatoxin resistance, ten genotypes were infected with a green fluorescent protein (GFP—expressing Aspergillus flavus strain. Percentages of fungal infected area and fungal GFP signal intensity were documented by visual ratings every 8 h for 72 h after inoculation. Significant genotypic differences in fungal growth rates were documented by repeated measures and area under the disease progress curve (AUDPC analyses. SICIA (Seed Infection Coverage and Intensity Analyzer, an image processing software, was developed to digitize fungal GFP signals. Data from SICIA image analysis confirmed visual rating results validating its utility for quantifying fungal growth. Among the tested peanut genotypes, NC 3033 and GT-C20 supported the lowest and highest fungal growth on the surface of peanut seeds, respectively. Although differential fungal growth was observed on the surface of peanut seeds, total fungal growth in the seeds was not significantly different across genotypes based on a fluorometric GFP assay. Significant differences in aflatoxin B levels were detected across peanut genotypes. ICG 1471 had the lowest aflatoxin level whereas Florida-07 had the highest. Two-year aflatoxin tests under simulated late-season drought also showed that ICG 1471 had reduced aflatoxin production under pre-harvest field conditions. These results suggest that all peanut genotypes support A. flavus fungal growth yet differentially influence aflatoxin production.

  9. Very low dose gamma irradiation stimulates gaseous exchange and carboxylation efficiency, but inhibits vascular sap flow in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Ahuja, Sumedha; Singh, Bhupinder; Gupta, Vijay Kumar; Singhal, R K; Venu Babu, P

    2014-02-01

    An experiment was carried out to determine the effect of low dose gamma radiation on germination, plant growth, nitrogen and carbon fixation and carbon flow and release characteristics of groundnut. Dry seeds of groundnut variety Trombay groundnut 37A (TG 37A), a radio mutant type developed by Bhabha Atomic Research Centre (BARC), Mumbai, India, were subjected to the pre-sowing treatment of gamma radiation within low to high dose physiological range, i.e., 0.0, 0.0082, 0.0164. 0.0328, 0.0656, 0.1312, 5, 25, 100, 500 Gray (Gy) from a cobalt source ((60)Co). Observations were recorded for the radiation effect on percentage germination, vigour, gas exchange attributes such as photosynthetic rate, stomatal conductance and transpiration rate, chlorophyll content, root exudation in terms of (14)C release, vascular sap flow rate and activities of rate defining carbon and nitrogen assimilating enzymes such as ribulose-1,5-bisphosphate carboxylase (rubisco) and nitrate reductase (NR). Seed germination was increased by 10-25% at the lower doses up to 5 Gy while the improvement in plant vigour in the same dose range was much higher (22-84%) than the unirradiated control. For radiation exposure above 5 Gy, a dose-dependent decline in germination and plant vigour was measured. No significant effect was observed on the photosynthesis at radiation exposure below 5 Gy but above 5 Gy dose there was a decline in the photosynthetic rate. Stomatal conductance and transpiration rate, however, were only inhibited at a high dose of 500 Gy. Leaf rubisco activity and NR activities remained unaffected at all the investigated doses of gamma irradiation. Mean root exudation and sap flow rate of the irradiated plants, irrespective of the dose, was reduced over the unirradiated control more so in a dose-dependent manner. Results indicated that a very low dose of gamma radiation, in centigray to gray range, did not pose any threat and in fact stimulated metabolic functions in such a way to aid growth and development of groundnut plants. It further showed that the radiation threshold for the gas exchange traits and rubisco activity, which ultimately determine the plant health and yield, were higher than compared to the other metabolic attributes and were well beyond 500 Gy and that the dose range above 500 Gy should be targeted to measure lethal effects of radiation on carbon assimilation attributes in leguminous crops, in general, and groundnut in particular.

  10. Stress inducible overexpression of AtHDG11 leads to improved drought and salt stress tolerance in peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Banavath, Jayanna N.; Chakradhar, Thammineni; Pandit, Varakumar; Konduru, Sravani; Guduru, Krishna K.; Akila, Chandra S.; Podha, Sudhakar; Puli, Chandra O. R.

    2018-03-01

    Peanut is an important oilseed and food legume cultivated as a rain-fed crop in semi-arid tropics. Drought and high salinity are the major abiotic stresses limiting the peanut productivity in this region. Development of drought and salt tolerant peanut varieties with improved yield potential using biotechnological approach is highly desirable to improve the peanut productivity in marginal geographies. As abiotic stress tolerance and yield represent complex traits, engineering of regulatory genes to produce abiotic stress-resilient transgenic crops appears to be a viable approach. In the present study, we developed transgenic peanut plants expressing an Arabidopsis homeodomain-leucine zipper transcription factor (AtHDG11) under stress inducible rd29Apromoter. A stress-inducible expression of AtHDG11 in three independent homozygous transgenic peanut lines resulted in improved drought and salt tolerance through up-regulation of known stress responsive genes(LEA, HSP70, Cu/Zn SOD, APX, P5CS, NCED1, RRS5, ERF1, NAC4, MIPS, Aquaporin, TIP, ELIP ) in the stress gene network , antioxidative enzymes, free proline along with improved water use efficiency traits such as longer root system, reduced stomatal density, higher chlorophyll content, increased specific leaf area, improved photosynthetic rates and increased intrinsic instantaneous WUE. Transgenic peanut plants displayed high yield compared to non-transgenic plants under both drought and salt stress conditions. Holistically, our study demonstrates the potentiality of stress-induced expression of AtHDG11 to improve the drought, salt tolerance in peanut.

  11. QTL-seq approach identified genomic regions and diagnostic markers for rust and late leaf spot resistance in groundnut (Arachis hypogaea L.).

    Science.gov (United States)

    Pandey, Manish K; Khan, Aamir W; Singh, Vikas K; Vishwakarma, Manish K; Shasidhar, Yaduru; Kumar, Vinay; Garg, Vanika; Bhat, Ramesh S; Chitikineni, Annapurna; Janila, Pasupuleti; Guo, Baozhu; Varshney, Rajeev K

    2017-08-01

    Rust and late leaf spot (LLS) are the two major foliar fungal diseases in groundnut, and their co-occurrence leads to significant yield loss in addition to the deterioration of fodder quality. To identify candidate genomic regions controlling resistance to rust and LLS, whole-genome resequencing (WGRS)-based approach referred as 'QTL-seq' was deployed. A total of 231.67 Gb raw and 192.10 Gb of clean sequence data were generated through WGRS of resistant parent and the resistant and susceptible bulks for rust and LLS. Sequence analysis of bulks for rust and LLS with reference-guided resistant parent assembly identified 3136 single-nucleotide polymorphisms (SNPs) for rust and 66 SNPs for LLS with the read depth of ≥7 in the identified genomic region on pseudomolecule A03. Detailed analysis identified 30 nonsynonymous SNPs affecting 25 candidate genes for rust resistance, while 14 intronic and three synonymous SNPs affecting nine candidate genes for LLS resistance. Subsequently, allele-specific diagnostic markers were identified for three SNPs for rust resistance and one SNP for LLS resistance. Genotyping of one RIL population (TAG 24 × GPBD 4) with these four diagnostic markers revealed higher phenotypic variation for these two diseases. These results suggest usefulness of QTL-seq approach in precise and rapid identification of candidate genomic regions and development of diagnostic markers for breeding applications. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  12. Genotypic regulation of aflatoxin accumulation but not Aspergillus fungal growth upon post-harvest infection of peanut (Arachis hypogaea L.) seeds

    Science.gov (United States)

    Aflatoxin contamination is a major economic and food safety concern for the peanut industry that largely could be mitigated by genetic resistance. To screen peanut for aflatoxin resistance, Ten genotypes were infected with green fluorescent protein (GFP) - expression Aspergillus flavus strain. Per...

  13. Composición lipídica de semillas de maní (Arachis hypogaea L. obtenidas bajo diferentes condiciones de disponibilidad de agua

    Directory of Open Access Journals (Sweden)

    Casanoves, Fernando

    2000-12-01

    Full Text Available The changes in the lipid composition, oleic/linoleic ratio (O/L and iodine value (IY for Florman INTA peanut seeds of different sizes obtained under two different water availability conditions during reproductive period were, evaluated. The water availability affected O/L ratio, IY, and the content of all fatty acid but behenic. The seed size affect the oleic, eicosenic and behenic contents. Interaction between water availability and size seed in relation to lipid and lignoseric acid content were also detected. The greatest water availability produced seeds with more lipid content. Moreover, probably due to an indirect effect of less soil temperature, the insaturated lipid concentration was increased as can be seen in the less O/L ratio and augmented IY.Se evaluaron las modificaciones que se producen en el contenido de materia grasa, perfil de ácidos grasos, relación oleico / linoleico (O/L e índice de yodo (IY de las semillas de maní (cv. Florman INTA de distinto tamaño producidas bajo dos situaciones diferentes de disponibilidad de agua durante el período reproductivo. La disponibilidad de agua afectó la relación O/L, el IY, y el contenido de todos los ácidos grasos menos behénico. En relación al tamaño de las semillas variaron el contenido de oleico, eicosenoico y behénico. Se encontró interacción entre disponibilidad hídrica y tamaño de semillas para el contenido de aceite y de ácido lignosérico. La mayor disponibilidad de agua produjo semillas con mayor contenido de aceite y además, probablemente debido a un efecto indirecto de disminución de la temperatura de suelo, se aumentó el grado de insaturación del aceite, lo cual se evidenció a través de una relación O/L menor y un IY superior.

  14. Genotypic Regulation of Aflatoxin Accumulation but Not Aspergillus Fungal Growth upon Post-Harvest Infection of Peanut (Arachis hypogaea L.) Seeds.

    Science.gov (United States)

    Korani, Walid Ahmed; Chu, Ye; Holbrook, Corley; Clevenger, Josh; Ozias-Akins, Peggy

    2017-07-12

    Aflatoxin contamination is a major economic and food safety concern for the peanut industry that largely could be mitigated by genetic resistance. To screen peanut for aflatoxin resistance, ten genotypes were infected with a green fluorescent protein (GFP)-expressing Aspergillus flavus strain. Percentages of fungal infected area and fungal GFP signal intensity were documented by visual ratings every 8 h for 72 h after inoculation. Significant genotypic differences in fungal growth rates were documented by repeated measures and area under the disease progress curve (AUDPC) analyses. SICIA (Seed Infection Coverage and Intensity Analyzer), an image processing software, was developed to digitize fungal GFP signals. Data from SICIA image analysis confirmed visual rating results validating its utility for quantifying fungal growth. Among the tested peanut genotypes, NC 3033 and GT-C20 supported the lowest and highest fungal growth on the surface of peanut seeds, respectively. Although differential fungal growth was observed on the surface of peanut seeds, total fungal growth in the seeds was not significantly different across genotypes based on a fluorometric GFP assay. Significant differences in aflatoxin B levels were detected across peanut genotypes. ICG 1471 had the lowest aflatoxin level whereas Florida-07 had the highest. Two-year aflatoxin tests under simulated late-season drought also showed that ICG 1471 had reduced aflatoxin production under pre-harvest field conditions. These results suggest that all peanut genotypes support A. flavus fungal growth yet differentially influence aflatoxin production.

  15. High transpiration efficiency increases pod yield under intermittent drought in dry and hot atmospheric conditions but less so under wetter and cooler conditions in groundnut (Arachis hypogaea (L.)).

    Science.gov (United States)

    Vadez, Vincent; Ratnakumar, Pasala

    2016-07-01

    Water limitation is a major yield limiting factor in groundnut and transpiration efficiency (TE) is considered the main target for improvement, but TE being difficult to measure it has mostly been screened with surrogates. The paper re-explore the contribution of TE to grain yield in peanut by using a novel experimental approach in which TE is measured gravimetrically throughout the crop life cycle, in addition to measurement of TE surrogates. Experimentation was carried out with the groundnut reference collection (n = 288), across seasons varying for the evaporative demand (vapor pressure deficit, VPD) and across both fully irrigated and intermittent water stress conditions. There was large genotypic variation for TE under water stress in both low and high VPD season but the range was larger (5-fold) in the high- than in the low-VPD season (2-fold). Under water stress in both seasons, yield was closely related to the harvest index (HI) while TE related directly to yield only in the high VPD season. After discounting the direct HI effect on yield, TE explained a large portion of the remaining yield variations in both seasons, although marginally in the low VPD season. By contrast, the total water extracted from the soil profile, which varied between genotypes, did not relate directly to pod yield and neither to the yield residuals unexplained by HI. Surrogates for TE (specific leaf area, SLA, and SPAD chlorophyll meter readings, SCMR) never showed any significant correlation to TE measurements. Therefore, TE is an important factor explaining yield differences in groundnut under high VPD environments, suggesting that stomatal regulation under high VPD, rather than high photosynthetic rate as proposed earlier, may have a key role to play in the large TE differences found, which open new opportunities to breed improved groundnut for high VPD.

  16. The potential of Arachis pintoi biomass to improve quality of soil continuously used for cassava cropping

    Directory of Open Access Journals (Sweden)

    N. Muddarisna

    2014-01-01

    Full Text Available A field experiment that was aimed to elucidate the effects of application of Arachis pintoi biomass and animal dung on quality of soil continuously used for cassava cropping was conducted at Jatikerto Village, Kromengan District of Malang Regency. Eight treatments tested were 100% NPK inorganic fertilizer, 100 kg N Arachis pintoi/ha, (3 100 kg N chicken dung/ ha, 100 kg N cow dung /ha, 100 kg N goat dung /ha, 100 kg N Arachis pintoi + chicken dung /ha, 100 kg N Arachis pintoi + cow dung /ha, and 100 kg N Arachis pintoi + goat dung /ha. Monitoring quality of top soil (0-20 cm was carried out at planting time and 3 months after planting. Soil samples were collected and analyzed for chemical and physical properties. Yield of cassava was measured at 6 months after planting. Results of this study showed that application of organic fertilizer in forms of green manure (Arachis pintoi biomass, and animal dung significantly improved physical and chemical properties of soil. Application of 50% NPK combined with organic manures did not significantly gave different tuber yield with that of 100% NPK.

  17. Induced plasmon mutations affecting the growth habit of peanuts, A. hypogaea L

    International Nuclear Information System (INIS)

    Levy, A.; Ashri, A.

    1978-01-01

    The effectiveness of the acridines ethidium bromide (EB) and acriflavine in inducing plasmon mutations was compared with the alkylating agents ethyl methanesulphonate (EMS) and diethyl sulphate and to γ-rays. The growth habit (trailing versus bunch) of peanuts (A. hypogaea), controlled by genic-cytoplasmic interactions, was utilized. Breeding tests distinguishing nuclear from plasmon mutations were developed and are described in detail. Plasmon mutations were induced, but there were differences in mutation yields between the cultivars and the mutagens. (Auth.)

  18. Morphological traits as variety descriptors of Arachis pintoi

    Directory of Open Access Journals (Sweden)

    Caroline Marques Castro

    2007-01-01

    Full Text Available Arachis pintoi is outstanding in the present agricultural scenery for adapting well to varied environments andin view of its high yield of quality fodder. It is therefore used as forage crop in different countries. In the last 15 years, morethan ten cultivars were released in different countries; none of them is protected in Brazil. To protect a cultivar the minimumdescriptors of the species must be determined. In this study, F2 populations of A. pintoi were evaluated by the number ofbristles on the petiole, number of bristles on the basal and distal leaflets, length and width of internodes, length and width ofbasal and distal leaflets, and flower color. The objective was the determination of morphological traits for variety identificationof forage peanut. The performance of the F2 progenies was trait-dependent. The heritability of all traits was high, indicatingthat a great part of the variation observed in these genotypes is genetic. This reinforces the usefulness of these traits as varietydescriptors of forage peanut.

  19. Nitrogen fertilization on the establishment of Arachis pintoi cv. Belmonte

    Directory of Open Access Journals (Sweden)

    Rita Manuele Porto Sales

    2012-11-01

    Full Text Available The objective was to evaluate the effect of nitrogen fertilization on the establishment of forage peanut (Arachis pintoi cv. Belmonte propagated vegetatively. The experiment was conducted in a greenhouse in a completely randomized design with treatments arranged in a 2 × 4 factorial design - two ages (70 and 85 days after planting and four nitrogen doses (0, 40, 80 and 120 kg/ha - with four replications. Morphogenetic and structural characteristics and production were evaluated. The nitrogen accelerated the establishment of the forage peanut with an increase in dry weight of green leaves and stolons. The greatest length of stolons (48.0 cm was obtained with a dose equivalent to 86 kg N/ha and higher density of stolons (20 stolons/vase between 78 and 82 kg N/ha. Nitrogen fertilization also reduced the phyllochron from 6.7 to 4.6 days/leaf. These data were more intense at 85 days, suggesting greater photosynthetic contribution during this period related to the large number of leaves after 70 days. Therefore, nitrogen can be an important tool to accelerate the establishment of pure stands of forage peanut.

  20. Fish oil versus arachis oil food supplementation in relation to pregnancy duration in rats

    DEFF Research Database (Denmark)

    Olsen, S.F.; Hansen, Harald S.; Jensen, B.

    1990-01-01

    Throughout pregnancy, Lewis rats were fed standard rat chow supplemented with 15% (w/w) of either MaxEPA fish oil (FO) or arachis oil (AO); a third group was fed standard rat chow only (St) (n = 15, 15, and 16 rats, respectively). Compared to AO-rats, FO-rats had substantially higher levels of n-3...

  1. Sapu pada Kacang Hias (Arachis pintoi: Penyakit Baru yang Berasosiasi dengan Fitoplasma

    Directory of Open Access Journals (Sweden)

    Budiyarto .

    2013-04-01

    Full Text Available Pinto peanut (Arachis pintoi witches’ broom is a new disease found in Bogor at high incidence and has not yet been reported elsewhere. Symptom type of the disease is very similar to that of peanut (A. hypogea witches’ broom, which has been well known to be associated with phytoplasma. Both A. pintoi and A. hypogea witches’ broom causal agent are transmissible to both healthy A. pintoi or A. hypogea, with grafting or vector transmission using peanut witches’ broom phytoplasma specific vector, Orosius argentatus. All combination of transmission means resulted in an identical type of witches’ broom symptom. Further confirmation using polymerase chain reaction detection and identification of phytoplasma employing universal primer pair for phytoplasmas (P1/P7, showed that all of the diseased plants, either from field or transmitted plants is associated with phytoplasma. The A. pintoi witches’ broom phytoplasma is likely identical to that of A. hypogea.Key words: Arachis pintoi, Orosius argentatus, phytoplasma, witches’ broom

  2. Genetic diversity analysis in the section Caulorrhizae (genus Arachis using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Darío A. Palmieri

    2010-01-01

    Full Text Available Diversity in 26 microsatellite loci from section Caulorrhizae germplasm was evaluated by using 33 accessions of A. pintoi Krapov. & W.C. Gregory and ten accessions of Arachis repens Handro. Twenty loci proved to be polymorphic and a total of 196 alleles were detected with an average of 9.8 alleles per locus. The variability found in those loci was greater than the variability found using morphological characters, seed storage proteins and RAPD markers previously used in this germplasm. The high potential of these markers to detect species-specific alleles and discriminate among accessions was demonstrated. The set of microsatellite primer pairs developed by our group for A. pintoi are useful molecular tools for evaluating Section Caulorrhizae germplasm, as well as that of species belonging to other Arachis sections.

  3. Genetic diversity analysis in the section Caulorrhizae (genus Arachis) using microsatellite markers.

    Science.gov (United States)

    Palmieri, Darío A; Bechara, Marcelo D; Curi, Rogério A; Monteiro, Jomar P; Valente, Sérgio E S; Gimenes, Marcos A; Lopes, Catalina R

    2010-01-01

    Diversity in 26 microsatellite loci from section Caulorrhizae germplasm was evaluated by using 33 accessions of A. pintoi Krapov. & W.C. Gregory and ten accessions of Arachis repens Handro. Twenty loci proved to be polymorphic and a total of 196 alleles were detected with an average of 9.8 alleles per locus. The variability found in those loci was greater than the variability found using morphological characters, seed storage proteins and RAPD markers previously used in this germplasm. The high potential of these markers to detect species-specific alleles and discriminate among accessions was demonstrated. The set of microsatellite primer pairs developed by our group for A. pintoi are useful molecular tools for evaluating Section Caulorrhizae germplasm, as well as that of species belonging to other Arachis sections.

  4. Evaluasi Pertumbuhan dan Perkembangan Arachis Pintoi sebagai Biomulsa pada Budidaya Tanaman di Lahan Kering Tropis

    OpenAIRE

    Sumiahadi, Ade; Chozin, M. Achmad; Guntoro, dan Dwi

    2016-01-01

    ABSTRACTCover crops is widely used as biomulch because of its advantages for land conservation, weed control and increasing soil nutrients, especially in upland agriculture. The objective of the research was to study the growth and development of Arachis pintoi as biomulch in upland agriculture. The experiment was carried out at IPB Experimental Field from February until May 2014. Observation was done everyweek up to 12 weeks with 10 plants were used for each observation. One stolon of A. pin...

  5. Plant Growth Promoting Bacteria Associated with Langsdorffia hypogaea-Rhizosphere-Host Biological Interface: A Neglected Model of Bacterial Prospection

    Science.gov (United States)

    Felestrino, Érica B.; Santiago, Iara F.; Freitas, Luana da Silva; Rosa, Luiz H.; Ribeiro, Sérvio P.; Moreira, Leandro M.

    2017-01-01

    Soil is a habitat where plant roots and microorganisms interact. In the region of the Brazilian Iron Quadrangle (IQ), studies involving the interaction between microbiota and plants have been neglected. Even more neglected are the studies involving the holoparasite plant Langsdorffia hypogaea Mart. (Balanophoraceae). The geomorphological peculiarities of IQ soil, rich in iron ore, as well as the model of interaction between L. hypogaea, its hosts and the soil provide a unique niche that acts as selective pressure to the evolution of plant growth-promoting bacteria (PGPB). The aim of this study was to prospect the bacterial microbiota of holoparasitic plant L. hypogaea, its plant host and corresponding rhizosphere of IQ soil, and to analyze the potential of these isolates as PGPB. We obtained samples of 11 individuals of L. hypogaea containing fragments of host and rhizosphere remnants, resulting in 81 isolates associated with Firmicutes and Proteobacteria phyla. The ability to produce siderophores, hydrocyanic acid (HCN), indole-3-acetic acid (IAA), nitrogen (N2) fixation, hydrolytic enzymes secretion and inhibition of enteropathogens, and phytopathogens were evaluated. Of the total isolates, 62, 86, and 93% produced, respectively, siderophores, IAA, and were able to fix N2. In addition, 27 and 20% of isolates inhibited the growth of enteropathogens and phytopathogens, respectively, and 58% were able to produce at least one hydrolytic activity investigated. The high number of isolates that produce siderophores and indole-3-acetic acid suggests that this microbiota may be important for adaptation of plants to IQ. The results demonstrate for the first time the biological importance of Brazilian IQ species as reservoirs of specific microbiotas that might be used as PGPB on agricultural land or antropized soils that needs to be reforested. PMID:28239369

  6. Review of literature on perennial peanut (Arachis pintoi) as potential cover crop in the tropics

    OpenAIRE

    Kartika, J.G.; Reyes, Manuel R.; Susila, Anas D.

    2007-01-01

    The use of living mulch as a substitute for plastic mulch is increasing in the tropics as researchers have gradually shifted their attention to organic farming systems. Arachis pintoi is a perennial plant and a member of the leguminosae family. A. pintoi has good potential for use as a living mulch in association with vegetables, trees, or grass (as a pasture) because of its ability to fix nitrogen from the atmosphere and to grow in heavy shade. This work, based on fact sheets, journals and t...

  7. Biomassa radicular e reservas orgânicas em coastcross consorciada ou não com Arachis pintoi, com e sem nitrogênio, sob pastejo

    OpenAIRE

    Ribeiro, Ossival Lolato; Cecato, Ulysses; Rodrigues, Augusto Manoel; Faveri, Juliana Cantos; Jobim, Clóves Cabreira; Lugão, Simony Marta Bernardo

    2011-01-01

    p. 318-328 Objetivou-se neste trabalho avaliar a concentração de carboidrato não-estrutural e biomassa radicular em pastagens de grama Coastcross + Arachis pintoi; Coastcross + Arachis pintoi com 100kg/ha de nitrogênio (N); Coastcross + Arachis pintoi com 200kg/ha de N; e Coastcross com 200kg/ha de N, nos períodos de verão, outono e inverno. Utilizou-se delineamento experimental em blocos ao acaso com os tratamentos em esquema de parcelas subdivididas, com dua...

  8. Improving a native pasture with the legume Arachis pintoi in the humid tropics of México

    NARCIS (Netherlands)

    Castillo Gallegos, E.

    2003-01-01

    The objective of this study was to determine the effect of introducing the legume Arachis pintoi CIAT 17434 into a native pasture where native grasses dominated the botanical composition, on establishment, persistence, standing dry matter, botanical composition, soil variables, animal performance,

  9. Estructura poblacional y actividad reproductiva de la rata de campo (Sigmodon hirsutus durante un ciclo de producción de maní (Arachis hypogaea en Costa Rica

    Directory of Open Access Journals (Sweden)

    Javier Monge

    2008-01-01

    Full Text Available Se estudió la estructura poblacional y la actividad reproductiva de la rata de campo (Sigmodon hirsutus, durante 1 ciclo de producción de maní, en Alajuela, Costa Rica. El muestreo consistió en un trampeo mensual de 2 días-noche consecutivos en un área de 0,5 ha, con trampas de golpe, durante agosto de 2006 a enero de 2007. Los especímenes capturados fueron sexados y pesados. Las clases de edad se basaron en el peso del individuo. Se logró la captura de 39 ratas, de las cuales 22 fueron machos, 16 hembras y uno no pudo ser sexado, para una proporción de sexos que no difiere de la relación 1:1. De esta muestra, 10 individuos fueron jóvenes, 12 adultos-jóvenes y 17 adultosviejos. En octubre, diciembre y enero se capturó hembras preñadas, siendo el tamaño promedio de camada de 6,25 embriones. La presencia de individuos jóvenes y hembras preñadas indica que la especie, dentro del período de tiempo que comprendió este estudio, tiene actividad reproductiva de setiembre a enero.

  10. Growth promotion of peanut (Arachis hypogaea L.) and maize (Zea mays L.) plants by single and mixed cultures of efficient phosphate solubilizing bacteria that are tolerant to abiotic stress and pesticides.

    Science.gov (United States)

    Anzuay, María Soledad; Ciancio, María Gabriela Ruiz; Ludueña, Liliana Mercedes; Angelini, Jorge Guillermo; Barros, Germán; Pastor, Nicolás; Taurian, Tania

    2017-06-01

    The aims of this study were, to analyze in vitro phosphate solubilization activity of six native peanut bacteria and to determine the effect of single and mixed inoculation of these bacteria on peanut and maize plants. Ability to produce organic acids and cofactor PQQ, to solubilize FePO 4 and AlPO 4 and phosphatase activity were analyzed. Also, the ability to solubilize phosphate under abiotic stress and in the presence of pesticides of the selected bacteria was determined. The effect of single and mixed bacterial inocula was analyzed on seed germination, maize plant growth and in a crop rotation plant assay with peanut and maize. The six strains produced gluconic acid and five released cofactor PQQ into the medium. All bacteria showed ability to solubilize phosphate from FePO 4 and AlPO 4 and phosphatase activity. The ability of the bacteria to solubilize tricalcium phosphate under abiotic stress and in presence of pesticides indicated encouraging results. Bacterial inoculation on peanut and maize increased seed germination, plant́s growth and P content. Phosphate solubilizing bacteria used in this study showed efficient phosphate mineralizing and solubilization ability and would be potential P-biofertilizers for peanut and maize. Copyright © 2017 Elsevier GmbH. All rights reserved.

  11. Simultaneous analysis of herbicides pendimethalin, oxyfluorfen, imazethapyr and quizalofop-p-ethyl by LC-MS/MS and safety evaluation of their harvest time residues in peanut (Arachis hypogaea L.).

    Science.gov (United States)

    Saha, Ajoy; Shabeer T P, Ahammed; Banerjee, Kaushik; Hingmire, Sandip; Bhaduri, Debarati; Jain, N K; Utture, Sagar

    2015-07-01

    This paper reports a simple and rapid method for simultaneous determination of the residues of selected herbicides viz. pendimethalin, oxyfluorfen, imazethapyr and quizalofop-p-ethyl in peanut by liquid chromatography-tandem mass spectrometry (LC-MS/MS). A modified approach of the QuEChERS methodology was used to extract the herbicides from the peanut kernel without any clean-up. The method showed excellent linearity (r(2) > 0.99) with no significant matrix effect. Accuracy of the method in terms of average recoveries of all the four herbicides ranged between 69.4 -94.4 % at spiking levels of 0.05, 0.10 and 0.25 mg kg(-1) with intra-day and inter-day precision RSD (%) between 2.6-16.6 and 8.0-11.3, respectively. Limit of quantification (LOQs) was 5.0 μg kg(-1) for pendimethalin, imazethapyr and quizalofop-p-ethyl and 10.0 μg kg(-1) for oxyfluorfen. The expanded uncertainties were <11 % for determination of these herbicides in peanut. The proposed method was successfully applied for analysis of these herbicide residues in peanut samples harvested from the experimental field and the residues were below the detection level.

  12. Contribución relativa del nitrógeno del suelo y del fijado biológicamente a la economía de la nutrición nitrogenada de maní (Arachis hypogaea L. en diferentes condiciones de fertilidad Relative contribution of biological fixed nitrogen and soil nitrogen to the nutrition economy of peanut (Arachis hypogaea L. under different conditions of soil fertility

    Directory of Open Access Journals (Sweden)

    S. Castro

    2006-12-01

    Full Text Available La producción de maní en Argentina se concentra en la región central de la provincia de Córdoba, la cual experimentó últimamente una pérdida importante de la productividad de los suelos y una declinación aleatoria del rendimiento de los cultivos. La contribución relativa de la fijación biológica (FBN de nitrógeno al maní en suelos de diferente fertilidad no ha sido suficientemente estudiada. Entonces, se evaluó el efecto de cepas de rizobios (TTOO2R, SEMIA 6144R y TAL 1000R sobre el rendimiento y el balance de nitrógeno de maní cultivado en suelos con alto y bajo contenido del nutriente. No hubo diferencias significativas en los parámetros simbióticos y de rendimiento del cultivo entre las cepas introducidas y las nativas, pero se observó una contribución relativa mayor de la FBN en el suelo con bajo contenido de nitrógeno (~58% de contribución que en el suelo con alto contenido (~27% de contribución. Esta comprobación del aporte relativo de la FBN asociada a la fertilidad del suelo, no registra antecedentes en la región central de Córdoba y debería recibir mayor consideración en el manejo del cultivo particularmente por su localización actual al sur de la provincia, donde los suelos presentan menores niveles de fertilidad. El rendimiento de maní confitería mostró mayores valores, si bien no significativos, con la inoculación en los 3 años del estudio.The peanut production in Argentina is concentrated in the central region of Córdoba province. At present, losses of soil fertility and a random decline peanut yield have been reported for this area. The relative contribution of biological nitrogen fixation (FBN in peanut plants cropped in soils with different fertility, has not been extensively studied. An experiment was carried out to determine the effects of rhizobia strains (TTOO2R, SEMIA 6144R and TAL 1000R on peanut crop yield and plant nitrogen balance under different conditions of soil nitrogen. The results did not show significant differences in the symbiotic parameters and peanut crop yield between native and non-native strains. However, a relative higher contribution of biological nitrogen fixation was observed in low nitrogen (~58% contribution than in high nitrogen soil content (~27% contribution. The relative contribution of FBN associated with soil fertility has not been investigated in the central region of Córdoba and it becomes particularly important in crop management for the current Southern cropping region where soils have lower fertility levels. The peanut crop showed a confectionary higher yield, although no significant, during the three years of experiments.

  13. Contribución relativa del nitrógeno del suelo y del fijado biológicamente a la economía de la nutrición nitrogenada de maní (Arachis hypogaea L.) en diferentes condiciones de fertilidad Relative contribution of biological fixed nitrogen and soil nitrogen to the nutrition economy of peanut (Arachis hypogaea L.) under different conditions of soil fertility

    OpenAIRE

    S. Castro; G. Cerioni; O. Giayetto; A. Fabra

    2006-01-01

    La producción de maní en Argentina se concentra en la región central de la provincia de Córdoba, la cual experimentó últimamente una pérdida importante de la productividad de los suelos y una declinación aleatoria del rendimiento de los cultivos. La contribución relativa de la fijación biológica (FBN) de nitrógeno al maní en suelos de diferente fertilidad no ha sido suficientemente estudiada. Entonces, se evaluó el efecto de cepas de rizobios (TTOO2R, SEMIA 6144R y TAL 1000R) sobre el rendimi...

  14. Under the volcano: phylogeography and evolution of the cave-dwelling Palmorchestia hypogaea (Amphipoda, Crustacea at La Palma (Canary Islands

    Directory of Open Access Journals (Sweden)

    Oromí Pedro

    2008-01-01

    Full Text Available Abstract Background The amphipod crustacean Palmorchestia hypogaea occurs only in La Palma (Canary Islands and is one of the few terrestrial amphipods in the world that have adapted to a strictly troglobitic life in volcanic cave habitats. A surface-dwelling closely related species (Palmorchestia epigaea lives in the humid laurel forest on the same island. Previous studies have suggested that an ancestral littoral Orchestia species colonized the humid forests of La Palma and that subsequent drought episodes in the Canaries reduced the distribution of P. epigaea favouring the colonization of lava tubes through an adaptive shift. This was followed by dispersal via the hypogean crevicular system. Results P. hypogaea and P. epigaea did not form reciprocally monophyletic mitochondrial DNA clades. They showed geographically highly structured and genetically divergent populations with current gene flow limited to geographically close surface locations. Coalescence times using Bayesian estimations assuming a non-correlated relaxed clock with a normal prior distribution of the age of La Palma, together with the lack of association of habitat type with ancestral and recent haplotypes, suggest that their adaptation to cave life is relatively ancient. Conclusion The data gathered here provide evidence for multiple invasions of the volcanic cave systems that have acted as refuges. A re-evaluation of the taxonomic status of the extant species of Palmorchestia is needed, as the division of the two species by habitat and ecology is unnatural. The information obtained here, and that from previous studies on hypogean fauna, shows the importance of factors such as the uncoupling of morphological and genetic evolution, the role of climatic change and regressive evolution as key processes in leading to subterranean biodiversity.

  15. Origin of triploid Arachis pintoi (Leguminosae) by autopolyploidy evidenced by FISH and meiotic behaviour

    Science.gov (United States)

    Lavia, Graciela Inés; Ortiz, Alejandra Marcela; Robledo, Germán; Fernández, Aveliano; Seijo, Guillermo

    2011-01-01

    Background and Aims Polyploidy is a dominant feature of flowering-plant genomes, including those of many important crop species. Arachis is a largely diploid genus with just four polyploid species. Two of them are economically important: the cultivated peanut and A. glabrata, a tropical forage crop. Even though it is usually accepted that polyploids within papilionoid legumes have arisen via hybridization and further chromosome doubling, it has been recently suggested that peanut arose through bilateral sexual polyploidization. In this paper, the polyploid nature of the recent, spontaneously originated triploid cytotype of the tropical lucerne, A. pintoi, was analysed, and thereby the mechanism by which polyploids may arise in the genus. Methods Chromosome morphology of 2x and 3x A. pintoi was determined by the Feulgeńs technique and the rDNA sites were mapped by FISH. To investigate whether polyploidization occurred by means of unreduced gametes, a detailed analysis of the microsporogenesis and pollen grains was made. Key Results The 2x and 3x plants presented 9m + 1sm and a satellited chromosome type 2 in each haploid genome. Physical mapping revealed a cluster of 18S–26S rDNA, proximally located on chromosome 6, and two 5S rDNA loci on chromosomes 3 and 5. Diploid plants presented 10II in meiosis while trivalents were observed in all triploids, with a maximum of 10III by cell. Diploid A. pintoi produced normal tetrads, but also triads, dyads and monads. Two types of pollen grains were detected: (1) normal-sized with a prolate shape and (2) large ones with a tetrahedral morphology. Conclusions Karyotype and meiotic analysis demonstrate that the 3x clone of A. pintoi arose by autopolyploidy. The occurrence of unreduced gametes strongly supports unilateral sexual polyploidization as the most probable mechanism that could have led to the origin of the triploid cytotype. This mechanism of polyploidization would probably be one of the most important mechanisms

  16. Origin of triploid Arachis pintoi (Leguminosae) by autopolyploidy evidenced by FISH and meiotic behaviour.

    Science.gov (United States)

    Lavia, Graciela Inés; Ortiz, Alejandra Marcela; Robledo, Germán; Fernández, Aveliano; Seijo, Guillermo

    2011-07-01

    Polyploidy is a dominant feature of flowering-plant genomes, including those of many important crop species. Arachis is a largely diploid genus with just four polyploid species. Two of them are economically important: the cultivated peanut and A. glabrata, a tropical forage crop. Even though it is usually accepted that polyploids within papilionoid legumes have arisen via hybridization and further chromosome doubling, it has been recently suggested that peanut arose through bilateral sexual polyploidization. In this paper, the polyploid nature of the recent, spontaneously originated triploid cytotype of the tropical lucerne, A. pintoi, was analysed, and thereby the mechanism by which polyploids may arise in the genus. Chromosome morphology of 2x and 3x A. pintoi was determined by the Feulgeńs technique and the rDNA sites were mapped by FISH. To investigate whether polyploidization occurred by means of unreduced gametes, a detailed analysis of the microsporogenesis and pollen grains was made. The 2x and 3x plants presented 9m + 1sm and a satellited chromosome type 2 in each haploid genome. Physical mapping revealed a cluster of 18S-26S rDNA, proximally located on chromosome 6, and two 5S rDNA loci on chromosomes 3 and 5. Diploid plants presented 10II in meiosis while trivalents were observed in all triploids, with a maximum of 10III by cell. Diploid A. pintoi produced normal tetrads, but also triads, dyads and monads. Two types of pollen grains were detected: (1) normal-sized with a prolate shape and (2) large ones with a tetrahedral morphology. Karyotype and meiotic analysis demonstrate that the 3x clone of A. pintoi arose by autopolyploidy. The occurrence of unreduced gametes strongly supports unilateral sexual polyploidization as the most probable mechanism that could have led to the origin of the triploid cytotype. This mechanism of polyploidization would probably be one of the most important mechanisms involved in the origin of economically important species

  17. Produção e qualidade de massa de forragem nos estratos da cultivar coastcross-1 consorciada com Arachis pintoi com e sem adubação nitrogenada = Forage mass production and quality in coastcross-1 pasture layers, mixed with Arachis pintoi with or without nitrogen fertilization

    Directory of Open Access Journals (Sweden)

    2008-04-01

    Full Text Available Neste trabalho, objetivou-se avaliar a massa de forragem nas frações lâminas foliares (LF, bainha + colmo verde (BCV, material morto (MM e seus teores de proteína bruta (PB e fibra em detergente neutro (FDN nos estratos de 0 a 7 cm, 7 a 14 cm e acima de 14 cm de altura da cultivar Coastcross-1 e planta inteira de Arachis pintoi (AP em pastejo, de março de 2003 a março de 2004. Estudaram-se os efeitos dos tratamentos CA0 = Coastcross-1 + Arachis sem N; CA100 = Coastcross-1 + Arachis com 100 kg de N; CA200 = Coastcross-1 + Arachis com 200 kg de N e C200 = Coastcross-1 com 200 kg deN, em um delineamento em blocos ao acaso, com duas repetições. O método de pastejo foi contínuo e a taxa de lotação, variável. As proporções de LF da gramínea Coastcross-1 aumentaram e de BCV, MM e AP diminuíram com o aumento da altura. Não foram observadas diferenças entre os tratamentos. A planta inteira da leguminosa Arachis teve pouca influência na composição da pastagem pela sua baixa disponibilidade. Os maiores (p This trial was carried out to evaluate forage mass in fraction leaf blade (LB, sheath + green stem (SGS, dead material (DE, and crude protein (CP percentage and neutral detergent fiber (NDF in thelayers of 0 to 7 cm, 7 to 14 cm and over 14 cm high. Coastcross-1 grass and the whole plant of Arachis pintoi (WPA were evaluated under grazing, from March 2003 to March 2004. The treatments evaluated were CA0 = Coastcross-1 + Arachis without N; CA100= Coastcross-1 + Arachis with 100 kg of N; CA200 = Coastcross-1 + Arachis with 200 kg of N; and C200 = Coastcross-1 with 200 kg of N, in a random block design, with two repetitions. The proportion of LB and SGS increased, while DE and WPA decreased with the increase of clipping height. No difference was observed among treatments. Arachis had little influence on pasture composition because of its low availability. The highest values (p < 0.05 for CP and the lowest values for NDF were observed in

  18. Wild peanut Arachis duranensis are nodulated by diverse and novel Bradyrhizobium species in acid soils.

    Science.gov (United States)

    Chen, Jing Yu; Gu, Jun; Wang, En Tao; Ma, Xing Xian; Kang, Shi Tong; Huang, Ling Zi; Cao, Xue Ping; Li, Liang Bing; Wu, Yan Ling

    2014-10-01

    Aiming at learning the microsymbionts of Arachis duranensis, a diploid ancestor of cultivated peanut, genetic and symbiotic characterization of 32 isolates from root nodules of this plant grown in its new habitat Guangzhou was performed. Based upon the phylogeny of 16S rRNA, atpD and recA genes, diverse bacteria belonging to Bradyrhizobium yuanmingense, Bradyrhizobium elkanii, Bradyrhizobium iriomotense and four new lineages of Bradyrhizobium (19 isolates), Rhizobium/Agrobacterium (9 isolates), Herbaspirillum (2 isolates) and Burkholderia (2 isolates) were defined. In the nodulation test on peanut, only the bradyrhizobial strains were able to induce effective nodules. Phylogeny of nodC divided the Bradyrhizobium isolates into four lineages corresponding to the grouping results in phylogenetic analysis of housekeeping genes, suggesting that this symbiosis gene was mainly maintained by vertical gene transfer. These results demonstrate that A. duranensis is a promiscuous host preferred the Bradyrhizobium species with different symbiotic gene background as microsymbionts, and that it might have selected some native rhizobia, especially the novel lineages Bradyrhizobium sp. I and sp. II, in its new habitat Guangzhou. These findings formed a basis for further study on adaptation and evolution of symbiosis between the introduced legumes and the indigenous rhizobia. Copyright © 2014 Elsevier GmbH. All rights reserved.

  19. (Glossoscolecidae y Acanthodrilidae y leguminosas (Arachis pintoi en un suelo de traspatio

    Directory of Open Access Journals (Sweden)

    Esperanza Huerta

    2007-01-01

    Full Text Available En el sureste de la República Mexicana, en el trópico húmedo, se llevó a cabo un estudio en un cultivo de traspatio (huerto familiar con el fin de aumentar la fertilidad del suelo mediante la reproducción e inoculación de individuos de las especies Glossoscolecidae sp y Dichogaster saliens (oligochaeta las cuales tuvieron la mayor tasa de crecimiento diario (3 mg día-1 en sustratos con 1.5 % Mucuna pruriens var. utilis (leguminosa. Cuatro tratamientos con seis repeticiones de 3 x 2 m cada una fueron instalados en el huerto familiar. El contenido de materia orgánica (5.45 ± 1.6%, nitrógeno total (0.27 ± 0.05%, fósforo disponible (40.6 ± 22.5 mg kg-1 y potasio (1.05 ± 0.88 mg kg-1 fueron significativamente superiores (p < 0.05 en aquellas unidades experimentales con lombrices (27 gm-2 en conjunto con Arachis pintoi.

  20. Cryopreservation of in vitro grown shoot tips and apical meristems of the forage legume Arachis pintoi.

    Science.gov (United States)

    Rey, Hebe Y; Faloci, Mirta; Medina, Ricardo; Dolce, Natalia; Mroginski, Luis; Engelmann, Florent

    2009-01-01

    A cryopreservation protocol using the encapsulation-dehydration procedure was established for shoot tips (2-3 mm in length) and meristems (0.3-0.5 mm) sampled from in vitro plantlets of diploid and triploid cytotypes of Arachis pintoi. The optimal protocol was the following: after dissection, explants were precultured for 24 h on establishment medium (EM), encapsulated in calcium alginate beads and pretreated in liquid EM medium with daily increasing sucrose concentration (0.5, 0.75, 1.0 M) and desiccated to 22-23 percent moisture content (fresh weight basis). Explants were frozen using slow cooling (1 C per min from 25C to -30C followed by direct immersion in liquid nitrogen), thawed rapidly and post-cultured in liquid EM medium enriched with daily decreasing sucrose concentrations (0.75, 0.50, 0.1 M). Explants were then transferred to solid EM medium in order to achieve shoot regeneration, then on Murashige and Skoog medium supplemented with 0.05 microM naphthalene acetic acid to induce rooting of shoots. With this procedure, 53 percent and 56 percent of cryopreserved shoot tips of the diploid and triploid cytotypes, respectively, survived and formed plants. However, only 16 percent of cryopreserved meristems of both cytotypes regenerated plants. Using ten isozyme systems and seven RAPD profiles, no modification induced by cryopreservation could be detected in plantlets regenerated from cryopreserved material.

  1. Fibre degradability of oil palm frond pellet, supplemented with Arachis pintoi in cattle

    Directory of Open Access Journals (Sweden)

    Bodee Khamseekhiew

    2002-04-01

    Full Text Available An experiment was conducted to evaluate the effect of different levels of Arachis pintoi (AP supplementation on rumen environment [(rumen pH, ruminal ammonia nitrogen (NH3N and volatile fatty acids (VFAs concentration] and degradability of oil palm frond (OPF. Three Kedah-Kelantan (KK cattle of about 2 1/2 years of age with an average body weight (BW173±17.2 kg, each fitted with a ruminal cannula, were used. The cattle were kept in individual pens and fed the treatment diets at 1.5% of BW. The diets comprised the following four OPF:AP ratios; 80:20 (L20, 70:30 (L30, 60:40 (L40, 50:50 (L50 in a 4 × 4 incomplete Latin Square Design. The DM an NDF degradation rates of OPF were significantly affected by AP supplementation. Ruminal pH was not significantly different (p>0.05 among the four different diets. The concentration of NH3N was significantly (p<0.05 higher in cattle fed L50 than those in L40, L30 and L20. Similarly, increasing levels of AP supplementation significantly increased the total VFAs concentration from 59.9 mmol/L for L20 to 69.2 mmol/L for L50. It is suggested that AP can be used as a protein supplement to improve fibre degradability of OPF in cattle.

  2. Chlorophyll and carbohydrates in Arachis pintoi plants under influence of water regimes and nitrogen fertilization

    Directory of Open Access Journals (Sweden)

    Rita Manuele Porto Sales

    2013-06-01

    Full Text Available In this experiment the chlorophyll and carbohydrate contents of Arachis pintoi were evaluated to verify if the presence of nitrogen in the soil could contribute to the effectiveness of the establishment of this legume. The design was completely randomized, in a 4 × 4 factorial arrangement, with four N rates (0, 40, 80 and 120 kg ha-1 and four irrigation levels (25, 50, 75 and 100% of field capacity, with four replications. The biochemical evaluations of chlorophylls a and b and total chlorophyll and total soluble sugars, sucrose and starch were performed. The highest contents of chlorophyll a and b and total chlorophyll in leaves were found at the dose of 120 kg ha-1. The water regime of 25% of field capacity was responsible for the lowest content of reducing sugars and total soluble sugars in leaves, stolons and roots. In the roots, the sucrose contents were higher in these conditions, which can be associated with a slight tolerance of the plant to water stress. The water deficiency was responsible for the decrease of reducing sugars and total N in the whole plant and positively influenced the levels of chlorophyll and sugars in the stolon, promoting growth, especially of shoots, at the beginning of establishment.

  3. Steers performance in dwarf elephant grass pastures alone or mixed with Arachis pintoi.

    Science.gov (United States)

    Crestani, Steben; Ribeiro Filho, Henrique Mendonça Nunes; Miguel, Marcolino Frederico; de Almeida, Edison Xavier; Santos, Flávio Augusto Portela

    2013-08-01

    The inclusion of legumes in pasture reduces the need for mineral nitrogen applications and the pollution of groundwater; however, the agronomic and animal husbandry advantages with tropical legumes are still little known. The objective of this study was to quantify the effect of the use of forage peanut (Arachis pintoi cv. Amarillo) in dwarf elephant grass pastures (Pennisetum purpureum cv. BRS Kurumi) on forage intake and animal performance. The experimental treatments were dwarf elephant grass fertilized with 200 kg N/ha, and dwarf elephant grass mixed with forage peanut without mineral fertilizers. The animals used for the experiment were 12 Charolais steers (body weight (BW) = 288 ± 5.2 kg) divided into four lots (two per treatment). Pastures were managed under intermittent stocking with an herbage allowance of 5.4 kg dry matter of green leaves/100 kg BW. Dry matter intake (mean = 2.44% BW), the average daily gain (mean = 0.76 kg), and the stocking rate (mean = 3.8 AU/ha) were similar between the studied pastures, but decreased drastically in last grazing cycle with the same herbage allowance. The presence of peanut in dwarf elephant grass pastures was enough to sustain the stocking rate, but did not allow increasing forage intake and animal performance.

  4. Characterization of rhizobia that nodulate Arachis pintoi by RAPD analysis Caracterização de rizóbios capazes de nodular Arachis pintoi via análise de "RAPD"

    Directory of Open Access Journals (Sweden)

    Patrícia Pereira Pinto

    2004-09-01

    Full Text Available The genetic relationships of 85 Arachis pintoi nodulating Rhizobium strains were determined using the random amplified polymorphic DNA (RAPD methods. The analysis included 75 strains isolated from Cerrado soils and 10 other ones of different origins. The results indicated that there is a high level of similarity between these strains and that geographic distribution may affect their phylogenetic relationship. In addition, the results allowed the selection of the most suitable primers for characterisation of these Rhizobium strains which will be useful for implementation of competitiveness studies in Cerrado soils.As relações genéticas de 85 estirpes de Rhizobium capazes de nodular Arachis pintoi foram determinadas usando o método de "RAPD" (Random Amplified Polymorphic DNA. As análises incluíram 75 estirpes isoladas de solos de Cerrado e 10 de diferentes origens. Os resultados indicaram que existe um alto grau de similaridade entre estas estirpes e que a distribuição geográfica pode afetar suas relações filogenéticas. Além disso, os resultados permitiram a seleção de "primers" mais adequados para a caracterização dessas estirpes de Rhizobium, os quais serão úteis para a implementação de estudos de competitividade nos solos de Cerrado.

  5. Composição botânica e química da Coastcross consorciada ou não com Arachis pintoi, com e sem nitrogênio

    OpenAIRE

    Ribeiro, Ossival Lolato; Cecato, Ulysses; Rodrigues, Augusto Manoel; Faveri, Juliana Cantos; Santos, Geraldo Tadeu dos; Lugão, Simony Marta Bernardo; Beloni, Tatiane

    2012-01-01

    O objetivo com este trabalho foi avaliar a composição botânica e química do pasto de Coastcross + Arachis pintoi; Coastcross + Arachis pintoi com 100kg/ha de nitrogênio (N); Coastcross + Arachis pintoi com 200 kg/ha de N; e Coastcross com 200kg/ha de N, nos períodos de inverno, primavera, verão e outono. Utilizouse delineamento experimental em blocos ao acaso com os tratamentos em esquema de parcelas subdivididas, com duas repetições (blocos). Avaliouse as percentagens de lâmina foliar verde,...

  6. Avaliação do feno de Arachis pintoi utilizando o ensaio de digestibilidade in vivo

    Directory of Open Access Journals (Sweden)

    Ladeira Márcio Machado

    2002-01-01

    Full Text Available Utilizaram-se seis ovinos, sem raça definida, para avaliar o consumo e as digestibilidades aparentes totais da matéria seca (MS, matéria orgânica (MO, proteína bruta (PB, extrato etéreo (EE, carboidratos totais (CHO, fibra em detergente neutro (FDN, carboidratos não fibrosos (CNF, fibra em detergente ácido (FDA, celulose (CEL, hemicelulose (HCEL e energia do feno de Arachis pintoi. Também foi determinado o balanço de nitrogênio. Os animais foram colocados em gaiolas metabólicas e receberam apenas o feno de A. pintoi mais sal mineral como componentes da dieta. O Arachis pintoi foi colhido com aproximadamente 100 dias. O fornecimento do feno foi ad libitum, sendo a quantidade calculada para permitir sobras de 20%. O experimento teve 20 dias de duração, sendo 15 dias de adaptação e cinco dias para coletas de amostras do feno, sobras, fezes e urina. Foi utilizado o óxido crômico, em duas doses diárias de 1 g cada, como indicador externo para estimar a produção fecal. Os consumos de MS e MO do A. pintoi foram 90,17 e 85,67 g/kg0,75, respectivamente. Os teores de PB, nutrientes digestíveis totais (NDT e energia metabolizável (EM foram, respectivamente, 14,3%, 66,4% e 2,0 Mcal/kg MS. O balanço de nitrogênio (N foi de 12,1 g/dia e representou 40,2% de todo N consumido. As digestibilidades aparentes totais da MS, MO, PB, EE, CHO, FDN, CNF, FDA, CEL, HCEL e energia foram 64,4, 68,4, 70,0, 63,4, 68,2, 53,6, 93,3, 47,2, 62,8, 66,8 e 63,7%, respectivamente. O feno de Arachis pintoi apresentou consumo e digestibilidades dos nutrientes elevados para uma forrageira, permitindo assim fornecer nutrientes em quantidades suficientes para ganhos de peso satisfatórios, o que dá maior suporte para o uso dessa leguminosa na alimentação de ruminantes.

  7. Adaptação, produtividade e persistência de Arachis pintoi submetido a diferentes níveis de sombreamento Adaptation, productivity and persistence of Arachis pintoi under different levels of shading

    Directory of Open Access Journals (Sweden)

    Carlos Maurício Soares de Andrade

    1999-01-01

    Full Text Available Este experimento foi realizado com o objetivo de determinar o potencial forrageiro da leguminosa Arachis pintoi, submetida a 0, 30, 50 e 70% de sombreamento, em sistemas silvipastoris e como cobertura do solo em sistemas agroflorestais. O delineamento experimental usado foi o inteiramente casualizado, com quatro repetições. Realizou-se uma avaliação no final do período chuvoso e outra no final do período seco, usando as características altura e vigor de plantas, cobertura do solo e biomassa aérea, subterrânea e total. Os resultados mostraram que A. pintoi apresentou boa adaptação e persistência nos níveis de sombreamento estudados. A produtividade, apesar de ter diminuído com o aumento dos níveis de sombreamento, foi considerada adequada mesmo nos níveis mais altos. Concluiu-se que é possível usar esta leguminosa como cobertura do solo em sistemas agroflorestais e como forrageira em sistemas silvipastoris.The experiment was conducted to determine the forage potential of the Arachis pintoi submitted to 0, 30, 50 and 70% of shading, in silvopastoral systems and as ground cover in agroforestry systems. The experimental design was a completely randomized design with four replications. An evaluation was carried at the end of the rainy season and another at the end of the dry season, using the caracteristics height and plant vigor, ground cover, and total, above and below ground biomass. The results showed that A. pintoi presented good adaptation and persistence in the studied levels of shading. Although its productivity decreased with the increase of the levels of shading, it was considered adequate, even in the highest levels of shading. This indicates that it is possible to use this legume as ground cover in agroforestry systems and as forage in silvopastoral systems.

  8. Fatty acid, sterol and proximate compositions of peanut species (Arachis L. seeds from Bolivia and Argentina

    Directory of Open Access Journals (Sweden)

    Grosso, Nelson R.

    1997-08-01

    Full Text Available The oil, protein, ash and carbohydrates contents, iodine value, fatty acid and sterol compositions were studied in seeds of Arachis correntina, A. durannensis, A. monticola, A. batizocoi, and A. cardenasii originating from Bolivia and Argentina. Oil content was greatest in A. batizocoi (mean value 53,35%. The protein level was higher in A. monticola (mean value 29,40% and A. durannensis (29,13%. Mean value of oleic acid varied between 34,91% (A. durannensis and A. cardenasii and 42,60% (Arachis correntina, and linoleic acid oscilated between 40,23% (A. correntina and 45,86% (A. durannensis. The better oleic to linoleic ratio was exhibited by A. correntina (1,06. Iodine value was lower in A. batizocoi (106,0. The sterol composition in the different peanut species showed higher concentration of β-sitosterol (mean values oscilated between 55,70-58,70% following by campesterol (15,18-16,47%, stigmasterol (10,67- 12,27% and Δ5-avenasterol (10,80-12,13%.

    Los contenidos en aceite, proteína, ceniza e hidratos de carbono, índice de acidez, composiciones en ácidos grasos y esteroles fueron estudiadas en semillas de Arachis correntina, A. durannensis, A. Monticola, A. batizocoi, y A. cardenasii originaria de Bolivia y Argentina. El contenido en aceite fue mayor en A. batizocoi (valor medio 53,35%. El nivel de proteína fue más alto en A. monticoia (valor medio 29,40% y A. durannensis (29,13%. El valor medio del ácido oleico varió entre 34,91% (A. Durannensis y A. cardenasii y 42,60% (Arachis correntina, y el ácido linoleico osciló entre 40,23% (A. correntina y 45,86% (A.durannensis. La mejor relación oleico a linoleico fue exhibida por A. correntina (1.06. El índice de iodo fue más bajo en A. batizocoi (106,0. La composición esterólica en las diferentes especies de

  9. In vitro multiplication of the rare and endangered slipper orchid ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... 2Biodiversity Unit, Institute of Bioscience, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia ... Thus, an in vitro tissue culture technique was explored in order to ..... peanut (Arachis hypogaea L.) Indian J. Crop Sci.

  10. assessment of adoption gaps in the management of aflatoxin ...

    African Journals Online (AJOL)

    p2333147

    Correspondence author: Dr. G.D. Satish Kumar1, National Research Centre for Groundnut, P.B.05, ... Groundnut (Arachis hypogaea L.) is an important oil seed crop of India. ..... Table 4: Stepwise regression analysis between adoption gap and.

  11. Protocol optimization for deoxyribonucleic acid (DNA) extraction ...

    African Journals Online (AJOL)

    Arachis hypogaea L.) is particularly problematic due to the presence of phenolic compounds and polysaccharides. Inconsistencies in extraction results can be attributed to the age and growth stages of the plant material analyzed. Mature leaves ...

  12. aqueous plant extracts for control of groundnut leaf spot in burkina

    African Journals Online (AJOL)

    ACSS

    2017-08-08

    Aug 8, 2017 ... Early and late leaf spots, the two fungal diseases of groundnut (Arachis hypogaea L.) caused by Cercospora arachidicola Hori. and .... effect of extracts of Azacdiractha indica on ... fruits of the other plants species were dried in.

  13. Effet du Mg et des oligo-éléments sur le comportement de cinq variétés d'arachides (Arachis hypogeae L.

    Directory of Open Access Journals (Sweden)

    Lumpungu, K.

    1987-01-01

    Full Text Available Effect of magnesium and trace elements on the development of five groundnut varieties (Arachis hypogeae L.. A study of Mg and certain minor elements (B, Cu, Fe, Mn, Mo and Zn given by seed imbibition has been conducted. The results have shown that the effect of Mg and minor elements on the growth, yield (pods and seeds and lipids content of the seeds depend on the variety and rate of Mg and minor elements application.

  14. Produção de novilhas de corte em pastagem de Coastcross-1 consorciada com Arachis pintoi com e sem adubação nitrogenada Beef heifer production in Coastcross-1 and Arachis pintoi mixed pasture with or without nitrogen fertilization

    Directory of Open Access Journals (Sweden)

    Wagner Paris

    2009-01-01

    Full Text Available Este trabalho foi realizado com o objetivo de avaliar a massa de forragem (MF, a taxa de acúmulo diário (TAD, a oferta de forragem (OF, a taxa de lotação (TL, a porcentagem de Arachis pintoi (PAR, o ganho médio diário (GMD e o ganho por hectare (GPV/ha de novilhas de corte em pastejo de Coastcross-1 consorciada com Arachis pintoi. Os consórcios avaliados foram: CA0 = coastcross + Arachis pintoi sem adubação nitrogenada; CA100 = coastcross + Arachis pintoi com 100 kg de nitrogênio; CA200 = coastcross + Arachis pintoi com 200 kg de nitrogênio; e C200 = coastcross com 200 kg de nitrogênio, distribuídos em delineamento de blocos ao acaso, com duas repetições. O manejo do pasto foi o de lotação continua com carga animal variável utilizando-se novilhas mestiças com três animais-testes por consórcio. A massa de forragem nas pastagens de coastcross + Arachis pintoi adubadas com 0, 100 e 200 kg de nitrogênio e na pastagem de coastcross adubada com 200 kg de nitrogênio foi de 2.641, 2.431, 2.760 e 2.704 kg de MS/ha, respectivamente. A taxa de acúmulo diário foi semelhante (66,12 kg de MS/ha entre as pastagens; o verão foi a estação de maior produção, seguido da primavera, do outono, que não diferiram entre si, e do inverno (108,6; 71,1; 54,2; 30,6 kg de MS/ha, respectivamente. Na associação de coastcross + Arachis pintoi sem adubação nitrogenada, foram obtidas a maior oferta de forragem e a menor taxa de lotação (4,0 UA/ha. As maiores taxas de lotação e as menores ofertas de forragem foram observadas com a adubação nitrogenada. A porcentagem de Arachis pintoi foi maior na primavera e, na associação coastcross + Arachis pintoi sem adubação, as estimativas visuais foram sempre superiores às medidas, em virtude do baixo teor de matéria seca dessa leguminosa. O ganho médio diário foi maior no cultivo em consórcio e adubação com 200 kg de nitrogênio e na pastagem de coastcross em cultivo exclusivo com 200 kg

  15. Perennial peanut (Arachis glabrata Benth.) contains polyphenol oxidase (PPO) and PPO substrates that can reduce post-harvest proteolysis.

    Science.gov (United States)

    Sullivan, Michael L; Foster, Jamie L

    2013-08-15

    Studies of perennial peanut (Arachis glabrata Benth.) suggest its hay and haylage have greater levels of rumen undegraded protein (RUP) than other legume forages such as alfalfa (Medicago sativa L.). Greater RUP can result in more efficient nitrogen utilization by ruminant animals with positive economic and environmental effects. We sought to determine whether, like red clover (Trifolium pretense L.), perennial peanut contains polyphenol oxidase (PPO) and PPO substrates that might be responsible for increased RUP. Perennial peanut extracts contain immunologically detectible PPO protein and high levels of PPO activity (>100 nkatal mg(-1) protein). Addition of caffeic acid (PPO substrate) to perennial peanut extracts depleted of endogenous substrates reduced proteolysis by 90%. Addition of phenolics prepared from perennial peanut leaves to extracts of either transgenic PPO-expressing or control (non-expressing) alfalfa showed peanut phenolics could reduce proteolysis >70% in a PPO-dependent manner. Two abundant likely PPO substrates are present in perennial peanut leaves including caftaric acid. Perennial peanut contains PPO and PPO substrates that together are capable of inhibiting post-harvest proteolysis, suggesting a possible mechanism for increased RUP in this forage. Research related to optimizing the PPO system in other forage crops will likely be applicable to perennial peanut. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  16. Current situation and perspective of the multi-use of Arachis pintoi in agro-ecosystems devoted to animal production

    Directory of Open Access Journals (Sweden)

    Verónica Andrade Yucailla

    2016-07-01

    Full Text Available This paper realized an analysis of the scientific literature in which 75 articles were reviewed from indexed Journals in specialized databases and of international recognition about the main aspects reviewed such as the origin, adaptation conditions in areas of the humid tropic, genetic aspects related to the chromosomal markers; demonstrating a big morphologic variability in the germplasms. Inside of the potential uses of major relevancy there was stand out the use as soil coverage and as soil improver, as well as weeds controller, presenting a positive effect in the content of organic matter and nitrogen of soil. The use of Arachis pintoi Frapovickas y Gregory in the animal feeding systems is a resource of high quality; it can be a viable alternative for the animal production systems in the tropic. The impact of some agroecological practices on the agroproductive parameters with the use of A. pintoi is of the important relevancy. It was concludes that A. pintoi presents a potential of multiple use in integrated systems of crops - trees – livestock, constituting an alternative of sustainable management of the tropical animal production.

  17. Produção de forragem e desempenho animal em pastagens de coastcross consorciada ou não com Arachis pintoi, com e sem nitrogênio = Forage Production and Performance Animal in Coastcross Intercropping or not with Arachis pintoi, with or without Nitrogen

    Directory of Open Access Journals (Sweden)

    Ossival Lolato Ribeiro

    2008-10-01

    Full Text Available O estudo objetivou avaliar a produção de forragem e desempenho animal em pastagens de Coastcross + Arachis pintoi; Coastcross + Arachis pintoi com 100 kg ha-1 de N; Coastcross + Arachis pintoi com 200 kg ha-1 de N e Coastcross com 200 kg ha-1 de N, nas estações de inverno, primavera, verão e outono. Utilizou-se o delineamento experimentalem blocos ao acaso, com os tratamentos em parcelas subdivididas, com duas repetições. Foram avaliados: acúmulo de massa de forragem e acúmulo diário de massa de forragem, ganho médio diário (GMD, ganho de peso vivo por área e taxa de lotação. A utilização de Coastcross + 200 kg ha-1 de N e as melhores condições climáticas na primavera e verão favoreceram tanto o acúmulo de massa de forragem (26.764 kg ha-1 de MS quanto o acúmulo diário de massa de forragem (82 kg ha-1 por dia de MS. A utilização da associação entre Arachis pintoi + 200 kg ha-1 de N e Coastcross + 200 kg ha-1 de N, possibilitou o melhor desempenho animal, com GMD de 0,570 e 0,500 kg e taxa de lotação de 3,51 e 3,26 UA ha-1, respectivamente. A utilização de pastagem consorciada sem a associação com doses de nitrogênio (100 e 200 kg ha-1 não favoreceu (p > 0,05 o acúmulo de massa de forrageme a taxa de acúmulo diária. A utilização de 200 kg ha-1 de N, com e sem a leguminosa, proporcionou o melhor desempenho e lotação animal por área.The objective of this study was to evaluate dry matter production and animal performance in pastures of Coastcross + Arachis pintoi; Coastcross + Arachis pintoi with 100 kg ha-1 of N; Coastcross +Arachis pintoi with 200 kg ha-1 of N and Coastcross with 200 kg ha-1 of N, during winter, spring, summer and autumn. The experimental design was complete randomized blocks with split-plot parcels, with two repetitions. The study evaluated the accumulation of foragemass and dairy accumulation of forage mass, average daily gain (ADG, live weight gain and stocking rate. The used of

  18. Arachis pintoi COMO COBERTURA DE SUELO EN CULTIVOS DE PLÁTANO MACHO (Musa AAB) EN CÁRDENAS, TABASCO, MÉXICO

    OpenAIRE

    Eder Ramos Hernández; Ángel Sol Sánchez; Armando Guerrero Peña; José J. Obrador Olán

    2011-01-01

    El experimento se realizó en Cárdenas, Tabasco enuna plantación de plátano macho, en un suelo con texturafranca, pH moderadamente ácido, contenido de materiaorgánica y nitrógeno total bajo; con la finalidad de evaluar larepuesta al establecimiento de Arachis pintoi Krap. y Greg.como una cobertura viva. El diseño experimental fue bloquescompletos al azar con tres replicas. Se evaluaron tresporcentajes de sombra producida por el cultivo de plátanomacho (21, 45 y 50 %). El establecimiento de A. ...

  19. Influência do Fósforo, Micorriza e Nitrogênio no Conteúdo de Minerais de Brachiaria brizantha e Arachis pintoi Consorciados Effect of Phosphorus, Mycorrhizal and Nitrogen on Mineral Content of Brachiaria brizantha - Arachis pintoi Mixture

    Directory of Open Access Journals (Sweden)

    Ívina Paula Almeida dos Santos

    2002-01-01

    Full Text Available O experimento foi conduzido em casa de vegetação com o objetivo de avaliar a influência do fósforo (P, fungos micorrízicos arbusculares (FMA's e nitrogênio (N no acúmulo de minerais na MS da parte aérea de braquiária MG-4 (Brachiaria brizantha cv. MG-4 e amendoim forrageiro (Arachis pintoi cv. Amarillo consorciados, em solo de baixa fertilidade. O delineamento utilizado foi o inteiramente casualizado, num esquema fatorial 5x2x2, sendo cinco doses de P (25, 50, 75, 100 e 200 mg de P/kg de solo, dois tratamentos de inoculação do solo (inoculado e não com o FMA Glomus etunicatum e dois tratamentos de N (com e sem N em cobertura, com quatro repetições. Foi realizado o corte da parte aérea das plantas aos 60 dias após a germinação para a determinação das quantidades acumuladas de N, P, K, Ca, Mg e S na MS da parte aérea. As adubações fosfatada e, principalmente, a nitrogenada provocaram aumento no conteúdo de N, P, K, Ca, Mg e S na braquiária MG-4, não se verificando tal aumento com a micorrização. No amendoim forrageiro, observou-se redução destes minerais com a aplicação de N, ao passo que a micorrização resultou em aumento dos mesmos. Por outro lado, a adubação fosfatada provocou pequeno aumento no acúmulo de minerais na MS da parte aérea do amendoim forrageiro.This experiment was carried out in a greenhouse condition to study the effect of phosphorus, arbuscular mycorrhizal fungi and nitrogen on mineral accumulation in braquiaria MG-4 (Brachiaria brizantha cv. MG-4 above ground forage DM and peanut (Arachis pintoi cv. Amarillo mixture, in soil of low fertility. The experimental design was a completely randomized in a 5x2x2 factorial arrangement, with five P rates (25, 50, 75, 100 and 200 mg/kg of soil, two inoculations (inoculated and no inoculated and two levels of N (with and without N, with four replicates. The harvest of the above ground parts of plants was at 60 days after seed germination to determine

  20. Evaluation of agronomic practices for the establishment of Pinto peanut (Arachis pintoi in native pastures of Mexico

    Directory of Open Access Journals (Sweden)

    E. Castillo-Gallegos

    2009-01-01

    Full Text Available Se realizaron tres experimentos en un clima cálido y húmedo para evaluar el establecimiento de Arachis pintoi CIAT 17434: 1 cero labranza y labranza reducida, con fertilización (P, K, Mg, Ca, Zn, Cu y B o sin fertilización; 2 control de la vegetación nativa con herbicida o chapeo, con quema o sin ella; y, con o sin fertilizante fosforado; y 3, siembra, por semilla, de tres accesiones CIAT de Arachis pintoi: 17434, 18744 y 18748, usando semilla en vainas. Los suelos de los sitios experimentales fueron Ultisoles, ácidos (Durustults, con un rango de pH de 4.1 a 5.2, y una capa impermeable situada entre 0 y 25 cm de profundidad. Se evaluó: número y altura de plantas, y suelo cubierto por la leguminosa, a 4, 8 y 12 semanas después de la siembra. En el experimento 1, se muestrearon cuadrantes dentro de cada parcela de tratamiento. En los experimentos 2 y 3 se empleó un diseño de bloques completos al azar con 3 bloques como repeticiones. Se realizaron análisis de varianza de acuerdo con el diseño experimental utilizado. En el experimento 1, el efecto principal de tratamientos sobre el número de plantas fue altamente significativo en las épocas de invierno, verano y sequía. El tiempo requerido para alcanzar un 50% de cobertura fue de 21 semanas para T2 (labranza mínima, sin fertilización en invierno; 21 semanas para T4 (cero labranza, sin fertilización en sequía; y 20 semanas para T1 (labranza mínima, con fertilización y T4 en el verano. En el experimento 2, el efecto principal del tiempo después de la siembra fue altamente significativo para todas las variables de respuesta. El tratamiento herbicida+quema produjo plantas con los tallos más altos (21.0±1.6 cm que el tratamiento de herbicida-sin quema (14.5±1.1 cm. La fertilización con P no incrementó la cobertura de la leguminosa. El tratamiento chapeo sin quema y sin fertilización resultó en una menor cobertura que el tratamiento herbicida+quema+fertilización. En el

  1. Determination of coefficient defining leaf area development in different genotypes, plant types and planting densities in peanut (Arachis hypogeae L.).

    Science.gov (United States)

    Halilou, Oumarou; Hissene, Halime Mahamat; Clavijo Michelangeli, José A; Hamidou, Falalou; Sinclair, Thomas R; Soltani, Afshin; Mahamane, Saadou; Vadez, Vincent

    2016-12-01

    Rapid leaf area development may be attractive under a number of cropping conditions to enhance the vigor of crop establishment and allow rapid canopy closure for maximizing light interception and shading of weed competitors. This study was undertaken to determine (1) if parameters describing leaf area development varied among ten peanut ( Arachis hypogeae L.) genotypes grown in field and pot experiments, (2) if these parameters were affected by the planting density, and (3) if these parameters varied between Spanish and Virginia genotypes. Leaf area development was described by two steps: prediction of main stem number of nodes based on phyllochron development and plant leaf area dependent based on main stem node number. There was no genetic variation in the phyllochron measured in the field. However, the phyllochron was much longer for plants grown in pots as compared to the field-grown plants. These results indicated a negative aspect of growing peanut plants in the pots used in this experiment. In contrast to phyllochron, there was no difference in the relationship between plant leaf area and main stem node number between the pot and field experiments. However, there was genetic variation in both the pot and field experiments in the exponential coefficient (PLAPOW) of the power function used to describe leaf area development from node number. This genetic variation was confirmed in another experiment with a larger number of genotypes, although possible G × E interaction for the PLAPOW was found. Sowing density did not affect the power function relating leaf area to main stem node number. There was also no difference in the power function coefficient between Spanish and Virginia genotypes. SSM (Simple Simulation model) reliably predicted leaf canopy development in groundnut. Indeed the leaf area showed a close agreement between predicted and observed values up to 60000 cm 2  m -2 . The slightly higher prediction in India and slightly lower prediction in

  2. Intensity of Ground Cover Crop Arachis pintoi, Rhizobium Inoculation and Phosphorus Application and Their Effects on Field Growth and Nutrient Status of Cocoa Plants

    Directory of Open Access Journals (Sweden)

    John Bako Baon

    2006-08-01

    Full Text Available Arachis pintoiis potentially as a cover crop for cocoa (Theobroma cacaoL. farm, however information regarding its effect on the growth of cocoa plants in the field is very limited. The objective of this experiment is to investigate the combined influence of ground cover crop A. pintoi, rhizobial bacterial inoculation and phosphorus (P fertilizer on the growth of cocoa in the field and nutrient status. This experiment laid out in split-split plot design consisted of three levels of cover crop (without, A. pintoiand Calopogonium caeruleum, two levels of rhizobium inoculation (not inoculated and inoculated and two levels of phosphorus application (no P added and P added. The results showed that in field condition the presence of A. pintoias cover crop did not affect the growth of cocoa. On the other hand, C. caeruleumas cover crop tended to restrict cocoa growth compared to A. pintoi. Application of P increased leaf number of cocoa plant. Biomass production of A. pintoiwas 40% higher than C. caeruleum. Soil organic carbon and nitrogen contents were not affected by ground cover crops, though higher value (0.235% N and 1.63% organic C was obtained from combined treatments of inoculation and P addition or neither inoculation nor P addition. In the case of no rhizobium inoculation, soil N content in cocoa farm with A. pintoicover crop was lower than that of without cover crop or with C. caeruleum. Cover crop increased plant N content when there was no inoculation, on the other hand rhizobium inoculation decreased N content of cocoa tissue. Tissue P content of cocoa plant was not influenced by A. Pintoicover crop or by rhizobium inoculation, except that the P tissue content of cocoa was 28% higher when the cover crop was C. caeruleumand inoculated. Key words : Arachis pintoi, Theobroma cacao, Calopogonium caeruleum, rhizobium, nitrogen, phosphorus.

  3. Decomposition of Arachis pintoi and Hyparrhenia rufa litters in monoculture and intercropped systems under lowland soil Decomposição da serrapilheira de Arachis pintoi e Hyparrhenia rufa em sistemas de monocultura e consórcio sob solo de várzea

    Directory of Open Access Journals (Sweden)

    Christiane Abreu de Oliveira

    2003-09-01

    Full Text Available Tropical grasslands under lowland soils are generally underutilized and the litter of forage legumes may be used to recover these degraded pastures. The objective of this work was to study the dynamics of litter decomposition of Arachis pintoi (pinto peanut, Hyparrhenia rufa (thatching grass and a mixture of both species in a lowland soil. These treatments were analyzed in three areas: grass monoculture, legume monoculture and legume intercropped with the grass during the dry and wet seasons. Litter bags containing the legume, grass or a mixture of both species were incubated to estimate the decomposition rate and microorganism colonization. Decomposition constants (K and litter half-lives (T1/2 were estimated by an exponential model whereas number of microorganisms in specific media were determined by plate dilution. The decomposition rate, release of nutrients and microorganisms number, especially bacteria, increased when pinto peanut was added to thatching grass, influenced by favorable lignin/N and C/N ratios in legume litter. When pinto peanut litter was incubated in the grass plots, 50% N and P was released within about 135 days in the dry season and in the wet season, the equivalent release occurred within 20 days. These results indicate that A. pintoi has a great potential for nutrient recycling via litter and can be used to recover degraded areas.Pastagens tropicais sobre solos de várzea são geralmente subutilizadas. A serrapilheira de leguminosas forrageiras pode ser usada para a recuperação destas pastagens. O objetivo deste trabalho foi estudar a dinâmica de decomposição de Arachis pintoi (arachis, Hyparrhenia rufa (capim jaraguá e da mistura destas espécies, em solo de várzea. Estes tratamentos foram analisados em três áreas: monocultivo da gramínea; monocultivo da leguminosa e no consórcio entre as espécies durante as estações seca e chuvosa. Sacos de decomposição contendo a serrapilheira da leguminosa ou da

  4. Produção de forragem e desempenho animal em pastagens de coastcross consorciada ou não com Arachis pintoi, com e sem nitrogênio - DOI: 10.4025/actascianimsci.v30i4.6466 Forage Production and Performance Animal in Coastcross Intercropping or not with Arachis pintoi, with or without Nitrogen - DOI: 10.4025/actascianimsci.v30i4.6466

    Directory of Open Access Journals (Sweden)

    José Augusto Nogueira Gomes

    2009-03-01

    Full Text Available O estudo objetivou avaliar a produção de forragem e desempenho animal em pastagens de Coastcross + Arachis pintoi; Coastcross + Arachis pintoi com 100 kg ha-1 de N; Coastcross + Arachis pintoi com 200 kg ha-1 de N e Coastcross com 200 kg ha-1 de N, nas estações de inverno, primavera, verão e outono. Utilizou-se o delineamento experimental em blocos ao acaso, com os tratamentos em parcelas subdivididas, com duas repetições. Foram avaliados: acúmulo de massa de forragem e acúmulo diário de massa de forragem, ganho médio diário (GMD, ganho de peso vivo por área e taxa de lotação. A utilização de Coastcross + 200 kg ha-1 de N e as melhores condições climáticas na primavera e verão favoreceram tanto o acúmulo de massa de forragem (26.764 kg ha-1 de MS quanto o acúmulo diário de massa de forragem (82 kg ha-1 por dia de MS. A utilização da associação entre Arachis pintoi + 200 kg ha-1 de N e Coastcross + 200 kg ha-1 de N, possibilitou o melhor desempenho animal, com GMD de 0,570 e 0,500 kg e taxa de lotação de 3,51 e 3,26 UA ha-1, respectivamente. A utilização de pastagem consorciada sem a associação com doses de nitrogênio (100 e 200 kg ha-1 não favoreceu (p > 0,05 o acúmulo de massa de forragem e a taxa de acúmulo diária. A utilização de 200 kg ha-1 de N, com e sem a leguminosa, proporcionou o melhor desempenho e lotação animal por área.The objective of this study was to evaluate dry matter production and animal performance in pastures of Coastcross + Arachis pintoi; Coastcross + Arachis pintoi with 100 kg ha-1 of N; Coastcross + Arachis pintoi with 200 kg ha-1 of N and Coastcross with 200 kg ha-1 of N, during winter, spring, summer and autumn. The experimental design was complete randomized blocks with split-plot parcels, with two repetitions. The study evaluated the accumulation of forage mass and dairy accumulation of forage mass, average daily gain (ADG, live weight gain and stocking rate. The used of

  5. Uso de N-alcanos na estimativa da composição botânica em amostras com diferentes proporções de Brachiaria brizantha e Arachis pintoi Use of N-alkanes for estimations of botanical composition in samples with different proportions of Brachiaria brizantha and Arachis pintoi

    Directory of Open Access Journals (Sweden)

    Cristiano Côrtes

    2005-10-01

    Full Text Available Este trabalho foi conduzido para se determinar a composição de n-alcanos (C24 a C36 em diferentes proporções de dietas hipotéticas de Brachiaria brizantha Stapf. cv. Marandu e Arachis pintoi Koprov & Gregory. cv. Amarillo (0; 15; 30; 45; 60 e 100% de Arachis pintoi e identificar a combinação de alcanos que permite calcular a composição botânica de dietas com o menor valor residual (real menos o estimado. As forragens foram amostradas no verão e os n-alcanos extraídos pelo método de saponificação direta, sendo identificados e quantificados por meio de análise de cromatografia gasosa. O alcano C34 foi utilizado como padrão interno. As proporções de A. pintoi nas dietas foram estimadas pela minimização do z (soma dos quadrados dos desvios entre a proporção real dos alcanos analisados e as proporções pré-estabelecidas (tratamentos, utilizando-se a equação de Duncan et al. (1999. Observou-se que houve predomínio das cadeias carbônicas ímpares e que a concentração total de n-alcanos decresceu à medida que se aumentou a proporção de A. pintoi nos tratamentos. Estimativas acuradas da composição botânica de misturas de A. pintoi com B. brizantha foram obtidas utilizando-se os alcanos C29, C31, C33 e C35. O alcano C35 foi fundamental para a qualidade das estimativas. Os resultados indicaram o grande potencial da técnica para estudos com animais em pastejo.This trial was carried out to determine the composition of n-alkanes (C24 to C36 in hypothetical diets comprising of pure Brachiaria brizantha Stapf. cv. Marandu and Arachis pintoi Koprov & Gregory. cv. Amarillo and mixtures of these two spececies with 15%, 30%, 45%, or 60% of Arachis pintoi; it also intended to identify the combination of alkanes that allows to calculate the botanical composition of diets with the smallest residual value (real less estimated values. The forages were sampled in the summer. The n-alkanes were extracted for the direct saponification

  6. Determinação da fixação biológica de nitrogênio no amendoim forrageiro (Arachis spp. por intermédio da abundância natural de 15N Determination of biological nitrogen fixation by the forage groundnut (Arachis spp. using the 15N natural abundance technique

    Directory of Open Access Journals (Sweden)

    Cesar Heraclides Behling Miranda

    2003-12-01

    Full Text Available Quantificou-se a fixação biológica de nitrogênio (FBN em cinco acessos de Arachis pintoi (BRA31534, BRA31828, BRA31796, BRA15121 e BRA30333 e dois de A. repens (BRA31801 e BRA31861. Os mesmos foram estabelecidos em um solo Latosolo Vermelho Escuro sujeito a inundação estacional, sendo a FBN estimada segundo a técnica da abundância natural do isótopo 15N (d15N. Estolões dos acessos foram plantados em novembro de 1999, em parcelas de 2,0 m x 2,0 m, com quatro repetições, distribuídas em blocos ao acaso. A massa verde das plantas acima de cinco centímetros do solo foi colhida em janeiro de 2000 e seca em estufa a 65ºC até peso constante, sendo posteriormente pesada e moída para análise dos conteúdos em N e d15N, em espectrômetro de massa. Verificaram-se diferenças significativas entre os genótipos quanto à produção de matéria seca (MS e N total, sobressaindo-se BRA31534 e BRA31828, com produções de 4,2 t/ha e conteúdos totais de N de 102 e 110 kg/ha, respectivamente. Os acessos BRA30333 e BRA31861 produziram apenas 2,6 t de MS/ha, com 59 e 65 kg/ha de N total, respectivamente. As taxas de FBN dos acessos testados, medidas por comparação dos seus teores de d15N com os de plantas não fixadoras crescendo na mesma área, variaram de 36% (BRA15121 a 90% (BRA31828 do N total das plantas, equivalente a 26 e 99 kg de N/ha, respectivamente. Verificou-se correlação positiva e significativa (r = 0,92, pThe biological nitrogen fixation (BNF of five Arachis pintoi (BRA31534, BRA31828, BRA31796, BRA15121 E BRA30333 and two A. repens (BRA31801 e BRA31861 accessions, grown in a Dark Red Latosol prone to seasonal flooding was evaluated using the 15N natural abundance method (d15N. Stolons of each accession were planted in November 1999, in plots of 2.0 m by 2.0 m, with four replications allotted to randomized blocks. Plant mass above five cm was harvested in January 2000. There were significant differences among the tested

  7. Experiencias en el establecimiento de Arachis pintoi Krapov & W.C. Greg. como cobertura en cítricos de Veracruz, México

    Directory of Open Access Journals (Sweden)

    B. Valles

    2006-01-01

    Full Text Available Se realizaron dos experimentos para evaluar el establecimiento de Arachis pintoi (Ap como cobertera en cítricos; el primero, en limón Persa, y el segundo, en naranjo. En el primero se sembraron los ecotipos CIAT 17434, 18744 y 18748 en suelo rastreado, en surcos separados a un metro, y distancia de 50 cm entre plantas. En el segundo, se sembró Ap 17434 en suelo rastreado, escardado, u hoyado; plantando a 50 y 35 cm en surcos separados a 75 cm, con y sin P+K+Mg. La cobertura se evaluó a 4, 8, 12, 16, 20 y 24 semanas postsiembra, con la misma frecuencia en el segundo caso hasta 20 semanas. El diseño experimental fue para el primero completamente al azar; y el segundo, de bloques al azar, en parcelas subdivididas. Del primero, resultó que las semanas para alcanzar 50% y 100% de cobertura fueron 16 y 32, 12 y 24, y 13 y 26, para 17434, 18744 y 18748, respectivamente (P=0.0001. Para el segundo caso, los máximos valores de cobertura fueron en suelo rastreado, en rango de 53.5 a 87.5 %, según la densidad de siembra y fertilización. En los restantes tratamientos los valores fueron pobres (3.5 % a 33.7%. Del primer experimento, los ecotipos 18744 y 18748 se consideraron como los más promisorios en cuanto al tiempo necesario para cubrir totalmente el terreno. Para el segundo experimento, la preparación del terreno con pases de rastra garantizó el mejor establecimiento de la cobertura.

  8. Nitrogen effects on maize yield following groundnut in rotation on ...

    African Journals Online (AJOL)

    Rotating maize (Zea mays L.) with groundnut (Arachis hypogaea L.) has been proposed as a way to maintain soil fertility and prevent maize productivity declines in the smallholder cropping systems of sub-humid Zimbabwe. Field experiments with fertilizer-N on maize in rotation with groundnut were conducted at three ...

  9. Crop response to biochar under differing irrigation levels in the southeastern USA

    Science.gov (United States)

    Application of biochar to soils is hypothesized to increase crop yield. Crop productivity impacts of biochar application in Southeastern cropping systems consisting of peanut (Arachis hypogaea L.), corn (Zea mays L.), and cotton (Gossypium hirsutum L.) produced under varying rates of irrigation have...

  10. 7 CFR 361.1 - Definitions.

    Science.gov (United States)

    2010-01-01

    .... trichoglume Robyns Pea, field—Pisum sativum L. Peanut—Arachis hypogaea L. Poa trivialis—(see Bluegrass, rough... intybus L. Chives—Allium schoenoprasum L. Citron—Citrullus lanatus (Thunb.) Matsum. and Nakai var...—Lepidium sativum L. Cress, upland—Barbarea verna (Mill.) Asch. Cress, water—Rorippa nasturtium-aquaticum (L...

  11. Crop yield response to increasing biochar rates

    Science.gov (United States)

    The benefit or detriment to crop yield from biochar application varies with biochar type/rate, soil, crop, or climate. The objective of this research was to identify yield response of cotton (Gossypium hirsutum L.), corn (Zea mayes L.), and peanut (Arachis hypogaea L.) to hardwood biochar applied at...

  12. Contributions of plant introductions to the ancestry of current U.S. peanut cultivars

    Science.gov (United States)

    Plant introductions (PIs) have been used in peanut (Arachis hypogaea L.) improvement in the U.S.A. since the inception of peanut breeding there in the 1930s. One might think that the era of screening collections of PIs for pest resistances or other economically important traits then crossing selecte...

  13. The impact of a parasitic nematode Thripinema fuscum (Tylenchida: Allantonematidae) on the feeding behavior and vector competence of Frankliniella fusca (Thysanoptera: Thripidae)

    Science.gov (United States)

    Frankliniella fusca (Hinds) (Thysanoptera: Thripidae) is the predominant thrips species found inhabiting and reproducing in peanut (Arachis hypogaea L.) and is one of at least seven thrips species reported to transmit Tomato spotted wilt virus (TSWV). The entomogenous nematode Thripinema fuscum Tipp...

  14. Genome-wide SNP genotyping resolves signatures of selection and tetrasomic recombination in peanut

    Science.gov (United States)

    Peanut (Arachis hypogaea; 2n=4x=40) is a nutritious food and a good source of vitamins, minerals, and healthy fats. Expansion of genetic and genomic resources for genetic enhancement of cultivated peanut has gained momentum from the sequenced genomes of the diploid ancestors of cultivated peanut. ...

  15. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 31; Issue 2. Genetic transformation of peanut (Arachis hypogaea L.) using cotyledonary node as explant and a promoterless gus::nptII fusion gene based vector. T Swathi Anuradha S K Jami R S Datla P B Kirti. Articles Volume 31 Issue 2 June 2006 pp 235-246 ...

  16. Minimising the effects of drought stress on growth of two peanut ...

    African Journals Online (AJOL)

    Peanut (Arachis hypogaea L.) is a major cash crop in the semi-arid tropics, where it is mainly grown under rainfed conditions. Inadequate soil fertility (especially N and P), drought and diseases are important factors causing low yields. Peanut forms two types of symbiotic associations with micro-organisms, one with ...

  17. Composition and variation of fatty acids among groundnut cultivars ...

    African Journals Online (AJOL)

    Groundnuts (Arachis hypogaea L.) contain approximately 44-56% oil made up of fatty acids. Oleic and linoleic acids comprise about 80% of fatty acids in groundnuts. Groundnuts with >80% oleic are beneficial health-wise and also improve groundnut quality, flavour, and extended shelf-life, which is beneficial to traders.

  18. Isolation, characterization and comparative analysis of plant-associated bacteria for suppression of soil-borne diseases of field-grown groundnut in Vietnam

    NARCIS (Netherlands)

    Le, C.N.; Hoang, T.K.; Thai, T.H.; Tran, T.L.; Phan, T.P.N.; Raaijmakers, J.M.

    2018-01-01

    Abstract Groundnut (Arachis hypogaea L.) is an important oil seed crop worldwide and used extensively for feed and food. In Vietnam, groundnut cultivation is hampered by several soil-borne fungal pathogens, in particular Sclerotium rolfsii. To develop sustainable measures to control stem rot disease

  19. Field evaluations of leaf spot resistance and yield in peanut genotypes in the United States and Bolivia

    Science.gov (United States)

    Field experiments were conducted in 2002-2006 to characterize yield potential and disease resistance to Cercospora arachidicola (early leaf spot) and Cercosporidium personatum (late leaf spot) in the Bolivian peanut (Arachis hypogaea) cultivar, Bayo Grande, and breeding lines developed from crosses ...

  20. Arbuscular mycorrhizal inoculation of peanut in low-fertile tropical soil. II. Alleviation of drought stress

    NARCIS (Netherlands)

    Quilambo, OA; Weissenhorn, I.; Doddema, H; Kuiper, PJC; Stulen, I.

    2005-01-01

    The effect of drought stress and inoculation with an indigenous Mozambican and a commercial arbuscular mycorrhizal (AM) inoculant on root colonization and plant growth and yield was studied in two peanut (Arachis hypogaea L.) cultivars-a traditional, low-yielding Mozambican landrace (Local) and a

  1. Arbuscular mycorrhizal inoculation of peanut in low-fertile tropical soil : I. Host-fungus compatibility

    NARCIS (Netherlands)

    Quilambo, OA; Weissenhorn, I.; Kuiper, P.J C; Stulen, I.

    2005-01-01

    The effects of inoculation with an indigenous Mozambican and a commercial arbuscular mycorrhizal (AM) inoculant on two peanut (Arachis hypogaea L.) cultivars, a traditional, low-yielding Mozambican landrace (Local) and a modern, high-yielding cultivar (Falcon), were tested in a non-sterile and

  2. Biological and water-use efficiencies of sorghum-groundnut intercrop

    African Journals Online (AJOL)

    In order to compare water-use efficiency of sole crops and intercrops, 2 experiments were conducted in 2 consecutive years with sorghum (Sorghum bicolor L. Moench) and groundnut (Arachis hypogaea L.) on a loamy, Grossarenic Paleudult. In a randomized block, split-plot design, sorghum (SS), groundnut (GG), ...

  3. Cloning and sequence analysis of putative type II fatty acid synthase ...

    Indian Academy of Sciences (India)

    Prakash

    Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

  4. Aqueous plant extracts for control of groundnut leaf spot in Burkina ...

    African Journals Online (AJOL)

    Early and late leaf spots, the two fungal diseases of groundnut (Arachis hypogaea L.) caused by Cercospora arachidicola Hori. and Phaeoisariopsis personata (Berk and Curt), respectively, cause severe groundnut crop losses in arid zone of West Africa. The objective of this study was to evaluate efficacy of aqueous extracts ...

  5. Aspergillus flavus infection triggered immune responses and host-pathogen cross-talks in groundnut during in-vitro seed colonization

    Science.gov (United States)

    Aflatoxin contamination, caused by fungal pathogen Aspergillus flavus, is a major quality and health problem delimiting the trade and consumption of groundnut (Arachis hypogaea L.) worldwide. RNA-seq approach was deployed to understand the host-pathogen interaction by identifying differentially expr...

  6. Strategies to mitigate peanut allergy: production, processing, utilization, and immunotherapy considerations

    Science.gov (United States)

    Peanut (Arachis hypogaea L.) is an important crop grown worldwide for food and edible oil. The surge of peanut allergy in the past 25 years has profoundly impacted both affected individuals and the peanut and related food industries. In response, several strategies to mitigate peanut allergy have em...

  7. Comportamiento ingestivo de vacas en una asociación grama nativa/ Arachis pintoi en el trópico húmedo veracruzano

    Directory of Open Access Journals (Sweden)

    Epigmenio Castillo Gallegos

    2014-01-01

    Full Text Available Se introdujo la leguminosa Arachis pintoi CIAT 17434 (AP en una pastura de gramas nativas, para estudiar su efecto sobre la conducta de ingestión del animal al pastar, en la época lluviosa del trópico húmedo del estado de Veracruz. Los tratamientos fueron gramas nativas (PN, testigo y AP asociado a gramas nativas (PNA. La rotación fue 1 día de pastoreo/20 días de recuperación con carga de 3.2 vacas F1 (Holstein x Cebú/ha. Las diferencias se probaron a P <0.05, presentándose primero las medias ± error estandar de PNA y luego de PN. Hubo diferencias entre tratamientos en cantidad de materia seca (MS presente antes del pastoreo (4,225 ± 212 vs 3,314 ± 212 kg/ha, así como en proteína cruda (15.1 ± 0.45 vs 10.6 ± 0.5 % y materia orgánica (MO digestible (67.65 ± 1.7 vs 64.1 ± 2.4 % de la extrusa esofágica. El tiempo de pastoreo (367 ± 11 vs 380 ± 11 min/24 h fue similar entre tratamientos y el de rumia diferente (291 ± 8 vs 379 ± 8 min/24 h. No hubo diferencias en consumo de MO calculado por Cr-indigestibilidad in situ (2.09 ± 0.11 vs 2.16 ± 0.11 kg MO/100 kg PV, pero por comportamiento ingestivo, si las hubo (1.54 ± 0.12 vs 2.02 ± 0.12. La producción diaria (kg/vaca de leche ordeñada (6.8 ± 0.4 vs 6.1 ± 0.4 y consumida por el becerro (4.4 ± 0.4 vs 3.8 ± 0.5 fueron similares, pero la producción total fue diferente (9.0 ± 0.6 vs 7.2 ± 0.6 kg/animal/ día.

  8. AUTUMNAL FORAGE YIELD AND NUTRITIVE VALUE OF THE LEGUME ARACHIS RENDIMENTO E VALOR NUTRITIVO DA FORRAGEM OUTONAL DE AMENDOIM-FORRAGEIRO

    Directory of Open Access Journals (Sweden)

    Pedro Lima Monks

    2007-09-01

    Full Text Available

    Dry matter yield and nutritive value of forage le-gume Arachis    pintoi (Krap. & Greg. cv. Alqueire-1 (BRA 037036, was evaluated under different cutting mana-gement regimes and levels of P and K fertilization, in a yellow-red argisoil, at CAP-UFPEL, Capão do Leão, RS, Brazil during Spring-Summer and Fall. Cutting regimes compared were: no cutting, one, two, three, four and five cuttings, at 5 cm above ground. Fertilization levels con-sisted in supplying zero, 50 and 100% of requirements for P and K recommended by Brazilian Soil Science Society, for warm season perennial forage legumes. Fertilization treatments were alocated to main plots and cutting regi-mes to subplots, in a complete splitplot randomized block design, with three replications. Data of the following va-riables were submitted to analysis of variance and polino-mial regression: dry matter yield and quality of autumnal cutting, dry matter accumulation rate of autumnal cutting and total dry matter yield. If the purpose is the utilization of the forage during Autumn, 70% of the recommended phosphorus and potassium fertilization is sufficient to ob-tain maximum forage yield. However, if the objective are cuttings during the growing season (Spring-Summer and also in Autumn, it is necessary 100% of the recommended fertilization. The increase in number of cuttings during Spring-Summer decreases in the same proportion the fo-rage yield in Autumn. Forage nutritive value in Autumn is better when greater number of cuttings are made during Spring-Summer. Spring deferments also result in higher autumnal forage quality.

    KEY-WORDS: Cutting, fertilization, tropical forage.

    Num Argissolo vermelho amarelo eutrófico típi-co, do Centro Agropecuário da Palma, da UFPEL, Capão do Leão, RS,  foram avaliados os efeitos de cortes esti-vais e da adubação fosfatada e potássica sobre o rendi-mento e valor nutritivo da matéria seca (MS outonal de amendoim-forrageiro (Arachis

  9. Uso de n-alcanos na estimativa da composição botânica da dieta em ovinos alimentados com diferentes proporções de Brachiaria decumbens Stapf e Arachis pintoi Koprov e Gregory Use of n-alkanes to estimate the dietary botanical composition in sheep fed different proportions of Brachiaria decumbens Stapf and Arachis pintoi Koprov and Gregory

    Directory of Open Access Journals (Sweden)

    Nelson Massaru Fukumoto

    2007-08-01

    Full Text Available Neste experimento objetivou-se avaliar o poder discriminatório dos n-alcanos para estimar com acurácia e precisão a composição botânica da dieta em ovinos alimentados com diferentes proporções de Arachis pintoi Koprov & Gregory cv. Amarillo (0, 15, 30, 45 e 60% e Brachiaria decumbens Stapf. Foram utilizados 20 ovinos em delineamento inteiramente casualizado, com período experimental de dez dias de adaptação à dieta e cinco dias de coleta de fezes. Nas amostras (compostas de fezes do período e nos fenos, foi analisada a concentração de n-alcanos. Para o cálculo da composição botânica, utilizou-se minimização da soma dos quadrados dos desvios, considerando as concentrações dos alcanos nos componentes da dieta e nas fezes. Para a escolha dos alcanos mais discriminatórios, foram utilizadas as análises multivariadas e as variáveis canônicas. As estimativas calculadas foram submetidas à análise de variância. As médias foram comparadas pelo teste t e as correções dos valores estimados em relação aos valores reais foram ajustadas em regressão linear. As variáveis canônicas indicaram que os alcanos C35, C33, C30, C31, C27, C29 e C36 são os de maior potencial discriminatório. O uso desses alcanos nos cálculos foi mais acurado e preciso para estimar a proporção de A. pintoi na dieta que o uso de apenas dois ou três alcanos com poder discriminatório. O melhor ajuste da regressão também foi encontrado para esses alcanos. O teste t para o intercepto da equação (a e o coeficiente de regressão (b indicaram que a = 0 e b = 1, comprovando que os valores estimados são equivalentes aos valores reais. As análises multivariadas mostraram-se ferramentas de grande importância na escolha dos n-alcanos nos cálculos nas estimativas.The objective of this experiment was to use n-alkane to estimate accurately and precisely the botanical composition of dietary forage in sheep fed different proportions of Arachis pintoi

  10. Alterations in subspecific characters of groundnut

    International Nuclear Information System (INIS)

    Mouli, C.; Patil, S.H.; Kale, D.M.

    1983-01-01

    Recombination of beneficial characters associated in the cultivars of groundnut (Arachis hypogaea, L.) belonging to the two subspecies hypogaea and fastigiata had little success in conventional breeding programme. The cultures of ssp. hypogaea have the desirable characters for the crop improvement viz; various growth habits, profuse branching, large pod, seed dormancy and stress tolerance. Sequential flowering, early maturity, compact fruiting habit and high kernel outturn are the other useful characters present in ssp. fastigiata cultures. Mutation research in a popular variety, Spanish Improved belonging to ssp. fastigiata led to the selection of various mutants. One among the mutants had large pod, a characteristic of hypogaea ssp. Hybridization among the mutants and improved cultivars as well as radiation treatment of selected cultures resulted in the isolation of cultures having not only combinations and alterations of characters in both subspecies, but also modifications. These cultures are classified into major groups and their significance in the groundnut improvement is discussed. (author)

  11. The effect of two pesticides (Vitavax-300 and Gaucho on rhizobia and on the nodulation of four legumes

    Directory of Open Access Journals (Sweden)

    P. MIETTINEN

    2008-12-01

    Full Text Available The application of seed-protecting pesticides is often a prerequisite for raising legumes in the tropics. However, these chemicals may influence the development of root nodule symbiosis. In the present study, high concentrations of Gaucho insecticide (imidacloprid and Vitavax-300 fungicide (carboxin and captan clearly inhibited the growth of root nodule bacterium under laboratory conditions. However, they did not effect to the nodulation or biomass production of Arachis pintoi, Arachis hypogaea, Mucuna pruriens or Desmodium ovalifolium raised in a green house in eastern Costa Rica. Explanations for these results are discussed.;

  12. The effect of two pesticides (Vitavax-300 and Gaucho on rhizobia and on the nodulation of four legumes

    Directory of Open Access Journals (Sweden)

    Pasi Miettinen

    1996-03-01

    Full Text Available The application of seed-protecting pesticides is often a prerequisite for raising legumes in the tropics. However, these chemicals may influence the development of root nodule symbiosis. In the present study, high concentrations of Gaucho insecticide (imidacloprid and Vitavax-300 fungicide (carboxin and captan clearly inhibited the growth of root nodule bacterium under laboratory conditions. However, they did not effect to the nodulation or biomass production of Arachis pintoi, Arachis hypogaea, Mucuna pruriens or Desmodium ovalifolium raised in a green house in eastern Costa Rica. Explanations for these results are discussed.

  13. Microbial activity in soil cultivated with different summer legumes in coffee crop

    Directory of Open Access Journals (Sweden)

    Elcio Liborio Balota

    2011-02-01

    Full Text Available A field experiment was conducted for ten years in a sandy soil in the north part of the Paraná State, Brazil. The soil samples were collected at 0-10 cm depth, both under the coffee canopy and in the inter row space between the coffee plants, in the following treatments: Control, Leucaena leucocephala, Crotalaria spectabilis, Crotalaria breviflora, Mucuna pruriens, Mucuna deeringiana, Arachis hypogaea and Vigna unguiculata. The legume crops influenced the microbial activity, both under the coffee canopy and in the inter row space. The cultivation of Leucaena leucocephala increased the microbial biomass C, N and P. Although L. leucocephala and Arachis hypogaea provided higher microbial biomass, the qCO2 decreased by up to 50% under the coffee canopy and by about 25% in the inter row space. The soil microbial biomass was enriched in N and P due to green manure residue addition.

  14. Caracterización de jamones adicionados con pastas residuales de la extracción mecánica de aceite de frutos secos

    OpenAIRE

    Luna, Juan; Guerrero-Beltrán, José

    2013-01-01

    Nuts contain in their composition nutrients and bioactive compounds that when consumed in sufficient amounts may provide health benefits. In this study was evaluated the influence of the addition of residual pastes (10%), obtained from the extraction of oil from walnut (Juglans regia L.), pecan (Carya illinoinensis (Wangenh.) K. Koch), variety Western Shley, and peanut (Arachis hypogaea), on the modification of some textural, proximate, physicochemical, microbiological and sensory characteris...

  15. Suitability of peanut residue as a nitrogen source for a rye cover crop

    OpenAIRE

    Balkcom,Kipling Shane; Wood,Charles Wesley; Adams,James Fredrick; Meso,Bernard

    2007-01-01

    Leguminous winter cover crops have been utilized in conservation systems to partially meet nitrogen (N) requirements of succeeding summer cash crops, but the potential of summer legumes to reduce N requirements of a winter annual grass, used as a cover crop, has not been extensively examined. This study assessed the N contribution of peanut (Arachis hypogaea L.) residues to a subsequent rye (Secale cereale L.) cover crop grown in a conservation system on a Dothan sandy loam (fine-loamy, kaoli...

  16. Monitoring of Aflatoxins in Peanuts

    OpenAIRE

    UÇKUN, Okşan; VAR, Işıl

    2014-01-01

    Peanuts (Arachis hypogaea L.) are one of the most important oilseed crops and snack foods in the world Agro-food trade market. The major producers/exporters of peanuts are the United States, China, Argentina, Sudan, Senegal, and Brazil. Peanuts are a perishable commodity, easily spoiled by fungi. Aflatoxins are a group of natural compounds mainly produced by Aspergillus flavus and Aspergillus parasiticus. They have been found to be carcinogenic, teratogenic, and mutagenic to humans and animal...

  17. Host Status of Seven Weed Species and Their Effects on Ditylenchus destructor Infestation of Peanut

    OpenAIRE

    De Waele, D.; Jordaan, Elizabeth M.; Basson, Selmaré

    1990-01-01

    The host suitability to Ditylenchus destructor of seven common weed species in peanut (Arachis hypogaea) fields in South Africa was determined. Based on the number of nematodes per root unit, white goosefoot (Chenopodium album), feathertop chloris (Chloris virgata), purple nutsedge (Cyperus rotundus), jimson weed (Datura stramonium), goose grass (Eleusine indica), khaki weed (Tagetes minuta), and cocklebur (Xanthium strumarium) were poor hosts. Ditylenchus destructor survived on all weed spec...

  18. Characterization of rust, early and late leaf spot resistance in wild and cultivated peanut germplasm Caracterização da resistência à ferrugem, mancha preta e mancha castanha em germoplasma silvestre e cultivado de amendoim

    Directory of Open Access Journals (Sweden)

    Alessandra Pereira Fávero

    2009-02-01

    Full Text Available Groundnut (Arachis hypogaea has an AB genome and is one of the most important oil crops in the world. The main constraints of crop management in Brazil are fungal diseases. Several species of the genus Arachis are resistant to pests and diseases. The objective of our experiments was to identify wild species belonging to the taxonomic section Arachis with either A or B (or " non-A" genomes that are resistant to early leaf spot (Cercospora arachidicola, late leaf spot (Cercosporidium personatum and rust (Puccinia arachidis. For the identification of genotypes resistant to fungal diseases, bioassays with detached leaves were done in laboratory conditions, with artificial inoculation, a controlled temperature of 25ºC and a photoperiod of 10 h light/14 h dark, for 20-42 days, depending on the fungi species. Most of the accessions of wild species were more resistant than accessions of A. hypogaea for one, two or all three fungi species studied. Arachis monticola, considered to be a possible tetraploid ancestor or a derivative of A. hypogaea, was also more susceptible to Cercosporidium personatum and Puccinia arachidis, as compared to most of the wild species. Therefore, wild germplasm accessions of both genome types are available to be used for the introgression of resistance genes against three fungal diseases of peanut.O amendoim (Arachis hypogaea possui genoma AB e é uma das mais importantes culturas oleaginosas em todo o mundo. Os principais problemas da cultura no Brasil são as doenças fúngicas. Várias espécies do gênero Arachis são resistentes a pragas e doenças. Este trabalho visou a identificar espécies silvestres pertencentes à seção Arachis associadas aos genomas A ou B (ou " não-A" do amendoim que são resistentes à mancha castanha (Cercospora arachidicola, mancha preta (Cercosporidium personatum e ferrugem (Puccinia arachidis. Para a identificação de genótipos resistentes a doenças fúngicas, bioensaios utilizando

  19. Advances in Arachis genomics for peanut improvement

    Science.gov (United States)

    Peanut genomics is very challenging due to its inherent problem of genetic architecture. Blockage of gene flow from diploid wild relatives to tetraploid cultivated peanut, recent polyploidization combined with self pollination and narrow genetic base of primary gene pool resulted in low genetic dive...

  20. The peanut landraces from Bolivia

    Directory of Open Access Journals (Sweden)

    Antonio Krapovickas

    2009-07-01

    Full Text Available Bolivia is reagarded as the probable place of origin of the domesticated peanut, and an important world center of unique peanut diversity. As the first published study of its kind or peanut, this paper identifies and describes the infraspecific diversity of the crop in its country of origin and center of diverstity. 62 distinct landraces of Bolivian peanut were identified and systematically described. 42 landraces belong to Arachis hypogaea L. ssp. hypogaea var. hypogaea; 17 to A. hypogaea ssp. fastigiata var. fastigiata; one to A. hypogaea ssp. fastigiata var.vulgaris; and two to A. hypogaea ssp. fastigiata var. peruviana. With very few exceptions, the landraces encountered in Bolivia are almost entirely endemic to that country. The most typical peanuts from Bolivia pertain to the landraces “Crema”, “Colorado San Simón”, “Bayo americano”, “Overo”, and “Overo carenado”, which are widely cultivated throughout the country. A few regions of unusually high peanut diversity can be identified. In the Yungas region of La Paz, 11 landraces were collected, of which three are endemic. In the mountainous regions of Santa Cruz and Cochabamba, 18 landraces were collected, of which six are endemic. The Department of Tarija yielded 14 landraces , of which two are endemic. All of the aforementioned landraces pertain to the botanical  variety hypogaea. In contrast, the subspecies fastigiata has a remarkable center or diversity  in the watershed of the Rio Beni, where 10 landraces were collected in a fairly small area, nine of which  are endemic to that region. This monograph is intended to enhance the knowledge and appreciation of peanut diversity, and facilitate the conservation and use of peanut landraces by scientistis, plant breeders, and farmers

  1. Effet du compost à base de Calotropis procera (Aiton) W.T. Aiton sur ...

    African Journals Online (AJOL)

    Objectifs: Une étude à base de compost de Calotropis procera a été menée afin de mesurer l'effet sur la production de l'arachide sur de sols pauvres. Méthodologie et résultats: L'essai a été conduit sur le site de Doyaba au niveau des zones marginales du Tchad avec la variété fleur 11 d'arachide (Arachis hypogaea L.) ...

  2. Variations on metabolic activities of legume tissues through radiation in tissue culture

    International Nuclear Information System (INIS)

    Batra, Amla

    1977-01-01

    Cell cultures from Arachis hypogaea L. cultivated in a modified medium developed by Murashige and Skoog (1962) showed vigorous qrowth after radiation treatment. Investigations on the effect of various sugars on the chlorophyll formation and growth of the irradiated tissues showed that sucrose was superior to maltose, glucose or fructose as a carbon source. Lactose and mannitol supported growth and development of chlorophyll to a less degree. On prolonging the cultures on a sugar free medium, the tissues failed to regain either growth or chlorophyll content. (author)

  3. Variations on metabolic activities of legume tissues through radiation in tissue culture

    Energy Technology Data Exchange (ETDEWEB)

    Batra, A [Rajasthan Univ., Jaipur (India). Dept. of Botany

    1977-12-01

    Cell cultures from Arachis hypogaea L. cultivated in a modified medium developed by Murashige and Skoog (1962) showed vigorous qrowth after radiation treatment. Investigations on the effect of various sugars on the chlorophyll formation and growth of the irradiated tissues showed that sucrose was superior to maltose, glucose or fructose as a carbon source. Lactose and mannitol supported growth and development of chlorophyll to a less degree. On prolonging the cultures on a sugar free medium, the tissues failed to regain either growth or chlorophyll content.

  4. Influence of temperature and diet on the development of Ulomoides dermestoides (Fairmaire, 1893 (Coleoptera, Tenebrionidae, Diaperinae

    Directory of Open Access Journals (Sweden)

    Renato C. Marinoni

    2001-06-01

    Full Text Available Ulomoides dermestoides (Fairmaire, 1893 develops in stored food products (peanuts, maize, oats, rice, sorghum, etc. and breeds successfully in the laboratory. To determine the best conditions for development, experiments were set up in different temperatures and diets, similar to storage conditions of peanuts (Arachis hypogaea L.. The higher viability of individuals and the shorter developmental time were observed in the diet composed of hulls and seeds of fruits at 21 and 24°C.Ulomoides dermestoides (Fairmaire, 1893 é um coleóptero que se desenvolve em produtos armazenados (amendoim, milho, aveia, arroz, sorgo, etc. e é facilmente criado em laboratório. Para avaliar as melhores condições de desenvolvimento foram estabelecidos experimentos em diferentes temperaturas e em dietas definidas por três diferentes condições de armazenamento de amendoim (Arachis hypogaea L.. A maior viabilidade de indivíduos e o menor tempo de desenvolvimento foram verificados na dieta constituída por frutos abertos (vagens e grãos e em temperaturas de 21 e 24°C. É discutida a possível influência da umidade relativa nos resultados.

  5. Conservação de sementes de amendoim em câmara fria e seca Peanut seed preservation in cold and dry chamber

    Directory of Open Access Journals (Sweden)

    Angelo Savy Filho

    1986-01-01

    Full Text Available Sementes de amendoim (Arachis hypogaea L. do cultivar Tatu, produzidas no Centro Experimental de Campinas, no período "das águas" do ano agrícola 1970/1971, foram descascadas manual e mecanicamente, tratadas com fungicida e mantidas em câmara de armazenamento regulada a 15°C e 35% de umidade relativa por 36 meses. Sementes descascadas manualmente apresentaram, ao final desse período, germinação de 87%, e as descascadas mecanicamente, de 62%. Os resultados mostraram ser possível conservar sementes tratadas de amendoim, nas condições mencionadas, por até 36 meses para as descascadas manualmente, e por até 24-30 meses, para as descascadas mecanicamente.Peanut (Arachis hypogaea L. seeds of the cultivar Tatu, produced at the Centro Experimental de Campinas, in the 1970/1971 crop year, were manually and mechanically shelled, treated with fungicide, and kept in a store-room maintained at 15°C and 35% relative humidity for a period of 36 months. Manually shelled seeds presented, after 36 months of storage, the germination of 87%, while those mechanically shelled exhibited in the same period, the germination of 62%. Results showed that it is possible to preserve treated peanut seeds in the above mentioned conditions for at least 36 months when manually shelled, and for at least, 24-30 months when mechanically shelled.

  6. Omissão de macronutrientes em plantas de amendoim Deficiency of macronutrients in peanuts

    Directory of Open Access Journals (Sweden)

    Francisco Solano de Oliveira Rodrigues Filho

    1988-01-01

    Full Text Available Plantas de amendoim Arachis hypogaea L. 'Tatu' foram cultivadas em condições de casa de vegetação, em vasos de Mitscherlich contendo areia lavada e irrigados com solução nutritiva completa e com soluções nutritivas com a omissão de cada macronutriente (N, P, K, Ca, Mg e S. As plantas mostraram sintomas de deficiência de macronutrientes, com exceção do fósforo, na ausência de cada elemento, relacionados com os seus baixos teores e redução no crescimento, desenvolvimento e produção de matéria seca.Peanut plants (Arachis hypogaea L. were cultivated in washed sand, under greenhouse conditions, irrigated with a complete nutrient solution and nutrient solutions with absence of each macronutrient (N, P, K, Ca, Mg and S. Typical symptoms of macronutrient deficiencies were observed, except for phosphorus, related to the content of the element in the plant. The absence of macronutrients also influenced the plant dry matter production, development and height.

  7. Development and characterization of highly polymorphic long TC repeat microsatellite markers for genetic analysis of peanut

    Directory of Open Access Journals (Sweden)

    Macedo Selma E

    2012-02-01

    Full Text Available Abstract Background Peanut (Arachis hypogaea L. is a crop of economic and social importance, mainly in tropical areas, and developing countries. Its molecular breeding has been hindered by a shortage of polymorphic genetic markers due to a very narrow genetic base. Microsatellites (SSRs are markers of choice in peanut because they are co-dominant, highly transferrable between species and easily applicable in the allotetraploid genome. In spite of substantial effort over the last few years by a number of research groups, the number of SSRs that are polymorphic for A. hypogaea is still limiting for routine application, creating the demand for the discovery of more markers polymorphic within cultivated germplasm. Findings A plasmid genomic library enriched for TC/AG repeats was constructed and 1401 clones sequenced. From the sequences obtained 146 primer pairs flanking mostly TC microsatellites were developed. The average number of repeat motifs amplified was 23. These 146 markers were characterized on 22 genotypes of cultivated peanut. In total 78 of the markers were polymorphic within cultivated germplasm. Most of those 78 markers were highly informative with an average of 5.4 alleles per locus being amplified. Average gene diversity index (GD was 0.6, and 66 markers showed a GD of more than 0.5. Genetic relationship analysis was performed and corroborated the current taxonomical classification of A. hypogaea subspecies and varieties. Conclusions The microsatellite markers described here are a useful resource for genetics and genomics in Arachis. In particular, the 66 markers that are highly polymorphic in cultivated peanut are a significant step towards routine genetic mapping and marker-assisted selection for the crop.

  8. Genome-Wide Association Study of Major Agronomic Traits Related to Domestication in Peanut

    Directory of Open Access Journals (Sweden)

    Xingguo Zhang

    2017-09-01

    Full Text Available Peanut (Arachis hypogaea consists of two subspecies, hypogaea and fastigiata, and has been cultivated worldwide for hundreds of years. Here, 158 peanut accessions were selected to dissect the molecular footprint of agronomic traits related to domestication using specific-locus amplified fragment sequencing (SLAF-seq method. Then, a total of 17,338 high-quality single nucleotide polymorphisms (SNPs in the whole peanut genome were revealed. Eleven agronomic traits in 158 peanut accessions were subsequently analyzed using genome-wide association studies (GWAS. Candidate genes responsible for corresponding traits were then analyzed in genomic regions surrounding the peak SNPs, and 1,429 genes were found within 200 kb windows centerd on GWAS-identified peak SNPs related to domestication. Highly differentiated genomic regions were observed between hypogaea and fastigiata accessions using FST values and sequence diversity (π ratios. Among the 1,429 genes, 662 were located on chromosome A3, suggesting the presence of major selective sweeps caused by artificial selection during long domestication. These findings provide a promising insight into the complicated genetic architecture of domestication-related traits in peanut, and reveal whole-genome SNP markers of beneficial candidate genes for marker-assisted selection (MAS in future breeding programs.

  9. Characterizing the Suitability of Selected Indigenous Soil Improving Legumes in a Humid Tropical Environment Using Shoot and Root Attributes

    Directory of Open Access Journals (Sweden)

    Anikwe, MAN.

    2003-01-01

    Full Text Available We studied the biomass accumulation, root length, nodulation, and chemical composition of roots and shoot of ten indigenous soil improving legumes in a humid tropical ecosystem with the view to selecting species for soil improvement programmes. Two cultivars of Vigna unguiculata, and one each of Glycine max, Arachis hypogaea, Crotararia ochroleuca, Cajanus cajan, Pueraria phaseoloides, Lablab purpureus, Mucuna pruriens and Vigna subterranea as treatments were planted in 20 kg pots containing soil from an Oxic paleustalf in Nigeria. The pots were arranged in randomized complete block layout with three replications in a greenhouse at IITA Ibadan, Nigeria. Results from the work show that M. pruriens and C. cajan produced the highest quantity of biomass. Root elongation was highest in M. pruriens whereas A. hypogaea produced the most root nodules with native rhizobia. The highest quantity of nodule dry weight was produced by A. hypogaea and P. phaseoloides whereas most of the legumes except G. max and P. phaseoloides had high and statistically comparable N content of between 2.36 and 3.34 mg.kg-1 N. The results show that the legumes have different root and shoot characteristics, which should be taken into consideration when selecting species for soil improvement programmes.

  10. Expression of antigen tf and galectin-3 in fibroadenoma.

    Science.gov (United States)

    Gallegos, Itandehui Belem; Pérez-Campos, Eduardo; Martinez, Margarito; Mayoral, Miguel Ángel; Pérez, Laura; Aguilar, Sergio; Zenteno, Edgar; Pina, Maria del Socorro; Hernández, Pedro

    2012-12-24

    Fibroadenomas are benign human breast tumors, characterized by proliferation of epithelial and stromal components of the terminal ductal unit. They may grow, regress or remain unchanged, as the hormonal environment of the patient changes. Expression of antigen TF in mucin or mucin-type glycoproteins and of galectin-3 seems to contribute to proliferation and transformations events; their expression has been reported in ductal breast cancer and in aggressive tumors. Lectin histochemistry, immunohistochemistry, and immunofluorescence were used to examine the expression and distribution of antigen TF and galectin-3. We used lectins from Arachis hypogaea, Artocarpus integrifolia, and Amaranthus lecuocarpus to evaluate TF expression and a monoclonal antibody to evaluate galectin-3 expression. We used paraffin-embedded blocks from 10 breast tissues diagnosed with fibroadenoma and as control 10 healthy tissue samples. Histochemical and immunofluorescence analysis showed positive expression of galectin-3 in fibroadenoma tissue, mainly in stroma, weak interaction in ducts was observed; whereas, in healthy tissue samples the staining was also weak in ducts. Lectins from A. leucocarpus and A. integrifolia specificaly recognized ducts in healthy breast samples, whereas the lectin from A. hypogaea recognized ducts and stroma. In fibroadenoma tissue, the lectins from A. integrifolia, A. Hypogaea, and A. leucocarpus recognized mainly ducts. Our results suggest that expression of antigen TF and galectin-3 seems to participate in fibroadenoma development.

  11. Expression of antigen tf and galectin-3 in fibroadenoma

    Directory of Open Access Journals (Sweden)

    Gallegos Itandehui Belem

    2012-12-01

    Full Text Available Abstract Background Fibroadenomas are benign human breast tumors, characterized by proliferation of epithelial and stromal components of the terminal ductal unit. They may grow, regress or remain unchanged, as the hormonal environment of the patient changes. Expression of antigen TF in mucin or mucin-type glycoproteins and of galectin-3 seems to contribute to proliferation and transformations events; their expression has been reported in ductal breast cancer and in aggressive tumors. Findings Lectin histochemistry, immunohistochemistry, and immunofluorescence were used to examine the expression and distribution of antigen TF and galectin-3. We used lectins from Arachis hypogaea, Artocarpus integrifolia, and Amaranthus lecuocarpus to evaluate TF expression and a monoclonal antibody to evaluate galectin-3 expression. We used paraffin-embedded blocks from 10 breast tissues diagnosed with fibroadenoma and as control 10 healthy tissue samples. Histochemical and immunofluorescence analysis showed positive expression of galectin-3 in fibroadenoma tissue, mainly in stroma, weak interaction in ducts was observed; whereas, in healthy tissue samples the staining was also weak in ducts. Lectins from A. leucocarpus and A. integrifolia specificaly recognized ducts in healthy breast samples, whereas the lectin from A. hypogaea recognized ducts and stroma. In fibroadenoma tissue, the lectins from A. integrifolia, A. Hypogaea, and A. leucocarpus recognized mainly ducts. Conclusions Our results suggest that expression of antigen TF and galectin-3 seems to participate in fibroadenoma development.

  12. Isolation and expression analysis of LEA genes in peanut (Arachis ...

    Indian Academy of Sciences (India)

    with 16 members, accounting for 32% of all the 50 Arabidopsis LEA genes. Aligning ... suggest that they play roles different from those of other LEA proteins. .... [Glycine max]; AAD53078, water stress-induced ER5 protein [Capsicum annuum]; ...

  13. The performance characteristics of groundnut ( Arachis hypogea , L ...

    African Journals Online (AJOL)

    The ethyl-esters were blended with automotive gas oil at (0 to 20%) mix with 5% increment of groundnut ethyl-esters to produce biodiesel. The performance of a 2.46 kW diesel engine was evaluated using the groundnut biodiesel at five loading conditions (0, 25, 50, 75 and 100% of full load). Automotive gas oil was used as ...

  14. In vitro regeneration of Pakistani peanut (Arachis hypogea L ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... spot disease and weeds) to increase yield of groundnut in the Potohar region of northern .... embryogenesis which involves much more tissue culture. (too many media, culture .... Meeting of Asian Reg. Res. on grain legumes ...

  15. Molecular Responses of Groundnut (Arachis hypogea L. to Zinc Stress

    Directory of Open Access Journals (Sweden)

    A. John De Britto

    2013-08-01

    Full Text Available Heavy metals are important environmental pollutants and their toxicity is a problem of increasing significance for ecological, evolutionary and environmental reasons. The interference of germination related proteins by heavy metals has not been well documented at the proteomic and genomic level. In the current study, molecular responses of germinating groundnut seeds were investigated under Zinc stress. The SDS-PAGE showed the preliminary changes in the polypeptides patterns under Zinc stress. Restriction digestion banding pattern of EcoRI and Hind III enzymes showed distinct banding pattern in the treated plants.

  16. Pré-seleção de estirpes de Rhizobium sp. para amendoim Preliminary selection of peanut Rhizobium sp. strains

    Directory of Open Access Journals (Sweden)

    Antonio Roberto Giardini

    1984-01-01

    Full Text Available Um ensaio foi conduzido em casa de vegetação, com solução nutritiva isenta de N, com o objetivo de selecionar estirpes de Rhizobium eficientes fixadoras de N2, quando associadas com amendoim (Arachis hypogaea L. cultivar Tatu. Foram testadas 35 estirpes de Rhizobium sp., isoladas de quinze diferentes espécies de leguminosas tropicais, e incluído um tratamento de inoculação com solo previamente cultivado com amendoim. Das 35 estirpes testadas, doze formaram nódulos e, entre essas, sete foram eficientes fixadoras de nitrogênio. Das doze estirpes que nodularam, sete foram isoladas de leguminosas da tribo Hedysareae (à qual pertence o género Arachis e, destas, apenas quatro foram eficientes fixadoras de nitrogênio. O peso e o número de nódulos não se mostraram como critérios adequados para avaliação da eficiência.An experiment was carried out in Leonard jars, in the greenhouse, with nitrogen-free nutrient solution to test the efficiency of 35 strains of rhizobia isolated from 15 species of tropical legumes. Twelve of the tested strains were capable of nodule formation in peanut. Seven of those strains were isolated from the trible Hedysareae, which includes the genus Arachis. Only four of the rhizobia strains with inducing nodulation were effective. Dry weight and number of nodules were not good criteria for evaluating effectiveness.

  17. Uptake and translocation of zinc absorbed through roots and fruiting organs in peanuts

    International Nuclear Information System (INIS)

    Chahal, R.S.; Singh, S.P.; Shukla, U.C.

    1979-01-01

    Peanut plants (Arachis hypogaea L.) are known to absorb Ca, P and S through the fruiting organs but information on Zn uptake pattern is lacking. Therefore, a green-house experiment was conducted to study the uptake and translocation of Zn when applied in the rooting and fruiting zones of peanut plants. To locate the pathway and distribution of radioactive Zn, autoradiographs of plants were also taken. Zinc uptake data and autoradiographs indicated that a substantial amount of 65 Zn was absorbed through the fruiting organs (auxillary system). Of the total 65 Zn in the whole plant, 55.2 per cent was absorbed through roots and remaining 44.8 per cent through fruiting organs. Zinc was translocated to all the plant parts regardless of its absorption through roots or fruiting organs. The highest zinc concentration was recorded in the kernels, followed by leaves, stem and the shell. (Auth.)

  18. Cabernet Sauvignon ve Merlot Şarapların Resveratrol Düzeyleri ve Ekolojik Koşulların Etkileri

    OpenAIRE

    Belkıs Çaylak Adıgüzel; Nedim Çetinkaya; Ufuk Yücel

    2015-01-01

    Fitoaleksinler bitkilerde patojen enfeksiyonuna bir reaksiyon olarak veya çeşitli biyotik ve abiyotik tetikleyicilerin etkisi sonucu oluşan fenolik madde karakterli, düşük molekül ağırlıklı antimikrobiyal bileşiklerdir. Resveratrol (trans–3,5,4’-trihidroksistilben) de bir fitoaleksin olup, asma (Vitis vinifera), yer fıstığı (Arachis hypogaea) ve diğer pek çok bitki türünde yaprak veya diğer organlarda yüksek miktarlarda bulunabilmektedir. Resveratrol asmada gövde, sürgün ve yapraklar yanında,...

  19. Analysis of Peanut Leaf Proteome

    DEFF Research Database (Denmark)

    Ramesh, R.; Suravajhala, Prashanth; Pechan, T.

    2010-01-01

    Peanut (Arachis hypogaea) is one of the most important sources of plant protein. Current selection of genotypes requires molecular characterization of available populations. Peanut genome database has several EST cDNAs which can be used to analyze gene expression. Analysis of proteins is a direct...... approach to define function of their associated genes. Proteome analysis linked to genome sequence information is critical for functional genomics. However, the available protein expression data is extremely inadequate. Proteome analysis of peanut leaf was conducted using two-dimensional gel...... electrophoresis in combination with sequence identification using MALDI/TOF to determine their identity and function related to growth, development and responses to stresses. Peanut leaf proteins were resolved into 300 polypeptides with pI values between 3.5 and 8.0 and relative molecular masses from 12 to 100 k...

  20. Modulation of ovomucoid-specific oral tolerance in mice fed plant extracts containing lectins

    DEFF Research Database (Denmark)

    Kjær, Tanja; Frøkiær, Hanne

    2002-01-01

    We investigated the effect of feeding extracts of four different legumes (red kidney bean (Phaseolus vulgaris), peanut (Arachis hypogaea), soyabean (Glycine max) and pea (Pisum sativum) on the specific immune response against a food protein. Mice were fed ovomucoid and the specific immune response...... influenced the immune response against ovomucoid; however, this was not as pronounced as for kidney bean and was only significant (Ppea extract was fed and peanut extract had a non-significant effect on induction of oral tolerance...... and on the general immune response. Plasma antibodies against kidney-bean lectin, but not against the three other legume lectins, were detected. Our current findings show that other dietary components can influence the specific immune response against food proteins. Various dietary components may thus contribute...

  1. Interaction of a novel Tn (GalNAc alpha 1-->Ser/Thr) glycoprotein with Gal, GalNAc and GlcNAc specific lectins.

    Science.gov (United States)

    Wu, A M; Wu, J H; Shen, F

    1994-01-14

    A naturally occurring Tn glycoprotein (Native ASG-Tn) with GalNAc alpha 1-->Ser/Thr as the only carbohydrate side chains, has been prepared from armadillo submandibular glands. In a quantitative precipitin assay, this glycoprotein completely precipitated Maclura pomifera (MPA), Vicia villosa B4 (VVL-B4) and Artocarpus integrifolia (Jacalin, AIL). It also reacted well with Helix pomatia (HPL) and Wistaria floribunda (WFL) and precipitated over 75% of the lectin nitrogen added, but poorly with Ricinus communis agglutinin (RCA1), ricin, peanut (Arachis hypogaea, PNA), Abrus precatorius agglutinin (APA) and Triticum vulgaris (WGA). This finding suggests that this novel Tn-glycoprotein may serve as a useful reagent for differentiating Tn and T specific monoclonal antibodies and lectins.

  2. Lectin histochemistry of 1,2-dimethylhydrazine-induced rat colon neoplasia.

    Science.gov (United States)

    Freeman, H J

    1983-10-01

    Lectins linked to fluorescein were used as carbohydrate probes to examine the goblet cell mucin and epithelial cell surface glycoconjugate alterations in an experimental rodent model of colonic neoplasia induced with parenteral 1,2-dimethylhydrazine dihydrochloride. Lectins derived from Triticum vulgare (WGA), Ricinus communis (RCA1), and Limulus polyphemus (LPA) showed reduced labeling of goblet cell mucin in these tumors, while binding with peanut lectin from Arachis hypogaea (PNA), a lectin ordinarily failing to bind to mucin in normal colon, was positive. In addition, RCA1 and LPA showed increased cell surface labeling of neoplastic epithelial cells. Finally, alterations were observed in lectin binding to "transitional" colonic mucosa adjacent to colonic tumors from carcinogen-treated rats. These findings indicate that significant alterations in both membrane and mucin glycoconjugates occur in colonic tumors and mucosa adjacent to tumors in a chemically induced experimental animal model of human colon cancer.

  3. Nitrogen fixation in peanut nodules during dark periods and detopped conditions with special reference to lipid bodies

    International Nuclear Information System (INIS)

    Siddique, A.M.; Bal, A.K.

    1991-01-01

    The peanut plant (Arachis hypogaea L.), unlike other known legumes, can sustain nitrogen fixation when prolonged periods of darkness or detopping curtail the supply of photosynthate to the nodule. This ability to withstand photosynthate stress is attributed to the presence of lipid bodies in infected nodule cells. In both dark-treated and detopped plants, the lipid bodies show a gradual decrease in numbers, suggesting their utilization as a source of energy and carbon for nitrogen fixation. Lipolytic activity can be localized in the lipid bodies, and the existence of β-oxidation pathway and glyoxylate cycle is shown by the release of 14 CO 2 from 14 C lineoleoyl coenzyme A by the nodule homogenate

  4. Evaluation of yield and N2 fixation of mutant lines of groundnut in Malaysia

    International Nuclear Information System (INIS)

    Rusli, I.; Harun, A.R.; Rahman, K.A.; Shamsuddin, S.; Rahim, K.A.; Danso, S.K.A.

    1998-01-01

    The 15 N-dilution technique was used to evaluate N 2 fixation in groundnut (Arachis hypogaea L.) in three field trials of cultivars Matjan and V-13 (parents), their selected mutant lines, and a other local and foreign genotypes. Matjan mutant MJ/40/42 consistently produced the highest pod yields, at above 4 t ha -1 , 14-22% higher yields than the parent. In contrast, none of the V-13 mutants had consistently better yields than the parent. The mutant lines did not show consistent agronomic performance from year to year. Total dry matter yield did not correlate with pod yield, and pod yield did not correlate with amount of N fixed

  5. Kazusa Marker DataBase: a database for genomics, genetics, and molecular breeding in plants

    Science.gov (United States)

    Shirasawa, Kenta; Isobe, Sachiko; Tabata, Satoshi; Hirakawa, Hideki

    2014-01-01

    In order to provide useful genomic information for agronomical plants, we have established a database, the Kazusa Marker DataBase (http://marker.kazusa.or.jp). This database includes information on DNA markers, e.g., SSR and SNP markers, genetic linkage maps, and physical maps, that were developed at the Kazusa DNA Research Institute. Keyword searches for the markers, sequence data used for marker development, and experimental conditions are also available through this database. Currently, 10 plant species have been targeted: tomato (Solanum lycopersicum), pepper (Capsicum annuum), strawberry (Fragaria × ananassa), radish (Raphanus sativus), Lotus japonicus, soybean (Glycine max), peanut (Arachis hypogaea), red clover (Trifolium pratense), white clover (Trifolium repens), and eucalyptus (Eucalyptus camaldulensis). In addition, the number of plant species registered in this database will be increased as our research progresses. The Kazusa Marker DataBase will be a useful tool for both basic and applied sciences, such as genomics, genetics, and molecular breeding in crops. PMID:25320561

  6. Effects of Tropical Rotation Crops on Meloidogyne arenaria Population Densities and Vegetable Yields in Microplots.

    Science.gov (United States)

    McSorley, R; Dickson, D W; de Brito, J A; Hewlett, T E; Frederick, J J

    1994-06-01

    The effects of 12 summer crop rotation treatments on population densities of Meloidogyne arenaria race 1 and on yields of subsequent spring vegetable crops were determined in microplots. The crop sequence was: (i) rotation crops during summer 1991 ; (ii) cover crop of rye (Secale cereale) during winter 1991-92; (iii) squash (Cucurbita pepo) during spring 1992; (iv) rotation crops during summer 1992; (v) rye during winter 1992-93; (vi) eggplant (Solanum melongena) during spring 1993. The 12 rotation treatments were castor (Ricinus communis), cotton (Gossypium hirsutum), velvetbean (Mucuna deeringiana), crotalaria (Crotalaria spectabilis), fallow, hairy indigo (Indigofera hirsuta), American jointvetch (Aeschynomene americana), sorghum-sudangrass (Sorghum bicolor x S. sudanense), soybean (Glycine max), horsebean (Canavalia ensiformis), sesame (Sesamum indicum), and peanut (Arachis hypogaea). Compared to peanut, the first eight rotation treatments resulted in lower (P crops may provide a means for depressing M. arenaria population densities on a short-term basis to enhance yields in a subsequent susceptible vegetable crop.

  7. Host Status of Seven Weed Species and Their Effects on Ditylenchus destructor Infestation of Peanut.

    Science.gov (United States)

    De Waele, D; Jordaan, E M; Basson, S

    1990-07-01

    The host suitability to Ditylenchus destructor of seven common weed species in peanut (Arachis hypogaea) fields in South Africa was determined. Based on the number of nematodes per root unit, white goosefoot (Chenopodium album), feathertop chloris (Chloris virgata), purple nutsedge (Cyperus rotundus), jimson weed (Datura stramonium), goose grass (Eleusine indica), khaki weed (Tagetes minuta), and cocklebur (Xanthium strumarium) were poor hosts. Ditylenchus destructor survived on all weed species; population densities increased in peanut hulls and caused severe damage to seeds of peanut grown after weeds. Roots of purple nutsedge left in the soil suppressed populations of D. destructor and root and pod development in peanut grown after the weed. However, nematode populations in peanut hulls and seeds were not suppressed. Some weed species, especially purple nutsedge which is common in peanut fields, can be used to indicate the presence of D. destructor in the absence of peanut.

  8. Hemoglobin promotes somatic embryogenesis in peanut cultures.

    Science.gov (United States)

    Jayabalan, N; Anthony, P; Davey, M R; Power, J B; Lowe, K C

    2004-02-01

    Critical parameters influencing somatic embryogenesis include growth regulators and oxygen supply. Consequently, the present investigation has focused on optimization of a somatic embryogenic system for peanut (Arachis hypogaea L.) through media supplementation with the auxin, picloram. The latter at 30 mg L(-1) was optimal for inducing regeneration of somatic embryos from cultured explants of zygotic embryos. In contrast, somatic embryogenesis did not occur in the absence of this growth regulator. An assessment has also been made of the beneficial effect on somatic embryogenesis and plant regeneration of the commercial hemoglobin (Hb) solution, Erythrogen. Hemoglobin at 1:50 and 1:100 (v:v) stimulated increases in mean fresh weight (up to a maximum of 57% over control), mean number of explants producing somatic embryos (15%) and mean number of somatic embryos per explant (29%).

  9. Effet structurant de la plante hôte chez la bruche de l'arachide, Caryedon serratus (Olivier, 1790 (Coleoptera : Bruchidae

    Directory of Open Access Journals (Sweden)

    Sembène, M.

    2012-01-01

    Full Text Available Structuring effect of the host plant in the groundnut bruchid, Caryedon serratus (Olivier, 1790 (Coleoptera: Bruchidae. Twenty-six samples of the groundnut seed-beetle which were reared from pods of five different host plants (Arachis hypogaea L., Bauhinia rufescens Lam., Cassia sieberiana DC., Piliostigma reticulatum (DC. Hochst. and Tamarindus indica L. in four localities of Senegal were compared using electrophoresis based on six loci of four enzymatic systems. The population structure of Caryedon serratus Olivier was analysed using Weir and Cockerham's estimator of Wright's F-statistics. θ value (0.235 and the dendrogram of Rogers'genetic distances revealed a high degree of genetic differentiation between host plants. Genetic analysis without C. sieberiana samples indicated that populations form host races which are partially isolated according to their host plants (θ = 0.035. Geographical distances between localities are not decisive for genetic structuration of C. serratus populations from a given host plant.

  10. Systemic and oral immunogenicity of hemagglutinin protein of rinderpest virus expressed by transgenic peanut plants in a mouse model

    International Nuclear Information System (INIS)

    Khandelwal, Abha; Renukaradhya, G.J.; Rajasekhar, M.; Sita, G. Lakshmi; Shaila, M.S.

    2004-01-01

    Rinderpest causes a devastating disease, often fatal, in wild and domestic ruminants. It has been eradicated successfully using a live, attenuated vaccine from most part of the world leaving a few foci of disease in parts of Africa, the Middle East, and South Asia. We have developed transgenic peanut (Arachis hypogaea L.) plants expressing hemagglutinin (H) protein of rinderpest virus (RPV), which is antigenically authentic. In this work, we have evaluated the immunogenicity of peanut-expressed H protein using mouse model, administered parenterally as well as orally. Intraperitoneal immunization of mice with the transgenic peanut extract elicited antibody response specific to H. These antibodies neutralized virus infectivity in vitro. Oral immunization of mice with transgenic peanut induced H-specific serum IgG and IgA antibodies. The systemic and oral immunogenicity of plant-derived H in absence of any adjuvant indicates the potential of edible vaccine for rinderpest

  11. Distribution of the alphaGal- and the non-alphaGal T-antigens in the pig kidney: potential targets for rejection in pig-to-man xenotransplantation

    DEFF Research Database (Denmark)

    Kirkeby, Svend; Mikkelsen, Hanne B

    2008-01-01

    Carbohydrate antigens, present on pig vascular endothelial cells, seem to be the prime agents responsible for graft rejection, and although genetically modified animals that express less amounts of carbohydrate antigen are available, it is still useful to decide the localization of the reactive...... xenoantigens in organs contemplated for xenotransplantation. Here we compare the distribution in pig kidney of antigens important in xenograft destruction, namely the Galalpha1-3Gal (alphaGal) glycans, with the localization of the T-antigen (Galbeta1-3GalNAc). The alpha-galactose-specific lectin Griffonia...... simplicifolia isolectin 1B4 was used to detect the Galalpha1-3Gal glycans, whereas Arachis hypogaea (PNA) lectin and a monoclonal antibody (3C9) detected T-antigen. In addition, two vascular markers (anti-caveolin-1 and anti-von Willebrand factor) served to identify vascular structures of the kidney. Both...

  12. Functional and nutraceutical legumes marketed in the metropolitan area of Buenos Aires, Argentina.

    Directory of Open Access Journals (Sweden)

    Julio A. Hurrell

    2016-07-01

    Full Text Available In this work, we analyzed data from ethnobotanical surveys of functional and nutraceutical legumes (Leguminosae commercialized in the metropolitan area of Buenos Aires, Argentina. The surveys took place in outlets of the general commercial circuit and the restricted circuits belonging to Bolivian and Chinese immigrants. We recorded the species, its products, local therapeutic uses, and available published data on biological activity and effects. Nineteen species were found: Arachis hypogaea var. hypogaea, Cicer arietinum, Glycine max, Lablab purpureus, Lens culinaris, Lupinus albus, L. mutabilis, Medicago sativa, Phaseolus lunatus, P. vulgaris, Pisum sativum, Prosopis alba, Tamarindus indica, Trifolium repens, Trigonella foenum-graecum, Vicia faba, Vigna angularis, V. radiata and V. unguiculata var. unguiculata. Most of these species (15 were found in the general commercial circuit, whereas the rest (4 only in the restricted commercial circuits of immigrants, including L. mutabilis, which deserves a wider diffusion. In most cases, the local uses assigned to a surveyed species correspond to the information available in the literature on the species’ biological activity and effects. This paper provides new insights for ethnobotanical studies and highlights the therapeutic relevance of legumes in the study area.

  13. Studies on the relationship between lectin binding carbohydrates and different strains of Leishmania from the New World

    Directory of Open Access Journals (Sweden)

    J. Schottelius

    1982-03-01

    Full Text Available The culture forms of L. mexicana pifanoi (LRC L-90, L. mexicana mexicana (LRC L-94, M-379; L. braziliensis braziliensis (LRC L-77, L-1, M-2903, H-LSS and L. mexicana amazonensis (H-JMMO, M-JOF, H-21, H-PLL,M-1696 were tested with the following lectins: Canavalia ensiformis, Ricinus communis-120, Axinella polypoides, Phaseolus vulgaris, Evonymus europaeus, lotus tetragonolobus, Dolichos biflorus, Aaptos papillata II, Laburnum alpinum, Ulex europaeus, Arachis hypogaea and Soja hispida. All examined strains of Leishmania were agglutinated by C. ensiformis, R. communis-120 and A. popypoides. No agglutination reactions were observed with P. vulgaris, D.biflorus, A. papillata II, E. europaeus and L. tetragonolobus. Only L. m. pifanoi and the L. m. amazonensis strains H-JMMO and MJOF showed agglutination reactions with S. hispida, U. europaeus, L. alpinum and A. hypogaea, while L. m. mexicana (LRC L-94; M-379 strains, L. b. braziliensis H. LSS, LRC L-77; L-1; M-2903 and the L. m. amazonensis strains, H-PLL, H-21, M-1696 showed no agglutination reactions with these four lectins.

  14. Haplotype-Based Genotyping in Polyploids

    Directory of Open Access Journals (Sweden)

    Josh P. Clevenger

    2018-04-01

    Full Text Available Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2 was developed for Arachis hypogaea (peanut, an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.

  15. Global transcriptome analysis of two wild relatives of peanut under drought and fungi infection

    Directory of Open Access Journals (Sweden)

    Guimarães Patricia M

    2012-08-01

    Full Text Available Abstract Background Cultivated peanut (Arachis hypogaea is one of the most widely grown grain legumes in the world, being valued for its high protein and unsaturated oil contents. Worldwide, the major constraints to peanut production are drought and fungal diseases. Wild Arachis species, which are exclusively South American in origin, have high genetic diversity and have been selected during evolution in a range of environments and biotic stresses, constituting a rich source of allele diversity. Arachis stenosperma harbors resistances to a number of pests, including fungal diseases, whilst A. duranensis has shown improved tolerance to water limited stress. In this study, these species were used for the creation of an extensive databank of wild Arachis transcripts under stress which will constitute a rich source for gene discovery and molecular markers development. Results Transcriptome analysis of cDNA collections from A. stenosperma challenged with Cercosporidium personatum (Berk. and M.A. Curtis Deighton, and A. duranensis submitted to gradual water limited stress was conducted using 454 GS FLX Titanium generating a total of 7.4 x 105 raw sequence reads covering 211 Mbp of both genomes. High quality reads were assembled to 7,723 contigs for A. stenosperma and 12,792 for A. duranensis and functional annotation indicated that 95% of the contigs in both species could be appointed to GO annotation categories. A number of transcription factors families and defense related genes were identified in both species. Additionally, the expression of five A. stenosperma Resistance Gene Analogs (RGAs and four retrotransposon (FIDEL-related sequences were analyzed by qRT-PCR. This data set was used to design a total of 2,325 EST-SSRs, of which a subset of 584 amplified in both species and 214 were shown to be polymorphic using ePCR. Conclusions This study comprises one of the largest unigene dataset for wild Arachis species and will help to elucidate genes

  16. Characterization of peanut phytochromes and their possible regulating roles in early peanut pod development.

    Directory of Open Access Journals (Sweden)

    Ye Zhang

    Full Text Available Arachis hypogaea L. geocarpy is a unique feature different from other legume plants. Flowering and fertilization occur above ground, while the following processes of pod formation and development proceed in the soil. The zygote divides only few times to develop into pre-embryo and then further embryo developmental process stops when the gynoecium is exposed to light condition or normal day/night period. In this study, eight phytochrome genes were identified in two wild peanuts (four in Arachis duranensis and four in Arachis ipaensis. Using RACE and homologous cloning, the full CDS of AhphyA, AhphyA-like, AhphyB and AhphyE were acquired in cultivated peanut. Protein structure analysis showed that the conservative coding domains of phytochromes from a number of other plant species were found in these proteins. The C-terminal of AhphyA, AhphyA-like and AhphyB could interact with phytochrome-interacting factor 3 in vitro. The expression patterns of these genes in various tissues were analyzed by qRT-PCR, and significant differences were observed. Interestingly, the expression levels of AhphyA-like changed significantly during gynophore growth and early pod development. Furthermore, protein accumulation patterns of AhphyA and AhphyB in gynophore were different during early pod development stages in that AhphyA and AhphyB proteins were not detected in S1 and S2 gynophores, while significant accumulation of AhphyA and AhphyB were detected in S3 gynophore. These results provided evidence that phytochromes mediated light signal transduction may play key roles in peanut geocarpy development.

  17. In silico polymorphism analysis for the development of simple sequence repeat and transposon markers and construction of linkage map in cultivated peanut

    Directory of Open Access Journals (Sweden)

    Shirasawa Kenta

    2012-06-01

    Full Text Available Abstract Background Peanut (Arachis hypogaea is an autogamous allotetraploid legume (2n = 4x = 40 that is widely cultivated as a food and oil crop. More than 6,000 DNA markers have been developed in Arachis spp., but high-density linkage maps useful for genetics, genomics, and breeding have not been constructed due to extremely low genetic diversity. Polymorphic marker loci are useful for the construction of such high-density linkage maps. The present study used in silico analysis to develop simple sequence repeat-based and transposon-based markers. Results The use of in silico analysis increased the efficiency of polymorphic marker development by more than 3-fold. In total, 926 (34.2% of 2,702 markers showed polymorphisms between parental lines of the mapping population. Linkage analysis of the 926 markers along with 253 polymorphic markers selected from 4,449 published markers generated 21 linkage groups covering 2,166.4 cM with 1,114 loci. Based on the map thus produced, 23 quantitative trait loci (QTLs for 15 agronomical traits were detected. Another linkage map with 326 loci was also constructed and revealed a relationship between the genotypes of the FAD2 genes and the ratio of oleic/linoleic acid in peanut seed. Conclusions In silico analysis of polymorphisms increased the efficiency of polymorphic marker development, and contributed to the construction of high-density linkage maps in cultivated peanut. The resultant maps were applicable to QTL analysis. Marker subsets and linkage maps developed in this study should be useful for genetics, genomics, and breeding in Arachis. The data are available at the Kazusa DNA Marker Database (http://marker.kazusa.or.jp.

  18. Post-infection activities of fungicides against Cercospora arachidicola of peanut (Arachis hypogaea).

    Science.gov (United States)

    Johnson, Robert C; Cantonwine, Emily G

    2014-08-01

    Despite strong indirect evidence of post-infection activity by a selection of systemic fungicides against Cercospora arachidicola, the causal organism of early leaf spot of peanut, direct post-infection activities in this pathosystem have yet to be reported in detail. This study was conducted to describe the activities of pyraclostrobin, penthiopyrad and prothioconazole on early leaf spot when each fungicide was applied after pathogen penetration began and throughout the incubation period. Most C. arachidicola penetration events occurred between 3 and 5 days after inoculation (dai), and the mean incubation period was 11.8 dai. Post-infection activities of the systemic fungicides were similar for all dependent variables measured. Systemic fungicides reduced lesion density compared with the non-treated control when applied at 3, 5 and 7 dai, and disease severity was >60% less for leaves treated with a systemic fungicide at all application dates (3, 5, 7, 9, 11 and 13 dai). Pyraclostrobin, penthiopyrad and prothioconazole showed similar systemic mobility within peanut leaves and activities against C. arachidicola, and appear to completely arrest the development of the pathogen at least 2 days post penetration, and limit pathogen colonization even when applications occur after symptom onset. © 2013 Society of Chemical Industry.

  19. Comparative mapping in intraspecific populations uncovers a high degree of macrosynteny between A- and B-genome diploid species of peanut

    Directory of Open Access Journals (Sweden)

    Guo Yufang

    2012-11-01

    Full Text Available Abstract Background Cultivated peanut or groundnut (Arachis hypogaea L. is an important oilseed crop with an allotetraploid genome (AABB, 2n = 4x = 40. Both the low level of genetic variation within the cultivated gene pool and its polyploid nature limit the utilization of molecular markers to explore genome structure and facilitate genetic improvement. Nevertheless, a wealth of genetic diversity exists in diploid Arachis species (2n = 2x = 20, which represent a valuable gene pool for cultivated peanut improvement. Interspecific populations have been used widely for genetic mapping in diploid species of Arachis. However, an intraspecific mapping strategy was essential to detect chromosomal rearrangements among species that could be obscured by mapping in interspecific populations. To develop intraspecific reference linkage maps and gain insights into karyotypic evolution within the genus, we comparatively mapped the A- and B-genome diploid species using intraspecific F2 populations. Exploring genome organization among diploid peanut species by comparative mapping will enhance our understanding of the cultivated tetraploid peanut genome. Moreover, new sources of molecular markers that are highly transferable between species and developed from expressed genes will be required to construct saturated genetic maps for peanut. Results A total of 2,138 EST-SSR (expressed sequence tag-simple sequence repeat markers were developed by mining a tetraploid peanut EST assembly including 101,132 unigenes (37,916 contigs and 63,216 singletons derived from 70,771 long-read (Sanger and 270,957 short-read (454 sequences. A set of 97 SSR markers were also developed by mining 9,517 genomic survey sequences of Arachis. An SSR-based intraspecific linkage map was constructed using an F2 population derived from a cross between K 9484 (PI 298639 and GKBSPSc 30081 (PI 468327 in the B-genome species A. batizocoi. A high degree of macrosynteny was observed

  20. Drivers of Preference and Perception of Freshness in Roasted Peanuts (Arachis spp.) for European Consumers

    NARCIS (Netherlands)

    Lykomitros, Dimitrios; Fogliano, Vincenzo; Capuano, Edoardo

    2018-01-01

    Roasted peanuts are a popular snack in Europe, but their drivers of liking and perceived freshness have not been previously studied with European consumers. Consumer research to date has been focused on U.S. consumers, and only on specific peanut cultivars. In this study, 26 unique samples were

  1. STUDY ON THE PERFORMANCE OF GROUNDNUT (ARACHIS HYPOGEA L. GENOTYPES FOR SEED YIELD AND QUALITY TRAITS

    Directory of Open Access Journals (Sweden)

    Chaitanya R. KOKKIRIPATI

    2015-12-01

    Full Text Available The present investigation was carried out at Department of Genetics and Plant Breeding, Sam Higginbottom Institute of Agriculture, Technology & Sciences (SHIATS, Allahabad, Uttar Pradesh during kharif 2014. The experimental material consisted of 11 Groundnut genotypes along with one check (IND-156. The genotypes were sown at Field Experimentation Centre in three replications adopting randomized block design to evaluate seed yield and quality traits. Analysis of variance revealed that the presence of considerable variation among the genotypes for all the characters studied. On the basis of mean performance, genotype ICG 14127 revealed better performance in primary branches/ plant, pods per plant, pod yield/plant, seed yield/plant and ICG 14482 showed better performance in kernel yield q/ha, oil content, oil yield while ICG 188 showed higher protein content.

  2. Évaluation agronomique de cinq cultivars d'arachide (Arachis ...

    African Journals Online (AJOL)

    SARAH

    30 mai 2015 ... Objectif : La place de l'arachide comme culture d'exportation a déclinée dans le Nord Cameroun depuis ... de la population n'a cessé d'accroître sa production à cause de l'extension des surfaces cultivées. ..... IRA (Ed) 75p.

  3. Inheritance of fresh seed dormancy in Spanish-type peanut (Arachis ...

    African Journals Online (AJOL)

    USER

    2010-03-29

    Mar 29, 2010 ... x Spanish crosses was studied with two sets of segregating populations, an F2 population derived from .... Briefly, leaves were ground in liquid .... Figure 1. Microsatellite marker survey of a subset of 44 F1 putative hybrids ...

  4. Aplikasi Pupuk Kandang Kotoran Ayam pada Tanaman Kacang Tanah (Arachis Hypogeae L.

    Directory of Open Access Journals (Sweden)

    Neni Marlina

    2015-09-01

    Full Text Available Pupuk kandang kotoran ayam diharapkan dapat memperbaiki sifat fisik, kimia dan biologi tanah, sehingga dapat menyuburkan tanah dan membantu dalam menyumbangkan unsur hara yang dapat digunakan dalam meningkatkan hasil kacang tanah.  Penelitian ini bertujuan untuk mendapatkan takaran pupuk kandang kotoran ayam yang tepat dalam meningkatkan produksi tanaman kacang tanah. Penelitian ini telah dilaksanakan di kebun petani di Desa Payakabung Kecamatan Indralaya Utara Kabupaten Ogan Ilir dari bulan Januari sampai dengan April  2014. Rancangan yang digunakan pada penelitian ini adalah Rancangan Acak Kelompok (RAK dengan tiga perlakuan dan delapan kelompok, sehingga berjumlah 24 petak penelitian dan setiap petak diambil 10 tanaman sebagai sampel .  Perlakuannya adalah takaran pupuk kandang kotoran ayam 5, 10 dan 15 ton ha-1.  Hasil penelitian menunjukkan bahwa takaran pupuk kandang kotoran ayam sebanyak 10 ton ha-1 memberikan pertumbuhan dan produksi terbaik dengan ditunjukkan produksi per petak sebesar 2,73 kg petak-1.Poultry manure is expected to improve soil physical, chemical and biological properties. It can improve soil fertility and help in nutrients contribution that can be used to increase the yield of peanut. This study aimed to get the right dose of poultry manure fertilizer in increasing the production of ground peanut plants. This research was conducted in farmyard in the North Indralaya Payakabung District of Ogan Ilir from January to April 2014. The design used in this study was a randomized block design with three treatments and eight groups, thus consisting 24 research plots and each plot was taken as a sample of 10 plants. The treatments of poultry manure fertilizer rate 5, 10 and 15 ton ha-1. The results showed that poultry manure fertilizer rate as much as 10 tons ha-1 gave the best growth and production of 2.73 kg per plot.

  5. Compatibility of Azospirillum brasilense and Pseudomonas fluorescens in growth promotion of groundnut ( Arachis hypogea L.).

    Science.gov (United States)

    Prasad, Andhare A; Babu, Subramanian

    2017-01-01

    We attempted to study the compatibility among plant beneficial bacteria in the culture level by growing them near in the nutrient agar plates. Among all the bacteria tested, Rhizobium was found to inhibit the growth of other bacteria. From the compatible group of PGPR, we have selected one biofertilizer (Azospirillum brasilense strain TNAU) and one biocontrol agent (Pseudomonas fluorescens strain PF1) for further studies in the pot culture. We have also developed a bioformulation which is talc powder based, for individual bacteria and mixed culture. This formulation was used as seed treatment, soil application, seedling root dip and foliar spray in groundnut crop in vitro germination conditions. A. brasilense was found to enhance the tap root growth and P. fluorescens, the lateral root growth. The other growth parameters like shoot growth, number of leaves were enhanced by the combination of both of the bacteria than their individual formulations. Among the method of application tested in our study, soil application was found to be the best in yielding better results of plant growth promotion.

  6. Compatibility of Azospirillum brasilense and Pseudomonas fluorescens in growth promotion of groundnut ( Arachis hypogea L.

    Directory of Open Access Journals (Sweden)

    ANDHARE A. PRASAD

    Full Text Available ABSTRACT We attempted to study the compatibility among plant beneficial bacteria in the culture level by growing them near in the nutrient agar plates. Among all the bacteria tested, Rhizobium was found to inhibit the growth of other bacteria. From the compatible group of PGPR, we have selected one biofertilizer (Azospirillum brasilense strain TNAU and one biocontrol agent (Pseudomonas fluorescens strain PF1 for further studies in the pot culture. We have also developed a bioformulation which is talc powder based, for individual bacteria and mixed culture. This formulation was used as seed treatment, soil application, seedling root dip and foliar spray in groundnut crop in vitro germination conditions. A. brasilense was found to enhance the tap root growth and P. fluorescens, the lateral root growth. The other growth parameters like shoot growth, number of leaves were enhanced by the combination of both of the bacteria than their individual formulations. Among the method of application tested in our study, soil application was found to be the best in yielding better results of plant growth promotion.

  7. Drivers of Preference and Perception of Freshness in Roasted Peanuts (Arachis spp.) for European Consumers.

    Science.gov (United States)

    Lykomitros, Dimitrios; Fogliano, Vincenzo; Capuano, Edoardo

    2018-04-01

    Roasted peanuts are a popular snack in Europe, but their drivers of liking and perceived freshness have not been previously studied with European consumers. Consumer research to date has been focused on U.S. consumers, and only on specific peanut cultivars. In this study, 26 unique samples were produced from peanuts of different types, cultivars, origins, and with different process technologies (including baking, frying, and maceration). The peanut samples were subjected to sensory (expert panel, Spectrum TM ) and instrumental analysis (color, headspace volatiles, sugar profile, large deformation compression tests, and graded by size) and were hedonically rated by consumers in The Netherlands, Spain, and Turkey (n > 200 each). Preference Mapping (PREFMAP) on mean liking models revealed that the drivers of liking are similar across the three countries. Sweet taste, roasted peanut, dark roast, and sweet aromas and the color b * value were related to increased liking, and raw bean aroma and bitter taste with decreased liking. Further partial least square regression (PLSR) modeling of liking and perceived freshness against instrumental attributes showed that the color coordinates in combination with sucrose content and a select few headspace volatiles were strong predictors of both preference and perceived freshness. Finally, additional PLSR models focusing on the headspace volatiles only showed that liking and ''fresh'' attributes were correlated with the presence of several pyrroles in the volatile fraction, and inversely related to ''stale'' and to hexanal and 2-heptanone. This study provides insight into which flavor, taste, and appearance attributes drive liking and disliking of roasted peanuts for European consumers. The drivers are linked back to analytical attributes that can be measured instrumentally, thereby reducing the reliance on costly sensory panels. Particular emphasis is placed on color as a predictor of preference, because of the low cost of the measuring equipment, it is available to even smaller producers. In addition to preference, the study also examines whether product attributes that drive perceived freshness exist. The results can be used to design products with high acceptability across several countries within Europe. © 2018 Institute of Food Technologists®.

  8. Next generation sequence analysis of the forage peanut (Arachis pintoi virome

    Directory of Open Access Journals (Sweden)

    Pablo Andrés Gutiérrez Sánchez

    2016-07-01

    resulted in the complete genome assembly of Peanut mottle virus (9707 nt, Turnip yellows virus (5578 nt and two variants of a virus with phylogenetic affinity to the genus Allexivirus. These two variants lack ORF6 present in Allexivirus and probably belong to an uncharacterized genus within the family Alphaflexiviridae. The presence of at least three viruses infecting A. pintoi in Colombia highlights the importance of starting a germplasm clean-up program of the plant material used as seed in this crop.

  9. Pattern analysis approach reveals restriction enzyme cutting abnormalities and other cDNA library construction artifacts using raw EST data

    Directory of Open Access Journals (Sweden)

    Zhou Sun

    2012-05-01

    Full Text Available Abstract Background Expressed Sequence Tag (EST sequences are widely used in applications such as genome annotation, gene discovery and gene expression studies. However, some of GenBank dbEST sequences have proven to be “unclean”. Identification of cDNA termini/ends and their structures in raw ESTs not only facilitates data quality control and accurate delineation of transcription ends, but also furthers our understanding of the potential sources of data abnormalities/errors present in the wet-lab procedures for cDNA library construction. Results After analyzing a total of 309,976 raw Pinus taeda ESTs, we uncovered many distinct variations of cDNA termini, some of which prove to be good indicators of wet-lab artifacts, and characterized each raw EST by its cDNA terminus structure patterns. In contrast to the expected patterns, many ESTs displayed complex and/or abnormal patterns that represent potential wet-lab errors such as: a failure of one or both of the restriction enzymes to cut the plasmid vector; a failure of the restriction enzymes to cut the vector at the correct positions; the insertion of two cDNA inserts into a single vector; the insertion of multiple and/or concatenated adapters/linkers; the presence of 3′-end terminal structures in designated 5′-end sequences or vice versa; and so on. With a close examination of these artifacts, many problematic ESTs that have been deposited into public databases by conventional bioinformatics pipelines or tools could be cleaned or filtered by our methodology. We developed a software tool for Abnormality Filtering and Sequence Trimming for ESTs (AFST, http://code.google.com/p/afst/ using a pattern analysis approach. To compare AFST with other pipelines that submitted ESTs into dbEST, we reprocessed 230,783 Pinus taeda and 38,709 Arachis hypogaea GenBank ESTs. We found 7.4% of Pinus taeda and 29.2% of Arachis hypogaea GenBank ESTs are “unclean” or abnormal, all of which could be cleaned

  10. Influência da calagem, da época de colheita e da secagem na incidência de fungos e aflatoxinas em grãos de amendoim armazenados Storage peanut kernels fungal contamination and aflatoxin as affected by liming, harvest time and drying

    Directory of Open Access Journals (Sweden)

    Claudia Antonia Vieira Rossetto

    2005-04-01

    Full Text Available O objetivo deste trabalho foi avaliar a contaminação e o potencial para síntese de aflatoxinas pelos isolados do grupo Aspergillus flavus em grãos armazenados de amendoim (Arachis hypogaea L., que foram produzidos com distintos procedimentos de calagem, de colheita e de secagem. Para isto, foram avaliadas doze amostras de grãos de amendoim, cv. Botutatu, provenientes de plantas cultivadas em área que recebeu ou não a aplicação de calcário, colhidas aos 104, 114 e 124 dias após a semeadura e secas em condições ambientais e em estufa. Aos 12 e 18 meses de armazenamento, os grãos foram tratados com hipoclorito de sódio e incubados em BDA, a 20°C, por cinco dias. As espécies do grupo Aspergillus flavus foram identificadas após incubação em meio ADM. Posteriormente, o potencial toxígeno foi avaliado pelo método da cromatografia de camada delgada. A análise da freqüência de fungos revelou que os grãos de amendoim armazenados estavam contaminados por Aspergillus spp., Penicillium spp. e Fusarium spp. Os grãos de amendoim, provenientes da colheita antecipada, apresentaram maior contaminação pelo grupo Aspergillus flavus, sendo menor a proporção destes com potencial toxígeno.The objective of this work was to evaluate the effect of the storage on the potential of aflatoxin production by isolates from Aspergillus flavus group in peanut (Arachis hypogaea L.. These kernels were obtained from a field experiment with two areas (with or without lime, three times of harvest (104, 114 and 124 days after planting and two types of dryer conditions (ambient and chamber with forced air. After 12 and 18 months of storage, the kernels were treated with sodium hypochloride and incubated in a PDA at 20°C during five days. The isolates from Aspergillus flavus group were identified after incubation in ADM culture medium. The toxigenic potential was analyzed by thin layer chromatography. The genera detected were Aspergillus, Penicillium and

  11. Efeito do espaçamento entre fileiras de amendoim rasteiro na interferência de plantas daninhas na cultura Effect of peanut crop row spacing on weed interference in the culture

    Directory of Open Access Journals (Sweden)

    T.C.S. Dias

    2009-06-01

    Full Text Available Objetivou-se com este trabalho avaliar o efeito da redução do espaçamento entre fileiras nos períodos de interferência e na produtividade do amendoim rasteiro (Arachis hypogaea. O experimento foi instalado no município de Jaboticabal-SP. Os tratamentos constaram de dois espaçamentos entre fileiras (80 e 90 cm, divididos em dois grupos. No primeiro, as plantas daninhas foram controladas desde a emergência até 0 (interferência constante, 30, 45, 60, 82, 97 e 112 dias depois. No segundo, as plantas daninhas conviveram com a cultura pelos mesmos períodos do grupo anterior. O delineamento experimental adotado foi o de blocos casualizados, em arranjo de parcelas subdivididas, com quatro repetições. As principais plantas daninhas presentes na área foram Digitaria sp., Xanthium strumarium, Acanthospermum hispidum e Cenchrus echinatus. Para uma perda tolerável de 5% de produtividade, o período crítico de prevenção à interferência foi dos 27 aos 76 e dos 35 aos 96 dias após a emergência para os espaçamentos de 80 e 90 cm, respectivamente; a queda de produtividade das parcelas mantidas com interferência de plantas daninhas em relação àquelas no limpo foi superior a 80%, independentemente do espaçamento.The aim of this research was to evaluate the effect of reducing the spacing between rows in periods of weed interference and peanut (Arachis hypogaea yield. The experiment was carried out in Jaboticabal, Brazil. Treatments consisted of two row spacings (80 to 90 cm, divided into two groups. In the first group, the weeds were controlled since emergence up to 0 (constant interference, 30, 45, 60, 82, 97 and 112 days. In the second group, the weeds were allowed to grow with the peanut culture during the same periods. The experiment was arranged in a randomized block design with treatments in split-plots, with four repetitions. The main weeds in the area were Digitaria sp., Xanthium strumarium, Acanthospermum hispidum and Cenchrus

  12. Avaliação da micoflora e ocorrência de micotoxinas em cascas de amendoim em diferentes estágios de maturação da vagem Evaluation of mycoflora and occurrence of mycotoxins in peanut hulls at different pod maturation stages

    Directory of Open Access Journals (Sweden)

    Edlayne Gonçalez

    2008-10-01

    Full Text Available As cascas de amendoim (Arachis hypogaea L. são de grande importância para confecção de cama de frangos, de gado de leite e como fonte de fibras para ruminantes, portanto a elucidação dos mecanismos de contaminação por fungos toxigênicos e por micotoxinas em amendoim é imprescindível, especialmente para que medidas preventivas possam ser tomadas. Realizou-se, este trabalho, em Junqueirópolis, Estado de São Paulo, Brasil. Os principais fungos isolados nas cascas de amendoim foram Fusarium ssp. (78,75 %, Rhizopus ssp. (14,1 % e A. flavus (11,75 %. No solo foram isolados Penicillium spp., Fusarium spp. e Aspergillus flavus, entre outros. Aflatoxinas foram detectadas em amostras de cascas de amendoim a partir do estágio de granação em concentrações que variaram de 5,42 μg/kg a 218,52 μg/kg. Ácido ciclopiazônico e fumonisinas B1 e B2 não foram detectadas. A presença de A. flavus e aflatoxinas nas amostras, revela a importância de um controle das cascas de amendoim antes de sua utilização. Boas práticas agrícolas são indicadas para região, uma vez que a contaminação das vagens ocorreu antes da colheita.Peanut (Arachis hypogaea L. hulls are very important because they are used as litter to poultry and dairy cattle and as fiber source to cattle. The elucidation of the peanuts contamination mechanisms by toxigenic fungi and their mycotoxins is vital, specially for prevention measurements. The peanuts total mycoflora and mycotoxin contamination were analyzed in plants sampled in Junqueirópolis, in São Paulo State (Brazil at different stages of the pod maturity. The prevalent mycoflora in peanut hulls were Fusarium spp., Rhizopus spp. and Aspergillus flavus. In soil under the peanut crop, the genus Penicillium spp., Fusarium spp. and A. flavus were detected. Aflatoxins were detected in peanut hull samples since filling pod stage in concentrations from 5.42 μg/kg to 218.52 μg/kg. Cyclopiazonic acid and fumonisins were not

  13. Análise histoquímica foliar do amendoim: genótipos 'Tatu' e SO-909 Leaf histochemical analyses of peanut: genotypes 'Tatu' and SO-909

    Directory of Open Access Journals (Sweden)

    Renato Ferraz de Arruda Veiga

    1992-01-01

    Full Text Available Este trabalho teve por finalidade a análise histoquímica foliar de dois genótipos de amendoim (Arachis hypogaea L., do tipo botânico Valência: SO-53 ('Tatu' e SO-909 (PI-259747, cuja literatura demonstra apresentarem respostas diferentes de resistência às principais moléstias fúngicas foliares do Brasil. Seções transversais das seguintes estruturas - pulvino, haste peciolar, raque, pulvínulo e folíolo - e seções paradérmicas de folíolos coletados em dois anos agrícolas consecutivos, foram analisadas quanto à presença de alcalóides, amido, calose, celulose pura, celulose com pectina, cera, cristais, cutina, lignina, mucilagem, óleo, resina, tanino e ureídeos (micrograma por folíolo (grama. As diferenças qualitativas histoquímicas observadas nos diversos tecidos, como a freqüência de tanino, alcalóide, pectina e óleo, supostamente, podem ser responsáveis pela resistência ou suscetibilidade dos genótipos às moléstias fúngicas foliares. Para fins de caracterização, mostrou-se eficiente a avaliação de pureza de celulose.Leaf histochemical analyses were made in two genotypes of Arachis hypogaea L., of the Valencia group, which present different responses to some of the peanut foliar diseases. The analyses were performed on cross sections of the pulvini, petiole, rachis, pulvinulus and leaflets. The following constituents were observed: alkaloids, callose, cellulose with pectin, cristal, cutin, lignin, mucilage, oil, pure cellulose, resin, starch, tannin, wax and weight of ureides by leaflets. Some histochemical characteristics such the amount of tannin, alkaloids, pectin and oil can be produce different responses of peanut to foliar fungal diseases, and can be used in the characterization of peanut genotypes like the amount of pure cellulose and cellulose with pectin.

  14. Intake, digestibility, and nitrogen retention by sheep supplemented with warm-season legume haylages or soybean meal.

    Science.gov (United States)

    Foster, J L; Adesogan, A T; Carter, J N; Blount, A R; Myer, R O; Phatak, S C

    2009-09-01

    The high cost of commercial supplements necessitates evaluation of alternatives for ruminant livestock fed poor quality warm-season grasses. This study determined how supplementing bahiagrass haylage (Paspalum notatum Flügge cv. Tifton 9) with soybean [Glycine max (L.) Merr.] meal or warm-season legume haylages affected the performance of lambs. Forty-two Dorper x Katadhin lambs (27.5 +/- 5 kg) were fed for ad libitum intake of bahiagrass haylage (67.8% NDF, 9.6% CP) alone (control) or supplemented with soybean meal (18.8% NDF, 51.4% CP) or haylages of annual peanut [Arachis hypogaea (L.) cv. Florida MDR98; 39.6% NDF, 18.7% CP], cowpea [Vigna unguiculata (L.) Walp. cv. Iron clay; 44.1% NDF, 16.0% CP], perennial peanut (Arachis glabrata Benth. cv. Florigraze; 40.0% NDF, 15.8% CP), or pigeonpea [Cajanus cajan (L.) Millsp. cv. GA-2; 65.0% NDF, 13.7% CP]. Haylages were harvested at the optimal maturity for maximizing yield and nutritive value, wilted to 45% DM, baled, wrapped in polyethylene plastic, and ensiled for 180 d. Legumes were fed at 50% of the dietary DM, and soybean meal was fed at 8% of the dietary DM to match the average CP concentration (12.8%) of legume haylage-supplemented diets. Lambs were fed each diet for a 14-d adaptation period and a 7-d data collection period. Each diet was fed to 7 lambs in period 1 and 4 lambs in period 2. Pigeonpea haylage supplementation decreased (P haylages increased (P haylage, all supplements increased (P haylage supplementation, but unaffected (P = 0.05) by other supplements. Efficiency of microbial protein synthesis was unaffected (P = 0.05) by diet. Ruminal ammonia concentration was increased (P = 0.01) by all supplements, but only soybean meal and annual peanut haylage increased (P haylages are promising protein supplements for growing lambs.

  15. Utilization of induced mutations for groundnut breeding in Uganda

    International Nuclear Information System (INIS)

    Busolo-Bulafu, C.M.

    1987-01-01

    Groundnuts (Arachis hypogaea L.) are on high demand in Uganda. There is, therefore, an urgent need to improve groundnut yields through breeding. The main objectives besides yield are the following: 1. To improve disease resistance: (a) rosette virus transmitted by aphids (Aphis craccivora); (b) leafspot caused by Cercospora arachidicola (early) and Cercosporidium personatum (late). 2. To advance the maturity period of high yielding varieties so as to fit better into the rainfall pattern of the main growing areas. 3. To improve seed uniformity, seed size and quality (protein, oil). 4. To reduce plant height by shortening the internodes so as to have more flower production near the ground. For mutation breeding three erect groundnut cultivars were used, Roxo a recommended commercial variety; Red Beauty (Bl) a recommended local variety and No. 534 a tan skinned variety. Seeds of the three varieties were irradiated in 1976 at the FAO/IAEA Agricultural Section of the IAEA Laboratory Seibersdorf, with 1500 rad of fast neutrons (Nf) or 20 krad of 60 Co gamma rays. The pedigree method of selection was used until M9. During 1985 and 1986, seven mutant selections of Red Beauty and one from Roxo were tested in replicated yield trials. Results are given. On the basis of plot yields some of the Red Beauty mutant lines outyielded the parent but not the commercial variety Roxo

  16. Protein Binding Capacity of Different Forages Tannin

    Science.gov (United States)

    Yusiati, L. M.; Kurniawati, A.; Hanim, C.; Anas, M. A.

    2018-02-01

    Eight forages of tannin sources(Leucaena leucocephala, Arachis hypogaea, Mimosa pudica, Morus alba L, Swietenia mahagoni, Manihot esculenta, Gliricidia sepium, and Bauhinia purpurea)were evaluated their tannin content and protein binding capacity. The protein binding capacity of tannin were determined using precipitation of bovine serum albumin (BSA). Swietenia mahagonihas higest total tannin level and condensed tannin (CT) compared with other forages (P<0.01). The Leucaena leucocephala has highest hydrolysable tannin (HT) level (P<0.01). The total and condensed tannin content of Swietenia mahagoni were 11.928±0.04 mg/100 mg and 9.241±0.02mg/100mg dry matter (DM) of leaves. The hydrolysable tannin content of Leucaena leucocephala was 5.338±0.03 mg/100 mg DM of leaves. Binding capacity was highest in Swietenia mahagoni and Leucaena leucocephala compared to the other forages (P<0.01). The optimum binding of BSA to tannin in Leucaena leucocephala and Swietenia mahagoniwere1.181±0.44 and 1.217±0.60mg/mg dry matter of leaves. The present study reports that Swietenia mahagoni has highest of tannin content and Leucaena leucocephala and Swietenia mahagoni capacity of protein binding.

  17. Plant growth promotion and root colonization by EPS producing Enterobacter sp. RZS5 under heavy metal contaminated soil.

    Science.gov (United States)

    Sayyed, R Z; Patel, P R; Shaikh, S S

    2015-02-01

    The heavy metal resistant bacterium isolated from field soil and identified as Enterobacter sp. RZS5 tolerates a high concentration (100-2000 μM) of various heavy metal ions such as Mn2+, Ni2+, Zn2+, Cu2+, CO2+ and Fe2+ when grown in such environment and produces exopolysaccharides (EPS). Here, we have demonstrated EPS production by Enterobacter sp. RZS5 during 60 h of growth in yeast extract mannitol broth (YEMB). The yield increased by two fold after the addition of 60 μM of Ca2+; 50 μM of Fe2+ and 60 μM of Mg2+ ions in YEMB, and the optimization of physico-chemical parameters. EPS was extracted with 30% (v/v) of isopropanol as against the commonly used 50% (v/v) isopropanol method. EPS-rich broth promoted seed germination, shoot height, root length, number of leaves and chlorophyll content of wheat (Triticum aestivum) seed and peanut (Arachis hypogaea) seed. The higher colony-forming unit of Enterobacter sp. in soil inoculated with EPS rich broth of Enterobacter sp. indicated the root colonizing potential and rhizosphere competence of the isolate. The FTIR spectra of the EPS extract confirmed the presence of the functional group characteristics of EPS known to exhibit a high binding affinity towards certain metal ions. This overall growth and vigour in plants along with the effective root colonization, reflected the potential of the isolate as an efficient bio-inoculant in bioremediation.

  18. Gamma-ray-induced bold seeded early maturing groundnut selections

    Energy Technology Data Exchange (ETDEWEB)

    Manoharan, V; Thangavelu, S [Regional Research Station, Vriddhachalam, Tamil Nadu (India)

    1990-07-01

    Full text: ''Chico'' is an early maturing (85-90 days) erect groundnut (Arachis hypogaea L.) genotype utilised in groundnut improvement to incorporate earliness in high yielding varieties. Though it has high shelling out-turn, its yield potential is low since it has small seeds. Mutation breeding was started with the objective of improving the seed size. In a preliminary experiment, dry seeds were treated with 20, 30, 40 or 50 kR of gamma rays. The M{sub 1} generation was grown during the post rainy season of 1988-1989. The M{sub 2} generation was planted as individual plant progeny rows during the rainy season of 1989. 105 progeny rows were studied, the total number of M{sub 2} plants being 1,730. All the M{sub 2} plants were harvested 90 days after sowing. Seven mutants with bold seed size were obtained. The mutants had 100 kernel weight ranging from 22.2 to 40.4 g compared to 21.1 g of control. The study is in progress. (author)

  19. Utilization of genetic variation created through induced mutations to develop drought tolerant groundnut mutants for the sandy rain-fed areas of western Sudan

    International Nuclear Information System (INIS)

    Abdalla, E. G. A.

    2000-10-01

    Groundnut (Arachis hypogaea. L.) is grown as a cash crop throughout the tropical and warm temperate regions of the world. Approximately 80% of the global production comes from developing countries and 67% of the total is produced in the seasonally rain fed areas of the semi-arid tropics (Gibbons, 1980). In Sudan, groundnut is grown under rain fed and irrigated sectors. Rain fed production accounts for 80% of the total production. Yield under the traditional rain fed farming conditions are very low (700kg/ha) compared to the world average (1200kg/ha). Low rainfall (250-450 mm) and short growing seasons (<90 days) are major constraints to groundnut production. Under these situations survival of the subsistence farmers depends entirely on minimizing the probabilities of crop failure. This can to some extent be addressed by adopting short term strategies of incorporating various physiological defense mechanisms into crop varieties to allow a certain level of realized yield in a more reliable manner (Subbarao et al, 1995)

  20. Simultaneous column chromatographic extraction and purification of abscisic acid in peanut plants for direct HPLC analysis.

    Science.gov (United States)

    Zhang, Ya-Wen; Fan, Wei-Wei; Li, Hui; Ni, He; Han, Han-Bing; Li, Hai-Hang

    2015-10-01

    Abscisic acid (ABA), a universal signaling molecule, plays important roles in regulating plant growth, development and stress responses. The low contents and complex components in plants make it difficult to be accurately analyzed. A novel one-step sample preparation method for ABA in plants was developed. Fresh peanut (Arachis hypogaea) plant materials were fixed by oven-drying, microwave drying, boiling or Carnoy's fixative, and loaded onto a mini-preparing column. After washed the impurities, ABA was eluted with a small amount of solvent. ABA in plant materials was completely extracted and purified in 2mL solution and directly analyzed by HPLC, with a 99.3% recovery rate. Multiple samples can be simultaneously prepared. Analyses using this method indicated that the endogenous ABA in oven-dried peanut leaves increased 20.2-fold from 1.01 to 20.37μgg(-1) dry weight within 12h and then decreased in 30% polyethylene glycol 6000 treated plants, and increased 3.34-fold from 0.85 to 2.84μgg(-1) dry weight in 5 days and then decreased in soil drought treated plants. The method combined the column chromatographic extraction and solid-phase separation technologies in one step and can completely extracted plant endogenous ABA in a purified and highly concentrated form for direct HPLC analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Draft whole genome sequence of groundnut stem rot fungus Athelia rolfsii revealing genetic architect of its pathogenicity and virulence.

    Science.gov (United States)

    Iquebal, M A; Tomar, Rukam S; Parakhia, M V; Singla, Deepak; Jaiswal, Sarika; Rathod, V M; Padhiyar, S M; Kumar, Neeraj; Rai, Anil; Kumar, Dinesh

    2017-07-13

    Groundnut (Arachis hypogaea L.) is an important oil seed crop having major biotic constraint in production due to stem rot disease caused by fungus, Athelia rolfsii causing 25-80% loss in productivity. As chemical and biological combating strategies of this fungus are not very effective, thus genome sequencing can reveal virulence and pathogenicity related genes for better understanding of the host-parasite interaction. We report draft assembly of Athelia rolfsii genome of ~73 Mb having 8919 contigs. Annotation analysis revealed 16830 genes which are involved in fungicide resistance, virulence and pathogenicity along with putative effector and lethal genes. Secretome analysis revealed CAZY genes representing 1085 enzymatic genes, glycoside hydrolases, carbohydrate esterases, carbohydrate-binding modules, auxillary activities, glycosyl transferases and polysaccharide lyases. Repeat analysis revealed 11171 SSRs, LTR, GYPSY and COPIA elements. Comparative analysis with other existing ascomycotina genome predicted conserved domain family of WD40, CYP450, Pkinase and ABC transporter revealing insight of evolution of pathogenicity and virulence. This study would help in understanding pathogenicity and virulence at molecular level and development of new combating strategies. Such approach is imperative in endeavour of genome based solution in stem rot disease management leading to better productivity of groundnut crop in tropical region of world.

  2. Efficiency of green manure species on the population of reniform nematode

    Directory of Open Access Journals (Sweden)

    Cristiane Gonçalves Gardiano

    2014-02-01

    Full Text Available The objective of this study was to evaluate the growing of soil improving crops on the population of Rotylenchulus reniformis in naturally infested soil. It was evaluated the effect of 6 species of plants as cover crops in winter and 13 summer species and a fallow treatment on the nematode population under greenhouse. After 60 days, the root system was collected. Then, a sample of soil was taken in order to extract juveniles from the soil and quantification the final population of the pathogen in each pot for determining of the reproduction factor (RF. Fallow and all winter species of green manure, except hairy vetch, reduced the population of R. reniformis after cultivation in infested soil, in comparison to the control. Regarding summer cover crops, it was observed that sorghum ‘SI03204’ (Sorghum vulgare, millet ‘BRS1501’ (Pennisetum glaucum, Brachiaria ruziziensis, finger millet (Eleusine coracana, estylo ‘Campo Grande’ (Stylosanthes capitata x S. macrocephala, peanut ‘IAC Tatu ST’ (Arachis hypogaea and dwarf velvet bean (Mucuna deeringiana reduced the population of R. reniformis, when compared to the control, could be used in the management of this nematode.

  3. Crop candidates for the bioregenerative life support systems in China

    Science.gov (United States)

    Chunxiao, Xu; Hong, Liu

    The use of plants for life support applications in space is appealing because of the multiple life support functions by the plants. Research on crops that were grown in the life support system to provide food and oxygen, remove carbon dioxide was begun from 1960. To select possible crops for research on the bioregenerative life support systems in China, criteria for the selection of potential crops were made, and selection of crops was carried out based on these criteria. The results showed that 14 crops including 4 food crops (wheat, rice, soybean and peanut) and 7 vegetables (Chinese cabbage, lettuce, radish, carrot, tomato, squash and pepper) won higher scores. Wheat ( Triticum aestivum L.), rice ( Oryza sativa L.), soybean ( Glycine max L.) and peanut ( Arachis hypogaea L.) are main food crops in China. Chinese cabbage ( Brassica campestris L. ssp. chinensis var. communis), lettuce ( Lactuca sativa L. var. longifolia Lam.), radish ( Raphanus sativus L.), carrot ( Daucus carota L. var. sativa DC.), tomato ( Lycopersicon escalentum L.), squash ( Cucurbita moschata Duch.) and pepper ( Capsicum frutescens L. var. longum Bailey) are 7 vegetables preferred by Chinese. Furthermore, coriander ( Coriandum sativum L.), welsh onion ( Allium fistulosum L. var. giganteum Makino) and garlic ( Allium sativum L.) were selected as condiments to improve the taste of space crew. To each crop species, several cultivars were selected for further research according to their agronomic characteristics.

  4. Detection of Peanut Allergen Ara h 6 in Commercially Processed Foods using a Single-Walled Carbon Nanotube-Based Biosensor.

    Science.gov (United States)

    Sobhan, Abdus; Oh, Jun-Hyun; Park, Mi-Kyung; Lee, Jinyoung

    2018-06-12

    Background : The peanut protein Arachis hypogaea (Ara h) 6 is one ofthe most serious food allergens that contributes to food-related, life-threatening problems worldwide. The extremely low allergic dose demands for more selective and rapid methods for detecting Ara h 6. Objective : The goal of this study was to develop a single-walled carbon nanotube (SWCNT)-based biosensor for the rapid detection of Ara h 6 in commercial food products. Methods : The detection principle of this biosensor was based on the binding of Ara h 6 to the anti-Ara h 6 antibody (pAb) through 1-pyrenibutanoic acid succinimidyl ester. The resistance difference (ΔR) was calculated via linear sweep voltammetry using a potentiostat. Results : The ∆R increased as the Ara h 6 concentrations increased above the range of 10 0 -10 7 pg/L. A specificity analysis showed that the anti-Ara h 6 pAb selectively interacted with Ara h 6 molecules in the buffer solution (pH 7.4). Conclusions : This research proposes that an SWCNT-based biosensor in self-assembly with antibodies could be an effective tool for the rapid detection of allergen proteins in food. Highlights : The developed biosensor exhibited higher sensitivity and selectivity. Application studies resulted in precise Ara h 6 detection in peanut-containing processed food.

  5. Aspergillus korhogoensis, a Novel Aflatoxin Producing Species from the Côte d’Ivoire

    Directory of Open Access Journals (Sweden)

    Amaranta Carvajal-Campos

    2017-10-01

    Full Text Available Several strains of a new aflatoxigenic species of Aspergillus, A. korhogoensis, were isolated in the course of a screening study involving species from section Flavi found contaminating peanuts (Arachis hypogaea and peanut paste in the Côte d’Ivoire. Based on examination of four isolates, this new species is described using a polyphasic approach. A concatenated alignment comprised of nine genes (ITS, benA, cmdA, mcm7, amdS, rpb1, preB, ppgA, and preA was subjected to phylogenetic analysis, and resulted in all four strains being inferred as a distinct clade. Characterization of mating type for each strain revealed A. korhogoensis as a heterothallic species, since three isolates exhibited a singular MAT1-1 locus and one isolate exhibited a singular MAT1-2 locus. Morphological and physiological characterizations were also performed based on their growth on various types of media. Their respective extrolite profiles were characterized using LC/HRMS, and showed that this new species is capable of producing B- and G-aflatoxins, aspergillic acid, cyclopiazonic acid, aflavarins, and asparasones, as well as other metabolites. Altogether, our results confirm the monophyly of A. korhogoensis, and strengthen its position in the A. flavus clade, as the sister taxon of A. parvisclerotigenus.

  6. "Chitin-specific" peroxidases in plants.

    Science.gov (United States)

    Maksimov, I V; Cherepanova, E A; Khairullin, R M

    2003-01-01

    The activity of various plant peroxidases and the ability of their individual isoforms to bind chitin was studied. Some increase in peroxidase activity was observed in crude extracts in the presence of chitin. Activated peroxidases of some species fell in the fraction not sorbed on chitin and those of other species can bind chitin. Only anionic isoperoxidases from oat (Avena sativa), rice (Oryza sativa), horseradish (Armoracia rusticana), garden radish (Raphanus sativus var. radicula), peanut (Arachis hypogaea), and tobacco (Nicotiana tabacum Link et Otto) were sorbed on chitin. Both anionic and cationic isoforms from pea (Pisum sativum), galega(Galega orientalis), cucumber (Cucumis sativus), and zucchini (Cucurbita pepo L.) were sorbed on chitin. Peroxidase activation under the influence of chitin was correlated to the processes that occur during hypersensitive reaction and lignification of sites, in which pathogenic fungus penetrates into a plant. The role of chitin-specific isoperoxidases in inhibition of fungal growth and connection of this phenomenon with structural characteristics of isoperoxidases are also discussed.

  7. Conjoint effect of oil-seed cakes and Pseudomonas fluorescens on the growth of chickpea in relation to the management of plant-parasitic nematodes

    Directory of Open Access Journals (Sweden)

    Rose Rizvi

    2012-12-01

    Full Text Available Soil application of organics has been explored as an alternative means of organic management of plant-parasitic nematodes. Efficiency of different oil-seed cakes of neem (Azadirachta indica, castor (Ricinus communis, groundnut (Arachis hypogaea, linseed (Linum usitatissimum, sunflower (Helianthus annuus and soybean (Glycine max were evaluated in field conditions with association of Pseudomonas fluorescens in relation to growth parameters of chickpea and population of plant-parasitic nematodes. Their efficacious nature was highly effective in reducing the population of these dominant soil nematodes. Significant improvement was observed in plant-growth parameters such as plant weight, percent pollen fertility, pod numbers, root-nodulation and chlorophyll content of chickpea, seemed to be due to reduction in disease incidence and might be due to growth promoting substances secreted by P. fluorescens. The multiplication rate of nematodes was less in the presence of P. fluorescens as compared to its absence. Most effective combination of P. fluorescens was observed with neem cake.

  8. Intercropping competition between apple trees and crops in agroforestry systems on the Loess Plateau of China.

    Science.gov (United States)

    Gao, Lubo; Xu, Huasen; Bi, Huaxing; Xi, Weimin; Bao, Biao; Wang, Xiaoyan; Bi, Chao; Chang, Yifang

    2013-01-01

    Agroforestry has been widely practiced in the Loess Plateau region of China because of its prominent effects in reducing soil and water losses, improving land-use efficiency and increasing economic returns. However, the agroforestry practices may lead to competition between crops and trees for underground soil moisture and nutrients, and the trees on the canopy layer may also lead to shortage of light for crops. In order to minimize interspecific competition and maximize the benefits of tree-based intercropping systems, we studied photosynthesis, growth and yield of soybean (Glycine max L. Merr.) and peanut (Arachis hypogaea L.) by measuring photosynthetically active radiation, net photosynthetic rate, soil moisture and soil nutrients in a plantation of apple (Malus pumila M.) at a spacing of 4 m × 5 m on the Loess Plateau of China. The results showed that for both intercropping systems in the study region, soil moisture was the primary factor affecting the crop yields followed by light. Deficiency of the soil nutrients also had a significant impact on crop yields. Compared with soybean, peanut was more suitable for intercropping with apple trees to obtain economic benefits in the region. We concluded that apple-soybean and apple-peanut intercropping systems can be practical and beneficial in the region. However, the distance between crops and tree rows should be adjusted to minimize interspecies competition. Agronomic measures such as regular canopy pruning, root barriers, additional irrigation and fertilization also should be applied in the intercropping systems.

  9. Evaluation of BNF by groundnut and responses of cereal crops to different levels of nitrogen fertilizer in the coastal area of the Syrian Arab Republic

    International Nuclear Information System (INIS)

    Janat, M.

    1996-01-01

    A two course crop rotation experiment was conducted over a period of two years in order to evaluate the biological nitrogen fixation (BNF) by groundnut (Arachis hypogaea) and its contribution to the subsequent cereal crop in terms of its N-conserving effect. Also the response of the treatment crop (Zea mays L.) to different levels of N-fertilization (100 and 150 kg N ha -1 ) were evaluated. Moreover, the effect of a previous crop, N rate and timing on the test crop (Triticum aestivum) was assessed. Results showed that groundnut fixed as much as 52.9 and 23.4 kg N ha -1 at pod filling stage and 66.7 and 34.4 at physiological maturity stage for the 1992 and 1993 growing season, respectively. The test crop did not benefit from the residual N due to the high precipitation in the region leaching down most of the inorganic nitrogen beyond the root zone. In the 1992 growing season, the lower N rate for maize (100 kg N ha -1 ) was superior over the higher rate (150 kg N ha -1 ). But due to water stress in the 1993 growing season, a different trend with regard to the response of maize to fertilizer N was obtained. (author). 14 refs, 1 fig., 10 tabs

  10. Overexpression of Bacterial mtlD Gene in Peanut Improves Drought Tolerance through Accumulation of Mannitol

    Directory of Open Access Journals (Sweden)

    Tengale Dipak Bhauso

    2014-01-01

    Full Text Available In the changing global environmental scenarios, water scarcity and recurrent drought impose huge reductions to the peanut (Arachis hypogaea L. crop yield. In plants, osmotic adjustments associated with efficient free radical scavenging ability during abiotic stress are important components of stress tolerance mechanisms. Mannitol, a compatible solute, is known to scavenge hydroxyl radicals generated during various abiotic stresses, thereby conferring tolerance to water-deficit stress in many plant species. However, peanut plant is not known to synthesize mannitol. Therefore, bacterial mtlD gene coding for mannitol 1-phosphate dehydrogenase under the control of constitutive promoter CaMV35S was introduced and overexpressed in the peanut cv. GG 20 using Agrobacterium tumefaciens-mediated transformation. A total of eight independent transgenic events were confirmed at molecular level by PCR, Southern blotting, and RT-PCR. Transgenic lines had increased amount of mannitol and exhibited enhanced tolerance in response to water-deficit stress. Improved performance of the mtlD transgenics was indicated by excised-leaf water loss assay and relative water content under water-deficit stress. Better performance of transgenics was due to the ability of the plants to synthesize mannitol. However, regulation of mtlD gene expression in transgenic plants remains to be elucidated.

  11. PICS bags safely store unshelled and shelled groundnuts in Niger.

    Science.gov (United States)

    Baributsa, D; Baoua, I B; Bakoye, O N; Amadou, L; Murdock, L L

    2017-05-01

    We conducted an experiment in Niger to evaluate the performance of hermetic triple layer (Purdue Improved Crop Storage- PICS) bags for the preservation of shelled and unshelled groundnut Arachis hypogaea L. Naturally-infested groundnut was stored in PICS bags and woven bags for 6.7 months. After storage, the average oxygen level in the PICS bags fell from 21% to 18% (v/v) and 21%-15% (v/v) for unshelled and shelled groundnut, respectively. Identified pests present in the stored groundnuts were Tribolium castaneum (Herbst), Corcyra cephalonica (Stainton) and Cryptolestes ferrugineus (Stephens). After 6.7 months of storage, in the woven bag, there was a large increase in the pest population accompanied by a weight loss of 8.2% for unshelled groundnuts and 28.7% for shelled groundnut. In PICS bags for both shelled and unshelled groundnuts, by contrast, the density of insect pests did not increase, there was no weight loss, and the germination rate was the same compared to that recorded at the beginning of the experiment. Storing shelled groundnuts in PICS bags is the most cost-effective way as it increases the quantity of grain stored.

  12. Cytochemical localization of small intestinal glycoconjugates by lectin histochemistry in controls and subjects with cystic fibrosis.

    Science.gov (United States)

    Jacobs, L R; De Fontes, D; Cox, K L

    1983-05-01

    Human mucosal glycoconjugates were examined in normal small intestinal biopsies from five control subjects using six different fluorescein-conjugated lectins: Triticum vulgare agglutinin (WGA), Ulex europaeus agglutinin I (UEA1), Ricinus communis agglutinin I (RCA1), glycin max-soy bean agglutinin (SBA), Dolichus biflorus agglutinin (DBA), and Arachis hypogaea peanut agglutinin (PNA). These plant agglutinins bind to specific nonreducing end-terminal carbohydrate residues. Only the lectins derived from WGA, which produced the strongest staining, and UEA1 consistently bound to both intestinal goblet cell mucin and epithelial cell microvillar membranes. The intensity of lectin binding was greatest in the upper villus and diminished down towards the crypt, being weakest in the crypt base. Similar histochemical studies carried out on small bowel biopsies from five patients with cystic fibrosis revealed no major qualitative differences between the intestinal glycoconjugates in normal subjects and those with cystic fibrosis. These results suggest that glycoconjugate biosynthesis of human intestinal goblet cell mucin and epithelial cell membranes may be complete and hence full differentiation achieved only when these cells have migrated out of the crypt and onto the villus.

  13. Histochemical characterization of glycoproteins present in jejunal and colonic goblet cells of pigs on different diets. A biopsy study using chemical methods and peroxidase-labelled lectins.

    Science.gov (United States)

    Moré, J; Fioramonti, J; Bénazet, F; Buéno, L

    1987-01-01

    We examined the glycoprotein composition of intestinal goblet cells in jejunal and colonic biopsies obtained from pigs on different diets. Paraffin sections were stained both chemically and with the following horseradish-peroxidase conjugated lectins: Canavalia ensiformis (Con-A), Limulus polyphemus (LPA), Lotus tetragonolobus (LTA), Arachis hypogaea (PNA), Ricinus communis (RCA1), Glycine max (SBA) and Triticum vulgaris (WGA). Using chemical staining procedures, only small quantitative differences were noted between the two organs. With respect to lectin staining, the mucus of the jejunum was characterized by the absence of Con-A binding sites, and colonic mucus consistently exhibited an absence of SBA affinity. After dietary modifications, O-acetyl sialic acid reactivity was lowered in the jejunum but was enhanced in the colon. In the jejunum, the glycoproteins became neuraminidase susceptible, whereas the colon became characterized by the absence of neutral mucins. The affinity for the tested lectins after the different diets was variable, but the most striking effects were observed after the fibreless diet (milk alone). Our data suggest the existence of marked regional variations in goblet-cell mucus and indicate significant differences between the glycoprotein components of the jejunal and colonic mucosa. Furthermore, the biosynthesis of mucins in both regions was altered by even only short-term feeding modifications.

  14. Selection of Rhizobium strain from Wonogiri, Central Java on the growth of soybean (Glycine max L. on the sand sterile medium in greenhouse

    Directory of Open Access Journals (Sweden)

    SRI PURWANINGSIH

    2005-07-01

    Full Text Available An experiment on the selection of Rhizobium strain from Wonogiri, Central Java on the growth of soybean (Glycine max L. on the sand sterile medium in green house. The aim of the experiment the selection and potency of the Rhizobium strain to increase the growth of soybean. The experiment was carried out in green house condition in Microbiology Division, Research Center for Biology-LIPI with sterile sand medium. The research design was Completely Randomized Design with three replications for each treatment. The Rhizobium strains used were 1 W (isolated from bean, Vigna radiata, 2 W (isolated from soybean, 3 W (isolated from bean, 4 W (isolated from soybean, 5 W (isolated from soybean, 6 W (isolated from peanut, Arachis hypogaea, 7 W (isolated from peanut, 8 W (isolated from peanut, the controls were uninoculated with Rhizobium strain and without urea fertilizer (K1, uninoculated and with urea fertilizer equal 100 kg/ha (K2. The plants were harvested after 50 days, the variable of investigation were the dry weight of canopy, roots, nodules root, total plants, number of nodules and ‘symbiotic capacity”. The results showed that all of experiment plant which be inoculated with Rhizobium able to form nodule. Strain of 2 W (isolated from soybean has given the best effects on the growth of soybean.

  15. Gamma-ray-induced bold seeded early maturing groundnut selections

    International Nuclear Information System (INIS)

    Manoharan, V.; Thangavelu, S.

    1990-01-01

    Full text: ''Chico'' is an early maturing (85-90 days) erect groundnut (Arachis hypogaea L.) genotype utilised in groundnut improvement to incorporate earliness in high yielding varieties. Though it has high shelling out-turn, its yield potential is low since it has small seeds. Mutation breeding was started with the objective of improving the seed size. In a preliminary experiment, dry seeds were treated with 20, 30, 40 or 50 kR of gamma rays. The M 1 generation was grown during the post rainy season of 1988-1989. The M 2 generation was planted as individual plant progeny rows during the rainy season of 1989. 105 progeny rows were studied, the total number of M 2 plants being 1,730. All the M 2 plants were harvested 90 days after sowing. Seven mutants with bold seed size were obtained. The mutants had 100 kernel weight ranging from 22.2 to 40.4 g compared to 21.1 g of control. The study is in progress. (author)

  16. Simultaneous detection of peanut and hazelnut allergens in food matrices using multiplex PCR method

    Directory of Open Access Journals (Sweden)

    Eva Renčová

    2014-01-01

    Full Text Available Multiplex PCR analysis for the detection of two targeting segments of genes coding major food protein allergens as peanut (Arachis hypogaea Ara h 1 gene and hazelnut (Corylus avellana Cor a 1 gene was developed. Two sets of primers were designed and tested to their specificity on a broad range of ingredients. The identity of amplicons (Ara h 1- 180 bp, Cor a 1 – 258 bp by sequencing and alignment of sequences with sequences deposited in Genbank was confirmed. When testing the specificity of designed primer pairs on a spectrum of food ingredients, no cross reactions were detected. A potential inhibition of PCR reaction was eliminated using the universal plant primers of chloroplast gene 124 bp for the plant matrices confirmation. The intrinsic detection limit was 10 pg·ml-1 and the practical detection limit was 0.001% w/w (10 mg·kg-1 for both peanuts and hazelnuts. The method was applied to the investigation of 60 commercial food samples. The developed multiplex PCR method is cheap, specific and sensitive enough and can be used as a simple, one day procedure for the checking of undeclared peanut and hazelnut major allergens in food.

  17. Characterization of hams added with nut residual pastes from the mechanical extraction of oil

    Directory of Open Access Journals (Sweden)

    Juan José Luna Guevara

    2013-06-01

    Full Text Available Nuts contain in their composition nutrients and bioactive compounds that when consumed in sufficient amounts may provide health benefits. In this study was evaluated the influence of the addition of residual pastes (10%, obtained from the extraction of oil from walnut (Juglans regia L., pecan (Carya illinoinensis (Wangenh. K. Koch, variety Western Shley, and peanut (Arachis hypogaea, on the modification of some textural, proximate, physicochemical, microbiological and sensory characteristics of cooked hams. Hams were stored at 4 ° C for 21 days. Hams containing pastes significantly increased (P ≤ 0.05 the protein, fat, and total fiber content. Hams added with paste presented a less rigid structures (P ≤ 0.05. The color parameters (L*, a*, and b* of hams decrease slightly during the storage time, except for the ham added with walnut paste, which was darker. The nut pastes contributed significantly (P ≤ 0.05 to decrease the shelf life of hams. However, the yeast and mold counts in ham were less than 10 CFU/g at 21 days of storage. aw and pH decreased significantly (P ≤ 0.05 and syneresis increased during storage. Hams added with residual pastes were well sensory accepted regarding color, aroma, taste, appearance, and overall acceptability.

  18. Seed priming with extracts of Acacia nilotica (L.) Willd. ex Delile and Sapindus mukorossi (L.) plant parts in the control of root rot fungi and growth of plants

    International Nuclear Information System (INIS)

    Rafi, H.; Dawar, S.; Zaki, M.J.

    2015-01-01

    Seed priming with plant extracts and chemicals has been used as an important growth enhancement tool in crop plants. In this research, an attempt was made to understand the mechanism of various seed priming treatments on greenhouse-grown okra (Abelmoschus esculentus (L.) Moench.), sunflower (Helianthus annuus L.), peanut (Arachis hypogaea L.) and chickpea (Cicer arietinum L.) for the control of root infecting fungi like Rhizoctonia solani (Kn), Fusarium spp. and Macrophomina phaseolina (Tassi) Goid by plant parts extracts (stem, leaves and seeds) of Acacia nilotica (L.) Willd. ex Delile and Sapindus mukorossi (L) at different time intervals (5, 10, 20, 40 minutes). Results showed significant suppression of root rot fungi and significantly enhanced the growth parameters like shoot length, root length, shoot weight and root weight. Seed-priming with A. nilotica and S. mukorossi leaves extract for 10 minutes time interval was found to be effective for the control of root rot fungi and growth of all tested leguminous and non-leguminous plants. (author)

  19. Peanuts, Aflatoxins and Undernutrition in Children in Sub-Saharan Africa

    Directory of Open Access Journals (Sweden)

    Innocent Mupunga

    2017-11-01

    Full Text Available Peanuts (Arachis hypogaea is an important and affordable source of protein in most of Sub-Saharan Africa (SSA and a popular commodity and raw material for peanut butter, paste and cooking oil. It is a popular ingredient for foods used at the point of weaning infants from mother’s milk. It is at this critical point that childhood undernutrition occurs and the condition manifests as stunting, wasting and growth restriction and accounts for nearly half of all deaths in children under five years of age in SSA. Undernutrition is multi-factorial but weaning foods contaminated with microbiological agents (bacteria and fungi and natural toxins have been shown to play a big part. While peanuts may provide good nutrition, they are also highly prone to contamination with mycotoxigenic fungi. The high nutritive value of peanuts makes them a perfect substrate for fungal growth and potential aflatoxin contamination. Aflatoxins are highly carcinogenic and mutagenic mycotoxins. This article reviews the nutritional value and aflatoxin contamination of peanuts, the role they play in the development of childhood malnutrition (including the different theories of aetiology and immunological problems in children. We also discuss the control strategies that have been explored and advocacy work currently taking shape in Africa to create more awareness of aflatoxins and thus combat their occurrence with the goal of reducing exposure and enhancing trade and food safety.

  20. Effect of Trichoderma harzianum biomass and Bradyrhizobium sp. strain NC 92 to control leaf blight disease of bambara groundnut (Vigna subterranea caused by Rhizoctonia solani in the field

    Directory of Open Access Journals (Sweden)

    Mana Kanjanamaneesathian

    2007-01-01

    Full Text Available Four hundred and sixty two strains of Trichoderma spp. were isolated from 23 soil samples in which groundnut (Arachis hypogaea L. and bambara groundnut (Vigna subterranea L. had been planted in Songkhla, Phattalung, Nakhon Si Thammarat, Narathiwat and Yala provinces. These fungi were tested against Rhizoctonia solani, a causal agent of leaf blight of bambara groundnut, using dual culture technique on PDA medium. Among 462 isolates tested, 226 isolates had an ability to overgrow R. solani completely. Further testing found 13 isolates having the ability to parasitize mycelia of R. solani. Among these isolates, ThB-1-54 produced a cellulolytic enzyme on congo-red agar. This isolate was later identified as T. harzianum Rifai. In the field test, applying biomass of the isolate ThB-1-54 cultured on ground mesocarp fiber of oil palm, the combination of the isolate ThB-1-54 on ground mesocarp fiber of oil palm and Bradyrhizobium sp. (strain NC 92, or fungicide (iprodione had no effect on disease severity, yield, or the amount of total nitrogen content in stems or seeds of bambara groundnut plant.

  1. Fabrication Of Biogenic Silver Nanoparticles Using Agricultural Crop Plant Leaf Extracts

    Science.gov (United States)

    Rajani, P.; SriSindhura, K.; Prasad, T. N. V. K. V.; Hussain, O. M.; Sudhakar, P.; Latha, P.; Balakrishna, M.; Kambala, V.; Reddy, K. Raja

    2010-10-01

    Nanoparticles are being viewed as fundamental building blocks of nanotechnology. Biosynthesis of nanoparticles by plant extracts is currently under exploitation. Use of agricultural crop plant extracts for synthesis of metal nanoparticles would add a new dimension to the agricultural sector in the utilization of crop waste. Silver has long been recognized as having an inhibitory effect towards many bacterial strains and microorganisms commonly present in medical and industrial processes. Four pulse crop plants and three cereal crop plants (Vigna radiata, Arachis hypogaea, Cyamopsis tetragonolobus, Zea mays, Pennisetum glaucum, Sorghum vulgare) were used and compared for their extra cellular synthesis of metallic silver nanoparticles. Stable silver nanoparticles were formed by treating aqueous solution of AgNO3 with the plant leaf extracts as reducing agent at temperatures 50 °C-95 °C. UV-Visible spectroscopy was utilized to monitor the formation of silver nanoparticles. XRD analysis of formed silver nanoparticles revealed face centered cubic structure with (111), (200), (220) and (311) planes. SEM and EDAX analysis confirm the size of the formed silver nanoparticles to be in the range of 50-200 nm. Our proposed work offers a enviro-friendly method for biogenic silver nanoparticles production. This could provide a faster synthesis rate comparable to those of chemical methods and potentially be used in areas such as cosmetics, food and medical applications.

  2. Beneficial effects of bio-controlling agent Bacillus cereus IB311 on the agricultural crop production and its biomass optimization through response surface methodology

    Directory of Open Access Journals (Sweden)

    GOUTAM BANERJEE

    2017-10-01

    Full Text Available ABSTRACT Disease in agricultural field is a big problem that causes a massive loss in production. In this present investigation, we have reported a soil-borne bacterium Bacillus cereus IB311 which is antagonistic to plant pathogens (Pseudomonas syringae and Agrobacterium tumefaciens, and could make a substantial contribution to the prevention of plant diseases. To prove the practical application, the strain was directly applied in agricultural field. The results demonstrated that B. cereus IB311 has increased the production (20% and 26% in term of average pod number per plant, average seed number per pod, and seed yield per experimental plot in ground nut (Arachis hypogaea var. Koushal, G201 and sesame (Sesamum indicum var. Kanak, respectively. To reduce the production cost, the biomass production was optimized through response surface methodology (RSM. Interactions of three variables (glucose, beef extract and inoculum were studied using Central Composite Design. According to our analysis, optimum production of Bacillus cereus IB311 (5.383 µg/ mL may be obtained at glucose 1.985%, beef extract 1.615% and inoculums size 0.757%. Therefore, we strongly believe that the application of this strain in agricultural field as bio-controlling agent will definitely enhance the production yield and will reduce the disease risk.

  3. Natural postharvest aflatoxin occurrence in food legumes in the smallholder farming sector of Zimbabwe.

    Science.gov (United States)

    Maringe, David Tinayeshe; Chidewe, Cathrine; Benhura, Mudadi Albert; Mvumi, Brighton Marimanzi; Murashiki, Tatenda Clive; Dembedza, Mavis Precious; Siziba, Lucia; Nyanga, Loveness Kuziwa

    2017-03-01

    Aflatoxins, mainly produced by Aspergillus flavus and Aspergillus parasiticus, are highly toxic and may lead to health problems such as liver cancer. Exposure to aflatoxins may result from ingestion of contaminated foods. Levels of AFB 1 , AFB 2 , AFG 1 and AFG 2 in samples of groundnuts (Arachis hypogaea), beans (Phaseolus vulgaris), cowpeas (Vigna unguiculata) and bambara nuts (Vigna subterranean) grown by smallholder farmers in Shamva and Makoni districts, Zimbabwe, were determined at harvesting, using high performance liquid chromatography after immunoaffinity clean-up. Aflatoxins were detected in 12.5% of groundnut samples with concentrations ranging up to 175.9 µg/kg. Aflatoxins were present in 4.3% of the cowpea samples with concentrations ranging from 1.4 to 103.4 µg/kg. Due to alarming levels of aflatoxins detected in legumes versus maximum permissible levels, there is a need to assist smallholder farmers to develop harvest control strategies to reduce contamination of aflatoxins in legumes.

  4. Early events of secretory granule formation in the rat parotid acinar cell under the influence of isoproterenol. An ultrastructural and lectin cytochemical study

    Directory of Open Access Journals (Sweden)

    F D’Amico

    2009-12-01

    Full Text Available The events involved in the maturation process of acinar secretory granules of rat parotid gland were investigated ultrastructurally and cytochemically by using a battery of four lectins [Triticum vulgaris agglutinin (WGA, Ulex europaeus agglutinin I (UEA-I, Glycine max agglutinin (SBA, Arachys hypogaea agglutinin (PNA]. In order to facilitate the study, parotid glands were chronically stimulated with isoproterenol to induce secretion. Specimens were embedded in the Lowicryl K4M resin. The trans-Golgi network (TGN derived secretory granules, which we refer to as immature secretory granules, were found to be intermediate structures in the biogenesis process of the secretory granules in the rat parotid acinar cell. These early structures do not seem to be the immediate precursor of the mature secretory granules: in fact, a subsequent interaction process between these early immature granule forms and TGN elements seems to occur, leading, finally, to the mature granules. These findings could explain the origin of the polymorphic subpopulations of the secretory granules in the normal acinar cells of the rat parotid gland. The lectin staining patterns were characteristic of each lectin. Immature and mature secretory gran- ules were labelled with WGA, SBA, PNA, and lightly with UEA-I. Cis and intermediate cisternae of the Golgi apparatus were labelled with WGA, and trans cisternae with WGA and SBA.

  5. Effects of interactions of auxin-producing bacteria and bacterial-feeding nematodes on regulation of peanut growths.

    Science.gov (United States)

    Xu, Li; Xu, Wensi; Jiang, Ying; Hu, Feng; Li, Huixin

    2015-01-01

    The influences of an IAA (indole-3-acetic acid)-producing bacterium (Bacillus megaterium) and two bacterial-feeding nematodes (Cephalobus sp. or Mesorhabditis sp.) on the growth of peanut (Arachis hypogaea L. cv. Haihua 1) after various durations of time were investigated in natural soils. The addition of bacteria and nematodes and incubation time all significantly affected plant growth, plant root growth, plant nutrient concentrations, soil nutrient concentrations, soil microorganisms and soil auxin concentration. The addition of nematodes caused greater increases in these indices than those of bacteria, while the addition of the combination of bacteria and nematodes caused further increases. After 42-day growth, the increases in soil respiration differed between the additions of two kinds of nematodes because of differences in their life strategies. The effects of the bacteria and nematodes on the nutrient and hormone concentrations were responsible for the increases in plant growth. These results indicate the potential for promoting plant growth via the addition of nematodes and bacteria to soil.

  6. Seed Oil from Ten Algerian Peanut Landraces for Edible Use and Biodiesel Production.

    Science.gov (United States)

    Giuffrè, Angelo Maria; Tellah, Sihem; Capocasale, Marco; Zappia, Clotilde; Latati, Mourad; Badiani, Maurizio; Ounane, Sidi Mohamed

    2016-01-01

    As a result of a recent ad hoc prospection of the Algerian territory, a collection of peanut (groundnut; Arachis hypogaea L.) landraces was established, covering a remarkable array of diversity in terms of morphological and physiological features, as well as of adaptation to local bioclimatic conditions. In the present work, the oils extracted from the seeds of these landraces were evaluated in terms of edible properties and suitability for biodiesel production. As for edible use, a low free acidity (ranging from 0.62 to 1.21%) and a high oleic acid content (44.61-50.94%) were common features, although a poor stability to oxidation [high peroxide values, high spectrophotometric indices, and low % of inhibition in the 2,2-diphenyl-1-picrylhydrazyl radical (DPPH)· test] was observed in a few cases. As for biodiesel production, low values of acidity [1.23-2.40 mg KOH (g oil)(-1)], low iodine values [90.70-101.54 g I2 (g oil)(-1)], high cetane numbers (56.95-58.88) and high calorific values (higher heating value 37.34-39.27 MJ kg(-1)) were measured. Edible properties and suitability for biodiesel production were discussed with respect to the German standard DIN 51605 for rapeseed oil and to the EN 14214 standard, respectively. One way ANOVA and Hierarchical Cluster Analysis showed significant differences among the oils from the Algerian peanut landraces.

  7. Physicochemical properties, fatty acid profile and antioxidant activity of peanut oil

    International Nuclear Information System (INIS)

    Shad, M.A.; Pervez, H.; Zafar, Z.I.

    2011-01-01

    The oil from seeds of 4 pea nut (Arachis hypogaea L.) varieties: Golden, Bari 2000, Mongphalla, and Mongphalli 334 cultivated in arid zones, was subjected to the comparative evaluation of its physicochemical properties, fatty acid profile and antioxidant activity. Pea nut seeds were found to be a rich source of crude fat (45.09-51.63 g/100 g dry weight). The physicochemical properties of the oil were investigated as specific gravity (0.915 +-0.008-0.918+-0.008), acid value (3.96+-0.22-4.95+-0.71 mg KOH/g oil), saponification value ( 226.40+-3.59-246.56+-2.04 mg KOH/g oil) and unsaponifiable matter (3.20 +- 0.23-4.20+-0.04 g/100 g oil). The higher amounts of unsaturated fatty acids (82.06-85.93%) were found to be present in each variety. A significant variation (p<0.05) was observed among the varieties regarding crude oil content, saponification value, oleic/linoleic (O/L) ratios, phenolic acid content and total antioxidant content. Golden was found to be high in oil content, O/L ratio, antioxidant profile and DPPH scavenging activity but low in iodine value. (author)

  8. Case Study: Trap Crop with Pheromone Traps for Suppressing Euschistus servus (Heteroptera: Pentatomidae in Cotton

    Directory of Open Access Journals (Sweden)

    P. G. Tillman

    2012-01-01

    Full Text Available The brown stink bug, Euschistus servus (Say, can disperse from source habitats, including corn, Zea mays L., and peanut, Arachis hypogaea L., into cotton, Gossypium hirsutum L. Therefore, a 2-year on-farm experiment was conducted to determine the effectiveness of a sorghum (Sorghum bicolor (L. Moench spp. bicolor trap crop, with or without Euschistus spp. pheromone traps, to suppress dispersal of this pest to cotton. In 2004, density of E. servus was lower in cotton fields with sorghum trap crops (with or without pheromone traps compared to control cotton fields. Similarly, in 2006, density of E. servus was lower in cotton fields with sorghum trap crops and pheromone traps compared to control cotton fields. Thus, the combination of the sorghum trap crop and pheromone traps effectively suppressed dispersal of E. servus into cotton. Inclusion of pheromone traps with trap crops potentially offers additional benefits, including: (1 reducing the density of E. servus adults in a trap crop, especially females, to possibly decrease the local population over time and reduce the overwintering population, (2 reducing dispersal of E. servus adults from the trap crop into cotton, and (3 potentially attracting more dispersing E. servus adults into a trap crop during a period of time when preferred food is not prevalent in the landscape.

  9. Penularan Fitoplasma Sapu pada Tanaman Kacang Tanah oleh Serangga Vektor Orosius argentatus dan Deteksi Molekuler dengan Teknik PCR

    Directory of Open Access Journals (Sweden)

    Tatit Sastrini

    2014-02-01

    Full Text Available Witches’ broom disease caused by phytoplasma is a very serious disease on peanut (Arachis hypogaea which may potentially lead to high yield loss. Insects are the most important agents of phytoplasma transmission in the field. The objective of this research was to examine the potential role of leafhoppers species as insect vector of phytoplasma and to determine their transmission characteristic. Two species of leafhopper i.e. O. argentatus and Empoasca sp. (both belong to Hemiptera: Cicadellidae were chosen for this study. The methodology involved were transmission study of phytoplasma by O. argentatus and Empoasca sp., and molecular detection of phytoplasma by PCR technique to confirm the association of pathogen, insect vector and symptomatic plants. The result showed that specific symptom was observed when using O. argentatus in the transmission study with number of insect as low as 1 insect per plant, whereas Empoasca sp. was not able to transmit the disease. Incubation period of phytoplasma in the host plant was affected by the number of insect, i.e. the more insect vector the shortest incubation period. The phytoplasma was successfully detected using P1/P7 primer in symptomatic plants as well as in the insect vector.Key words: Empoasca sp., leafhoppers, polymerase chain reaction

  10. Integrated genetic linkage map of cultivated peanut by three RIL populations

    Institute of Scientific and Technical Information of China (English)

    Yanbin Song; Huifang Jiang; Huaiyong Luo; Li Huang; Yuning Chen; Weigang Chen; Nian Liu; Xiaoping Ren; Bolun Yu; Jianbin Guo

    2017-01-01

    High-density and precise genetic linkage map is fundamental to detect quanti-tative trait locus (QTL) of agronomic and quality related traits in cultivated peanut (Arachis hypogaea L.). In this study, three linkage maps from three RIL (recombinant inbred line) populations were used to construct an integrated map. A total of 2,069 SSR and transposon markers were anchored on the high-density integrated map which covered 2,231.53 cM with 20 linkage groups. Totally, 92 QTLs correlating with pod length (PL), pod width (PW), hun-dred pods weight (HPW) and plant height (PH) from above RIL populations were mapped on it. Seven intervals were found to harbor QTLs controlling the same traits in different pop-ulations, including one for PL, three for PW, two for HPW, and one for PH. Besides, QTLs controlling different traits in different populations were found to be overlapped in four inter-vals. Interval on A05 contains 17 QTLs for different traits from two RIL populations. New markers were added to these intervals to detect QTLs with narrow confidential intervals. Results obtained in this study may facilitate future genomic researches such as QTL study, fine mapping, positional cloning and marker-assisted selection (MAS) in peanut.

  11. Effects of potassium application on the accumulated nitrogen source and yield of peanut

    International Nuclear Information System (INIS)

    Wang Yuefu; Kang Yujie; Wang Minglun; Zhao Changxing

    2013-01-01

    Pot experiments and were carried out respectively to study the effects of different potassium application on soil nitrogen uptake, fertilizer nitrogen uptake, nodule nitrogen fixation and their proportion and yield of peanut (Arachis Hypogaea L.) by "1"5N tracer technique, and explore the reasons, which may provide a theoretical basis and technical guidance for peanut production in the scientific fertilizer application. Results showed that nitrogen in peanut all mainly accumulated in the kernel for different treatments of potassium fertilizer application. However, with increasing of potassium application, the increasing extent of nitrogen content of stems was the biggest during all the peanut organs, with nut shells the smallest. Properly increasing the amount of potassium can improve nitrogen content, "1"5N abundance, nitrogen and "1"5N accumulation of every organ, and promote absorption and utilization three nitrogen-source especially with the most effect for the kernel biomass (economic output). The ratio of fertilizer nitrogen, soil nitrogen and atmospheric nitrogen absorbed by peanut was respectively between 12.37%-13.10%, 38.29%-45.10%, and 42.53%-48.31% respectively. Properly increasing potassium fertilizer application improved the absorption ratio of fertilizer nitrogen and nodule nitrogen fixation, reduced the proportion of soil uptake and enhanced fertilizer nitrogen use efficiency. However, the influences of excessive application of potassium fertilizer decreased. (authors)

  12. Resistance to Aspergillus flavus in maize and peanut: Molecular biology, breeding, environmental stress, and future perspectives

    Directory of Open Access Journals (Sweden)

    Jake C. Fountain

    2015-06-01

    Full Text Available The colonization of maize (Zea mays L. and peanut (Arachis hypogaea L. by the fungal pathogen Aspergillus flavus results in the contamination of kernels with carcinogenic mycotoxins known as aflatoxins leading to economic losses and potential health threats to humans. The regulation of aflatoxin biosynthesis in various Aspergillus spp. has been extensively studied, and has been shown to be related to oxidative stress responses. Given that environmental stresses such as drought and heat stress result in the accumulation of reactive oxygen species (ROS within host plant tissues, host-derived ROS may play an important role in cross-kingdom communication between host plants and A. flavus. Recent technological advances in plant breeding have provided the tools necessary to study and apply knowledge derived from metabolomic, proteomic, and transcriptomic studies in the context of productive breeding populations. Here, we review the current understanding of the potential roles of environmental stress, ROS, and aflatoxin in the interaction between A. flavus and its host plants, and the current status in molecular breeding and marker discovery for resistance to A. flavus colonization and aflatoxin contamination in maize and peanut. We will also propose future directions and a working model for continuing research efforts linking environmental stress tolerance and aflatoxin contamination resistance in maize and peanut.

  13. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  14. Weed Control and Peanut Tolerance with Ethalfluralin-Based Herbicide Systems

    Directory of Open Access Journals (Sweden)

    W. J. Grichar

    2012-01-01

    Full Text Available Field studies were conducted from 2007 through 2009 to determine weed efficacy and peanut (Arachis hypogaea L. response to herbicide systems that included ethalfluralin applied preplant incorporated. Control of devil's claw (Proboscidea louisianica (Mill. Thellung, yellow nutsedge (Cyperus esculentus L., Palmer amaranth (Amaranthus palmeri S. Wats., and puncturevine (Tribulus terrestris L. was most consistent with ethalfluralin followed by either imazapic or imazethapyr applied postemergence. Peanut stunting was 19% when paraquat alone was applied early-postemergence. Stunting increased to greater than 30% when ethalfluralin applied preplant incorporated was followed by S-metolachlor applied preemergence and paraquat applied early-postemergence. Stunting (7% was also observed when ethalfluralin was followed by flumioxazin plus S-metolachlor applied preemergence with lactofen applied mid-postemergence. Ethalfluralin followed by paraquat applied early-postemergence reduced peanut yield when compared to the nontreated check. Ethalfluralin applied preplant incorporated followed by imazapic applied mid-postemergence provided the greatest yield (6220 kg/ha. None of the herbicide treatments reduced peanut grade (sound mature kernels plus sound splits when compared with the nontreated check.

  15. Effects of mutagens on somatic embryogenesis and plant regeneration in groundnut

    International Nuclear Information System (INIS)

    Muthusamy, A.; Vasanth, K.; Sivasankari, D.; Chandrasekar, B.R.; Jayabalan, N.

    2007-01-01

    The embryogenic calli (EC) were obtained from hypocotyl explants of groundnut (Arachis hypogaea L.) cultured on Murashige and Skoog (MS) medium supplemented with different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) in combination with 0.5 mg dm −3 6-benzylaminopurine (BAP). The EC were exposed to γ-radiation (10–50 Gy) or treated with 1–5 mM of ethyl methane sulphonate (EMS) or sodium azide (SA). The mutated EC were subcultured on embryo induction medium containing 20 mg dm −3 2,4-D. Somatic embryos (SE) developed from these calli were transferred to MS medium supplemented with BAP (2.0 mg dm −3 ) and 0.5 mg dm −3 2,4-D for maturation. The well-developed embryos were cultured on germination medium consisting of MS salts with 2.0 mg dm −3 BAP and 0.25 mg dm −3 naphthaleneacetic acid (NAA). Well-developed plantlets were transferred for hardening and hardened plants produced normal flowers and set viable seeds. The fresh mass of the EC, mean number of SE per explant and regeneration percentage were higher at lower concentrations of mutagens (up to 30 Gy/3 mM). Some abnormalities in regenerated plants were observed, especially variations in leaf shape. (author)

  16. Characterisation of cytotrophoblastic-like cells present in subinvolutioned placental sites of the bitch.

    Science.gov (United States)

    Fernández, P E; Portiansky, E L; Barbeito, C G; Gimeno, E J

    1998-10-01

    This paper describes an approach to study the cells present in the subinvolution of placental sites (SIPS), a pathological post partum condition of the bitch that causes persistent hemorrhage of the genital tract. The expression of intermediate filament proteins was examined to determine the fetal or maternal origin of the cytotrophoblastic-like cells found in this entity. Lectin binding on tissue sections were also studied to characterise cellular glycoconjugates. Image processing and morphometrical analysis of the histological images were done. The results revealed that the cells observed in bitches with SIPS expressed pancytokeratins but neither vimentin nor desmin, in coincidence with normal cytotrophoblasts. The lectin binding pattern of both types of cells was similar, with the only exception of Arachis hypogaea agglutinin (PNA) and Triticum vulgaris agglutinin (WGA). These observations, in addition to the non statistically significant differences between morphometrical characteristics of cytotrophoblastic and cytotrophoblastic-like cells in SIPS, might suggest the fetal origin of the latter cells which could play a role in the pathogenesis of this entity.

  17. Effect of infection by chlorotic spot virus on 14CO2 fixation in leaves of groundnut Arachis hypogea L

    International Nuclear Information System (INIS)

    Sreenivasulu, P.; Nayudu, M.V.

    1980-01-01

    Photosynthetic incorporation of 14 CO 2 into leaves of groundnut infected by chlorotic spot virus (GCSV) was slightly more at stages 2 and 5 less at stage 4 as compared to control. 14 C incorporation into the alcohol soluble fraction of infected leaves followed the same trend as total 14 CO 2 fixation but in the alcohol-insoluble fraction the same was less at all the sampled stages. 14 C in the alcohol-soluble fraction of fed leaves of both types (stage 5) decreased with time along with simultaneous increase in alcohol-insoluble fraction. The proportion of 14 C incorporated into organic acids, amino acids and sugars was same in both the samples at stage 2, greater into organic and amino acids and less into sugars at stages 4 and 5, and at 12 and 24 hr time periods of stage 5 of virus infected leaves when compared to healthy ones. 14 C incorporated into total sugars and organic acids of infected leaves followed that of total 14 C fixation, and varied in individual sugars and organic acids. 14 C in sugars of both type of leaves decreased with time and with simultaneous increase in organic and amino acids. 14 C incorporated into virus infected leaf proteins was more when compared to healthy leaves. (auth.)

  18. PERTUMBUHAN KACANG HIAS (Arachis pintoi PADA MEDIA TANAH PASCA PENAMBANGAN BATUBARA YANG DIPERKAYA MIKORIZA, KAPUR DAN PUPUK NPK

    Directory of Open Access Journals (Sweden)

    Willie Samodra Laya

    2016-09-01

    Full Text Available This study aimed to determine the effects of the provision of arbuscular mycorrhizal fungi (AMF, the provision of lime, and the provision of NPK fertilizer, and the interaction effect of the provision of Arbuscular mycorrhizal fungi (AMF, lime and NPK fertilizers in promoting the growth of pinto peanut in the soil media of post-mining land. The research method used was a completely randomized design (CRD three-factor factorial with the first factor is the type of inoculant FMA (M = 3 levels, the second factor is the provision of lime (K = 3 levels, and the third factor is the NPK fertilizer (P = 3 levels. These results indicated that the interaction between AMF Glomus sp. and NPK fertilizer dose of 1 gram/polybag can increase height increase pinto peanut plants for 34.16 % of the controls. The interaction between AMF Gigaspora sp. The lime dose of 50 % Al-dd and Fertilizers NPK dose of 1 gram/polybag can increase the growth of leaves pinto peanut plants at 108.33 % of the controls. The interaction between AMF Glomus sp. and NPK fertilizer dose of 2 grams/polybag can increase canopy and root biomass pinto peanut plants at 245.21 % of the controls. The interaction between AMF Glomus sp. and NPK fertilizer dose of 2 grams/polybag can increase canopy and root biomass pinto peanut plants at 245.21 % of the controls. Level relative mycorrhizal dependency (RMD was influenced by the type of AMF plant inoculated host. Highest RMD shown in pinto peanut using AMF Glomus sp. is 31.99% at moderately dependent.

  19. Insights into the Indian peanut genotypes for ahFAD2 gene polymorphism regulating its oleic and linoleic acid fluxes

    Directory of Open Access Journals (Sweden)

    Bhagwat Nawade

    2016-08-01

    Full Text Available In peanut (Arachis hypogaea L., the customization of fatty acid profile is an evolving area to fulfil the nutritional needs in the modern market. A total of 174 peanut genotypes, including 167 Indian cultivars, 6 advanced breeding lines and ‘SunOleic’‒ a double mutant line, were investigated using AS-PCRs, CAPS and gene sequencing for the ahFAD2 allele polymorphism, along with its fatty acid compositions. Of these, 80 genotypes were found having substitution (448G>A mutation only in ahFAD2A gene, while none recorded 1-bp insertion (441_442insA mutation in ahFAD2B gene. Moreover, 22 wild peanut accessions found lacking both the mutations. Among botanical types, the ahFAD2A mutation was more frequent in ssp. hypogaea (89% than in ssp. fastigiata (17%. This single allele mutation, found affecting not only oleic to linoleic acid fluxes, but also the composition of other fatty acids in the genotypes studied. Repeated use of a few selected genotypes in the Indian varietal development programs were also eminently reflected in its ahFAD2 allele polymorphism. Absence of known mutations in the wild-relatives indicated the possible origin of these mutations, after the allotetraploidization of cultivated peanut. The SNP analysis of both ahFAD2A and ahFAD2B genes, revealed haplotype diversity of 1.05% and 0.95%, while Ka/Ks ratio of 0.36 and 0.39 respectively, indicating strong purifying selection pressure on these genes. Cluster analysis, using ahFAD2 gene SNPs, showed presence of both mutant and non-mutant genotypes in the same cluster, which might be due the presence of ahFAD2 gene families. This investigation provided insights into the large number of Indian peanut genotypes, covering various aspects related to O/L flux regulation and ahFAD2 gene polymorphism.

  20. Nutritive value, fermentation characteristics, and in situ disappearance kinetics of ensiled warm-season legumes and bahiagrass.

    Science.gov (United States)

    Foster, J L; Carter, J N; Sollenberger, L E; Blount, A R; Myer, R O; Maddox, M K; Phatak, S C; Adesogan, A T

    2011-04-01

    This study determined the nutritive value, ensiling characteristics, and in situ disappearance kinetics of bahiagrass (Paspalum notatum Flügge 'Tifton 9'), perennial peanut (Arachis glabrata Benth. 'Florigraze'), annual peanut [Arachis hypogaea (L.) 'FL MDR 98'], cowpea [Vigna unguiculata (L.) Walp. 'Iron clay'], and pigeonpea [Cajanus cajan (L.) Millsp. 'GA-2']. All forages were harvested at maturity stages that optimized dry matter (DM) yield and nutritive value. After harvest, forages were wilted to 45% DM, and 4 replicate bales of each legume and 8 bales of bahiagrass were wrapped in polyethylene and ensiled for 180 d. After each bale was opened, the forage was thoroughly mixed, and representative subsamples were taken for laboratory analysis and in situ incubation. Wilting and ensiling decreased the rumen-undegradable protein, water-soluble carbohydrate, crude protein (CP), and in vitro true digestibility (IVTD) of bahiagrass, perennial peanut, and cowpea, and increased their neutral detergent fiber (NDF) concentrations. Among haylages, CP concentration was greatest for annual peanut, followed by perennial peanut and cowpea, and least for bahiagrass. In contrast, NDF concentration was greater in bahiagrass than in legumes. Pigeonpea had the greatest NDF concentration among legumes and lowest IVTD of all haylages. All haylages were aerobically stable for at least 84 h, but pH was lower in perennial peanut and cowpea than in pigeonpea. Ammonia-N concentrations tended to be greater in legume haylages than in bahiagrass haylage. Butyrate concentration was greater in annual and perennial peanut than in bahiagrass. Total VFA concentration was greater in annual and perennial peanut and cowpea haylages than in bahiagrass haylage. Undegradable DM fractions were greater and extent of DM degradation was lower in bahiagrass and pigeonpea than in other haylages but lag time and degradation rates did not differ. Annual and perennial peanut and cowpea haylages were as

  1. Distribuição da concentração de potássio no solo em lisímetros cultivados com amendoim Distribution of the potassium concentration in soil with lysimeters cultivated with peanut

    Directory of Open Access Journals (Sweden)

    Jarbas H Miranda

    2010-04-01

    Full Text Available A aplicação de fertilizantes na agricultura pode provocar uma dinâmica de solutos no solo abaixo da zona radicular, podendo, além de provocar prejuízos econômicos, contaminar águas subterrâneas. O presente trabalho teve como objetivo acompanhar o processo de deslocamento do íon potássio (K+ em lisímetros preenchidos com solo de textura arenosa e cultivado com amendoim (Arachis hypogaea L., sob diferentes condições de atenuação da densidade de fluxo radiante, como a utilização de filmes plásticos com diferentes espessuras (100 e 150 micras. O deslocamento do íon potássio (K+ foi monitorado por extratores de solução instalados em diferentes profundidades (15 e 25 cm, e o manejo da fertirrigação foi realizado com a utilização de tensiômetros. Concluiu-se que a baixa radiação solar incidente nos dois ambientes com coberturas plásticas afetou negativamente a produtividade do amendoim; o período em que o amendoim demanda maior quantidade de potássio ocorre dos 30 aos 55 dias após a semeadura; as plantas de amendoim não apresentaram deficiência nutricional com menor lixiviação de K+ para as camadas mais profundas do solo; nos lisímetros com cobertura plástica de 100 e 150 micras, ocorreu maior concentração de K+ na superfície do solo.The application of fertilizers in agriculture produce some solute displacement below the root zone and this situation has provoked great impacts, besides the economic damages, causing groundwater contamination. The present work has as the objective of monitoring the displacement process of the potassium (K+ in lysimeters filled with soil, sandy texture and cultivated with peanuts (Arachis hypogaea L. under different conditions of reducing solar radiation by using plastic films with different thickness (100 and 150 µ. The potassium displacement was monitored by soil solution extractors installed in different depths (15 and 25 cm and the fertigation management was accomplished by

  2. Efeito da mucuna e amendoim em rotação com algodoeiro A study on crop rotation for cotton using velvet bean and peanut

    Directory of Open Access Journals (Sweden)

    Carlos A. M. Ferraz

    1977-01-01

    Full Text Available O efeito da rotação de mucuna (Stizolobium atterrimum Piper & Tracy e amendoim (Arachis hypogaea L. e de duas variedades comerciais de algodoeiro, IAC RM3 e IAC 12-2 (Gossypium hirsutum L. foi estudado nos anos agrícolas de 1967/68 a 1972/73. Foram instalados dois ensaios, um em Presidente Bernardes, com fusariose, em solo podzolizado de Lins e Marília var. Lins naturalmente infectado por Fusarium oxysporumf. vasinfectum e o nematóide causador de galhas Meloidogyne incognita (Kofoid & White Chitwood, e outro em Presidente Venceslau, sem fusariose, em latossolo vermelho-escuro f. arenosa não infectado. A variedade comercial IAC RM3 é resistente e a IAC 12-2 é suscetível à fusariose. Para a análise estatística dos dados adotou-se o esquema de parcelas subdivididas, com seis repetições, tendo sido consideradas como parcelas as variedades de algodoeiro IAC RM3 e IAC 12-2, plantadas em 1968/69, 1970/71, 1971/72 e 1972/73, e como subparcelas as culturas em rotação, mucuna, amendoim e as variedades de algodoeiro IAC RM3 e IAC 12-2, plantadas nos anos-agrícolas de 1967/68 e 1969/70. Em solos com fusariose, em 1968/69, e em solos sem fusariose, no ano agrícola de 1970/71, destacou-se o efeito da rotação com mucuna, seguida da rotação com amendoim. Depois do plantio consecutivo de algodoeiro durante três anos (1970/71 a 1972/73, cessaram praticamente os efeitos da rotação para os dois casos. Houve aumento do teor de potássio após o primeiro ano de rotação, sendo maior para a mucuna.The effect of rotation of velvet bean (Stizolobium atterrimum Piper & Tracy, and peanut (Arachis hypogaea L. with two comercial varieties of cotton IAC RM3 and IAC 12-2 (Gossypium hirsutum L. was studied during 1967/68 to 1972/73. One experiment was conducted in a soil naturally infected by Fusarium oxysporum f. vasinfectum (Atk. Snyder & Hansen and by Meloidogyne incognita (Kofoid & White Chitwood, (President Bernardes, State of São Paulo, in

  3. Capacidade fotossintética de genótipos de amendoim em ambiente natural e controlado Photosynthetic capacity of peanut genotypes under natural and controlled environment

    Directory of Open Access Journals (Sweden)

    Norma de Magalhães Erismann

    2006-07-01

    Full Text Available A capacidade fotossintética das cultivares de amendoim rasteiro (Arachis hypogaea L. IAC-Caiapó e Runner IAC-886 foi avaliada sob condição controlada, em plantas cultivadas em vasos, mantidos em casa de vegetação, e sob condição natural, em plantas irrigadas, cultivadas em tanques de alvenaria. A resposta da taxa de assimilação líquida de CO2 (A em decorrência da densidade de fluxo de fótons fotossinteticamente ativos (DFFF foi melhor em condição controlada, mas, nas duas condições, a mesma A máxima de ca. 28 µmol m-2 s-1 foi atingida. Em condição controlada, a saturação lumínica ocorreu próximo a 1.000 µmol m-2 s-1 , ao passo que sob condição natural, ocorreu em DFFF maiores. A temperatura foliar entre 23 e 36°C não afetou A. A diferença de pressão de vapor entre a folha e o ar causou o fechamento parcial dos estômatos, diminuindo A, quando acima de 3,0 kPa. As capacidades fotossintéticas das duas cultivares de amendoim foram iguais. Ambas cultivares apresentaram boa adaptação às variações diárias do ambiente, ocorridas durante o verão, apresentando fotoinibição dinâmica da fotossíntese no início da tarde (13-14h, manifestada pela queda reversível da eficiência quântica máxima (Fv/Fm do fotossistema II.Photosynthetic capacity of runner peanuts (Arachis hypogaea L. cv. IAC-Caiapó and cv. Runner IAC-886 was evaluated under controlled condition, in plants grown on pots maintained in a greenhouse, and in irrigated plants grown on soil-filled tanks made of concrete, and exposed to natural ambient condition. CO2 net assimilation rate (A response in relation to photosynthetic photon flux density (DFFF was better in controlled condition, but in both conditions the same maximum A of ca. 28 µmol m-2 s-1 was reached. Under controlled condition, light saturation was about 1,000 µmol m-2 s-1 , although under natural condition, saturation occurred at higher DFFF. Leaf temperature between 23 and 36°C did

  4. Enzymatic activity and mineralization of carbon and nitrogen in soil cultivated with coffee and green manures Atividade enzimática e mineralização do carbono e nitrogênio sob solo cultivado com adubos verdes na cultura do cafeeiro

    Directory of Open Access Journals (Sweden)

    Elcio Liborio Balota

    2010-10-01

    Full Text Available There are great concerns about degradation of agricultural soils. It has been suggested that cultivating different plant species intercropped with coffee plants can increase microbial diversity and enhance soil sustainability. The objective of this study was to evaluate enzyme activity (urease, arylsulfatase and phosphatase and alterations in C and N mineralization rates as related to different legume cover crops planted between rows of coffee plants. Soil samples were collected in a field experiment conducted for 10 years in a sandy soil in the North of Paraná State, Brazil. Samples were collected from the 0-10 cm layer, both from under the tree canopy and in-between rows in the following treatments: control, Leucaena leucocephala, Crotalaria spectabilis, Crotalaria breviflora, Mucuna pruriens, Mucuna deeringiana, Arachis hypogaea and Vigna unguiculata. The soil was sampled in four stages of legume cover crops: pre-planting (September, after planting (November, flowering stage (February and after plant residue incorporation (April, from 1997 to 1999. The green manure species influenced soil enzyme activity (urease, arylsulfatase and phosphatase and C and N mineralization rates, both under the tree canopy and in-between rows. Cultivation of Leucaena leucocephala increased acid phosphatase and arilsulfatase activity and C and N mineralization both under the tree canopy and in-between rows. Intercropped L. leucocephala increased urease activity under the tree canopy while C. breviflora increased urease activity in-between rows.Existe grande preocupação sobre a degradação dos solos agrícolas. Tem sido sugerido que o cultivo de plantas intercalares no cafeeiro aumenta a diversidade microbiana e a sustentabilidade do solo. No presente trabalho foi avaliada a alteração na atividade de enzimas do solo (urease, arilsulfatase e fosfatase e na mineralização do C e N devido ao cultivo intercalar de diferentes leguminosas de verão na cultura do

  5. Adaptabilidade e estabilidade de genótipos de amendoim de porte rasteiro Adaptability and stability of peanut genotypes of runner growth habit

    Directory of Open Access Journals (Sweden)

    Eder Jorge de Oliveira

    2006-08-01

    Full Text Available O comportamento produtivo de genótipos de amendoim (Arachis hypogaea L. foi avaliado a partir de três diferentes métodos de adaptabilidade e estabilidade. Foram avaliadas 18 linhagens e as cultivares Runner IAC 886 e IAC Caiapó, quanto à produtividade de vagens (PV e peso de 100 grãos (P100G, em dez ensaios de campo, no Estado de São Paulo, utilizando-se os métodos de ecovalência, Eberhart & Russel e Lin & Binns. Foram observadas diferenças significativas para o efeito de genótipo (G, ambiente (E e interação (GxE, para as duas variáveis. As linhagens L123, L137 e L150 foram as mais produtivas, com comportamento estável e previsível. O método de Lin & Binns mostrou-se mais discriminante na avaliação da PV e do P100G, enquanto o método de Eberhart & Russel foi mais útil na indicação das linhagens com adaptabilidade ampla ou específica a determinados ambientes. Os métodos de Lin & Binns e de Eberhart & Russel foram mais informativos que o de ecovalência, na predição do comportamento das linhagens para as duas características. Foi encontrada correlação negativa entre a PV e o parâmetro Pi, e positiva entre deltaij e ômegai. Para P100G, detectaram-se as mesmas correlações de PV, além da correlação negativa entre Pi e ômegai.The performance of peanut (Arachis hypogaea L. genotypes was assessed using three different adaptability and stability methods. Eighteen lines and two cultivars, Runner IAC 886 and IAC Caiapó, were evaluated for pod yield (PY and one hundred kernel weight (HKW, in ten field trials in the State of São Paulo, using ecovalance, Eberhart & Russel and Lin & Binns methods. Significant differences for genotype (G, environment (E and interaction (GxE effects were observed for both variables. The lines L123, L137 and L150 were most productive and showed stable and predictable behavior. Lin & Binns methods was more sensitive for PY and HKW, while the Eberhart & Russel method was more useful for

  6. Nitrogen fixation by groundnut and velvet bean and residual benefit to a subsequent maize crop Fixação de nitrogênio por amendoim e mucuna e benefício residual para uma cultura de milho

    Directory of Open Access Journals (Sweden)

    Ambate Okito

    2004-12-01

    Full Text Available Chemical fertilisers are rarely avaiable to poor farmers, for whom the nitrogen (N is often the most limiting element for cereal grain production. The objective of this study was to quantify the contribution of biological nitrogen fixation (BNF to groundnut (Arachis hypogaea and velvet bean (Mucuna pruriens crops using the 15N natural abundance (delta15N technique and to determine their residual effect and that of a natural fallow, on growth and N accumulation by two rustic maize varieties. The contribution of BNF calculated from delta15N data was 40.9, 59.6 and 30.9 kg ha-1, for groundnut, velvet bean and the natural fallow, respectively. The only legume grain harvested was from the groundnut, which yielded approximately 1.000 kg ha-1. The subsequent maize varieties ("Sol de Manhã" and "Caiana Sobralha" yielded between 1.958 and 2.971 kg ha-1, and were higher after velvet bean for both maize varieties and "Sol da Manhã" groundnut, followed by "Caiana" after groundnut and, finally, the natural fallow. For a small-holder producer the most attractive system is the groundnut followed by maize, as, in this treatment, both groundnut and maize grain harvest are possible. However, a simple N balance calculation indicated that the groundnut-maize sequence would, in the long term, deplete soil N reserves, while the velvet bean-maize sequence would lead to a build up of soil nitrogen.Fertilizantes químicos raramente estão disponíveis aos agricultores com poucos recursos econômicos, e assim o N é, freqüentemente, um elemento mais limitante para a produção de grãos. O objetivo deste trabalho foi quantificar a contribuição da fixação biológica de nitrogênio (FBN às culturas de amendoim (Arachis hypogaea e mucuna (Mucuna pruriens, por meio da técnica de abundância natural de 15N e determinar o efeito residual das leguminosas e do pousio sobre o crescimento e acumulação de N em duas variedades de milho. A contribuição da FBN calculada a

  7. Condutividade elétrica em função do teor de água inicial de sementes de amendoim Electrical conductivity and water content in peanut seeds

    Directory of Open Access Journals (Sweden)

    Rafael Marani Barbosa

    2012-01-01

    Full Text Available O vigor de sementes de amendoim (Arachis hypogaea L. avaliado pelo teste de condutividade elétrica demonstra estreita relação com o desempenho no campo, mas alguns fatores podem afetar o resultado da condutividade elétrica, sendo um destes o teor de água inicial das sementes. Assim, o objetivo deste trabalho foi avaliar o teor de água ou faixa de umidade da semente mais adequado para a avaliação da condutividade elétrica em sementes de amendoim. Quatro lotes de sementes da cultivar 'IAC Tatu ST' e quatro da cultivar 'IAC Runner 886' foram avaliados quanto ao seu potencial fisiológico e posteriormente o teor de água foi ajustado para 5, 7, 9, 11, 13 e 15%, pelo método da atmosfera úmida. O delineamento foi inteiramente casualizado em esquema fatorial 4×6 (lotes × teores de água para as sementes de cada cultivar, em quatro repetições e os resultados para o fator teor de água foram submetidos à análise de regressão. A maior relação da condutividade elétrica com vigor das sementes ocorreu naquelas com teor de água entre 9 a 15%, de forma que sementes com 5 a 7% de umidade não devem ser submetidas ao teste de condutividade elétrica, porque os lotes expressam alto padrão de germinação e vigor. A condutividade elétrica de sementes de amendoim é influenciada pelo teor de água e a estabilização dos resultados ocorre quando elas estão com teor de água entre 10 e 14%.The vigor of peanut seeds (Arachis hypogaea L. assessed by the conductivity test shows close relationship with performance in the field, but some factors may affect the outcome of the electrical conductivity, being one of that the initial water content of seeds. The objective of this study was to evaluate the seed water content most appropriate for evaluating the seed vigor through electrical conductivity test in peanut. Four seed lots of 'IAC Tatu ST' cultivar and four 'IAC Runner 886' were initially evaluated for their physiological potential and

  8. Envelhecimento acelerado e deterioração controlada em sementes de amendoim Accelerated aging and controlled deterioration of peanut seeds

    Directory of Open Access Journals (Sweden)

    Claudia Antonia Vieira Rossetto

    2004-08-01

    Full Text Available Pesquisas têm sido desenvolvidas visando determinar os procedimentos para a avaliação de diferenças no potencial fisiológico de lotes de sementes, com destaque aos testes de vigor. O objetivo deste trabalho foi estudar o envelhecimento acelerado e a deterioração controlada para avaliação do vigor de sementes de amendoim (Arachis hypogaea. Quatro lotes de sementes de amendoim da cultivar Tatu foram submetidos ao teste de envelhecimento acelerado, em caixas tipo gerbox, com temperatura de 42ºC ou 43ºC, por 48 horas e 72 horas, com e sem o emprego de solução saturada de NaCl, e ao teste de deterioração controlada, com teor de água de 15% e 20%, a 40ºC ou 45ºC, por 48 horas. O teor de água, a germinação e sanidade das sementes foram determinados. Pelos testes de germinação e de emergência, não houve diferença significativa de desempenho entre os quatro lotes. No teste de envelhecimento acelerado com solução salina, o período de 72 horas a 42ºC é suficiente para avaliar o potencial fisiológico das sementes. No teste de deterioração controlada, a combinação de 15% de teor de água nas sementes e 48 horas em banho maria a 45ºC é eficiente para detectar diferenças de vigor entre os lotes.Researches have been developed aiming to determine the procedures for physiological potential seeds evaluation with emphasis to vigour tests. The objective was to study the controlled deterioration and the accelerated aging in peanut (Arachis hypogaea seeds vigour. Four lots of peanut seeds were submitted to the ageing accelerated test, at 42ºC or 43ºC, for 48 hours and 72 hours, with or without the use of saturated solution of NaCl, and controlled deterioration test, with 15% and 20% water content, at 40ºC or 45ºC, for 48 hours. The evaluation of water content, germination and health test was accomplished. There was no different performance among the four lots by the germination and emergency tests. In the ageing accelerated

  9. Suitability of peanut residue as a nitrogen source for a rye cover crop Resíduos da cultura de amendoim como fonte de nitrogênio para uma cultura de cobertura de centeio

    Directory of Open Access Journals (Sweden)

    Kipling Shane Balkcom

    2007-01-01

    Full Text Available Leguminous winter cover crops have been utilized in conservation systems to partially meet nitrogen (N requirements of succeeding summer cash crops, but the potential of summer legumes to reduce N requirements of a winter annual grass, used as a cover crop, has not been extensively examined. This study assessed the N contribution of peanut (Arachis hypogaea L. residues to a subsequent rye (Secale cereale L. cover crop grown in a conservation system on a Dothan sandy loam (fine-loamy, kaolinitic, thermic Plinthic Kandiudults at Headland, AL USA during the 2003-2005 growing seasons. Treatments were arranged in a split plot design, with main plots of peanut residue retained or removed from the soil surface, and subplots as N application rates (0, 34, 67 and 101 kg ha-1 applied in the fall. Peanut residue had minimal to no effect on rye biomass yields, N content, carbon (C /N ratio, or N, P, K, Ca and Zn uptake. Additional N increased rye biomass yield, and N, P, K, Ca, and Zn uptakes. Peanut residue does not contribute significant amounts of N to a rye cover crop grown as part of a conservation system, but retaining peanut residue on the soil surface could protect the soil from erosion early in the fall and winter before a rye cover crop grows sufficiently to protect the typically degraded southeastern USA soils.Culturas leguminosas de inverno tem sido utilizadas em sistemas conservacionistas para suprimento parcial das necessidades de nitrogênio (N de culturas subseqüentes de verão, mas o potencial destas culturas leguminosas de verão no sentido de reduzir as necessidades de N de gramíneas anuais de inverno, utilizadas como culturas de cobertura, ainda não foi extensivamente estudado. Este trabalho avaliou a contribuição dos resíduos de uma cultura de amendoim (Arachis hypogaea L. sobre as necessidades de N de uma cultura subsequente de centeio (Secale cereale L. como cobertura desenvolvida dentro de um sistema conservacionista, em um

  10. Predicting favorable conditions for early leaf spot of peanut using output from the Weather Research and Forecasting (WRF) model

    Science.gov (United States)

    Olatinwo, Rabiu O.; Prabha, Thara V.; Paz, Joel O.; Hoogenboom, Gerrit

    2012-03-01

    Early leaf spot of peanut ( Arachis hypogaea L.), a disease caused by Cercospora arachidicola S. Hori, is responsible for an annual crop loss of several million dollars in the southeastern United States alone. The development of early leaf spot on peanut and subsequent spread of the spores of C. arachidicola relies on favorable weather conditions. Accurate spatio-temporal weather information is crucial for monitoring the progression of favorable conditions and determining the potential threat of the disease. Therefore, the development of a prediction model for mitigating the risk of early leaf spot in peanut production is important. The specific objective of this study was to demonstrate the application of the high-resolution Weather Research and Forecasting (WRF) model for management of early leaf spot in peanut. We coupled high-resolution weather output of the WRF, i.e. relative humidity and temperature, with the Oklahoma peanut leaf spot advisory model in predicting favorable conditions for early leaf spot infection over Georgia in 2007. Results showed a more favorable infection condition in the southeastern coastline of Georgia where the infection threshold were met sooner compared to the southwestern and central part of Georgia where the disease risk was lower. A newly introduced infection threat index indicates that the leaf spot threat threshold was met sooner at Alma, GA, compared to Tifton and Cordele, GA. The short-term prediction of weather parameters and their use in the management of peanut diseases is a viable and promising technique, which could help growers make accurate management decisions, and lower disease impact through optimum timing of fungicide applications.

  11. Transcriptome Analysis of a New Peanut Seed Coat Mutant for the Physiological Regulatory Mechanism Involved in Seed Coat Cracking and Pigmentation.

    Science.gov (United States)

    Wan, Liyun; Li, Bei; Pandey, Manish K; Wu, Yanshan; Lei, Yong; Yan, Liying; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Wei, Guo; Varshney, Rajeev K; Liao, Boshou

    2016-01-01

    Seed-coat cracking and undesirable color of seed coat highly affects external appearance and commercial value of peanuts ( Arachis hypogaea L.). With an objective to find genetic solution to the above problems, a peanut mutant with cracking and brown colored seed coat (testa) was identified from an EMS treated mutant population and designated as "peanut seed coat crack and brown color mutant line ( pscb )." The seed coat weight of the mutant was almost twice of the wild type, and the germination time was significantly shorter than wild type. Further, the mutant had lower level of lignin, anthocyanin, proanthocyanidin content, and highly increased level of melanin content as compared to wild type. Using RNA-Seq, we examined the seed coat transcriptome in three stages of seed development in the wild type and the pscb mutant. The RNA-Seq analysis revealed presence of highly differentially expressed phenylpropanoid and flavonoid pathway genes in all the three seed development stages, especially at 40 days after flowering (DAF40). Also, the expression of polyphenol oxidases and peroxidase were found to be activated significantly especially in the late seed developmental stage. The genome-wide comparative study of the expression profiles revealed 62 differentially expressed genes common across all the three stages. By analyzing the expression patterns and the sequences of the common differentially expressed genes of the three stages, three candidate genes namely c36498_g1 (CCoAOMT1), c40902_g2 (kinesin) , and c33560_g1 (MYB3) were identified responsible for seed-coat cracking and brown color phenotype. Therefore, this study not only provided candidate genes but also provided greater insights and molecular genetic control of peanut seed-coat cracking and color variation. The information generated in this study will facilitate further identification of causal gene and diagnostic markers for breeding improved peanut varieties with smooth and desirable seed coat color.

  12. Transcriptome Analysis of a New Peanut Seed Coat Mutant for the Physiological Regulatory Mechanism Involved in Seed Coat Cracking and Pigmentation

    Science.gov (United States)

    Wan, Liyun; Li, Bei; Pandey, Manish K.; Wu, Yanshan; Lei, Yong; Yan, Liying; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Wei, Guo; Varshney, Rajeev K.; Liao, Boshou

    2016-01-01

    Seed-coat cracking and undesirable color of seed coat highly affects external appearance and commercial value of peanuts (Arachis hypogaea L.). With an objective to find genetic solution to the above problems, a peanut mutant with cracking and brown colored seed coat (testa) was identified from an EMS treated mutant population and designated as “peanut seed coat crack and brown color mutant line (pscb).” The seed coat weight of the mutant was almost twice of the wild type, and the germination time was significantly shorter than wild type. Further, the mutant had lower level of lignin, anthocyanin, proanthocyanidin content, and highly increased level of melanin content as compared to wild type. Using RNA-Seq, we examined the seed coat transcriptome in three stages of seed development in the wild type and the pscb mutant. The RNA-Seq analysis revealed presence of highly differentially expressed phenylpropanoid and flavonoid pathway genes in all the three seed development stages, especially at 40 days after flowering (DAF40). Also, the expression of polyphenol oxidases and peroxidase were found to be activated significantly especially in the late seed developmental stage. The genome-wide comparative study of the expression profiles revealed 62 differentially expressed genes common across all the three stages. By analyzing the expression patterns and the sequences of the common differentially expressed genes of the three stages, three candidate genes namely c36498_g1 (CCoAOMT1), c40902_g2 (kinesin), and c33560_g1 (MYB3) were identified responsible for seed-coat cracking and brown color phenotype. Therefore, this study not only provided candidate genes but also provided greater insights and molecular genetic control of peanut seed-coat cracking and color variation. The information generated in this study will facilitate further identification of causal gene and diagnostic markers for breeding improved peanut varieties with smooth and desirable seed coat color. PMID

  13. Transcriptomic and Physiological Evidence for the Relationship between Unsaturated Fatty Acid and Salt Stress in Peanut.

    Science.gov (United States)

    Sui, Na; Wang, Yu; Liu, Shanshan; Yang, Zhen; Wang, Fang; Wan, Shubo

    2018-01-01

    Peanut ( Arachis hypogaea L.) is one of the five major oilseed crops cultivated worldwide. Salt stress is a common adverse condition for the growth of this crop in many countries and regions. In this study, physiological parameters and transcriptome profiles of peanut seedlings exposed to salt stress (250 mM NaCl for 4 days, S4) and recovery for 3 days (when transferred to standard conditions for 3 days, R3) were analyzed to detect genes associated with salt stress and recovery in peanut. We observed that the quantum yield of PSII electron transport (ΦPSII) and the maximal photochemical efficiency of PSII ( F v / F m ) decreased in S4 compared with the control, and increased in R3 compared with those in S4. Seedling fresh weight, dry weight and PSI oxidoreductive activity (Δ I / I o ) were inhibited in S4 and did not recover in R3. Superoxide dismutase (SOD) and ascorbate peroxidase (APX) activities decreased in S4 and increased in R3, whereas superoxide anion ([Formula: see text]) and hydrogen peroxide (H 2 O 2 ) contents increased in S4 and decreased in R3. Transcriptome analysis revealed 1,742 differentially expressed genes (DEGs) under salt stress and 390 DEGs under recovery. Among these DEGs, two DEGs encoding ω-3 fatty acid desaturase that synthesized linolenic acid (18:3) from linoleic acid (18:2) were down-regulated in S4 and up-regulated in R3. Furthermore, ω-3 fatty acid desaturase activity decreased under salt stress and increased under recovery. Consistent with this result, 18:3 content decreased under salt stress and increased under recovery compared with that under salt treatment. In conclusion, salt stress markedly changed the activity of ω-3 fatty acid desaturase and fatty acid composition. The findings provide novel insights for the improvement of salt tolerance in peanut.

  14. The Longevity of Crop Seeds Stored Under Long-term Condition in the National Gene Bank of Bulgaria

    Directory of Open Access Journals (Sweden)

    Desheva Gergana

    2016-10-01

    Full Text Available Seed accessions from 7 plant families and 28 species stored for above 20 years in the National gene bank of Bulgaria were evaluated. All seed accessions were maintained as base collection under long-term storage conditions with low moisture contents (5±2% in hermetically closed containers at −18°C. On the basis of experimental data, the seed storage characters σ (standard deviation of seed death in storage, P50% (the time for viability to fall to 50% and P10% (the time for viability reduction of 10% were determined allowing the prediction of seed storage life and the regeneration needs. The results showed significant differences in loss of seed viability among species and within the species. After 20–24 years of storage, eleven crops showed minimal viability decline under 5% as compared to the initial viability (oats, barley, maize, bread wheat, durum wheat, smooth brome grass, faba bean, chickpea, sunflower, cucumber and pepper. For the same storage time, another group of crops (sorghum, triticale, orchard grass, tall fescue, common vetch, grass pea, lentil, common bean, rapeseed, tobacco, flax, cabbage and tomatoes presented 5–10% reduction of seed viability. More significant changes in seed viability – above 10% – were detected for peanuts, lettuce, soybean and rye. The σ values varied from 20.41 years (Arachis hypogaea L. to 500 years (for Avena sativa L. and Triticum aestivum L. There was wide variation across species, both in time taken for the viability to fall to 50% and in time taken for the seed viability reduction of 10%. The study illustrates the positive effect of both seed storability early monitoring and prediction of regeneration needs as a tool for limiting undesired losses.

  15. Caracterización de jamones adicionados con pastas residuales de la extracción mecánica de aceite de frutos secos

    Directory of Open Access Journals (Sweden)

    Juan José Luna Guevara

    2013-01-01

    Full Text Available Los frutos secos contienen en su composición nutrientes y compuestos bioactivos que al ser consumidos en cantidades suficientes aportan beneficios a la salud. En este estudio se evaluó la influencia de la adición de pastas residuales (10 %, obtenidas de la extracción de aceite de nuez de Castilla (Juglans regia L., nuez pecanera (Carya illinoinensis (Wangenh. K. Koch, variedad Western Shley, y cacahuate (Arachis hypogaea, sobre la modificación de algunas características de textura, composición proximal, fisicoquímicas, microbiológicas y sensoriales en jamones cocidos. Los jamones estudiados fueron almacenados a 4 °C durante 21 días. Las pastas adicionadas a los jamones aumentaron de manera significativa (P≤0,05 el contenido de proteína, grasa y fibra total. Los jamones adicionados con pasta presentaron estructuras menos rígidas (P≤0,05. Los parámetros de color (L*, a* y b* de los jamones mostraron una ligera disminución durante el tiempo de almacenamiento, a excepción de los adicionados con nuez de Castilla que mostraron un mayor oscurecimiento. Las pastas de frutos secos contribuyeron significativamente (P≤ 0,05 a disminuir la vida de anaquel de los jamones. Sin embargo, el recuento de mohos y levaduras en los jamones fue menor a 10 UFC/g a los 21 días de almacenamiento. La aw y el pH disminuyeron significativamente (P≤0,05 y la sinéresis aumentó durante el almacenamiento. Los jamones adicionados con pastas residuales fueron sensorialmente bien aceptados con respecto al color, olor, sabor, apariencia y aceptabilidad general.

  16. Global Synthesis of Drought Effects on Food Legume Production.

    Directory of Open Access Journals (Sweden)

    Stefani Daryanto

    Full Text Available Food legume crops play important roles in conservation farming systems and contribute to food security in the developing world. However, in many regions of the world, their production has been adversely affected by drought. Although water scarcity is a severe abiotic constraint of legume crops productivity, it remains unclear how the effects of drought co-vary with legume species, soil texture, agroclimatic region, and drought timing. To address these uncertainties, we collected literature data between 1980 and 2014 that reported monoculture legume yield responses to drought under field conditions, and analyzed this data set using meta-analysis techniques. Our results showed that the amount of water reduction was positively related with yield reduction, but the extent of the impact varied with legume species and the phenological state during which drought occurred. Overall, lentil (Lens culinaris, groundnut (Arachis hypogaea, and pigeon pea (Cajanus cajan were found to experience lower drought-induced yield reduction compared to legumes such as cowpea (Vigna unguiculata and green gram (Vigna radiate. Yield reduction was generally greater when legumes experienced drought during their reproductive stage compared to during their vegetative stage. Legumes grown in soil with medium texture also exhibited greater yield reduction compared to those planted on soil of either coarse or fine texture. In contrast, regions and their associated climatic factors did not significantly affect legume yield reduction. In the face of changing climate, our study provides useful information for agricultural planning and research directions for development of drought-resistant legume species to improve adaptation and resilience of agricultural systems in the drought-prone regions of the world.

  17. Characterization and compilation of polymorphic simple sequence repeat (SSR markers of peanut from public database

    Directory of Open Access Journals (Sweden)

    Zhao Yongli

    2012-07-01

    Full Text Available Abstract Background There are several reports describing thousands of SSR markers in the peanut (Arachis hypogaea L. genome. There is a need to integrate various research reports of peanut DNA polymorphism into a single platform. Further, because of lack of uniformity in the labeling of these markers across the publications, there is some confusion on the identities of many markers. We describe below an effort to develop a central comprehensive database of polymorphic SSR markers in peanut. Findings We compiled 1,343 SSR markers as detecting polymorphism (14.5% within a total of 9,274 markers. Amongst all polymorphic SSRs examined, we found that AG motif (36.5% was the most abundant followed by AAG (12.1%, AAT (10.9%, and AT (10.3%.The mean length of SSR repeats in dinucleotide SSRs was significantly longer than that in trinucleotide SSRs. Dinucleotide SSRs showed higher polymorphism frequency for genomic SSRs when compared to trinucleotide SSRs, while for EST-SSRs, the frequency of polymorphic SSRs was higher in trinucleotide SSRs than in dinucleotide SSRs. The correlation of the length of SSR and the frequency of polymorphism revealed that the frequency of polymorphism was decreased as motif repeat number increased. Conclusions The assembled polymorphic SSRs would enhance the density of the existing genetic maps of peanut, which could also be a useful source of DNA markers suitable for high-throughput QTL mapping and marker-assisted selection in peanut improvement and thus would be of value to breeders.

  18. Breeding for high N2 fixation in groundnut and soybean in Viet Nam

    International Nuclear Information System (INIS)

    Nguyen Xuan Hong

    1998-01-01

    Groundnut (Arachis hypogaea L.) and soybean (Glycine max (L.) Mer.) are grown mainly on two types of soil in Viet Nam: coastal-sandy and upland-degraded soils. These soils are deficient in N, and considering that fertilizer N is not only costly to farmers but also a threat to the environment, it is important to maximize productivity by exploiting the ability of these legumes to fix N 2 symbiotically in their root nodules. We initiated programmes of breeding and selection to combine high N 2 fixation and high grain-yielding capacity. In the spring of 1992, breeding lines of groundnut and soybean were tested under greenhouse conditions for varietal differences in the capacity to fix N 2 using the acetylene reduction assay and the 15 N-dilution technique, with upland rice as reference plants. Varietal differences were found in nitrogenase activity, and percent N derived from fixation (%Ndfa) ranged from 11 to 63% for groundnut and from 9 to 79% for soybean. Field experiments in the autumn-winter season of 1992 again revealed significant varietal differences; %Ndfa ranged from 36 to 56% for groundnut and from 28 to 58% for soybean. Gamma-irradiated seeds of soybean were propagated in bulk from M 1 to M 4 . Five high-yielding mutant lines of both species were selected from the M 5 populations, and N 2 fixation was estimated using the 15 N-dilution technique. The average values for %Ndfa of the mutants were 55 and 57%, significant improvements over the parent-cultivar values of 25 and 29% for soybean and groundnut, respectively

  19. Qualidade sanitária de grãos e frutos de amendoim comercializados no estado de Alagoas e identificação através de características culturais de espécies do gênero Aspergillus

    Directory of Open Access Journals (Sweden)

    Edna Peixoto da Rocha Amorim

    2010-12-01

    Full Text Available A identificação de espécies fúngicas presentes em grãos e frutos de amendoim (Arachis hypogaea, bem como a caracterização cultural das espécies de Aspergillus detectadas, é um importante passo para a prevenção da presença de micotoxinas no substrato, garantindo a qualidade do produto, tanto para a comercialização in natura quanto já processado. A partir de grãos e frutos de amendoim comercializados, in natura ou processados, no estado de Alagoas foram isolados os fungos Aspergillus flavus, A. niger, A. ochraceus, A. parasiticus, Fusarium verticillioides (= F. moniliforme, F. equiseti, Rhizopus stolonifer, Botrytis cinerea, Penicillium italicum e Colletotrichum sp. De um modo geral, os grãos processados apresentaram menor incidência de fungos, diferindo estatisticamente dos grãos in natura, com destaque para as espécies A. flavus, A. parasiticus, F. verticillioides e F. equiseti. As espécies de Aspergillus foram identificadas com base nas características culturais, exibidas em meio de Czapek-ágar, e morfológicas, através de microscópio ótico. No oitavo dia de crescimento em meio de BDA, cada espécie apresentou diferenças quanto à taxa de crescimento durante o período de incubação, de acordo com a procedência das amostras dos grãos ou frutos.

  20. Biosynthesis of the major tetrahydroxystilbenes in spruce, astringin and isorhapontin, proceeds via resveratrol and is enhanced by fungal infection.

    Science.gov (United States)

    Hammerbacher, Almuth; Ralph, Steven G; Bohlmann, Joerg; Fenning, Trevor M; Gershenzon, Jonathan; Schmidt, Axel

    2011-10-01

    Stilbenes are dibenzyl polyphenolic compounds produced in several unrelated plant families that appear to protect against various biotic and abiotic stresses. Stilbene biosynthesis has been well described in economically important plants, such as grape (Vitis vinifera), peanut (Arachis hypogaea), and pine (Pinus species). However, very little is known about the biosynthesis and ecological role of stilbenes in spruce (Picea), an important gymnosperm tree genus in temperate and boreal forests. To investigate the biosynthesis of stilbenes in spruce, we identified two similar stilbene synthase (STS) genes in Norway spruce (Picea abies), PaSTS1 and PaSTS2, which had orthologs with high sequence identity in sitka (Picea sitchensis) and white (Picea glauca) spruce. Despite the conservation of STS sequences in these three spruce species, they differed substantially from angiosperm STSs. Several types of in vitro and in vivo assays revealed that the P. abies STSs catalyze the condensation of p-coumaroyl-coenzyme A and three molecules of malonyl-coenzyme A to yield the trihydroxystilbene resveratrol but do not directly form the dominant spruce stilbenes, which are tetrahydroxylated. However, in transgenic Norway spruce overexpressing PaSTS1, significantly higher amounts of the tetrahydroxystilbene glycosides, astringin and isorhapontin, were produced. This result suggests that the first step of stilbene biosynthesis in spruce is the formation of resveratrol, which is further modified by hydroxylation, O-methylation, and O-glucosylation to yield astringin and isorhapontin. Inoculating spruce with fungal mycelium increased STS transcript abundance and tetrahydroxystilbene glycoside production. Extracts from STS-overexpressing lines significantly inhibited fungal growth in vitro compared with extracts from control lines, suggesting that spruce stilbenes have a role in antifungal defense.

  1. Fraction A of armadillo submandibular glycoprotein and its desialylated product as sialyl-Tn and Tn receptors for lectins.

    Science.gov (United States)

    Wu, A M; Shen, F; Herp, A; Song, S C; Wu, J H

    1995-02-27

    Fraction A of the armadillo submandibular glycoprotein (ASG-A) is one of the simplest glycoproteins among mammalian salivary mucins. The carbohydrate side chains of this mucous glycoprotein have one-third of the NeuAc alpha 2-->6GalNAc (sialyl-Tn) sequence and two thirds of Tn (GalNAc alpha-->Ser/Thr) residues. Those of the desialylated product (ASG-Tn) are almost exclusively unsubstituted GalNAc residues (Tn determinant). When the binding properties of these glycoproteins were tested by a precipitin assay with Gal, GalNAc and GlcNAc specific lectins, it was found that ASG-Tn reacted strongly with all of the Tn-active lectins and completely precipitated Vicia villosa (VVL both B4 and mixture of A and B), Maclura pomifera (MPA), and Artocarpus integrifolia (jacalin) lectins. However, it precipitated poorly or negligibly with Ricinus communis (RCA1); Dolichos biflorus (DBA); Viscum album, ML-I; Arachis hypogaea (PNA), and Triticum vulgaris (WGA). The reactivity of ASG-A (sialyl-Tn) was as active as that of ASG-Tn with MPA and less or slightly less active than that of ASG-Tn with VVL-A+B, VVL-B4, HPA, WFA, and jacalin, as one-third of its Tn was sialylated. These findings indicate that ASG-A and its desialylated product (ASG-Tn) are highly useful reagents for the differentiation of Tn, T (Gal beta 1-->3GalNAc), A (GalNAc alpha 1-->3Gal) or Gal specific lectins and monoclonal antibodies against such epitopes.

  2. Interaction of hamster submaxillary sialyl-Tn and Tn glycoproteins with Gal, GalNAc and GlcNAc specific lectins.

    Science.gov (United States)

    Wu, A M; Shen, F; Herp, A; Wu, J H

    1994-04-01

    Hamster submaxillary glycoprotein (HSM), one of the simplest glycoproteins among mammalian salivary mucins, is composed of approximately equivalent amounts of protein, hexosamine and sialic acid. The Thr and Ser residues in the protein core account for more than half of all of the amino acid residues, while Lys, Glu, Pro and Ala are the major components of the remaining portion of amino acids. The carbohydrate side chains of this mucous glycoprotein have mainly the NeuAc-GalNAc-(sialyl-Tn) sequence (HSM), and those of the desialylated product (HSM-Tn) are almost exclusively unsubstituted GalNAc residues (Tn determinants). The binding properties of sialyl-Tn (HSM) and asialo-HSM (HSM-Tn) glycoproteins were tested by precipitin assay with Gal, GalNAc and GlcNAc specific lectins. The HSM-Tn completely precipitated Vicia villosa (VVL both B4 and mixture of A and B), Maclura pomifera (MPL), and Artocarpus integrifolia (Jacalin) lectins; less than 2 micrograms of HSM-Tn were required for precipitating 50% of 5.0-6.3 micrograms lectin nitrogen added. HSM-Tn also reacted well with Helix pomatia lectin (HPL), Wistaria floribunda lectin (WFL) and Abrus precatorius agglutinin (APA) and precipitated in each case over 81% of the lectin nitrogen added. The reactivity of HSM-Tn with other lectins (Ricinus communis, RCA1; Dolichol biflorus, DBL; Viscum album, ML-I; Arachis hypogaea, PNA, and Triticum vulgaris, WGA) was weak or negligible. The activity of sialyl-Tn (HSM) was more restricted; HSM reacted well with Jacalin, moderately with MPL and VVL-B4, but was inactive or only weakly with the other lectins used. These findings indicate that HSM and its desialylated product (HSM-Tn) are highly useful reagents for the differentiation of Tn and T/Gal specific lectins and for anti-T, Tn and Af monoclonal antibodies.

  3. Dietary Plant Lectins Appear to Be Transported from the Gut to Gain Access to and Alter Dopaminergic Neurons of Caenorhabditis elegans, a Potential Etiology of Parkinson’s Disease

    Science.gov (United States)

    Zheng, Jolene; Wang, Mingming; Wei, Wenqian; Keller, Jeffrey N.; Adhikari, Binita; King, Jason F.; King, Michael L.; Peng, Nan; Laine, Roger A.

    2016-01-01

    Lectins from dietary plants have been shown to enhance drug absorption in the gastrointestinal tract of rats, be transported trans-synaptically as shown by tracing of axonal and dendritic paths, and enhance gene delivery. Other carbohydrate-binding protein toxins are known to traverse the gut intact in dogs. Post-feeding rhodamine- or TRITC-tagged dietary lectins, the lectins were tracked from gut to dopaminergic neurons (DAergic-N) in transgenic Caenorhabditis elegans (C. elegans) [egIs1(Pdat-1:GFP)] where the mutant has the green fluorescent protein (GFP) gene fused to a dopamine transport protein gene labeling DAergic-N. The lectins were supplemented along with the food organism Escherichia coli (OP50). Among nine tested rhodamine/TRITC-tagged lectins, four, including Phaseolus vulgaris erythroagglutinin (PHA-E), Bandeiraea simplicifolia (BS-I), Dolichos biflorus agglutinin (DBA), and Arachis hypogaea agglutinin (PNA), appeared to be transported from gut to the GFP-DAergic-N. Griffonia Simplicifolia and PHA-E, reduced the number of GFP-DAergic-N, suggesting a toxic activity. PHA-E, BS-I, Pisum sativum (PSA), and Triticum vulgaris agglutinin (Succinylated) reduced fluorescent intensity of GFP-DAergic-N. PHA-E, PSA, Concanavalin A, and Triticum vulgaris agglutinin decreased the size of GFP-DAergic-N, while BS-I increased neuron size. These observations suggest that dietary plant lectins are transported to and affect DAergic-N in C. elegans, which support Braak and Hawkes’ hypothesis, suggesting one alternate potential dietary etiology of Parkinson’s disease (PD). A recent Danish study showed that vagotomy resulted in 40% lower incidence of PD over 20 years. Differences in inherited sugar structures of gut and neuronal cell surfaces may make some individuals more susceptible in this conceptual disease etiology model. PMID:27014695

  4. Dietary plant lectins appear to be transported from the gut to gain access to and alter dopaminergic neurons of Caenorhabditis elegans, a potential etiology of Parkinson’s disease

    Directory of Open Access Journals (Sweden)

    Jolene eZheng

    2016-03-01

    Full Text Available Lectins from dietary plants have been shown to enhance drug absorption in the gastrointestinal tract of rats, be transported trans-synaptically as shown by tracing of axonal and dendritic paths, and enhance gene delivery. Other carbohydrate-binding protein toxins are known to traverse the gut intact in dogs. Post-feeding rhodamine- or TRITC-tagged dietary lectins, the lectins were tracked from gut to dopaminergic neurons (DAergic-N in transgenic Caenorhabditis elegans (C. elegans (egIs1[Pdat-1::GFP] where the mutant has the Green Fluorescent Protein (GFP gene fused to a dopamine transport protein gene labeling dopaminergic neurons, The lectins were supplemented along with the food organism Escherichia coli (OP50. Among nine tested rhodamine/TRITC-tagged lectins, four, including Phaseolus vulgaris erythroagglutinin (PHA-E, Bandeiraea simplicifolia (BS-I, Dolichos biflorus agglutinin (DBA, and Arachis hypogaea (PNA, appeared to be transported from gut to the GFP-DAergic-N. Griffonia Simplicifolia (GSL-I and PHA-E, reduced the number of GFP-DAergic-N suggesting a toxic activity. PHA-E, BS-I, Pisum Sativum (PSA, and Triticum vulgaris agglutinin (Succinylated reduced fluorescent intensity of GFP-DAergic-N. PHA-E, PSA, Concanavalin A, and Triticum vulgaris agglutinin decreased the size of GFP-DAergic-N, while BS-I increased neuron size. These observations suggest that dietary plant lectins are transported to and affect DAergic-N in C. elegans, which support Braak and Hawkes’ hypothesis, suggesting one alternate potential dietary etiology of Parkinson’s disease (PD. A recent Danish study showed that vagotomy resulted in 40% lower incidence of PD over 20 years. Differences in inherited sugar structures of gut and neuronal cell surfaces may make some individuals more susceptible in this conceptual disease etiology model.

  5. Expression pattern of glycoconjugates in the Bidderian and ovarian follicles of the Brazilian toad Bufo ictericus analyzed by lectin histochemistry

    Directory of Open Access Journals (Sweden)

    C. F. Farias

    Full Text Available The Bidder's organ and ovary of the Brazilian toad Bufo ictericus were studied by light microscopy, using hematoxylin-eosin (HE and periodic acid Schiff (PAS staining. The expression and distribution of carbohydrate moieties was analyzed by lectin histochemistry, using 8 lectins with different carbohydrate specificities: Ulex europaeus (UEA I, Lens culinaris (LCA, Erythrina cristagalli (ECA, Arachis hypogaea (PNA, Ricinus communis (RCA I, Aleuria aurantia (AAA, Triticum vulgaris (WGA, and Glycine maximum (SBA. The results showed that the Bidderian zona pellucida presented alpha-mannose, alpha-L-fucose, beta-D-galactose, N-acetyl-D-glucosamine, and alpha/beta-N-acetyl-galactosamine residues. The Bidderian follicular cells showed the presence of beta-D-galactose and N-acetyl-D-glucosamine. In the extracellular matrix, alpha-mannose and alpha/beta-N-acetyl-galactosamine residues were detected. The ovarian zona pellucida showed alpha-L-fucose, N-acetyl-D-glucosamine, alpha/beta-N-acetyl-galactosamine residues, and alpha-mannose and N-acetyl-D-glucosamine residues were detected in the follicular cells. Thus, the zona pellucida in both organs contains N-acetyl-D-glucosamine, and alpha/beta-N-acetyl-galactosamine residues. alpha-L-fucose residues were detected in the zona pellucida of both organs, using different lectins. Considering that beta-D-galactose residue was absent from ovary but present in the Bidder's organ, this sugar residue may play an important role in follicle development, blocking the Bidderian follicles and preventing further development of the Bidder's organ into a functional ovary.

  6. Glicosilación intestinal y su relación con la interacción hospedero-patógeno.

    Directory of Open Access Journals (Sweden)

    Gregory Ramón Valdés Paneca

    2015-03-01

    Full Text Available Se evaluó el efecto bloqueador de diferentes lectinas vegetales en la adhesión de E. coli enterotoxigénicas que expresan fimbrias F4. Se realizaron dos experimentos. Primero – las vellosidades fueron incubadas con lectinas de Glycine max, Ulex europaeus, Lens culinaris y Arachis hypogaea a diferentes concentraciones y después fueron incubadas con las cepa de E. coli GIS26 (F4ac. Segundo – veinte y seis lectinas vegetales biotiniladas se enfrentaron a las vellosidades bajo 3 métodos de fijación diferentes. La unión se verificó mediante la técnica de inmunofluorescencia. Para el primer caso hubo bloqueo total de la adhesión de la E. coli GIS26 al borde en cepillo por parte de las lectinas; para el segundo caso se mostró que existe una adhesión moderada y fuerte a las células epiteliales intestinales en el 69,2% (18/26 de las lectinas. Al mismo tiempo se probaron la adhesión de lectinas biotiniladas a diferentes regiones del intestino delgado y la unión de los antígenos fimbriales F4ab, F4ac y F4ad al borde en cepillo. Se encontraron variaciones en el perfil de unión de las lectinas a lo largo de las diferentes regiones del intestino delgado y no homogeneidad en la adhesión de los antígenos fimbriales.

  7. Helix lucorum'un Tükürük Bezindeki Glikokonjugatların Lektin Histokimyası ile Belirlenmesi

    Directory of Open Access Journals (Sweden)

    Seçil ZORLU

    2014-07-01

    Full Text Available Bu çalışmada Helix lucorum'un tükürük bezinde büyüklük ve morfolojik özellikleri dikkate alınarak beş hücre tipi tespit edildi. Bu hücreler Tip 1, 2, 3, 4 ve 5 olarak isimlendirildi. Yapılan sayımlar sonucunda tükürük bezinde en fazla Tip 1, en az Tip 3 hücrelerinin bulunduğu belirlendi. Hücrelerin çaplarının ölçülmesi sonucu en büyük hücrenin Tip 1, en küçük hücrenin Tip 3 olduğu saptandı. Tip 1 ve 2 hücrelerinin uygulanan Dolichos biflorus (DBA, Ulex europaeus (UEA-1, Arachis hypogaea (PNA, Canavalia ensiformis (Con A, Bandeiraea simplicifolia (BSA I-B4, Triticum vulgare (WGA lektinlerinin hepsine karşı reaksiyon verdiği belirlendi. Bu iki hücre tipinin BSA I-B4 ile zayıf reaksiyon verdiği gözlenirken, PNA ve DBA ile kuvvetli reaksiyon verdiği saptandı. Tip 3, 4 ve 5 hücrelerinin ise uygulanan hiçbir lektine karşı reaksiyon göstermediği belirlendi.

  8. High efficiency transformation of banana [Musa acuminata L. cv. Matti (AA)] for enhanced tolerance to salt and drought stress through overexpression of a peanut salinity-induced pathogenesis-related class 10 protein.

    Science.gov (United States)

    Rustagi, Anjana; Jain, Shalu; Kumar, Deepak; Shekhar, Shashi; Jain, Mukesh; Bhat, Vishnu; Sarin, Neera Bhalla

    2015-01-01

    Bananas and plantains (Musa spp. L.) are important subsistence crops and premium export commodity in several countries, and susceptible to a wide range of environmental and biotic stress conditions. Here, we report efficient, rapid, and reproducible Agrobacterium-mediated transformation and regeneration of an Indian niche cultivar of banana [M. acuminata cv. Matti (AA)]. Apical meristem-derived highly proliferative multiple shoot clump (MSC) explants were transformed with the Agrobacterium strain EHA105 harboring a binary vector pCAMBIA-1301 carrying hptII and uidA. Sequential agro-infiltration (10 min, 400 mmHg), infection (additional 35 min, Agrobacterium density A 600 = 0.8) and co-cultivation (18 h) regimen in 100 µM acetosyringone containing liquid medium were critical factors yielding high transformation efficiency (~81 %) corroborated by transient GUS expression assay. Stable transgenic events were recovered following two cycles of meristem initiation and selection on hygromycin containing medium. Histochemical GUS assay in several tissues of transgenic plants and molecular analyses confirmed stable integration and expression of transgene. The protocol described here allowed recovery of well-established putative transgenic plantlets in as little as 5 months. The transgenic banana plants could be readily acclimatized under greenhouse conditions, and were phenotypically similar to the wild-type untransformed control plants (WT). Transgenic plants overexpressing Salinity-Induced Pathogenesis-Related class 10 protein gene from Arachis hypogaea (AhSIPR10) in banana cv. Matti (AA) showed better photosynthetic efficiency and less membrane damage (P < 0.05) in the presence of NaCl and mannitol in comparison to WT plants suggesting the role of AhSIPR10 in better tolerance of salt stress and drought conditions.

  9. Characterization and Mineralization Rates of Low Temperature Peanut Hull and Pine Chip Biochars

    Directory of Open Access Journals (Sweden)

    K.C. Das

    2013-04-01

    Full Text Available Biochar can potentially increase soil fertility and sequester carbon by incorporating nutrients and stable black carbon into the soil; however its effect on soil nitrogen (N and carbon (C processes is not well understood. A defined methodology to characterize biochar is necessary to predict how specific biochars will affect C and N mineralization. We amended a Tifton soil (Fine-loamy, siliceous, thermic Plinthic Kandiudults with peanut hull (Arachis hypogaea; PH; 2.1% N and pine chip (Pinus taeda; PC: 0.4% N biochar at application rates of 1% and 2% (w/w and performed a 136-day mineralization study. A companion 24-day mineralization study amended Tifton soil with PH and PC biochar at 2% and their respective feedstocks at equal C rates. Soil C mineralization rates were monitored periodically throughout each study and total N mineralization rates were also measured. In addition, we characterized each biochar using thermogravimetric analysis with mass spectrometer (TGA-MS, proximate analysis, Fourier transform infrared spectroscopy (FTIR, and total mineral analysis to identify biochar characteristics that might correlate with mineralization properties. Limited C (<2% mineralized from both biochars, but mineralization rates of soil amended with PH biochar were higher than PC biochar. Carbon mineralization correlated well with estimated aliphatic content determined by TGA-MS but not with volatile content indicated by proximate analysis. Nitrogen was not mineralized from either biochar, indicating that plant-based biochar should not be considered a source of N for plant growth. The N in biochar may be contained in the stable aromatic structure of the biochar, as indicated by TGA-MS, and not available to soil microbes.

  10. Cowpea and peanut in southern Africa are nodulated by diverse Bradyrhizobium strains harboring nodulation genes that belong to the large pantropical clade common in Africa.

    Science.gov (United States)

    Steenkamp, Emma T; Stepkowski, Tomasz; Przymusiak, Anna; Botha, Wilhelm J; Law, Ian J

    2008-09-01

    Cowpea (Vigna unguiculata) and peanut (Arachis hypogaea) in southern Africa are nodulated by a genetically diverse group of Bradyrhizobium strains. To determine the identity of these bacteria, a collection of 22 isolates originating from the root nodules of both hosts in Botswana and South Africa was investigated using the combined sequences for the core genome genes rrs, recA, and glnII. These data separated the majority of the isolates into one of three unique lineages that most likely represent novel Bradyrhizobium species. Some isolates were also conspecific with B. yuanmingense and with B. elkanii, although none grouped with B. japonicum, B. canariense or B. liaoningense. To study the evolution of nodulation genes in these bacteria, the common nodulation gene, nodA, and host-specific nodulation genes, nodZ, noeE, and noeI, were analyzed. The nodA phylogeny showed that the cowpea and peanut Bradyrhizobium isolates represent various locally adapted groups or ecotypes that form part of Clade III of the seven known BradyrhizobiumnodA clades. This large and highly diverse clade comprises all strains from sub-Saharan Africa, as well as some originating from the Americas, Australia, Indonesia, China and Japan. Some similar groupings were supported by the other nodulation genes, although the overall phylogenies for the nodulation genes were incongruent with that inferred from the core genome genes, suggesting that horizontal gene transfer significantly influences the evolution of cowpea and peanut root-nodule bacteria. Furthermore, identification of the nodZ, noeI, and noeE genes in the isolates tested indicates that African Bradyrhizobium species may produce highly decorated nodulation factors, which potentially represent an important adaptation enabling nodulation of a great variety of legumes inhabiting the African continent.

  11. Distribution of peanut allergen in the environment.

    Science.gov (United States)

    Perry, Tamara T; Conover-Walker, Mary Kay; Pomés, Anna; Chapman, Martin D; Wood, Robert A

    2004-05-01

    Patients with peanut allergy can have serious reactions to very small quantities of peanut allergen and often go to extreme measures to avoid potential contact with this allergen. The purpose of this study was to detect peanut allergen under various environmental conditions and examine the effectiveness of cleaning agents for allergen removal. A monoclonal-based ELISA for Arachis hypogaea allergen 1 (Ara h 1; range of detection, 30-2000 ng/mL) was used to assess peanut contamination on cafeteria tables and other surfaces in schools, the presence of residual peanut protein after using various cleaning products on hands and tabletops, and airborne peanut allergen during the consumption of several forms of peanut. After hand washing with liquid soap, bar soap, or commercial wipes, Ara h 1 was undetectable. Plain water and antibacterial hand sanitizer left detectable Ara h 1 on 3 of 12 and 6 of 12 hands, respectively. Common household cleaning agents removed peanut allergen from tabletops, except dishwashing liquid, which left Ara h 1 on 4 of 12 tables. Of the 6 area preschools and schools evaluated, Ara h 1 was found on 1 of 13 water fountains, 0 of 22 desks, and 0 of 36 cafeteria tables. Airborne Ara h 1 was undetectable in simulated real-life situations when participants consumed peanut butter, shelled peanuts, and unshelled peanuts. The major peanut allergen, Ara h 1, is relatively easily cleaned from hands and tabletops with common cleaning agents and does not appear to be widely distributed in preschools and schools. We were not able to detect airborne allergen in many simulated environments.

  12. Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

    Directory of Open Access Journals (Sweden)

    Jiongming Sui

    2018-03-01

    Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

  13. Comparative assessment of herbicide and fungicide runoff risk: a case study for peanut production in the Southern Atlantic Coastal Plain (USA).

    Science.gov (United States)

    Potter, Thomas L; Bosch, David D; Strickland, Timothy C

    2014-08-15

    Peanut (Arachis hypogaea) is produced intensively in the southern Atlantic Coastal Plain of the eastern USA. To effectively protect the region's water quality data are needed which quantify runoff of pesticides used to protect these crops. Fungicides are used intensively yet there is little published data which describe their potential for loss in surface runoff. This study compared runoff of a fungicide, tebuconazole (α-[2-(4-chlorophenyl)ethyl]-α-(1,1-dimethylethyl)-1H-1,2,4-triazole-1-ethanol), and an herbicide, metolachlor (2-chloro-N-(2-ethyl-6-methylphenyl)-N-(2-methoxy-1-methylethyl)acetamide) from 0.2 ha fields in strip (ST), a commonly used conservation-tillage practice, and conventional tillage (CT) near Tifton, GA (USA). Following their first application, metolachlor and tebuconazole were detected at high frequency in runoff. Concentrations and their annual losses increased with application frequency and runoff event timing and frequency with respect to applications, and when fields were positioned at the top of the slope and CT was practiced. Runoff one day after treatment (DAT) contributed to high tebuconazole runoff loss, up to 9.8% of the amount applied on an annual basis. In all cases, metolachlor loss was more than 10 times less even though total application was 45% higher. This was linked to the fact that the one metolachlor application to each crop was in May, one of the region's driest months. In sum, studies showed that fungicide runoff rates may be relatively high and emphasize the need to focus on these products in future studies on peanut and other crops. The study also showed that peanut farmers should be encouraged to use conservation tillage practices like ST which can substantially reduce pesticide runoff. Published by Elsevier B.V.

  14. Measurement and modeling of diclosulam runoff under the influence of simulated severe rainfall.

    Science.gov (United States)

    van Wesenbeeck, I J; Peacock, A L; Havens, P L

    2001-01-01

    A runoff study was conducted near Tifton, GA to measure the losses of water, sediment, and diclosulam (N-(2,6-dichlorophenyl)-5-ethoxy-7-fluoro-[1,2,4]triazolo-[1,5c]-pyrimidine- 2-sulfonamide), a new broadleaf herbicide, under a 50-mm-in-3-h simulated rainfall event on three separate 0.05-ha plots. Results of a runoff study were used to validate the Pesticide Root Zone Model (PRZM, v. 3.12) using field-measured soil, chemical, and weather inputs. The model-predicted edge-of-field diclosulam loading was within 1% of the average observed diclosulam runoff from the field study; however, partitioning between phases was not as well predicted. The model was subsequently used with worst-case agricultural practice inputs and a 41-yr weather record from Dublin, GA to simulate edge-of-field runoff losses for the two most prevalent soils (Tifton and Bibb) in the southeastern U.S. peanut (Arachis hypogaea L.) market for 328 simulation years, and showed that the 90th percentile runoff amounts, expressed as percent of applied diclosulam, were 1.8, 0.6, and 5.2% for the runoff study plots and Tifton and Bibb soils, respectively. The runoff study and modeling indicated that more than 97% of the total diclosulam runoff was transported off the field by water, with < 3% associated with the sediment. Diclosulam losses due to runoff can be further reduced by lower application rates, tillage and crop residue management practices that reduce edge-of-field runoff, and conservation practices such as vegetated filter strips.

  15. Caractéristiques polliniques des plantes mellifères de la zone soudano-guinéenne d'altitude de l'ouest Cameroun

    Directory of Open Access Journals (Sweden)

    Pinta, JY.

    2008-01-01

    Full Text Available Pollen Characteristics of Melliferous Plants of the Soudano Guinean Western Highlands of Cameroon. Between November 2000 and 2001, an inventory and pollen characteristics study of major melliferous plants of the Menoua Division in the Western highlands of Cameroon (Latitude North 5° 21.45N- 5°35.44'N and Longitude east 10°04.72- 10°26.24 were carried out. A total of 78 melliferous plants belonging to 33 families were identified. In terms of number of plants, the most-represented species were Asteraceae (12.9%; Solanaceae (8.6%; Euphorbiaceae (7.6%; Myrtaceae and Malvaceae (6.4% respectively in decreasing order. As concerns pollen characteristics inter and intra families variations were recorded. The smallest pollen size (15.7 ± 1.6 μ was found with Leucaena leucocephala while Calliandra callothyrsus had the highest (190.9 ± 7.1 μ. Subcircular pollen form was predominant (Asteraceae 39.2% of the 78 melliferous plants followed respectively by spheric (20.3%; Convovulaceae, elliptic (12.2%; Dacryodes edulis, cordia sp., and triangular (10.8%; Myrtaceae. Melliferous plants with aperturated exine pollen (Ageratum conyzoides, Psidium guayava were predominant (71.7% compared to those without aperturated exine pollen (Manihot esculenta, Croton macrostachyus; 28.2%. Pollen ornamentation also showed a trend of variation between species. Smooth pollen plants (Arachis hypogaea, Psidium guajava were more numerous (46.1%, followed respectively by spined (25.6%; Asteracea, Malvaceae and scabrous pollen species (Casuarina equisetifolia, Musa paradisiaca.

  16. Burrower bugs (Heteroptera: Cydnidae) in peanut: seasonal species abundance, tillage effects, grade reduction effects, insecticide efficacy, and management.

    Science.gov (United States)

    Chapin, Jay W; Thomas, James S

    2003-08-01

    Pitfall traps placed in South Carolina peanut, Arachis hypogaea (L.), fields collected three species of burrower bugs (Cydnidae): Cyrtomenus ciliatus (Palisot de Beauvois), Sehirus cinctus cinctus (Palisot de Beauvois), and Pangaeus bilineatus (Say). Cyrtomenus ciliatus was rarely collected. Sehirus cinctus produced a nymphal cohort in peanut during May and June, probably because of abundant henbit seeds, Lamium amplexicaule L., in strip-till production systems. No S. cinctus were present during peanut pod formation. Pangaeus bilineatus was the most abundant species collected and the only species associated with peanut kernel feeding injury. Overwintering P. bilineatus adults were present in a conservation tillage peanut field before planting and two to three subsequent generations were observed. Few nymphs were collected until the R6 (full seed) growth stage. Tillage and choice of cover crop affected P. bilineatus populations. Peanuts strip-tilled into corn or wheat residue had greater P. bilineatus populations and kernel-feeding than conventional tillage or strip-tillage into rye residue. Fall tillage before planting a wheat cover crop also reduced burrower bug feeding on peanut. At-pegging (early July) granular chlorpyrifos treatments were most consistent in suppressing kernel feeding. Kernels fed on by P. bilineatus were on average 10% lighter than unfed on kernels. Pangaeus bilineatus feeding reduced peanut grade by reducing individual kernel weight, and increasing the percentage damaged kernels. Each 10% increase in kernels fed on by P. bilineatus was associated with a 1.7% decrease in total sound mature kernels, and kernel feeding levels above 30% increase the risk of damaged kernel grade penalties.

  17. Phylogenies of symbiotic genes of Bradyrhizobium symbionts of legumes of economic and environmental importance in Brazil support the definition of the new symbiovars pachyrhizi and sojae.

    Science.gov (United States)

    Delamuta, Jakeline Renata Marçon; Menna, Pâmela; Ribeiro, Renan Augusto; Hungria, Mariangela

    2017-07-01

    Bradyrhizobium comprises most tropical symbiotic nitrogen-fixing strains, but the correlation between symbiotic and core genes with host specificity is still unclear. In this study, the phylogenies of the nodY/K and nifH genes of 45 Bradyrhizobium strains isolated from legumes of economic and environmental importance in Brazil (Arachis hypogaea, Acacia auriculiformis, Glycine max, Lespedeza striata, Lupinus albus, Stylosanthes sp. and Vigna unguiculata) were compared to 16S rRNA gene phylogeny and genetic diversity by rep-PCR. In the 16S rRNA tree, strains were distributed into two superclades-B. japonicum and B. elkanii-with several strains being very similar within each clade. The rep-PCR analysis also revealed high intra-species diversity. Clustering of strains in the nodY/K and nifH trees was identical: 39 strains isolated from soybean grouped with Bradyrhizobium type species symbionts of soybean, whereas five others occupied isolated positions. Only one strain isolated from Stylosanthes sp. showed similar nodY/K and nifH sequences to soybean strains, and it also nodulated soybean. Twenty-one representative strains of the 16S rRNA phylogram were selected and taxonomically classified using a concatenated glnII-recA phylogeny; nodC sequences were also compared and revealed the same clusters as observed in the nodY/K and nifH phylograms. The analyses of symbiotic genes indicated that a large group of strains from the B. elkanii superclade comprised the novel symbiovar sojae, whereas for another group, including B. pachyrhizi, the symbiovar pachyrhizi could be proposed. Other potential new symbiovars were also detected. The co-evolution hypotheses is discussed and it is suggested that nodY/K analysis would be useful for investigating the symbiotic diversity of the genus Bradyrhizobium. Copyright © 2017 Elsevier GmbH. All rights reserved.

  18. Genetic diversity and symbiotic effectiveness of Bradyrhizobium strains nodulating selected annual grain legumes growing in Ethiopia.

    Science.gov (United States)

    Degefu, Tulu; Wolde-Meskel, Endalkachew; Rasche, Frank

    2018-01-01

    Vigna unguiculata, Vigna radiata and Arachis hypogaea growing in Ethiopia are nodulated by a genetically diverse group of Bradyrhizobium strains. To determine the genetic identity and symbiotic effectiveness of these bacteria, a collection of 36 test strains originating from the root nodules of the three hosts was investigated using multilocus sequence analyses (MLSA) of core genes including 16S rRNA, recA, glnII, gyrB, atpD and dnaK. Sequence analysis of nodA and nifH genes along with tests for symbiotic effectiveness using δ 15 N analysis were also carried out. The phylogenetic trees derived from the MLSA grouped most test strains into four well-supported distinct positions designated as genospecies I-IV. The maximum likelihood (ML) tree that was constructed based on the nodA gene sequences separated the entire test strains into two lineages, where the majority of the test strains were clustered on one of a well-supported large branch that comprise Bradyrhizobium species from the tropics. This clearly suggested the monophyletic origin of the nodA genes within the bradyrhizobia of tropical origin. The δ 15 N-based symbiotic effectiveness test of seven selected strains revealed that strains GN100 (δ 15 N=0.73) and GN102 (δ 15 N=0.79) were highly effective nitrogen fixers when inoculated to cowpea, thus can be considered as inoculants in cowpea production. It was concluded that Ethiopian soils are a hotspot for rhizobial diversity. This calls for further research to unravel as yet unknown bradyrhizobia nodulating legume host species growing in the country. In this respect, prospective research should also address the mechanisms of symbiotic specificity that could lead to high nitrogen fixation in target legumes.

  19. Transgenic tobacco plants constitutively expressing peanut BTF3 exhibit increased growth and tolerance to abiotic stresses.

    Science.gov (United States)

    Pruthvi, V; Rama, N; Parvathi, M S; Nataraja, K N

    2017-05-01

    Abiotic stresses limit crop growth and productivity worldwide. Cellular tolerance, an important abiotic stress adaptive trait, involves coordinated activities of multiple proteins linked to signalling cascades, transcriptional regulation and other diverse processes. Basal transcriptional machinery is considered to be critical for maintaining transcription under stressful conditions. From this context, discovery of novel basal transcription regulators from stress adapted crops like peanut would be useful for improving tolerance of sensitive plant types. In this study, we prospected a basal transcription factor, BTF3 from peanut (Arachis hypogaea L) and studied its relevance in stress acclimation by over expression in tobacco. AhBTF3 was induced under PEG-, NaCl-, and methyl viologen-induced stresses in peanut. The constitutive expression of AhBTF3 in tobacco increased plant growth under non stress condition. The transgenic plants exhibited superior phenotype compared to wild type under mannitol- and NaCl-induced stresses at seedling level. The enhanced cellular tolerance of transgenic plants was evidenced by higher cell membrane stability, reactive oxygen species (ROS) scavenging activity, seedling survival and vigour than wild type. The transgenic lines showed better in vitro regeneration capacity on growth media supplemented with NaCl than wild type. Superior phenotype of transgenic plants under osmotic and salinity stresses seems to be due to constitutive activation of genes of multiple pathways linked to growth and stress adaptation. The study demonstrated that AhBTF3 is a positive regulator of growth and stress acclimation and hence can be considered as a potential candidate gene for crop improvement towards stress adaptation. © 2016 German Botanical Society and The Royal Botanical Society of the Netherlands.

  20. Analysis of expression and glycosylation of avian metapneumovirus attachment glycoprotein from recombinant baculoviruses.

    Science.gov (United States)

    Luo, Lizhong; Nishi, Krista; MacLeod, Erin; Sabara, Marta I; Li, Yan

    2010-11-01

    Recently, we reported the expression and glycosylation of avian metapneumovirus attachment glycoprotein (AMPV/C G protein) in eukaryotic cell lines by a transient-expression method. In the present study, we investigated the biosynthesis and O-linked glycosylation of the AMPV/C G protein in a baculovirus expression system. The results showed that the insect cell-produced G protein migrated more rapidly in SDS-PAGE as compared to LLC-MK2 cell-derived G proteins owing to glycosylation differences. The fully processed, mature form of G protein migrated between 78 and 86 kDa, which is smaller than the 110 kDa mature form of G expressed in LLC-MK2 cells. In addition, several immature G gene products migrating at 40-48 and 60-70 kDa were also detected by SDS-PAGE and represented glycosylated intermediates. The addition of the antibiotic tunicamycin, which blocks early steps of glycosylation, to insect cell culture resulted in the disappearance of two glycosylated forms of the G protein and identified a 38 kDa unglycosylated precursor. The maturation of the G protein was completely blocked by monensin, suggesting that the O-linked glycosylation of G initiated in the trans-Golgi compartment. The presence of O-linked sugars on the mature protein was further confirmed by lectin Arachis hypogaea binding assay. Furthermore, antigenic features of the G protein expressed in insect cells were evaluated by ELISA. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  1. Novel and Stress Relevant EST Derived SSR Markers Developed and Validated in Peanut

    Science.gov (United States)

    Bosamia, Tejas C.; Mishra, Gyan P.; Thankappan, Radhakrishnan; Dobaria, Jentilal R.

    2015-01-01

    With the aim to increase the number of functional markers in resource poor crop like cultivated peanut (Arachis hypogaea), large numbers of available expressed sequence tags (ESTs) in the public databases, were employed for the development of novel EST derived simple sequence repeat (SSR) markers. From 16424 unigenes, 2784 (16.95%) SSRs containing unigenes having 3373 SSR motifs were identified. Of these, 2027 (72.81%) sequences were annotated and 4124 gene ontology terms were assigned. Among different SSR motif-classes, tri-nucleotide repeats (33.86%) were the most abundant followed by di-nucleotide repeats (27.51%) while AG/CT (20.7%) and AAG/CTT (13.25%) were the most abundant repeat-motifs. A total of 2456 EST-SSR novel primer pairs were designed, of which 366 unigenes having relevance to various stresses and other functions, were PCR validated using a set of 11 diverse peanut genotypes. Of these, 340 (92.62%) primer pairs yielded clear and scorable PCR products and 39 (10.66%) primer pairs exhibited polymorphisms. Overall, the number of alleles per marker ranged from 1-12 with an average of 3.77 and the PIC ranged from 0.028 to 0.375 with an average of 0.325. The identified EST-SSRs not only enriched the existing molecular markers kitty, but would also facilitate the targeted research in marker-trait association for various stresses, inter-specific studies and genetic diversity analysis in peanut. PMID:26046991

  2. Global Synthesis of Drought Effects on Food Legume Production.

    Science.gov (United States)

    Daryanto, Stefani; Wang, Lixin; Jacinthe, Pierre-André

    2015-01-01

    Food legume crops play important roles in conservation farming systems and contribute to food security in the developing world. However, in many regions of the world, their production has been adversely affected by drought. Although water scarcity is a severe abiotic constraint of legume crops productivity, it remains unclear how the effects of drought co-vary with legume species, soil texture, agroclimatic region, and drought timing. To address these uncertainties, we collected literature data between 1980 and 2014 that reported monoculture legume yield responses to drought under field conditions, and analyzed this data set using meta-analysis techniques. Our results showed that the amount of water reduction was positively related with yield reduction, but the extent of the impact varied with legume species and the phenological state during which drought occurred. Overall, lentil (Lens culinaris), groundnut (Arachis hypogaea), and pigeon pea (Cajanus cajan) were found to experience lower drought-induced yield reduction compared to legumes such as cowpea (Vigna unguiculata) and green gram (Vigna radiate). Yield reduction was generally greater when legumes experienced drought during their reproductive stage compared to during their vegetative stage. Legumes grown in soil with medium texture also exhibited greater yield reduction compared to those planted on soil of either coarse or fine texture. In contrast, regions and their associated climatic factors did not significantly affect legume yield reduction. In the face of changing climate, our study provides useful information for agricultural planning and research directions for development of drought-resistant legume species to improve adaptation and resilience of agricultural systems in the drought-prone regions of the world.

  3. Cowpea (Vigna unguiculata L. Walp) and groundnut (Arachis hypogea L.) haulms as supplements to sorghum (Sorghum bicolor L. Moench) stover : intake, digestibility and optimum feeding levels

    NARCIS (Netherlands)

    Savadogo, M.; Zemmelink, G.; Nianogo, A.J.; Keulen, van H.

    2000-01-01

    Two feeding trials were conducted to study the combined effects of (i) varying degrees of selective consumption and (ii) supplementation with cowpea (Trail 1) or groundnut haulms (Trial 2), on intake of organic matter (IOM) from sorghum stover, and total intake of digestible organic matter (IDOM).

  4. Influence of seaweed extract as an organic fertilizer on the growth and yield of Arachis hypogea L. and their elemental composition using SEM–Energy Dispersive Spectroscopic analysis

    Directory of Open Access Journals (Sweden)

    G. Ganapathy Selvam

    2014-03-01

    Conclusion: It is suggested that there are considerable gains to be made in increasing yield and stabilizing the yield in environments characterized by terminal requirement for organic and by shortening crop duration nutrient management appear promising.

  5. EVALUACIÓN FENOLÓGICA Y DIGESTIBILIDAD in vivo DE LA LEGUMINOSA FORRAJERA (Arachis pintoi EN DIFERENTES EDADES DE CORTE

    Directory of Open Access Journals (Sweden)

    Víctor Godoy Espinoza

    2013-02-01

    Full Text Available Resumen El objetivo de ésta investigación fue evaluar la fenología, producción, composición química nutricional y digestibilidad in vivo de A. pintoi y de establecer modelos matemáticos para determinar el valor nutricional y producción en base a la composición química de la planta. Las evaluaciones fenológicas se realizaron en la hacienda ESPE y la digestibilidad in vivo en la Facultad de Ciencias Pecuarias de la ESPOCH. En la primera fase se utilizaron parcelas experimentales de 10x15 m con cuatro repeticiones, mientras que en la segunda fase la unidad experimental fue un ovino (n=4. En ambos ensayos se aplicó un diseño experimental completamente al azar con un modelo lineal aditivo utilizando un nivel de significancia del 5%. Se realizó un análisis de correlación y regresión lineal entre variables fenológicas, composición química, digestibilidad y energía. Todos los análisis fueron realizados con el paquete SPSS 10. Las mayores producciones de forraje verde y materia seca (MS por hectárea se obtuvieron con cortes a los 75 días con 47,730 y 12,480 kg ha-1, respectivamente. En cuanto a la composición química de la proteína bruta y digestibilidad in vivo de la MS, el forraje cortado a 30 días obtuvo los mayores valores con 24.50 y 66.42%, respectivamente. El máximo valor de energía neta de lactancia (ENL se logró en el corte de 30 días, alcanzando 1.51 para luego disminuir a 1.24 Mcal ENL kg-1 a los 75 días.

  6. UAV remote sensing for phenotyping drought tolerance in peanuts

    Science.gov (United States)

    Balota, Maria; Oakes, Joseph

    2017-05-01

    Farmers can benefit from growing drought tolerant peanut (Arachis hypogaea L.) cultivars with improved yield when rainfall is sporadic. In the Virginia-Carolina (VC) region, drought is magnified by hot summers and usually occurs in July and Aug when pod and seed growth are intense. At these growth stages, weekly supply of 50 to 75 mm of water is needed to ensure profitability. Irrigation can supplement crop water needs, but only 10% of the peanut farms are irrigated. In this frame, drought tolerant varieties can be profitable, but breeding for cultivars with improved drought tolerance requires fast yet accurate phenotyping. Our objective was to evaluate the potential of UAV remote sensing technologies for drought tolerance selection in peanut. In this study, we examined the effect of drought on leaf wilting, pod yield, grading characteristics, and crop value of 23 peanut cultivars (Virginia, Runner, and Valencia type). These varieties were arranged in a factorial design, with four replications drought stressed and two replications well-watered. Drought was imposed by covering the drought stressed plots with rainout shelters on July 19; they remained covered until August 29 and only received 38 mm irrigation in mid Aug. The well-watered plots continued to receive rain and supplemental irrigation as needed. During this time, Canopy Temperature Depression (CT) and Normalized Differential Vegetative Index (NDVI) were collected from the ground on all plots at weekly intervals. After the shelters were removed, these measurements were collected daily for approximately 2 weeks. At the same time, Red-Green-Blue (RGB), near-infrared (NIR), and infrared (IR) images taken from an UAV platform were also collected. Vegetation indices derived from the ground and aerial data were compared with leaf wilting, pod yield and crop value. Wilting, which is a common water stress symptom, was best estimated by NDVI and RGB, and least by CT; but CT was best in estimating yield, SMK and

  7. Population dynamics of Meloidogyne arenaria and Pasteuria penetrans in a long-term crop rotation study.

    Science.gov (United States)

    Timper, Patricia

    2009-12-01

    The endospore-forming bacterium Pasteuria penetrans is an obligate parasite of root-knot nematodes (Meloidogyne spp.). The primary objective of this study was to determine the effect of crop sequence on abundance of P. penetrans. The experiment was conducted from 2000 to 2008 at a field site naturally infested with both the bacterium and its host Meloidogyne arenaria and included the following crop sequences: continuous peanut (Arachis hypogaea) (P-P-P) and peanut rotated with either 2 years of corn (Zea mays) (C-C-P), 1 year each of cotton (Gossypium hirsutum) and corn (Ct-C-P), or 1 year each of corn and a vegetable (V-C-P). The vegetable was a double crop of sweet corn and eggplant (Solanum melongena). A bioassay with second-stage juveniles (J2) of M. arenaria from a greenhouse (GH) population was used to estimate endospore abundance under the different crop sequences. A greater numerical increase in endospore densities was expected in the P-P-P and V-C-P sequences than in the other sequences because both peanut and eggplant are good hosts for M. arenaria. However, endospore densities, as determined by bioassay, did not substantially increase in any of the sequences during the 9-year experiment. To determine whether the nematode population had developed resistance to the resident P. penetrans, five single egg-mass (SEM) lines from the field population of M. arenaria were tested alongside the GH population for acquisition of endospores from the field soil. Four of the five SEM lines acquired 9 to 14 spores/J2 whereas the GH population and one of the SEM lines acquired 3.5 and 1.8 spores/J2, respectively. Endospore densities estimated with the four receptive SEM lines were highest in the P-P-P plots (14-20 spores/J2), intermediate in the V-C-P plots (6-7 spores/J2), and lowest in the Ct-C-P plots (< 1 spore/J2). These results indicate that the field population of M. arenaria is heterogeneous for attachment of P. penetrans endospores. Moreover, spore densities

  8. Cabernet Sauvignon ve Merlot Şarapların Resveratrol Düzeyleri ve Ekolojik Koşulların Etkileri

    Directory of Open Access Journals (Sweden)

    Belkıs Çaylak Adıgüzel

    2015-02-01

    Full Text Available Fitoaleksinler bitkilerde patojen enfeksiyonuna bir reaksiyon olarak veya çeşitli biyotik ve abiyotik tetikleyicilerin etkisi sonucu oluşan fenolik madde karakterli, düşük molekül ağırlıklı antimikrobiyal bileşiklerdir. Resveratrol (trans–3,5,4’-trihidroksistilben de bir fitoaleksin olup, asma (Vitis vinifera, yer fıstığı (Arachis hypogaea ve diğer pek çok bitki türünde yaprak veya diğer organlarda yüksek miktarlarda bulunabilmektedir. Resveratrol asmada gövde, sürgün ve yapraklar yanında, özellikle renkli çeşitlerin tane kabuğunda bol miktarda sentezlenebilmekte ve şarap yapımı sırasında şıraya, şıradan da şaraba geçmektedir. Son yıllarda resveratrolün antikanserojen özelliği ve antioksidan karakteri nedeniyle sağlık yararları üzerine yoğun araştırmalar yapılmakta ve günlük diyette alımı önerilmektedir. Bu çalışmada, Ege, Marmara ve Trakya Bölgeleri’nde üretilen kimi bağlardan sağlanan Cabernet sauvignon ve Merlot siyah üzümlerinden üretilmiş şaraplarda bulunan resveratrol miktarları Yüksek Performanslı Sıvı Kromatografisi yöntemi kullanılarak belirlenmiştir. Elde edilen sonuçlar bölgelerin ekolojik koşulları açısından birbirleriyle karşılaştırılmış ve resveratrol miktarı ile bu parametreler arasındaki korelasyon araştırılmıştır. Resveratrol konsantrasyonunun üzüm çeşidi ve bölgelerin iklim şartlarına bağlı olarak farklılıklar gösterebileceği görülmüştür.

  9. Efeito de diferentes herbicidas na nodulação e na atividade da nitrogenase no amendoim Effect of herbicides on nodulation and nitrogenase activity in peanuts

    Directory of Open Access Journals (Sweden)

    Maria do Carmo de Salvo Soares Novo

    1991-01-01

    Full Text Available Em ensaio de herbicidas na cultura do amendoim (Arachis hypogaea L., realizado em Ribeirão Preto, SP, em 1984/85, sem o uso de inoculante, não foram encontrados nódulos nos diferentes tratamentos. Como é comum sua presença em amendoim nessa região, suspeitou-se que os herbicidas utilizados pudessem ter efeito inibitório na nodulação. Avaliou-se, então, o efeito de alachlor, linuron, oxadiazon, pendimetalin e trifluralin aplicados na dose recomendada, na nodulação e na atividade da nitrogenase, durante dois anos consecutivos, usando-se sementes inoculadas e não inoculadas. Foram feitas amostragens aos 28, 42, 63, 84 e 105 dias após a semeadura, observando-se nodulação abundante, em todos os tratamentos, e reduções ocasionais na nodulação e na fixação do nitrogênio, porém não consistentes nas diversas amostragens. A atividade da população nativa de Rhizobium em geral permaneceu num nível maior do que nos tratamentos com inoculação. Embora alguns herbicidas tenham afetado a nodulação e a fixação do nitrogênio, não houve influência na produção de grãos.No nodules were found in a peanut herbicide trial held at Ribeirão Preto, State of São Paulo, Brazil, during the growing season 1984/85. Since spontaneous nodulation is commom in this region, a hypotheses was raised that herbicides could have an inhibitory effect on nodulation. To test the effect of herbicides on nodulation and nitrogenase activity an experiment was carried out on two consecutive years, using a factorial design with two factors: a five herbicides (alachior, linuron, oxadiazon, pendimethalin and trifluralin applied in usual dosages and a control without herbicide and b with and without Bradyrhizobium inoculation. Samples were collected at 28, 42, 63, 84 and 105 days after planting. The results showed that nodulation was abundant in all treatments. Nitrogenase activity in the non inoculated treatments persisted for a longer period than in the

  10. Efeitos de diferentes teores de umidade e espessuras do material de embalagem plástica na conservação de sementes de amendoim Effects of different moisture contents and thickness of the plastic packaging material on the preservation of peanut seeds

    Directory of Open Access Journals (Sweden)

    Romeu de Tella

    1979-01-01

    Full Text Available Determinaram-se, aos 3, 6, 9, 12 e 18 meses de armazenamento, as porcentagens de germinação e umidade de sementes de amendoim do cultivar tatu, descascadas mecanicamente, com níveis iniciais de 5,2; 6,2; 7,0; 8,2 e 9,2% de umidade, acondicionadas em sacos de polietileno de 0,05; 0,08; 0,10 e 0,15mm de espessura e mantidas em uma sala em condições não controladas de temperatura e umidade relativa, por um período de 18 meses. As umidades iniciais de 8,2 e 9,2% foram prejudiciais à conservação das sementes, principalmente quando estas foram acondicionadas nos sacos plásticos de 0,15 ou 0,10mm de espessura. As melhores condições para a manutenção da germinação das sementes foram a secagem aos níveis de 5,2 ou 6,2% de umidade e acondicionamento nos sacos plásticos de 0,15 ou 0,10mm de espessura. As paredes dos sacos plásticos não impediram trocas de umidade entre o ambiente e as sementes, sendo que essas trocas foram mais rápidas nos sacos de menor espessura.Mecanically shelled peanut (Arachis hypogaea L. seeds of the cultivar tatu, with initial moisture contents of 5.2, 6.2, 7.0, 8.2, and 9.2%, and packaged in polyethylene bags of 0.05, 0.08, 0.10, and 0.15mm thick. were stored in a room with no temperature and relative humidity control, in Campinas, State of São Paulo. Germination and moisture content percentagens were determined at 3, 6, 9, 12, and 18 months storage. The initial moisture contents of 8.2 and 9.2% were damaging to the preservation of the seeds, mainly when these were packaged in the bags of 0.15 or 0.10mm thick. The best storage conditions were those provided by drying to 5.2 or 6.2% moisture levels, and packaging in 0.15 or 0.10 mm thick plastic bags. The walls of the plastic bags did not hamper moisture vapor transmission between environment and seeds. The transmission rates were higher in the bags of thinner walls.

  11. Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius

    Directory of Open Access Journals (Sweden)

    Goggin Danica E

    2011-04-01

    Full Text Available Abstract Background In legumes, seed storage proteins are important for the developing seedling and are an important source of protein for humans and animals. Lupinus angustifolius (L., also known as narrow-leaf lupin (NLL is a grain legume crop that is gaining recognition as a potential human health food as the grain is high in protein and dietary fibre, gluten-free and low in fat and starch. Results Genes encoding the seed storage proteins of NLL were characterised by sequencing cDNA clones derived from developing seeds. Four families of seed storage proteins were identified and comprised three unique α, seven β, two γ and four δ conglutins. This study added eleven new expressed storage protein genes for the species. A comparison of the deduced amino acid sequences of NLL conglutins with those available for the storage proteins of Lupinus albus (L., Pisum sativum (L., Medicago truncatula (L., Arachis hypogaea (L. and Glycine max (L. permitted the analysis of a phylogenetic relationships between proteins and demonstrated, in general, that the strongest conservation occurred within species. In the case of 7S globulin (β conglutins and 2S sulphur-rich albumin (δ conglutins, the analysis suggests that gene duplication occurred after legume speciation. This contrasted with 11S globulin (α conglutin and basic 7S (γ conglutin sequences where some of these sequences appear to have diverged prior to speciation. The most abundant NLL conglutin family was β (56%, followed by α (24%, δ (15% and γ (6% and the transcript levels of these genes increased 103 to 106 fold during seed development. We used the 16 NLL conglutin sequences identified here to determine that for individuals specifically allergic to lupin, all seven members of the β conglutin family were potential allergens. Conclusion This study has characterised 16 seed storage protein genes in NLL including 11 newly-identified members. It has helped lay the foundation for efforts to use

  12. Binding properties of a blood group Le(a+) active sialoglycoprotein, purified from human ovarian cyst, with applied lectins.

    Science.gov (United States)

    Wu, A M; WU, J H; Watkins, W M; Chen, C P; Tsai, M C

    1996-06-07

    Studies on the structures and binding properties of the glycoproteins, purified from human ovarian cyst fluids, will aid the understanding of the carbohydrate alterations occurring during the biosynthesis of blood group antigens and neoplasm formation. These glycoproteins can also serve as important biological materials to study blood group A, B, H, Le(a), Le(b), Le(x), Le(y), T and Tn determinants, precursor type I and II sequences and cold agglutinin I and i epitopes. In this study, the binding property of a cyst glycoprotein from a human blood group Le(a+) nonsecretor individual, that contains an unusually high amount (18%) of sialic acid (HOC 350) was characterized by quantitative precipitin assay with a panel of lectins exhibiting a broad range of carbohydrate-binding specificities. Native HOC 350 reacted well only with three out of nineteen lectins tested. It precipitated about 80% of Ricinus communis (RCA1), 50% of Triticum vulgaris (WGA) and 37% of Bauhinia purpurea aba (BPA) agglutinins, respectively. However, its asialo product had dramatically enhanced reactivity and reacted well with many I/II (Gal beta1 --> 3/4GcNAc), T(Gal beta1 --> 3GalNAc) and Tn(GaNIAc alphaI --> Ser/Thr) active lectins. It bound best to Jacalin, BPA, and abrin-a and completely precipitated all the lectins added. Asialo-HOC 350 also reacted strongly with Wistaria floribunda, Abrus precatorius agglutinin, ricin and RCA1 and precipitated over 75% of the lectin nitrogen added, and moderately with Arachis hypogaea, Maclura pomifera, WGA, Vicia viosa-B4, Codium fragile tomentosoides and Ulex europaeus-II. But native HOC 350 and its asialo product reacted not at all or poorly with Dolichos biflorus, Helix pomatia, Lotus tetra-gonolobus, Ulex europaeus-I, Lens culinaris lectins and Con A. The lectin-glycoform interactions through bioactive sugars were confirmed by precipitin inhibition assay. Mapping the precipitation profiles of the interactions have led to the conclusion that HOC 350

  13. A sheep hydatid cyst glycoprotein as receptors for three toxic lectins, as well as Abrus precatorius and Ricinus communis agglutinins.

    Science.gov (United States)

    Wu, A M; Song, S C; Wu, J H; Pfüller, U; Chow, L P; Lin, J Y

    1995-01-18

    The binding properties of a glycoprotein with blood group P1 specificity isolated from sheep hydatid cyst fluid with Gal and GalNAc specific lectins was investigated by quantitative precipitin and precipitin inhibition assays. The glycoprotein completely precipitated Ricinus communis agglutinin (RCA1), Abrus precatorius agglutinin (APA) and Mistletoe toxic lectin-I (ML-I). Only 1.0 microgram of P1 glycoprotein was required to precipitate 50% of 5.1 micrograms ML-I nitrogen. It also reacted well with abrin-a and ricin, precipitating over 73% of the lectin nitrogen added, but poorly or weakly with Dolichos biflorus (DBL), Vicia villosa (VVL, a mixture of A4, A2B2 and B4), VVL-B4, Arachis hypogaea (PNA), Maclura pomifera (MPL), Bauchinia purpurea alba (BPL) and Wistaria floribunda (WFL) lectins. When an inhibition assay in the range of 5.1 micrograms N to 5.9 micrograms N of lectins (ML-I, abrin-a; ricin, RCA1, and APA, and 10 micrograms P1 active glycoprotein interaction was performed; from 76 to 100% of the precipitations were inhibited by 0.44 and 0.52 mumol of Gal alpha 1-->4Gal and Gal beta 1-->4GlcNAc, respectively, but not or insignificantly with 1.72 mumol of GlcNAc. The Gal alpha 1-->4Gal disaccharide found in this P1 active glycoprotein is a frequently occurring sequence of many glycosphingolipids located at the surface of mammalian cell membranes, especially human erythrocytes and intestinal cells for ligand binding and microbial toxin attachment. The present finding suggests that the Gal alpha 1-->4Gal beta 1-->4GlcNAc sequence in this P1 active glycoprotein is one of the best glycoprotein receptors for three toxic lectins (ricin, abrin-a, and ML-I) as well as for APA, and RCA1, and the result of inhibition assay implies that these lectins are recognizing part or all of the Gal alpha 1-->4Gal beta 1-->4GlcNAc sequence in the P1 active glycoprotein.

  14. Kıvırcık Cüce Koşin (Gallus gallus Testisindeki Bazı Glikokonjugatların Lektin Histokimyasal Olarak Belirlenmesi

    Directory of Open Access Journals (Sweden)

    Şeyda BÜYÜKYILDIRIM

    2016-07-01

    Full Text Available Bu çalışmada Kıvırcık Cüce Koşin (Gallus gallus testisindeki bazı glikokonjugatların lektin histokimyasal yöntemle belirlenmesi amaçlandı.  Glikokonjugat içeriğinin belirlenmesi amacıyla alınan doku kesitleri horseradish peroxidase  (HRP bağlı Canavalia ensiformis aglutinin (Con A, Glycine max aglutinin (SBA, Ulex europaeus aglutinin (UEA-I, Arachis hypogaea aglutinin (PNA ve Triticum vulgaris aglutinin (WGA lektinleri ile inkübe edildi. Uygulanan lektin histokimyasal yöntemler sonucunda spermatagonyum ve Leydig hücrelerinde çok güçlü Con A reaksiyonu gözlenirken, lamina proprianın peritübüler hücrelerinde reaksiyona rastlanmadı. Primer spermatositlerde orta yoğunlukta PNA, çok güçlü WGA reaksiyonu gözlendi. Buna karşılık bazal laminada SBA’ya karşı reaksiyon gözlenmezken, UEA-I’e karşı çok güçlü reaksiyon saptandı. Sertoli hücrelerinde Con A, SBA ve UEA I lektinlerinde orta yoğunlukta, PNA ve WGA’ da ise zayıf reaksiyon tespit edildi. Sonuç olarak sekonder spermatosit ve erken dönem spermatid aşamasındaki hücrelerdeki glikokonjugatların α-D-Mannoz (α-D-Man, α-D-Glikoz  (α-D-Glc ve α-L-Fukoz (α-L-Fuc içeriğinin diğer spermatojenik hücrelere göre az olduğu, tüm spermatojenik hücrelerdeki glikokonjugatın yoğun miktarda siyalik asit içerdiği saptandı. Leydig hücrelerindeki glikokonjugatın ise dağılımı araştırılan tüm şeker rezidülerine sahip olduğu belirlendi.

  15. A comparative study on the decomposition of edible and non-edible oil cakes in the Gangetic alluvial soil of West Bengal.

    Science.gov (United States)

    Mondal, Sudeshna; Das, Ritwika; Das, Amal Chandra

    2014-08-01

    An experiment has been conducted under laboratory conditions to investigate the effect of decomposition of two edible oil cakes, viz. mustard cake (Brassica juncea L) and groundnut cake (Arachis hypogaea L), and two non-edible oil cakes, viz. mahua cake (Madhuca indica Gmel) and neem cake (Azadirachta indica Juss), at the rate of 5.0 t ha(-1) on the changes of microbial growth and activities in relation to transformations and availability of some plant nutrients in the Gangetic alluvial (Typic Haplustept) soil of West Bengal, India. Incorporation of oil cakes, in general, highly induced the proliferation of total bacteria, actinomycetes, and fungi, resulting in greater retention and availability of oxidizable C, N, and P in soil. As compared to untreated control, the highest stimulation of total bacteria and actinomycetes was recorded with mustard cake (111.9 and 84.3 %, respectively) followed by groundnut cake (50.5 and 52.4 %, respectively), while the fungal colonies were highly accentuated due to the incorporation of neem cake (102.8 %) in soil. The retention of oxidizable organic C was highly increased due to decomposition of non-edible oil cakes, more so under mahua cake (14.5 %), whereas edible oil cakes and groundnut cake in particular exerted maximum stimulation (16.7 %) towards the retention of total N in soil. A similar trend was recorded towards the accumulation of available mineral N in soil and this was more pronounced with mustard cake (45.6 %) for exchangeable NH4 (+) and with groundnut cake (63.9 %) for soluble NO3 (-). The highest retention of total P (46.9 %) was manifested by the soil when it was incorporated with neem cake followed by the edible oil cakes; while the available P was highly induced due to the addition of edible oil cakes, the highest being under groundnut cake (23.5 %) followed by mustard cake (19.6 %).

  16. Population Dynamics of Meloidogyne arenaria and Pasteuria penetrans in a Long-Term Crop Rotation Study

    Science.gov (United States)

    2009-01-01

    The endospore-forming bacterium Pasteuria penetrans is an obligate parasite of root-knot nematodes (Meloidogyne spp.). The primary objective of this study was to determine the effect of crop sequence on abundance of P. penetrans. The experiment was conducted from 2000 to 2008 at a field site naturally infested with both the bacterium and its host Meloidogyne arenaria and included the following crop sequences: continuous peanut (Arachis hypogaea) (P-P-P) and peanut rotated with either 2 years of corn (Zea mays) (C-C-P), 1 year each of cotton (Gossypium hirsutum) and corn (Ct-C-P), or 1 year each of corn and a vegetable (V-C-P). The vegetable was a double crop of sweet corn and eggplant (Solanum melongena). A bioassay with second-stage juveniles (J2) of M. arenaria from a greenhouse (GH) population was used to estimate endospore abundance under the different crop sequences. A greater numerical increase in endospore densities was expected in the P-P-P and V-C-P sequences than in the other sequences because both peanut and eggplant are good hosts for M. arenaria. However, endospore densities, as determined by bioassay, did not substantially increase in any of the sequences during the 9-year experiment. To determine whether the nematode population had developed resistance to the resident P. penetrans, five single egg-mass (SEM) lines from the field population of M. arenaria were tested alongside the GH population for acquisition of endospores from the field soil. Four of the five SEM lines acquired 9 to 14 spores/J2 whereas the GH population and one of the SEM lines acquired 3.5 and 1.8 spores/J2, respectively. Endospore densities estimated with the four receptive SEM lines were highest in the P-P-P plots (14-20 spores/J2), intermediate in the V-C-P plots (6-7 spores/J2), and lowest in the Ct-C-P plots (< 1 spore/J2). These results indicate that the field population of M. arenaria is heterogeneous for attachment of P. penetrans endospores. Moreover, spore densities

  17. Detection, Characterization, and Biological Effect of Quorum-Sensing Signaling Molecules in Peanut-Nodulating Bradyrhizobia

    Directory of Open Access Journals (Sweden)

    Walter Giordano

    2012-03-01

    Full Text Available Bacteria of the genus Bradyrhizobium are able to establish a symbiotic relationship with peanut (Arachis hypogaea root cells and to fix atmospheric nitrogen by converting it to nitrogenous compounds. Quorum sensing (QS is a cell-cell communication mechanism employed by a variety of bacterial species to coordinate behavior at a community level through regulation of gene expression. The QS process depends on bacterial production of various signaling molecules, among which the N-acylhomoserine lactones (AHLs are most commonly used by Gram-negative bacteria. Some previous reports have shown the production of QS signaling molecules by various rhizobia, but little is known regarding mechanisms of communication among peanut-nodulating strains. The aims of this study were to identify and characterize QS signals produced by peanut-nodulating bradyrhizobial strains and to evaluate their effects on processes related to cell interaction. Detection of AHLs in 53 rhizobial strains was performed using the biosensor strains Agrobacterium tumefaciens NTL4 (pZLR4 and Chromobacterium violaceum CV026 for AHLs with long and short acyl chains, respectively. None of the strains screened were found to produce AHLs with short acyl chains, but 14 strains produced AHLs with long acyl chains. These 14 AHL-producing strains were further studied by quantification of β-galactosidase activity levels (AHL-like inducer activity in NTL4 (pZLR4. Strains displaying moderate to high levels of AHL-like inducer activity were subjected to chemical identification of signaling molecules by high-performance liquid chromatography coupled to mass spectrometry (LC-MS/MS. For each AHL-producing strain, we found at least four different AHLs, corresponding to N-hexanoyl-DL-homoserine lactone (C6, N-(3-oxodecanoyl-L-homoserine lactone (3OC10, N-(3-oxododecanoyl-L-homoserine lactone (3OC12, and N-(3-oxotetradecanoyl-L-homoserine lactone (3OC14. Biological roles of 3OC10, 3OC12, and 3OC14 AHLs

  18. Ensaios de variedades de amendoim: III - Décima e décima-primeira séries de ensaios Peanut variety trials: III

    Directory of Open Access Journals (Sweden)

    Vicente Canecchio Filho

    1957-01-01

    Full Text Available No presente trabalho são relatadas experiências com 16 variedades de amendoim (Arachis hypogaea, L., recebidas dos Estados Unidos da América do Norte, do Congo Belga e de várias regiões do Brasil. Essas experiências, em número de oito, das quais três pertencentes à décima série (ano agrícola de 1953/54 e cinco compreendendo a décima-primeira série (ano agrícola de 1954/55, foram executadas nas localidades de Campinas, Ribeirão Prêto, Pindorama, Presidente Prudente e Tatuí, no Estado de São Paulo. Os resultados obtidos mostraram que, para as condições em que foram realizados os ensaios, as variedades Paulista-269, Bandeirante-263, Brasília-265, Centenário-264 e Tatuí-76, sobressairam-se das demais, notadamente a primeira, que, de um modo geral, foi bem classificada em todas as localidades, não só em relação à produção como pelo alto teor em óleo, nos frutos. A variedade Tatu-53 (testemunha, ainda bastante cultivada no Estado, classificou-se entre as piores. As maiores produções foram obtidas em terra arenosa. Nas terras roxa e roxa-misturada, também se conseguiram boas produções. Já na região representada pela terra massapê as produções foram fracas, confirmando os resultados dos anos anteriores.This paper reports the results obtained from field tests with sexteen peanut varieties received from the United States of America, Belgium Congo and several Brazilian regions. Eight experiments were conducted in the following counties of the State of São Paulo: Campinas, Ribeirão Preto, Pindorama, Presidente Prudente and Tatuí. Yield data showed the varieties Paulista-269, Bandeirante-263, Brasilia-265, Centenário-264 and Tatui-76 to prove better, particularly the first one, that ranked good classification in every locality as far as seed production and oil content of the seeds are concerned. Variety Tatu-53 which still widespreads all over the State, was one of the least yielders. The highest yields were

  19. Biocompatibility of sweetpotato and peanut in a hydroponic system

    Science.gov (United States)

    Mortley, D. G.; Loretan, P. A.; Hill, W. A.; Bonsi, C. K.; Morris, C. E.; Hall, R.; Sullen, D.

    1998-01-01

    'Georgia Red' peanut (Arachis hypogaea L.) and TU-82-155 sweetpotato [Ipomoea batatas (L.) Lam] were grown in monocultured or intercropped recirculating hydroponic systems in a greenhouse using the nutrient film technique (NFT). The objective was to determine whether growth and subsequent yield would be affected by intercropping. Treatments were sweetpotato monoculture (SP), peanut monoculture (PN), and sweetpotato and peanut grown in separate NFT channels but sharing a common nutrient solution (SP-PN). Greenhouse conditions ranged from 24 to 33 degrees C, 60% to 90% relative humidity (RH), and photosynthetic photon flux (PPF) of 200 to 1700 micromoles m-2 s-1. Sweetpotato cuttings (15 cm long) and 14-day-old seedlings of peanuts were planted into growth channels (0.15 x 0.15 x 1.2 m). Plants were spaced 25 cm apart within and 25 cm apart between growing channels. A modified half-Hoagland solution with a 1 N: 2.4 K ratio was used. Solution pH was maintained between 5.5 and 6.0 for treatments involving SP and 6.4 and 6.7 for PN. Electrical conductivity (EC) ranged between 1100 and 1200 microS cm-1. The number of storage roots per sweetpotato plant was similar for both SP and SP-PN. Storage root fresh and dry mass were 29% and 36% greater, respectively, for plants in the SP-PN treatment than for plants in the SP treatment. The percent dry mass of the storage roots, dry mass of fibrous and pencil roots, and the length-to-diameter ratio of storage roots were similar for SP and SP-PN sweetpotato plants. Likewise, foliage fresh and dry mass and harvest index were not significantly influenced by treatment. Total dry mass was 37% greater for PN than for SP-PN peanut plants, and pod dry mass was 82% higher. Mature and total seed dry mass and fibrous root dry mass were significantly greater for PN than for SP-PN plants. Harvest index (HI) was similar for both treatments. Root length tended to be lower for seedlings grown in the nutrient solution from the SP-PN treatment.

  20. Crop rotation biomass and arbuscular mycorrhizal fungi effects on sugarcane yield Produção de biomassa e presença de fungos micorrízicos arbusculares em culturas utilizadas em rotação com a cana-de-açúcar

    Directory of Open Access Journals (Sweden)

    Edmilson José Ambrosano

    2010-12-01

    Full Text Available A cana-de-açúcar (Saccharum spp. vem sendo cultivada no Brasil para produção de açúcar e agroenergia. Em seu sistema de produção, após um ciclo de 4 a 8 anos, é possível a rotação com plantas de cobertura, antes do seu replantio, para melhoria do solo e geração de renda. Estudou-se a caracterização e produtividade de biomassa de leguminosas (como adubos-verdes e girassol (Helianthus annuus L., a ocorrência natural de micorrizas, o teor de açúcar e a produtividade em colmos da cana-de-açúcar IAC 87-3396 e a viabilidade econômica desse sistema com cultivo após as opções de rotação, com quantificação da produtividade durante três cortes consecutivos. O amendoim (Arachis hypogaea L. cv. IAC-Caiapó, girassol cv. IAC-Uruguai e mucuna-preta (Mucuna aterrimum Piper and Tracy foram as culturas que apresentaram maior percentagem de colonização por fungos micorrízicos. O girassol foi a planta de cobertura que mais extraiu nutrientes do solo, seguido por amendoim (Arachis hipogaea L. cv. IAC-Tatu e feijão-mungo (Vigna radiata L. Wilczek. A colonização por fungos micorrízicos mostrou correlação positiva com a altura de plantas de cana no primeiro corte (p = 0,01 e R = 0,52, mas não se correlacionou com a produtividade de colmos ou açúcar. No primeiro corte, o girassol foi a cultura de rotação que ocasionou o maior aumento de produtividade, da ordem de 46% em colmos e de 50% na quantidade de açúcar, em comparação com a testemunha. Com exceção dos amendoins, todas as culturas em rotação aumentaram a renda líquida do sistema na média de três cortes de cana-de-açúcar.Sugarcane (Saccharum spp. is an important crop for sugar production and agro-energy purposes in Brazil. In the sugarcane production system after a 4- to 8-year cycle crop rotation may be used before replanting sugarcane to improve soil conditions and give an extra income. This study had the objective of characterizing the biomass and the

  1. Effect of Planting Date and Biological and Chemical Fertilizers on Phenology and Physiological Indices of Peanuts

    Directory of Open Access Journals (Sweden)

    A Sepehri

    2017-06-01

    Full Text Available Introduction Peanut (Arachis hypogaea L. is an annual herbaceous plant in Fabaceae which grown in tropical to temperate regions worldwide for extracting its seed oil and nut consumption. Select the optimum planting date is one of the most important agricultural techniques that comply with the seed yield is maximized . For instance, delay planting date can reduce the number of fertile nodes and the number of pods per plant. The delay in planting date reduces total dry matter (TDM, leaf area index (LAI, crop growth rate (CGR and yield in bean (Phaseolus vulgaris L.. Daneshian et al., (2008 reported that the delay in planting date reduced sunflower (Helianthus annuus yield due to high temperatures in early growth which shortened flowering time and reduced solar radiation. On the other hand, due to increase importance of environmental issues has been attending biofertilizers to replace chemical fertilizers. Biofertilizers has formed by beneficial bacteria and fungi that each of them are produced for a specific purpose, such as nitrogen fixation, release of phosphate, potassium and iron ions of insoluble compound. The use of nitrogen fertilizer with slow-releasing ability stimulated shoot growth in soybean (Glycine max and be created more LAI in the reproductive process, particularly during grain filling stage and finally increased seed yield . Therefore, this study was conducted in order to evaluate the interaction of biological and chemical fertilizers in the purpose of achieving sustainable agriculture with emphasis of the effects of various planting dates on physiological parameters and growth of peanut in Hamadan. Materials and Methods In order to investigate the effects of planting date on important physiological indices of peanuts (Arachis hypogaea L. under the influence of biological and chemical fertilizers. A field experiment was conducted in the research farm of Bu-Ali Sina University, Hamedan during 2013 growing season. This study was

  2. Análise do extrato aquoso de Arachis hipoagea L. no combate à dislipidemia e ao ganho ponderal de ratos Wistar submetidos à dieta hiperlipídica1

    Directory of Open Access Journals (Sweden)

    Thárcia K.B. de Oliveira

    Full Text Available RESUMO: O objetivo desse estudo foi avaliar os efeitos do Extrato Aquoso de Amendoim (EAA no peso, bioquímica sérica e na histologia hepática de ratos Wistar submetidos a dietas normo e hiperlipídicas. A pesquisa foi realizada utilizando 40 ratos Wistar machos, divididos em quatro grupos (n=10: GA (dieta hiperlipídica, GB (dieta hiperlipídica +EAA, GC (dieta normolipídica e GD (dieta normolipídica +EAA. Após 8 semanas, os animais foram eutanasiados e foram coletadas amostras sanguíneas para a avaliação de dados bioquímicos (Colesterol total e suas frações, triglicerídeos, uréia, creatinina, AST, ALT e glicemia e fragmentos do fígado para análise histológica. Os animais do grupo GB tiveram um ganho de peso inferior quando comparados ao GA (XGB= versus XGA= p<0,05, já os grupos GC e GD não obtiveram diferenças estatísticas. Os animais que receberam o EAA tiveram uma redução nos níveis de colesterol (XGB= versus XGA= p<0,05 e XGD= versus XGA= p<0,01, dos triglicerídeos (XGB= versus XGA e XGD= versus XGA= p<0,001 e mais discretamente dos níveis de ALT. A glicemia, uréia e creatina permaneceram dentro dos valores de referência. As amostras hepáticas analisadas, dos ratos dos diferentes grupos, não apresentaram alterações histopatológicas. Conclui-se que O EAA apresentou efeitos preventivos sobre o ganho ponderal e dislipidemia.

  3. Gastric emptying of oils in the rat

    International Nuclear Information System (INIS)

    Palin, K.J.; Whalley, D.R.; Wilson, C.G.; Phillips, A.J.; Davis, S.S.

    1982-01-01

    Sulphur colloid, labelled with technetium 99 and emulsified with arachis oil, miglyol 812 or liquid paraffin, was administered orally to male rats. A gamma camera, linked to a computer was used for imaging for 108 mins. after administration. The efficiency of the oils to aid stomach emptying was compared and arachis oil found to be the most effective. (U.K.)

  4. Peanut gene expression profiling in developing seeds at different reproduction stages during Aspergillus parasiticus infection

    Directory of Open Access Journals (Sweden)

    Liang Xuanqiang

    2008-02-01

    Full Text Available Abstract Background Peanut (Arachis hypogaea L. is an important crop economically and nutritionally, and is one of the most susceptible host crops to colonization of Aspergillus parasiticus and subsequent aflatoxin contamination. Knowledge from molecular genetic studies could help to devise strategies in alleviating this problem; however, few peanut DNA sequences are available in the public database. In order to understand the molecular basis of host resistance to aflatoxin contamination, a large-scale project was conducted to generate expressed sequence tags (ESTs from developing seeds to identify resistance-related genes involved in defense response against Aspergillus infection and subsequent aflatoxin contamination. Results We constructed six different cDNA libraries derived from developing peanut seeds at three reproduction stages (R5, R6 and R7 from a resistant and a susceptible cultivated peanut genotypes, 'Tifrunner' (susceptible to Aspergillus infection with higher aflatoxin contamination and resistant to TSWV and 'GT-C20' (resistant to Aspergillus with reduced aflatoxin contamination and susceptible to TSWV. The developing peanut seed tissues were challenged by A. parasiticus and drought stress in the field. A total of 24,192 randomly selected cDNA clones from six libraries were sequenced. After removing vector sequences and quality trimming, 21,777 high-quality EST sequences were generated. Sequence clustering and assembling resulted in 8,689 unique EST sequences with 1,741 tentative consensus EST sequences (TCs and 6,948 singleton ESTs. Functional classification was performed according to MIPS functional catalogue criteria. The unique EST sequences were divided into twenty-two categories. A similarity search against the non-redundant protein database available from NCBI indicated that 84.78% of total ESTs showed significant similarity to known proteins, of which 165 genes had been previously reported in peanuts. There were

  5. Inoculação com Rhizobium e aplicação de nitrogênio em amendoim Comparison among Rhizobium strains inoculations and nitrogen applications on peanut, in field conditions

    Directory of Open Access Journals (Sweden)

    Antonio Roberto Giardini

    1985-01-01

    Full Text Available Existe, nas nossas condições, uma população autóctone de Rhizobium capaz de nodular o amendoim (Arachis hypogaea L., mas pouco se sabe da contribuição do nitrogênio fixado para esta planta. Foram conduzidos dois ensaios no campo, em solo de baixa fertilidade, um no período "da seca" e outro no "das águas", comparando o crescimento e a produção de plantas de amendoim inoculado com Rhizobium selecionado, com o de plantas noduladas pela população autóctone, adubadas ou não com nitrogênio. A nodulação das plantas inoculadas foi semelhante à observada nos tratamentos não inoculados, com ou sem nitrogênio. Na fase final do ciclo das plantas, houve maior acúmulo e maior taxa de absorção diária de nitrogênio nos tratamentos inoculados ou com adubação nitrogenada, do que no controle sem inoculação e sem nitrogênio. No ensaio da seca, não houve aumento de produção devido à adubação nitrogenada, ou à inoculação. No ensaio das águas, houve resposta à aplicação de nitrogênio no plantio. Os resultados de produção não foram coerentes com os da marcha de absorção de N. A produção de ensaio das águas foi equivalente a 3.400 kg/ha para o tratamento sem nitrogênio e sem inoculação.Two field experiments were carried out with peanut in the same area on a limed and fertilized "cerrado soil" (originally acidic and low fertility. The first experiment was carried out in the autumn/winter (dry season, and the second one in the subsequent spring/summer (wet season, in Campinas, State of São Paulo, Brazil. Plant development and production of inoculated (three Rhizobium strains and nitrogen fertilized treatments (at planting 25 and 45 days after planting were compared with non-inoculated and non-N-fertilized control. Nodulation of inoculated plants was similar to those of non-inoculated, with or without nitrogen. Greater accumulations, and rates for average daily uptake of nitrogen were observed for inoculated as

  6. Herbicidas de aplicação em pós-emergência em amendoim: I: controle de plantas daninhas e persistência no solo Post emergence herbicides in peanuts: I: weed control and persistence in the soil

    Directory of Open Access Journals (Sweden)

    Luciano Souza Paes Cruz

    1991-01-01

    Full Text Available No ano agrícola 1987/88, foi realizado um experimento de campo na Estação Experimental de Ribeirão Preto, do Instituto Agronômico, em latossolo roxo, textura argilosa, com a finalidade de pesquisar a ação dos herbicidas aplicados em pós-emergência no controle de plantas daninhas e sua persistência em solo, na cultura de amendoim (Arachis hypogaea L. O experimento foi em parcelas subdivididas com as parcelas distribuídas em blocos ao acaso com quatro repetições. Nas parcelas, estudaram-se os tratamentos referentes à presença e à ausência de inoculação, sendo o inoculante preparado com a mistura de estirpes de Bradyrhizobium sp. (SMS-319, SMS-400 e SMS-561; nas subparcelas, os herbicidas fomesafen (250g/ha, lactofen (192g/ha, fluazifop-p-butil (187g/ha, haioxifop-metil (240g/ha e a mistura de fomesafen com fluazifop-p-butil (250 + 187g/ha, além de uma testemunha sem herbicida. Nas entrelinhas das subparcelas, tomaram-se ao acaso cinco pontos paraformar uma amostrado solo composta para análise de persistência dos produtos. As principais plantas daninhas presentes no experimento foram as gramíneas Cenchrus echinatus L. e Eleusine indica (L. Gaerth, e as dicotiledôneas Alternanthera fícoidea(L. R. Br. e Sidaspp. Aos 20 dias da aplicação dos herbicidas, as gramíneas foram 100% controladas pelos graminicidas fluazifop-p-butil e haioxifop-metil. Fomesafen e lactofen controlaram eficientemente A. fícoidea e, regularmente, Sida spp. A mistura de fomesafen com fluazifop-p-butil não apresentou vantagens em relação aos herbicidas isolados. Os resultados obtidos mostraram que não houve influenciada inoculação no controle de plantas daninhas e que os herbicidas não foram tóxicos às plantas de amendoim. Os herbicidas fluazifop-p-butil e haioxifop-metil, aos 28 dias, não mais causavam fitotoxicidade na planta-teste, mostrando uma persistência no solo inferior a esse período. Aos 28 dias, no tratamento não inoculado

  7. Two novel aflatoxin-producing Aspergillus species from Argentinean peanuts

    DEFF Research Database (Denmark)

    Pildain, M.B.; Frisvad, Jens Christian; Vaamonde, G.

    2008-01-01

    Two novel species from Aspergillus section Flavi from different species of Arachis (peanuts) in Argentina are described as Aspergillus arachidicola sp. nov. and Aspergillus minisclerotigenes sp. nov. Their novel taxonomic status was determined using a polyphasic taxonomic approach with phenotypic...

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 451 - 500 of 781 ... ... artificial insemination and early rebreeding in Yankasa sheep, Abstract ... groundnut (Arachis hypogae) cultivars for food and feed, Abstract ... containing malted sorghum sprout with varying combinations of additives.

  9. Evaluation of the influence of nitrogen fixing, phosphate solubilizing ...

    African Journals Online (AJOL)

    Three biofertilizers nitrobein, phosphorein, and potash, containing nitrogen fixing, phosphate solubilizing, and potash mobilizing microorganisms, respectively were studied in peanut (Arachis hypogea L.) and sunflower (Helianthus annuus L.). Amendment with each of these biofertilizers enhanced different growth ...

  10. 59 - 62 lawan paid

    African Journals Online (AJOL)

    DR. AMIN

    development rather than seed germination. Key words: Allelochemicals, Eucalyptus species, Root length, Germination, Arachis hypogea. INTRODUCTION. Plants that ..... Bangladesh Journal of Botany, 33(2): 79-84. Ahmed, R., Uddin, M. B. ...

  11. Chemical qualities of oils from some fresh and market vegetable ...

    African Journals Online (AJOL)

    JTEkanem

    production was examined by evaluating the oil yield and chemical qualities of oil extracted from fresh ... oil may be considered as Nigeria potential asset for biofuel and oleochemical production. Keywords: ..... standards for edible Arachis oil.

  12. African Journal of Biotechnology - Vol 9, No 13 (2010)

    African Journals Online (AJOL)

    Inheritance of fresh seed dormancy in Spanish-type peanut (Arachis ... Construction of a novel lentiviral vector carrying human B-domain-deleted factor VIII gene ... Studies on hemorrhagic pneumonia in Moschus sifanicus · EMAIL FREE FULL ...

  13. 1907-IJBCS-Article-Bernice Kingha

    African Journals Online (AJOL)

    hp

    Campo, Tchuenguem Fohouo et al. (2000) ont trouvé 4 ouvrières de Apis mellifica sur un pied de A. hypogaea. La durée moyenne d'une visite de récolte de pollen varie avec l'insecte et ceci d'une année à une autre. La durée des visites semble être liée à l'accessibilité au pollen de. A. hypogaea. Nos données confirment ...

  14. In situ degradability and selected ruminal constituents of sheep fed with peanut forage hay.

    Science.gov (United States)

    Fernandes, Gisele Machado; Possenti, Rosana Aparecida; Teixeira de Mattos, Waldssimiler; Schammass, Eliana Aparecida; Junior, Evaldo Ferrari

    2013-01-01

    Because legumes are a very important feed source for ruminants, the aim of this study was to evaluate the ideal inclusion level of hay Arachis pintoi cv. Belmonte in sheep diets by measuring the dry matter intake (DMI), concentration of volatile fatty acids, ammonia-nitrogen concentration, ruminal pH and the in situ degradability of dry matter (DM) and crude protein (CP). In the experiment with four sheep, a 4 × 4 Latin Square design was used with four periods and four treatments (0%, 30%, 60% and 100% Arachis replacing grass hay). Significant interactions were observed between treatments and sampling times for ammonia-nitrogen and acetate, propionate and butyrate concentration and the acetate:propionate ratio. The ruminal pH and total volatile fatty acids concentration were not affected by interaction between treatments and sampling time. The degradation of DM and CP was similar, rising with the increasing content of Arachis, showing a linear effect. The treatment containing 60% of Arachis showed best results, with good levels of daily weight gain and higher ruminal concentrations of volatile fatty acids. The legume showed high levels of CP, high digestibility and appropriate levels of fibre, with excellent standards of degradation and ruminal characteristics. The use of the legume  Arachis for ruminants is a promising option of nutrient supply to meet production demands of these animals.

  15. Evaluation of Forage Yield and Important Agronomic Indices of Corn Affected by Intercropping Systems with Peanut and Nitrogen Rates

    Directory of Open Access Journals (Sweden)

    M Nabati nasaz

    2016-07-01

    Full Text Available Introduction Multiple cropping such as intercropping plays an important role in agriculture because of maximizing beneficial interactions. Intercropping of legumes and cereals is an old practice in tropical agriculture that dates back to ancient civilization. Maize-legume intercrops could substantially increase forage quantity and quality and decrease requirement for protein supplements (Ahmad et al., 2008. Intercropping of cereals and legumes is important for development of sustainable food production systems. This may be due to some of the potential benefits in intercropping systems such as high productivity and profitability, improvement of soil fertility through the additional supply of N by fixation and excretion from the component legume, efficient use of resources, reducing damage caused by pests, diseases and weeds and improvement of forage quality (Ahmad et al., 2008; Fernandez-Aparicio et al., 2007; Lithourgidis et al., 2006. The main advantage of intercropping is more efficient utilization of the available resources and the increased productivity compared with each sole crop of the mixture. Therefore, this experiment was conducted to evaluate agronomic characteristics of corn and Land equivalent ratio (LER under intercropping with peanut and different rates of nitrogen. Materials and methods In order to evaluate the forage yield and important agronomic indices of corn (Zea mays L. affected by intercropping systems with peanut and different nitrogen rates, this experiment was performed in the experimental field of agricultural and natural resource research center of Guilan province, Rasht, Iran, during 2013-14 cropping season as a split plot arrangement in randomized complete block design with three replications. Nitrogen rates, including of zero, 100, 200 and 300 kg per hectare as main plot and sole cropping of corn and peanut (Arachis hypogaea L., intercropping systems including of intercropping corn and peanut at ratio of 1:1, 2

  16. Constitutive expression of fluorescent protein by Aspergillus var. niger and Aspergillus carbonarius to monitor fungal colonization in maize plants

    Science.gov (United States)

    Aspergillus niger and A. carbonarius are two species in the Aspergillus section Nigri (black-spored aspergilli) frequently associated with peanut (Arachis hypogea), maize (Zea mays), and other plants as pathogens. These infections are symptomless and as such are major concerns since some black aspe...

  17. Yield response and economics of shallow subsurface drip irrigation systems

    Science.gov (United States)

    Field tests were conducted using shallow subsurface drip irrigation (S3DI) on cotton (Gossypium hirsutum, L.), corn (Zea mays, L.), and peanut (Arachis hypogeae, L.) in rotation to investigate yield potential and economic sustainability of this irrigation system technique over a six year period. Dri...

  18. Download this PDF file

    African Journals Online (AJOL)

    Wartu et al.

    Process Wheat and Flour From Selected Major Stores Within Northern Nigeria. PHYLOGENETICS ... Thirty seven (37. %) and 25 % of the wheat flour samples from in-process and .... and 2 min at. 72oC for extension) and a 5-min final extension at 72oC was run .... Nutrient composition and oil of peanuts (Arachis hypogeal) ...

  19. Defoliation management affects morphogenetic and structural ...

    African Journals Online (AJOL)

    ... increase of about 30% on forage and leaf accumulation rates of both grass and legume. Therefore, to enhance productivity and stability when these species are associated we recommend defoliating at 90–95% LI, which represents a canopy height ranging from 26 to 32 cm. Keywords: Arachis pintoi, Brachiaria brizantha, ...

  20. Aqueous and ethanolic extracts of Vernonia amygdalina L. in the ...

    African Journals Online (AJOL)

    A study was carried out on the use of Vernonia amygdalina del. extract to control fungi associated with groundnut (Arachis hypogeae L) seeds. Aspergillus niger van Tiegh, A. flavus link ex fries, Cercospora arachidicola Hori, Phoma exigua desm., Macrophomina phaseolina (Tassi) Goid, Fusarium oxysporium schl., ...

  1. Effect of some stabilizing agents on globule characteristics and ...

    African Journals Online (AJOL)

    This study investigated the effects of some stabilizing agents (cassava, maize and bentonite mucilages) on globule characteristics and rheological properties of oil in water emulsions. Emulsions were prepared by mixing varying proportions of the mucilages with Arachis oil in the ratio of 60:40 (oil: water) with the aid of a ...

  2. Host range, symbiotic effectiveness and nodulation competitiveness ...

    African Journals Online (AJOL)

    ERIC-PCR DNA fingerprinting patterns were used to identify the isolates occupying nodules. All the isolates nodulated cowpea, groundnut (Arachis hypogeae) and mungbean (Vigna radiata), but only AII-2-1, AII-3-4 and BIII-2-2 nodulated soybean (Glycine max). Apart from cowpea where all the isolates were effective, there ...

  3. Nematode parasites of groundnut

    Science.gov (United States)

    Groundnut is the common name for several leguminous plant species producing seed that mature underground, including Bambara groundnut (Vigna subterranean), Hausa groundnut (Macrotyloma geocarpum), and peanut (Arachis spp.). Hausa groundnut is cultivated as a food crop primarily in West Africa and t...

  4. Matting of Hair Due to Halo-egg Shampoo

    Directory of Open Access Journals (Sweden)

    Z M Mani

    1983-01-01

    Full Text Available A case of hair matting in an 18 year old female is reported. The hair got densely entangled immediately after washing the hair with ′Halo Egg′ shampoo. The hair was disentangled completely after prolonged dipping of the hair in arachis oil frr 5 days.

  5. Effects of Allelochemicals of Some Eucalyptus Species on ...

    African Journals Online (AJOL)

    A laboratory experiment was conducted to assess the effects of allelochemicals of Eucalyptus camaldulensis, Eucalyptus citriodora and Eucalyptus globules on germination and root elongation using leguminous crop ground nut (Arachis hypogea) as bioassay material. The experiments were conducted in sterilized ...

  6. Untitled

    Indian Academy of Sciences (India)

    their lipase content with a view to get cheap and active lipase on a large scale. The lipases are prepared from the following oilseeds according to. Longnecker and Haly's method and the different factors which control the activity of these lipases are studied--(1) Castor (Ricinus communis);. (2) Groundnut (Arachis hypogea); ...

  7. Energy partitioning for growth by rabbits fed groundnut and stylo ...

    African Journals Online (AJOL)

    Forty eight crossbred (California X New Zealand White) rabbits were used to evaluate energy partitioning of rabbits fed forages supplemented with concentrate. The rabbits were randomly allocated to three treatments consisting of sole Stylosanthes hamata (stylo),sole Arachis hypogea (groundnut) haulms and 50:50 mixture ...

  8. Research Paper:

    African Journals Online (AJOL)

    Shanu

    2014-01-08

    Jan 8, 2014 ... Forty years in capsaicin research for sensory pharmacology and physiology. Neuropeptides 38:377-384. Thomas E (2002). Tissue culture studies in Arachis hypogea L. and. Vignaunguiculata (L.) Walp. for micropropagation and cell line selection for amino acid overproduction, Ph.D. Thesis, University of.

  9. Relative bioavailability of three newly developed albendazole formulations : a randomized crossover study with healthy volunteers

    NARCIS (Netherlands)

    Rigter, I M; Schipper, H G; Koopmans, R P; van Kan, H J M; Frijlink, H W; Kager, P A; Guchelaar, H-J

    2004-01-01

    This study of healthy volunteers shows that the relative bioavailability of albendazole formulations that use arachis oil-polysorbate 80 or hydroxypropyl-beta-cyclodextrin as an excipient was enhanced 4.3- and 9.7-fold compared to the results seen with commercial tablets. Administration of macrogol

  10. Relative bioavailability of three newly developed albendazole formulations: a randomized crossover study with healthy volunteers

    NARCIS (Netherlands)

    Rigter, I. M.; Schipper, H. G.; Koopmans, R. P.; van Kan, H. J. M.; Frijlink, H. W.; Kager, P. A.; Guchelaar, H.-J.

    2004-01-01

    This study of healthy volunteers shows that the relative bioavailability of albendazole formulations that use arachis oil-polysorbate 80 or hydroxypropyl-beta-cyclodextrin as an excipient was enhanced 4.3- and 9.7-fold compared to the results seen with commercial tablets. Administration of macrogol

  11. Establishment of five cover crops and total soil nutrient extraction in a humid tropical soil in the Peruvian Amazon

    Science.gov (United States)

    In order to evaluate the establishment of five cover crops and their potential to increase soil fertility through nutrient extraction, an experiment was installed in the Research Station of Choclino, San Martin, Peru. Five cover crops were planted: Arachis pintoi Krapov. & W.C. Greg, Calopogonium m...

  12. CARACTERIZAÇÃO MORFOLÓGICA DE ACESSOS DE GERMOPLASMA DE QUATRO ESPÉCIES BRASILEIRAS DE AMENDOIM-SILVESTRE MORPHOLOGICAL CHARACTERIZATION OF GERMPLASM ACESSIONS OF FOUR BRAZILIAN SPECIES OF WILD PEANUT

    Directory of Open Access Journals (Sweden)

    RENATO FERRAZ DE ARRUDA VEIGA

    2001-01-01

    Full Text Available Caracterizaram-se morfologicamente os acessos de germoplasma de espécies silvestres brasileiras de amendoim do gênero Arachis L., Sect. Arachis e analisaram-se a similaridade genética entre acessos da mesma espécie e entre as espécies. Realizou-se o experimento nos anos agrícolas de 1993 a 1996, no Núcleo Experimental de Campinas, do Instituto Agronômico (IAC. Avaliaram-se os acessos disponíveis no Banco Ativo de Germoplasma de Espécies Silvestres de Arachis, da Embrapa Recursos Genéticos e Biotecnologia (CENARGEN - Brasília, DF, das espécies A. palustris Krapov., W.C. Gregory & Valls, A. decora Krapov., W.C. Gregory & Valls, A. praecox Krapov., W.C. Gregory & Valls e A. stenosperma Krapov. & W.C. Gregory, efetuando-se anotações fenotípicas quantitativas e qualitativas, conforme lista de descritores morfológicos. Observou-se que os acessos de A. stenosperma são semelhantes, apesar da sua grande distância geográfica, e diferem das demais espécies, formando um grupo mais coeso. Caracteres como o diâmetro do eixo central e o comprimento dos frutos e das sementes serviram para distingui-la das demais espécies. Arachis decora apresentou alta variação entre acessos nos vários caracteres morfológicos estudados. A. palustris apresentou alta variação morfológica entre acessos, ainda que tenham sido analisados apenas dois, para altura da planta, largura da semente, dimensões do esporão, istmo, folíolo, raque e eixo central e quanto à presença e ausência de tricomas no folíolo. Arachis praecox, representada por um único acesso, aproximou-se mais de A. decora que das demais espécies.In this work, a morphological characterization of germplasm accessions of wild Brazilian species of peanut, section Arachis was accomplished. Also, an analysis of the genetic similarity among accessions and between species was evaluated. The experiment was undertaken from 1993 to 1996, at the Campinas Experimental Station of the Instituto

  13. IRRIGAÇÃO COM ÁGUA SALINA NA CULTURA DO AMENDOIM EM SOLO COM BIOFERTILIZANTE BOVINO

    Directory of Open Access Journals (Sweden)

    Geocleber Gomes de Sousa

    2014-06-01

    Full Text Available O experimento foi conduzido na área experimental da Estação Agrometereológica, UFC, em Fortaleza/Ceará, no período de setembro a novembro de 2012, com o objetivo de avaliar o efeito da salinidade da água de irrigação nas características agronômicas do amendoinzeiro, cultivar BRS 1 em solo com e sem biofertilizante bovino. Os tratamentos foram distribuídos em delineamento inteiramente casualizado, em esquema fatorial 5 x 2, com cinco repetições, referente aos valores de condutividade elétrica da água de irrigação:0,8; 1,5; 3,0; 4,5 e 6,0 dS m-1, em solo sem e com biofertilizante bovino, aplicado de uma única vez, ao nível de 10% do volume do substrato, três dias antes da semeadura. As variáveis analisadas foram: número de folhas, altura de plantas, diâmetro do caule, área foliar, comprimento de raiz, matéria seca da parte aérea, da raiz e total. O aumento da concentração salina da água de irrigação reduziu a área foliar, matéria seca da parte aérea, matéria seca total e comprimento da raiz do amendoinzeiro, porém com menor intensidade no solo com o biofertilizante bovino. A elevação da salinidade do solo decorrente da irrigação com água salina provoca redução na altura da planta, diâmetro do caule e matéria seca da raiz. Palavra-chave: estresse salino, índices fisiológicos, insumo orgânico. PEANUT CULTURE IRRIGATED WITH SALINE WATER IN SOIL WITH BOVINE BIOFERTILIZER ABSTRACT This experiment was conducted at the agrometeorological experimental station, at the UFC, Fortaleza-CE (BR, in the period from September 2012 to November 2012, aiming to evaluate the effects of irrigation water salinity on the agronomic characteristics of BRS 1 peanut plant, in bio fertilized and non-bio fertilized soil. Treatments were arranged in a completely randomized design in a 5 x 2 factorial scheme, with five repetitions. Five different saline solutions (or irrigation water, identified by their respective electrical

  14. Removal of Reactive Dyes (Green, Orange, and Yellow from Aqueous Solutions by Peanut Shell Powder as a Natural Adsorbent

    Directory of Open Access Journals (Sweden)

    Hosein Nadi

    2012-11-01

    . Adsorption of phenol and its derivative from water using synthetic resins and low- cost natural adsorbents: A review. J Environ manage 2009;90(3:1336–49. 23. Yang C, KE L, Gong R, Liu H, Sun Y. [Utilization of powdered peanut hull as biosorbent for removal of azo dyes from aqueous solution]. J Biol 2005;2:16. (Full Text in Chinese 24. Rasekh H, Safarzadeh Vishkaei MN, Asghari J. [Response of yield and qualitative characteristics of peanut (Arachis hypogaea L. to planting pattern and plant density in Guilan province]. J Agric Sci 2006;12(2:387-96. (Full Text in Persian 25. Shokoohi R, Vatanpoor V, Zarrabi M, Vatani A. Adsorption of Acid Red 18 (AR18 by Activated Carbon from Poplar Wood - A Kinetic and Equilibrium Study. E J Chem 2010;7(1:65-72. 26. Nagda GK, Diwan AM, Ghole VS. Potential of Tendu leaf refuse for phenol removal in aqueous systems. Appl Ecol Environ Res 2007;5(2:1-9. 27. Rahman IA, Saad B. Utilization of Guava seed as a source of activated carbon for removal of methylene blue from aqueous solution. Malays J Chem 2003;5(1:8-14. 28. Rafatullah M, Sulaiman O, Hashim R, Ahmad A. Adsorption of copper(II, chromium(III, nickel(II and lead(II ions from aqueous solutions by meranti sawdust. J Hazard Mater 2009;170(2-3:969–77. 29. Tanyildizi MŞ, Modeling of adsorption isotherms and kinetics of reactive dye from aqueous solution by peanut hull. Chem Eng J 2011;168(3:1234-40.

  15. Determination of gastric-emptying profiles in the rat: influence of oil structure and volume

    International Nuclear Information System (INIS)

    Palin, K.J.; Whalley, D.R.; Wilson, C.G.; Davis, S.S.; Phillips, A.J.

    1982-01-01

    A simple non-invasive technique was developed for the determination of the gastric-emptying rate of oils in rats, employing a gamma camera and 99m-Tc-sulphur colloid as the oil phase marker. Using this method the gastric emptying of 3 oils, arachis oil, Miglyol 812 and liquid paraffin, was investigated. It was shown that both the oil volume and chemcial structure altered the rate of gastric emptying. (Auth.)

  16. Determination of gastric-emptying profiles in the rat: influence of oil structure and volume

    Energy Technology Data Exchange (ETDEWEB)

    Palin, K.J.; Whalley, D.R.; Wilson, C.G.; Davis, S.S.; Phillips, A.J. (Nottingham Univ. (UK). Medical School)

    1982-11-01

    A simple non-invasive technique was developed for the determination of the gastric-emptying rate of oils in rats, employing a gamma camera and 99m-Tc-sulphur colloid as the oil phase marker. Using this method the gastric emptying of 3 oils, arachis oil, Miglyol 812 and liquid paraffin, was investigated. It was shown that both the oil volume and chemical structure altered the rate of gastric emptying.

  17. Leguminous cover crops differentially affect maize yields in three contrasting soil types of Kakamega, Western Kenya

    Directory of Open Access Journals (Sweden)

    Kelvin Mark Mtei

    2011-06-01

    Full Text Available Maize production in smallholder farming systems in Kenya is largely limited by low soil fertility. As mineral fertilizer is expensive, green manuring using leguminous cover crops could be an alternative strategy for farmers to enhance farm productivity. However due to variability in soil type and crop management, the effects of green manure are likely to differ with farms. The objectives of this study were to evaluate Mucuna pruriens and Arachis pintoi on (i biomass and nitrogen fixation (15N natural abundance, (ii soil carbon and nitrogen stocks and (iii their effects on maize yields over two cropping seasons in Kakamega, Western Kenya. Mucuna at 6 weeks accumulated 1–1.3 Mg ha^{-1} of dry matter and 33–56 kg ha^{-1} nitrogen of which 70% was nitrogen derived from the atmosphere (Ndfa. Arachis after 12 months accumulated 2–2.7 Mg ha^{-1} of dry matter and 51–74 kg N ha^{-1} of which 52-63 % was from Ndfa. Soil carbon and nitrogen stocks at 0–15 cm depth were enhanced by 2-4 Mg C ha^{-1} and 0.3–1.0 Mg N ha^{-1} under Mucuna and Arachis fallow, irrespective of soil type. Maize yield increased by 0.5-2 Mg ha^{-1} in Mucuna and 0.5–3 Mg ha^{-1} in Arachis and the response was stronger on Nitisol than on Acrisol or Ferralsol. We concluded that leguminous cover crops seem promising in enhancing soil fertility and maize yields in Kenya, provided soil conditions and rainfall are suitable.

  18. Forage yield and nitrogen nutrition dynamics of warm-season native forage genotypes under two shading levels and in full sunlight

    OpenAIRE

    Barro,Raquel Santiago; Varella,Alexandre Costa; Lemaire,Gilles; Medeiros,Renato Borges de; Saibro,João Carlos de; Nabinger,Carlos; Bangel,Felipe Villamil; Carassai,Igor Justin

    2012-01-01

    The successful achievement of a highly productive understorey pasture in silvopastoral systems depends on the use of well-adapted forage genotypes, showing good agronomic performance and persistence under shading and grazing. In this study, the herbage dry matter yield (DMY) and nitrogen nutrition dynamics were determined in three native warm-season grasses (Paspalum regnellii, Paspalum dilatatum and Paspalum notatum) and a forage legume (Arachis pintoi) under two shading levels compared with...

  19. Conc goitro centrat ogens i Akor tions o in two ru in N of iodin select ...

    African Journals Online (AJOL)

    sunny

    ntration of iod world has be. @yahoo.com. anently open ac ne and ted wa. , Enug arachi1 and ... pH. ally less than o contain an w cases whe e, 1985). Th id hormones e (T4), which .... triplicates changed to pink. Also, 0.1 .... Urine Iodine of Pregnant Women in Owerri, Nigeria. Nig. ... Iodine in evolution of salivary glands and.

  20. Calibração dos modelos century, apsim e ndicea para decomposição e liberação de nitrogênio de materiais orgânicos vegetais em condições tropicais úmidas

    OpenAIRE

    Nascimento, Alexandre Ferreira do; Mendonça, Eduardo de Sá; Leite, Luiz Fernando Carvalho; Neves, Júlio Cesar Lima

    2011-01-01

    The aim of this study was to calibrate the CENTURY, APSIM and NDICEA simulation models for estimating decomposition and N mineralization rates of plant organic materials (Arachis pintoi, Calopogonium mucunoides, Stizolobium aterrimum, Stylosanthes guyanensis) for 360 days in the Atlantic rainforest bioma of Brazil. The models´ default settings overestimated the decomposition and N-mineralization of plant residues, underlining the fact that the models must be calibrated for use under tropical ...

  1. Población de nematodos en forrajes tropicales en dos rangos de altura en el cantón de San Carlos, Alajuela

    OpenAIRE

    WingChing-Jones, Rodolfo; Salazar Figueroa, Luís

    2011-01-01

    Se caracterizó la población de nematodos fitoparásitos presente en los pastos Sorgo negro (Sorghum almus), Camerún (Pennisetum purpureum var Camerun), King grass (Pennisetum purpureum var King grass), Tanzania (Panicum maximum var Tanzania), Brizantha (Brachiaria brizantha), Toledo (Brachiaria brizantha var Toledo), Estrella africana (Cynodon nlemfuensis), Mombaza (Panicum maximum var Mombaza), Ratana (Ischaemum ciliare) y la leguminosa maní forrajero (Arachis pintoi) en la localidad de San C...

  2. Roughage digestion evaluation in horses with total feces collection and mobile nylon bags

    OpenAIRE

    Rodrigues, Liziana Maria; Almeida, Fernando Queiroz de; Pereira, Marcos Barreto; Miranda, Ana Cláudia Tavares; Guimarães, Andresa; Andrade, Agnaldo Machado de

    2012-01-01

    This study aimed to evaluate the nutrient digestibility of roughages in horses with total feces collection and mobile bags. Two trials were carried out simultaneously. The first trial evaluated the digestibility of nutrients of coastcross hay (Cynodon dactylon cv. coastcross) with total feces collection. The second trial assessed the digestibility of nutrients of alfalfa hay (Medicago sativa), peanut (Arachis pintoi) and coastcross hay with mobile bags. This trial was conducted with gastric i...

  3. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  4. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  5. ESTABLISHMENT TECHNIQUES FOR TROPICAL LEGUMES IN THE UNDERSTORY OF A EUCALYPTUS PLANTATION

    Directory of Open Access Journals (Sweden)

    Maria Luiza Franceschi Nicodemo

    2015-04-01

    Full Text Available This study evaluated establishment methods for a mixture of herbaceous forage legumes [Centrosema acutifolium, Clitoria ternatea, Pueraria phaseoloides, Stylosanthes Campo Grande (Stylosanthes capitata + S. macrocephala, Calopogonium mucunoides, Lablab purpureus, Arachis pintoi, and Aeschynomene villosa] under the shade of an Eucalyptus grandis plantation submitted to thinning (40% 8 years after planting in Anhembi, São Paulo (22°40'S, 48°10'W, altitude of 455 m. The experiment started in December 2008 and consisted of the comparison of the following four types of seed incorporation by light disc harrowing: (1 broadcast sowing without seed incorporation; disc harrowing before (2 or after (3 planting, and (4 disc harrowing before and after planting. Ninety days after planting, the number of legume plants/m2 and the percentage of ground cover by the plants varied between the treatments tested; however, the treatments had no effect on the dry matter accumulation of forage legumes. Disc harrowing before planting yielded superior results compared to the treatments without disc harrowing and disc harrowing after planting. At the end of the experimental period, the plots contained Arachis, Centrosema, Stylosanthes, and Pueraria. The dry matter accumulated by Centrosema corresponded to 73% of total dry matter yield of the plots. The participation of Arachis, Centrosema and Stylosanthes in final dry matter composition of the plots varied according to establishment method. The advantages of the use of species mixtures rather than monocultures in the understory of forest plantations were discussed.

  6. Características morfológicas e produtivas de leguminosas forrageiras tropicais submetidas a duas frequências de corte Morphologic and productive characteristics of tropical forage legumes under two harvest frequencies

    Directory of Open Access Journals (Sweden)

    Valdson José da Silva

    2010-01-01

    Full Text Available Objetivou-se com este trabalho avaliar características morfológicas e produtivas de leguminosas forrageiras submetidas a duas frequências de corte (28 e 56 dias a altura de 10 cm. Foram avaliadas as seguintes espécies: Arachis pintoi (cv. Amarillo, Clitoria ternatea, Calopogonium mucunoides, Desmodium ovalifolium (cv. Itabela e Stylosanthes guianensis (cvs. Bandeirante, Cook, Mineirão. O delineamento utilizado foi o inteiramente casualizado em arranjo fatorial (7 leguminosas × 2 frequências de corte com quatro repetições, para avaliação das seguintes variáveis: acúmulo de biomassa, número de ramificações/planta, número de folhas vivas/planta, massa seca das raízes, número e massa seca dos nódulos. A produção acumulada de MS da parte aérea e das raízes foi equivalente para os cortes efetuados a cada 28 dias ou a cada 56 dias, com exceção do Arachis, Clitoria e Desmodium, que apresentaram maior biomassa aérea e de raízes no intervalo de corte de 56 dias. Houve diferenças entre leguminosas quanto à massa seca e ao número de nódulos, todavia, o maior número de nódulos foi observado na frequência de 56 dias. O número de folhas vivas/planta foi maior na frequência de 56 dias, com exceção das leguminosas Arachis e Calopogonium, cujos valores foram próximos quando cortadas nas diferentes frequências. A frequência de corte afetou de forma diferenciada as características morfológicas e produtivas das leguminosas estudadas, o que indica a necessidade de manejo diferenciado para as variedades testadas.The objective of this research was to evaluate morphological and productive characteristics of forage legumes under two harvest frequencies (28 and 56 days and 10 cm harvest intensity. The following legume species were evaluated: Arachis pintoi (cv. Amarillo, Clitoria ternatea, Calopogonium mucunoides, Desmodium ovalifolium (cv. Itabela and Stylosanthes guianensis (cvs. Bandeirante, Cook, Mineirão. A randomized

  7. Produção de híbridos de amendoim forrageiro por meio de hibridação artificial Production of forage peanut hybrids through artificial hybridization

    Directory of Open Access Journals (Sweden)

    Marilda Augusta Peres Oliveira

    2002-06-01

    Full Text Available O objetivo deste trabalho foi a obtenção de híbridos de amendoim forrageiro por meio da hibridação artificial. O experimento foi realizado na Embrapa-Centro Nacional de Pesquisa de Recursos Genéticos e Biotecnologia, durante a época de florescimento dos acessos de Arachis pintoi Krap. & W. C. Gregory e de A. repens Handro. Cerca de 700 polinizações produziram 27 segmentos de frutos, com taxas de fecundação que variaram entre 1,1 e 12,9%, considerando-se todas as combinações híbridas. Os híbridos intra-específicos de A. pintoi produziram sementes F2, e os interespecíficos não produziram semente. A técnica de hibridação utilizada nas espécies forrageiras necessitou de ajustes, devido a diferenças observadas em relação ao amendoim cultivado, entre elas o hábito de crescimento.The purpose of this work was to obtain forage peanut hybrids through artificial hybridization. The experiment was conducted in a screenhouse at Embrapa-Centro Nacional de Pesquisa de Recursos Genéticos e Biotecnologia during the flowering period of Arachis pintoi Krap. & W. C. Gregory and A. repens Handro accessions. About 700 pollinations produced 27 fruit segments and the fertilization rates ranged from 1.1 to 12.9% for all cross combinations. The intraspecific hybrids produced F2 seeds, which did not occur to the interspecific hybrids. To effect the hybridization technique, adjustments were necessary to forage Arachis species, in relation to cultivated peanut, since differences in the growth habit were verified.

  8. Effect of oils on drug absorption

    OpenAIRE

    Palin, K.J.

    1981-01-01

    Oil and emulsion vehicles have been shown to alter the oral absorption of many drugs. This may be due to enhanced lymph flow and/or altered gastro-intestinal motility in the presence of the oils. The oral absorption of a model compound (DOT) in the presence of three chemically different oils, arachis oil, Miglyol 812 and liquid paraffin was investigated in rats, the influence of lymphatic absorption and gastro-intestinal motility being determined. The findings were applied to the for.mulation...

  9. Cultivo agroecológico de berinjeleira sob doses de adubação orgânica em coberturas vivas perenes.

    OpenAIRE

    Santos, Carlos Antonio B dos; Rocha, Marcus Vinícius C; Espindola , José Antonio A; Guerra, José Guilherme M; Almeida, Dejair L de; Ribeiro , Raul de LD

    2013-01-01

    O desempenho agronômico da berinjeleira foi avaliado em cultivo agroecológico, comparando-se espécies de gramínea e leguminosa perenes para cobertura viva do solo. O experimento foi conduzido no município de Seropédica-RJ, no delineamento de blocos casualizados, com parcelas subdivididas e três repetições. Foram avaliadas as coberturas vivas do solo com amendoim forrageiro (Arachis pintoi), grama batatais (Paspalum notatum) e preparo convencional do solo (controle). Nas subparcelas, foram emp...

  10. 15-hydroxyprostaglandin dehydrogenase activity in vitro in lung and kidney of essential fatty acid-deficient rats

    DEFF Research Database (Denmark)

    Hansen, Harald S.; Toft, B.S.

    1978-01-01

    Weanling rats were fed for 6 months on a diet deficient in essential fatty acids: either fat-free, or with 28% (w/w) partially hydrogenated fish oil. Control rats were fed a diet with 28% (w/w) arachis oil for 6 months. 15-Hydroxyprostaglandin dehydrogenase activity was determined as initial rates...... of the two groups on diets deficient in essential fatty acids as compared to the control group. No difference was observed in dehydrogenase activity in the kidneys. The dehydrogenase may be of importance for the regulation of the level of endogenous prostaglandins and, thus, a decrease in activity could...

  11. Synthesis and non-covalent functionalization of carbon nanotubes rings: new nanomaterials with lectin affinity

    International Nuclear Information System (INIS)

    Assali, Mohyeddin; Leal, Manuel Pernía; Khiar, Noureddine; Fernández, Inmaculada

    2013-01-01

    We present a mild and practical carbon nanotubes rings (CNRs) synthesis from non-covalent functionalized and water-soluble linear single-wall carbon nanotubes. The hemi-micellar–supramolecular self-organization of lactose-based glycolipid 1 on the ring surface, followed by photo-polymerization of the diacetylenic function triggered by UV light afforded the first water-soluble and biocompatible CNRs. The obtained donut-like nanoconstructs expose a high density of lactose moieties on their surface, and are able to engage specific interactions with Arachis hypogea lectin similar to glycoconjugates on the cell membrane. (paper)

  12. Food preferences of wild house-mice (Mus musclus L).

    Science.gov (United States)

    Rowe, F P; Bradfield, A; Redfern, R

    1974-12-01

    The relative acceptance of various plain foods by wild house-mice (Mus musculus L.) was compared in laboratory choice tests. The palatability of glycerine and six oils, each included at 5% in pinhead oatmeal, was compared in a similar manner.The most favoured food was found to be whole canary seed (Phalaris canariensis). Pinhead oatmeal and wheat were also comparatively well accepted. Glycerine, corn oil, arachis oil and mineral oil were more palatable than either olive, linseed or cod-liver oils.The results of the choice tests are considered in relation to the use of poison baits for the control of free-living mice.

  13. Food preferences of wild house-mice (Mus musculus L.)*

    Science.gov (United States)

    Rowe, F. P.; Bradfield, A.; Redfern, R.

    1974-01-01

    The relative acceptance of various plain foods by wild house-mice (Mus musculus L.) was compared in laboratory choice tests. The palatability of glycerine and six oils, each included at 5% in pinhead oatmeal, was compared in a similar manner. The most favoured food was found to be whole canary seed (Phalaris canariensis). Pinhead oatmeal and wheat were also comparatively well accepted. Glycerine, corn oil, arachis oil and mineral oil were more palatable than either olive, linseed or cod-liver oils. The results of the choice tests are considered in relation to the use of poison baits for the control of free-living mice. PMID:4531454

  14. Effects Total Solar Eclipse to Nasty Behaviour of the Several Legume Plants as a Result Student Research

    Science.gov (United States)

    Anggraeni, S.; Diana, S.; Supriatno, B.

    2017-09-01

    Some group students of plant Physiology course have given task to do free inquiry. They investigated of the nasty behaviour of several legume plants in response to changes in light during the partial solar eclipse that occurred at March 9, 2016. The investigation carried out in UPI Bandung, West Java, Indonesia, which is in the penumbra region of a total solar eclipse with the location coordinates of latitude: -6.86105, longitude: 07.59071, S 6057’ 37.53553 “and E 107035’ 24.29141”. They were measuring the movement of opening leaves every ten minutes at the beginning of the start until the end of the eclipse compared with the behaviour without eclipsing. Influence is expressed by comparing the leaf opening movement (measured in the form of leaf angular) at the time of the eclipse with a normal day. Each group was observed for one plant of the legume, there are: Mimosa pudica, Bauhinia purpurea, Caesalpinia pulcherrima, and Arachis pintoi. The results showed that the changes in leaf angular in plants Mimosa pudica, Caesalpinia pulcherrima, and Arachis pintoi differently significant, except for Bauhinia purpurea. In conclusion, the total solar eclipse in the penumbra area affects the movement of some nasty legume plants. It is recommended to conduct a study of the nasty behaviour of legume plants in the area umbra in the path of a total solar eclipse.

  15. Genome-wide analysis of basic/helix-loop-helix gene family in peanut and assessment of its roles in pod development.

    Directory of Open Access Journals (Sweden)

    Chao Gao

    Full Text Available The basic/helix-loop-helix (bHLH proteins constitute a superfamily of transcription factors that are known to play a range of regulatory roles in eukaryotes. Over the past few decades, many bHLH family genes have been well-characterized in model plants, such as Arabidopsis, rice and tomato. However, the bHLH protein family in peanuts has not yet been systematically identified and characterized. Here, 132 and 129 bHLH proteins were identified from two wild ancestral diploid subgenomes of cultivated tetraploid peanuts, Arachis duranensis (AA and Arachis ipaensis (BB, respectively. Phylogenetic analysis indicated that these bHLHs could be classified into 19 subfamilies. Distribution mapping results showed that peanut bHLH genes were randomly and unevenly distributed within the 10 AA chromosomes and 10 BB chromosomes. In addition, 120 bHLH gene pairs between the AA-subgenome and BB-subgenome were found to be orthologous and 101 of these pairs were highly syntenic in AA and BB chromosomes. Furthermore, we confirmed that 184 bHLH genes expressed in different tissues, 22 of which exhibited tissue-specific expression. Meanwhile, we identified 61 bHLH genes that may be potentially involved in peanut-specific subterranean. Our comprehensive genomic analysis provides a foundation for future functional dissection and understanding of the regulatory mechanisms of bHLH transcription factors in peanuts.

  16. Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco.

    Science.gov (United States)

    Shukla, Pawan; Singh, Naveen Kumar; Kumar, Dilip; Vijayan, Sambasivam; Ahmed, Israr; Kirti, Pulugurtha Bharadwaja

    2014-06-01

    Usable male sterility systems have immense potential in developing hybrid varieties in crop plants, which can also be used as a biological safety containment to prevent horizontal transgene flow. Barnase-Barstar system developed earlier was the first approach to engineer male sterility in plants. In an analogous situation, we have evolved a system of inducing pollen abortion and male sterility in transgenic tobacco by expressing a plant gene coding for a protein with known developmental function in contrast to the Barnase-Barstar system, which deploys genes of prokaryotic origin, i.e., from Bacillus amyloliquefaciens. We have used a plant pathogen-induced gene, cysteine protease for inducing male sterility. This gene was identified in the wild peanut, Arachis diogoi differentially expressed when it was challenged with the late leaf spot pathogen, Phaeoisariopsis personata. Arachis diogoi cysteine protease (AdCP) was expressed under the strong tapetum-specific promoter (TA29) and tobacco transformants were generated. Morphological and histological analysis of AdCP transgenic plants showed ablated tapetum and complete pollen abortion in three transgenic lines. Furthermore, transcript analysis displayed the expression of cysteine protease in these male sterile lines and the expression of the protein was identified in western blot analysis using its polyclonal antibody raised in the rabbit system.

  17. Biomass accumulation and chemical composition of Massai grass intercropped with forage legumes on an integrated crop-livestock-forest system

    Directory of Open Access Journals (Sweden)

    Tatiana da Costa Moreno Gama

    2014-06-01

    Full Text Available The objective was to evaluate the use of woody legumes (Albizia lebbeck, Cratylia argentea, Dipteryx Allata (Baru, a Leucaena hybrid (L. leucocephala + L. diversifolia, and Leucaena leucocephalacv. Cunningham and herbaceous legumes (Arachis pintoi intercropped with Panicum maximum cv. Massai, simultaneously implanted in a maize crop. The study made use of a randomized block experimental design with four replications. Assessments of biomass accumulation and forage nutritional value were made after the maize harvest, between June 2008 and October 2010. It was found that the residues of maize provided better growing conditions for Massai grass during the dry season. L. leucocephala cv. Cunningham and the Leucaena hybrid had the highest accumulation of all forage legumes evaluated, and provided the best nutritional value of all the arrangements tested. Of all woody legumes tested in this system, Leucaena was considered feasible for intercropping with Massai grass. The intercrop of perennial woody Baru with maize is not recommended. Albizia lebbeck and Cratylia argentea require further study, especially the yield assessment at different cutting intervals and cutting heights. Arachis pintoi had a low participation in the intercropping, showing greater performance over time, indicating slow thriving in this experimental condition.

  18. Weed supression by smother crops and selective herbicides

    Directory of Open Access Journals (Sweden)

    Severino Francisco José

    2004-01-01

    Full Text Available Using a smother crop is thought to suppress weed density and to add other beneficial effects in sustainable agricultural systems. Weed suppression ought to be considered an essential component of integrated weed management. However, very little is known about the effects of green manure plants on weeds. This study evaluated the influence of three green manure species on weed suppression and selectivity of herbicides. A field experiment was designed to determine the effect of the green manure species Crotalaria juncea, Arachis pintoi and pigeon pea on the weeds Brachiaria decumbens, guineagrass and hairy beggarticks, and on the natural weed infestation in the inter rows area of an avocado orchard. The weed species were suppressed differently by each green manure species. Soil samples collected from the field experiment presented a residual effect, of at least 30 d, in suppressing weed seed bank recruitment; this residual effect was caused by the residues of the green manure present in the soil. When the green manure was incorporated into the top 5 cm of soil or left on the surface, in a greenhouse experiment, the emergence of weed seeds was significantly inhibited, depending on the species, and on the amount and depth of green manure incorporation. Greenhouse experiments indicate that pre-emergence herbicides cause lower phytotoxicity than post-emergence Arachis pintoi. Smother crops using green manure species, when well established in an area, provide additional weed control to the cropping system and are effective and valuable tools in integrated weed management.

  19. Genetic diversity of the forage peanut in the Jequitinhonha, São Francisco, and Paranã River valleys of Brazil.

    Science.gov (United States)

    Azêvedo, H S F S; Sousa, A C B; Martins, K; Oliveira, J C; Yomura, R B T; Silva, L M; Valls, J F M; Assis, G M L; Campos, T

    2016-09-09

    Arachis pintoi and A. repens are legumes with a high forage value that are used to feed ruminants in consortium systems. Not only do they increase the persistence and quality of pastures, they are also used for ornamental and green cover. The objective of this study was to analyze microsatellite markers in order to access the genetic diversity of 65 forage peanut germplasm accessions in the section Caulorrhizae of the genus Arachis in the Jequitinhonha, São Francisco and Paranã River valleys of Brazil. Fifty-seven accessions of A. pintoi and eight of A. repens were analyzed using 17 microsatellites, and the observed heterozygosity (H O ), expected heterozygosity (H E ), number of alleles per locus, discriminatory power, and polymorphism information content were all estimated. Ten loci (58.8%) were polymorphic, and 125 alleles were found in total. The H E ranged from 0.30 to 0.94, and H O values ranged from 0.03 to 0.88. By using Bayesian analysis, the accessions were genetically differentiated into three gene pools. Neither the unweighted pair group method with arithmetic mean nor a neighbor-joining analysis clustered samples into species, origin, or collection area. These results reveal a very weak genetic structure that does not form defined clusters, and that there is a high degree of similarity between the two species.

  20. Effect of Pollen Feed on Parasitization and Predatism of Cephalonomia stephanoderis onHypothenemus hampei

    Directory of Open Access Journals (Sweden)

    Dwi Suci Rahayu

    2014-05-01

    Full Text Available Biological control of the coffee berry borer (Hypothenemus hampeiusing parasitoid Cephalonomia stephanoderishas been developed through the improvement of the parasitoid role may using pollens as feed source. The objective of this study was to investigate the effect of cover crop and weed pollens on parasitization and predatism of C. stephanoderis.The applied treatments were pollens of Turnera ulmifolia, Arachis pintoi, Ageratum conyzoidesadded in glass tube that consist of 10 CBB pupaes and a mated female of C. stephanoderis. Number of pupae parasitized and pupae preyed were observed. The result showed that addition of A. Pintoi pollen increased the number of pupae parasitized at 135% whereas addition of T. ulmifolia and A. conyzoides pollens did not affect parasitization of C. Stephanoderis. The predatismof C. stephanoderiswas higher than parasitization to pupae of H. hampei which showed that the behavior of C. stephanoderiswas parasitization. Addition of T. ulmifolia, A. pintoi, and A. conyzoidespollens increased the number of pupae predatism at 132%, 102%, and 225%, respectively. Key words: Ageratum conyzoides, Arachis pintoi, Cephalonomia stephanoderis, Hypothenemus hampei,parasitization, predatism, pollens, Turnera ulmifolia

  1. Velocidade de estabelecimento de acessos de amendoim forrageiro na Amazônia Ocidental Speed of establishment of accessions of forage peanut in the Western Amazon

    Directory of Open Access Journals (Sweden)

    Judson Ferreira Valentim

    2003-12-01

    Full Text Available O objetivo deste estudo foi avaliar a velocidade de estabelecimento de acessos de amendoim forrageiro (Arachis repens e Arachis pintoi, visando selecionar materiais adaptados aos sistemas intensivos de produção pecuária do Acre. O delineamento experimental utilizado foi de blocos casualizados, com quatro repetições. Os tratamentos consistiram de dois acessos de A. repens, sete acessos e duas cultivares de Arachis pintoi identificados como promissores para as condições ambientais de Rio Branco, Acre. Foi adotado como testemunha A. pintoi cv. Amarillo. Os acessos Ap 65, Ap 39 e Ar 10, com desempenho semelhante às cultivares Amarillo e Belmonte, destacaram-se por apresentar excelente velocidade de estabelecimento, com índice de sobrevivência das mudas e cobertura do solo superiores a 80% e comprimento dos estolões acima de 85 cm, respectivamente, aos 50, 70 e 120 dias após o plantio. Estes genótipos apresentaram produtividade de matéria seca (MS superior a 2.300 kg/ha, taxas de acúmulo de MS iguais ou superiores a 20 kg/ha/dia e teor de proteína bruta variando entre 17,9 e 21,7%, no final do período de estabelecimento. Entre os quatro grupos heteróticos, o formado pelo acesso Ap 39 destacou-se dos demais, por apresentar valores médios a altos para todas as características avaliadas, de acordo com a análise de agrupamento realizada pelo Método de Otimização de Tocher, com base na distância generalizada de Mahalanobis. Para que os materiais promissores possam ser recomendados para uso nos sistemas intensivos de produção de bovinos no Acre, devem ser desenvolvidos estudos adicionais com relação à: 1 produtividade e qualidade de MS nos períodos chuvoso e seco; 2 ocorrência de pragas e doenças; 3 produção de sementes; 4 adaptação a solos de baixa permeabilidade; 5 compatibilidade com gramíneas forrageiras e espécies arbóreas e arbustivas perenes; 6 produção animal e persistência sob pastejo.The objective of

  2. Produção de mudas de espécies forrageiras no sistema hidropônico de leito flutuante (floating com solução nutritiva à base de biofertilizante ou adubo solúvel = Production of seedlings of forage species in floating hydroponics system with biofertilizer or soluble fertilizer

    Directory of Open Access Journals (Sweden)

    Ricardo Probst

    2009-10-01

    Full Text Available Neste trabalho objetivou-se avaliar a sobrevivência das estacas e a produção de matéria seca na fase de cultivo de mudas das espécies forrageiras missioneira gigante (Axonopus catharinensis, amendoim forrageiro (Arachis pintoi e maku (Lotus uliginosus cv. Maku. No sistema hidropônico de leito flutuante com solução nutritiva à base de biofertilizante ou adubo solúvel. O delineamento experimental adotado foi o de blocos ao acaso em esquema fatorial 3 x 2, sendo três espécies forrageiras e duas soluções nutritivas. As espécies não apresentaram diferença quanto à sobrevivência (p = 0,225, independentemente do tipo de fertilizante (p = 0,92. No entanto, quando se quantificou a produção de MS planta-1 proporcionada por cada uma dessas espécies, o maku (p = 0,001 obteve as maiores quantidades (47,18 g, enquanto o amendoim forrageiro (19,90 g e a missioneira gigante (16,81 g foram semelhantes entre si (p = 0,227, tendo o mesmo ocorrido entre os fertilizantes (p = 0,559. Deste modo, as três espécies possuem condições semelhantes de sobrevivência, independentemente da concentração de nutrientes da solução nutritiva, com o maku proporcionando a maior produção de MS planta-1.The aim of this work was to evaluate the survival and dry matter production during the seedling culture phase of three forage species: Axonopus catharinensis, forage peanut (Arachis pintoi, and greater lotus (Lotus uliginosus cv. Maku, in a floating hydroponic system using biofertilizer or soluble fertilizer. The experimental design adopted was randomized blocks in a 3 x 2 factorial scheme, with three forage species and two fertilizers. There was no difference between species with regard to survival (p = 0.225, regardless of the fertilizer used (p = 0.92. However, when dry matter production was considered, Maku (P=0,001 showed greater weight (47.18 g, while there was no difference (p = 0.227 in weight between Arachis pintoi (19.90 g and Axonopus

  3. Amendoins silvestres para uso ornamental.

    Directory of Open Access Journals (Sweden)

    Renato Ferraz de Arruda Veiga

    2003-06-01

    Full Text Available Algumas espécies silvestres de amendoim (Arachis spp. gênero Arachis L. (Fabaceae, vêm sendo utilizadas como forração em jardins no Brasil, porém todas com pouca variabilidade já que a distribuição do germoplasma é feita sempre pelos mesmos acessos4. Por outro lado, inúmeras coletas têm sido realizadas, particularmente pela Embrapa Recursos Genéticos e Biotecnologia (Cenargen, disponibilizando acessos até então inacessíveis à pesquisa científica. Em virtude dessa nova disponibilidade e igualmente de híbridos resultantes de pesquisas do Cenargen, organizou-se este trabalho. Foram objeto desta pesquisa cinco espécies: A. glabrata Benth., A. helodes Mart. ex Krapov.& Rigoni, A. pintoi‘Krapov.& W.C.Gregory, A. repens Handro e A. kempff-mercadoi Krapov.,W.C.Gregory & C.E.Simpson, e seis híbridos originados dos paternais: A. appressipila Krapov.&W.C.Gregory, A. paraguariensis Chodat & Hassl., A. pintoi, A. repens e A. vallsi Krapov.& W.C.Gregoryi. O experimento foi desenvolvido no período dos anos agrícolas de 1998 a 2000, na Fazenda Santa Elisa do Instituto Agronômico (IAC, em Campinas (SP, anotando-se o número de flores por planta, a velocidade de desenvolvimento, a capacidade de cobertura do solo, aspectos ornamentais como exuberância das flores e folíolos, coloração e, ainda, sanidade e vigor dos acessos. Os híbridos apresentaram um bom comportamento, porém com ciclo anual, ao passo que os acessos de Arachis kempffmercadoi, A.helodes, A. repens e A. glabrata mostraram-se mais recomendáveis para o uso em jardins por serem perenes. Todos os acessos ficam mais bonitos no verão em razão do período de floração e graças ao verde de sua massa foliar.

  4. Ação do paradiclorobenzeno sôbre os cromossômios somáticos

    Directory of Open Access Journals (Sweden)

    Cândida H. T. Mendes Conagin

    1950-01-01

    Full Text Available Neste trabalho são apresentados os resultados obtidos com Coffea arabica, Allium cepa, Arachis prostrata e Aloë sp., pela aplicação do processo Meyer para o estudo dos cromossômios somáticos. Em linhas gerais, o processo consta das seguintes fases : a tratamento de raízes por uma solução saturada de paradiclorobenzeno ; b fixação em Carnoy ; c hidrólise em HCl a 10%, a 60°C durante dois minutos ; d lavagens em água destilada ; e lavagens em ácido acético a 45% ; f coloração dos esfregaços pela orceína acética. Em virtude dêsse tratamento, os cromossômios se contraem e se apresentam bem separados nas placas metafásicas, sendo facilitada a sua determinação numérica. As constrições, a duplicidade e os satélites nos cromossômios, ficam também postos em evidência. Trata-se de um processo que pode substituir, com a vantagem da rapidez, o processo lento, de exame dos cromossômios somáticos por meio de cortes de material incluído em parafina, nas espécies estudadas.The effects of a prefixation treatment with paradichlorobenzene on the somatic chromosomes of Coffea arabica, Allium cepa, Arachis prostrata and Aloë sp. have been studied. The following schedule was followed for treating root tips : a prefixation in a solution of paradichlorobenzene ; b fixation in Carnoy ; c hydrolisis in 10 per cent HCI for two minutes at 60°C ; d washing in distilled water ; e washing in 45 per cent acetic acid ; f smearing and staining in aceto-orcein. Good smears were obtained with root tips of Coffea arabica, Allium cepa and Aloe sp. The chromosomes of Coffea arabica were well scattered in the cells. The long chromosomes of Allium cepa and Aloe sp. were also well separated from each other. No difference in the chromosomes was noticed in smears made from paradichlorobenzene treated and untreated root tips of Arachis prostrata. This technique can substitute the paraffin method to advantage for counting chromosome number in root tip

  5. Produção de mudas de espécies forrageiras no sistema hidropônico de leito flutuante (floating com solução nutritiva à base de biofertilizante ou adubo solúvel - DOI: 10.4025/actascianimsci.v31i4.4290 Production of seedlings of forage species in floating hydroponics system with biofertilizer or soluble fertilizer - DOI: 10.4025/actascianimsci.v31i4.7459

    Directory of Open Access Journals (Sweden)

    Júlio Graeff Erpen

    2009-10-01

    Full Text Available Neste trabalho objetivou-se avaliar a sobrevivência das estacas e a produção de matéria seca na fase de cultivo de mudas das espécies forrageiras missioneira gigante (Axonopus catharinensis, amendoim forrageiro (Arachis pintoi e maku (Lotus uliginosus cv. Maku. No sistema hidropônico de leito flutuante com solução nutritiva à base de biofertilizante ou adubo solúvel. O delineamento experimental adotado foi o de blocos ao acaso em esquema fatorial 3 x 2, sendo três espécies forrageiras e duas soluções nutritivas. As espécies não apresentaram diferença quanto à sobrevivência (p = 0,225, independentemente do tipo de fertilizante (p = 0,92. No entanto, quando se quantificou a produção de MS planta-1 proporcionada por cada uma dessas espécies, o maku (p = 0,001 obteve as maiores quantidades (47,18 g, enquanto o amendoim forrageiro (19,90 g e a missioneira gigante (16,81 g foram semelhantes entre si (p = 0,227, tendo o mesmo ocorrido entre os fertilizantes (p = 0,559. Deste modo, as três espécies possuem condições semelhantes de sobrevivência, independentemente da concentração de nutrientes da solução nutritiva, com o maku proporcionando a maior produção de MS planta-1.Production of seedlings of forage species in floating hydroponics system with biofertilizer or soluble fertilizer. The aim of this work was to evaluate the survival and dry matter production during the seedling culture phase of three forage species: Axonopus catharinensis, forage peanut (Arachis pintoi, and greater lotus (Lotus uliginosus cv. Maku, in a floating hydroponic system using biofertilizer or soluble fertilizer. The experimental design adopted was randomized blocks in a 3 x 2 factorial scheme, with three forage species and two fertilizers. There was no difference between species with regard to survival (p = 0.225, regardless of the fertilizer used (p = 0.92. However, when dry matter production was considered, Maku (p = 0,001 showed greater

  6. Two new aflatoxin producing species, and an overview of Aspergillus section Flavi

    DEFF Research Database (Denmark)

    Varga, J.; Frisvad, Jens Christian; Samson, R. A.

    2011-01-01

    this section. The data indicate that Aspergillus section Flavi involves 22 species, which can be grouped into seven clades. Two new species, A. pseudocaelatus sp. nov. and A. pseudonomius sp. nov. have been discovered, and can be distinguished from other species in this section based on sequence data...... and extrolite profiles. Aspergillus pseudocaelatus is represented by a single isolate collected from Arachis burkartii leaf in Argentina, is closely related to the non-aflatoxin producing A. caelatus, and produces aflatoxins B & G, cyclopiazonic acid and kojic acid, while A. pseudonomius was isolated from...... insects and soil in the USA. This species is related to A. nomius, and produces aflatoxin B-1 (but not G-type aflatoxins), chrysogine and kojic acid. In order to prove the aflatoxin producing abilities of the isolates, phylogenetic analysis of three genes taking part in aflatoxin biosynthesis, including...

  7. Antimicrobial and antioxidant activities of Cortex Magnoliae Officinalis and some other medicinal plants commonly used in South-East Asia

    Directory of Open Access Journals (Sweden)

    Weng Wanyu

    2008-11-01

    Full Text Available Abstract Background Eight medicinal plants were tested for their antimicrobial and antioxidant activities. Different extraction methods were also tested for their effects on the bioactivities of the medicinal plants. Methods Eight plants, namely Herba Polygonis Hydropiperis (Laliaocao, Folium Murraya Koenigii (Jialiye, Rhizoma Arachis Hypogea (Huashenggen, Herba Houttuyniae (Yuxingcao, Epipremnum pinnatum (Pashulong, Rhizoma Typhonium Flagelliforme (Laoshuyu, Cortex Magnoliae Officinalis (Houpo and Rhizoma Imperatae (Baimaogen were investigated for their potential antimicrobial and antioxidant properties. Results Extracts of Cortex Magnoliae Officinalis had the strongest activities against M. Smegmatis, C. albicans, B. subtilis and S. aureus. Boiled extracts of Cortex Magnoliae Officinalis, Folium Murraya Koenigii, Herba Polygonis Hydropiperis and Herba Houttuyniae demonstrated greater antioxidant activities than other tested medicinal plants. Conclusion Among the eight tested medicinal plants, Cortex Magnoliae Officinalis showed the highest antimicrobial and antioxidant activities. Different methods of extraction yield different spectra of bioactivities.

  8. Increased concentration of vasopressin in plasma of essential fatty acid-deficient rats

    DEFF Research Database (Denmark)

    Hansen, Harald S.; Jensen, B.; Warberg, J.

    1985-01-01

    The effect of essential fatty acid deficiency (EFA-D) on the plasma concentration of arginine-vasopressin (AVP) and the urinary AVP excretion was investigated. Weanling rats were fed a fat-free diet (FF-rats). Control rats received the same diet in which 6% by wt. of sucrose was replaced by arachis...... oil. After 4-6 weeks of feeding, urine and plasma were analysed for AVP, osmolality, sodium and potassium. When compared to control rats FF-rats had decreased urine volume (6.0 ± 1.6 ml/24 hr versus 11.7 ± 3.2 ml/24 hr), increased urine osmolality (2409 ± 691 mOsm/kg versus 1260 ± 434 m...

  9. Decomposição e liberação de nutrientes de resíduos culturais de plantas de cobertura em argissolo vermelho-amarelo na região noroeste Fluminense (RJ Decomposition and nutrient release from cover crop residues in passion-fruit plantation

    Directory of Open Access Journals (Sweden)

    Antonio Carlos da Gama-Rodrigues

    2007-12-01

    Full Text Available A decomposição pode assumir importante papel no manejo da fertilidade do solo, possibilitando a elaboração de técnicas de cultivo que melhorem a utilização de nutrientes contidos nos resíduos vegetais. O objetivo deste trabalho foi estimar as taxas de decomposição e liberação de C, N, P, K, Ca e Mg de resíduos culturais provenientes de plantas de coberturas na cultura do maracujá. As espécies avaliadas foram feijão-de-porco (Canavalia ensiformis, amendoim forrageiro acesso CIAT 1734 (Arachis pintoi, siratro (Macroptilium atropurpureum, cudzu tropical (Pueraria phaseoloides e Brachiaria brizantha. A decomposição dos resíduos culturais, colocados em sacos de malha de 2 mm, foi avaliada durante 140 dias. O modelo que proporcionou melhor ajuste foi o exponencial de primeira ordem. O feijão-de-porco e o amendoim forrageiro apresentaram as maiores taxas de decomposição de matéria seca, diferindo significativamente das demais coberturas vegetais. As taxas de liberação de C, N, P, Ca e Mg foram maiores no feijão-de-porco. O amendoim forrageiro apresentou a maior taxa de liberação de K. Para todas as coberturas vegetais, os maiores valores médios de taxa de liberação foram de K e polifenóis. As taxas de liberação de C, N, P, Ca e Mg estão associadas positivamente à taxa de decomposição da matéria seca. As taxas de decomposição de matéria seca e de liberação de C, de nutrientes e de polifenóis variaram em função da qualidade nutricional e orgânica do substrato referente ao início do estudo. As distintas taxas de decomposição e liberação de nutrientes das espécies estimadas mostraram o potencial de uso de resíduos vegetais como fonte de nutrientes na cultura do maracujá.Decomposition can assume an important role in soil fertility management, underlying techniques that optimize the use of nutrients of plant residues. The objective of this study was to estimate the decomposition rate and nutrient

  10. Effect of Meloidogyne arenaria and Mulch Type on Okra in Microplot Experiments.

    Science.gov (United States)

    Ritzinger, C H; McSorley, R; Gallaher, R N

    1998-12-01

    The effects of perennial peanut (Arachis glabrata) hay, an aged yard-waste compost (mainly woodchips), and a control treatment without amendment were determined on two population levels of root-knot (Melaidogyne arenaria) nematode over three consecutive years in field microplots. Okra (Hibiscus esculentus, susceptible to the root-knot nematode) and a rye (Secale cereale) cover crop (poor nematode host) were used in the summer and winter seasons, respectively. The organic amendment treatments affected plant growth parameters. In the first year, okra yields were greatest in peanut-amended plots. Yield differences with amendment treatment diminished in the second and third years. Okra plant height, total fruit weight, and fruit number were greater with the lower population level of the root-knot nematode. Residual levels of nutrients in soil were greater where root-knot nematode levels and damage were higher and plant growth was poor. Nutrient levels affected the growth of a subsequent rye cover crop.

  11. Antimicrobial and antioxidant activities of Cortex Magnoliae Officinalis and some other medicinal plants commonly used in South-East Asia

    Science.gov (United States)

    Chan, Lai Wah; Cheah, Emily LC; Saw, Constance LL; Weng, Wanyu; Heng, Paul WS

    2008-01-01

    Background Eight medicinal plants were tested for their antimicrobial and antioxidant activities. Different extraction methods were also tested for their effects on the bioactivities of the medicinal plants. Methods Eight plants, namely Herba Polygonis Hydropiperis (Laliaocao), Folium Murraya Koenigii (Jialiye), Rhizoma Arachis Hypogea (Huashenggen), Herba Houttuyniae (Yuxingcao), Epipremnum pinnatum (Pashulong), Rhizoma Typhonium Flagelliforme (Laoshuyu), Cortex Magnoliae Officinalis (Houpo) and Rhizoma Imperatae (Baimaogen) were investigated for their potential antimicrobial and antioxidant properties. Results Extracts of Cortex Magnoliae Officinalis had the strongest activities against M. Smegmatis, C. albicans, B. subtilis and S. aureus. Boiled extracts of Cortex Magnoliae Officinalis, Folium Murraya Koenigii, Herba Polygonis Hydropiperis and Herba Houttuyniae demonstrated greater antioxidant activities than other tested medicinal plants. Conclusion Among the eight tested medicinal plants, Cortex Magnoliae Officinalis showed the highest antimicrobial and antioxidant activities. Different methods of extraction yield different spectra of bioactivities. PMID:19038060

  12. Plantas de cobertura de solo como hospedeiras alternativas de Colletotrichum guaranicola Cover crops as intermediate hosts to Colletotrichum guaranicola

    Directory of Open Access Journals (Sweden)

    L.J. Mileo

    2006-12-01

    Full Text Available As plantas de cobertura de solo usadas para suprimir o crescimento de plantas daninhas podem hospedar fungos fitopatogênicos. Para testar essa hipótese, elaborou-se este trabalho com o objetivo de avaliar o comportamento de nove espécies de plantas como possíveis hospedeiras do fungo Colletotrichum guaranicola. O experimento foi conduzido em casa de vegetação sob delineamento inteiramente casualizado, com quatro repetições. Cada vaso com três plantas da mesma espécie representou uma unidade experimental. As espécies que constituíram os tratamentos foram: Arachis pintoi, Calopogonium mucunoides, Chamaecrista rotundifolia, Crotalaria striata, Desmodium ovalifolium, Flemingia congesta, Mucuna aterrima, Pueraria phaseoloides e Tephrosia candida. Quarenta dias após a semeadura, as plantas foram inoculadas com suspensão de esporos de C. guaranicola na concentração de 10(5 conídios mL¹, enquanto as plantas testemunhas receberam somente água. As plantas foram mantidas em câmara úmida por 48 horas. Diariamente, foram feitas observações por 15 dias após a inoculação, para visualizar sintomas da doença. As espécies que não apresentaram sintomas de C. guaranicola foram Arachis pintoi, Chamaecrista rotundifolia, Desmodium ovalifolium, Flemingia congesta e Tephrosia candida, e as que manifestaram sintomas após a inoculação foram Calopogonium mucunoides, Crotalaria striata, Mucuna aterrima e Pueraria phaseoloides, que podem ser fontes de inóculo do patógeno da antracnose para o guaranazeiro.Cover crops used to suppress weed growth can be intermediate hosts to phytopathogenic fungi. To test this hypothesis, nine species of cover crops were evaluated as hosts to Colletotrichum guaranicola. The experiment was arranged in a randomized design, with four replicates, and conducted under greenhouse conditions. Each vase with three plants of one species constituted one plot. The species treated were: Arachis pintoi, Calopogonium

  13. Influence of drying treatments on antioxidant capacity of forage legume leaves.

    Science.gov (United States)

    Sang, Saw Yei; Jamharee, Fazrina; Prasad, K Nagendra; Azlan, Azrina; Maliki, Nurzillah

    2014-05-01

    This study was aimed to investigate the antioxidant capacities of four common forage legume leaves namely, Arachis pintoi (Pintoi), Calapogonium mucunoides (Calapo), Centrosema pubescens (Centro), and Stylosanthes guanensis (Stylo). Two different drying methods (oven-drying and freeze-drying) were employed and antioxidant activities were determined by DPPH, Ferric Reducing Antioxidant Power (FRAP) and β-carotene bleaching assays. Total phenolic content (TPC) was determined using Folin-Ciocalteu assay. Freeze-dried extract showed the highest antioxidant activities by DPPH (EC50 values 1.17-2.13 mg/ml), FRAP (147.08-246.42 μM of Fe(2+)/g), and β-carotene bleaching (57.11-78.60%) compared to oven drying. Hence, freeze drying treatment could be considered useful in retention of antioxidant activity and phenolic content.

  14. Bromatologic composition of the herbaceous species of the Northeastern Brazil Caatinga Composição bromatológica de espécies herbáceas da caatinga

    Directory of Open Access Journals (Sweden)

    D.S. Silva

    2011-04-01

    Full Text Available The objective of this work was to evaluate the chemical composition of the pool and of four species of caatinga herbaceous vegetation in the rainy and dry seasons. The experiment was conducted in three selected shrub areas at different levels of conservation. Four samples of each species (Arachis pintoi, Boerhavia diffusa, Heliotropium ternatum, Aristida adscensionis were collected in each area and from a pool of species for determination of bromatologic composition. In the dry season, only the pool of species and the grass Aristida adscensionis were evaluated. There was a significant effect of the studied area on the chemical composition of all analyzed species. The nutrient content found in the dry matter (DM and the digestibility of the pool of species indicate that caatinga herbs presented improved quality in the rainy season. The qualitative variables of the studied species were most heterogeneous due to the variability found in caatinga. Conservation conditions in caatinga and season of the year influence bromatologic composition of the species Arachis pintoi, Boerhavia diffusa L., Heliotropium ternatum Vahl. Aristida adscensionis L. and of a pool of typical species found in Caatinga.Com o objetivo de avaliar a composição bromatológica do pool e de quatro espécies da vegetação herbácea da caatinga nos períodos chuvoso e seco foi conduzido um experimento em três áreas selecionadas de caatinga, com níveis diferenciados de conservação. Em cada área, foram colhidas quatro amostras de cada espécie (Arachis pintoi, Boerhavia diffusa, Heliotropium ternatum, Aristida adscensionis e de um pool de espécies, para determinação da composição bromatológica. Na época seca foram avaliados somente o pool de espécies e a gramínea Aristida adscensionis. Houve efeito significativo da área amostrada na composição bromatológica de todas as espécies analisadas. Os teores de nutrientes na matéria seca (MS e a digestibilidade do pool

  15. Recovery of hillside soils, degraded by the erosion, by means of the use of biological-forest procedures

    International Nuclear Information System (INIS)

    Leon Moreno, Clara Esperanza

    1998-01-01

    Soil degradation is present in some areas of the Guanenta Comunero province in Andean Region of Colombia. Different responsible factors are identified: inadequate soil management (tilling in slope direction), machinery overuse and monoculture without natural cover. This carried out erosion that is severe in 40% of the affected area with furrows, gullies and barrens occurrence. For prevent the erosion were built wood barriers, established whit gramineous, leguminous and trees. The gramineous, Brachiaria decumbens was established using seeds a live material, which produced 1860, and 1631 kg/ha of dry material respectively. Arachis pintoi established like protein bank and in association reached a soil coverage of 87 % and improved disposability of Ca, Mg, K and P. farmers can easily build wooden barriers and them can retain sediments un amounts of 4.72, 23.43 and 1.50 m 3 in areas of 207,494 and 129 m 2 respectively

  16. Roughage digestion evaluation in horses with total feces collection and mobile nylon bags

    Directory of Open Access Journals (Sweden)

    Liziana Maria Rodrigues

    2012-02-01

    Full Text Available This study aimed to evaluate the nutrient digestibility of roughages in horses with total feces collection and mobile bags. Two trials were carried out simultaneously. The first trial evaluated the digestibility of nutrients of coastcross hay (Cynodon dactylon cv. coastcross with total feces collection. The second trial assessed the digestibility of nutrients of alfalfa hay (Medicago sativa, peanut (Arachis pintoi and coastcross hay with mobile bags. This trial was conducted with gastric insertions of nylon bags every 12 hours, and each bag contained 663 mg of feed samples in a proportion of 17 mg DM/cm². Feces and bags were collected directly from the stall floor immediately after excretion. There was no difference between the digestibility of dry matter, crude protein, carbohydrates and hydrolysable carbohydrates of coastcross hay estimated with feces collection and mobile bags. Forage peanut showed high nutrients digestibility, with values close to those observed with alfalfa, indicating potential for use in diets for horses.

  17. Produtividade de amendoim em função da calagem e do método de secagem Peanut yield as affected by liming and drying method

    Directory of Open Access Journals (Sweden)

    Elena Mercedes Fernandes

    1999-01-01

    Full Text Available Estudar o efeito da calagem e do método de secagem na produtividade do amendoim (Arachis hypogea L., cv. Botutatu foi o objetivo deste trabalho, conduzido num solo Latossolo Vermelho-Escuro, textura média, em São Manuel, São Paulo. Os tratamentos consistiram de ausência ou presença de calagem (2,05 Mg ha-1 e secagem à sombra, ao sol e duas formas combinadas desta última com estufa. A calagem eliminou a fitotoxicidade de manganês, melhorando a nodulação e a nutrição nitrogenada, que, conseqüentemente, levaram ao aumento do número de ramificações, de vagens por planta e da produtividade. Com a calagem, observou-se também redução nas perdas durante a colheita. Das formas de secagem, a realizada à sombra e a combinada campo-estufa foram as que proporcionaram maiores produtividades, por permitirem melhor maturação dos frutos e menores perdas na colheita.Peanut (Arachis hypogea L., cv. Botutatu was grown in a Dark Red Latosol (Haplortox, sandy loam in São Manuel, São Paulo, to study the effects of liming and drying method on grain yields. Treatments consisted of lime rates (0 and 2.05 Mg ha-1 and the drying methods: shadow, field and two combinations of field + oven. Manganese toxicity desapeared in limed plots, providing a better nodulation and N nutrition, which in turn, led to a higher plant branching, a higher number of fruits per plant and higher yields. Yield losses were lower in limed plots. The plots dried in the shadow and in the combined field + oven method yielded more than those field dried because they allowed a better fruit maturation and lower yield losses.

  18. Influência de variáveis químicas e estruturais do dossel sobre a taxa de ingestão instantânea em bovinos manejados em pastagens tropicais Influence of structural characteristics and chemical composition of tropical grasses on the instantaneous forage intake rate

    Directory of Open Access Journals (Sweden)

    Fabíola Cristine de Almeida Rego

    2006-06-01

    Full Text Available Avaliou-se a taxa de ingestão (TI em bovinos em pastagens exclusivas de Brachiaria brizantha, Panicum maximum cv. Tanzânia, Arachis pintoi e uma consorciação de Brachiaria brizantha com Arachis pintoi com o objetivo de selecionar as características estruturais e qualitativas da planta, de maior importância para estimativa da taxa de ingestão dos animais. Os animais pastejavam em pares, passando por todas as alturas e espécies em dias sucessivos. Após jejum de três horas, permaneciam por 60 minutos na área experimental, onde foram quantificados o tempo efetivo de pastejo e o número de bocados. A quantidade de forragem ingerida foi estimada pela técnica de dupla pesagem. As características estruturais da pastagem utilizadas na equação para determinar a TI foram altura média da pastagem (cm, proporção dos componentes morfológicos (%, massa dos componentes morfológicos (t MS/ha e densidade de matéria seca dos componentes morfológicos (kg MS/ha/cm. As características qualitativas foram expressas em termos de PB e de FDN. As variáveis da pastagem foram selecionadas pelo procedimento estatístico stepwise. As equações das TI, definidas a partir das características estudadas, foram: capim-marandu: TI = 59,8980 + 0,7299 LV + 3,5777 MF - 1,2459 FDNL + 0,2882 ALT (LV - proporção de lâminas verdes, MF - massa de forragem, FDNL - FDN de lâminas, ALT - altura média da pastagem. Capim-tanzânia: TI = 111,762 - 4,1532 PBL + 0,3469 LV - 0,5207 FDNL (PB de lâminas, LV - proporção de lâminas verdes, FDNL - FDN de lâminas. Amendoim forrageiro: TI = -196,589 + 12,1978 PBH + 8,3406 MF + 1,1060 HV + 17,3669 MLV (PBH - PB de HASTEs, MF - massa de forragem, DLV - massa de lâminas verdes. Consorciação: TI = -7,25 + 1,15ALTA - 0,22ALTI + 18,49MA - 9,88MLM + 0,49ALTM + 1,00PBL (ALTA - altura amendoim forrageiro, ALTI - altura de invasoras, MA - massa de amendoim forrageiro, MLM - massa de lâminas verdes de capim-marandu, ALTM

  19. Desempenho de fungos micorrízicos arbusculares na produção de mudas de maracujazeiro-amarelo, em diferentes substratos Arbuscular mycorrhizal fungi performance to produce mycorrhizal passionflower seedlings under different substrates

    Directory of Open Access Journals (Sweden)

    Adriana Parada Dias da Silveira

    2003-01-01

    Full Text Available O trabalho teve por objetivo selecionar fungos micorrízicos arbusculares (FMAs eficientes na promoção do crescimento de mudas de maracujazeiro-amarelo, em substrato esterilizado, com diferentes níveis de fertilidade, em função da adição ou não de matéria orgânica. Foram realizados três experimentos, em casa de vegetação. No primeiro, empregou-se como substrato uma mistura de 2:1:1 de areia, solo (Latossolo Vermelho Eutroférrico e esterco de curral; no segundo, uma mistura de 1:1 de solo e areia e no terceiro, uma mistura de 9:1 de solo e esterco de curral. Os FMAs empregados foram: Acaulospora sp.(IAC-13, Gigaspora margarita, Glomus sp (IAC-27, Acaulospora morrowae, Acaulospora sp. (IAC-44, Acaulospora scrobiculata, Scutellospora heterogama, Glomus clarum,Glomus sp. (IAC-28, Entrophospora colombiana, Glomus etunicatum e Glomus macrocarpum. No terceiro experimento, empregaram-se G. clarum, Glomus sp. (IAC-28, G. margarita, G. etunicatum e G. macrocarpum (IAC-50, uma mistura dessas espécies e populações de fungos nativos, oriundas de solo de uma cultura de maracujá estabelecida no campo e multiplicadas em Brachiaria decumbens, maracujazeiro e amendoinzeiro. Os efeitos positivos da micorrização foram maiores no substrato sem adição de matéria orgânica (esterco de curral, não superando, entretanto, o efeito da sua adição. G. clarum, G. etunicatum e G. margarita promoveram aumento significativo na produção de matéria seca. No substrato com adição de 25% de matéria orgânica, os fungos Acaulospora sp. (IAC- 44 e A. morrowae foram eficientes na promoção do desenvolvimento das mudas, com desempenho comparável ao Glomus sp. (IAC- 28 no substrato com adição de 10% de esterco de curral. G. clarum mostrou efeito parasítico, diminuindo o crescimento das plantas no substrato com 25% de matéria orgânica.The purpose of this study was to select effective arbuscular mycorrhizal fungi (AMF on the production of yellow

  20. Local wisdom of Cikondang village community in the utilization of medicinal plants

    Science.gov (United States)

    Mulyani, Y.; Munandar, A.; Nuraeni, E.

    2018-05-01

    This study aims to analyze local wisdom Cikondang community in the use of medicinal plants. This research used qualitative method with emic and ethical approach to explain the relationship of public knowledge about the type and utilization of medicinal plants in the view of science. Determination of respondents conducted by purposive sampling, taken 30% of the total respondent. The data of the knowledge of the use of medicinal plants obtained through interview techniques as many as 39 respondents. Cikondang people know 27 known medicinal plants and commonly used. Zingiberaceae family has a type that is more widely used as a medicinal plant. The most widely used plant part is leaf and medicinal plant processing which mostly done by boiling. The species with the highest value of use is owned by Curcuma longa L. with a value of 4.28, which states important species / priorities, while the species with the lowest SUV value is Aracchis hypogaea L. of 0.15, which states species are less important and can be replaced by other plants.

  1. Investigation of Stilbenoids as Potential Therapeutic Agents for Rotavirus Gastroenteritis

    Directory of Open Access Journals (Sweden)

    Judith M. Ball

    2015-01-01

    Full Text Available Rotavirus (RV infections cause severe diarrhea in infants and young children worldwide. Vaccines are available but cost prohibitive for many countries and only reduce severe symptoms. Vaccinated infants continue to shed infectious particles, and studies show decreased efficacy of the RV vaccines in tropical and subtropical countries where they are needed most. Continuing surveillance for new RV strains, assessment of vaccine efficacy, and development of cost effective antiviral drugs remain an important aspect of RV studies. This study was to determine the efficacy of antioxidant and anti-inflammatory stilbenoids to inhibit RV replication. Peanut (A. hypogaea hairy root cultures were induced to produce stilbenoids, which were purified by high performance countercurrent chromatography (HPCCC and analyzed by HPLC. HT29.f8 cells were infected with RV in the presence stilbenoids. Cell viability counts showed no cytotoxic effects on HT29.f8 cells. Viral infectivity titers were calculated and comparatively assessed to determine the effects of stilbenoid treatments. Two stilbenoids, trans-arachidin-1 and trans-arachidin-3, show a significant decrease in RV infectivity titers. Western blot analyses performed on the infected cell lysates complemented the infectivity titrations and indicated a significant decrease in viral replication. These studies show the therapeutic potential of the stilbenoids against RV replication.

  2. Perennial herbaceous legumes as live soil mulches and their effects on C, N and P of the microbial biomass Leguminosas herbáceas perenes como cobertura viva do solo e seu efeito no C, N e P da biomassa microbiana

    Directory of Open Access Journals (Sweden)

    Gustavo Pereira Duda

    2003-02-01

    Full Text Available The use of living mulch with legumes is increasing but the impact of this management technique on the soil microbial pool is not well known. In this work, the effect of different live mulches was evaluated in relation to the C, N and P pools of the microbial biomass, in a Typic Alfisol of Seropédica, RJ, Brazil. The field experiment was divided in two parts: the first, consisted of treatments set in a 2 x 2 x 4 factorial combination of the following factors: live mulch species (Arachis pintoi and Macroptilium atropurpureum, vegetation management after cutting (leaving residue as a mulch or residue remotion from the plots and four soil depths. The second part had treatments set in a 4 x 2 x 2 factorial combination of the following factors: absence of live mulch, A. pintoi, Pueraria phaseoloides, and M. atropurpureum, P levels (0 and 88 kg ha-1 and vegetation management after cutting. Variation of microbial C was not observed in relation to soil depth. However, the amount of microbial P and N, water soluble C, available C, and mineralizable C decreased with soil depth. Among the tested legumes, Arachis pintoi promoted an increase of microbial C and available C content of the soil, when compared to the other legume species (Pueraria phaseoloides and Macroptilium atropurpureum. Keeping the shoot as a mulch promoted an increase on soil content of microbial C and N, total organic C and N, and organic C fractions, indicating the importance of this practice to improve soil fertility.A adoção de práticas de cobertura do solo com leguminosas tem aumentado. Porém, o impacto desta prática sobre o compartimento microbiano ainda não é bem conhecido. Para avaliar o efeito de diferentes leguminosas, sobre o C, N e P da biomassa microbiana, coletaram-se amostras de Argissolo oriundas de um experimento sob condições de campo em Seropédica-RJ. O experimento foi subdividido em dois ensaios. No primeiro, os tratamentos corresponderam à combinação de tr

  3. Dissimilaridade de porta-enxertos da laranjeira 'folha murcha' sob dois sistemas de manejo de cobertura permanente do solo Divergence of 'folha murcha' orange tree rootstocks as influenced by two groundcover crops

    Directory of Open Access Journals (Sweden)

    Jonez Fidalski

    2007-04-01

    Full Text Available Os porta-enxertos de citros são dependentes do sistema de manejo do solo nas entrelinhas. Este trabalho foi realizado com o objetivo de identificar a dissimilaridade de sete porta-enxertos para a laranjeira 'Folha Murcha' em dois sistemas de manejo da cobertura de um Argissolo Vermelho distrófico latossólico. O estudo foi realizado na Estação Experimental do IAPAR, em Paranavaí. O delineamento experimental foi de blocos ao acaso com quatro repetições, com gramínea mato-grosso ou batatais (Paspalum notatum Flügge em três blocos e leguminosa amendoim forrageiro (Arachis pintoi Krap. & Greg. em um bloco. A produção, o desenvolvimento vegetativo e os nutrientes nas folhas da laranjeira 'Folha Murcha' foram avaliados anualmente (1997 a 2002. As análises multivariadas basearam-se nas variáveis canônicas e nos componentes principais, agrupando-os pelo método Tocher. O manejo da cobertura do solo com a leguminosa amendoim forrageiro Arachis pintoi diminui a dissimilaridade dos grupos de porta-enxertos da laranjeira 'Folha Murcha'. O manejo da cobertura do solo com a gramínea Paspalum notatum aumenta a dissimilaridade dos grupos de porta-enxertos da laranjeira 'Folha Murcha' com a inclusão dos teores dos nutrientes foliares, da produção de frutos e do desenvolvimento vegetativo das plantas. A gramínea Paspalum notatum é o melhor sistema de manejo da cobertura do solo para avaliação do comportamento de porta-enxertos da laranjeira 'Folha Murcha'.Citurs rootstocks are dependent of the growdcover management systems. This study aimed to identify the divergences of seven rootstocks for 'Folha Murcha' sweet orange trees in two groundcover management systems on a Paleudult. The study was performed at the IAPAR research station, in Paranavai, northwestern Paraná, Brazil. The experiment was in a complete random block design with threer replications for the bahiagrass (Paspalum notatum Flügge groundcover treatment and one replication for

  4. Influencia de la fertilización, la época y la especie forrajera en la presencia Influence of fertilization, season, and forage species in presence of arbuscular mycorrhizae in a degraded Andisoil of Colombia

    Directory of Open Access Journals (Sweden)

    Arnulfo Gómez-Carabalí

    2011-01-01

    Full Text Available Para determinar la influencia de la fertilización, época, y especies forrajeras en la producción de micorrizas arbusculares se realizó un experimento con una gramínea C4, (Brachiaria dictyoneura), dos leguminosas forrajeras C3 (Arachis pintoi y Centrosema macrocarpum) y la vegetación nativa; cultivadas en dos sistemas de siembra (monocultivo y asociación), dos niveles de fertilización (alto y bajo) y cuatro edades de cosecha. Se uso un diseño de parcelas sub-sub divididas, en el cual la parcela principal fue la especie, los niveles de fertilización como subparcelas y la edad de rebrote como la sub-sub parcela. El número de esporas de hongos micorrízicos en el suelo y el porcentaje de infección en las raíces se incrementó con la edad y varió con la especie y la época del muestreo (seca o húmeda). Se encontraron diferencias en la capacidad para formar simbiosis micorrízica entre las especies de gramíneas y leguminosas bajo condiciones de campo.In the Colombian coffee zone much of the land has infertile soils with an ongoing accelerated degradation. As vegetation has changed from forest to transitory base (cassava cropping) and overgrazed pastures, ground cover has decreased resulting in increasing runoff. These changes have contributed to severe erosion, decline in soil fertility, productivity, soil structure, and water quality as well as loss of biodiversity. A field study was conducted at the farm "La Esperanza" (Mondomo, Department of Cauca, Colombia, South-America). The main objective was to determine the influence of fertilization, season and forage species in Arbuscular Mycorrhyzae in a degraded Andisol. One C4 forage grass (Brachiaria dictyoneura) and two C3 forage legumes (Arachis pintoi and Centrosema macrocarpum) and native vegetation grown under two fertilization levels, cultivated either in monoculture or in association and harvested at four different ages were evaluated. The numbers of mycorrizal spores in the soil

  5. Produção orgânica de rabanete em plantio direto sobre cobertura morta e viva Organic cropping of radish in no-tillage under died and live mulching

    Directory of Open Access Journals (Sweden)

    Regina Lúcia F Ferreira

    2011-09-01

    Full Text Available O objetivo deste trabalho foi avaliar o uso de plantas espontâneas e cobertura viva de amendoim forrageiro (Arachis pintoi, associado à aplicação de composto orgânico na produção orgânica do rabanete em plantio direto. O experimento foi instalado na Universidade Federal do Acre, em Rio Branco-AC, de 15/06 a 14/07/2007. O delineamento experimental utilizado foi em blocos casualizados com parcelas subdivididas 4x3, em quatro repetições. As parcelas corresponderam ao sistema de plantio direto com cobertura viva de amendoim forrageiro, cobertura viva de planta espontânea, cobertura morta de planta espontânea e sistema de plantio em canteiro com solo descoberto. As subparcelas foram compostas pelas doses de composto orgânico de 5, 10 e 15 t ha-1 (base seca. O plantio direto na palha de plantas espontâneas teve desempenho semelhante ao preparo convencional do solo, ambos superiores ao plantio sobre as coberturas vivas. A produtividade do rabanete cv. Cometo, não foi afetada pelas doses crescentes de composto orgânico, podendo aplicar-se apenas 5 t ha-1, enquanto em preparo convencional do solo, o aumento da produtividade ultrapassa o plantio direto na palha apenas na dose maior de composto (15 t ha-1.The use of volunteer plants and live coverage of peanut (Arachis pintoi was evaluated, associating the application of organic compost in organic production of radish in no-till. The experiment was carried out at Federal University of Acre, in Rio Branco, Acre State, Brazil. A randomized complete block design with a split plot arrangement (4x3 and four replications was used. The plots consisted of the no-tillage systems with live coverage of peanut, with live coverage of spontaneous plants (weeds, with mulching of spontaneous plants, and conventional soil tillage with no-mulching soil. The subplots were composed of the doses of organic compost of 5, 10 and 15 t ha-1 in dry basis. The no-tillage with straw weed mulch had similar performance

  6. Lâminas de irrigação e coberturas do solo sobre a incidência da mancha fisiológica e produtividade do mamão "Golden" Irrigation dosages and soil coverings in the incidence of skin freckles and yield components of papaya ‘Golden’

    Directory of Open Access Journals (Sweden)

    Aroldo Gomes Filho

    2007-12-01

    Full Text Available Nesse experimento, avaliou-se o efeito de diferentes lâminas de irrigação e coberturas do solo sobre aspectos qualitativos e de produção do mamão cv. "Golden" no período de dezembro de 2003 a novembro de 2004. Utilizou-se delineamento em blocos casualizados, com três repetições, em esquema fatorial. Os resultados encontrados demonstram uma alta correlação entre a época de colheita com a incidência da mancha fisiológica e as variáveis de produção. Com relação à mancha fisiológica do mamão (MFM, confirmou-se o aspecto sazonal de incidência, sendo que a cv. "Golden" apresentou a maior incidência do distúrbio no mês de setembro. Com relação às coberturas de solo, a cobertura morta se mostrou promissora para os fatores em estudo, ao contrário da cobertura verde com a leguminosa Arachis pintoe, pois a mesma, provavelmente, competiu por água e nutrientes com o mamoeiro, acarretando, assim, redução na sua produtividade.In this experiment the effect of different irrigation rates and soil coverings on qualitative aspects as well as yield components of the papaya cv. ‘Golden’ during the period December 2003 to November 2004 were evaluated. A randomized complete block design was used with three replications in a factorial scheme. The results demonstrate high correlation involving the factors harvest season, incidence of skin freckles and yield components. With relation to skin freckles a seasonal incidence was confirmed, showing that for cv. ‘Golden’, the major incidence of the disturbance was verified in September. The mulching treatment was promising for the factors studied, in contrast to the green covering using the leguminosae Arachis pintoe, due to competition with the papaya trees for water and nutrients, causing a reduction in the yield components.

  7. Bananeiras consorciadas com leguminosas herbáceas perenes utilizadas como coberturas vivas Banana plants intercropped with perennial herbaceous legumes used as living mulches

    Directory of Open Access Journals (Sweden)

    José Antonio Azevedo Espindola

    2006-03-01

    Full Text Available O objetivo deste trabalho foi avaliar a produção de bananeiras consorciadas com as leguminosas herbáceas perenes - amendoim forrageiro (Arachis pintoi, cudzu tropical (Pueraria phaseoloides e siratro (Macroptilium atropurpureum. Os tratamentos-controle consistiram em vegetação espontânea com predomínio de Panicum maximum, e vegetação espontânea com adubação nitrogenada das bananeiras. Também foi avaliado o desenvolvimento vegetativo das bananeiras. Entre as coberturas avaliadas, a vegetação espontânea e o cudzu tropical apresentaram produções maiores de biomassa; o cudzu tropical proporcionou valores maiores para quantidades de N acumulado e derivado da fixação biológica. As leguminosas amendoim forrageiro, cudzu tropical e siratro proporcionaram desenvolvimento vegetativo mais rápido nas bananeiras consorciadas. Cudzu tropical e siratro promoveram maiores valores de peso dos cachos e das pencas. O uso das leguminosas avaliadas resulta em aumento da porcentagem de cachos colhidos e redução do tempo de colheita, além de proporcionar maior produtividade, quando comparado ao uso de vegetação espontânea.The objective of this work was to evaluate the yield of banana plants intercropped with the perennial herbaceous legumes forage groundnut (Arachis pintoi, tropical kudzu (Pueraria phaseoloides and siratro (Macroptilium atropurpureum. The control treatments were spontaneous vegetation (mainly Panicum maximum and spontaneous vegetation plus nitrogen fertilizer application to banana plants. The vegetative growth of banana plants was also evaluated. Among the treatments, spontaneous vegetation and tropical kudzu promoted the highest dry matter productions; tropical kudzu had the highest amounts of accumulated and fixed N. Forage groundnut, tropical kudzu and siratro promoted the fastest vegetative growth for banana plants in this intercropped system. Tropical kudzu and siratro promoted the highest values for bunch weight and

  8. SUKU FABACEAE DI KAMPUS UNIVERSITAS ISLAM NEGERI SYARIF HIDAYATULLAH, JAKARTA, BAGIAN 2: TUMBUHAN POLONG BERPERAWAKAN TERNA

    Directory of Open Access Journals (Sweden)

    Priyanti Priyanti

    2017-04-01

    Full Text Available Abstrak Suku Fabaceae adalah tetumbuhan yang memiliki buah bertipe polong. Suku tersebut selain berperawakan pohon juga berupa terna. Anggota suku Fabaceae (polong banyak ditemukan di sekitar lingkungan manusia termasuk di Kampus Universitas Islam Negeri (UIN Syarif Hidayatullah, Jakarta. Informasi mengenai keanekaragaman tumbuhan polong yang berupa terna di Kampus UIN Syarif Hidayatullah belum tersedia. Penelitian dilakukan menggunakan metode jelajah di kampus I dan II serta studi pustaka. Sebanyak 3 jenis tumbuhan polong berperawakan terna telah didapatkan di lingkungan kampus, yaitu Arachis pintoi Krapov. & W. C. Greg., Mimosa diplotricha C. Wright ex Sauvalle, dan M. pudica L. Jenis-jenis tersebut termasuk ke dalam 2 anak suku (Faboideae, Mimosoideae dan 2 puak (Aeschynomeneae, Mimoseae. Jenis-jenis tersebut tumbuh di lokasi yang berbeda-beda. Tumbuhan polong yang hanya ditemukan di Fakultas Kedokteran dan Ilmu Keshatan (FKIK adalah A. pintoi. Mimosa diplotricha ditemukan tumbuh di Pusat Laboratorium Terpadu Fakultas Sains dan Teknologi, Perpustakaan Utama, FKIK, Fakultas Sosial dan Ilmu Politik (FISIP, Wisma Syahida, Pusat Bahasa, dan Sekolah Pascasarjana, sedangkan M. pudica ditemukan Perpustakaan Utama, FISIP, dan Wisma Syahida. Kelengkapan data tentang tumbuhan polong di Kampus UIN Syarif Hidayatullah ini dapat digunakan oleh para mahasiswa untuk mempelajari keanekaragamnnya. Abstract Fabaceae is a plant with a pod-type fruit. A Habit of this family is not only trees but also herb. Fabaceae (legumes is often found on the human environment around campus included in the State Islamic University (UIN Syarif Hidayatullah, Jakarta. The Information about the legume herbs diversity on the UIN Syarif Hidayatullah yet available. The study was conducted using survey and literature methods. There were 3 species legume herbs in the campus, viz. Arachis pintoi Krapov. & W. C. Greg., Mimosa diplotricha C. Wright ex Sauvalle, and M. pudica L. All

  9. Perfil de n-alcanos em cinco espécies de plantas forrageiras tropicais - DOI: 10.4025/actascianimsci.v27i3.1207 Profile of n-alkanes in five species of plants tropical forages - DOI: 10.4025/actascianimsci.v27i3.1207

    Directory of Open Access Journals (Sweden)

    Antônio Ferriani Branco

    2005-03-01

    Full Text Available O objetivo do experimento foi estudar o perfil de n-alcanos em espécies de gramíneas (Brachiaria brizantha, Cynodon dactylon e Panicum maximum e leguminosas (Arachis pintoi e Glycine wightii. Foram identificados e quantificados por meio de cromatografia gasosa, os n-alcanos C24 a C35, sendo C32 e C34 padrões internos. As concentrações dos n-alcanos nas diferentes espécies e respectivas frações (lâminas foliares, colmos porções superior e inferior e matéria morta para gramíneas; folhas, caule porção superior e inferior e matéria morta para leguminosas foram submetidas à análise de variância e teste de média (Tukey. Nos períodos de primavera e inverno, para a maioria das espécies e frações, há predomínio dos n-alcanos de cadeia ímpar. Houve maior concentração de C29, C31 e C33 na primavera, C27, C28, C29, C30 e C31, no verão e C27, C29, C31 e C33 no invernoThis experiment aimed to study the profile of n-alkanes in tropical grasses species (Brachiaria brizantha, Cynodon dactylon and Panicum maximum and legumes (Arachis pintoi and Glycine wightii. They were identified and quantified, through gas cromatography, the n-alkanes C24 to C35, being the alkanes C32 and C34 internal indices. The n-alkanes concentrations in the different species and respective fractions (leaf blade, stem higher and lower portion and dead matter for grasses; leaves, stem higher portion, stem lower portion and dead matter for legumes were submitted to variance analysis and mean test (Tukey. For most of the species and fractions, there is prevalence of odd chain n-alkanes during springtime and winter. There was larger concentration of the alkanes C29, C31 and C33 in springtime, C27, C28, C29, C30 and C31 in summer and C27, C29, C31 and C33 in winter

  10. Potential Nitrification and Nitrogen Mineral of Soil in Coffee Agroforestry System with Various Shading Trees

    Directory of Open Access Journals (Sweden)

    Purwanto .

    2007-05-01

    Full Text Available The role of shading trees in coffee farms has been well understood to establish suitable condition for the growth of coffee trees, on the other hand their role in nitrogen cycle in coffee farming is not yet well understood. The objectives of this study are to investigate the influence of various legume shading trees on the concentration of soil mineral N (N-NH4 + and N-NO3-, potential nitrification and to study the controlling factors of nitrification under field conditions. This field explorative research was carried out in Sumberjaya, West Lampung. Twelve observation plots covered four land use systems (LUS, i.e. 1 Coffee agroforestry with Gliricidiasepium as shade trees; 2 Coffee agroforestry with Gliricidiaas shade trees and Arachis pintoias cover crops; 3Coffee agroforestry with Paraserianthes falcataria as shade trees; and 4 Mixed/multistrata coffee agroforestry with Gliricidiaand other fruit crops as shade trees. Measurements of soil mineral-N concentration were carried out every three weeks for three months. Results showed that shade tree species in coffee agroforestry significantly affected concentrations of soil NH4 +, NO3- and potential nitrification. Mixed coffee agroforestry had the highest NH4+/N-mineral ratio (7.16% and the lowest potential nitrification (0.13 mg NO2-kg-1 hour -1 compared to other coffee agroforestry systems using single species of leguminous shade trees. Ratio of NH4 + /N-mineral increased 0.8—21% while potential nitrification decreased 55—79% in mixed coffee agroforestry compared to coffee agroforestry with Gliricidia or P. falcatariaas shade trees. Coffee agroforestry with P. falcatariaas shade trees had potential nitrification 53% lower and ratio of NH4 + /N-mineral concentration 20% higher than that with Gliricidia. Coffee agroforestry with P. falcataria as shade trees also had organic C content 17% higher, total N 40% higher, available P 112% higher than that with Gliricidia. The presence of A. pintoiin

  11. Feijão-vagem semeado sobre cobertura viva perene de gramínea e leguminosa e em solo mobilizado, com adubação orgânica Snap bean planted on living perennial mulch of grass and legume and in tilled soil with organic amendment

    Directory of Open Access Journals (Sweden)

    Nelson Geraldo de Oliveira

    2006-09-01

    Full Text Available O objetivo deste trabalho foi avaliar o desempenho agronômico do feijão-vagem, cv. Alessa, cultivado sobre cobertura viva perene de grama-batatais (Paspalum notatum Flüggé e de amendoim forrageiro (Arachis pintoi Krapov & Gregory, e em solo convencionalmente preparado, como controle. Diferentes doses de cama de aviário (0, 7, 14 e 28 t ha-1 foram fornecidas, parceladamente, em um Planossolo, em Seropédica, RJ, de agosto a outubro de 2002. O delineamento adotado foi o de blocos ao acaso, dispostos em parcelas subdivididas, com quatro repetições, utilizando-se modelo quadrático para análise dos resultados. A produtividade de vagens foi semelhante nos três sistemas de cultivo sem efeito competitivo das espécies de cobertura viva, sobre as quais foi realizada a semeadura direta da cultura, com enxada. A produtividade máxima estimada pelo modelo de regressão foi 20,3 t ha-1 de vagens. Esse valor foi obtido com a dose de 26 t ha-1 de cama de aviário, aplicada de forma parcelada. A semeadura direta de feijão-vagem sobre cobertura viva perene de grama-batatais e de amendoim forrageiro é viável, com resultados preliminares positivos.The objective of this work was to evaluate the agronomic performance of snap bean planted on living perennial mulch of bahia grass (Paspalum notatum Flüggé and of peanut (Arachis pintoi Krapov & Gregory and in a conventional tillage soil as a control. Different parcels and doses of poultry bed manure (0, 7, 14 and 28 t ha-1 were used in a Planosol soil from August to October of 2002. The statistical design was a split plot, in completely randomized blocks, with four replications, using a quadratic model to analyze the results. Snap bean yield was similar for the tillage system treatments without competition effect from the living mulch, in which direct seeding of the main crop was performed with a hoe. The greatest snap bean yield estimated by regression model was 20.3 t ha-1, corresponding to the dose of

  12. Cultivo orgânico de coentro em plantio direto utilizando cobertura viva e morta adubado com composto Organic faming of coriander in no-tillage system fertilized with compost using dead and living mulching

    Directory of Open Access Journals (Sweden)

    Leonardo Barreto Tavella

    2010-12-01

    Full Text Available O objetivo deste trabalho foi avaliar o desempenho agronômico do coentro em sistema de plantio direto orgânico sob diferentes tipos de cobertura viva e palhada e doses crescentes de composto orgânico. Foi utilizado o delineamento em blocos aleatorizados em esquema de parcela subdividida com quatro repetições. As parcelas corresponderam aos sistemas de plantio direto com cobertura viva de Arachis pintoi, cobertura viva de plantas espontâneas e cobertura com palhada de resteva natural que foram comparados ao preparo convencional do solo com canteiro e sem cobertura. As subparcelas representavam as doses residuais de composto orgânico 10; 20 e 30 t ha-1 (base seca. O sistema de plantio direto com palhada de resteva natural e o preparo convencional proporcionaram os melhores resultados em todas as variáveis avaliadas na planta, comparado com os sistemas de plantio direto com cobertura viva de amendoim forrageiro e plantas espontâneas. O coentro respondeu linearmente a adubação orgânica, com produtividade de 4.554 t ha-1 a 6.542 t ha-1 quando adubado de 10 a 30 t ha-1, respectivamente.The objective of this work was to evaluate the agronomic behavior of the cilantro in organic no-tillage system under alive and dead mulching and fertilized with doses of compost. The experimental design was randomized blocks, in a split-plot arrangement with four replications. The plot corresponded to the planting system (no-tillage with live mulching of Arachis pintoi, with live mulching of native weed, with mulching of straw and conventional tillage. In each plot the split-plot were represented by the doses of organic compost 10; 20 e 30 t ha-1 of dry compost. The no-tillage system with straw and conventional tillage showed the best results in all variables in the plant compared with no-tillage systems with live mulching of peanut crop and native weed. Cilantro answered linearly to fertilization, with yields of 4,554 t ha-1 to 6,542 t ha-1 when fertilized

  13. The use of dilute calogen[reg] as a fat density oral contrast medium in upper abdominal computed tomography, compared with the use of water and positive oral contrast media

    International Nuclear Information System (INIS)

    Ramsay, Duncan W.; Markham, Derrian H.; Morgan, Bruno; Rodgers, Peter M.; Liddicoat, Amanda J.

    2001-01-01

    AIM: Oral contrast media are commonly given prior to computed tomography (CT) examination of the upper abdomen. Although positive oral contrast media are normally used, there is increasing interest in using negative agents such as water and less commonly fat density products. The aim of this study was to compare a positive oral contrast medium, water, and a diluted emulsion of arachis oil (Calogen[reg], a fat density food supplement) for assessment of the upper abdomen. MATERIALS AND METHODS: Seventy-one patients referred for upper abdominal CT were randomized to receive either 500 ml water, 2% sodium diatrizoate or a dilute suspension of Calogen[reg]. The CT images were scored independently by three radiologists. Distension and anatomical identification was assessed for the stomach, duodenum and jejunum; with anatomical identification recorded for the pancreas, retroperitoneum, liver, gallbladder and spleen. RESULTS: Dilute Calogen[reg] produced a significant improvement (P < 0.01) in distension and anatomical visualization of the stomach and proximal duodenum. Only minimal differences were demonstrated between the three contrast media for visualization of more distal small bowel or identification of the other upper abdominal viscera. Significantly more artifacts were caused by positive contrast media than with the Calogen[reg] mixture. CONCLUSION: A dilute suspension of Calogen[reg] as an oral contrast medium is recommended when disease is suspected within the stomach or proximal duodenum. Ramsay, D.W. et al. (2001)

  14. Performance of tropical legumes grown as understory of a eucalypt plantation in a seasonally dry area of the Brazilian Cerrado

    Directory of Open Access Journals (Sweden)

    Maria Luiza F. Nicodemo

    2015-09-01

    Full Text Available Nine tropical legumes were grown outside the canopy and in the understory of an 8-year-old Eucalyptus grandis stand in order to assess their seasonal production and forage quality for 4 evaluation periods. Incident photosynthetically active radiation in the understory was 18% of that outside the canopy. In the understory, production of Lablab purpureus, Centrosema schiedeanum, Clitoria ternatea, Pueraria phaseoloides, Alysicarpus vaginalis, Aeschynomene villosa, Estilosantes Campo Grande (Stylosanthes capitata + S. macrocephala, Calopogonium mucunoides and Arachis pintoi was <1 kg/ha/d for most samples. Even considering this low production, the large area available for animal production in forest plantations might justify the interest in legumes because of their high nutritive value. Lablab purpureus produced the greatest amount of dry matter in the understory in the establishment phase (12.1 kg/ha/d, but did not persist. It could be a suitable candidate for a cover legume species mixture to provide early growth. Centrosema schiedeanum developed rapidly and showed a high capacity for ground cover (>70% and persistence, and had high nitrogen concentration, thus demonstrating good potential for protecting soils and promoting nutrient cycling in forest plantations. Another species with potential is A. pintoi, which established slowly but towards the end of the experiment showed moderate to high understory ground cover.Keywords: Dry matter production, forage quality, shade, silvopastoral system.DOI: 10.17138/TGFT(3151-160

  15. Lack of effect of Pitressin on the learning ability of Brattleboro rats with diabetes insipidus using positively reinforced operant conditioning.

    Science.gov (United States)

    Laycock, J F; Gartside, I B

    1985-08-01

    Brattleboro rats with hereditary hypothalamic diabetes insipidus (BDI) received daily subcutaneous injections of vasopressin in the form of Pitressin tannate (0.5 IU/24 hr). They were initially deprived of food and then trained to work for food reward in a Skinner box to a fixed ratio of ten presses for each pellet received. Once this schedule had been learned the rats were given a discrimination task daily for seven days. The performances of these BDI rats were compared with those of rats of the parent Long Evans (LE) strain receiving daily subcutaneous injections of vehicle (arachis oil). Comparisons were also made between these two groups of treated animals and untreated BDI and LE rats studied under similar conditions. In the initial learning trial, both control and Pitressin-treated BDI rats performed significantly better, and manifested less fear initially, than the control or vehicle-injected LE rats when first placed in the Skinner box. Once the initial task had been learned there was no marked difference in the discrimination learning between control or treated BDI and LE animals. These results support the view that vasopressin is not directly involved in all types of learning behaviour, particularly those involving positively reinforced operant conditioning.

  16. Fermentation of aqueous plant seed extracts by lactic acid bacteria

    Energy Technology Data Exchange (ETDEWEB)

    Schafner, D.W.; Beuchat, R.L.

    1986-05-01

    The effects of lactic acid bacterial fermentation on chemical and physical changes in aqueous extracts of cowpea (Vigna unguiculata), peanut (Arachis hypogea), soybean (Glycine max), and sorghum (Sorghum vulgare) were studied. The bacteria investigated were Lactobacillus helveticus, L. delbrueckii, L. casei, L. bulgaricus, L. acidophilus, and Streptococcus thermophilus. Organisms were inoculated individually into all of the seed extracts; L. bulgaricus and S. thermophilus were also evaluated together as inocula for fermenting the legume extracts. During fermentation, bacterial population and changes in titratable acidity, pH, viscosity, and color were measured over a 72 h period at 37 degrees C. Maximum bacterial populations, titratable acidity, pH, and viscosity varied depending upon the type of extract and bacterial strain. The maximum population of each organism was influenced by fermentable carbohydrates, which, in turn, influenced acid production and change in pH. Change in viscosity was correlated with the amount of protein and titratable acidity of products. Color was affected by pasteurization treatment and fermentation as well as the source of extract. In the extracts inoculated simultaneously with L. bulgaricus and S. thermophilus, a synergistic effect resulted in increased bacterial populations, titratable acidity, and viscosity, and decreased pH in all the legume extracts when compared to the extracts fermented with either of these organisms individually. Fermented extracts offer potential as substitutes for cultured dairy products. 24 references.

  17. Antioxidant and membrane effects of procyanidin dimers and trimers isolated from peanut and cocoa.

    Science.gov (United States)

    Verstraeten, Sandra V; Hammerstone, John F; Keen, Carl L; Fraga, César G; Oteiza, Patricia I

    2005-06-15

    The antioxidant and membrane effects of dimer (Dim) and trimer (Trim) procyanidins isolated from cocoa (Theobroma cacao) (B- and C-bonded) and peanut (Arachis hypogea L.) skin (A-bonded) were evaluated in phosphatidyl choline liposomes. When liposomes were oxidized with a steady source of oxidants, the above dimers and trimers inhibited to a similar extent lipid oxidation in a concentration (0.33-5 microM)-dependent manner. With respect to membrane effects, Dim A1, Dim B, Trim A, and Trim C increased (Dim A1 = Dim B and Trim A = Trim C), while Dim A2 decreased, membrane surface potential. All of the procyanidins tested decreased membrane fluidity as determined by fluorescent probes at the water-lipid interface, an effect that extended into the hydrophobic region of the bilayer. Both dimers and trimers protected the lipid bilayer from disruption by Triton X-100. The magnitude of the protection was Dim A1 > Dim A2 > Dim B and Trim C > Trim A. Thus, dimers and trimers can interact with membrane phospholipids, presumably with their polar headgroup. As a consequence of this interaction, they can provide protection against the attack of oxidants and other molecules that challenge the integrity of the bilayer.

  18. Effect of Soil Use and Coverage on the Spectral Response of an Oxisol in the VIS-NIR-MIR Region

    Directory of Open Access Journals (Sweden)

    Javier M. Martín-López

    2017-02-01

    Full Text Available In this study, the spectral responses obtained from a Typic Red Hapludox (oxisol were analyzed under different uses and occupations: Ficus elastica cultivation, Citrus + Arachis association cultivation, transitional crops, forest, Mangifera indica, Anacardium occidentale, Elaeis guineensis (18 years, Brachiaria decumbens, Brachiaria brizantha, and Musa × paradisiaca + Zea mays at the La Libertad Research Center in the department of Meta in Colombia (4°04′ North latitude, 73°30′ West longitude, 330 MAMSL. Sampling was performed with four random replicates of the horizon A and B to determine the contents of organic carbon (CO, pH, exchangeable acidity (Ac. I, cation exchange capacity (Cc, P, Ca, Mg, K, Na, sand, lime, and clay and spectral responses were obtained in the visible band (VIS, near infrared (NIR, and infrared (MIR for each sample under laboratory conditions. A comparison was made between the obtained spectra, determining the main changes in soil properties due to their use and coverage. Variation of soil characteristics such as color, organic carbon content, presence of ferrous compounds, sand, silt, and clay content and mineralogy allow the identification of the main spectral changes of soils, demonstrating the importance of the use of reflectance spectroscopy as a tool of comparison and estimation between physical-chemical properties of the soils.

  19. Agroindustrial Waste for Lead and Chromium Biosorption

    Directory of Open Access Journals (Sweden)

    Susana P. Boeykens

    2018-06-01

    Full Text Available There is a need to re-evaluate the residues generated in industrial processes for the production of new raw material, reducing the volume of waste. In this regard, the biosorption is a low-cost alternative method for treating effluents compared to conventional methods. The main objectives of this research were: the evaluation of the biosorbent capacity of six waste materials for the extraction of chromium(VI and lead(II ions from aqueous solutions and, the determination of the adsorption and kinetic parameters for the more efficient system. The materials evaluated were: peanut shell (Arachis hypagaea, sugarcane bagasse (Saccharum officinarum, avocado peel (Persea americana, pecan nutshell (Carya illinoinensis, wheat bran (Triticum aestivum and banana peel (Mussa paradisiaca. The highest percentage of lead removal was obtained with wheat bran (89%. For chromium, the percentage was generally much lower compared with lead for all tested biosorbents, the banana peel being the most efficient with a 10% removal. The models that better describe the adsorption processes were: Langmuir and Freundlich. The pseudo-second order kinetic model allowed obtaining the parameters for both systems. The equilibrium time, in both systems, was reached after 60 minutes. The study of Fourier Transformed Infrared spectra and the results of desorption experiments allowed to hypothesize on the mechanisms involved in the adsorption of these metals.

  20. Introgression of wild alleles into the tetraploid peanut crop to improve water use efficiency, earliness and yield.

    Directory of Open Access Journals (Sweden)

    Wellison F Dutra

    Full Text Available The introduction of genes from wild species is a practice little adopted by breeders for the improvement of commercial crops, although it represents an excellent opportunity to enrich the genetic basis and create new cultivars. In peanut, this practice is being increasingly adopted. In this study we present results of introgression of wild alleles from the wild species Arachis duranensis and A. batizocoi improving photosynthetic traits and yield in a set of lines derived from the cross of an induced allotetraploid and cultivated peanut with selection under water stress. The assays were carried out in greenhouse and field focusing on physiological and agronomic traits. A multivariate model (UPGMA was adopted in order to classify drought tolerant lines. Several lines showed improved levels of tolerance, with values similar to or greater than the tolerant control. Two BC1F6 lines (53 P4 and 96 P9 were highlighted for good drought-related traits, earliness and pod yield, having better phenotypic profile to the drought tolerant elite commercial cultivar BR1. These lines are good candidates for the creation of peanut cultivars suitable for production in semiarid environments.