WorldWideScience

Sample records for alveolares atroficos analisis

  1. Pulmonary alveolar proteinosis

    Science.gov (United States)

    PAP; Alveolar proteinosis; Pulmonary alveolar phospholipoproteinosis; Alveolar lipoproteinosis phospholipidosis ... PAP is unknown. In others, it occurs with lung infection or an immune problem. It also can ...

  2. Analisi matematica

    CERN Document Server

    Canuto, Claudio

    2014-01-01

    Il presente testo intende essere di supporto ad un secondo insegnamento di Analisi Matematica in quei corsi di studio (quali ad esempio Ingegneria, Informatica, Fisica) in cui lo strumento matematico parte significativa della formazione dell'allievo. I concetti e i metodi fondamentali del calcolo differenziale ed integrale in più variabili, le serie di funzioni e le equazioni differenziali ordinarie sono presentati con l'obiettivo primario di addestrare lo studente ad un loro uso operativo, ma critico. L'impostazione didattica dell'opera ricalca quella usata nel testo parallelo di Analisi Matematica I. La modalità di presentazione degli argomenti ne permette un uso flessibile e modulare. Lo stile adottato privilegia la chiarezza e la linearità dell'esposizione. Il testo organizzato su due livelli di lettura. Uno, più essenziale, permette allo studente di cogliere i concetti indispensabili della materia, di familiarizzarsi con le relative tecniche di calcolo e di trovare le giustificazioni dei principali r...

  3. Proteinosis alveolar pulmonar Pulmonary alveolar proteinosis

    Directory of Open Access Journals (Sweden)

    Concepción Sánchez Infante

    2011-12-01

    Full Text Available La proteinosis alveolar pulmonar es una enfermedad respiratoria crónica, caracterizada por alteración en el metabolismo del surfactante, lo que determina su acumulación anormal en el espacio alveolar. Es una enfermedad extremadamente rara. Se han reportado solamente 500 casos en la literatura. Se describió por primera vez en 1958. Se presenta un caso de proteinosis alveolar pulmonar en un lactante de 2 meses, con desnutrición proteico energética, que ingresa por dificultad respiratoria e hipoxemia, y, con imágenes radiológicas de tipo retículo-nodulillar, en vidrio deslustrado, en el cual se plantea inicialmente el diagnóstico de bronconeumonía. Ante la evolución desfavorable y no respuesta al tratamiento, se realizó un estudio para descartar enfermedades pulmonares crónicas. El paciente fallece y se confirma el diagnóstico por anatomía patológica. Se realiza una revisión del tema.The pulmonary alveolar proteinosis is a chronic respiratory disease characterized by surfactant metabolism alteration determining its abnormal accumulation in the alveolar space. It is a disease very rare and in literature only 500 cases have been reported; it was described for the first time in 1958. This is a case presentation of pulmonary alveolar proteinosis in an infant aged 2 months with energetic protein malnutrition admitted due to respiratory difficulty and hypoxemia and with radiologic images of the reticulonodulillary, in frosting glass, where initially is made the diagnosis of bronchopneumonia. In the face of unfavorable evolution and no response to treatment, a study was conducted to rule out chronic pulmonary diseases. Patient died confirming the diagnosis according to the pathologic anatomy. A review on subject is carried out.

  4. Analisi e cultura elettronica

    Directory of Open Access Journals (Sweden)

    Roberto Doati

    2014-10-01

    Full Text Available Da alcuni anni assistiamo in Italia ad una crescita del numero di analisi che si occupano di musica elettroacustica. Ciò è dovuto da un lato all’assestamento di modelli analitici messi a punto negli anni ‘70 e ‘80, dall’altro a una prova di analisi, nell’ambito dell’esame di diploma in Musica Elettronica, che induce i giovani a scoprire i benefici di una disciplina tutt’altro che fine a se stessa. Infatti, come altri campi di indagine, anche la musica elettroacustica trae vantaggio dalla pratica analitica come strumento di lavoro non solo per lo storico, il musicologo, l’interprete, l’insegnante, ma anche per il compositore. La quasi totalità dei modelli di analisi oggi a disposizione ha origine dal lavoro di compositori che avevano bisogno di mettere a punto strumenti in grado di costruire una letteratura pertinente alla cultura elettronica, oppure di formalizzare il proprio modello compositivo che in alcuni casi, per il suo carattere di "universalità", è diventato punto di riferimento per l’analisi. Nel seguito, quindi, pur riferendomi alla mia attività di insegnante di Musica Elettronica, il beneficio degli obiettivi indicati è da intendersi esteso anche alla mia attività di compositore.

  5. Pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    Surender Kashyap

    2013-01-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a rare, chronic lung disease with bilateral intra-alveolar calcium and phosphate deposition throughout the lung parenchyma with predominance to lower and midzone. Although, etiology and pathogenesis of PAM is not fully understood, the mutation in SLC34A2 gene that encodes a sodium-phosphate co-transporter in alveolar type II cells resulting in the accumulation and forming of microliths rich in calcium phosphate (due to impaired clearance are considered to be the cause of the disease. Chest radiograph and high-resolution CT of thorax are nearly pathognomonic for diagnosing PAM. HRCT demonstrates diffuse micronodules showing slight perilobular predominance resulting in calcification of interlobular septa. Patients with PAM are asymptomatic till development of hypoxemia and cor-pulmonale. No therapy has been proven to be beneficial except lung transplantation.

  6. Proteinosis alveolar pulmonar

    Directory of Open Access Journals (Sweden)

    Concepción Sánchez Infante

    2011-12-01

    Full Text Available La proteinosis alveolar pulmonar es una enfermedad respiratoria crónica, caracterizada por alteración en el metabolismo del surfactante, lo que determina su acumulación anormal en el espacio alveolar. Es una enfermedad extremadamente rara. Se han reportado solamente 500 casos en la literatura. Se describió por primera vez en 1958. Se presenta un caso de proteinosis alveolar pulmonar en un lactante de 2 meses, con desnutrición proteico energética, que ingresa por dificultad respiratoria e hipoxemia, y, con imágenes radiológicas de tipo retículo-nodulillar, en vidrio deslustrado, en el cual se plantea inicialmente el diagnóstico de bronconeumonía. Ante la evolución desfavorable y no respuesta al tratamiento, se realizó un estudio para descartar enfermedades pulmonares crónicas. El paciente fallece y se confirma el diagnóstico por anatomía patológica. Se realiza una revisión del tema.

  7. Alveolar development and disease.

    Science.gov (United States)

    Whitsett, Jeffrey A; Weaver, Timothy E

    2015-07-01

    Gas exchange after birth is entirely dependent on the remarkable architecture of the alveolus, its formation and function being mediated by the interactions of numerous cell types whose precise positions and activities are controlled by a diversity of signaling and transcriptional networks. In the later stages of gestation, alveolar epithelial cells lining the peripheral lung saccules produce increasing amounts of surfactant lipids and proteins that are secreted into the airspaces at birth. The lack of lung maturation and the associated lack of pulmonary surfactant in preterm infants causes respiratory distress syndrome, a common cause of morbidity and mortality associated with premature birth. At the time of birth, surfactant homeostasis begins to be established by balanced processes involved in surfactant production, storage, secretion, recycling, and catabolism. Insights from physiology and engineering made in the 20th century enabled survival of newborn infants requiring mechanical ventilation for the first time. Thereafter, advances in biochemistry, biophysics, and molecular biology led to an understanding of the pulmonary surfactant system that made possible exogenous surfactant replacement for the treatment of preterm infants. Identification of surfactant proteins, cloning of the genes encoding them, and elucidation of their roles in the regulation of surfactant synthesis, structure, and function have provided increasing understanding of alveolar homeostasis in health and disease. This Perspective seeks to consider developmental aspects of the pulmonary surfactant system and its importance in the pathogenesis of acute and chronic lung diseases related to alveolar homeostasis.

  8. ANALISIS LITERASI EKONOMI

    Directory of Open Access Journals (Sweden)

    Peter Garlans Sina

    2012-10-01

    Full Text Available Abstract: Analysis of Economic Literacy. The aim of this research is as an effort to increase economic literacy for individuals and households who want to achieve prosperity. Therefore, the obligation of improving the economic literacy needs to be done in a well-planned manner and come from the strong intention to learn in order to improve the economic literacy. It could have an effect on the assets accumulation, a better debt management, as a protection, as well as to increase savings and managing spending intelligently.   Keyword: economic literacy, asset, debt, protection, saving, spending   Abstrak: Analisis Literasi Ekonomi. Tulisan ini bertujuan sebagai upaya meningkatkan literasi ekonomi bagi individu maupun rumah tangga yang menginginkan mencapai kesejahteraan. Oleh karena itu, kewajiban meningkatkan literasi ekonomi perlu dilakukan secara terencana dan diawali dari niat untuk belajar meningkatkan literasi ekonomi karena dapat berefek pada akumulasi aset, pengelolaan utang yang tepat, proteksi, meningkatkan tabungan dan cerdas mengelola pengeluaran.   Kata kunci: literasi ekonomi, aset, utang, proteksi, menabung, pengeluaran

  9. Analisis Cadangan Devisa Indonesia

    Directory of Open Access Journals (Sweden)

    Lusia Bunga Uli

    2016-09-01

    Full Text Available Abstract This study aims to determine the relationship between variables export, import, and exchange rate against Foreign Exchange Reserves in Indonesia. The data used in the empirical study of a sequence of data monthly time of year 2011.01 through 2014.12 from Bank Indonesia and the Central Statistics Agency (BPS. The analysis tool used is Auto Regression Vector Model (VAR. The results of this study indicate that the one-way relationship between the variables of foreign reserves and export. Then one-way relationship between exchange rate and exports. Lastly, there is a two-way relationship between imports and foreign exchange reserves, two-way relationship between exchange rate and foreign exchange reserves, two-way relationship between imports and exports, two-way relationship between the exchange rate and imports. The results also showed foreign exchange reserves are significantly influenced by the movement itself at a probability of 1 %. Export variable negative and not significantly affect the foreign exchange reserves. While imports of positive and not significant to the foreign exchange reserves. Foreign Exchange Reserves Indonesia is positively influenced by the exchange rate and not significant. Keywords: Foreign exchange reserves, exports, imports, exchange rate   Abstrak. Penelitian ini bertujuan untuk mengetahui seberapa keterkaitan antar variabel ekspor, impor, dan nilai tukar rupiah terhadap Cadangan Devisa Indonesia. Data yang digunakan dalam kajian empiris ini merupakan data runtutaan waktu bulanan dari tahun 2011.01 sampai 2014. 12 yang berasal dari Bank Indonesia dan Badan Pusat Statistik (BPS. Alat analisis yang digunakan yaitu Vector Autoregression Model (VAR. Hasil dari penelitian ini menunjukkan bahwa hubungan searah antara variabel cadangan devisa ke ekspor. Lalu hubungan searah antara kurs terhadap ekspor Terakhir, terdapat hubungan dua arah antara impor dan cadangan devisa, hubungan dua arah antara kurs dan cadangan

  10. Alveolar bone resorption after tooth extraction

    OpenAIRE

    Dimova, Cena; Popovski, Stipica

    2012-01-01

    Alveolar ridge resorption has long been considered an unavoidable consequence of tooth extraction. Atrophy of the alveolar bone may cause significant esthetic and surgical problems in implantation, as well as at prosthetic and restorative dentistry. Alveolar ridge prophylaxis immediately upon tooth extraction may reduce such sequelae for both, the treating dentist and the patient. Attempts to reduce alveolar bone resorption have included the placement of natural roots, root analogues, and...

  11. Analisis Semiotik Sajak Bulang Cahaya

    Directory of Open Access Journals (Sweden)

    Junaidi Junaidi

    2014-11-01

    Full Text Available Penelitian ini bertujuan menggali makna tanda yang terdapat dalam sajak Bulang Cahaya karya Rida K Liamsi. Untuk menggali makna itu, pendekatan analisis semiotik Roland Barthes digunakan. Hasil penelitian menunjukkan bahwa sajak ini berisi tanda-tanda bersumber dari kosa kata Melayu lama. Sajak ini juga berisi simbol-simbol yang berkaitan dengan kehidupan orang Melayu. Penggunaan kata-kata Melayu lama dan simbol Melayu memperkuat setting Melayu dalam sajak ini. Analisis makna menunjukkan bahwa seseorang merasakan kedukaan sangat mendalam ketika cintanya harus berakhir, tetapi ia terus merasakan kerinduan dengan kekasihnya yang telah pergi. Mitos cinta yang terdapat dalam pusinya adalah orang tahu bahwa putus cinta itu menyakitkan tetapi orang tetap saja jatuh cinta.

  12. Analisis Morfologis Nomina Bahasa Jerman

    OpenAIRE

    Siahaan, Jujur

    2008-01-01

    Tulisan ini mendeskripsikan morfologi nomina, yang membahas tentang bagaimana kategori dan proses morfologis pembentukan nomina bahasa Jerman. Metode yang digunakan dalam analisis ini adalah metode kualitatif deskriptif. Data kepustakaan seperti: buku teks ( Themen neu, Wieso nicht ?, Sprachkurs Deutsch), Jurnal (Scala, Journal für Deutschland, Europa Magazin ) dan majalah Jugend, die Mitmach Gesellschaft serta Juma merupakan sumber data. Data yang sudah terkumpul melalui teknik studi p...

  13. Intravascular bronchio-alveolar tumor

    International Nuclear Information System (INIS)

    Mata, J.M.; Caceres, J.; Prat, J.; Lopez, J.I.; Velilla, O.

    1991-01-01

    In 1975 Dail and Liebow described the clinical and pathological characteristics of a pulmonary tumor which they dominated intravascular bronchio-alveolar tumor (IVBAT). Our aim is to acquaint radiologists with the existence of this tumor by describing the radiologic findings in 2 patients with IVBAT, 1 with hepatic involvement ant the other with pulmonary osteoarthropathy. (author). 7 refs.; 2 figs

  14. Human alveolar echinococcosis in Kyrgyzstan.

    Science.gov (United States)

    Usubalieva, Jumagul; Minbaeva, Gulnara; Ziadinov, Iskender; Deplazes, Peter; Torgerson, Paul R

    2013-07-01

    Human echinococcosis is a reportable disease in Kyrgyzstan. Between 1995 and 2011, human alveolar echinococcosis increased from 60 cases per year. The origins of this epidemic, which started in 2004, may be linked to the socioeconomic changes that followed the dissolution of the former Soviet Union.

  15. True Fibroma of Alveolar Mucosa

    Directory of Open Access Journals (Sweden)

    Shankargouda Patil

    2014-01-01

    Full Text Available Benign fibrous overgrowths are often found in the oral cavity, almost always being reactive/irritational in nature. However, benign mesenchymal neoplasms of the fibroblasts are extremely uncommon. Here we report a case of “True Fibroma of Alveolar Mucosa” for its rarity.

  16. ANALISIS COST – BENEFIT TEKNOLOGI INFORMASI

    Directory of Open Access Journals (Sweden)

    Khakim Ghozali

    2002-07-01

    Full Text Available Pada penelitian ini akan dibahas bagaimana melakukan analisis Cost - Benefit untuk investasi di bidang Teknologi Informasi. Dengan melakukan analisis Cost Benefit ini maka akan dapat diketahui apakah sebuah investasi di bidang teknologi informasi menguntungkan ataukah merugikan perusahaan. Setelah menentukan arah investasi organisasi teknologi informasi pada level bisnis maka perlu dilakukan analisis yang lebih detil mengenai dampak finansial terhadap organisasi tersebut. Hal ini melibatkan business case accounting atau analisis cost benefit . Teknik ini digunakan untuk menentukan jenis analisis termasuk capital investment yang terjadi, yang melibatkan perhitungan financial ratio seperti Payback Period, Return On Investment (ROI, Net Present Value (NPV,Internal Rate Of Return (IRR.Kata kunci: cost-benefit, business case accounting, teknologi informasi.

  17. ANALISIS PERBAIKAN SISTEM PENTANAHAN TELEKOMUNIKASI

    Directory of Open Access Journals (Sweden)

    Umar Umar

    2015-04-01

    Hasil dari penelitian ini adalah perbaikan sistem pentanahan site Kampung Baru dengan menggunakan konfigurasi single point connection window (SPCW, untuk mengamankan sistem telekomunikasi dari kebocoran arus dan petir serta imbasnya.  Perbaikan sistem pentanahan di site Kampung Baru menggunakan banyak elektroda yang membentuk persegi dikarenakan topografi tempat di sana yang memungkinkan dan efektif adalah menggunakan sistem tersebut. Berdasarkan hasil analisis dan perhitungan perbaikan sistem di site Kampung Baru, didapatkan nilai perhitungan sistem pentanahan adalah 1.34 Ohm serta pengukurannya 1.21-1.25 Ohm.

  18. ANALISIS DAYA SAING KEDELAI INDONESIA

    Directory of Open Access Journals (Sweden)

    Sarwono Sarwono

    2014-09-01

    Full Text Available RCA (Revealed Comparative Advantage index of soybean in Indonesia from 1983 up to 2013 is less than one, mostly. It means that the competitiveness of soybean in Indonesia is low. The purpose of this study is to analyze the factors influence the soybean competitiveness. OLS (Ordinary Least Square was used as the analysis method. Hypotheses test based on that analysis model is not bias, so that, classic divergence test is needed. It is for getting the Best Linier Unbiased Estimator (BLUE appraisal. T statistic and F statistic were also applied. The result of this research shows that production and export have positive and significant influence. In addition, exchange rate and government policy do not influence the Indonesia soybean competitiveness.Indeks RCA (Revealed Comparative Advantage kedelai Indonesia dari tahun 1983-2013 kecenderungan bernilai kurang dari satu yang berarti daya saing kedelai Indonesia rendah.Penelitian ini bertujuan untuk menganalisis faktor-faktor yang mempengaruhi daya saing kedelai Indonesia.Metode analisis yang digunakan adalah Ordinary Least Square (OLS.Pengujian hipotesis berdasarkan model analisis tersebut tidak bias maka perlu dilakukan uji penyimpangan klasik yang tujuannya agar diperoleh penaksiran yang bersifat Best Linier Unbiased Estimator (BLUE.Pengujian statistik menggunakan uji t statistikdan uji f statistik.Hasil penelitian ini menunjukkan bahwa produksi dan ekspor berpengaruh secara positif dan signifikan terhadap daya saing kedelai Indonesia. Nilai tukar rupiah dan kebijakan pemerintah tidak berpengaruh terhadap daya saing kedelai Indonesia.

  19. Analisis Harmonisa Inverter PWM Satu Fasa

    OpenAIRE

    Rejeki Simanjorang

    2008-01-01

    Pada tesis ini dianalisis harmonisa inverter PWM satu fasa. Inverter PWM satu fasa yang akan ditinjau adalah inverter satu fasa jembatan penuh (konvensional) dan inverter komposit. Analisis difokuskan pada penentuan pola penyaklaran yang optimum agar pembangkitan harmonisa dan switching losses inverter rendah. Untuk menentukan pola penyaklaran optimum maka dilakukan analisis yang berbasis pada rangkaian ekivalen harmonisa inverter satu fasa. Dengan menggunakan pola penyaklaran optimum, kedua ...

  20. Pulmonary alveolar microlithiasis in children

    International Nuclear Information System (INIS)

    Schmidt, H.; Loercher, U.; Kitz, R.; Zielen, S.; Ahrens, P.; Koenig, R.

    1996-01-01

    Two asymptomatic Turkish sibs are presented, a 4-year-old boy and his 7-year-old sister, with pulmonary alveolar microlithiasis (PAM) confirmed by transbronchial lung biopsy and bronchoalveolar lavage. Chest radiographs and high resolution CT demonstrated wide-spread intra-alveolar calcifications in both lungs. The lesions were sharply defined and less than 1 mm in diameter. CT documented a high concentration of microliths along the bronchovascular bundles, the intralobular fissue and the (sub)pleural lung parenchyma. The combination of bronchoalveolar lavage and roentgenographic appearance in high resolution CT are characteristic and pathognomonic, and can confirm the diagnosis. The more severe changes in the elder sib and the radiographic controls suggest that the pulmonary disease may be progressive in our patients. The described family of consanguineous, unaffected parents with two affected and one healthy child confirmed the autosomal recessive inheritance of PAM (McKusick 265100). In addition, the affected girl had autosomal recessive Waardenburg-anophthalmia syndrome (McKusick 206920), raising the question of whether this is a chance occurrence or possibly a contiguous gene syndrome. (orig.)

  1. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy

    OpenAIRE

    Kaya, Bülent; Yildiz, Ibrahim; Baha, Reshat Mehmet; Zeytun, Neslihan Ebru Eryaşar; Yetisgen, Azize

    2015-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  2. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy.

    Science.gov (United States)

    Kaya, Bülent; Yildiz, Ibrahim; Baha, Reshat Mehmet; Zeytun, Neslihan Ebru Eryaşar; Yetisgen, Azize

    2015-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  3. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy

    Directory of Open Access Journals (Sweden)

    Bülent Kaya

    2015-01-01

    Full Text Available Diffuse alveolar hemorrhage (DAH is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  4. CT quantification of pulmonary alveolar microlithiasis

    International Nuclear Information System (INIS)

    Wurche, K.D.; Kubale, R.; Vallee, D.; Ostertag, H.

    1987-01-01

    Pulmonary alveolar microlithiasis is a rare, familial disease with massive symmetrical intra-alveolar calcium deposition. Conventional CT findings and CT measurements with a dual energy technique were carried out in a 26-year-old patient suffering from this disease. The importance of the findings in the differential diagnosis and for estimating the progression and prognosis of the disease is discussed. (orig.) [de

  5. ANALISIS IMPOR BERAS DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Ratih Kumala Sari

    2014-10-01

    Full Text Available Abstrak ___________________________________________________________________ Salah satu kebijakan pemerintah untuk memenuhi kebutuhan beras yaitu dengan menggenjot produksi beras dalam negeri. Namun dengan semakin meningkatnya jumlah penduduk akan meningkatkan permintaan terhadap beras dan upaya peningkatan produktivitas dalam negeri tidak dapat memenuhi kebutuhan beras dalam negeri. Sehingga untuk menutupi kekurangan tersebut pemerintah mengambil keputusan untuk melakukan impor beras dari negara lain. Akan tetapi pada kenyataannya impor beras dilakukan ketika data statistik menunjukkan bahwa Indonesia sedang mengalami surplus beras. Penelitian ini bertujuan untuk mengetahui faktor-faktor apa saja yang mempengaruhi impor beras di Indonesia. Metode analisis yang digunakan adalah analisis regresi linier berganda dengan model Error Correction Model (ECM. Berdasarkan hasil penelitian disimpulkan bahwa secara parsial maupun secara bersama-sama produksi beras, konsumsi beras, harga beras dalam negeri dan nilai tukar rupiah terhadap dollar AS berpengaruh dan signifikan terhadap impor beras di Indonesia. Abstract ___________________________________________________________________ One of the government’s policy to fulfill the need of rice is to boost the domestic production. However, by increasing the population, the demand of rice will also increase and the effort of increasing the domestic productivity cannot supply domestic rice need. So, to cover the shortage the government make decision to import rice from other countries. Yet, in fact importing rice is occurred when the statistical data showed that the supply of rice in Indonesia is surplus. The purpose of this research is necessary to study the factors which influence the import of rice in Indonesia. The analysis method used is multiple linear regression analysis model with Error Correction Model (ECM. Based on the research proven that partially or jointly the production, the consumption, the

  6. Effect of Alveolar Segmental Sandwich Osteotomy on Alveolar Height: A Preliminary Study.

    Science.gov (United States)

    Mehta, Karan S; Prasad, Kavitha; Shetty, Vibha; Ranganath, Krishnappa; Lalitha, R M; Dexith, Jayashree; Munoyath, Sejal K; Kumar, Vineeth

    2017-12-01

    Bone loss following extraction is maximum in horizontal dimension. Height is also reduced which is pronounced on the buccal aspect. Various surgical procedures are available to correct the bone volume viz. GBR, onlay bone grafting, alveolar distraction and sandwich osteotomy. Sandwich osteotomy has been found to increase the vertical alveolar bone height successfully. The objective of the study was to assess the effect of alveolar segmental sandwich osteotomy on alveolar height and crestal width. A prospective study was undertaken from December 2012 to August 2014. Seven patients with 12 implant sites with a mean age of 36 years were recruited. All seven patients with 12 implant sites underwent alveolar segmental sandwich osteotomy and interpositional bone grafting. Alveolar bone height was assessed radiographically preoperatively, immediate post-op, and at 3 months post-op. Alveolar bone width was assessed radiographically preoperatively and at 3 months post-op. Statistical significance was inferred at p  Sandwich osteotomy can be used as an alternative technique to increase alveolar bone height prior to implant placement. Moderate alveolar deficiency can be predictably corrected by this technique.

  7. Alveolar ridge augmentation by osteoinduction in rats

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1990-01-01

    The purpose of this study was to evaluate bone substitutes for alveolar ridge augmentation by osteoinduction. Allogenic, demineralized, and lyophilized dentin and bone was tested for osteoinductive properties in order to establish an experimental model for further studies. Implantations were...

  8. ANALISIS KESALAHAN FONOLOGIS BAHASA MANDARIN OLEH MAHASISWA D3 BAHASA MANDARIN UNIVERSITAS JENDERAL SOEDIRMAN

    Directory of Open Access Journals (Sweden)

    Nunung Supriadi

    2015-01-01

    Full Text Available This study focuses on Chinese pronunciation errors by students of Chinese D3 Program at Jenderal Soedirman University. The data collected  using interview and observation methods were analyzed with the theory of transformational-generative phonology and a speech analyser program. The result shows that pronunciation errors occur because the consonants supposed to be pronounced with aspiration were pronounced without aspiration, and consonants supposed to be pronounced at the post-alveolar articulation were pronounced at the frontal alveolar. The factor causing the pronunciation error is the phonological system difference between Chinese and Indonesia, and Chinese and Javanese as the mother tongue of the respondents.   Penelitian ini membahas kesalahan pengucapan bahasa Mandarin oleh mahasiswa Program D3 bahasa Mandarin Universitas Jenderal Soedirman. Data diperoleh menggunakan metode wawancara dan observasi, kemudian data dianalisis dengan teori fonologi generatif transformasional dan program ‘speech analyzer’. Hasil analisis menunjukkan bahwa kesalahan pengucapan bahasa Mandarin terjadi karena bunyi konsonan yang seharusnya diucapkan aspirasi, tetapi diucapkan tanpa aspirasi, dan bunyi konsonan dengan letak artikulasi ‘post alveolar’ diucapkan dengan ‘frontal anterior’. Faktor penyebab terjadinya kesalahan adalah karena perbedaan sistem fonologis bahasa Mandarin dan bahasa Indonesia ataupun bahasa Jawa, yang merupakan bahasa ibu para responden

  9. [Cleft lip, alveolar and palate sequelae. Proposal of new alveolar score by the Alveolar Cleft Score (ACS) classification].

    Science.gov (United States)

    Molé, C; Simon, E

    2015-06-01

    The management of cleft lip, alveolar and palate sequelae remains problematic today. To optimize it, we tried to establish a new clinical index for diagnostic and prognostic purposes. Seven tissue indicators, that we consider to be important in the management of alveolar sequelae, are listed by assigning them individual scores. The final score, obtained by adding together the individual scores, can take a low, high or maximum value. We propose a new classification (ACS: Alveolar Cleft Score) that guides the therapeutic team to a prognosis approach, in terms of the recommended surgical and prosthetic reconstruction, the type of medical care required, and the preventive and supportive therapy to establish. Current studies are often only based on a standard radiological evaluation of the alveolar bone height at the cleft site. However, the gingival, the osseous and the cellular areas bordering the alveolar cleft sequelae induce many clinical parameters, which should be reflected in the morphological diagnosis, to better direct the surgical indications and the future prosthetic requirements, and to best maintain successful long term aesthetic and functional results. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  10. ANALISIS KESELAMATAN TERMOHIDROLIK BULK SHIELDING REAKTOR KARTINI

    Directory of Open Access Journals (Sweden)

    Azizul Khakim

    2015-10-01

    Full Text Available ABSTRAK ANALISIS KESELAMATAN TERMOHIDROLIK BULK SHIELDING REAKTOR KARTINI. Bulk shielding merupakan fasilitas yang terintegrasi dengan reaktor Kartini yang berfungsi sebagai penyimpanan sementara bahan bakar bekas. Fasilitas ini merupakan fasilitas yang termasuk dalam struktur, sistem dan komponen (SSK yang penting bagi keselamatan. Salah satu fungsi keselamatan dari sistem penanganan dan penyimpanan bahan bakar adalah mencegah kecelakaan kekritisan yang tak terkendali dan membatasi naiknya temperatur bahan bakar. Analisis keselamatan paling kurang harus mencakup analisis keselamatan dari sisi neutronik dan termo hidrolik Bulk shielding. Analisis termo hidrolik ditujukan untuk memastikan perpindahan panas dan proses pendinginan bahan bakar bekas berjalan baik dan tidak terjadi akumulasi panas yang mengancam integritas bahan bakar. Code tervalidasi PARET/ANL digunakan untuk analisis pendinginan dengan mode konveksi alam. Hasil perhitungan menunjukkan bahwa mode pendinginan konvekasi alam cukup memadai dalam mendinginkan panas sisa tanpa mengakibatkan kenaikan temperatur bahan bakar yang signifikan. Kata kunci: Bulk shielding, bahan bakar bekas, konveksi alam, PARET.   ABSTRACT THERMAL HYDRAULIC SAFETY ANALYSIS OF BULK SHIELDING KARTINI REACTOR. Bulk shielding is an integrated facility to Kartini reactor which is used for temporary spent fuels storage. The facility is one of the structures, systems and components (SSCs important to safety. Among the safety functions of fuel handling and storage are to prevent any uncontrolable criticality accidents and to limit the fuel temperature increase. Safety analyses should, at least, cover neutronic and thermal hydraulic calculations of the bulk shielding. Thermal hydraulic analyses were intended to ensure that heat removal and the process of the spent fuels cooling takes place adequately and no heat accumulation that challenges the fuel integrity. Validated code, PARET/ANL was used for analysing the

  11. Perawatan Ortodontik Gigi Anterior Berjejal dengan Tulang Alveolar yang Tipis

    Directory of Open Access Journals (Sweden)

    Miesje K. Purwanegara

    2015-09-01

    Full Text Available Anterior teeth movement in orthodontic treatment is limited to labiolingual direction by very thin alveolar bone. An uncontrolled anterior tooth movement to labiolingual direction can cause alveolar bone perforation at its root segment. This case report is to remind us that alveolar bone thickness limits orthodontc tooth movement. A case of crowded anterior teeth with thin alveolar bone in malocclusion I is reported. This case is treated using adgewise orthodontic appliance. Protraction of anterior teeth is anticipated due to thin alveolar bone on the anterior surface. The conclusion is although the alveolar bone surrounding the crowded anterior teeth is thin, by controlling the movement the teeth reposition is allowed.

  12. Lateralization Technique and Inferior Alveolar Nerve Transposition

    Directory of Open Access Journals (Sweden)

    Angélica Castro Pimentel

    2016-01-01

    Full Text Available Bone resorption of the posterior mandible can result in diminished bone edge and, therefore, the installation of implants in these regions becomes a challenge, especially in the presence of the mandibular canal and its contents, the inferior alveolar nerve. Several treatment alternatives are suggested: the use of short implants, guided bone regeneration, appositional bone grafting, distraction osteogenesis, inclined implants tangential to the mandibular canal, and the lateralization of the inferior alveolar nerve. The aim was to elucidate the success rate of implants in the lateralization technique and in inferior alveolar nerve transposition and to determine the most effective sensory test. We conclude that the success rate is linked to the possibility of installing implants with long bicortical anchor which favors primary stability and biomechanics.

  13. Analisis SWOT pada Toko Lestari Rattan and Furniture Jl. Gatot Subroto No. 457 Medan

    OpenAIRE

    Desira, Sheila

    2011-01-01

    Penelitian ini bertujuan untuk menganalisis SWOT yang ada pada Toko Lestari Rattan and Furniture. Analisis SWOT merupakan penilaian lingkungan internal berupa kekuatan (strength) dan kelemahan (weakness) serta lingkungan eksternal berupa peluang (opportunity) dan ancaman (treath). Analisis SWOT akan menghasilkan strategi yang tepat bagi perusahaan. Analisis SWOT umumnya digunakan pada perusahaan besar. Penelitian ini melihat penerapan analisis SWOT pada UKM (Usaha Kecil Mene...

  14. Bone graft healing in alveolar osteoplasty in patients with unilateral lip, alveolar process, and palate clefts.

    Science.gov (United States)

    Rychlik, Dariusz; Wójcicki, Piotr

    2012-01-01

    Secondary osteoplasty by means of autogenic spongy bone grafting is the most common procedure used in the reconstruction of the continuity of the maxillary alveolar process. The aim of the study was to analyze retrospectively the effect of certain factors on the course of the bone graft healing process in patients with unilateral complete clefts of the lip, alveolar process, and palate. The investigations involved 62 children aged 8 to 14 years (mean age, 11 years) with unilateral complete cleft of the lip, alveolar process, and palate operated on at the Clinic of Plastic Surgery in Polanica Zdrój from November 2007 to April 2009. All the procedures consisted in the reconstruction of the maxillary alveolar process by means of autogenic spongy bone grafting from the iliac bone. The analysis was performed on the basis of computed tomography scans presenting maxillary alveolar processes in the horizontal cross-sectional planes performed on the second or third postoperative day and after 6 months. They were used as the basis for the measurement of the volume and density (condensation) of the bone graft, the surface of its adhesion to the maxillary alveolar bone, and the volume and density of the healed bone. The following correlation coefficients were determined: between the adhesion surface of the bone to the alveolar bone and the volume of the healed bone, between the adhesion surface of the bone to the alveolar bone and the density of the healed bone, and between the density of the graft and the volume of the healed bone. Increasing the surface of the graft adhesion to the bone ridges of the alveolar cleft contributes to increased volume of the healed bone and slows down the increase in its density (on 6-month follow-up). Crushing of the bone graft increases its resorption and reduces volume of the healed bone.

  15. Alveolar Ridge Carcinoma. Two Cases Report

    International Nuclear Information System (INIS)

    Pupo Triguero, Raul J; Vivar Bauza, Miriam; Alvarez Infante, Elisa

    2008-01-01

    Two cases with alveolar ridge carcinoma due to prosthetist traumatism are discussed in this paper, after 9 and 10 years of using dental prosthesis. Both patients began with disturbance in the alveolar ridge. The clinical examination and biopsy showed a well differenced carcinoma. The treatment was radical surgery and radiotherapy in the first patient, and conservative surgery with radiotherapy in the second case .The patients had xerostomia after radiotherapy and the woman had difficulties with mastication. The advantages and disadvantages of the treatment were discussed, focused on the prevention and treatment for oral

  16. Alveolar Bone Fracture: Pathognomonic Sign for Clinical Diagnosis

    OpenAIRE

    Gutmacher, Zvi; Peled, Eli; Norman, Doron; Lin, Shaul

    2017-01-01

    Aim: Dental injuries, especially luxation and avulsion, are common. Dental trauma can cause alveolar bone fracture that can lead to tooth loss and malocclusion. Single tooth alveolar bone fractures are difficult to identify unless it protrudes through the overlying mucosa and can be visualized. Pain, malocclusion, and tooth mobility provide signs of suspected alveolar bone fractures. Integrity of the proximate alveolar bone should be examined for fractures where avulsion, luxation, or other t...

  17. ANALISIS EPISTEMOLOGICO DE LA REALIDAD SOCIAL

    OpenAIRE

    NEPOMUCENO, VALERIO

    2005-01-01

    Este articulo pretende hacer un analisis epistemologico de la realidad social,desde la optica contable,partiendo de la premisa historica de que los cambios que han ocurrido en los ultimos siglos - revolucion industrial en la sociedad pos - industrial- han provocado profundos cambios en la forma de manipular el capital,generado como consecuencia un estado de confusion en los sistemas de informacion contable y en sus verdaderos objetivos cientificos.

  18. Teaching Alveolar Ventilation with Simple, Inexpensive Models

    Science.gov (United States)

    DiCarlo, Stephen E.

    2008-01-01

    When teaching and learning about alveolar ventilation with our class of 300 first-year medical students, we use four simple, inexpensive "models." The models, which encourage research-oriented learning and help our students to understand complex ideas, are distributed to the students before class. The students anticipate something new every day,…

  19. Alveolar ridge augmentation by osteoinduction in rats

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1990-01-01

    The purpose of this study was to evaluate bone substitutes for alveolar ridge augmentation by osteoinduction. Allogenic, demineralized, and lyophilized dentin and bone was tested for osteoinductive properties in order to establish an experimental model for further studies. Implantations were perf...

  20. Alveolar proteinosis associated with aluminium dust inhalation.

    Science.gov (United States)

    Chew, R; Nigam, S; Sivakumaran, P

    2016-08-01

    Secondary alveolar proteinosis is a rare lung disease which may be triggered by a variety of inhaled particles. The diagnosis is made by detection of anti-granulocyte-macrophage colony-stimulating factor antibodies in bronchoalveolar lavage fluid, which appears milky white and contains lamellar bodies. Aluminium has been suggested as a possible cause, but there is little evidence in the literature to support this assertion. We report the case of a 46-year-old former boilermaker and boat builder who developed secondary alveolar proteinosis following sustained heavy aluminium exposure. The presence of aluminium was confirmed both by histological examination and metallurgical analysis of a mediastinal lymph node. Despite cessation of exposure to aluminium and treatment with whole-lung lavage which normally results in improvements in both symptoms and lung function, the outcome was poor and novel therapies are now being used for this patient. It may be that the natural history in aluminium-related alveolar proteinosis is different, with the metal playing a mediating role in the disease process. Our case further supports the link between aluminium and secondary alveolar proteinosis and highlights the need for measures to prevent excessive aluminium inhalation in relevant industries. © The Author 2016. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  1. Alveolar Bone Fracture: Pathognomonic Sign for Clinical Diagnosis.

    Science.gov (United States)

    Gutmacher, Zvi; Peled, Eli; Norman, Doron; Lin, Shaul

    2017-01-01

    Dental injuries, especially luxation and avulsion, are common. Dental trauma can cause alveolar bone fracture that can lead to tooth loss and malocclusion. Single tooth alveolar bone fractures are difficult to identify unless it protrudes through the overlying mucosa and can be visualized. Pain, malocclusion, and tooth mobility provide signs of suspected alveolar bone fractures. Integrity of the proximate alveolar bone should be examined for fractures where avulsion, luxation, or other tooth trauma is detected. Any suggestion of alveolar fractures should be further investigated with an appropriate radiograph. This case report shows a pathognomonic sign that detects and diagnosis single tooth alveolar bone fractures, i.e. , a localized hematoma crossing the attached gingiva from the free gingival margin to the vestibular mucosa. This should serve as a warning for localized alveolar bone fracture. A visualized hematoma and gentle, careful palpation may help detect covered fractures when the overlying mucosa is not perforated.

  2. Rare Lung Diseases II: Pulmonary Alveolar Proteinosis

    Directory of Open Access Journals (Sweden)

    Stephen C Juvet

    2008-01-01

    Full Text Available The present article is the second in a series on rare lung diseases. It focuses on pulmonary alveolar proteinosis (PAP, a disorder in which lipoproteinaceous material accumulates in the alveolar space. PAP was first described in 1958, and for many years the nature of the material accumulating in the lungs was unknown. Major insights into PAP have been made in the past decade, and these have led to the notion that PAP is an autoimmume disorder in which autoantibodies interfere with signalling through the granulocyte-macrophage colony-stimulating factor receptor, leading to macrophage and neutrophil dysfunction. This has spurred new therapeutic approaches to this disorder. The discussion of PAP will begin with a case report, then will highlight the classification of PAP and review recent insights into the pathogenesis of PAP. The approach to therapy and the prognosis of PAP will also be discussed.

  3. Silver Nanoparticles in Alveolar Bone Surgery Devices

    Directory of Open Access Journals (Sweden)

    Stefano Sivolella

    2012-01-01

    Full Text Available Silver (Ag ions have well-known antimicrobial properties and have been applied as nanostrategies in many medical and surgical fields, including dentistry. The use of silver nanoparticles (Ag NPs may be an option for reducing bacterial adhesion to dental implant surfaces and preventing biofilm formation, containing the risk of peri-implant infections. Modifying the structure or surface of bone grafts and membranes with Ag NPs may also prevent the risk of contamination and infection that are common when alveolar bone augmentation techniques are used. On the other hand, Ag NPs have revealed some toxic effects on cells in vitro and in vivo in animal studies. In this setting, the aim of the present paper is to summarize the principle behind Ag NP-based devices and their clinical applications in alveolar bone and dental implant surgery.

  4. Alveolar ridge preservation immediately after tooth extraction.

    Science.gov (United States)

    Feller, L; Khammissa, R A G; Bouckaert, M; Lemmer, J

    2013-10-01

    Ridge preservation procedures immediately after tooth extraction, are commonly used with a view to minimising remodelling and shrinkage of the alveolar ridge, associated with socket healing. These procedures may sometimes be effective, but they cannot completely prevent reduction in dimension of the ridge. Certain biomater als used may actually hamper normal deposition of bone within the healing socket, reducing bone trabeculae that can integrate with the implant surface. However, in extraction sockets in alveolar ridges of low bone density, particles of implanted bone substitute incorporated in the healing bone, may enhance the mechanical support for the implant, provided by normal healed bone of low trabecular density alone. This paper reviews biological rationales and procedures for ridge preservation immediately after extraction and comments on their clinical use.

  5. [Clinical research on repairing alveolar cleft with osteoinduction active material].

    Science.gov (United States)

    She, Xiao-ming; Zhang, Qian; Tian, Kun; Yang, Li; Xiong, Gui-fa

    2010-08-01

    To study the feasibility and authenticity of repairing alveolar defects in alveolar cleft patients with osteoinduction active material (OAM) in clinic. Twenty-seven cases of alveolar defect chosen from clinic were divided into two groups (test group and control group). For test group (12 cases), OAM was transplanted to repair the alveolar cleft. For control group (15 cases), autogenous ilium cancellous bone were transplanted into the defect region to repair alveolar cleft. At 6 months after operation, CT and three-dimensional reconstruction were used to observe alveolar appearance, and the effect and clinical success rate of recover alveolar cleft by using different repair material were compared. In the 27 cases, all the maxillary continuity was restored except two of test group and two of control group. There was no significant difference between test group and control group regarding the clinical success rate of the alveolar cleft repair (P = 1.000). OAM was used to repair the alveolar cleft that can result in new bone formations and the burgeon of canines from the bone grafted areas. There is no significant difference between OAM and autogenous ilium cancellous bone regarding the effect of the alveolar cleft repair.

  6. Alveolar ridge preservation in the esthetic zone.

    Science.gov (United States)

    Jung, Ronald E; Ioannidis, Alexis; Hämmerle, Christoph H F; Thoma, Daniel S

    2018-02-27

    In the esthetic zone, in the case of tooth extraction, the clinician is often confronted with a challenge regarding the optimal decision-making process for providing a solution using dental implants. This is because, after tooth extraction, alveolar bone loss and structural and compositional changes of the covering soft tissues, as well as morphological alterations, can be expected. Ideally, the therapeutic plan starts before tooth extraction and it offers three options: spontaneous healing of the extraction socket; immediate implant placement; and techniques for preserving the alveolar ridge at the site of tooth removal. The decision-making process mainly depends on: (i) the chosen time-point for implant placement and the ability to place a dental implant; (ii) the quality and quantity of soft tissue in the region of the extraction socket; (iii) the remaining height of the buccal bone plate; and (iv) the expected rates of implant survival and success. Based on scientific evidence, three time-periods for alveolar ridge preservation are described in the literature: (i) soft-tissue preservation with 6-8 weeks of healing after tooth extraction (for optimization of the soft tissues); (ii) hard- and soft-tissue preservation with 4-6 months of healing after tooth extraction (for optimization of the hard and soft tissues); and (iii) hard-tissue preservation with > 6 months of healing after tooth extraction (for optimization of the hard tissues). © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. ANALISIS PENGELOLAAN LINGKUNGAN PERMUKIMAN DI KABUPATEN SOPPENG

    Directory of Open Access Journals (Sweden)

    Bakhrani Rauf

    2016-08-01

    Full Text Available Penelitian ini  bertujuan untuk mendeskripsikan pengelolaan lingkungan permukiman di Kabupaten Soppeng pada aspek: (1 penyediaan dan penanganan lahan terbuka hijau (open space; (2 penyediaan dan penanganan drainase; (3  penanganan sampah; (4 penyediaan dan penanganan pembuangan veses (septic tank. Jenis penelitian ini adalah penelitian kuantitatif dengan pendekatan survei.  Sampel wailayah penelitian ini adalah satu RW di ibu kota kabupaten dan satu RW di desa yang dipilih dengan metode purpossive sampling,  yaitu RW yang sudah maju di ibu kota kabupaten dan RW yang tertinggal di desa. Responden sebanyak 50 kepala keluarga yakni masing-masing 25 kepala keuarga di setiap RW, dipilih dengan  systematic random sampling.  Teknik pengumpulan data yang dilakukan adalah melakukan observasi langsung dan dilengkapi dengan wawancara terhadap responden. Analisis yang digunakan adalah analisis deskriptif. Hasil penelitian menunjukkan bahwa pengelolaan lingkungan permukiman di Kabupaten Soppeng pada aspek: (1 ketersediaan dan penanganan lahan terbuka hijau (open space ditemukan belum memadai; (2 ketersediaan drainase (air kotor dan air hujan ditemukan belum memadai; (3 Penanganan sampahbelum memadai; dan (4 penanganan veses dan penyediaan septic tankbelum memadai.

  8. STUDI ANALISIS PENGELOLAAN HUTAN MANGROVE KABUPATEN CIREBON

    Directory of Open Access Journals (Sweden)

    Eka Fitriah

    2013-11-01

    Full Text Available Telah dilakukan studi analisis Pengelolaan Hutan Mangrove kabupaten Cirebon dengan pendekatan kulitatif deskriptif untuk mengkaji Peningkatan kerusakan yang berpotensi terhadap pelestarian kawasan mangrove, penurunan produktivitas sumber daya di kawasan mangrove, pelanggaran dan penyalahgunaan dalam pemanfaatan kawasan mangrove, potensi konflik horizontal pada masyarakat di kawasan mangrove dan Terjadi degradasi kearifan lokal dalam pengelolaan kawasan mangrove. Penelitian ini dilakukan dengan  pendekatan kualitatif deskriptif. Metode Penelitian yang digunakan adalah Field Research. Penelitian diawali dengan studi pustaka mengumpulkan referensi, kemudian melakukan Observasi lapangan dan wawancara mendalam dengan masyarakat. Kerusakan ekosistem mangrove merupakan hal yang sangat mengkhawatirkan, kerusakan ini disebabkan tekanan dari luar yang diperoleh dari perkembagan yang ada di sekitar wilayah mangrove, dan tekanan dari dalam yang berasal eksploitasi yang berlebihan terhadap kawasan mangrove. Masalah kerusakan hutan mangrove dapat ditangani dengan mengatasi akar permasalahan klasik yang melingkupinya. Pengolahan dapat diwujudkan melalui pengelolaan dan perlindungan ekosistem hutan mangrove secara terpadu dan berbasis masyarakat. Strategi pelibatan masyarakat dalam pelestarian hutan mangrove dengan menerapkan sistem insentif yang diharapkan dapat merangsang dan memacu usaha-usaha kegiatan pengelolaan ekosistem hutan mangrove yaitu melalui peningkatan kualitas sumberdaya manusia dan peningkatan peran serta masyarakat. Kata kunci: Analisis hutan mangrove, kabupaten Cirebon, berbasis masyarakat.

  9. Analisis Sektor Ekonomi Unggulan di Kabupaten Batanghari

    Directory of Open Access Journals (Sweden)

    Yurliana Yurliana

    2015-12-01

    Full Text Available Abstract. This study aimed to analyze the leading sectors in the district of Batanghari. The analysis tool used is location quotient, dynamic location quotient, shift-share and specialisation index. Based on the analysis found that the sectors of the economy in the district of Batanghari can be grouped into four criteria: 1 The leading sector is the services sector; 2 The main supporting sectors are the electricity sector and the transportation sector; 3 The prospective sectors are agriculture, industry, building and construction and trade sectors; 4 The less promising sector are the mining sector and the financial sector. Keywords: Leading sector, Main supporting sector, prospectif sector Abstrak Penelitian ini bertujuan untuk menganalisis sektor ekonomi unggulan di Kabupaten Batanghari. Alat analisis yang digunakan adalah location quotient, dinamic location quotient, shift-share dan indeks spesialisasi. Berdasarkan hasil analisis ditemukan bahwa sektor perekonomian di Kabupaten Batanghari dapat dikelompokkan atas empat kriteria yaitu: 1 sektor unggulan adalah sektor jasa-jasa; 2 sektor andalan adalah sektor listrik dan sektor pengangkutan; 3 sektor prospektif adalah sektor pertanian, industri, bangunan dan konstruksi serta sektor perdagangan; 4 sektor kurang prospektif adalah sektor pertambangan dan sektor keuangan. Kata kunci: Sektor unggulan, sektor andalan, sektor prospektif

  10. ANALISIS KEKUATAN STRUKTUR PADA KAPAL WISATA SUNGAI KALIMAS

    OpenAIRE

    Budianto Budianto

    2015-01-01

    Dalam mengembangkan sektor pariwisata di sungai Kalimas Surabaya, salah satu diantaranya adalah pembuatan perahu wisata sungai Kalimas. Dalam perancangan kapal wisata kalimas dengan menggunakan bahan komposit FRP (Fiber Reinforcement Plastic) yang menggunakan serat buatan alam yang tidak merusak ekosistem di sungai Kalimas dan memiliki kekuatan struktur kapal yang baik. Analisis perancangan struktur dalam perahu wisata sungai Kalimas yang menggunakan bahan FRP yang diterapkan pada analisis st...

  11. Analisis Kekuatan Struktur Pada Kapal Wisata Sungai Kalimas

    OpenAIRE

    Budianto, Budianto

    2015-01-01

    Dalam mengembangkan sektor pariwisata di sungai Kalimas Surabaya, salah satu diantaranya adalah pembuatan perahu wisata sungai Kalimas. Dalam perancangan kapal wisata kalimas dengan menggunakan bahan komposit FRP (Fiber Reinforcement Plastic) yang menggunakan serat buatan alam yang tidak merusak ekosistem di sungai Kalimas dan memiliki kekuatan struktur kapal yang baik. Analisis perancangan struktur dalam perahu wisata sungai Kalimas yang menggunakan bahan FRP yang diterapkan pada analisis st...

  12. Intranasal Fentanyl Intoxication Leading to Diffuse Alveolar Hemorrhage.

    Science.gov (United States)

    Ruzycki, Shannon; Yarema, Mark; Dunham, Michael; Sadrzadeh, Hossein; Tremblay, Alain

    2016-06-01

    Increasing rates of opioid abuse, particularly fentanyl, may lead to more presentations of unusual effects of opioid toxicity. Diffuse alveolar hemorrhage is a rare complication of fentanyl overdose. A 45-year-old male presented in hypoxic respiratory failure secondary to diffuse alveolar hemorrhage requiring intubation. Comprehensive drug screening detected fentanyl without exposure to cocaine. Further history upon the patient's recovery revealed exposure to snorted fentanyl powder immediately prior to presentation. Diffuse alveolar hemorrhage is a potential, though rare, presentation of opioid intoxication. Recognition of less common complications of opioid abuse such as diffuse alveolar hemorrhage is important in proper management of overdoses.

  13. IDENTIFIKASI MISKONSEPSI SISWA SMP PADA KONSEP FOTOSINTESIS MELALUI ANALISIS GAMBAR

    Directory of Open Access Journals (Sweden)

    Devi Ariandini

    2014-01-01

    Full Text Available Tujuan dari penelitian ini adalah untuk mengidentifikasi miskonsepsi siswa dengan analisis menggambar. Tiga puluh empat siswa di kelas 8 di sekolah menengah pertama digunakan sebagai subyek dalam penelitian ini. Teknik sampel menggunakan teknik purposive sampling. Data yang diperlukan untuk penelitian ini dikumpulkan melalui kuesioner, menggambar analisis rubrik, dan wawancara. Identifikasi Kesalahpahaman ditentukan dengan menggambar siswa berdasarkan menggambar kriteria klasifikasi oleh Kose (2008. Siswa diperintahkan untuk menarik tentang konsep fotosintesis setelah proses pembelajaran. Gambar siswa dianalisis dengan rubrik dan setelah itu mereka diwawancarai. Hasil penelitian menunjukkan tidak semua tingkat kriteria menggambar dari tingkat 1 sampai 5 diidentifikasi. Dari hasil analisa, gambar paling banyak ditemukan adalah pada tingkat 4. Gambar pada tingkat 4 dikategorikan sebagai gambar lengkap konsep fotosintesis dan tidak ada kesalahpahaman ditemukan. Berdasarkan gambar mereka, ada siswa 2,9% diidentifikasi yang diselenggarakan kesalahpahaman. Ada perbedaan jumlah siswa yang diadakan kesalahpahaman antara gambar hasil analisis dan hasil wawancara. Dari hasil wawancara, ada siswa 35,2% dimiliki kesalahpahaman, lebih dari menggambar hasil analisis. Ini berarti bahwa identifikasi kesalahpahaman melalui analisis gambar tidak efektif. Kesalahpahaman siswa yang paling sering terjadi pada konsep fotosintesis adalah tempat berlangsungnya fotosintesis. Faktor yang membuat kesalahpahaman siswa yaitu karena siswa itu sendiri dan lingkungannya. Kata Kunci: fotosintesis, kesalahpahaman, konsep, menggambar analisis

  14. PERFORATION OF INFERIOR ALVEOLAR NERVE BY MAXILLARY ARTERY. LA PERFORACION DEL NERVIO ALVEOLAR INFERIOR POR LA ARTERIA MAXILAR

    OpenAIRE

    Vanishree S Nayak; Ramachandra Bhat K; Prakash Billakanti Babu

    2011-01-01

    Infratemporal fossa is clinically important anatomical area for the delivery of local anesthetic agents in dentistry and maxillofacial surgery. Variations in the anatomy of the inferior alveolar nerve and maxillary artery were studied in infratemporal dissection. During routine dissection of the head in an adult male cadaver an unusual variation in the origin of the inferior alveolar nerve and its relationship with the surrounding structures was observed. The inferior alveolar nerve originate...

  15. Segment distraction to reduce a wide alveolar cleft before alveolar bone grafting.

    NARCIS (Netherlands)

    Binger, T.; Katsaros, C.; Rucker, M.; Spitzer, W.J.

    2003-01-01

    OBJECTIVE: To demonstrate a method for reduction of wide alveolar clefts prior to bone grafting. This method aims to facilitate bone grafting and achieve adequate soft tissue coverage of the graft with attached gingiva. CASE REPORT: Treatment of a patient with bilateral cleft lip and palate with a

  16. Alveolar soft part sarcoma: A rare diagnosis

    Directory of Open Access Journals (Sweden)

    Priyanka Sarkar

    2013-01-01

    Full Text Available Alveolar soft-part sarcoma (ASPS is an extremely rare disease arising from connective tissues with a propensity for recurrence and metastasis. Clinically, it can be confused with hemangioma or arterio-venous malformations. Thus, a high index of suspicion and histopathological examination are required to make a definitive diagnosis. We report a case of recurrent ASPS in a young female with multiple sites involvement without any features of metastasis who has been treated with excision of the symptomatic lesions followed by chemotherapy.

  17. Nostril Base Augmentation Effect of Alveolar Bone Graft

    Directory of Open Access Journals (Sweden)

    Woojin Lee

    2013-09-01

    Full Text Available Background The aims of alveolar bone grafting are closure of the fistula, stabilization ofthe maxillary arch, support for the roots of the teeth adjacent to the cleft on each side.We observed nostril base augmentation in patients with alveolar clefts after alveolar bonegrafting. The purpose of this study was to evaluate the nostril base augmentation effect ofsecondary alveolar bone grafting in patients with unilateral alveolar cleft.Methods Records of 15 children with alveolar clefts who underwent secondary alveolar bonegrafting with autogenous iliac cancellous bone between March of 2011 and May of 2012 werereviewed. Preoperative and postoperative worm’s-eye view photographs and reconstructedthree-dimensional computed tomography (CT scans were used for photogrammetry. Thedepression of the nostril base and thickness of the philtrum on the cleft side were measuredin comparison to the normal side. The depression of the cleft side pyriform aperture wasmeasured in comparison to the normal side on reconstructed three-dimensional CT.Results Significant changes were seen in the nostril base (P=0.005, the philtrum length(P=0.013, and the angle (P=0.006. The CT measurements showed significant changes in thepyriform aperture (P<0.001 and the angle (P<0.001.Conclusions An alveolar bone graft not only fills the gap in the alveolar process but alsoaugments the nostril base after surgery. In this study, only an alveolar bone graft was performedto prevent bias from other procedures. Nostril base augmentation can be achieved byperforming alveolar bone grafts in children, in whom invasive methods are not advised.

  18. Alveolar bone loss in obese subjects.

    Science.gov (United States)

    Alabdulkarim, Maher; Bissada, Nabil; Al-Zahrani, Mohammad; Ficara, Anthony; Siegel, Burton

    2005-04-01

    Obesity was found to be significantly associated with periodontal disease prevalence as measured by probing depth and clinical attachment loss. The aim of this study was to examine if obesity correlates with chronic periodontitis as diagnosed by radiographic alveolar bone loss. Four hundred subjects > or =18 years old were included; 200 with body mass index (BMI) > or =30 kg/m2 (obese) and 200 with BMI periodontitis. Obesity was found to be significantly associated with periodontitis in the uni-variate regression analysis (OR = 2.37, 95% CI, 1.55-3.63). After adjusting for age, gender, smoking, employment, diabetes, marital status, and number of teeth present, obese subjects were found to be 1.86 times more likely to have periodontitis (95% CI, 0.99-3.51) than non-obese ones. When the sample was stratified based on age, the multivariate association was statistically significant among individuals or = 40 years of age the association was statistically insignificant (OR = 1.06, 95% CI, 0.57-1.95). Stratifying the sample based on gender and smoking status revealed a stronger association among females than males (OR = 3.14 vs. 1.95) and among non-smokers than smokers (OR = 3.36 vs. 2.22). Obesity is associated with increased prevalence of periodontitis as measured by radiographic alveolar bone loss, especially among younger individuals. Prevention and management of obesity may be considered to promote better systemic and periodontal health.

  19. Analisis Model Manajemen Insiden Berbasis Cloud Computing

    Directory of Open Access Journals (Sweden)

    Anggi Sukamto

    2015-05-01

    Full Text Available Dukungan teknologi informasi yang diterapkan oleh organisasi membutuhkan suatu manajemen agar penggunaannya dapat memenuhi tujuan penerapan teknologi tersebut. Salah satu kerangka kerja manajemen layanan teknologi informasi yang dapat diadopsi oleh organisasi adalah Information Technology Infrastructure Library (ITIL. Dukungan layanan (service support merupakan bagian dari proses ITIL. Pada umumnya, aktivitas dukungan layanan dilaksanakan dengan penggunaan teknologi yang dapat diakses melalui internet. Kondisi tersebut mengarah pada suatu konsep cloud computing. Cloud computing memungkinkan suatu instansi atau perusahaan untuk bisa mengatur sumber daya melalui jaringan internet. Fokus penelitian ini adalah menganalisis proses dan pelaku yang terlibat dalam dukungan layanan khususnya pada proses manajemen insiden, serta mengidentifikasi potensi penyerahan pelaku ke bentuk layanan cloud computing. Berdasarkan analisis yang dilakukan maka usulan model manajemen insiden berbasis cloud ini dapat diterapkan dalam suatu organisasi yang telah menggunakan teknologi komputer untuk mendukung kegiatan operasional. Kata Kunci—Cloud computing, ITIL, Manajemen Insiden, Service Support, Service Desk.

  20. Prevention of Alveolar Osteitis After Third Molar Surgery ...

    African Journals Online (AJOL)

    2017-05-16

    May 16, 2017 ... development of alveolar osteitis were obtained and analyzed. Comparative statistics were done using ... KEY WORDS: Alveolar osteitis, chlorhexidine, prevention, warm saline. Department of Dental. Surgery .... healing by inducing vasodilatation of the vasculature of oral cavity, and thus enhances migration ...

  1. Increased alveolar soluble Annexin V promotes lung inflammation and fibrosis

    OpenAIRE

    Buckley, S.; Shi, W.; Xu, W.; Frey, M.R.; Moats, R.; Pardo, A.; Selman, M.; Warburton, D.

    2015-01-01

    The causes underlying the self-perpetuating nature of idiopathic pulmonary fibrosis (IPF), a progressive and usually lethal disease, remain unknown. We hypothesized that alveolar soluble Annexin V contributes to lung fibrosis, based on the observation that human IPF BALF containing high Annexin V levels promoted fibroblast involvement in alveolar epithelial wound healing that was reduced when Annexin V was depleted from the BALF.

  2. Alveolar ridge augmentation by osteoinductive materials in goats

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Roervik, M

    1992-01-01

    The purpose of the present study was to determine whether alveolar ridge augmentation could be induced in goats. In 12 male goats allogenic, demineralized, and lyophilized dentin or bone was implanted subperiosteally on the buccal sides of the natural edentulous regions of the alveolar process...

  3. Tongue-Palate Contact of Perceptually Acceptable Alveolar Stops

    Science.gov (United States)

    Lee, Alice; Gibbon, Fiona E.; O'Donovan, Cliona

    2013-01-01

    Increased tongue-palate contact for perceptually acceptable alveolar stops has been observed in children with speech sound disorders (SSD). This is a retrospective study that further investigated this issue by using quantitative measures to compare the target alveolar stops /t/, /d/ and /n/ produced in words by nine children with SSD (20 tokens of…

  4. Classification of alveolar bone destruction patterns on maxillary ...

    African Journals Online (AJOL)

    Objective: The defective diagnosis of alveolar structures is one of most serious handicaps when assessing available periodontal treatment options for the prevention of tooth loss. The aim of this research was to classify alveolar bone defects in the maxillary molar region which is a challenging area for dental implant ...

  5. Pulmonary alveolar proteinosis in a child from an informal settlement

    African Journals Online (AJOL)

    clinical, histopathological, biochemical and genetic data.[3]. Surfactant homeostasis is critical for lung function and is tightly regulated, in part by pulmonary granulocyte-macrophage colony- stimulating factor (GM-CSF), which is required for surfactant clearance by alveolar macrophages and alveolar macrophage maturation.

  6. Alveolar ridge preservation and biologic width management for ...

    African Journals Online (AJOL)

    Alveolar bone atrophy is a chronically progressive, irreversible process which results in bone loss in both the buccal, lingual and apico-coronal region. Without bone preservation measures, bone resorption is experienced and continues for life. Preservation of alveolar ridge is indicated when a tooth-supported fixed partial ...

  7. Diffuse alveolar hemorrhage in a young woman with systemic lupus ...

    African Journals Online (AJOL)

    Diffuse Alveolar Hemorrhage (DAH) is rarely reported complication of Systemic Lupus Erythematosus (SLE). A young woman diagnosed SLE, with a previously normal plain chest radiograph, developed acute onset cough, dyspnoea and hemoptysis. The repeat urgent chest radiograph revealed alveolar opacities. The triad ...

  8. ANALISIS VARIABEL KEUANGAN YANG MEMPENGARUHI KEBIJAKAN DEVIDEN

    Directory of Open Access Journals (Sweden)

    Sumiadji -

    2012-03-01

    Full Text Available Penelitian ini dilakukan untuk menguji pengaruh variabel keuangan yang terdiri dari: rasio pro-fitabilitas (return on assets, likuiditas (cash ratio, rasio hutang (debt to equity ratio, market value (earnings per share, dan perputaran total aset (total assets turnover terhadap kebijakan dividen yang diproksikan dengan dividend payout ratio (DPR pada perusahaan manufaktur yang terdaftar di Bursa Efek Indonesia tahun 2004-2008. Prosedur pemilihan sampel penelitian menggunakan purposive sampling sehingga menghasilkan 8 perusahaan yang memenuhi kriteria sampel. Data sekunder dikumpulkan dengan teknik dokumentasi bersumber dari Indonesian Capital Market Directory (ICMD, laporan keuangan, dan hasil Rapat Umum Pemegang Saham (RUPS. Teknik analisis yang digunakan dalam penelitian ini adalah analisis regresi linear berganda. Hasil penelitian ini adalah secara simultan variabel ROA, CR, DER, EPS dan TATO berpengaruh terhadap DPR. Secara parsial variabel yang mempengaruhi DPR adalah CR, EPS dan TATO. Varabel lainnya, yaitu ROA dan DER ditemukan tidak berpengaruh terhadap DPR. This research was conducted to examine the influence of the financial variables which consists of: return on assets (ROA, cash ratio (CR, debt to equity ratio (DER, earnings per share (EPS, and total asset turnover (TATO to the dividend policy that indicated by the dividend payout ratio (DPR of listed manufacturing company in Indonesia Stock Exchange  2004 to 2008. The sample selection procedure used was a purposive sampling so that it produced eight companies that met the sample criteria. Se-condary data was collected by the documentation technique were obtained from the Indonesian Capital Market Directory (ICMD, financial statements, and the results of the Annual General Meeting of Shareholders. The analysis technique used was multiple linear regression analysis. The research found that five variables of kind of ROA, CR, DER, EPS dan TATO simultaneously influence to dividend

  9. PENENTUAN DAERAH RAWAN GIZI BERDASARKAN ANALISIS SPATIAL

    Directory of Open Access Journals (Sweden)

    Noviati Fuada

    2012-11-01

    Full Text Available Latar Belakang : Riset Kesehatan Dasar telah dilakukan di Indonesia (RISKESDAS 2007. Riset telah mengumpulkan data-data yang terdiri dari data kesehatan yang menggambarkan status gizi anak di bawah lima (antrophometri data di seluruh wilayah Indonesia. Kenyataanya masih sedikit analisis dengan menggunakan metode GIS, oleh karena itu artikel ini akan dikaji dengan metode spasial. Kajian ini diharapkan dapat memberikan informasi faktual, yang dapat mendukung kebijakan daerah. Tujuan: Mengidentifikasi daerah kabupaten/provinsi rawan status gizi anak balita, Metode: Analisa GIS denganmenggunakan metode spasial (pengelompokan data dan overlay dengan cara union. Data RISKESDAS 2007. Hasil: Wilayah tingkat tinggi potensi rawan gizi bermasalah (bersumber overlay antara peta sebaran status gizi balita dengan peta sebaran KK miskin  adalah; Kota Tasikmalaya, Kab. Tasikmalaya, Cianjur, Garut, Ciamis, Bandung, Subang dan Majalengka. Wilayah tingkat tinggi berpotensi terkena infeksi penyakit (berdasarkan peta sebaran resiko Infeksi Penyakit dan pemanfaatan posyandu adalah: Kabupaten Purwakarta, Karawang, Bekasi, Bogor, Sukabumi, Tasikmalaya, Kota Tasikmalaya, Bekasi dan Bogor. Wilayah berpotensi rawan gizi kategori tinggi (bersumber pada 4 faktor/peta sebaran meliputi, Kabupaten Cianjur, Garut, Tasikmalaya dan Kota Tasikmalaya. Kasus Gizi bermasalah berdasarkan 3 indeks gabungan menyebar di seluruh wilayah Provinsi Jawa Barat. Wilayah kasus gizi bermasalah kategori tinggi, dan kategori sedang, sebagian besar  terjadi di wilayah Kabupaten. Baik kategori sedang maupun tinggi merupakan wilayah yang berdampingan. Gambaran ini mengarah pada fakta bahwa  masalah gizi cenderung merupakan masalah epidemiologi. Kesimpulan: Terdapat empat wilayah kabupaten status gizi yang paling serius dalam kategori tinggi meliputi, Kabupaten Cianjur, Garut, Tasikmalaya dan Kota Tasikmalaya.  Kata kunci: analisis spasial, status gizi, posyandu, rawan gizi 

  10. Contemporary Approaches in the Repair of Alveolar Clefts

    Directory of Open Access Journals (Sweden)

    Ufuk Tatli

    2014-08-01

    Full Text Available Cleft lip and palate is one of the most common craniofacial anomalies. The repair of the alveolar clefts is an important part of the treatment for patients with cleft lip and palate. The treatment concepts of alveolar bone grafting are still controversial. The corresponding controversial issues are; timing of alveolar bone grafting, graft materials, and timing of the orthodontic expansion. In the present article, aforementioned controversial issues and contemporary treatment modalities of the maxillary alveolar clefts were reviewed in the light of current literature. In conclusion, the most suitable time for alveolar bone grafting is mixed dentition period. Grafting procedure may be performed in the early or late phases of this period depending on some clinical features. Adjunct orthodontic expansion procedures should be performed before and/or after grafting depending on the patient's current features. [Archives Medical Review Journal 2014; 23(4.000: 563-574

  11. PERFORATION OF INFERIOR ALVEOLAR NERVE BY MAXILLARY ARTERY. Perforation of inferior alveolar nerve by maxillary artery

    OpenAIRE

    Prakash B Billakanti

    2016-01-01

    La fosa infratemporal es un área anatómica clínicamente importante para la administración de agentes anestésicos locales en odontología y cirugía maxilofacial. Fueron estudiadas variaciones en la anatomía del nervio alveolar inferior y la arteria maxilar en la disección infratemporal. Durante la disección rutinaria de la cabeza en el cadáver de un varón adulto, fue observada una variación excepcional en el origen del nervio alveolar inferior y su relación con las estructuras circundantes. El ...

  12. ANALISIS VARIABILITAS CURAH HUJAN DAN SUHU DI BALI

    Directory of Open Access Journals (Sweden)

    Ogi Setiawan

    2017-01-01

    Full Text Available Indonesia sebagai negara kepulauan yang terdiri dari pulau-pulau besar dan kecil menjadi sangat rentan terhadap dampak perubahan iklim. Salah satu pulau yang juga rentan terhadap perubahan iklim adalah pulau Bali. Dampak potensial adanya perubahan iklim adalah perubahan pola hujan, peningkatan suhuudaradankenaikanpermukaanlaut. Sektoryangakanmenerimadampakperubahaniklimdengan serius adalah sektor kehutanan dan pertanian. Untuk mendukung upaya mitigasi dan adaptasi maka diperlukan informasi perubahan iklim yang terjadi. Penelitian ini bertujuan untuk mengetahui variabilitas iklim di Bali. Metode yang digunakan adalah analisis kecenderungan curah hujan, analisis perubahan suhu udara, analisis perubahan tipe iklim dan analisis pergeseran bulan basah, lembab dan kering. Data hujan yang digunakan adalah data hujan dari GPCC (1961-1998 dan BMKG Bali (19992008, sedangkan data suhu berasal dari BMKG Bali (2004-2008. Hasil analisis menunjukkan bahwa di pulau Bali secara umum sudah mengalami perubahan iklim. Tipe iklim berdasarkan Schmidt-Ferguson mengalami perubahan dari relatif basah menjadi agak kering. Suhu udara rata-rata bulanan serta curah hujan bulanan dan tahunan memiliki kecenderungan yang semakin meningkat. Bulan basah dan bulan kering telah mengalami pergeseran dan perubahan jumlahnya. Dampak perubahan iklim terhadap ekosistem hutan di Bali belum diketahui dengan pasti, namun terdapat beberapa implikasi perubahan iklim terhadap sektor kehutanan diantaranya kebakaran hutan dan perubahan jadwal penanaman.

  13. Analisis Kata menō Berdasarkan Surat 1 Yohanes

    Directory of Open Access Journals (Sweden)

    Nyoman Lisias Fernand Dju

    2016-03-01

    Full Text Available Tujuan penulisan ini adalah mengetahui makna kata menō dalam surat 1 Yohanes melalui pendekatan studi eksegesis yaitu analisis leksikal, analisis grammatikal, analisis konteks dan analisis historis. Perjanjian Baru menggunakan kata menō digunakan dalam hubungan dengan Allah, berarti menekankan sifatnya, sementara dalam hubungan dengan doktrin Kristen, kata ini digunakan secara kiasan menunjuk kepada ketetapan hidup sebagai umat yang diselamatkan. Secara grammatikal, bentuk yang menyatakan bahwa suatu tindakan (peristiwa sedang terjadi, subjeknya melakukannya secara aktif dan tindakan/peristiwa itu merupakan suatu realitas. Penulis surat ini, Yohanes menyatakan dengan serius bahwa hal yang paling mungkin bagi seseorang untuk tinggal dalam Anak dan Bapa adalah harus tetap tinggal di dalam firman yang “telah kamu dengar dari mulanya.” Sedangkan pendekatan analisis konteks arti menō adalah orang yang lahir dari Allah dan berada di dalam Dia memiliki potensi untuk menjauhkan diri dari dosa karena benih ilahi tinggal tetap di dalamnya dan karena mereka mengenal Dia. Dalam konteks historis penggunaan kata menō yang di dalamnya terkandung pengajaran dan nasihat yang mendasar mengenai doktrin dan praktika hidup Kristen jelas menunjukkan bahwa secara historis teologis kata ini merupakan kata yang penting dalam pergumulan iman dan perkembangan doktrin dalam komunitas Kristen mula-mula. 

  14. Proteomic Analysis of Gingival Tissue and Alveolar Bone during Alveolar Bone Healing*

    OpenAIRE

    Yang, Hee-Young; Kwon, Joseph; Kook, Min-Suk; Kang, Seong Soo; Kim, Se Eun; Sohn, Sungoh; Jung, Seunggon; Kwon, Sang-Oh; Kim, Hyung-Seok; Lee, Jae Hyuk; Lee, Tae-Hoon

    2013-01-01

    Bone tissue regeneration is orchestrated by the surrounding supporting tissues and involves the build-up of osteogenic cells, which orchestrate remodeling/healing through the expression of numerous mediators and signaling molecules. Periodontal regeneration models have proven useful for studying the interaction and communication between alveolar bone and supporting soft tissue. We applied a quantitative proteomic approach to analyze and compare proteins with altered expression in gingival sof...

  15. Hemorragia alveolar associada a nefrite lúpica Alveolar hemorrhage associated with lupus nephritis

    Directory of Open Access Journals (Sweden)

    Ricardo Henrique de Oliveira Braga Teixeira

    2003-12-01

    Full Text Available Hemorragia alveolar, como causa de insuficiência respiratória, é pouco freqüente, com diversas etiologias possíveis. Entre elas, o lúpus eritematoso sistêmico, que se apresenta geralmente como síndrome pulmão-rim, possui alta morbimortalidade. Acredita-se que a patogênese da microangiopatia, tanto renal como pulmonar, esteja associada ao depósito de imunocomplexos, que ativariam as vias de apoptose celular. Relatam-se dois casos de pacientes com nefrite lúpica que evoluíram com hemorragia alveolar associada à insuficiência respiratória necessitando de ventilação mecânica com evoluções totalmente distintas frente às terapias farmacológicas. O achado de anticorpos antimembrana basal em um dos casos evidencia a multiplicidade de mecanismos fisiopatológicos possivelmente envolvidos, que poderiam justificar as respostas heterogêneas frente aos tratamentos disponíveis.Alveolar hemorrhage leading to respiratory failure is uncommon. Various etiologies have been reported, including systemic lupus erythematosus, which generally presents as pulmonary-renal syndrome. It is believed that the pathogenesis of microangiopathy is related to deposits of immune complexes that lead to activation of cellular apoptosis. The authors report two cases of alveolar hemorrhage and respiratory failure, both requiring mechanical ventilation. The two cases had opposite outcomes after pharmacological therapy. The presence of anti-glomerular basement membrane antibodies in one of the cases demonstrates the multiplicity of physiopathological mechanisms that may be involved. This multiplicity of mechanisms provides a possible explanation for the heterogeneous responses to the available treatments.

  16. [Massive alveolar haemorrhage in Wegener's granulomatosis].

    Science.gov (United States)

    Valero-Roldán, J; Nuñez-Castillo, D; Fernández-Fígares, C; López-Leiva, I

    2014-01-01

    Wegener's granulomatosis is a systemic vasculitis with involvement of primary granulomatous upper and lower respiratory tract, glomerulonephritis and vasculitis of small vessels. The lung disease ranges from asymptomatic pulmonary nodules to pulmonary infiltrates and fulminant alveolar haemorrhage. The prognosis is poor due to kidney and respiratory failure, although the data are changing due to new treatments with glucocorticoids and cyclophosphamide. We report a case with severe lung disease, which after appropriate anamnesis, multiple tests, and optimal sequential action, the patient was diagnosed with Wegener's granulomatosis. This disease has a low incidence in the Emergency Department, where the patient history supported by the appropriate additional provides a diagnostic suspicion. It is important that the Emergency Department has the skills to manage the stability in these patients in order to resolve their symptoms. Copyright © 2013 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

  17. Accelerated orthodontics with alveolar decortication and augmentation: a case report.

    Science.gov (United States)

    Yezdani, A Arif

    2012-01-01

    This case report reiterates the fact that selective alveolar decortication in conjunction with periodontal alveolar augmentation with a bone graft indubitably and efficaciously produces rapid orthodontic tooth movement. A 29-year-old woman presented with a Class I malocclusion and increased bidentoalveolar protrusion with increased spacing between the maxillary and mandibular incisors. She readily agreed to selective alveolar decortication in conjunction with periodontal alveolar augmentation with a bone graft when presented with the proposal that her malocclusion could be corrected in one-third the treatment time required for conventional orthodontics. A preadjusted edgewise appliance (Roth prescription, 0.022 x 0.028-inch slot) was placed prior to the surgical procedure. One week later, full-thickness labial and lingual flaps were reflected in the maxillary and mandibular arches. The alveolar bone was selectively decorticated and periodontally augmented with a bone graft. Starting 1 week postsurgically, orthodontic adjustments were carried out every 2 weeks. From bracketing to debracketing, the entire orthodontic treatment took 7 months. The rapid orthodontic tooth movement was attributed to the regional acceleratory phenomenon, triggered by selective alveolar decortication. The subsequent periodontal alveolar augmentation with the bone graft repaired the bony dehiscences and enhanced the bone volume and dramatically improved the patient's soft tissue profile.

  18. ANALISIS GEN HAEMAGGLUTININ PADA VIRUS CAMPAK LIAR

    Directory of Open Access Journals (Sweden)

    Subangkit Subangkit

    2015-05-01

    Full Text Available AbstrakPenyakit Campak disebabkan oleh virus campak yang termasuk genus Morbilivirus dan Family Paramyxoviridae. Penyakit campak masih menjadi masalah kesehatan karena masih ditemukan Kejadian Luar Biasa (KLB di Indonesia. Salah satu penyebab terjadinya KLB tersebut diduga sebagaiakibat perbedaan antigenesitas antara strain vaksin yang digunakan dengan strain virus campak liar yang beredar di Indonesia. Penelitian ini bertujuan mendapatkan gambaran tentang karakteristik genetik gen Haemagglutinin virus campak liar yang ada di Indonesia. Spesimen yang digunakan sebanyak 27 isolat virus penyebab KLB dari 17 propinsi selama periode tahun 2003-2010. Isolat virus dilakukan pemeriksaan secara RT-PCR dan sekuensing dengan metode Sanger. Hasil sekuensing dianalisis dengan menggunakan perangkat lunak Bioedit 7.0 dan MEGA 4.0. Hasil penelitian didapatkan perbedaan 10 asam amino antara virus campak strain vaksin CAM-70 dan virus campak liar pada posisi D416N; K424T; V451M; N455T; V466I; I473T; F476L; Y481S atau Y481N; H495N; G505D. Kesimpulan penelitian ini adalah terdapat perbedaan karakteristik genetik antara virus campak liar di Indonesia berbeda dengan strain virus vaksin CAM-70.Kata kunci : Campak, Analisis Molekuler, Hemagglutinin, CD46AbstractMeasles is caused by virus belonging to the genus Morbilivirus and Family Paramyxoviridae. Measles is still a public health problem because outbreak of measles still found in Indonesia. Outbreak is suspected as a result of differences in antigenicity between vaccine strains used with wild-type measles virus strains circulating in Indonesia. This study aims to get genetic characteristics of wild-type measles virus haemagglutinin gene in Indonesia. The specimens were used 27 viral isolates from 17 provinces period 2003-2010. Viral isolates examined by RT-PCR and sequencing with Sanger method. Sequencing analysis were conducted using Bioedit 7.0 and MEGA 4.0 software. The results showed 10 amino acid differences

  19. Analisis Aliran Daya Berbasis Injeksi Arus dalam Bentuk Vektor

    Directory of Open Access Journals (Sweden)

    Ahmad Wira Satriawan

    2017-11-01

    Full Text Available Tulisan ini memaparkan hasil penelitian yang telah dilakukan untuk membandingkan metode analisis aliran daya berbasis injeksi arus dalam bentuk vektor dengan format polar dan rektangular. Penelitian ini dilakukan untuk memperoleh metode analisa aliran daya dengan perhitungan yang lebih cepat dan akurat, serta iterasi yang lebih sedikit. Metode iterasi Newton Raphson diadopsi dalam penelitian ini dan bahasa pemrograman Python serta library komputasinya digunakan. Analisis terhadap karakteristik konvergensi dari kedua format dilakukan pada IEEE 14-bus Test System. Dari penelitian ini diperoleh hasil bahwa format rektangular lebih unggul dibandingkan format polar untuk kasus yang diteliti.

  20. ANALISIS MODEL KEPUASAN TERHADAP PEMBELIAN ULANG

    Directory of Open Access Journals (Sweden)

    Naili Farida

    2014-09-01

    Full Text Available Tujuan penelitian ini yaitu untuk menguji pengaruh brand equity, nilai pelanggan dan lifestyle yang dimediasi kepuasan konsumen terhadap pembelian ulang produk gadget di Kota Semarang. Responden dalam penelitian ini adalah seluruh konsumen yang telah melakukan pembelian produk gadget merek Samsung, sebanyak 120 orang. Teknik sampling yang digunakan yaitu purposive sampling. Teknik analisis yang digunakan yaitu Partial Least Square (PLS. Hasil penelitian menunjukkan bahwa terdapat pengaruh brand equity terhadap kepuasan, namun dalam konteks lifestyle dan nilai pelanggan tidak ada pengaruh terhadap kepuasan. Sedangkan kepuasan menunjukkan adanya pengaruh terhadap pembelian ulang. Diharapkan dari hasil penelitian ini mampu meningkatkan pembelian ulang melalui brand equity, lifestyle dan nilai pelanggan dalam konteks kepuasan. The objective of the research was to test the influence of brand equity, customer value and lifestyle which were mediated by consumer satisfaction toward re-purchasing of gadget products in Semarang. The respondents of the study were all consumers who have purchased Samsung gadget products. It was a purposive sampling study with 120 respondents. The data were analyzed by Partial Least Square (PLS. The result of the study showed that there was an influence of brand equity toward satisfaction, but in the lifestyle context and customer value did not give any influence toward satisfaction. Whereas; the satisfaction gave influence toward re-purchase. It is expected that this study can increase the repurchasethrough brand equity, lifestyle and customer values in the satisfaction context.

  1. Analisis Komponen Biaya Asuransi Jiwa Dwiguna (Endowment

    Directory of Open Access Journals (Sweden)

    Desak Nyoman Trisnawati

    2014-06-01

    Full Text Available Asuransi adalah suatu istilah penyediaan jasa yang bergerak dalam bidang pertanggungan atau perlindungan. Seseorang yang telah mengasuransikan dirinya akan menyetujui kontrak yang disebut dengan polis. Di Indonesia terdapat beberapa jenis asuransi jiwa, salah satunya adalah asuransi jiwa dwiguna. Asuransi jiwa dwiguna adalah asuransi jiwa yang kepada tertanggung akan diberikan sejumlah uang pada akhir asuransi sesuai dengan polis. Jika tertanggung meninggal selama masa asuransi atau setelah akhir asuransi, kepada tertanggung akan diberikan uang sebesar uang pertanggungan. Untuk memenuhi pertanggungan, akan dibayarkan sejumlah uang yang disebut dengan premi. Premi terdiri dari premi netto dan premi bruto, premi netto adalah premi yang perhitungannya hanya berdasarkan faktor mortalita, sedangkan premi bruto adalah gabungan dari premi netto dengan faktor-faktor lain seperti faktor biaya. Penelitian ini membahas tentang analisis komponen biaya pada asuransi jiwa dwiguna. Komponen dari biaya asuransi jiwa dwiguna ini adalah biaya penutupan awal, biaya pengumpulan premi dan biaya pemeliharaan.Semua perhitungan aktuaria menggunakan tabel CSO 1980 dengan bunga 9%. Dengan menerapkan metode Eliminasi Gauss Jordan besarnya komponen biaya dari asuransi jiwa dwiguna masing-masing, biaya penutupan awal sebesar dan , biaya pengumpulan premi sebesar 0,075 dan biaya pemeliharaan sebesar 2.

  2. Alveolar cleft closure with iliac bone graft: A case report.

    Directory of Open Access Journals (Sweden)

    Tichvy Tammama

    2017-04-01

    Conclusion: The timing of alveolar bone grafting usually associated with the state of the developing of dentition. Post operative management is important to get a good result, and to prevent any complications.

  3. Radionuclide study of the action of cadmium on alveolar macrophages

    International Nuclear Information System (INIS)

    Reulet, Maryse.

    1976-01-01

    The experimental toxicity of cadmium was studied on the lung, using cadmium sulfate, cadmium acetate and the radioactive isotope cadmium 109 in chloride or acetate form. The results are given in the following order: part one is devoted to the results of investigations on chronic cadmium poisoning and the role of alveolar macrophages in this poisoning; in part two the uptake of cadmium on alveolar macrophages is studied with cadmium 109, administered intraperitoneally; in part three the action of cadmium on the phospholipid metabolism of alveolar macrophages is examined. The cadmium, as sulfate or acetate, is administered in several ways: by intraperitoneal injection; or by inhalation of cadmium dusts or aerosols. The effect of cadmium on the oxidative metabolism of alveolar macrophages is studied in part four. This work is carried out 'in vitro' and 'in vivo' after cadmium oxide dusting of the air [fr

  4. Horizontal alveolar bone loss: A periodontal orphan

    Directory of Open Access Journals (Sweden)

    Jayakumar A

    2010-01-01

    Full Text Available Background: Attempts to successfully regenerate lost alveolar bone have always been a clinician′s dream. Angular defects, at least, have a fairer chance, but the same cannot be said about horizontal bone loss. The purpose of the present study was to evaluate the prevalence of horizontal alveolar bone loss and vertical bone defects in periodontal patients; and later, to correlate it with the treatment modalities available in the literature for horizontal and vertical bone defects. Materials and Methods: The study was conducted in two parts. Part I was the radiographic evaluation of 150 orthopantomographs (OPGs (of patients diagnosed with chronic periodontitis and seeking periodontal care, which were digitized and read using the AutoCAD 2006 software. All the periodontitis-affected teeth were categorized as teeth with vertical defects (if the defect angle was ≤45° and defect depth was ≥3 mm or as having horizontal bone loss. Part II of the study comprised search of the literature on treatment modalities for horizontal and vertical bone loss in four selected periodontal journals. Results: Out of the 150 OPGs studied, 54 (36% OPGs showed one or more vertical defects. Totally, 3,371 teeth were studied, out of which horizontal bone loss was found in 3,107 (92.2% teeth, and vertical defects were found only in 264 (7.8% of the teeth, which was statistically significant (P<.001. Search of the selected journals revealed 477 papers have addressed the treatment modalities for vertical and horizontal types of bone loss specifically. Out of the 477 papers, 461 (96.3% have addressed vertical bone loss, and 18 (3.7% have addressed treatment options for horizontal bone loss. Two papers have addressed both types of bone loss and are included in both categories. Conclusion: Horizontal bone loss is more prevalent than vertical bone loss but has been sidelined by researchers as very few papers have been published on the subject of regenerative treatment

  5. Alveolar lymphangioma in infants: report of two cases.

    LENUS (Irish Health Repository)

    FitzGerald, Kirsten

    2012-02-01

    The alveolar lymphangioma is a benign but relatively rare condition found only in the oral cavities of black infants. Dentists practising in Ireland may be unaware of this condition due to its racial specificity. This paper presents two case reports of multiple alveolar lymphangiomas found in black infants in a children\\'s hospital in Ireland. The epidemiology, aetiology, clinical presentation, histology, and management options are discussed. The photographs should aid the practitioner in recognising these lesions.

  6. Soft tissue healing in alveolar socket preservation technique: histologic evaluations.

    Science.gov (United States)

    Pellegrini, Gaia; Rasperini, Giulio; Obot, Gregory; Farronato, Davide; Dellavia, Claudia

    2014-01-01

    After tooth extraction, 14 alveolar sockets were grafted with porous bovine bone mineral particles and covered with non-cross-linked collagen membrane (test group), and 14 alveolar sockets were left uncovered. At 5 and 12 weeks, microvascular density (MVD), collagen content, and amount of lymphocytes (Lym) T and B were analyzed in soft tissue. At 5 weeks, MVD was significantly lower and Lym T was significantly higher in tests than in controls (P healing process of the soft tissue.

  7. Dynamic thermal performance of alveolar brick construction system

    International Nuclear Information System (INIS)

    Gracia, A. de; Castell, A.; Medrano, M.; Cabeza, L.F.

    2011-01-01

    Highlights: → Even though U-value does not measure thermal inertia, it is the commonly used parameter. → The thermal performance analysis of buildings must include the evaluation of transient parameters. → Transient parameters of alveolar brick constructive system show good agreement with its low energy consumption. -- Abstract: Alveolar bricks are being introduced in building sector due to the simplicity of their construction system and to the elimination of the insulation material. Nevertheless, it is not clear if this new system is energetically efficient and which is its thermal behaviour. This paper presents an experimental and theoretical study to evaluate the thermal behaviour of the alveolar brick construction system, compared with a traditional Mediterranean brick system with insulation. The experimental study consists of measuring the thermal performance of four real house-like cubicles. The thermal transmittance in steady-state, also known as U-value, is calculated theoretically and experimentally for each cubicle, presenting the insulated cubicles as the best construction system, with differences around 45% in comparison to the alveolar one. On the other hand, experimental results show significantly smaller differences on the energy consumption between the alveolar and insulated construction systems during summer period (around 13% higher for the alveolar cubicle). These values demonstrate the high thermal efficiency of the alveolar system. In addition, the lack of agreement between the measured energy consumption and the calculated U-values, guides the authors to analyze the thermal inertia of the different building components. Therefore, several transient parameters, extracted from the heat transfer matrix and from experimental data, are also evaluated. It can be concluded that the alveolar brick construction system presents higher thermal inertia than the insulated one, justifying the low measured energy consumption.

  8. Alveolar ridge augmentation by osteoinductive materials in goats

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Roervik, M

    1992-01-01

    The purpose of the present study was to determine whether alveolar ridge augmentation could be induced in goats. In 12 male goats allogenic, demineralized, and lyophilized dentin or bone was implanted subperiosteally on the buccal sides of the natural edentulous regions of the alveolar process of...... of the mandible. Light microscopic evaluation revealed fibrous encapsulation, a few multinuclear giant cells, little inflammatory reaction, and no osteoinduction. It was concluded that no osteoinduction took place in goats....

  9. Postextraction Alveolar Ridge Preservation: Biological Basis and Treatments

    OpenAIRE

    Pagni, Giorgio; Pellegrini, Gaia; Giannobile, William V.; Rasperini, Giulio

    2012-01-01

    Following tooth extraction, the alveolar ridge undergoes an inevitable remodeling process that influences implant therapy of the edentulous area. Socket grafting is a commonly adopted therapy for the preservation of alveolar bone structures in combination or not with immediate implant placement although the biological bases lying behind this treatment modality are not fully understood and often misinterpreted. This review is intended to clarify the literature support to socket grafting in ord...

  10. Alveolar lymphangioma in infants: report of two cases.

    LENUS (Irish Health Repository)

    FitzGerald, Kirsten

    2009-06-01

    The alveolar lymphangioma is a benign but relatively rare condition found only in the oral cavities of black infants. Dentists practising in Ireland may be unaware of this condition due to its racial specificity. This paper presents two case reports of multiple alveolar lymphangiomas found in black infants in a children\\'s hospital in Ireland. The epidemiology, aetiology, clinical presentation, histology, and management options are discussed. The photographs should aid the practitioner in recognising these lesions.

  11. [Fatal alveolar haemorrhage following a "bang" of cannabis].

    Science.gov (United States)

    Grassin, F; André, M; Rallec, B; Combes, E; Vinsonneau, U; Paleiron, N

    2011-09-01

    The new methods of cannabis consumption (home made water pipe or "bang") may be responsible for fatal respiratory complications. We present a case, with fatal outcome, of a man of 19 years with no previous history other than an addiction to cannabis using "bang". He was admitted to intensive care with acute dyspnoea. A CT scan showed bilateral, diffuse alveolar shadowing. He was anaemic with an Hb of 9.3g/l. Bronchoalveolar lavage revealed massive alveolar haemorrhage. Investigations for infection and immunological disorder were negative and toxicology was negative except for cannabis. Antibiotic treatment was given and favourable progress allowed early discharge. Death occurred 15 days later due to alveolar haemorrhage following a further "bang" of cannabis. Autopsy showed toxic alveolar haemorrhage. The probable mechanism is pulmonary damage due to acid anhydrides released by the incomplete combustion of cannabis in contact with plastic. These acids have a double effect on the lungs: a direct toxicity with severe inflammation of the mucosa leading to alveolar haemorrhage and subsequently the acid anhydrides may lead to the syndrome of intra-alveolar haemorrhage and anaemia described in occupational lung diseases by Herbert in Oxford in 1979. It manifests itself by haemoptysis and intravascular haemolysis. We draw attention to the extremely serious potential consequences of new methods of using cannabis, particularly the use of "bang" in homemade plastic materials. Copyright © 2011 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  12. Alveolar socket healing: what can we learn?

    Science.gov (United States)

    Araújo, Mauricio G; Silva, Cléverson O; Misawa, Mônica; Sukekava, Flavia

    2015-06-01

    Tooth extraction induces a series of complex and integrated local changes within the investing hard and soft tissues. These local alterations arise in order to close the socket wound and to restore tissue homeostasis, and are referred to as '"socket healing". The aims of the present report were twofold: first, to describe the socket-healing process; and, second, to discuss what can be learned from the temporal sequence of healing events, in order to improve treatment outcomes. The socket-healing process may be divided into three sequential, and frequently overlapping, phases: inflammatory; proliferative; and modeling/remodeling. Several clinical and experimental studies have demonstrated that the socket-healing process promotes up to 50% reduction of the original ridge width, greater bone resorption at the buccal aspect than at the lingual/palatal counterpart and a larger amount of alveolar bone reduction in the molar region. In conclusion, tooth extraction, once a simple and straightforward surgical procedure, should be performed in the knowledge that ridge reduction will follow and that further clinical steps should be considered to compensate for this, when considering future options for tooth replacement. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Inferior alveolar canal course: a radiographic study.

    Science.gov (United States)

    Liu, Tie; Xia, Bing; Gu, Zhiyuan

    2009-11-01

    To describe the morphology and course of the inferior alveolar canal (IAC) as it appears in digital panoramic radiographs. Three hundred and eighty-six digital rotational panoramic radiographs (OPG) were studied using the Clinview Software (6.1.3.7 version, Instrumentarium). Among the 386 radiographs, 86 radiographs with 5-mm steel balls were used to calculate the magnification. The average magnification of radiographs in this study was 7.24+/-7.55%. The course of IAC as seen in the panoramic radiograph may be classified into four types: (1) linear curve, 12.75%, (2) spoon-shaped curve, 29.25%, (3) elliptic-arc curve, 48.5%, and (4) turning curve, 9.5%. On panoramic radiographs, the IAC appeared closest to the inferior border of the mandible in the region of the first molar. In relation to the teeth, on panoramic radiographs, the IAC appeared closest to the distal root tip of the third molar and furthest from the mesial root tip of the first molar. In the OPG, there are four types of IAC: linear, spoon shape, elliptic-arc, and turning curve. The data found in the study may be useful for dental implant, mandibule surgery, and dental anesthesia. The limitations of the panoramic radiograph in depicting the true three-dimensional (3D) morphology of the IAC are recognized, computed tomography (CT) and cone beam (CB)3D imaging being more precise.

  14. Populations at Risk for Alveolar Echinococcosis, France

    Science.gov (United States)

    Piarroux, Martine; Piarroux, Renaud; Knapp, Jenny; Bardonnet, Karine; Dumortier, Jérôme; Watelet, Jérôme; Gerard, Alain; Beytout, Jean; Abergel, Armand; Bresson-Hadni, Solange

    2013-01-01

    During 1982–2007, alveolar echinococcosis (AE) was diagnosed in 407 patients in France, a country previously known to register half of all European patients. To better define high-risk groups in France, we conducted a national registry-based study to identify areas where persons were at risk and spatial clusters of cases. We interviewed 180 AE patients about their way of life and compared responses to those of 517 controls. We found that almost all AE patients lived in 22 départements in eastern and central France (relative risk 78.63, 95% CI 52.84–117.02). Classification and regression tree analysis showed that the main risk factor was living in AE-endemic areas. There, most at-risk populations lived in rural settings (odds ratio [OR] 66.67, 95% CI 6.21–464.51 for farmers and OR 6.98, 95% CI 2.88–18.25 for other persons) or gardened in nonrural settings (OR 4.30, 95% CI 1.82–10.91). These findings can help sensitization campaigns focus on specific groups. PMID:23647623

  15. Computed tomography of the alveolar bone

    International Nuclear Information System (INIS)

    Schueller, H.

    1996-01-01

    In addition to the conventional radiological methods used in odontology, computed tomography (CT) provides superposition-free images of the mandible and maxilla. Its value has been proved not only in cases of malignancy but also in many other problems. If an examination is performed with a slice thickness of less than 1.5 mm, the form and position of retained teeth in the alveolar bone, as well as subsequent lesions of neighboring permanent teeth, can be visualized so that early treatment can be planned. If the parodontal space of a retained tooth is visible, orthodontic intervention is possible. Precise assessment of horizontal or vertical bone loss is essential in inflammatory dental diseases. The morphology and extent of benign cystic lesions are also shown by CT. With CT surgical strategy of an intended implant therapy can take into account the remaining bone substance and the exact position of nerves and foramina. If such therapy is possible, the location, form and number of implants are easily defined. (orig.) [de

  16. ANALISIS PENGARUH ENDORSEMENT DAN VIEWERS TERHADAP KREDIBILITAS YOUTUBERS

    OpenAIRE

    Savira, Faradhita Delicia

    2016-01-01

    Penelitian ini bertujuan untuk mengetahui dan menganalisis dampak endorsement dan viewers terhadap kredibilitas youtubers. Data primer diperoleh melalui survei dengan online maupun offline kuesioner. Teknik pengumpulan data dengan membagikan kuesioner kepada 200 partisipan, dimana partisipan tersebut dibagi dalam 4 kelompok penelitian. Partisipan yang dipilih dalam penelitian ini dilakukan dengan metode random sampling. Alat analisis yang digunakan adalah Two Way ANOVA dengan bantuan SPSS ...

  17. Analisis Sektor/Sub Sektor Unggulan di Kabupaten Bungo

    Directory of Open Access Journals (Sweden)

    Gafur Gafur

    2016-03-01

    Full Text Available Abstract. This study aimed to analyze the leading sectors in Bungo. The method used is Location Quotient (LQ, Dynamic Location Quotient (DLQ, specialization index, Growth Ratio Model (MRP. Based on analysis of LQ and DLQ, there are only two basis sectors at present and in the future, namely the construction sector and trade, hotels and restaurants. Based on the analysis of Specialization Index, in Bungo Regency has a concentration of the economy in the agricultural sector and the manufacturing sector. Based on MRP analysis also showed that prominent sector growth at the level of Bungo and Jambi Province, namely electricity, gas and water supply; the building sector; and trade, hotels and restaurants. Keywords : Location Quotient (LQ, Dinamic Location Quotient (DLQ, Specialization Index, Growth Ratio Model   Abstrak. Penelitian ini bertujuan untuk menganalisis sektor unggulan di Kabupaten Bungo. Metode yang digunakan adalah analisis Location Quotient (LQ, Dinamic Location Quotient (DLQ, indeks spesialisasi, Model Rasio Pertumbuhan (MRP. Berdasarkan analisis LQ dan DLQ,  hanya ada 2 sektor yang menjadi sektor basis pada saat ini dan pada masa yang akan datang yaitu sektor bangunan dan sektor perdagangan, hotel dan restoran. Berdasarkan analisis Indeks Spesialisasi, di Kabupaten Bungo telah terjadi konsentrasi ekonomi pada sektor pertanian dan sektor industri pengolahan. Berdasarkan analisis MRP juga dapat diketahui bahwa sektor yang menonjol pertumbuhannya pada tingkat Kabupaten Bungo dan Provinsi Jambi yaitu sektor listrik, gas dan air bersih; sektor bangunan; serta sektor perdagangan, hotel dan restoran. Kata Kunci : Location Quotient (LQ, Dinamic Location Quotient (DLQ, indeks spesialisasi, Model Rasio Pertumbuhan

  18. ANALISIS KONTRIBUSI PAJAK HOTEL TERHADAP PENDAPATAN ASLI DAERAH KABUPATEN NUNUKAN

    OpenAIRE

    -, MULIATI

    2014-01-01

    2014 Analisis Kontribusi Pajak Hotel terhadap Pendapatan Asli Daerah Kabupaten Nunukan Analysis of The Contributions Tax on Hotel Againts Regional Renenue Nunukan District Muliati Haerial M. Christian Mangiwa Penelitian ini bertujuan untuk mengetahui seberapa besar kontribusi pajak hotel terhadap pendapatan asli daerah, mengetahui sistem pengawasan, dan potensi yang ada untuk meningkatkan pajak hotel, mengetahui sistem dan prosedur...

  19. ANALISIS KEGAGALAN SOOTBLOWER TERHADAP PERPINDAHAN PANAS DI PIPA BOILER

    Directory of Open Access Journals (Sweden)

    Nurul Chandra Purnama

    2017-11-01

    Full Text Available Kementerian Energi dan Sumber Daya Mineral (ESDM menyebut konsumsi listrik nasional saat ini masih terbilang mini, yaitu seperempat dari indikator negara maju di dunia. Dengan angka 956 per Kilowatt-hour (kWh per kapita, konsumsi listrik Indonesia baru mencapai 23,9 persen dari konsumsi listrik negara maju sebanyak 4 ribu kWh per kapita. Salah satu komponen utama pada sistem pembangkit adalah boiler. Uap hasil produksi Boiler ini digunakan untuk memutar turbine yang akan menggerakkan generator guna menghasilkan listrik. Sootblower merupakan peralatan penunjang pada boiler yang berfungsi untuk membersihkan jelaga. Oleh karena itu peranan sootblower sangat penting dalam menjaga effisiensi boiler. Tujuan dari dilakukan analisis ini adalah mampu mengidentifikasi penurunan perpindahan panas yang terjadi pada pipa boiler, mengidentifikasi faktor penyebab kegagalan pada Sootblower, mengurangi energi yang terbuang akibat pengoperasian Sootblower. Metode penelitian untuk melakukan pelaksanaan analisis sootblower ini terdiri atas berbagai bagian, antara lain: studi literatur, proses pengumpulan data, kemudian data diolah dan dilakukan analisis guna mengetahui penyebab kegagalan pada sootblower. Hasil dari analisis kegagalan pada sootblower ini didapatkan bahwa sootblower gagal beroperasi karena ada masalah pada lance tube yang sering bengkok sehingga mempengaruhi proses perpindahan panas di pipa boiler, oleh sebab itu di rekomendasikan untuk penggantian material lance tube dari carbon steel A105 dengan defleksi 1,1 m menjadi chrome moly (AISI 4130 dengan defleksi 1,05 cm  dan dilakukan perawatan sootblower lebih baik dan rutin lagi.

  20. Modeling Alveolar Epithelial Cell Behavior In Spatially Designed Hydrogel Microenvironments

    Science.gov (United States)

    Lewis, Katherine Jean Reeder

    The alveolar epithelium consists of two cell phenotypes, elongated alveolar type I cells (AT1) and rounded alveolar type II cells (ATII), and exists in a complex three-dimensional environment as a polarized cell layer attached to a thin basement membrane and enclosing a roughly spherical lumen. Closely surrounding the alveolar cysts are capillary endothelial cells as well as interstitial pulmonary fibroblasts. Many factors are thought to influence alveolar epithelial cell differentiation during lung development and wound repair, including physical and biochemical signals from the extracellular matrix (ECM), and paracrine signals from the surrounding mesenchyme. In particular, disrupted signaling between the alveolar epithelium and local fibroblasts has been implicated in the progression of several pulmonary diseases. However, given the complexity of alveolar tissue architecture and the multitude of signaling pathways involved, designing appropriate experimental platforms for this biological system has been difficult. In order to isolate key factors regulating cellular behavior, the researcher ideally should have control over biophysical properties of the ECM, as well as the ability to organize multiple cell types within the scaffold. This thesis aimed to develop a 3D synthetic hydrogel platform to control alveolar epithelial cyst formation, which could then be used to explore how extracellular cues influence cell behavior in a tissue-relevant cellular arrangement. To accomplish this, a poly(ethylene glycol) (PEG) hydrogel network containing enzymatically-degradable crosslinks and bioadhesive pendant peptides was employed as a base material for encapsulating primary alveolar epithelial cells. First, an array of microwells of various cross-sectional shapes was photopatterned into a PEG gel containing photo-labile crosslinks, and primary ATII cells were seeded into the wells to examine the role of geometric confinement on differentiation and multicellular arrangement

  1. Analisis Nilai Murni Dalam Seteguh Karang

    Directory of Open Access Journals (Sweden)

    Jumali Hj. Selamat

    2012-12-01

    Full Text Available Penelitian ini menganalisis nilai­nilai murni dalam kehidupan remaja berdasarkan teks Seteguh Karang karya Tuan Faridah Syed Abdullah dari perspektif pendekatan moral. Analisis ini bertujuan melihat penyemaian nilai murni dalam karya untuk membentuk akhlak dan budi pekerti remaja. Menerusi pemupukan nilai murni diharap dapat melahirkan remaja yang berilmu pengetahuan, berakhlak mulia, berjiwa murni dan berkeupayaan memberi sumbangan kepada agama, bangsa dan tanah air. Kajian ini mendapati teks ini menyentuh nilai­nilai murni, seperti nilai baik hati, kasih sayang, keberanian, kerjasama, kesyukuran dan rasional. Peristiwa yang dilalui oleh manusia menyerlahkan pelbagai ragam, perlakuan dan hubungan manusia dari aspek positif dan negatif untuk dijadikan cerminan perbandingan dan contoh teladan. Elemen ini memberi pengalaman dan pengetahuan dalam kehidupan remaja. Abstract: This article analyzes the moral values in the adolescent life based on text Seteguh Karang authored by Tuan Faridah Syed Abdullah from the moral approach perspective. This analysis intends to observe the inculcation of moral values in the text to form the adolescent morals and characters. The inculcation of moral values is expected to generate adolescents who are knowledgeable, honorable, noble­minded and able to contribute to the religion, race and country. The analysis has found that this text touches moral values such as kindness, compassion, courage, cooperation, gratitude to God and rationalness. All events traversed by humans display various treatment and human relationships from positive and negative aspects to become a reflection of comparison and role models. This element provides the experience and knowledge in the adolescent life. Key Words: novel, moral values, adolescents, moral approach, human life

  2. ANALISIS KINERJA DENGAN MENGGUNAKAN PENDEKATAN RASIO CAMEL

    Directory of Open Access Journals (Sweden)

    Sri Murdiati

    2015-06-01

    Full Text Available Tujuan penelitian ini adalah untuk menganalisis tingkat kesehatan bank dilihat dari kategori CAMEL. Metode penelitian yang digunakan adalah studi kasus di PD BPR BKK Banjarharjo.Dalam menguji hipotesis digunakan alat analisis CAMEL. Hasil penelitian ini yaitu modal pada 2008 sampai 2010 termasuk dalam kriteria sehat. ROA meningkat 2008 sampai 2010 dengan kriteria sehat bagi biaya operasional yang dikeluarkan oleh pendapatan operasional yang seimbang. Rasio Kas tahun 2008 sampai 2010 termasuk dalam kriteria sehat berarti bank memiliki kemampuan untuk mengelola asset yang digunakan untuk membayar kewajiban. LDR mengalami tren yang signifikan selama tahun 2008 sampai 2010 sehingga dana yang diterima bank untuk meningkatkan baik tabungan, deposito berjangka, modal inti, yang berarti kemampuan bank untuk meningkatkan penyaluran kredit, IRR menunjukan nilai positif dalam menghadapi resiko pasar.Pengembangan tingkat kesehatan pada tahun 2008 sampai 2010 untuk komponen Capital, Assets, Laba dan Likuiditas meningkat. The goal of this research is to analyze the healtiness of banks seen from CAMEL category. The research applied a case study in PD BPR BKK Banjarharjo. The hypotheses tested using CAMEL analysis tools. The result of the study is that the modal used 2008 until 2010 is consideredin a healthy criteria. The increasing ROA in 2008 until 2010 is considered healthy criteria for operational expenses incurred by the operating income. Such condition meant that the banks are able to manage the assets which are used to pay the obligations. The significant increasing of LDR over the years 2008 until 2010 makes the received funds by the bank to increase the savings deposits, time deposits and the core capital. As the recunts, the banks are able to increase credit disstribution. More over, the IRR showed a positive values in the face of market risks and the development of healthy levels in 2008 until 2010 for the components of Capital, Assets, Earnings and

  3. ANALISIS FAKTOR YANG BERHUBUNGAN DENGAN KEJADIAN DISMENORHEA

    Directory of Open Access Journals (Sweden)

    Sadiman Sadiman

    2017-04-01

    Full Text Available Dismenorhea membuat wanita tidak bisa beraktivitas secara normal dan memerlukan obat. Keadaan tersebut menyebabkan menurunnya kualitas hidup wanita. Angka kejadian dismenorhea tipe primer di Indonesia adalah sekitar 54,89%, sedangkan sisanya dengan tipe sekunder.Hasil studi pendahuluan yang dilakukan di Program Studi Kebidanan Metro dari 74 mahasiswa yang dilakukan survey 63% (47 mahasiswa pernah mengalami dismenorhea. Sedangkan dari  47 mahasiswa yang pernah mengalami dismenorhea ada 9% atau 4 mahasiswa yang tidak mengikuti kuliah karena dismenorhea. Tujuan penelitian ini adalah untuk mengetahui faktor-faktor yang berhubungan dengan kejadian dismenorhea. Jenis penelitian ini adalah analitik dengan rancangan case control. Populasi dalam penelitian ini adalah mahasiswa Program Studi Kebidanan Metro dengan jumlah 280 mahasiswa. Besar sampel pada penelitian ini ditentukan berdasarkan rumus pengambilan sampel menggunakan rumus Lemeshow. Sampel kasus sama dengan sampel kontrol yaitu sampel kasus 53mahasiswa dan sampel kontrol 53mahasiswa. Teknik sampling yang digunakan dalam penelitian ini adalah random sampling atau pengambilan sampel secara acak atau random. Analisis untuk mengetahui hubungan usia menarche dan riwayat dismenorhea keluarga dengan kejadian dismenorheadengan menggunakan uji Chi-square dengan nilai alfa 0,05. Tidak ada hubungan antara usia menarche dengan kejadian dismenorheanilai p=0,301. Ada hubungan antara lama menstruasi dan riwayat keluarga dengan kejadian dismenorhea dengan nilai p=0,032 dannilai p=0,000. Upaya untuk  mengurangi rasa nyeri saat dismenorhea, mahasiswa perlu menerapkan gaya hidup sehat seperti: rutin melakukan olah raga,  memenuhi kebutuhan gizi seimbang, tidak mengkonsumsi minuman yang mengandung kofein dan banyak minum air putih.

  4. Distracción osteogénica alveolar como método de aumento del reborde alveolar Alveolar osteogenic distraction as method to increase the alveolar ridge

    Directory of Open Access Journals (Sweden)

    Denia Morales Navarro

    2011-03-01

    Full Text Available La distracción osteogénica alveolar, como proceso biológico de neoformación de hueso alveolar, nos motivó a la realización de la presente revisión bibliográfica, con el objetivo enfatizar en el análisis de las variables: antecedentes históricos en Cuba, clasificación de los distractores, fases de la distracción (latencia, distracción y consolidación, indicaciones, contraindicaciones, ventajas, desventajas y complicaciones. Se realizó una revisión bibliográfica mediante la consulta de bases de datos de los sistemas referativos, como MEDLINE y PubMed con la utilización de descriptores "alveolar distraction" y "osteogenic distraction". Se consultaron las fuentes bibliográficas publicadas fundamentalmente en los últimos 5 años, lo que reveló que esta técnica es una excelente alternativa para la formación de huesos y tejidos blandos en zonas de atrofia alveolar, que consta de tres etapas: latencia, distracción y consolidación; un método previsible y con bajas tasas de reabsorción ósea en comparación con otras técnicas de aumento del reborde alveolar. Tiene su principal indicación en la terapia de implantes al proveer volumen óseo. Debemos individualizar cada caso y usar el método más adecuado según las características clínicas y personales del paciente. Una adecuada selección de los casos y una mejor comprensión de la técnica son los puntales para lograr exitosos resultados mediante la distracción osteogénica alveolar. En Cuba se ha aplicado poco la distracción alveolar, por lo que ha sido necesario ampliar los estudios sobre esta temática.The alveolar osteogenic distraction, as a biological process of alveolar bone neoformation, motivates us to make the bibliographic review whose objective was to emphasize in analysis the following variables: historical backgrounds in Cuba, distraction classification, distraction phases (latency, distraction and consolidation, indications, contraindications, advantages

  5. Proteinose alveolar pulmonar: série de quatro casos Pulmonary alveolar proteinosis: four cases

    Directory of Open Access Journals (Sweden)

    João Carlos Thompson

    2006-06-01

    Full Text Available OBJETIVO: Apresentar a evolução de quatro casos de proteinose alveolar pulmonar atendidos na Faculdade de Medicina da Universidade Estadual de Londrina, enfocando a importância da lavagem pulmonar total como tratamento de escolha. MÉTODOS: Trata-se de um estudo retrospectivo de quatro pacientes, sendo três do gênero feminino, com idades de 22 a 34 anos, e histórias semelhantes de dispnéia progressiva e tosse seca. O diagnóstico final foi realizado por biópsia pulmonar a céu aberto. A lavagem pulmonar total foi realizada em três pacientes em centro cirúrgico, com anestesia geral e sonda de duplo lúme. RESULTADOS: Um paciente apresentou regressão espontânea da proteinose alveolar pulmonar, não sendo necessária a lavagem pulmonar. Nos outros três casos, o número de lavagens variou: uma única lavagem unilateral com remissão completa do quadro bilateralmente, três lavagens sem melhora significativa e quatro procedimentos intercalados com períodos de melhora. CONCLUSÃO: Constatamos em nossa casuística que a lavagem pulmonar se mostrou eficiente, apesar de alguns pacientes apresentarem certa resistência ao procedimento, enquanto que outros podem ter remissão completa da doença.OBJECTIVE: The aim of this study was to present the evolution of four patients presenting pulmonary alveolar proteinosis and treated at the State University of Londrina School of Medicine. We focus on the importance of whole-lung lavage as the treatment of choice. METHODS: A retrospective study of four patients, three females and one male, 22 to 34 years old, presenting similar histories of progressive dyspnea and dry cough. The final diagnosis was established through open-lung biopsy. Three of the patients underwent whole-lung lavage in the Department of Surgery. The procedures were performed under general anesthesia and using a double-lumen endotracheal tube. RESULTS: One patient presented spontaneous regression of the pulmonary alveolar proteinosis

  6. Partial pulmonary embolization disrupts alveolarization in fetal sheep

    Directory of Open Access Journals (Sweden)

    Hooper Stuart B

    2010-04-01

    Full Text Available Abstract Background Although bronchopulmonary dysplasia is closely associated with an arrest of alveolar development and pulmonary capillary dysplasia, it is unknown whether these two features are causally related. To investigate the relationship between pulmonary capillaries and alveolar formation, we partially embolized the pulmonary capillary bed. Methods Partial pulmonary embolization (PPE was induced in chronically catheterized fetal sheep by injection of microspheres into the left pulmonary artery for 1 day (1d PPE; 115d gestational age; GA or 5 days (5d PPE; 110-115d GA. Control fetuses received vehicle injections. Lung morphology, secondary septal crests, elastin, collagen, myofibroblast, PECAM1 and HIF1α abundance and localization were determined histologically. VEGF-A, Flk-1, PDGF-A and PDGF-Rα mRNA levels were measured using real-time PCR. Results At 130d GA (term ~147d, in embolized regions of the lung the percentage of lung occupied by tissue was increased from 29 ± 1% in controls to 35 ± 1% in 1d PPE and 44 ± 1% in 5d PPE fetuses (p VEGF and Flk-1, although a small increase in PDGF-Rα expression at 116d GA, from 1.00 ± 0.12 in control fetuses to 1.61 ± 0.18 in 5d PPE fetuses may account for impaired differentiation of alveolar myofibroblasts and alveolar development. Conclusions PPE impairs alveolarization without adverse systemic effects and is a novel model for investigating the role of pulmonary capillaries and alveolar myofibroblasts in alveolar formation.

  7. Asymmetric [14C]albumin transport across bullfrog alveolar epithelium

    International Nuclear Information System (INIS)

    Kim, K.J.; LeBon, T.R.; Shinbane, J.S.; Crandall, E.D.

    1985-01-01

    Bullfrog lungs were prepared as planar sheets and bathed with Ringer solution in Ussing chambers. In the presence of a constant electrical gradient (20, 0, or -20 mV) across the tissue, 14 C-labeled bovine serum albumin or inulin was instilled into the upstream reservoir and the rate of appearance of the tracer in the downstream reservoir was monitored. Two lungs from the same animal were used to determine any directional difference in tracer fluxes. An apparent permeability coefficient was estimated from a relationship between normalized downstream radioactivities and time. Results showed that the apparent permeability of albumin in the alveolar to pleural direction across the alveolar epithelial barrier is 2.3 X 10(-7) cm/s, significantly greater (P less than 0.0005) than that in the pleural to alveolar direction (5.3 X 10(-8) cm/s) when the tissue was short circuited. Permeability of inulin, on the other hand, did not show any directional dependence and averaged 3.1 X 10(-8) cm/s in both directions. There was no effect on radiotracer fluxes permeabilities of different electrical gradients across the tissue. Gel electrophoretograms and corresponding radiochromatograms suggest that the large and asymmetric isotope fluxes are not primarily due to digestion or degradation of labeled molecules. Inulin appears to traverse the alveolar epithelial barrier by simple diffusion through hydrated paracellular pathways. On the other hand, [ 14 C]albumin crosses the alveolar epithelium more rapidly than would be expected by simple diffusion. These asymmetric and large tracer fluxes suggest that a specialized mechanism is present in alveolar epithelium that may be capable of helping to remove albumin from the alveolar space

  8. Alveolar ridge sockets preservation with bone grafting--review.

    Science.gov (United States)

    Allegrini, Sergio; Koening, Bruno; Allegrini, Marcia Rivellino Facci; Yoshimoto, Marcelo; Gedrange, Tomasz; Fanghaenel, Jochen; Lipski, Mariusz

    2008-01-01

    Alveolar bone seems to play a key role in providing support to the teeth, which are anchored to the bone by desmodontal fibers. The progressive alveolar bone resorption process occurs due to a loss of anatomic, biologic and mechanical factors. Mechanical stimulation of alveolar bone during mastication is crucial in keeping the teeth and underlying bone healthy. Tooth extraction leads to typical bone deficiency of ridge width and height of alveolar crest and reduces the possibility of placing screw titanium implants. When tooth extraction is necessary, trauma should be minimized during the procedure and bone preservation should receive careful attention. The literature has shown that early bone loss can be significantly reduced by socket grafting. The process of socket grafting requires an understanding of wound healing and an appreciation of the biological properties of the products available for socket grafting. Augmentative measures may, thus, be required to guarantee optimal prosthetic replacement of the lost tissue. Success or failure of augmentation procedures is dependent on revascularization and remodelling of the grafted bone into a vital, load bearing bone. In contrast to a visible three-dimensional change, the concept of remodelling refers to the internal turnover of bone, which is a coupled process where osteoclastic resorption and osteoblastic formation are more or less balanced. To restore alveolar bone loss and support efficient placement of dental implants, many different bone substitute such as autografts, allografts, xenografts, synthetic biomaterials and osteoactive agents have been proposed. In order to avoid harvesting an autograft, and thereby eliminating additional surgical procedures and risks, bone grafting materials and substitutes are alternative filler materials to be used for ridge augmentation. To present a literature review about biomaterials applicable in alveolar ridge sockets preservation to future implants insertion. The

  9. NFκB signaling in alveolar rhabdomyosarcoma

    Directory of Open Access Journals (Sweden)

    Megan M. Cleary

    2017-09-01

    Full Text Available Alveolar rhabdomyosarcoma (aRMS is a pediatric soft tissue cancer commonly associated with a chromosomal translocation that leads to the expression of a Pax3:Foxo1 or Pax7:Foxo1 fusion protein, the developmental underpinnings of which may give clues to its therapeutic approaches. In aRMS, the NFκB–YY1–miR-29 regulatory circuit is dysregulated, resulting in repression of miR-29 and loss of the associated tumor suppressor activity. To further elucidate the role of NFκB in aRMS, we first tested 55 unique sarcoma cell lines and primary cell cultures in a large-scale chemical screen targeting diverse molecular pathways. We found that pharmacological inhibition of NFκB activity resulted in decreased cell proliferation of many of the aRMS tumor cultures. Surprisingly, mice that were orthotopically allografted with aRMS tumor cells exhibited no difference in tumor growth when administered an NFκB inhibitor, compared to control. Furthermore, inhibition of NFκB by genetically ablating its activating kinase inhibitor, IKKβ, by conditional deletion in a mouse model harboring the Pax3:Foxo1 chimeric oncogene failed to abrogate spontaneous tumor growth. Genetically engineered mice with conditionally deleted IKKβ exhibited a paradoxical decrease in tumor latency compared with those with active NFκB. However, using a synthetic-lethal approach, primary cell cultures derived from tumors with inactivated NFκB showed sensitivity to the BCL-2 inhibitor navitoclax. When used in combination with an NFκB inhibitor, navitoclax was synergistic in decreasing the growth of both human and IKKβ wild-type mouse aRMS cells, indicating that inactivation of NFκB alone may not be sufficient for reducing tumor growth, but, when combined with another targeted therapeutic, may be clinically beneficial.

  10. Alveolar targeting of aerosol pentamidine. Toward a rational delivery system

    Energy Technology Data Exchange (ETDEWEB)

    Simonds, A.K.; Newman, S.P.; Johnson, M.A.; Talaee, N.; Lee, C.A.; Clarke, S.W. (Royal Free Hospital, London (England))

    1990-04-01

    Nebulizer systems that deposit a high proportion of aerosolized pentamidine on large airways are likely to be associated with marked adverse side effects, which may lead to premature cessation of treatment. We have measured alveolar deposition and large airway-related side effects (e.g., cough, breathlessness, and effect on pulmonary function) after aerosolization of 150 mg pentamidine isethionate labeled with {sup 99m}Tc-Sn-colloid. Nine patients with AIDS were studied using three nebulizer systems producing different droplet size profiles: the Acorn System 22, Respirgard II, and Respirgard II with the inspiratory baffle removed. Alveolar deposition was greatest and side effects least with the nebulizer producing the smallest droplet size profile (Respirgard II), whereas large airway-related side effects were prominent and alveolar deposition lowest with the nebulizer producing the largest droplet size (Acorn System 22). Values for alveolar deposition and adverse airway effects were intermediate using the Respirgard with inspiratory baffle removed, thus indicating the importance of the baffle valve in determining droplet size. Addition of a similar baffle valve to the Acorn System 22 produced a marked improvement in droplet size profile. Selection of a nebulizer that produces an optimal droplet size range offers the advantage of enhancing alveolar targeting of aerosolized pentamidine while reducing large airway-related side effects.

  11. Hypocapnic but Not Metabolic Alkalosis Impairs Alveolar Fluid Reabsorption

    Science.gov (United States)

    Myrianthefs, Pavlos M.; Briva, Arturo; Lecuona, Emilia; Dumasius, Vidas; Rutschman, David H.; Ridge, Karen M.; Baltopoulos, George J.; Sznajder, Jacob Iasha

    2005-01-01

    Acid-base disturbances, such as metabolic or respiratory alkalosis, are relatively common in critically ill patients. We examined the effects of alkalosis (hypocapnic or metabolic alkalosis) on alveolar fluid reabsorption in the isolated and continuously perfused rat lung model. We found that alveolar fluid reabsorption after 1 hour was impaired by low levels of CO2 partial pressure (PCO2; 10 and 20 mm Hg) independent of pH levels (7.7 or 7.4). In addition, PCO2 higher than 30 mm Hg or metabolic alkalosis did not have an effect on this process. The hypocapnia-mediated decrease of alveolar fluid reabsorption was associated with decreased Na,K-ATPase activity and protein abundance at the basolateral membranes of distal airspaces. The effect of low PCO2 on alveolar fluid reabsorption was reversible because clearance normalized after correcting the PCO2 back to normal levels. These data suggest that hypocapnic but not metabolic alkalosis impairs alveolar fluid reabsorption. Conceivably, correction of hypocapnic alkalosis in critically ill patients may contribute to the normalization of lung ability to clear edema. PMID:15764729

  12. Is alveolar cleft reconstruction still controversial? (Review of literature

    Directory of Open Access Journals (Sweden)

    Sameh A. Seifeldin

    2016-01-01

    Full Text Available Cleft lip and palate (CL/P is a frequent congenital malformation that manifests in several varieties including unilateral or bilateral and complete or incomplete. Alveolar cleft reconstruction remains controversial with regard to timing, graft materials, surgical techniques, and methods of evaluation. Many studies have been conducted addressing these points to develop an acceptable universal protocol for managing CL/P. The primary goal of alveolar cleft reconstruction in CL/P patients is to provide a bony bridge at the cleft site that allows maxillary arch continuity, oronasal fistula repair, eruption of the permanent dentition into the newly formed bone, enhances nasal symmetry through providing alar base support, orthodontic movement and placement of osseointegrated implants when indicated. Other goals include improving speech, improvement of periodontal conditions, establishing better oral hygiene, and limiting growth disturbances. In order to rehabilitate oral function in CL/P patients alveolar bone grafting is necessary. Secondary bone grafting is the most widely accepted method for treating alveolar clefts. Autogenous bone graft is the primary source for reconstructing alveolar cleft defects and is currently the preferred grafting material.

  13. ANALISIS TRANSIEN PADA FIXED BED NUCLEAR REACTOR

    Directory of Open Access Journals (Sweden)

    M. Rizaal

    2015-03-01

    Full Text Available Desain teras Fixed Bed Nuclear Reactor (FBNR yang modular memungkinkan pengendalian daya dapat dilakukan dengan mengatur ketinggian suspended core dan laju aliran massa pendingin. Tujuan penelitian ini adalah mempelajari perubahan daya termal teras sebagai akibat perubahan laju aliran massa pendingin yang masuk ke teras reaktor dan perubahan ketinggian suspended core serta mempelajari karakteristik keselamatan melekat yang dimiliki FBNR saat terjadi kegagalan pelepasan kalor (loss of heat sink. Keadaan neutronik teras dimodelkan pada kondisi tunak dengan menggunakan paket program Standard Reactor Analysis Code (SRAC untuk memperoleh data fluks neutron, konstanta grup, fraksi neutron kasip, konstanta peluruhan prekursor neutron kasip, dan beberapa parameter teras penting lainnya. Selanjutnya data tersebut digunakan pada perhitungan transien sebagai syarat awal. Analisis transien dilakukan pada tiga kondisi, yaitu saat terjadi penurunan laju aliran massa pendingin, saat terjadi penurunan ketinggian suspended core, dan saat terjadi kegagalan sistem pelepasan kalor. Hasil yang diperoleh dari penelitian ini menunjukkan bahwa penurunan laju aliran massa pendingin sebesar 50%, dari kondisi normal, menyebabkan daya termal teras turun 28% dibanding daya sebelumnya. Penurunan ketinggian suspended core sebesar 30% dari ketinggian normal menyebabkan daya termal teras turun 17% dibanding daya sebelumnya. Sementara untuk kondisi kegagalan sistem pelepasan kalor, daya termal teras mengalami penurunan sebesar 76%. Dengan demikian, pengendalian daya pada FBNR dapat dilakukan dengan mengatur laju aliran massa pendingin dan ketinggian suspended core, serta keselamatan melekat yang handal pada kondisi kegagalan sistem pelepasan kalor. Kata kunci: FBNR, transien, daya, laju aliran massa, suspended core Modular in design enables Fixed Bed Nuclear Reactor (FBNR power controlled by the adjustment of suspended core and coolant flow rate. The main purposes of this paper

  14. Diffuse bronchiolo-alveolar carcinoma in a dog.

    Science.gov (United States)

    Bertazzolo, W; Zuliani, D; Pogliani, E; Caniatti, M; Bussadori, C

    2002-06-01

    An eight-year-old female German wirehaired pointer was presented with signs of respiratory distress. Clinical examination, laboratory results, thoracic radiography and echocardiography indicated the presence of a diffuse interstitial lung disease with secondary appropriate erythrocytosis, pulmonary hypertension and cor pulmonale. Transthoracic fine needle aspiration biopsy of the lung suggested malignant epithelial neoplasia. A primary lung cancer with an unusually diffuse distribution of miliary/micronodular lesions was found at postmortem examination. Histological diagnosis was bronchiolo-alveolar carcinoma. Bronchiolo-alveolar carcinoma can occasionally occur in a diffuse fashion involving most or all of the lung parenchyma. In man, diffuse bronchiolo-alveolar carcinoma is considered a great imitator of other, more common diffuse interstitial forms of lung disease. This case report indicates that it is also a differential diagnosis to consider in dogs.

  15. Bone resorption and complications in alveolar distraction osteogenesis.

    Science.gov (United States)

    Ettl, Tobias; Gerlach, Till; Schüsselbauer, Thomas; Gosau, Martin; Reichert, Torsten E; Driemel, Oliver

    2010-10-01

    Distraction osteogenesis presents an alternative procedure for augmentation of atrophic alveolar bone prior to inserting dental implants. The aim of this retrospective study was to evaluate complications of this method with specific focus on bone resorption during the consolidation period and the follow-up period after dental implant insertion into distracted bone. Thirty partially edentulous patients underwent a total of 36 vertical alveolar distractions with an extraosseous distraction system. Eleven devices were placed in the maxilla and 25 in the mandible. Eighty-two dental implants were inserted after a mean consolidation period of 4.5 months. Treatment results were evaluated by means of panoramic radiographs for distraction follow-up and periapical radiographs for implant follow-up. The mean length of the transport segment was 19 mm. The average alveolar height achieved was 6.4 mm with a mean resorption of 1.8 mm (21.1%) at the time of dental implant insertion. Main problems comprised oral displacement of the transport segment (n = 15) and inadequate soft tissue extension (n = 13). Eighty-two dental implants were inserted with an overall survival rate of 95.1% after 45.8 months. For periimplant marginal bone, an average resorption of 3.5 mm was recorded 50.4 months after implant insertion. Although alveolar distraction osteogenesis seems to be an effective tool to treat vertical defects of the alveolar ridge, it is not an uncomplicated procedure. A combination with vestibular augmentation of autogenous bone grafts should be considered. Overcorrection of 20% may compensate bone relapse during the consolidation period of the distracted alveolar bone. Further bone resorption after dental implantation is common.

  16. Alveolar bone width preservation after decoronation of ankylosed anterior incisors.

    Science.gov (United States)

    Lin, Shaul; Schwarz-Arad, Dvorah; Ashkenazi, Malka

    2013-12-01

    The aim of the study was to assess the alteration of alveolar ridge dimensions after decoronation procedures in children and adolescents at least 1 year after surgery. Twelve children who underwent decoronation of ankylosed maxillary anterior incisors with at least 1 year after surgery follow-up were recalled for reevaluation. All decoronations were performed when the ankylosed teeth were submerged 1-1.5 mm. During the recall appointment, impressions of the upper arch were obtained. The bucco-palatal alveolar dimensions of the decoronated teeth were measured on the cast at the mid-mesiodistal distance from the missing tooth and were compared with the distance from the contralateral healthy incisor. Overall, 12 children (9 male and 3 female) were reevaluated up to 82 months after decoronation (mean, 49.58 ± 24 months). The mean age of the patients at the time of trauma was 9.83 ± 2.8 years. The average bucco-palatal dimension of the alveolar ridge at the mid-decoronation area was 9 ± 1 mm compared with 10.17 ± 0.9 mm at the contralateral homologous tooth (difference of 1.67 ± 1.12, P = .004). The findings show a positive statistical correlation between the duration of the follow-up period and the bucco-palatal dimension of the alveolar ridge (P = .027). Although decoronation of ankylosed young permanent incisors resulted in a decrease in the bucco-palatal dimension with time, it did not prevent additional alveolar growth that occurs with age in a developing child and thus may help maintain the alveolar bone ridge width, height, and continuity and assist in future rehabilitation with less invasive ridge augmentation procedures required for implant placement. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  17. Proximal alveolar bone loss in a longitudinal radiographic investigation

    International Nuclear Information System (INIS)

    Bolin, A.; Lavstedt, S.; Henrikson, C.O.; Frithiof, L.

    1986-01-01

    The difference in proximal alveolar bone height between 1970 and 1980, the ''ABD index'', has been measured longitudinally in radiographs from an unselected material. The group constitutes 406 individuals born in 1904 - 1952 in the county of Stockholm. 13 of 18 predictors determined in 1970 were significantly related to the ABD index in the simple correlation analyses. The predictor ''the alveolar bone loss 1970'' (ABL index 1970) had the strongest correlation to the ABD index. In the stepwise multiple regression analysis the predictor ABL index 1970 and three other predictors reached significant levels. These were age, number of lost teeth and Russell's Periodontal Index

  18. Postextraction alveolar ridge preservation: biological basis and treatments.

    Science.gov (United States)

    Pagni, Giorgio; Pellegrini, Gaia; Giannobile, William V; Rasperini, Giulio

    2012-01-01

    Following tooth extraction, the alveolar ridge undergoes an inevitable remodeling process that influences implant therapy of the edentulous area. Socket grafting is a commonly adopted therapy for the preservation of alveolar bone structures in combination or not with immediate implant placement although the biological bases lying behind this treatment modality are not fully understood and often misinterpreted. This review is intended to clarify the literature support to socket grafting in order to provide practitioners with valid tools to make a conscious decision of when and why to recommend this therapy.

  19. Repopulation of denuded tracheal grafts with alveolar type II cells

    International Nuclear Information System (INIS)

    Johnson, N.F.

    1988-01-01

    Repopulation of denuded heterotopic tracheal grafts with populations of specific epithelial cell types is one approach to study the differentiation potential of various cell types. This technique has been adopted to delineate the differentiation pathways of alveolar type II cells isolated from rat lungs. Under the conditions of this experiment, the reestablished epithelial lining was alveolar-like, however, ultrastructural analysis of the cells showed them to be like Clara cells. These preliminary results suggest that the secretary cells of the lung parenchyma and terminal airways may share a common ancestry. (author)

  20. Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients

    DEFF Research Database (Denmark)

    Andersen, Kristian

    2012-01-01

    Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients......Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients...

  1. Secondary bone grafting for alveolar cleft in children with cleft lip or cleft lip and palate

    NARCIS (Netherlands)

    Guo, J.; Li, C.; Zhang, Q.; Wu, G.; Deacon, S.A.; Chen, J.; Hu, H.; Zou, S.; Ye, Q.

    2011-01-01

    BACKGROUND: Secondary alveolar bone grafting has been widely used to reconstruct alveolar cleft. However, there is still some controversy. OBJECTIVES: To compare the effectiveness and safety of different secondary bone grafting methods. SEARCH STRATEGY: The final electronic and handsearches were

  2. Identifiksi Sebaran Litologi berdasarkan Analisis Data Resistivitas di Gunung Wungkal

    OpenAIRE

    Nurul Dzakiya; MGS. Dwiki Nugraha; Nenden L. Sidik; Trias Galena

    2017-01-01

    Analisis data untuk mengidentifikasi sebaran litologi yang memiliki potensi bahan galian industri di Daerah Gunung Wungkal Yogyakarta dengan menggunakan metode resistivitas dan survei geologi permukaan telah dilakukan. Hasil korelasi kedua data tersebut menunjukkan sebaran litologi merupakan pelapukan intrusi batuan beku yang kemudian menghasilkan material lempung (6,0-10 m), lempung pasiran (11-30 m) dan lapukan batuan diorit (30-55 m) yang berada di kedalaman berbeda. Ketebalan batuan di pe...

  3. Uso de Analisis de Covarianza (ANCOVA en investigacion cientifica.

    Directory of Open Access Journals (Sweden)

    Badii, M.H.

    2008-01-01

    Full Text Available The basics of the ANalisis of COVAriance (ANCOVA are given. The objectives and the application of ANCOVA are laid out. Techniques for the estimation of contrasts and for the control and reduction of the degree of error are discussed. The application of a simple ANCOVA using real data is highlighted. The application of this technique in fixing the auxiliary variable in experimentation is emphasized.

  4. Batman sebagai Pahlawan Borjuis (Analisis Semiotika pada Film Batman Returns)

    OpenAIRE

    Muthia, Shafira Indah; Nugroho, AdI; Lukmantoro, Triyono

    2013-01-01

    Nama : Shafira Indah MNIM : D2C009036Judul : Batman Sebagai Pahlawan Borjuis(Analisis Semiotika pada Film Batman Returns)ABSTRAKBatman merupakan salah satu karakter superhero (pahlawan super) yangeksistensinya dalam dunia perfilman Hollywood tidak dapat diragukan lagi. Mengawalikesuksesan melalui komik dan serial TV, Batman telah berhasil menjadi film superheroterbaik dan terlaris sepanjang masa. Namun penelitian ini akan mengkritik sosok pahlawanborjuis yang direpresentasikan dalam karakter ...

  5. ANALISIS KEBIJAKAN PENANAMAN MODAL ASING DI KABUPATEN BANTAENG

    OpenAIRE

    RACHMAT, ANUGRAH

    2015-01-01

    2015 Anugrah Rachmat, Nomor Induk E12110255,Program Studi Ilmu Pemerintahan, Fakultas Ilmu Sosial dan Ilmu Politik, Unversitas Hasanuddin, Menyusun Skripsi dengan judul ??? Analisis Kebijakan Penanaman Modal Asing di Kabupaten Bantaeng???. Di bawah bimbingan Dr. H. Andi Gau Kadir, M.A sebagai pemimbing I dan Dr. Hj.Nurlinah, M.Si sebagai pembimbing II. Penelitian ini bertujuan untuk mengambarkan model invetasi penanaman modal asing serta mengetahui prospeknya di Kabup...

  6. ANALISIS KEPEMIMPINAN BUPATI DALAM PENYELENGGARAAN PEMERINTAHAN DAERAH DI KABUPATEN PINRANG

    OpenAIRE

    -, M.RIJAL.R

    2015-01-01

    2015 M.Rijal.R, Nomor Pokok E121 11 256, Program Studi Ilmu Pemerintahan,Jurusan Ilmu Politik Pemerintahan, Fakultas Ilmu Sosial dan Ilmu Politik Universitas Hasanuddin, menyusun skripsi dengan judul: ???ANALISIS KEPEMIMPINAN BUPATI DALAM PENYELENGGARAAN PEMERINTAHAN DAERAH DI KABUPATEN PINRANG??? di bawah bimbingan Dr. H. Andi Samsu Alam, M.Si dan A.Murfi S.Ip, M.Si. Penelitian ini bertujuan Untuk mengetahui gaya kepemimpinan yang digunakan bupati dalam penyelengga...

  7. ANALISIS KINERJA KEUANGAN PERUSAHAAN PT. ASURANSI JIWASRAYA (PERSERO) CABANG SULAWESI SELATAN

    OpenAIRE

    ARIANTY, ASTRI

    2012-01-01

    ANALISIS KINERJA KEUANGAN PERUSAHAAN PT. ASURANSI JIWASRAYA (PERSERO) CABANG SULAWESI SELATAN COMPANY FINANCIAL PERFORMANCE ANALYSIS PT. INSURANCE JIWASRAYA (LIMITED) SOUTH BRANCH SULAWESI Astri Arianty Prof. Dr. H. Muhammad Ali, SE., M.S Drs. Armayah Sida, M.Si Analisis terhadap kinerja keuangan perusahaan sangat penting dilakukan untuk mengetahui sejauh mana tingkat pencapaian yang telah diperoleh perusahaan sebagaimana tujuan perusahaan dalam menjalankan proses produk...

  8. Analisis Perbandingan Performansi dan Pemilihan Web Browser (Studi Kasus: Universitas Siliwangi)

    OpenAIRE

    Rachman, Andi Nur; Gufroni, Acep Irham; Hiron, Nurul; Rahmayati, Gina

    2013-01-01

    Semakin berkembangnya browser baik dari segi performansi maupun jumlah yang kerap membuat pengguna bingung untuk memilih dan tidak memanfaatkan fitur yang ditawarkan browser secara penuh. Dengan melakukan analisis perbandingan dan pembuatan panduan pemilihan browser, pengguna browser diharapkan dapat memilih browser secara lebih objektif dan sesuai dengan kebutuhan. Metodologi yang digunakan dalam penelitian ini adalah survey analitik dengan pendekatan cross sectional. Analisis performansi di...

  9. Analisis Perbandingan Performansi Dan Pemilihan Web Browser (Studi Kasus: Universitas Siliwangi)

    OpenAIRE

    Rachman, Andi Nur; Gufroni, Acep Irham; Hiron, Nurul; Rahmayati, Gina

    2013-01-01

    Semakin berkembangnya browser baik dari segi performansi maupun jumlah yang kerap membuat pengguna bingung untuk memilih dan tidak memanfaatkan fitur yang ditawarkan browser secara penuh. Dengan melakukan analisis perbandingan dan pembuatan panduan pemilihan browser, pengguna browser diharapkan dapat memilih browser secara lebih objektif dan sesuai dengan kebutuhan. Metodologi yang digunakan dalam penelitian ini adalah survey analitik dengan pendekatan cross sectional. Analisis performansi di...

  10. Microfinanza: analisi d’impatto di un programma in India

    Directory of Open Access Journals (Sweden)

    Tommaso Rondinella

    2005-03-01

    Full Text Available L’analisi d’impatto dei programmi di microfinanza è uno strumento utile sia per migliorare i servizi offerti sia per garantire ai donatori che il denaro concesso sia utilizzato per programmi efficaci nell’alleviare la povertà. Il presente lavoro è costituito da due parti: la prima è dedicata all’analisi d’impatto, la seconda all’analisi empirica sul campo. L’indagine è stata condotta attraverso l’utilizzo di uno strumento in grado di dare una indicazione chiara dei cambiamenti avvenuti nelle condizioni di vita dei beneficiari e con il pregio di essere applicabile a costi molto ridotti. I risultati ottenuti mostrano in che misura l’accesso al credito cambi le condizioni di vita dei più poveri inducendo consistenti aumenti del reddito familiare, dei risparmi, della diversificazione delle attività produttive e del consumo di cibo. Inoltre si osserva, all’interno dei nuclei familiari, un miglioramento della condizione femminile chiaramente dipendente dalla partecipazione al programma di microcredito

  11. La prospettiva transgenerazionale: i contributi dell’analisi transazionale

    Directory of Open Access Journals (Sweden)

    Alessia Dall’Argine

    2009-12-01

    Full Text Available Facendo riferimento alla “nuova” dimensione transgenerazionale, l'autrice propone un parallelismo tra la prospettiva psicanalitica e quella analitico-transazionale.Partendo da concetti come quelli di impianto ed intromissione delineati da Laplanche, l'autrice delinea un confronto con alcuni concetti chiave dell'Analisi Transazionale. In particolare viene fatto riferimento al copione di vita e ai messaggi ingiuntivi ed attributivi.Nella parte finale del lavoro viene delineata l'ipotesi di un possibile processo alla base  della  trasmissione  transgenerazionale,  secondo  l'ottica  dell'Analisi  Transazionale. Viene  inoltre presentata  una  situazione  clinica  per  mostrare  come  le  ingiunzioni  dal genitore  al bambino  possano  costituire  il  fondamento  di  contenuti  psichici  fra  le generazioni.L’articolo si conclude con una riflessione relativa al possibile statuto transgenerazionale di tutta l’Analisi Transazionale.

  12. ANALISIS KEKUATAN STRUKTUR PADA KAPAL WISATA SUNGAI KALIMAS

    Directory of Open Access Journals (Sweden)

    Budianto Budianto

    2015-02-01

    Full Text Available Dalam mengembangkan sektor pariwisata di sungai Kalimas Surabaya, salah satu diantaranya adalah pembuatan perahu wisata sungai Kalimas. Dalam perancangan kapal wisata kalimas dengan menggunakan bahan komposit FRP (Fiber Reinforcement Plastic yang menggunakan serat buatan alam yang tidak merusak ekosistem di sungai Kalimas dan memiliki kekuatan struktur kapal yang baik. Analisis perancangan struktur dalam perahu wisata sungai Kalimas yang menggunakan bahan FRP yang diterapkan pada analisis struktur konstruksi dengan menggunakan metode elemen hingga. Dimana diterapkan dengan mampu menerima beban baik dari dalam maupun luar pada perahu wisata sungai Kalimas FRP tersebut. Kemampuan kekuatan struktur yang cukup aman diijinkan, dengan nilai tengangan bending yang masih dalam nilai dibawah 67 mPa. Dimana dalam keadaan kondisi hogging maupun sagging telah dianalisis cukup aman kekuatan pada struktur perahu wisata sungai Kalimas FRP yang dapat timbul pembebanan akibat adanya manouvering tersebut, baik secara global memanjang kapal maupun struktur lokal didudukan mesin yang merupakan fokus konsentarsi utama. Untuk Struktur lokal di dudukan mesin dimana menerima beban statis dari mesin outboard maupun beban dinamis yang ditimbulkan akibat pergerakan perahu wisata Kalimas FRP tersebut. Perhitungan dengan mekanisme pembebanan distribusi merata ataupun beban terpusat merupakan faktor utama hasil analisis perancangan struktur perahu wisata sungai Kalimas yang effisien dan efektif.

  13. ANALISIS KARAKTERISTIK KONSUMEN BERAS DI KECAMATAN PEKANBARU KOTA KOTA PEKANBARU

    Directory of Open Access Journals (Sweden)

    ASGAMI PUTRI

    2016-03-01

    Full Text Available Penelitian ini bertujuan mengetahui karakteristik konsumen yang membeli beras baik beras unggul nasional maupun beras unggul lokal.Penelitian ini dilaksanakan di Kecamatan Pekanbaru Kota, Kota Pekanbaru.Sampel yang diambil sebanyak 120 orang. Metode penelitian yanng digunakan adalah accidental sampling. Pengumpulan data dilakukan dengan wawancara. Analisis yang digunakan dalam penelitian adalah analisis deskriptif.Karakteristik konsumen yang mengkonsumsi beras unggul nasional memiliki rata-rata umur 41 tahun, memiliki pendapatan rata-rata Rp.1.679.333,-, pekerjaan Ibu rumah tangga, memiliki tanggungan keluarga sebanyak 3 orang, memiliki pendidikan terakhir Diploma. Sedangkan karakteristik konsumen yang mengkonsumsi beras unggul lokal antara lain memiliki umur rata-rata 35 tahun, memiliki tanggngan keluarga sebanyak 3 orang, memiliki pendapatan keluarga sebanyak Rp. 3.274.638,-, memiliki pendidikan terakhir yaitu sarjana. Jenis beras unggul lokal yang banyak dikonsumsi adalah beras anak daro dan beras belida, sedangkan beras unggul nasional yang dikonsumsi adalah kuriak kusuik. Kata Kunci : Analisis Karakteristik Konsumen, Konsumen, Beras

  14. Analisis Strategi Peningkatan Layanan Sertifikasi Perangkat Telepon Seluler

    Directory of Open Access Journals (Sweden)

    Widya Budi Andhini

    2015-03-01

    Full Text Available Standardisasi sebagai unsur penunjang pembangunan mempunyai peran penting dalam usaha optimasi pendayagunaan sumber daya.Peningkatan standarisasi dan sertifikasi perangkat telekomunikasi dilaksanakan secara aktif dalam menjaga terlaksananya interkoneksi, seperti dalam Renstra KemKominfo Tahun 2010-2014. Tujuan kegiatan standardisasi telekomunikasi antara lain menjamin interoperabilitas dan interkonektivitas, mengendalikan mutu perangkat. Untuk meningkatkan penyelenggaraan sertifikasi perangkat, dilakukan kajian yang menggambarkan analisis strategi untuk meningkatkan penyelenggaraan sertifikasi telepon seluler. Penelitian ini menggunakan pendekatan kualitatif, dengan format desain deskriptif kualitatif, pendekatan kualitatif matriks SWOT untuk menghasilkan strategi. Pengumpulan data dilakukan melalui wawancara kepada narasumber terdiri dari Direktorat Standardisasi Ditjen SDPPI, Balai Besar Pengujian Perangkat Telekomunikasi, Telkom R&D Center, kuesioner kepada pabrikan dan toko handphone. Teknis analisis data menggunakan Model Miles and Huberman, dan analisis SWOT yaitu mengidentifikasi dan menganalisis faktor Strength (kekuatan, Weakness (Kelemahan, Opportunity (Peluang dan Threat (Tantangan. Hasil pembahasan memperlihatkan strategi masing-masing kolom di matriks SWOT adalah comparative advantage meliputi Roadmap pengembangan lembaga uji, perangkat, SDM; knowledge sharing; mobilization meliputi penyusunan aturan persyaratan teknis perangkat telekomunikasi, sosialisasi, survey; Divestment/ investment : facility sharing, kompetensi SDM, sosialisasi aplikasi online; dan Damage Control meliputi penambahan SDM, uji fungsi/pretest, pertemuan rutin antara Ditstand dan Lembaga Uji.

  15. ANALISIS CLUSTER K-MEANS DALAM PENGELOMPOKAN KEMAMPUAN MAHASISWA

    Directory of Open Access Journals (Sweden)

    B. Poerwanto

    2016-12-01

    Full Text Available Abstract. Cluster Analysis, K-Means Algorithm, Student Classification. This study aims to classify students based on learning outcomes for subject the basic of statistics (DDS, which is measured based on attendance, task, midterm (UTS, and final exams (UAS to further used to evaluate learning for subjects that require analysis of quantitative . This study uses k-means cluster analysis to classify the students into three groups based on learning outcomes. After grouped, there are 3 people in the low category, 27 in the medium category and over 70% in the high category.Abstrak. Analisis Cluster K-Means dalam Pengelompokan Kemampuan Mahasiswa. Pene-litian ini bertujuan untuk mengelompokkan mahasiswa berdasarkan hasil belajar mata kuliah dasar-dasar statistika (DDS yang diukur berdasarkan variabel nilai kehadiran, tugas, ujian tengah semester (UTS, dan ujian akhir semester (UAS untuk selanjutnya digunakan untuk mengevaluasi pembelajaran untuk mata kuliah yang membutuhkan kemampuan analisis kuantititatif yang baik. Penelitian ini menggunakan analisis cluster k-means dalam mengelompokkan mahasiswa ke dalam tiga kelompok berdasarkan hasil belajarnya. Seteleh dikelompokkan, terdapat 3 orang yang masuk pada kategori rendah, 27 orang pada kategori sedang dan lebih dari 70% pada kategori tinggi.Kata Kunci: Cluster Analysis, K-Means Algoritma, Klasifikasi Mahasiswa, Universitas Cokroaminoto Palopo

  16. Estetika Tari Minang dalam Kesenian Randai Analisis Tekstual-Kontekstual

    Directory of Open Access Journals (Sweden)

    Sri Rustiyanti

    2013-03-01

    Full Text Available ABSTRACT   This paper reveals textual and contextual Randai, among other things, an analysis of Gerak Ga­ lombang Randai, an analysis of the character of Anak Randai, and at the end of the study series, to reveal the values contained in Randai as a cultural reality, which in principle is an inseparable part of the existence of Minangkabau community as the cultural support. The variety of motion used in Gerak Galombang Randai is not only a decoration of the motion beauty (tangible, but it also can be translated, as well as a symbol or emblem that has educational meanings (intangible, and can be an example of the daily life of the indigenous Minangkabau society.   Keywords: Minang Dance aesthetic, Randai, textual­contextual analysis     ABSTRAK   Tulisan ini mengungkap teksual dan kontekstual Randai, di antaranya, analisis terhadap gerak galombang Randai, analisis karakter tokoh anak Randai, dan sebagai akhir dari rang- kaian penelitian ini, mengungkapkan nilai-nilai yang terdapat pada Randai sebagai realitas budaya, yang pada prinsipnya merupakan bagian yang tak dapat dipisahkan dari eksistensi masyarakat Minangkabau sebagai penyangga kebudayaan. Ragam gerak yang digunakan dalam gerak galombang Randai itu kiranya tidak hanya sekedar hiasan keindahan gerak be- laka (tangibel, namun ia dapat diterjemahkan, sekaligus merupakan simbol atau lambang yang bermakna  mendidik (intangibel, dan dapat   menjadi teladan dalam kehidupan se- hari-hari dalam masyarakat adat di Minangkabau.   Kata Kunci: estetika Tari Minang, Randai, analisis tekstual-kontekstual

  17. A novel semi-automatic segmentation protocol for volumetric assessment of alveolar cleft grafting procedures

    NARCIS (Netherlands)

    Janssen, Nard G.; Schreurs, Ruud; Bittermann, Gerhard K.P.; Borstlap, Wilfred A.; Koole, Ronald; Meijer, Gert J.; Maal, Thomas J.J.

    2017-01-01

    A novel protocol for volumetric assessment of alveolar cleft grafting procedures is presented. Eleven cone-beam computed tomography (CBCT) datasets of patients who underwent secondary alveolar cleft reconstructive surgery for a unilateral alveolar cleft were evaluated by two investigators. Residual

  18. A novel semi-automatic segmentation protocol for volumetric assessment of alveolar cleft grafting procedures.

    NARCIS (Netherlands)

    Janssen, N.G.; Schreurs, R.; Bittermann, G.K.P.; Borstlap, W.A.; Koole, R.A.; Meijer, G.J.; Maal, T.J.J.

    2017-01-01

    A novel protocol for volumetric assessment of alveolar cleft grafting procedures is presented. Eleven cone-beam computed tomography (CBCT) datasets of patients who underwent secondary alveolar cleft reconstructive surgery for a unilateral alveolar cleft were evaluated by two investigators. Residual

  19. Serial bronchoscopic lung lavage in pulmonary alveolar proteinosis under local anesthesia

    Directory of Open Access Journals (Sweden)

    K Rennis Davis

    2015-01-01

    Full Text Available Pulmonary alveolar proteinosis (PAP is a rare disease, characterized by alveolar accumulation of surfactant composed of proteins and lipids due to defective surfactant clearance by alveolar macrophages. Mainstay of treatment is whole lung lavage, which requires general anesthesia. Herein, we report a case of primary PAP, successfully treated with serial bronchoscopic lung lavages under local anesthesia.

  20. Autochthonous human alveolar echinococcosis in a Hungarian patient.

    Science.gov (United States)

    Dezsényi, Balázs; Strausz, Tamás; Makrai, Zita; Csomor, Judit; Danka, József; Kern, Peter; Rezza, Giovanni; Barth, Thomas F E; Casulli, Adriano

    2017-02-01

    Alveolar echinococcosis is a zoonotic parasitic disease causing a severe clinical condition and is known as the most deadly of all helminth infections. Moreover, this disease is also an increasing concern in Northern and Eastern Europe due to its spread in the wildlife animal host. An asymptomatic 70-year-old woman from south-western Hungary was diagnosed with multiple liver lesions. Imaging techniques (ultrasound, computed tomography and magnetic resonance imaging), serology (ELISA, indirect hemagglutination and Western blot), and conventional staining methods (hematoxylin-eosin and periodic acid-Schiff) were used for the detection of the disease. A histopathological re-evaluation of formalin-fixed paraffin block by immunohistochemical staining with the monoclonal antibody Em2G11 definitively confirmed the diagnosis of alveolar echinococcosis. To our knowledge, this is the first confirmed autochthonous case of human alveolar echinococcosis in Hungary. To what extent diagnostic difficulties may contribute to underestimate this zoonosis in Eastern Europe is unknown. Differential diagnosis with alveolar echinococcosis should be considered for patients with multiple, tumor-like cystic lesions of the liver, in countries where this parasite is emerging.

  1. Three‑dimensional Evaluation of Alveolar Bone Thickness of ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... mandibular anterior teeth are going to be retracted, mechanics for torque control should be preferred not to have uncontrolled tipping. In Class I, light orthodontic forces should be applied using elastic arch wires, and time must be allowed for the remodeling and healing of the alveolar bone in these patient ...

  2. Advanced Alveolar Rhabdomyosarcoma of the Uterus: A Case Report

    African Journals Online (AJOL)

    Alveolar rhabdomyosarcoma is an uncommon malignant soft tissue tumour rarely found in the female genital tract and carries a very poor prognosis especially in adults. A 44 year old premenopausal woman was evaluated for a lower abdominal mass, intermittent unprovoked vaginal bleeding and weight loss. Examination ...

  3. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings

    Directory of Open Access Journals (Sweden)

    Pilar Eguía-Aguilar

    2016-11-01

    The aggressive behavior of alveolar rhabdomyosarcoma has been associated with the expression of oncogenic fusion proteins resulting from chromosomal translocations, particularly t(2;13 (q35;q14 PAX3/FOXO1, and t(1;13 (p36;q14 PAX7/FOXO1 which were present in this patient.

  4. Complications in alveolar distraction osteogenesis of the atrophic mandible.

    NARCIS (Netherlands)

    Perdijk, F.B.T.; Meijer, G.J.; Strijen, P.J. van; Koole, R.A.

    2007-01-01

    To improve the starting point for placement of dental implants, 45 patients suffering from atrophied edentulous mandibles, with a vertical height varying between 7.3 and 15.8mm, were treated by alveolar vertical distraction osteogenesis (VDO). The mean follow-up period was 3 years, ranging from 1 to

  5. Alveolar pulmonary proteinosis: case report and literature review

    International Nuclear Information System (INIS)

    Vergara, Erika; Saenz, Alberto; Ojeda, Paulina

    2009-01-01

    We describe the case of a young women with primary alveolar proteinosis, with a short period of symptoms that are uncommon for this disease, without risk factors for this entity, the clinical evolution of the patient and some complications with the treatment. We review the literature for this entity.

  6. Buccal Infiltration versus Inferior Alveolar Nerve Block in Mandibular ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... Purpose: The purpose of this study is to compare the success rates of inferior alveolar nerve block (IANB) and buccal infiltration anesthesia of mandibular second premolar with irreversible pulpitis and to evaluate the level of patient discomfort with these methods. Matherials and Methods: Forty patients, who.

  7. Alveolar Bone Housing- A Modified Wilkodontics Approach- A Case Report

    OpenAIRE

    Awasthi, Eshan; Sanjay, Kothamachu; Bhongade, ML; Shrivastav, Sunita

    2016-01-01

    Accelerated orthodontic treatment is the need of the hour in current scenario as the conventional orthodontics is time taking. Corticotomy assisted orthodontics have been used for years to reduce the treatment duration by reducing the resistance provided by alveolar bone housing.

  8. Three‑dimensional evaluation of alveolar bone thickness of ...

    African Journals Online (AJOL)

    Aim: The aim of this randomized study was to compare the alveolar bone thickness (ABT) of the mandibular incisor teeth of dental and skeletal Class I, II, and III adult patients at labial and lingual aspects of the bone and develop recommendations for the associated movements of teeth in this region, taking vertical facial type ...

  9. Alveolar ridge augmentation in rats by Bio-Oss

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1991-01-01

    The purpose of the study was to examine if Bio-Oss initiated osteoinduction or osteoconduction when implanted into rats. Sintered and unsintered granules of the anorganic bovine bone Bio-Oss was implanted subperiosteally for alveolar ridge augmentation purposes and heterotopically in the abdominal...

  10. The Effect of Astragalus Extractive on Alveolar Bone Rebuilding ...

    African Journals Online (AJOL)

    Background: Postmenopausal osteoporosis (PMO) is an estrogen deficiency condition that causes severe loss of bone mass in the vertebrae and long bones. We explored the effect and the possible underlying mechanism of the extracts of Astragalus (AE) on the tooth alveolar bone rebuilding progress of postmenopausal ...

  11. Contribution of the tooth bud mesenchyme to alveolar bone

    Czech Academy of Sciences Publication Activity Database

    Diep, L.; Matalová, Eva; Mitsiadis, T. A.; Tucker, A. S.

    312B, č. 5 (2009), 510-517 ISSN 1552-5007 R&D Projects: GA ČR GC524/08/J032; GA AV ČR KJB500450802 Institutional research plan: CEZ:AV0Z50450515 Keywords : tooth * alveolar bone * bud Subject RIV: FF - HEENT, Dentistry Impact factor: 2.938, year: 2009

  12. Alveolar occupation infiltrations, eosinophilia in peripheral blood and bronchoalveolar lavage

    International Nuclear Information System (INIS)

    Hincapie Diaz, Gustavo Adolfo; Yama Mosquera, Erica; Guevara, Jairo

    2006-01-01

    A case of a patient of 25 years old is shown with the antecedent of no potable water consumption who entered for having pulmonary symptoms. Fever, presence of alveolar occupation infiltrations and eosinophilia in peripheral blood a treatment with antiparasitary started with a significant improvement of the symptoms, infiltrations and eosinophilia. it is considered eosinophilic pneumonia diagnostic by parasitary infection (Loeffler's syndrome)

  13. Pulmonary alveolar hemorrhage mimicking a pneumopathy: a rare ...

    African Journals Online (AJOL)

    Diffuse alveolar hemorrhage after percutaneous coronary intervention (PCI) is a rare complication. The diagnosis is difficult and can mimic by clinical and radiological features other diagnosis as pneumopathy. We herein report the case of a 63-year-old female admitted to the hospital for ST elevation myocardial infarction.

  14. Alveolar Ridge Split Technique Using Piezosurgery with Specially Designed Tips

    Directory of Open Access Journals (Sweden)

    Alessandro Moro

    2017-01-01

    Full Text Available The treatment of patients with atrophic ridge who need prosthetic rehabilitation is a common problem in oral and maxillofacial surgery. Among the various techniques introduced for the expansion of alveolar ridges with a horizontal bone deficit is the alveolar ridge split technique. The aim of this article is to give a description of some new tips that have been specifically designed for the treatment of atrophic ridges with transversal bone deficit. A two-step piezosurgical split technique is also described, based on specific osteotomies of the vestibular cortex and the use of a mandibular ramus graft as interpositional graft. A total of 15 patients were treated with the proposed new tips by our department. All the expanded areas were successful in providing an adequate width and height to insert implants according to the prosthetic plan and the proposed tips allowed obtaining the most from the alveolar ridge split technique and piezosurgery. These tips have made alveolar ridge split technique simple, safe, and effective for the treatment of horizontal and vertical bone defects. Furthermore the proposed piezosurgical split technique allows obtaining horizontal and vertical bone augmentation.

  15. Modulation of epithelial sodium channel in human alveolar epithelial ...

    African Journals Online (AJOL)

    Modulation of epithelial sodium channel in human alveolar epithelial cells by lipoxin A4 through AhR-cAMP-dependent pathway. Bi-Huan Cheng, Li-Wei Pan, Sheng-Rong Zhang, Bin-Yu Ying, Ben-Ji Wang, Guo-Liang Lin, Shi-Fang Ding ...

  16. Structural changes and effect of denopamine on alveolar fluid ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... sectioning plane, and D = the mean caliper diameter of pulmonary cell nuclei. The frequency of occurrence of nuclear profiles per unit area of a random sectioning plane (NA) was determined using the electron microscope. ..... Chronic pulmonary artery occlusion increases alveolar fluid clearance in rats.

  17. Pulmonary alveolar proteinosis — a case report and review

    African Journals Online (AJOL)

    Enrique

    with granular, eosinophilic, proteina- ceous material (Fig. 2) with preserva- tion of the alveolar architecture. The patient was treated by whole-lung lavage, followed by a 4-week trial of subcutaneous granulocyte-macro- phage colony-stimulating factor. (GM-CSF). The trial of GM-CSF failed, however, and the patient is cur-.

  18. Alveolar occupation infiltrations, eosinophilia in peripheral blood and bronchoalveolar lavage

    International Nuclear Information System (INIS)

    Hincapie Diaz, Gustavo Adolfo; Yama Mosquera, Erica; Guevara, Jairo

    2006-01-01

    A case of a patient of 25 years old is shown with the antecedent of no potable water consumption who entered for having pulmonary symptoms, fever, presence of alveolar occupation infiltrations and eosinophilia in peripheral blood treatment with antiparasitary started with a significant improvement of the symptoms, infiltrations and eosinophilia. It is considered eosinophilic pneumonia diagnostic by parasitary infection (Loefffers Syndrome)

  19. Buccal infiltration versus inferior alveolar nerve block in mandibular ...

    African Journals Online (AJOL)

    Purpose: The purpose of this study is to compare the success rates of inferior alveolar nerve block (IANB) and buccal infiltration anesthesia of mandibular second premolar with irreversible pulpitis and to evaluate the level of patient discomfort with these methods. Materials and Methods: Forty patients, who had irreversible ...

  20. The development and plasticity of alveolar type 1 cells

    Science.gov (United States)

    Yang, Jun; Hernandez, Belinda J.; Martinez Alanis, Denise; Narvaez del Pilar, Odemaris; Vila-Ellis, Lisandra; Akiyama, Haruhiko; Evans, Scott E.; Ostrin, Edwin J.; Chen, Jichao

    2016-01-01

    Alveolar type 1 (AT1) cells cover >95% of the gas exchange surface and are extremely thin to facilitate passive gas diffusion. The development of these highly specialized cells and its coordination with the formation of the honeycomb-like alveolar structure are poorly understood. Using new marker-based stereology and single-cell imaging methods, we show that AT1 cells in the mouse lung form expansive thin cellular extensions via a non-proliferative two-step process while retaining cellular plasticity. In the flattening step, AT1 cells undergo molecular specification and remodel cell junctions while remaining connected to their epithelial neighbors. In the folding step, AT1 cells increase in size by more than 10-fold and undergo cellular morphogenesis that matches capillary and secondary septa formation, resulting in a single AT1 cell spanning multiple alveoli. Furthermore, AT1 cells are an unexpected source of VEGFA and their normal development is required for alveolar angiogenesis. Notably, a majority of AT1 cells proliferate upon ectopic SOX2 expression and undergo stage-dependent cell fate reprogramming. These results provide evidence that AT1 cells have both structural and signaling roles in alveolar maturation and can exit their terminally differentiated non-proliferative state. Our findings suggest that AT1 cells might be a new target in the pathogenesis and treatment of lung diseases associated with premature birth. PMID:26586225

  1. Arterial-alveolar oxygen partial pressure ratio: a theoretical reappraisal.

    Science.gov (United States)

    Viale, J P; Percival, C J; Annat, G; Rousselet, B; Motin, J

    1986-02-01

    The relationship between the arterial-alveolar oxygen partial pressure ratio (PaO2/PAO2) and different fractions of inspired oxygen (FIO2) was studied using a bicompartmental computer model. PaO2/PAO2 was found to be less stable than in previous clinical works probably because the venous admixture varied with changes in the FIO2.

  2. The role of alveolar type II cells in swine leptospirosis

    Directory of Open Access Journals (Sweden)

    Ângela P. Campos

    2015-07-01

    Full Text Available Abstract: This study aimed to investigate a possible relationship between alveolar type II cells and the inflammatory response to infection with Leptospira spp., and thus comprise a further element that can be involved in the pathogenesis of lung injury in naturally infected pigs. The study group consisted of 73 adult pigs that were extensively reared and slaughtered in Teresina, Piauí state, and Timon, Maranhão state, Brazil. The diagnosis of leptospirosis was made using the microscopic agglutination test (MAT aided by immunohistochemistry and polymerase chain reaction. The MAT registered the occurrence of anti-Leptospira antibodies in 10.96% (8/73 of the pigs. Immunohistochemistry allowed for the visualization of the Leptospira spp. antigen in the lungs of 87.67% (64/73 of the pigs. There was hyperplasia of bronchus-associated lymphoid tissue and circulatory changes, such as congestion of alveolar septa, parenchymal hemorrhage and edema within the alveoli. Lung inflammation was more intense (p = 0.0312 in infected animals, which also showed increased thickening of the alveolar septa (p = 0.0006. Evaluation of alveolar type II (ATII cells using an anti-TTF-1 (Thyroid Transcription Factor-1 antibody showed that there were more immunostained cells in the non-infected pigs (53.8% than in the infected animals (46.2% and that there was an inverse correlation between TTF-1 positive cells and the inflammatory infiltrate. There was no amplification of Leptospira DNA in the lung samples, but leptospiral DNA amplification was observed in the kidneys. The results of this study showed that a relationship exists between a decrease in alveolar type II cells and a leptospire infection. Thus, this work points to the importance of studying the ATII cells as a potential marker of the level of lung innate immune response during leptospirosis in pigs.

  3. Hard tissue augmentation for alveolar defects before implant placement

    Directory of Open Access Journals (Sweden)

    Mutia Rochmawati

    2017-08-01

    Full Text Available Background. Often when planning implant therapy, there is a need to augment or  replace  bone  that  has  been  lost. The alveolar defects may occur as a result of tooth loss due to extraction, advanced periodontal diseases or trauma, long term use of removable appliances, dehiscence and fenestration defects, developmental defects/clefts, congenitally missing teeth and odontogenic cysts and tumors. Insufficient bone volume can be brought about by hard tissue augmentation. This techniques have led to increased predictability in reconstruction of alveolar ridge defects and functional implant placement. Purpose. To describe the methods of hard tissue augmentation which can be done with block grafts (autografts and allografts, particulate grafts (cortical and cancellous, xenografts, or synthetic materials. Review. The reconstruction of a normal alveolar housing, in height and width, is imperative to achieve a harmonious balance between biology, function, and aesthetics. Depending on the size and morphology of the defect, horizontal or vertical, various augmentation procedures can be used. Soft tissue management is a critical aspect of hard tissue augmentation procedures. Incisions, reflection, and manipulation should be designed to optimize blood supply and wound closure. The design and management of mucoperiosteal flaps must consider the increased dimensions of the ridge after augmentation as well as esthetics and approximation of the wound margins. The surgical procedure needs to be executed with utmost care to preserve the maximum vascularity to the flap and minimize tissue injury. Conclusion. Alveolar ridge defects can be classified by using Seibert’s classification or HVC System. The treatment of alveolar ridge defect before implant placement can be done with hard tissue augmentation.

  4. Alveolar ridge atrophy related to facial morphology in edentulous patients

    Directory of Open Access Journals (Sweden)

    Kuć J

    2017-09-01

    Full Text Available Joanna Kuć,1 Teresa Sierpińska,2 Maria Gołębiewska1 1Department of Prosthodontics, 2Department of Dental Technology, Medical University of Bialystok, Bialystok, Poland Objectives: The morphology of the alveolar process determines the retention and stability of prosthetic restorations, thereby determining the result of the therapy. Considering that the edentulous jaws may be affected by the atrophy process, it was hypothesized that the morphology of the alveolar process of the maxilla may be dependent on the anterior facial height and anatomy of the mandible. Subjects and methods: Twenty-five healthy edentulous Caucasian individuals were randomly chosen. Each subject underwent a lateral cephalogram before and after prosthetic rehabilitation. During exposition, newly made prostheses were placed in the patient’s mouth. Teeth remained in maximal intercuspidation. Morphological parameters were evaluated according to the Ricketts, McNamara, and Tallgren’s method. Results: An inversely proportional association was observed between patient age and the distal part of the maxilla. A statistically significant connection was noted between the vertical dimension of alveolar ridge and anterior total and lower facial height conditioned by prosthetic rehabilitation. Conclusion: The height of the lateral part of the alveolar ridge of the maxilla remains in connection with the anterior total and lower facial height obtained in the course of prosthetic rehabilitation. The vertical dimension of the alveolar ridge of the maxilla seems to be in close relationship with the morphology of the lower jaw. Keywords: anterior facial height, cephalometric analysis, complete dentures, vertical occlusal dimension

  5. Sistemi Informativi Territoriali e analisi spaziale per l'analisi dei valori immobiliari. Un caso applicato alla città di Swindon (UK

    Directory of Open Access Journals (Sweden)

    Francesco Battaglia

    2012-06-01

    Full Text Available L'articolo riguarda l'analisi dei valori urbani e la loro distribuzione spaziale in un ambito urbano. Lo scopo del contributo è quello di combinare l'utilizzo di Sistemi Informativi Geografici con le tecniche di analisi spaziale per modellizzare i valori immobiliari nell'ambito di un'area urbana. Un test è stato condotto utilizzando valori immobiliari a livello di codici postali per la città di Swindon (UK.

  6. Alveolar but not intravenous S-ketamine inhibits alveolar sodium transport and lung fluid clearance in rats

    NARCIS (Netherlands)

    Berger, Marc M.; Pitzer, Bernhard; Zügel, Stefanie; Wieland, Catharina W.; Vlaar, Alexander P.; Schultz, Marcus J.; Dahan, Albert; Bärtsch, Peter; Hollmann, Markus W.; Mairbäurl, Heimo

    2010-01-01

    BACKGROUND: S-ketamine is frequently used for analgosedation, especially during sepsis and cardiovascular instability. Because S-ketamine blocks voltage-gated sodium (Na+) channels in neurons and skeletal muscle, it is conceivable that S-ketamine also blocks alveolar epithelial Na+ channels that are

  7. Distracción osteogénica alveolar como método de aumento del reborde alveolar

    Directory of Open Access Journals (Sweden)

    Denia Morales Navarro

    2011-03-01

    Full Text Available La distracción osteogénica alveolar, como proceso biológico de neoformación de hueso alveolar, nos motivó a la realización de la presente revisión bibliográfica, con el objetivo enfatizar en el análisis de las variables: antecedentes históricos en Cuba, clasificación de los distractores, fases de la distracción (latencia, distracción y consolidación, indicaciones, contraindicaciones, ventajas, desventajas y complicaciones. Se realizó una revisión bibliográfica mediante la consulta de bases de datos de los sistemas referativos, como MEDLINE y PubMed con la utilización de descriptores "alveolar distraction" y "osteogenic distraction". Se consultaron las fuentes bibliográficas publicadas fundamentalmente en los últimos 5 años, lo que reveló que esta técnica es una excelente alternativa para la formación de huesos y tejidos blandos en zonas de atrofia alveolar, que consta de tres etapas: latencia, distracción y consolidación; un método previsible y con bajas tasas de reabsorción ósea en comparación con otras técnicas de aumento del reborde alveolar. Tiene su principal indicación en la terapia de implantes al proveer volumen óseo. Debemos individualizar cada caso y usar el método más adecuado según las características clínicas y personales del paciente. Una adecuada selección de los casos y una mejor comprensión de la técnica son los puntales para lograr exitosos resultados mediante la distracción osteogénica alveolar. En Cuba se ha aplicado poco la distracción alveolar, por lo que ha sido necesario ampliar los estudios sobre esta temática.

  8. Characteristic aspects of alveolar proteinosis diagnosis Aspectos característicos do diagnóstico da proteinose alveolar

    Directory of Open Access Journals (Sweden)

    Thiago Prudente Bártholo

    2012-02-01

    Full Text Available Alveolar proteinosis is an uncommon pulmonary disease characterized by an accumulation of surfactant in terminal airway and alveoli, thereby impairing gas exchange and engendering respiratory insufficiency in some cases. Three clinically and etiologically distinct forms of pulmonary alveolar proteinosis are recognized: congenital, secondary and idiopathic, the latter corresponding to 90% of the cases. In this case report we present a young male patient that was diagnosed with alveolar proteinosis. Computed tomography of the thorax, bronchoscopy and transbronchial biopsy were performed. The histopathologic aspect was characteristic. The patient was discharged in good health conditions and remains asymptomatic to date.Proteinose alveolar é uma doença pulmonar incomum caracterizada pelo acúmulo de surfactante nas vias aéreas terminais e nos alvéolos, alterando a troca gasosa e, em alguns casos, promovendo insuficiência respiratória. Três formas clínicas e etiologicamente distintas de proteinose alveolar são reconhecidas: congênitas, secundárias e idiopáticas (mais de 90% dos casos são de etiologia idiopática. Neste relato, apresentamos um homem jovem que foi diagnosticado com proteinose pulmonar. Tomografia computadorizada de tórax, broncoscopia e biópsia transbrônquica foram realizadas. O aspecto histopatológico foi característico. O paciente teve alta, com boas condições de saúde, e encontra-se assintomático nos dias de hoje.

  9. ANALISIS PENERAPAN 8 STANDAR NASIONAL PENDIDIKAN PADA SMP NEGERI 2 DOLOPO KABUPATEN MADIUN

    Directory of Open Access Journals (Sweden)

    Luki Eko Cahyono

    2015-10-01

    Penelitian ini menggunakan desain penelitian Deskriptif Kualitatif. Jenis penelitian adalah studi kasus. Data yang digunakan adalah data Primer. Teknik pengumpulan data yang digunakan adalah wawancara dan dokumentasi. Teknik keabsahan data adalah Triangulasi Sumber dan teknik analisis data yang digunakan adalah pendekatan Strengths, Weakness, Opportunities, dan Threats (Analisis SWOT. Kesimpulan penelitian ini adalah (1 Hasil analisis Strenght (Kekuatan adalah sekolah sudah merencanakan, melaksanakan dan mengevaluasi sebagian besar indikator dalam pemenuhan Standar Nasional Pendidikan sehingga meningkatkan mutu pendidikan sekolah. (2 Hasil analisis Weakness (kelemahan adalah keterbatasan anggaran dana dan sumber daya manusia baik peserta didik, pendidik, maupun tenaga kependidikan dalam pemenuhan seluruh unsur Standar Nasional Pendidikan. (3 Hasil analisis Opportunities (peluang adalah Pemberian workshop dan pelatihan kepada pendidik dan tenaga kependidikan meningkatkan kualitas pendidikan sekolah, dan perencanaan, pelaksanaan pembiayaan serta evaluasi penganggaran yang baik memberikan dampak positif terhadap semua unsur operasional sekolah maupun sarana prasarana sekolah. (4 Hasil analisis Threats (Tantangan adalah perencanaan, sosialisasi, pelaksanaan dan evaluasi serta tindak lanjut yang tidak dijalankan dengan manajemen yang baik dalam upaya pemenuhan Standar Nasional Pendidikan akan menghambat peningkatan kualitas pendidikan sekolah. (5 Hasil penerapan Standar Nasional Pendidikan pada SMP Negeri 2 Dolopo menggunakan analisis SWOT menunjukkan bahwa Kekuatan lebih besar daripada Kelemahan dan Peluang lebih besar dari Ancaman, yang berarti Standar Nasional Pendidikan telah terpenuhi dan menghasilkan Akreditasi Sekolah nilai A.

  10. CT findings of extrahepatic alveolar echinococcus (report of 12 cases)

    International Nuclear Information System (INIS)

    Liu Wenya; Shang Ge; Dang Jun

    2000-01-01

    Objective: To analyze the CT findings of extrahepatic alveolar echinococcus (EAE), and assess the value of CT scanning for the diagnosis of such cases. Methods: 12 patients with hepatic alveolar echinococcus (HAE) verified by operation and histology were examined by CT because of new complains. It was found that multiple organs were involved by the same lesions. Results: Brain AE (7 cases) showed single or multiple cerebral nodules, characterized by honeycombed hypodense structures or target sign after enhancement. Lung AE (3 cases) appeared as irregular, peripherally scattered nodules, with small vacuoles or cavities inside. The only 1 case with heart AE demonstrated a multiple calcifications and vacuoles within the mass. Adrenal gland AE (2 cases) presented as plaques containing different sizes of hypodense areas and calcifications. Retroperitoneal AE (2 cases) exhibited mass with plentiful calcifications. Conclusion: CT can define the location and morphology of the lesion, providing a reliable method for the diagnosis and treatment of the disease

  11. Tranexamic acid in diffuse alveolar hemorrhage (case report

    Directory of Open Access Journals (Sweden)

    Owlia MB

    2007-05-01

    Full Text Available Background: Wagener's granulomatosis (WG is a systemic necrotizing vasculitis characterized by upper and lower respiratory tract involvement and glomerulonephritis in most instances. Case Report: We report a 36 years old man with DAH secondary to WG, as the presenting feature. He successfully treated with standard immune suppressive agents including pulse methylprednisolone and cyclophospha-mide, along with tranexamic acid as adjunctive therapy for control of active bleeding. Laboratory results showed mild to moderate anemia, increased serum lactate dehydrogenase and very high c-ANCA titer. Chest radiograph showed bilateral alveolar infilterates. Conclusion: Diffuse Alveolar hemorrhage (DAH is a dread complication of Wagener’s granulomatosis. Control of acute phase of hemorrhage with tranexamic acid can improve out come of patients.

  12. Post-neonatal drop in alveolar SP-A expression

    DEFF Research Database (Denmark)

    Stray-Pedersen, Arne; Vege, Ashild; Stray-Pedersen, Asbjorg

    2008-01-01

    BACKGROUND: Surfactant protein A (SP-A) is synthesized in the lung and is a part of the innate immune system. The aim of this study was to evaluate the expression of SP-A in lung tissue from fetuses, infants, children and adults with special regard to sudden infant death syndrome (SIDS). METHODS......: A total of 160 cases were studied; 19 fetuses and neonates, 59 SIDS and 49 explained infant deaths below 1 year of age, 19 toddlers and 14 adults. Immunohistochemical detection of SP-A using monoclonal antibodies was performed by microscopy of lung tissue specimens collected at autopsy. A scoring system...... was developed enabling semi-quantitative estimation of staining intensity and distribution. RESULTS: SP-A was detected in the terminal bronchioles and alveolar spaces of fetuses >35 weeks gestation. The intra-alveolar SP-A expression increased in the perinatal period followed by a marked drop in infants aged...

  13. Diffuse alveolar hemorrhage resulting from Pauci-immune pulmonary capillaritis

    Directory of Open Access Journals (Sweden)

    Andreia Salarini Monteiro

    2003-08-01

    Full Text Available A 27 year-old female patient, cocaine user, presenting hemoptysis and progressive dyspnea with onset 48 hours prior to hospital admission, without any other signs or symptoms. Serum tests for infectious diseases, collagen disorders and vasculitis were negative. Urinalysis was normal. Computed tomography of the chest showed diffuse alveolar infiltrate, affecting mainly the lower left lobe. A thoracoscopic lung biopsy was performed to clarify the diagnosis. The histopathological findings showed capillaritis and diffuse intra-alveolar hemorrhage. Treated with steroid and cyclophosphamide pulse therapy, a good clinical and radiographical response was obtained. The recently described pauci-immune pulmonary capillaritis is characterized by the presence of isolated pulmonary capillaritis and negative serum testing for auto-immune diseases.

  14. AUTOMATIC SEGMENTATION AND CLASSIFICATION OF CELLS FROM BRONCHO ALVEOLAR LAVAGE

    Directory of Open Access Journals (Sweden)

    Olivier Lezoray

    2011-05-01

    Full Text Available Broncho alveolar lavage is the most commonly used diagnostic tool for confirming alveolar hemorrhage. Golde has introduced a ranking score, based on the hemosiderin content of macrophages which enables ranking cells from 0 to 4 based on the degree of Prussian blue stain. We propose a complete image analysis scheme to automatically perform both the extraction of the cellular objects and the ranking of each cell according to the Golde score. The image analysis techniques used mainly involve clustering and mathematical morphology. A 2D histogram is clustered to extract the main cellular components, a color watershed is used to determine and refine the regions. Finally, the cellular components of interest are firstly classified according to their hue and secondly according to their staining repartition. The proposed image analysis technique is very fast and produces reliable and accurate results.

  15. Analisis Penerimaan PAD Pada Dinas Perikanan dan Peternakan Kabupaten Tebo

    Directory of Open Access Journals (Sweden)

    Eko Purnarianto

    2016-06-01

    Full Text Available Abstract. This study aims to analyze potential, efficiency, effectivity and contribution of PAD admission at Department of Fishery and Animal Husbandry in Tebo Regencyincluding the strategy establishment to increase its revenue.The analysis used is a potential formula, efficiency ratio, effectivity ratio, contributions ratio and SWOT analysis.The results shows that the potential revenue of retribution slaughterhouse (RPH, the potential sales of livestock, and potential sales fishery product are beyond the current target. The efficiency level of retribution slaughterhouse (RPH and sales of fishery product is poor, but the sales of livestock is very efficient. Effectivity level of livestock and fishery product sales are low, whileretribution slaughterhouses(RPH is not effective regarded to its potential  but in the contrary for its target. Contribution of PAD admission of Fishery and Animal Husbandry Department is very low regarded Tebo Regency PAD. The result of SWOT analysis of retribution slaughter house (RPH admission using WO (Weakness-Opportunity strategy, livestock sales using SO (Strength-Oppurtunity strategy, and fishery product sales using ST (strength-threat strategy. Keywords: Retribution SlaughterHouse (RPH, Sales of Fishery, Livestock Sales, SWOT Analysis   Abstrak. Penelitian ini bertujuan untuk menganalisis potensi, efisiensi, efektivitas dan kontribusi penerimaan PAD pada Dinas Perikanan dan Peternakan Kabupaten Teboserta menetapkan strategi untuk peningkatan penerimaan PAD. Analisis yang digunakan adalah rumus potensi, rasio efisiensi, rasio efektivitas, rasio kontribusi dan analisis SWOT.Hasil penelitian menunjukkan bahwa potensi penerimaan retribusi rumah potong hewan (RPH, potensi penjualan hasil peternakan, potensi  penjualan hasil perikanan lebih besar dari target yang telah ditetapkan. Tingkat efisiensi retribusi RPH dan penjualan hasil perikanan tidak efisien, penjualan hasil peternakan sangat efisien. Tingkat

  16. Identifiksi Sebaran Litologi berdasarkan Analisis Data Resistivitas di Gunung Wungkal

    Directory of Open Access Journals (Sweden)

    Nurul Dzakiya

    2017-05-01

    Full Text Available Analisis data untuk mengidentifikasi sebaran litologi yang memiliki potensi bahan galian industri di Daerah Gunung Wungkal Yogyakarta dengan menggunakan metode resistivitas dan survei geologi permukaan telah dilakukan. Hasil korelasi kedua data tersebut menunjukkan sebaran litologi merupakan pelapukan intrusi batuan beku yang kemudian menghasilkan material lempung (6,0-10 m, lempung pasiran (11-30 m dan lapukan batuan diorit (30-55 m yang berada di kedalaman berbeda. Ketebalan batuan di permukaan sekitar 225-231 meter berdasarkan penampang peta geologi dengan arah sebaran dari Barat Laut hingga Tenggara. Proses pelapukan dan alterasi di daerah ini intensif (alterasi argilik dengan jenis morfologi perbukitan intrusi terdenudasi dan dataran Alluvial.

  17. Alveolar ridge augmentation in rats by Bio-Oss

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1991-01-01

    The purpose of the study was to examine if Bio-Oss initiated osteoinduction or osteoconduction when implanted into rats. Sintered and unsintered granules of the anorganic bovine bone Bio-Oss was implanted subperiosteally for alveolar ridge augmentation purposes and heterotopically in the abdominal...... muscles of rats. Light microscopic evaluation revealed no osteoinduction or osteoconduction in connection with sintered or unsintered Bio-Oss. A foreign body reaction was observed around both forms....

  18. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings

    OpenAIRE

    Eguía-Aguilar, Pilar; López-Martínez, Briceida; Retana-Contreras, Carmen; Perezpeña-Diazconti, Mario

    2016-01-01

    We present the case of a 2-year-old male patient with a facial tumor partially treated with chemotherapy before his admission to our institution. The tumor involved from the frontal region to the maxillary floor, the orbit, and the maxillary and sphenoid sinuses. The histopathological diagnosis revealed a stage IV alveolar rhabdomyosarcoma with infiltration to bone marrow and cerebrospinal fluid. He was managed with four cycles of adriamycin, actinomycin, cyclophosphamide and vincristine; cis...

  19. Nerve damage associated with inferior alveolar nerve blocks.

    Science.gov (United States)

    Pogrel, M A; Bryan, J; Regezi, J

    1995-08-01

    The authors reviewed 12 cases in which altered sensation occurred in the distribution of the inferior alveolar or lingual nerves following injection of a local anesthetic for restorative treatment only. Most patients suffered only partial damage, but recovery was poor. The exact mechanism of the nerve damage is unknown, but a number of theories are proposed. The extent of this problem is also unknown, but many more cases probably exist than have been reported to date.

  20. Modulation of epithelial sodium channel in human alveolar epithelial ...

    African Journals Online (AJOL)

    Modulation of epithelial sodium channel in human alveolar epithelial cells by lipoxin A4 through AhR-cAMP-dependent pathway. Bi-Huan Cheng1,2, Li-Wei Pan2, Sheng-Rong Zhang3, Bin-Yu Ying2, Ben-Ji. Wang2, Guo-Liang Lin2 and Shi-Fang Ding1*. 1Department of Critical Care Medicine, Qilu Hospital of Shandong ...

  1. [Treatment of dental accidents and associated alveolar fractures].

    Science.gov (United States)

    Teerijoki-Oksa, Tuija; Karjalainen, Sára; Soukka, Tero

    2010-01-01

    Diagnosis of dental accidents is based on patient history, clinical examination and imaging. A completely avulsed tooth should immediately be reimplanted, and a dislodged tooth urgently repositioned to the original position. Avulsed primary teeth will never be reimplanted, and primary teeth of children under three years are not repositioned. Furthermore, fractures of the alveolar process and various soft tissue injuries but not dental fractures require urgent treatment. All dental accident patients should be referred to dental consultation for further examinations and treatment.

  2. Oxidative Stress, Cell Death, and Other Damage to Alveolar Epithelial Cells Induced by Cigarette Smoke

    Directory of Open Access Journals (Sweden)

    Nagai A

    2003-09-01

    Full Text Available Abstract Cigarette smoking is a major risk factor in the development of various lung diseases, including pulmonary emphysema, pulmonary fibrosis, and lung cancer. The mechanisms of these diseases include alterations in alveolar epithelial cells, which are essential in the maintenance of normal alveolar architecture and function. Following cigarette smoking, alterations in alveolar epithelial cells induce an increase in epithelial permeability, a decrease in surfactant production, the inappropriate production of inflammatory cytokines and growth factors, and an increased risk of lung cancer. However, the most deleterious effect of cigarette smoke on alveolar epithelial cells is cell death, i.e., either apoptosis or necrosis depending on the magnitude of cigarette smoke exposure. Cell death induced by cigarette smoke exposure can largely be accounted for by an enhancement in oxidative stress. In fact, cigarette smoke contains and generates many reactive oxygen species that damage alveolar epithelial cells. Whether apoptosis and/or necrosis in alveolar epithelial cells is enhanced in healthy cigarette smokers is presently unclear. However, recent evidence indicates that the apoptosis of alveolar epithelial cells and alveolar endothelial cells is involved in the pathogenesis of pulmonary emphysema, an important cigarette smoke-induced lung disease characterized by the loss of alveolar structures. This review will discuss oxidative stress, cell death, and other damage to alveolar epithelial cells induced by cigarette smoke.

  3. Simulation of lung alveolar epithelial wound healing in vitro.

    Science.gov (United States)

    Kim, Sean H J; Matthay, Michael A; Mostov, Keith; Hunt, C Anthony

    2010-08-06

    The mechanisms that enable and regulate alveolar type II (AT II) epithelial cell wound healing in vitro and in vivo remain largely unknown and need further elucidation. We used an in silico AT II cell-mimetic analogue to explore and better understand plausible wound healing mechanisms for two conditions: cyst repair in three-dimensional cultures and monolayer wound healing. Starting with the analogue that validated for key features of AT II cystogenesis in vitro, we devised an additional cell rearrangement action enabling cyst repair. Monolayer repair was enabled by providing 'cells' a control mechanism to switch automatically to a repair mode in the presence of a distress signal. In cyst wound simulations, the revised analogue closed wounds by adhering to essentially the same axioms available for alveolar-like cystogenesis. In silico cell proliferation was not needed. The analogue recovered within a few simulation cycles but required a longer recovery time for larger or multiple wounds. In simulated monolayer wound repair, diffusive factor-mediated 'cell' migration led to repair patterns comparable to those of in vitro cultures exposed to different growth factors. Simulations predicted directional cell locomotion to be critical for successful in vitro wound repair. We anticipate that with further use and refinement, the methods used will develop as a rigorous, extensible means of unravelling mechanisms of lung alveolar repair and regeneration.

  4. Diffuse alveolar hemorrhage in isolated pulmonary capillaritis: Case report

    Directory of Open Access Journals (Sweden)

    Medenica Milić

    2014-01-01

    Full Text Available Introduction. Pulmonary capillaritis is a small-diameter vessel vasculitis of the lung, which may occur in isolation as in isolated pauci-immune capillaritis, usually associated with the systemic vasculitis but it could be also related to collagen vascular diseases and in lung transplant rejection. Pulmonary capillaritis leads to diffuse alveolar hemorrhage. The clinical presentation includes symptoms like dyspnea, cough, pleuritic chest pain, fever and hemoptysis. Case Outline. A 48 year-old female patient, smoker, presented with progressive dyspnea. Serum tests for infectious diseases, collagen disorders and vasculitis were negative. Radiography and computed tomography of the chest showed diffuse alveolar infiltrates. Cytology of bronchoalveolar lavage showed presence of siderophages. A thoracoscopic lung biopsy was performed to clarify the diagnosis. The histopathological findings showed capillaritis and diffuse intraalveolar hemorrhage. Patient was treated with steroids, and good clinical and minimal radiographic response was obtained. Recently described pauci-immune pulmonary capillaritis has been characterized as p-ANCA (antineutrophil cytoplasmic antibodies negative isolated pulmonary capillaritis. Conclusion. Isolated pauci-immune pulmonary capillaritis is a rare disease. First clinical manifestations of the isolated pulmonary capillaritis were the symptoms of progressive dyspnea, radiographic and functional signs of the interstitial fibrosis. At the same time, the signs of extrapulmonary diseases were not found. Presence of siderophages in bronchoalveolar lavage indicated alveolar hemorrhage. Histopathological tests of the sample of the lung pointed to pulmonary capillaritis and intraalveolar hemorrhage. Prolonged treatment with corticosteroids was necessary.

  5. Strategies for alveolar ridge reconstruction and preservation for implant therapy.

    Science.gov (United States)

    Masaki, Chihiro; Nakamoto, Tetsuji; Mukaibo, Taro; Kondo, Yusuke; Hosokawa, Ryuji

    2015-10-01

    In dental implant treatment, ridge preservation and immediate or early implant placement are recommended to minimize bone resorption after tooth extraction and achieve esthetic outcomes. However, there is no consensus concerning the efficacy of this surgical method. There is also no consensus on the efficacy of bone and soft tissue grafts and surgical methods for alveolar ridge reconstruction. This paper reports ridge alteration in the anterior maxilla after tooth extraction, and summarizes the efficacy of various ridge preservation methods and immediate or early implant placement as alveolar ridge preservation methods to minimize bone resorption after tooth extraction. The advantages and complications of alveolar ridge reconstruction methods, and the efficacy and surgical method of soft tissue graft are reviewed. The anterior maxilla is in the esthetic zone, and the thickness of the bone on the labial side around the natural tooth is less than 1mm in many cases. Therefore, it is impossible to prevent bone resorption completely, even if ridge preservation and immediate or early implant placement are performed after tooth extraction. It is necessary to obtain stable and long-term esthetics by combining connective tissue and free gingival grafts, in addition to hard tissue augmentation. It is important to consider the burden and level of satisfaction of patients, such as in terms of donor site morbidity in hard and soft tissue grafting, and to pay attention to appropriate indications to avoid overtreatment. Copyright © 2015 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

  6. Quality assessment of systematic reviews on alveolar socket preservation.

    Science.gov (United States)

    Moraschini, V; Barboza, E Dos S P

    2016-09-01

    The aim of this overview was to evaluate and compare the quality of systematic reviews, with or without meta-analysis, that have evaluated studies on techniques or biomaterials used for the preservation of alveolar sockets post tooth extraction in humans. An electronic search was conducted without date restrictions using the Medline/PubMed, Cochrane Library, and Web of Science databases up to April 2015. Eligibility criteria included systematic reviews, with or without meta-analysis, focused on the preservation of post-extraction alveolar sockets in humans. Two independent authors assessed the quality of the included reviews using AMSTAR and the checklist proposed by Glenny et al. in 2003. After the selection process, 12 systematic reviews were included. None of these reviews obtained the maximum score using the quality assessment tools implemented, and the results of the analyses were highly variable. A significant statistical correlation was observed between the scores of the two checklists. A wide structural and methodological variability was observed between the systematic reviews published on the preservation of alveolar sockets post tooth extraction. None of the reviews evaluated obtained the maximum score using the two quality assessment tools implemented. Copyright © 2016 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  7. Effect of Alveolar Ridge Preservation after Tooth Extraction

    Science.gov (United States)

    Avila-Ortiz, G.; Elangovan, S.; Kramer, K.W.O.; Blanchette, D.; Dawson, D.V.

    2014-01-01

    Alveolar ridge preservation strategies are indicated to minimize the loss of ridge volume that typically follows tooth extraction. The aim of this systematic review was to determine the effect that socket filling with a bone grafting material has on the prevention of postextraction alveolar ridge volume loss as compared with tooth extraction alone in nonmolar teeth. Five electronic databases were searched to identify randomized clinical trials that fulfilled the eligibility criteria. Literature screening and article selection were conducted by 3 independent reviewers, while data extraction was performed by 2 independent reviewers. Outcome measures were mean horizontal ridge changes (buccolingual) and vertical ridge changes (midbuccal, midlingual, mesial, and distal). The influence of several variables of interest (i.e., flap elevation, membrane usage, and type of bone substitute employed) on the outcomes of ridge preservation therapy was explored via subgroup analyses. We found that alveolar ridge preservation is effective in limiting physiologic ridge reduction as compared with tooth extraction alone. The clinical magnitude of the effect was 1.89 mm (95% confidence interval [CI]: 1.41, 2.36; p preservation. PMID:24966231

  8. Effects of alveolar ridge preservation on delayed implant osseointegration.

    Science.gov (United States)

    Shao, Shan; Li, Bin; Xue, Hui-Min; Huang, Hai-Yun; Liu, Gang-Li

    2015-01-01

    To evaluate the effects of alveolar ridge preservation with Bio-Oss bone substitute (Geistlich Pharma) on delayed implant osseointegration. The 3rd and 4th left and right mandibular premolars were extracted from four adult healthy male and female dogs. For the experimental group, we randomly selected two extraction sockets in each dog to be filled with Bio-Oss bone substitute (Geistlich Pharma). The two remaining extraction sockets remained untreated and served as the control group. Three months after Bio-Oss placement, dental implants were inserted into the alveolar bone of the experimental group and the control group. The osteogenic activity of the bone around the implants was assessed by evaluating the histological morphology and by estimating histomorphometric parameters at 3 and 6 months after delayed implantation. At 3 months, Goldner's trichrome staining analysis showed that the bone-implant contact rate and mineralised bone area around the implant were significantly higher in the experimental group (75.98% ± 8.97% and 69.52% ± 9.63%, respectively) than in the control group (56.13% ± 8.18% and 52.82% ± 7.25%, respectively; P alveolar ridge preservation by using Bio-Oss placement can promote osseointegration of delayed implantation. This may be a promising option for clinical use.

  9. Pulmonary alveolar microlithiasis: review of the 1022 cases reported worldwide

    Directory of Open Access Journals (Sweden)

    Giuseppe Castellana

    2015-12-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a rare disease characterised by the widespread intra-alveolar accumulation of minute calculi called microliths. It is caused by mutation of the SLC34A2 gene encoding the type IIb sodium phosphate cotransporter in alveolar type II cells. The present study explores the epidemiological, familial, genetic, clinical, diagnostic, radiological and therapeutic aspects with the aim of contributing to a better understanding of this uncommon disease. We searched articles on PAM published up to December 2014 and 544 papers were found, accounting for 1022 cases. PAM is present in all continents and in many nations, in particular in Turkey, China, Japan, India, Italy and the USA. Familiality is frequent. The clinical course is not uniform and the causes of this clinical variability seem to be largely nongenetic. The optimal diagnostic procedure is the association of chest high-resolution computed tomography (HRCT with bronchoalveolar lavage, but a chest radiograph may suffice in families in which a case has already been diagnosed. Moreover, chest radiography and HRCT allow the classification of the evolutionary phase of the disease and its severity. At present lung transplantation is the only effective therapy. However, better knowledge of the gene responsible offers hope for new therapies.

  10. Alveolar echinococcosis of the liver. Findings of magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Hayasaka, Kazumasa; Tanaka, Yoshiaki; Okuhata, Yoshitaka; Yoshinobu, Takashi; Takemoto, Akiko; Himi, Kazuhisa; Mutoh, Haruomi [Nihon Univ., Tokyo (Japan). School of Medicine; Shuke, Noriyuki; Aburano, Tamio

    1995-06-01

    The purpose of the present study was to evaluate the findings of MR imaging obtained in patients with Echinococcus multilocularis involving the liver. For 10 patients with alveolar echinococcosis of the liver, the MR findings were compared with the histopathologic findings after biopsy or surgery. Conventional T1-weighted spin echo, T2-weighted spin echo and T1-weighted spin echo after Gd-DTPA were employed. The signal from the lesions of alveolar liver echinococcosis on T1-weighted images was hypointense in 16 of 23 lesions (69.6%), hyperintense in 4 (17.4%), and isointense in 3 (13.0%). The signal from the lesions on T2-weighted images was hyperintense in 20 lesions (87.0%), hypointense in 2 (8.7%), and isointense in one (4.3%). On using Gd-DTPA, 7 of 21 lesions (33.3%) were observed with rim enhancement, and 14 lesions (66.7%) were non-enhanced. We describe our clinical experience together with the various findings of MR imaging as observed in the patients with alveolar echinococcosis of the liver. MR imaging excels in visualizing a low-intensity rim and small cystic foci, with liquefaction necrotic foci displaying a variety of signal intensities. After Gd-DTPA administration, the surrounding inflammatory granulomatous foci could be more clearly visualized. (author).

  11. Requirement of alveolar bone formation for eruption of rat molars.

    Science.gov (United States)

    Wise, Gary E; He, Hongzhi; Gutierrez, Dina L; Ring, Sherry; Yao, Shaomian

    2011-10-01

    Tooth eruption is a localized event that requires a dental follicle (DF) to regulate the resorption of alveolar bone to form an eruption pathway. During the intra-osseous phase of eruption, the tooth moves through this pathway. The mechanism or motive force that propels the tooth through this pathway is controversial but many studies have shown that alveolar bone growth at the base of the crypt occurs during eruption. To determine if this bone growth (osteogenesis) was causal, experiments were designed in which the expression of an osteogenic gene in the DF, bone morphogenetic protein-6 (Bmp6), was inhibited by injection of the first mandibular molar of the rat with a small interfering RNA (siRNA) targeted against Bmp6. The injection was followed by electroporation to promote uptake of the siRNA. In 45 first molars injected, eruption was either delayed or completely inhibited (seven molars). In the impacted molars, an eruption pathway formed but bone growth at the base of the crypt was greatly reduced compared with the erupted first-molar controls. These studies show that alveolar bone growth at the base of the crypt is required for tooth eruption and that Bmp6 may be essential for promoting this growth. © 2011 Eur J Oral Sci.

  12. Massive Alveolar Hemorrhage During Wegener Granulomatosis: a Case Report

    Directory of Open Access Journals (Sweden)

    Gökhan Perincek

    2011-11-01

    Full Text Available This is a presentation of Wegener Granulomatosis (WG disease. Even though the lungs are rarely affected. massive alveolar hemorrhage is seen which leads to mortality. The patient was a 28 year old man. His illness was diagnosed as WG and glomerulonephritis a year previously and he was treated by administration of methylprednisolone orally. He had been treated irregularly. He applied to the emergency service with hemoptysis and asthma complaints two days earlier. After the results of his examination Hb: 3.6 gr/dl, Htc:10.3%, Üre:131 mg /dl, kreatini: 7.7 mg/dl, pH: 7.41, pO2: 55 mmHg, pCO2:33 mmHg, and being diagnosed as alveolar consolidation on lung X-ray, he was taken to the intensive care unit with a diagnosis of a massive alveolar hemorrhagei. He was intubated and attached to mechanical ventilation. He was treated with parenteral 1 mg/kg/day methylprednisolone and, siklofosfamid 2 mg/kg/day. He was extubated on the 21st day. He was taken to the chest service department on 24th day. He is still being treated.

  13. Alveolar osteitis following surgical removal of mandibular third molars.

    Science.gov (United States)

    Fridrich, K L; Olson, R A

    1990-01-01

    The purpose of this study was to evaluate 2 methods that could be used universally to reduce the incidence of alveolar osteitis. In addition, other variables including age and sex of patient, preoperative aspirin use and discomfort, and the use of oral contraceptives (OCs) were studied. A large controlled prospective study was completed with 952 surgical extraction sites in 476 patients. Postoperative dressings included lincomycin hydrochloride (Lincocin)/absorbable gelatin sponge (Gelfoam), oxytetracycline HCL-hydrocortisone acetate (Terra-Cortril)/absorbable gelatin sponge, and absorbable gelatin sponge/saline. Bilaterally impacted mandibular 3rd molars of similar surgical difficulty were selected. Standard accepted surgical technique was used. Patients were seen 1 and 7 days after surgery or as needed. Lincomycin hydrochloride/absorbable gelatin sponge and oxytetracycline HC1-hydrocortisone acetate/absorbable gelatin sponge were effective in reducing the incidence of alveolar osteitis. Lincomycin hydrochloride/absorbable gelatin sponge is preferred because of the increased morbidity associated with dressings containing petrolatum products. Absorbable gelatin sponge alone is not effective in reducing the incidence of alveolar osteitis. Age and OC use were found to be significant factors in the incidence of this problem.

  14. The Milieu of Damaged Alveolar Epithelial Type 2 Cells Stimulates Alveolar Wound Repair by Endogenous and Exogenous Progenitors

    Science.gov (United States)

    Buckley, Susan; Shi, Wei; Carraro, Gianni; Sedrakyan, Sargis; Da Sacco, Stefano; Driscoll, Barbara A.; Perin, Laura; De Filippo, Roger E.

    2011-01-01

    Alveolar epithelial integrity is dependent upon the alveolar milieu, yet the milieu of the damaged alveolar epithelial cell type 2 (AEC2) has been little studied. Characterization of its components may offer the potential for ex vivo manipulation of stem cells to optimize their therapeutic potential. We examined the cytokine profile of AEC2 damage milieu, hypothesizing that it would promote endogenous epithelial repair while recruiting cells from other locations and instructing their engraftment and differentiation. Bronchoalveolar lavage and lung extract from hyperoxic rats represented AEC2 in vivo damage milieu, and medium from a scratch-damaged AEC2 monolayer represented in vitro damage. CINC-2 and ICAM, the major cytokines detected by proteomic cytokine array in AEC2 damage milieu, were chemoattractive to normoxic AECs and expedited in vitro wound healing, which was blocked by their respective neutralizing antibodies. The AEC2 damage milieu was also chemotactic for exogenous uncommitted human amniotic fluid stem cells (hAFSCs), increasing migration greater than 20-fold. hAFSCs attached within an in vitro AEC2 wound and expedited wound repair by contributing cytokines migration inhibitory factor and plasminogen activator inhibitor 1 to the AEC2 damage milieu, which promoted wound healing. The AEC2 damage milieu also promoted differentiation of a subpopulation of hAFSCs to express SPC, TTF-1, and ABCA3, phenotypic markers of distal alveolar epithelium. Thus, the microenvironment created by AEC2 damage not only promotes autocrine repair but also can attract uncommitted stem cells, which further augment healing through cytokine secretion and differentiation. PMID:21700959

  15. Mechanism of action and morphologic changes in the alveolar bone in response to selective alveolar decortication-facilitated tooth movement.

    Science.gov (United States)

    Baloul, S Susan; Gerstenfeld, Louis C; Morgan, Elise F; Carvalho, Roberto S; Van Dyke, Thomas E; Kantarci, Alpdogan

    2011-04-01

    The aim of this study was to test if corticotomy-induced osteoclastogenesis and bone remodeling underlie orthodontic tooth movement and how selective alveolar decortication enhances the rate of tooth movement. A total of 114 Sprague-Dawley rats were included in 3 treatment groups: selective alveolar decortication alone (SADc); tooth movement alone (TM); and "combined" therapy (SADc + TM). Surgery was performed around the buccal and palatal aspects of the left maxillary first molar tooth and included 5 decortication dots on each side. Tooth movement was performed on the first molar using a 25-g Sentalloy spring. Measurements were done at baseline (day 0: no treatment rendered) and on days 3, 7, 14, 21, 28 and 42. Microcomputed tomography, Faxitron analyses, and quantitative real-time polymerase chain reaction (q-PCR) of expressed mRNAs were used to assess changes. The combined group showed increased tooth movement (P = 0.04) at 7 days compared with the tooth movement group with significantly decreased bone volume (62%; P = 0.016) and bone mineral content (63%; P = 0.015). RNA markers of osteoclastic cells and key osteoclastic regulators (M-CSF [macrophage colony-stimulating factor], RANKL [receptor activator of nuclear factor kappa-B ligand], OPG [osteoprotegerin], calcitonin receptor [CTR], TRACP-5b [tartrate-resistant acid phosphatase 5b], cathepsin K [Ctsk]) all showed expression indicating increased osteoclastogenesis in the combined group. RNA markers of osteoblastic cells (OPN [osteopontin], BSP [bone sialoprotein], OCN [osteocalcin]) also showed increased anabolic activity in response to the combination of alveolar decortication and tooth movement. The data suggest that the alveolar decortication enhances the rate of tooth movement during the initial tooth displacement phase; this results in a coupled mechanism of bone resorption and bone formation during the earlier stages of treatment, and this mechanism underlies the rapid orthodontic tooth movement

  16. Influence of the Alveolar Cleft Type on Preoperative Estimation Using 3D CT Assessment for Alveolar Cleft

    Directory of Open Access Journals (Sweden)

    Hang Suk Choi

    2012-09-01

    Full Text Available Background The bone graft for the alveolar cleft has been accepted as one of the essentialtreatments for cleft lip patients. Precise preoperative measurement of the architecture andsize of the bone defect in alveolar cleft has been considered helpful for increasing the successrate of bone grafting because those features may vary with the cleft type. Recently, somestudies have reported on the usefulness of three-dimensional (3D computed tomography(CT assessment of alveolar bone defect; however, no study on the possible implication of thecleft type on the difference between the presumed and actual value has been conducted yet.We aimed to evaluate the clinical predictability of such measurement using 3D CT assessmentaccording to the cleft type.Methods The study consisted of 47 pediatric patients. The subjects were divided according tothe cleft type. CT was performed before the graft operation and assessed using image analysissoftware. The statistical significance of the difference between the preoperative estimationand intraoperative measurement was analyzed.Results The difference between the preoperative and intraoperative values were -0.1±0.3cm3 (P=0.084. There was no significant intergroup difference, but the groups with a cleftpalate showed a significant difference of -0.2±0.3 cm3 (P<0.05.Conclusions Assessment of the alveolar cleft volume using 3D CT scan data and image analysissoftware can help in selecting the optimal graft procedure and extracting the correct volumeof cancellous bone for grafting. Considering the cleft type, it would be helpful to extract anadditional volume of 0.2 cm3 in the presence of a cleft palate.

  17. Treatment of sharp mandibular alveolar process with hybrid prosthesis

    Directory of Open Access Journals (Sweden)

    Sukaedi Sukaedi

    2010-09-01

    Full Text Available Background: Losing posterior teeth for a long time would occasionally lead to the sharpening of alveolar process. The removable partial denture usually have problems when used during mastication, because of the pressure on the mucosa under the alveolar ridge. Purpose: The purpose of this case report was to manage patients with sharp mandibular alveolar process by wearing hybrid prosthesis with extra coronal precision attachment retention and soft liner on the surface base beneath the removable partial denture. Case: A 76 years old woman visited the Prosthodontic Clinic Faculty of Dentistry Airlangga University. The patient had a long span bridge on the upper jaw and a free end acrylic removable partial denture on the lower jaw. She was having problems with mastication. The patient did not wear her lower denture because of the discomfort with it during mastication. Hence, she would like to replace it with a new removable partial denture. Case management: The patient was treated by wearing a hybrid prosthesis with extra coronal precision attachment on the lower jaw. Soft liner was applied on the surface of the removable partial denture. Hybrid prosthesis is a complex denture consisting of removable partial denture and fixed bridge. Conclusion: It concluded that after restoration, the patient had no problems with sharp alveolar process with her new denture, and she was able to masticate well.Latar belakang: Kehilangan geligi posterior dapat menimbulkan processus alveolaris tajam. Gigi tiruan sebagian lepasan mempunyai masalah selama pengunyahan karena adanya tekanan di mukosa di bawah alveolar ridge. Tujuan: Tujuan laporan kasus ini adalah untuk menjelaskan cara menangani pasien yang mempunyai prosesus alveolaris yang tajam di rahang bawah dengan dibuatkan protesis hybrid dengan daya tahan extra coronal precision attachment dan soft liner di permukaan bawah basis gigi tiruan sebagian lepasan. Kasus: Pasien wanita berumur 76 tahun datang di klinik

  18. ANALISIS EXPERIENTIAL MARKETING TERHADAP EXPERIENTIAL VALUE DI INDUSTRI SMARTPHONE

    Directory of Open Access Journals (Sweden)

    Rydho Styawan

    2016-01-01

    Full Text Available Persaingan yang ketat di industri smartphone membuat perusahaan mulai menanamkan konsep experiential marketing dan experiential value dalam memposisikan produk untuk mengalahkan pesaing. Saat ini para produsen smartphone berlomba-lomba untuk menawarkan produk dan jasa bagi konsumen berdasarkan pada perkembangan kebutuhan dan keinginan konsumen. Produsen dituntut untuk tidak sekedar menjual produk atau jasa saja, tetapi juga berpikir bagaimana menciptakan produk maupun jasa yang dapat memberikan pengalaman berkesan bagi konsumennya. Penelitian dengan judul “Analisis Experiential Marketing terhadap Experiential Value di Industri Smartphone” ini merupakan replikasi penelitian yang dilakukan oleh Maghnati et al (2012, dengan judul “Exploring the Relationship between Experiential Marketing and Experiential Value in the Smartphone Industry“. Penelitian ini bertujuan mengetahui pengaruh indikator experiential marketing yaitu sense experience, feel experience, act experience, relate experience, think experience terhadap experiential value. Jumlah sampel yang digunakan sebanyak 500 mahasiswa yang diperoleh melalui metode Judgement Sampling dan Quota Sampling yang diambil dari 5 perguruan tinggi di Daerah Istimewa Yogyakarta. Hasil dari Analisis Regresi Linear Berganda dengan pengolahan data menggunakan perangkat lunak SPSS versi 16: sense experience, feel experience, act experience, relate experience, think experience berpengaruh positif signifikan terhadap experiential value. Variabel yang mempunyai pengaruh paling dominan dalam mempengaruhi experiential value adalah variable think experience. Dengan demikian hasil penelitian ini mendukung penelitian Maghnati. et al (2012 yang menemukan bahwa experiental marketing berpengaruh positif signifikan terhadap experiental value. Kata kunci: Sense Experience, Feel Experience, Act Experience, Relate Experience, Think Experience, Experiential Value

  19. Analisis keragaman tanaman durian sukun (Durio zibethinus berdasarkan penanda RAPD

    Directory of Open Access Journals (Sweden)

    ISMI PUJI RUWAIDA

    2009-11-01

    Full Text Available Ruwaida IP, Yuniastuti E, Supriyadi. 2009. Analisis keragaman tanaman durian sukun (Durio zibethinus berdasarkan penanda RAPD. Bioteknologi 6: 96-105. Tujuan penelitian adalah mengkaji keragaman durian varietas sukun, sunan, kani, monthong, dan petruk serta keragaman durian sukun yang ditanam pada wilayah yang berbeda berdasarkan penanda RAPD. Bahan penelitian berupa daun tanaman durian varietas sukun, sunan, kani, monthong dan petruk dari Kebun Benih Ranukutri Karanganyar; serta durian varietas sukun dari Gempolan Karanganyar, Jepara dan Salatiga. Selanjutnya dilakakukan analisis DNA terhadap sampel daun yang diawali dengan isolasi DNA, uji kuantitas dan kualitas DNA, seleksi primer, dan amplifikasi dengan PCR. Visualisasi hasil PCR dilakukan dengan elektroforesis menggunakan EtBr yang menghasilkan pita DNA. Pita DNA selanjutnya dianalisis dengan program NTSYS untuk mendapatkan keragaman durian antar varietas dan antar durian sukun dari wilayah yang berbeda. Primer yang digunakan adalah 6 primer polimorfik, yaitu OPA-01, OPA-02, OPA-07, OPA-16, OPA-18 dan OPA-19. Pola pita DNA hasil amplifikasi menunjukkan adanya keragaman antar varietas durian sukun, sunan, kani, monthong dan petruk serta menunjukkan keragaman durian sukun yang ditanam di wilayah yang berbeda. Dendrogram pengelompokkan menunjukkan lima varietas durian cenderung memisah, yaitu sukun, sunan, monthong dan petruk merupakan satu kelompok yang memisah dengan durian Kani. Dendrogram pengelompokkan durian sukun yang ditanam pada wilayah berbeda menghasilkan dua kelompok, yaitu kelompok durian sukun dari Gempolan Karanganyar dan Salatiga serta kelompok lainnya dari Kebun Benih Ranukutri Karanganyar dan Jepara.

  20. Klasifikasi Kecamatan Berdasarkan Nilai Akhir SMA/MA di Kabupaten Aceh Selatan Menggunakan Analisis Diskriminan

    Directory of Open Access Journals (Sweden)

    Fitriana A.R.

    2015-11-01

    Full Text Available Analisis diskriminan merupakan bagian dari analisis peubah ganda. Analisis diskriminan digunakan untuk memodelkan variabel tak bebas yang bersifat kualitatif dengan variabel bebas yang bersifat kuantitatif. Pada penelitian ini, analisis diskriminan lebih dari dua kelompok diterapkan pada data nilai akhir SMA/MA di Kabupaten Aceh Selatan yang bertujuan untuk mendapatkan model untuk pengklasifikasian kecamatan. Pengklasifikasian ini bertujuan untuk melihat perbedaan kualitas siswa SMA/MA yang berada di masing-masing kecamatan Kabupaten Aceh Selatan berdasarkan data nilai akhir. Variabel tak bebas yang digunakan berupa klasifikasi kecamatan berdasarkan rata-rata jumlah nilai akhir SMA/MA yang berada di masing-masing kecamatan yang dibentuk dengan K-Means Cluster. Sedangkan variabel bebas yang digunakan adalah data rata-rata nilai akhir SMA/MA untuk setiap mata pelajaran yang diujiankan pada masing-masing jurusan setiap kecamatan. Model yang didapatkan adalah dua model diskriminan untuk jurusan IPA dan IPS.

  1. ANALISIS KELEMBAGAAN PEMASARAN KENTANG VARIETAS GRANOLA TERHADAP PENDAPATAN PETANI DI KECAMATAN TOMBOLOPAO KABUPATEN GOWA

    OpenAIRE

    ANDI LELANOVITA.S

    2017-01-01

    ANALISIS KELEMBAGAAN PEMASARAN KENTANG VARIETAS GRANOLA TERHADAP PENDAPATAN PETANI DI KECAMATAN TOMBOLOPAO KABUPATEN GOWA TESIS Oleh : ANDI LELANOVITA.S Nomor Induk Mahasiswa : 201311812 PROGRAM PASCASARJANA MAGISTER MANAJEMEN UNIVERSITAS MUHAMMADIYAH MAKASSAR MAKASSAR 2015

  2. Analisis Hubungan Kinerja Keuangan Terhadap Kemampulabaan PT. Perkebunan Nusantara IV (Persero).

    OpenAIRE

    Nasution, M Azmi

    2011-01-01

    Penelitian ini bertujuan untuk mengetahui hubungan Kinerja keuangan yang diukur dengan quick ratio, debt to equity ratio, debt to asset ratio,long term debt to equity ratio, total asset turnover, inventory turnover dan fixed asset turnover terhadap kemampulabaan yang diukur dengan return on investment (ROI) pada PT. Perkebungan Nusantara IV (Persero) selama periode 1999 sampai dengan 2006. Berdasarkan metode analisis yang digunakan penulis yaitu metode analisis Rank Spearman dan pengujian hip...

  3. Analisis Framing Pemberitaan Konflik Partai Nasional Demokrat (Nasdem) Di Harian Media Indonesia Dan Koran Sindo

    OpenAIRE

    R. Surbakti, Leonarda Johanes

    2013-01-01

    Mundurnya Hary Tanoesoedibjo beserta sejumlah kader Partai NasDem mengundang banyak perhatian media. Untuk menganalisis hal tersebut, peneliti menggunakan metode penelitian analisis framing yang dikembangkan dengan menggunakan model analisis Pan dan Kosicki dengan tujuan untuk melihat bagaimana bingkai pemberitaan Harian Media Indonesia dan Koran SINDO terkait kemunduran Hary Tanoesoedibjo beserta sejumlah kader Partai NasDem.Temuan peneliti dari hasil penelitian ini, Harian Media Indonesia d...

  4. ANALISIS POLA WACANA PEDAGOGIS GURU BIOLOGI DI SMA NEGERI 7 CIREBON

    Directory of Open Access Journals (Sweden)

    Edy Chandra

    2013-04-01

    Full Text Available Permasalahan yang berkembang di kalangan pengajar muda yang belum memiliki pengalaman dalam dunia pengajaran adalah membutuhkan profil seorang guru ideal  yang disenangi oleh siswa.Analisis wacana pedagogis guru tidak hanya dapat mengungkap kualitas pengajaran seorang guru di kelas, tetapi merupakan salah satu pendekatan yang dapat digunakan untuk mengungkap proses belajar mengajar secara totalitas.Penelitian ini bertujuan untuk mengetahui profil seorang guru Biologi yang terbaik di salah satu SMA Negeri di Cirebon berdasarkan kemampuannya dalam menyampaikan materi dan memberikan pemahaman kepada siswa. Masalah yang diangkat dalam penelitian ini adalah dengan mengamati tingkat relevansi penguasaan materi guru biologi pada indikator RPP, tingkat analisis wacana pedagogis guru menggunakan model representasi, tingkat analisis wacana pedagogis guru berdasarkan penyajian motif dan tingkat analisis wacana pedagogis guru berdasarkan level penyajian konsep.Metode penelitian yang digunakan oleh penulis adalah metode Kualitatif Deskriptif. Prosedur pengumpulan data dilakukan oleh peneliti sendiri dengan melakukan observasi, wawancara, penyebaran angket dan dokumentasi. Subjek penelitian adalah seorang guru biologi yang dianggap guru biologi terbaik di SMA Negeri 7 Cirebon.Data utama yang diperoleh berupa rekaman audio visual, diubah kedalam bentuk teks atau transkripsi untuk dapat dianalisis lebih lanjut.Hasil penelitian ini menunjukan tingkat relevansi penguasaan materi guru terhadap RPP yang dibuatnya dikatakan baik karena sebagian besar sudah teraktualisasi. Hal ini dapat dilihat dari hasil persentase tingkat relevansi indikator 90% materi terakomodasi, dan 10% tidak terakomodasi. Sementara itu, hasil analisis wacana pedagogis guru pada representasi teks mencapai struktur 5 level. Artinya semakin banyak konsep yang disampaikan guru dan semakin tinggi kompleksitas penguasaan materi guru. Analisis wacana pedagogis berdasarkan penyajian motif menunjukan

  5. Analisis Dinamik Skema Euler Untuk Model Predator-Prey Dengan Efek Allee Kuadratik

    Directory of Open Access Journals (Sweden)

    Vivi Aida Fitria

    2017-03-01

    Full Text Available Pada penelitian ini dilakukan pendekatan numerik menggunakan skema Euler pada model predator-prey dengan efek alelopati. Perilaku dinamik dari model diskrit yang diperoleh kemudian dianalisis, yaitu eksistensi dan kestabilan titik kesetimbangan model tersebut. Analisis kestabilan titik kesetimbangan menunjukkan bahwa titik kepunahan predator dan predator-prey bersifat tidak stabil tetapi titik kepunahan prey dan titik keberhasilan hidup predator-prey bersifat stabil dengan syarat tertentu. Dari simulasi numerik menunjukkan bahwa hasil yang diperoleh sesuai dengan hasil analisis.

  6. Effects of fibrin adhesive material (Tissucol) on alveolar healing in rats under stress.

    OpenAIRE

    Alves-Rezende, Maria C. R. [UNESP; Okamoto, Tetuo [UNESP

    1997-01-01

    The effects of Tissucol on alveolar healing following stress were evaluated histologically, comparing three groups of 28 male albino rats each. Stress was applied and their right upper incisors were extracted. Group A served as an empty control site. In Group B, Tissucol was applied into the alveolar cavity. Group C received local antifibrinolytic treatment (alveolar irrigation with epsilon-aminocaproic acid solution) before implant of Tissucol into the tooth socket. Four animals in each grou...

  7. Differentiated bronchiolar epithelium in alveolar ducts of rats exposed to ozone for 20 months

    Energy Technology Data Exchange (ETDEWEB)

    Pinkerton, K.E.; Dodge, D.E.; Cederdahl-Demmler, J.; Wong, V.J.; Peake, J.; Haselton, C.J.; Mellick, P.W.; Singh, G.; Plopper, C.G. (Univ. of California, Davis (United States))

    1993-03-01

    The effects of exposure to 1.0 ppm of ozone for twenty months were studied in male Fischer 344 rats. Light microscopic, morphometric, and immunohistological approaches were used to determine the distribution and degree of differentiation of ciliated and nonciliated bronchiolar epithelial (Clara) cells lining alveolar ducts of the central acinus, a primary target of ozone-induced lung injury. Alveolar duct pathways extending beyond the level of the most proximal alveolar outpocketing of terminal bronchioles were isolated in longitudinal profile. The distance that ciliated and nonciliated bronchiolar epithelial (Clara) cells projected down each alveolar duct pathway was determined by placing concentric arcs radiating outward from a single reference point at the level of the first alveolar outpocketing. A high degree of heterogeneity in the magnitude of bronchiolar epithelial cell extension into alveolar ducts was noted for each isolation and animal. Age-matched control animals also demonstrated variation in the degree of bronchiolar epithelial cell extension down alveolar ducts. In animals exposed to ozone, a striking similarity was noted by scanning electron microscopy in the surface characteristics of cells lining both terminal bronchioles and alveolar ducts. The presence of Clara cell secretory protein in cells of bronchioles and alveolar ducts was also detected immunohistochemically and visualized using confocal laser scanning microscopy in the reflectance mode. Well-differentiated ciliated and nonciliated bronchiolar epithelial cells were found lining alveolar septal tips and alveoli up to a depth of 1,000 mu into the pulmonary acinus after 20 months of exposure to ozone. No evidence of inflammation was present in alveolar ducts, suggesting that epithelial cell transformations in alveolar ducts is a natural consequence of lifetime exposures to oxidant gases.

  8. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation

    OpenAIRE

    Schwartz, João Paulo; Raveli, Taisa Boamorte; Schwartz-Filho, Humberto Osvaldo; Raveli, Dirceu Barnabé

    2016-01-01

    ABSTRACT Objective: This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. Methods: The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years), Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0) and after Herbst treatment (T1). Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B), lingual (L) and to...

  9. Analisis Makna Lagu Bugis “Sajang Rennu” Ciptaan Yusuf Alamudi Melalui Pendekatan Hermeneutika

    Directory of Open Access Journals (Sweden)

    Herianah Herianah

    2010-12-01

    Full Text Available Tulisan ini bertujuan membahas makna lagu Bugis Sajang Rennu ciptaan Yusuf Alamudi melalui pendekatan hermeneutika. Penelitian ini menggunakan metode deskriptif kualitatif dengan teknik inventarisasi, baca-simak, dan pencatatan dalam pengumpulan datanya. Teknik analisis data melalui tahap identifikasi, klasifikasi, analisis, dan deskripsi. Analisis makna lagu dengan pendekatan hermeneutika ini dilakukan melalui tiga tahap, yaitu analisis kata dalam larik lagu, analisis larik dalam bait, dan analisis bait dalam lagu. Hasil penelitian menunjukkan bahwa makna lagu Sajang Rennu ciptaan Yusuf Alamudi adalah adanya rasa sirik ‘malu’ dari seorang lelaki karena kekasih pujaan hatinya menikah dengan orang lain tanpa kabar berita. Konsekuensi dari rasa sirik ‘malu’ ini membuatnya berpikir untuk mengakhiri hidupnya. Abstract: This writing is intended to discuss the meaning of Buginese song Sajang Rennu by Yusuf Alamudi using hermeneutic approach. This research applies descriptive qualitative method by collecting data using inventory technique, reading-observing, and noting. The technique of data analysis is identification, classification, analysis, and description. The result of the research shows that the meaning of Sajang Rennu by Yusuf Alamudi is sirik or feeling embarassed of a man since his girl friend gets married to another man without any notification before. The consequence of sirik makes him think of suicide. It is figured by the statement that one day people will find a new grave, and he is in. Key Words: meaning; Buginese song; hermeneutic research

  10. Augmentation of residual alveolar bone height with tissue engineering for dental implant placement

    Directory of Open Access Journals (Sweden)

    S M Balaji

    2014-01-01

    Full Text Available The challenge of correcting deficient vertical alveolar height for dental implant placement has been there since dental implants came in to regular clinical placement. The ability of various methods to increase the residual alveolar height has met with varying results. The primary reason is that the techniques were not quite successful in maintaining the required residual alveolar height. Use of Bone Morphogentic Protein, especially rhBMP-2 has been met with high degree of success in deficient vertical alveolar height in a mandibular ridge. The demonstration of this using a case has been presented here.

  11. Alveolar nitric oxide in adults with asthma: evidence of distal lung inflammation in refractory asthma.

    Science.gov (United States)

    Berry, M; Hargadon, B; Morgan, A; Shelley, M; Richter, J; Shaw, D; Green, R H; Brightling, C; Wardlaw, A J; Pavord, I D

    2005-06-01

    Recent studies have suggested that alveolar nitric oxide (NO) concentration is a noninvasive test of distal lung inflammation. The current study determined whether alveolar NO concentration can be measured in patients with asthma of varying severity, tested the hypothesis that there is an association between alveolar NO and bronchoalveolar lavage (BAL) eosinophil count and determined whether refractory asthma is characterised by a raised alveolar NO concentration. Finally, the present authors assessed the effect of 2 weeks of prednisolone (30 mg q.d.) on alveolar NO concentration. Alveolar NO concentration was both measurable and repeatable in patients with refractory asthma. A positive correlation was found between alveolar NO concentration and BAL eosinophil count but not with bronchial wash or sputum eosinophil count. Alveolar NO concentration was increased in patients with refractory asthma (7.1 ppb) compared with mild-to-moderate asthma (3.4 ppb) and normal controls (3.4 ppb) and reduced by treatment with prednisolone. In conclusion, these findings support the hypothesis that alveolar nitric oxide is a measure of distal airway inflammation and suggest that distal lung inflammation is present in refractory asthma.

  12. Alveolar corticotomies for accelerated orthodontics: A systematic review.

    Science.gov (United States)

    Gil, A P S; Haas, O L; Méndez-Manjón, I; Masiá-Gridilla, J; Valls-Ontañón, A; Hernández-Alfaro, F; Guijarro-Martínez, R

    2018-03-01

    It has been suggested that alveolar corticotomies may accelerate tooth movement, broaden the scope of malocclusion types that can be treated orthodontically, decrease the need for extractions, and support long-term stability. Several techniques have been proposed, although the indications, ideal design and technical characteristics, potential complications, and objective clinician and patient satisfaction remain unclear. This systematic review aimed to provide scientific support to validate alveolar corticotomies as a reliable approach to accelerated orthodontics. A literature search was conducted using MEDLINE (via PubMed), Cochrane, and EMBASE electronic databases until December, 2016. Articles written in any language other than English, Spanish, French, German, and Portuguese were excluded. Randomized controlled trials, controlled clinical trials, and case series involving healthy adult patients, with a sample size of at least 5 patients, and using alveolar corticotomy techniques were included. Two reviewers extracted the data independently. Three randomized clinical trials, 2 prospective randomized clinical trials, 6 case series and 1 randomized controlled split-mouth study were included. No clinical trials were retrieved. Mean total treatment time in corticotomy-facilitated orthodontic cases was 8.85 months (range, 4-20 months); control groups treatment duration was 16.4 months (range, 7.8-28.3 months). Complications such as pain, swelling, and dentin hypersensitivity were reported. Few studies mentioned patient/clinician satisfaction. The faster and less invasive procedures appeared to be well tolerated. However, the methodological quality of the selected studies was low, with only low to moderate scientific evidence. Corticotomy-facilitated orthodontics resulted in decreased treatment time. Few complications and low morbidity were found. More solid evidence-based research is required to support these results. Copyright © 2018 European Association for Cranio

  13. Metabolic shift in lung alveolar cell mitochondria following acrolein exposure.

    Science.gov (United States)

    Agarwal, Amit R; Yin, Fei; Cadenas, Enrique

    2013-11-15

    Acrolein, an α,β unsaturated electrophile, is an environmental pollutant released in ambient air from diesel exhausts and cooking oils. This study examines the role of acrolein in altering mitochondrial function and metabolism in lung-specific cells. RLE-6TN, H441, and primary alveolar type II (pAT2) cells were exposed to acrolein for 4 h, and its effect on mitochondrial oxygen consumption rates was studied by XF Extracellular Flux analysis. Low-dose acrolein exposure decreased mitochondrial respiration in a dose-dependent manner because of alteration in the metabolism of glucose in all the three cell types. Acrolein inhibited glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity, leading to decreased substrate availability for mitochondrial respiration in RLE-6TN, H441, and pAT2 cells; the reduced GAPDH activity was compensated in pAT2 cells by an increase in the activity of glucose-6-phosphate dehydrogenase, the regulatory control of the pentose phosphate pathway. The decrease in pyruvate from glucose metabolism resulted in utilization of alternative sources to support mitochondrial energy production: palmitate-BSA complex increased mitochondrial respiration in RLE-6TN and pAT2 cells. The presence of palmitate in alveolar cells for surfactant biosynthesis may prove to be the alternative fuel source for mitochondrial respiration. Accordingly, a decrease in phosphatidylcholine levels and an increase in phospholipase A2 activity were found in the alveolar cells after acrolein exposure. These findings have implications for understanding the decrease in surfactant levels frequently observed in pathophysiological situations with altered lung function following exposure to environmental toxicants.

  14. Influence of platelet-rich fibrin on alveolar ridge preservation.

    Science.gov (United States)

    Suttapreyasri, Srisurang; Leepong, Narit

    2013-07-01

    The aim of this study was to investigate the influence of platelet-rich fibrin (PRF) on early wound healing and preservation of the alveolar ridge shape following tooth extraction. In this clinical trial, 20 symmetrical, premolar extraction sockets using split-mouth design were randomly selected with PRF or blood clot. The evaluations of wound healing, alveolar ridge contour changes, and crestal bone resorption were performed in dental casts and periapical radiographs (T0, initial; T1, 1 week; T2, 2 weeks; T4, 4 weeks; T6, 6 weeks; T8, 8 weeks). Platelet-rich fibrin clinically showed early healing of soft tissue covering socket orifices in the first 4 weeks. At the first week, the horizontal resorption on buccal aspect of PRF (1.07 ± 0.31 mm) was significantly less than that of the control (1.81 ± 0.88 mm). Platelet-rich fibrin demonstrated the tendency to enter the steady stage after the fourth week following tooth extraction, whereas in the control group the progression of buccal contour contraction was still detected through the eighth week. Radiographically, the overall resorption of marginal bone levels at mesial and distal to the extraction site in PRF (0.70, 1.23 mm) was comparable to that of the control (1.33, 1.14 mm). Although the PRF group demonstrated faster bone healing compared with the control, no statistically significant difference was detected. This preliminary result demonstrated neither better alveolar ridge preservation nor enhanced bone formation of PRF in the extraction socket. The use of PRF revealed limited effectiveness by accelerated soft-tissue healing on the first 4 weeks.

  15. Alveolar hemorrhage and kidney disease: characteristics and therapy.

    Science.gov (United States)

    Fatma, Lilia Ben; El Ati, Zohra; Lamia, Rais; Aich, Dorra Ben; Madiha, Krid; Wided, Smaoui; Maiz, Hedi Ben; Beji, Somaya; Karim, Zouaghi; Moussa, Fatma Ben

    2013-07-01

    Anti-neutrophil cytoplasmic antibody-associated vasculitis and Goodpasture's glomerular basement membrane disease are the most common causes of diffuse alveolar hemorrhage, a life-threatening disease. Systemic lupus erythematosus and the antiphospholipid syndrome are also causes of alveolar hemorrhage. We retrospectively reviewed 15 cases of diffuse alveolar hemorrhage (DAH) associated with renal diseases. Diagnosis of DAH was based on the presence of bloody bronchoalveolar lavage fluid. There were three men and 12 women, with a mean age of 50.5 years (extremes: 24-74 years). Proteinuria and hematuria were observed, respectively, in 15 and 14 cases. Six patients revealed arterial hypertension. Crescentic glomerulonephritis was diagnosed with kidney biopsies in ten cases. The etiology of renal disease was microscopic polyangiitis (MPA) in seven cases, Wegener disease in four cases, systemic lupus erythematous in one case, cryoglobulinemia in one case, myeloma in one case and propyl-thiouracil-induced MPA in one case. Hemoptysis occurred in 14 cases. The mean serum level of hemoglobin was 7.1 g/dL (5.1-10 g/dL). The mean serum creatinine concentration was 7.07 mg/dL (2.4-13.7 mg/dL). Gas exchange was severely compromised, with an oxygenation index <80 mmHg in 14 patients and <60 mmHg in seven patients. Bronchoalveolar lavage was performed in 11 cases, and had positive findings for hemorrhage in all. Methylprednisolone pulses and cyclophosphamide were used in 14 patients. Plasmapheresis was performed in three cases. One patient received cycles of Dexamethasome-Melphalan. Three patients died as a result of DAH. The mortality rate in our study was 20%.

  16. Enhanced rifampicin delivery to alveolar macrophages by solid lipid nanoparticles

    International Nuclear Information System (INIS)

    Chuan Junlan; Li Yanzhen; Yang Likai; Sun Xun; Zhang Qiang; Gong Tao; Zhang Zhirong

    2013-01-01

    The present study aimed at developing a drug delivery system targeting the densest site of tuberculosis infection, the alveolar macrophages (AMs). Rifampicin (RFP)-loaded solid lipid nanoparticles (RFP-SLNs) with an average size of 829.6 ± 16.1 nm were prepared by a modified lipid film hydration method. The cytotoxicity of RFP-SLNs to AMs and alveolar epithelial type II cells (AECs) was examined using MTT assays. The viability of AMs and AECs was above 80 % after treatment with RFP-SLNs, which showed low toxicity to both AMs and AECs. Confocal Laser Scanning Microscopy was employed to observe the interaction between RFP-SLNs and both AMs and AECs. After incubating the cells with RFP-SLNs for 2 h, the fluorescent intensity in AMs was more and remained longer (from 0.5 to 12 h) when compared with that in AECs (from 0.5 to 8 h). In vitro uptake characteristics of RFP-SLNs in AMs and AECs were also investigated by detection of intracellular RFP by High performance liquid chromatography. Results showed that RFP-SLNs delivered markedly higher RFP into AMs (691.7 ng/mg in cultured AMs, 662.6 ng/mg in primary AMs) than that into AECs (319.2 ng/mg in cultured AECs, 287.2 ng/mg in primary AECs). Subsequently, in vivo delivery efficiency and the selectivity of RFP-SLNs were further verified in Sprague–Dawley rats. Under pulmonary administration of RFP-SLNs, the amount of RFP in AMs was significantly higher than that in AECs at each time point. Our results demonstrated that solid lipid nanoparticles are a promising strategy for the delivery of rifampicin to alveolar macrophages selectively.

  17. Diffuse alveolar hemorrhage as initial manifestation of microscopic polyangiitis

    OpenAIRE

    Campanholo, Cristiano Barbosa; Cavalcante, Leonardo de Oliveira; Torigoe, Dawton Yukito; Souza, Branca Dias Batista de

    2007-01-01

    Hemorragia alveolar (HA) é uma manifestação clínica com alta taxa de mortalidade que deve ser investigada, reconhecida e estabilizada. Causas possíveis para a HA incluem infecções respiratórias ou sistêmicas, malformações arteriovenosas, estenose mitral, discrasias sangüíneas e doenças auto-imunes, como o lúpus eritematoso sistêmico (LES), a síndrome de Goodpasture e as vasculites sistêmicas primárias, principalmente aquelas associadas aos anticorpos anticitoplasma de neutrófilos (Anca), como...

  18. Case report 501: Alveolar soft parts sarcoma with pulmonary metastases

    International Nuclear Information System (INIS)

    Munk, P.L.; Connell, D.G.; Mueller, N.L.; Lentle, B.C.

    1988-01-01

    Alveolar soft part sarcoma (ASPS) is a rare, soft tissue malignancy, usually presenting in young adults. We report a patient with ASPS in the thigh, evaluated with plain films, computed tomography, and a radionuclide scan. The findings in this patient and those in which CT findings have been reported in the literature, show a similar appearance which we believe is highly suggestive of this unusual tumor. The combination of a soft tissue lesion, that on CT appears highly vascular, with features suggestive of an arteriovenous malformation, in association with multiple pulmonary nodules and a bone scan with features suggestive of infection should lead to a consideration of this rare entity. (orig./GDG)

  19. A review on alveolar ridge preservation following tooth extraction.

    Science.gov (United States)

    Horowitz, Robert; Holtzclaw, Danny; Rosen, Paul S

    2012-09-01

    The question that clinicians face is whether the use of bone replacement grafts and/or barrier membranes enhance their ability to provide for the future placement of a dental implant or to maximize ridge dimensions following the extraction of a tooth versus no additional treatments. The evidence was obtained by search of Entrez PubMed and manual search of The International Journal of Oral and Maxillofacial Implants, The International Journal of Periodontics & Restorative Dentistry, Clinical Oral Implant Research, The Journal of Periodontology, The Journal of Clinical Periodontology, and The Compendium of Continuing Education in Dentistry. Key search words included Guided Bone Regeneration, Dental Extraction, Tooth Extraction, Bone Replacement Graft, Alveolar Ridge. The years of search included from January 2011 through February 2012. The recurring theme was that there was considerable heterogeneity to study designs, time periods, and methods of evaluation. This created great difficulty in trying to answer with good high-quality evidence questions about the techniques and materials to be used for maximizing regeneration at the time of tooth extraction or in which situations this ought to be used. There appears to be consensus from the reviewed literature supporting ridge preservation techniques as a whole. Multiple studies demonstrated less ridge resorption occurring when alveolar ridge preservation procedures were used versus the placement of no graft material in fresh alveolar sockets. The analysis did not show any grafting materials demonstrating a clear benefit over any others or that a barrier membrane is necessary. The evidence is also too premature about whether socket preservation efforts require primary closure. In the emerging area of growth factors, there is no high-quality evidence to either support or refute their use. Tooth extraction is one of the most widely performed procedures in dentistry today and it has been historically well documented that

  20. Is acute alveolar dilation an indicator of strangulation homicide?

    DEFF Research Database (Denmark)

    Klysner, Anne; Lynnerup, Niels; Hougen, Hans Petter

    2011-01-01

    Some cases of suspected homicidal strangulation are difficult to diagnose if the classical injuries of strangulation are few or lacking. The main purpose of this study was to determine if abnormal distension of alveolar airspaces is present in strangulation deaths and whether or not it can be used...... to support this diagnosis. Another purpose was to see how often the gross examination of the lungs was in agreement with the microscopic examination. The material comprised 33 victims of homicidal strangulation above the age of 15 years, autopsied at the Department of Forensic Medicine in Copenhagen between...

  1. Alveolar hemorrhage after scuba diving: a case report.

    Science.gov (United States)

    Tsai, Ming-Ju; Tsai, Mee-Sun; Tsai, Ying-Ming; Lien, Chi-Tun; Hwang, Jhi-Jhu; Huang, Ming-Shyan

    2010-07-01

    Self-contained underwater breathing apparatus (scuba) diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving. Copyright 2010 Elsevier. Published by Elsevier B.V. All rights reserved.

  2. Alveolar Hemorrhage After Scuba Diving: A Case Report

    Directory of Open Access Journals (Sweden)

    Ming-Ju Tsai

    2010-07-01

    Full Text Available Self-contained underwater breathing apparatus (scuba diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving.

  3. Demineralized dentin matrix scaffolds for alveolar bone engineering

    Directory of Open Access Journals (Sweden)

    In-Woong Um

    2017-01-01

    Full Text Available From the point of view of implant dentistry, this review discusses the development and clinical use of demineralized dentin matrix (DDM scaffolds, produced from the patient's own extracted teeth, to repair alveolar bone defects. The structure and the organic and inorganic components of DDM are presented to emphasize the similarities with autogenous bone. Studies of DDM properties, such as osteoinductive and osteoconductive functions as well as efficacy and safety, which are mandatory for its use as a bone graft substitute, are also presented. The clinical applications of powder, block, and moldable DDM are discussed, along with future developments that can support growth factor and stem cell delivery.

  4. Analisis Keagenan pada Bank yang Memiliki Anak Perusahaan Leasing

    Directory of Open Access Journals (Sweden)

    Novia Nour Halisa

    2017-05-01

    antara biaya agensi terhadap tingkat risiko kredit dan profitabilitas. Pengumpulan data sekunder penelitian diperoleh dari laporan keuangan bank dan leasing dengan teknik pengambilan sampel yaitu purposive sampling sehingga diperoleh sampel enam perbankan dan tiga perusahaan leasing. Metode analisis data yang digunakan adalah analisis deskriptif statistika dan analisis Structural Equation Modelling (SEM-PLS. Hasil penelitian menunjukkan bahwa biaya agensi pada bank yang memiliki anak perusahaan leasing lebih rendah jika dibandingkan dengan bank. Selanjutnya biaya agensi memiliki pengaruh signifikan terhadap risiko kredit, biaya agensi memiliki pengaruh tidak signifikan terhadap profitabilitas, sedangkan risiko kredit memiliki pengaruh signifikan terhadap profitabilitas.Kata kunci: keagenan, biaya agensi, profitabilitas, risiko kredit, partial least square

  5. ANALISIS KELAYAKAN FINANSIAL WISATA AIR WADUK JATIGEDE KABUPATEN SUMEDANG

    Directory of Open Access Journals (Sweden)

    Bambang Susanto

    2016-04-01

    pendahuluan agar manfaatnya jauh lebih besar dari biaya yang dikeluarkan. Oleh sebab itu untuk kepentingan ilmiah perlu dilakukan kajian akademisnya berupa Analisis kelayakan Finansial. Berdasarkan analisis kelayakan keuangan   ,dapat  disimpulkan bahwa wisata air di Waduk jatigede Kabupaten Sumedang  memberikan manfaat yang lebih dibandingkan dengan biaya yang dikeluarkan . ini dapat dilihat dari hasil analisis net present value yang positif, internal rate of return yang lebih besar dari tingkat bunga bank serta benefit cost yang lebih besar dari satu. Kata Kunci: Kelayakan Finansial; Wisata Air.

  6. ANALISIS RELEVANSI LULUSAN PERGURUAN TINGGI DENGAN DUNIA KERJA

    Directory of Open Access Journals (Sweden)

    Ali Muhson

    2012-04-01

    Full Text Available Abstract: A Relevance Analysis of University Graduates with World of Work. Education should be oriented to the competencies required by the workforce as a percentage of unemployment among the educated increase continuously. This study aims to examine the relevance of YSU Economic Education graduates. The study only focuses on the type of work and subjects taught. The subject of this study is the alumni of Economic Education Study Program. Sampling technique used is snowball sampling. Data collection technique using questionnaires and documentation while the technique of data analysis using descriptive analysis. The result suggests that the majority of the graduates find their first job as private a teacher, a private employee and a tutor, while current job of the most graduates are private teacher, private employee, and civil servant (teacher. The data shows that more than 50 percent of the graduates work in the education area. This implies that the relevance level based on the type of work is categorized as sufficient. Majority of the graduates teaches social science, economic, and entrepreneurship, hence it can be concluded that the relevance level based on the subjects taught is highly relevant.   Keyword: relevance of graduates, type of work, unemployment, employment     Abstrak: Analisis Relevansi Lulusan Perguruan Tinggi dengan Dunia Kerja. Pendidikan harus berorientasi pada kompetensi yang dibutuhkan oleh dunia kerja karena persentase penganggur di kalangan terdidik terus meningkat. Penelitian ini bertujuan untuk mengkaji tingkat relevansi (kesesuaian lulusan Pendidikan Ekonomi UNY. Kajian hanya diarahkan pada jenis pekerjaan dan mata pelajaran yang diampu. Penelitian ini mengambil subjek alumni Prodi Pendidikan Ekonomi dari berbagai angkatan. Teknik sampling yang digunakan adalah snowball sampling. Teknik pengumpulan data menggunakan angket dan dokumentasi sedangkan teknik analisis data menggunakan analisis deskriptif. Penelitian ini

  7. The axonal guidance cue semaphorin 3C contributes to alveolar growth and repair.

    Directory of Open Access Journals (Sweden)

    Arul Vadivel

    Full Text Available Lung diseases characterized by alveolar damage such as bronchopulmonary dysplasia (BPD in premature infants and emphysema lack efficient treatments. Understanding the mechanisms contributing to normal and impaired alveolar growth and repair may identify new therapeutic targets for these lung diseases. Axonal guidance cues are molecules that guide the outgrowth of axons. Amongst these axonal guidance cues, members of the Semaphorin family, in particular Semaphorin 3C (Sema3C, contribute to early lung branching morphogenesis. The role of Sema3C during alveolar growth and repair is unknown. We hypothesized that Sema3C promotes alveolar development and repair. In vivo Sema3C knock down using intranasal siRNA during the postnatal stage of alveolar development in rats caused significant air space enlargement reminiscent of BPD. Sema3C knock down was associated with increased TLR3 expression and lung inflammatory cells influx. In a model of O2-induced arrested alveolar growth in newborn rats mimicking BPD, air space enlargement was associated with decreased lung Sema3C mRNA expression. In vitro, Sema3C treatment preserved alveolar epithelial cell viability in hyperoxia and accelerated alveolar epithelial cell wound healing. Sema3C preserved lung microvascular endothelial cell vascular network formation in vitro under hyperoxic conditions. In vivo, Sema3C treatment of hyperoxic rats decreased lung neutrophil influx and preserved alveolar and lung vascular growth. Sema3C also preserved lung plexinA2 and Sema3C expression, alveolar epithelial cell proliferation and decreased lung apoptosis. In conclusion, the axonal guidance cue Sema3C promotes normal alveolar growth and may be worthwhile further investigating as a potential therapeutic target for lung repair.

  8. Gravidez em paciente com microlitíase alveolar pulmonar grave Pregnancy in a patient with severe pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    José Osmar Bezerra de Souza Filho

    2008-10-01

    Full Text Available A microlitíase alveolar pulmonar (MAP é uma doença rara que atinge ambos os pulmões, caracterizada pela presença de pequenos cálculos (fosfato de cálcio nos espaços alveolares. Relatamos o caso de uma paciente do sexo feminino, de 26 anos, cujo diagnóstico foi confirmado com base nos achados marcantes na radiografia de tórax e tomografia computadorizada de alta resolução. A paciente, gestante de 28 semanas, retornou ao hospital 10 meses após o diagnóstico apresentando insuficiência respiratória hipoxêmica e com distúrbio ventilatório restritivo grave à espirometria. Após completadas 32 semanas e 4 dias de gestação, foi submetida aparto cesariano, com sucesso para mãe e filha. A MAP tem evolução clínica variável. Tem provável caráter autossômico recessivo e associação com história familiar positiva. A etiologia é incerta, e muitos autores especulam que haja um defeito enzimático local responsável pelo acúmulo intra-alveolar de cálcio. Relatos de pacientes com MAP que engravidaram são excepcionais, sendo o presente caso o primeiro descrito no Brasil. O curso dessa doença costuma ser lentamente progressivo, e os pacientes geralmente falecem devido à insuficiência cardiorrespiratória. O presente caso ilustra a necessidade de se oferecer aconselhamento genético e orientações sobre o risco de gravidez às pacientes, especialmente em casos de doença avançada. Atualmente, a única terapia efetiva é o transplante pulmonar.Pulmonary alveolar microlithiasis (PAM is a rare disease that affects both lungs. It is characterized by the presence of small calculi (calcium phosphate within the alveolar spaces. We report the case of a 26-year-old female whose diagnosis was based on characteristic findings on chest X-rays and high-resolution computed tomography scans. The patient, 28 weeks pregnant, was rehospitalized 10 months after the diagnosis, presenting hypoxemic acute respiratory failure and severe restrictive

  9. Analisis Kekuatan Struktur Pallet Menggunakan Metode Elemen Hingga

    Directory of Open Access Journals (Sweden)

    Tria Mariz Arief

    2015-07-01

    Full Text Available Pallet sebagai suatu alat bantu untuk mempermudah proses bongkar-muat logistik. Palletdigunakan hampir dalam berbagai lingkungan transportasi logistik. Pada bahasan berikutdikhususkan dalam lingkup transportasi di dalam pesawat udara khususnya pada pesawatangkut militer. Di lingkungan militer pallet digunakan untuk transport logistik baik secara normalmuat (loading dan bongkar (unloading maupun kondisi bongkar dengan diterjunkan daripesawat udara. Untuk pemenuhan penggunaan tersebut dilakukan perancangan ulang (reverseengineering struktur pallet yang dapat dimanufaktur secara lokal. Hipotesis awal menunjukkanbahwa berdasarkan kondisi pembebanan pada pallet dapat diperkirakan bahwa kondisitegangan dan regangan maksimum akan terjadi pada posisi sudut struktur pallet yang ditransferbebannya ke komponen plat besi penahan siku-siku dan baut. Material yang digunakan padastruktur pallet adalah Allumunium Alloy 7075-T6 dengan kekuatan tarik sebesar 503 MPa.Analisis dilakukan dengan menggunakan simulasi numerik dengan metoda elemen hingga(FEM. Proses simulasi numerik kekuatan struktur pallet difokuskan pada pembebanan statis(termasuk pengaruh factor G dalam interval beban statis 4 ton sampai 7 ton. Analisis dilakukanpada perubahan variabel tegangan dan regangan terhadap variasi beban yang diberikan untukmendapatkan tingkat keamanan struktur (margin safety. Pemodelan dilakukan denganidealisasi model ¼ bagian menggunakan elemen terstruktur dengan jenis elemen hexahedral(brick dengan jumlah 73803 elemen dan 360323 node. Hasil analisis menunjukkan teganganekuivalen maksimum struktur Pallet adalah 94 MPa yang terjadi di penguat sudut (anglebracket. Sedangkan pada struktur penguat lapis (sandwich structure berbahan thick blockyang mempunyai kekuatan sebesar 20 MPa adalah sebesar 0.84 MPa. Tingkat keamanansecara keseluruhan struktur dengan mempertimbangkan factor G hingga 2 adalah 5.3.Kata kunci: Analisis struktur, pallet, logistik, reverse engineering, FEM

  10. ANALISIS PERANCANGAN BUSINESS INTELLIGENCE BERBASIS SAAS CLOUD COMPUTING

    Directory of Open Access Journals (Sweden)

    I Gede Adnyana

    2014-05-01

    Full Text Available Persaingan bisnis yang ketat, mendorong setiap perusahaan menyusun strategi bisnis agar dapat bertahan dari para pesaing. Penyusunan strategi bisnis mutlak memerlukan informasi yang tepat dan akurat, pengolahan hingga analisis data yang menghasilkan informasi yang tepat dan akurat menjadi proses yang sangat penting. Business Intelligence (BI menawarkan solusi bisnis untuk menganalisis data dan memungkinkan suatu perusahaan untuk mengambil keputusan untuk meningkatkan keuntungan dan kinerja bisnis. Namun, BI mahal untuk diimplementasikan, memerlukan biaya pemeliharaan yang tidak sedikit dan infrastruktur yang kuat. Hal ini mendorong perusahaan mengurangi biaya tetapi masih memiliki teknologi yang tepat untuk memungkinkan mereka untuk membuat keputusan, mengidentifikasi peluang dan proaktif mengidentifikasi risiko yang dapat mempengaruhi bisnis. Konsep Software as a Service (SaaS Cloud Computing dapat menjawab tantangan yang dihadapi BI. Sebelum merancang BI berbasis SaaS perlu diketahui parameter-parameter evaluasi hingga kelebihan dan kekurangannya.

  11. ANALISIS LEMBAR KERJA SISWA DALAM MENINGKATKAN KOMUNIKASI MATEMATIS TULIS SISWA

    Directory of Open Access Journals (Sweden)

    Fimmatur Rizka Ardina

    2016-02-01

    Komunikasi merupakan suatu kemampuan yang penting untuk dimiliki setiap manusia. Komunikasi dalam artikel ini difokuskan pada komunikasi matematis tulis. Komunikasi matematis tulis ini akan berhubungan dengan lembar kerja siswa yang dipakai dalam proses pembelajaran. Tujuan penulisan artikel ini adalah untuk mendeskripsikan proses analisis LKS sebagai alat untuk meningkatkan komunikasi matematis tulis siswa. Jenis penelitian yang digunakan adalah kualitatif deskriptif. LKS akan dianalisis menggunakan standar indikator kemampuan komunikasi NCTM (2000 yang dimodifikasi sehingga terdapat empat indikator yaitu (1 siswa dapat menuliskan ide yang dimiliki dengan jelas dan tepat (2 siswa dapat menuliskan alasan untuk jawaban yang diberikan (3 siswa dapat memberikan tanggapan untuk ide atau jawaban siswa lain (4 siswa dapat menuliskan kembali ide orang lain menggunakan bahasanya sendiri. Berdasarkan hasil penelitian dapat disimpulkan bahwa LKS oleh Tim MGMP Kota Malang tidak dapat digunakan sebagai alternatif untuk meningkatkan kemmapuan komunikasi matematis tulis siswa.

  12. ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI INDEPENDENSI PENAMPILAN AKUNTAN PUBLIK

    Directory of Open Access Journals (Sweden)

    Ardiani Ika S.

    2012-03-01

    Full Text Available Tujuan dari penelitian ini adalah untuk menguji secara empiris faktor-faktor yang mempengaruhi independensi penampilan akuntan publik baik secara parsial dan simultan. Faktor-faktor tersebut adalah financial interests, hubungan bisnis dengan klien, pelayanan asuransi dan audit, hubungan antara klien atau yg diaudit dengan auditor, kompetisi antara Kantor Akuntan Publik (KAP, ukuran KAP dan audit fee. Populasi dalam penelitian ini adalah para auditor di akuntan publik di Semarang tahun 2009. Metode penyeleksian sampel yang digunakan adalah convenience sampling dan jumlah respondennya 35. Alat analisis yang digunakan adalah multiple regression analysis. Dimulai dengan analisis kuantitatif untuk mengetes validitas dan reabilitas. Kemudian dilanjutkan uji asumsi klasik termasuk normality, multicollinearity, and heteroscedastisity. Hasil menunjukkan bahwa 6 variabel yang sudah dikaji secara simultan dan partial tersebut mempunyai efek yang signifikan terhadap independensi penampilan akuntan publik dengan R square 0.749. The objective of this study is to test empirically the factors that influence the independence of public accountant appearance both partially and simultaneously. The factors cover financial interests, business relationships with clients, assurance services and audit services, the length of relationship between client or auditee and auditor, the competition between Public Accountan Offices (KAPs, the size of KAP, and audit fee. The population in this study was the auditors who worked in the public accountant’s office in Semarang in 2009. The sample selection method is a convenience sampling and the  number of  respondents are 35. The Analysis tools used is multiple regression analysis. It starts by applying quantitative analysis to test the validity and reliability. Then, it is continued by testing the classical assumptions which include normality, multicollinearity, and heteroscedastisity. The result shows that the six

  13. ANALISIS KENDALA POTENSIAL PENERAPAN TOTAL QUALITY MANAGEMENT HOTEL PLAZA SEMARANG

    Directory of Open Access Journals (Sweden)

    Hendrajaya -

    2010-03-01

    Full Text Available Penelitian ini bertujuan untuk menemukan faktor-faktor yang terbentuk dari kendala penerapan Total Quality Management (TQM, sebagai upaya untuk menganalisis masalah-masalah potensial dari penerapan TQM di Hotel Plaza, Semarang. Sampel dari penelitian ini sejumlah 65 karyawan Hotel Plaza, Semarang yang terdiri dari manajer dan staf. Teknik analisis menggunakan Faktor Analisis. Hasil penelitian menunjukkan, bahwa kendala potensial dari implementasi TQM dapat disimpulkan menjadi lima faktor, yaitu faktor inkonsistensi, visi-misi, transformasi budaya, manajerial dan manajemen kualitas. Penelitian ini memberikan rekomendasi bahwa peningkatan fungsi-fungsi korporat melalui optimalisasi kualitas sebagai strategi bisnis dan orientasi pada kepuasan konsumen dengan melibatkan seluruh anggota organisasi, akan menjadi dasar untuk memaksimalkan daya saing perusahaan dalam hal produk, layanan, SDM, lingkungan dan seluruh proses yang dapat mendukung upaya perbaikan produktivitas. This study aims to determine the constraint factors and to analyze the potential problems of TQM implementation of Plaza Semarang Hotel. The sample of 65 employees of TQM implementation of Plaza Semarang Hotel, consist of managers and staffs. Factor analysis is used to achieve the results of the potential constraint implementation of Total Quality Management which can be summarized into five factors, they are: the factor of inconsistencies, the factor of vision and mission, cultural transformation factors, managerial factors and the factors of quality management. In order to increase the corporate functions through the optimization of quality as a business strategy and to achieve customer satisfaction, this study suggests that all members of the organization should be involved by the company as on-going basis to maximize the competitiveness of the organization on products, services, human resources, environment and all processes that support productivity improvement.

  14. ENCAPAI SUMBER DAYA MANUSIA UNGGUL (ANALISIS KINERJA DAN KUALITAS PELAYANAN

    Directory of Open Access Journals (Sweden)

    Ketut Sudarma

    2012-03-01

    Full Text Available Penelitian ini  bertujuan untuk menganalisis pengaruh kemampuan individu, kepuasan kerja, komitmen organisasi terhadap kinerja dan kinerja terhadap kualitas pelayanan. Sampel penelitian berjumlah 76 orang. Teknik pengambilan sampel menggunakan proportional random sampling. Variabel penelitian terdiri dari kemampuan individu, kepuasan kerja, komitmen organisasi, dan kinerja serta kualitas pelayanan  Analisis data menggunakan regresi dua tahap. Hasil penelitian menunjukkan bahwa kemampuan individu, kepuasan kerja dan komitmen organisasi mempunyai pengaruh positif signifikan terhadap kinerja dan kinerja berpengaruh positif signifikan terhadap kualitas pelayanan. Ini berarti semakin meningkat kinerja, maka semakin meningkat juga kualitas pelayanan. Dari hasil analisis deskriptif persentase tampak secara rata-rata  semua variabel penelitian  menunjukkan kategori baik, namun pada aspek-aspek tertentu pada masing-masing variabel masih terdapat kekurangan. Hasil penelitian ini diharapkan dapat menjadi masukan bagi pimpinan dalam meningkatkan kinerja dan kualitas pelayanan. Upaya perbaikan dimulai dari peningkatan kemampuan melalui pendidikan dan latihan, monitoring pelaksanaan kerja secara rutin, menumbuhkan komitmen kerja dan perbaikan standar operasi prosedur.The aim of the study is toanalyze the influence of individual abilities, job satisfaction, organizational commitment to performanceand performance againstservice quality. This samplingmethod is using 76 samples by the proportionalrandom sampling techniques. Variables consisted of individual ability, job satisfaction, organizational commitment, and performance andservice qualitydata analysisusingtwo-stageregression. The results showedthat theability of individuals, job satisfaction and organizational commitment had asignificant positive effecton performance and the performance ofa significant positive effecton quality of service. It means the higher performance, the higher service

  15. Il difficile cammino dell’analisi musicale in Italia

    Directory of Open Access Journals (Sweden)

    Claudio Annibaldi

    2014-10-01

    Full Text Available Si immaginino gli atti d’un convegno sull’analisi musicale che abbia avuto luogo in un paese come la Francia, la Germania, l’ Inghilterra o gli Stati Uniti. Potrebbe mai accadere che essi vengano pubblicati sostituendo il discorso ufficiale d’apertura dei lavori con un testo tutto nuovo epperò simulante d’esser quello effettivamente pronunciato dall’autore? E potrebbe mai accadere - essendo costui un noto critico musicale e il direttore della collana editoriale comprendente gli atti in questione - che questo nuovo testo sia da lui dedicato a uno sfoggio della propria competenza analitica capace solo di esibire una visione dilettantesca della tecnica musicale tout court? Penso proprio di no. Eppure questo è accaduto in Italia non molti anni fa, quando le Edizioni Unicopli pubblicarono, nella collana dei "Quaderni di Musica/Realtà", gli atti di un convegno sull’analisi musicale tenuto nel 1989 a Reggio Emilia: il primo del genere negli annali della musicologia italiana. L’episodio rende bene l’idea dei pericoli incombenti sul cammino di quegli studiosi che, a far data dal convegno suddetto, si sono adoperati a che la pratica analitica acquisisse anche da noi la dignità scientifica di cui gode, appunto, in paesi come la Francia, la Germania, l’Inghilterra o gli Stati Uniti. Quei pericoli si chiamano ‘dilettantismo tecnico’, ‘arroganza intellettuale’, ‘ vezzo d’ imporre l’uno e l’altra grazie a un qualche tipo di potere personale’, ‘necessità di subire tale imposizione in cambio di qualche vantaggio pratico’.

  16. Ovariectomy delays alveolar wound healing after molar extractions in rats.

    Science.gov (United States)

    Pereira, Michele Conceição; Zecchin, Karina Gottardello; Campagnoli, Eduardo Bauml; Jorge, Jacks

    2007-11-01

    This study was conducted to investigate the morphological effects of the absence of estrogen on alveolar wound healing of young female rats after tooth extraction. A total of 60 4- to 6-week-old female rats underwent bilateral ovariectomy (OVX) or sham operations. Three weeks later, the first mandibular molars were extracted. Subsequently, the animals were killed by cervical dislocation 3, 5, 7, 14, 21, or 28 days after tooth extraction. The mandibles were removed, and serial transversal sections of mesial alveolus of the first mandibular molars were obtained for histometric analysis. OVX sockets showed significant increases in fibroblasts and collagen content 3 and 5 days after the extractions, followed by significant decreases in these parameters in the subsequent periods. In accordance with the decreased collagen content in the latest period of healing, new bone formation was significantly reduced in the OVX animals. These findings suggest that the initial molecular changes observed in the absence of estrogen lead to delayed alveolar wound healing.

  17. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings.

    Science.gov (United States)

    Eguía-Aguilar, Pilar; López-Martínez, Briceida; Retana-Contreras, Carmen; Perezpeña-Diazconti, Mario

    We present the case of a 2-year-old male patient with a facial tumor partially treated with chemotherapy before his admission to our institution. The tumor involved from the frontal region to the maxillary floor, the orbit, and the maxillary and sphenoid sinuses. The histopathological diagnosis revealed a stage IV alveolar rhabdomyosarcoma with infiltration to bone marrow and cerebrospinal fluid. He was managed with four cycles of adriamycin, actinomycin, cyclophosphamide and vincristine; cisplatin and irinotecan were added to the last cycle. The tumor had a 50% size reduction, but the patient died after a neutropenia and fever episode. The aggressive behavior of alveolar rhabdomyosarcoma has been associated with the expression of oncogenic fusion proteins resulting from chromosomal translocations, particularly t(2;13) (q35;q14) PAX3/FOXO1, and t(1;13) (p36;q14) PAX7/FOXO1 which were present in this patient. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  18. Primary pulmonary alveolar proteinosis: computed tomography features at diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Berteloot, Laureline; Emond-Gonsard, Sophie; Mamou-Mani, Tania; Lambot, Karen; Grevent, David [Hopital Necker Enfants-Malades, Department of Pediatric Radiology, Paris (France); Taam, Rola Abou; Le Bourgeois, Muriel [Hopital Necker Enfants-Malades, Department of Pediatric Pneumology and Allergology, Paris (France); Elie, Caroline [Hopital Necker Enfants-Malades, Department of Biostatistics, Paris (France); Paris Descartes University, Paris (France); Delacourt, Christophe; Blic, Jacques de [Hopital Necker Enfants-Malades, Department of Pediatric Pneumology and Allergology, Paris (France); Paris Descartes University, Paris (France); Brunelle, Francis [Hopital Necker Enfants-Malades, Department of Pediatric Radiology, Paris (France); Paris Descartes University, Paris (France)

    2014-07-15

    Pulmonary alveolar proteinosis (PAP) is characterized by an abnormal accumulation of periodic acid-schiff-positive lipoproteinaceous material in the alveoli. Early diagnosis allows setting up of therapeutic lung lavages, which reduces the need for oxygen supplementation and weight gain. To provide a description of radiological features by CT at the onset of primary PAP in children. The clinical and radiological data of 24 patients, including 16 boys and 8 girls (median age: 12 months), diagnosed with a primary form of PAP between April 1992 and May 2012 in a tertiary referral hospital, were retrospectively reviewed. CT images were examined for the presence of alveolar and interstitial elementary lesions. Correlation between clinical and radiological findings was assessed. The types of elementary lesions detected were: ground-glass opacities (n = 24), intralobular lines (n = 24), thickened interlobular septa (n = 22), thickened fissures (n = 21), airspace consolidation (n = 16), hyperinflation (n = 16), cystic lesions (n = 2) and micronodules (n = 1). A crazy-paving pattern was found in 92% of cases. Consolidation and hyperinflation were especially detected in younger children (median age, 8 months, P < 0.01). A density dependent gradient was found. The distribution of the lesions was symmetrical. There was no correlation between radiological and clinical data of severity of the disease. CT findings are suggestive of diagnosis of PAP in immunocompetent children with chronic respiratory failure. (orig.)

  19. Alveolar macrophage dysregulation in Hermansky-Pudlak syndrome type 1.

    Science.gov (United States)

    Rouhani, Farshid N; Brantly, Mark L; Markello, Thomas C; Helip-Wooley, Amanda; O'Brien, Kevin; Hess, Richard; Huizing, Marjan; Gahl, William A; Gochuico, Bernadette R

    2009-12-01

    Individuals with Hermansky-Pudlak syndrome type 1 (HPS-1), an autosomal recessive disorder characterized by defective biogenesis of lysosome-related organelles, develop an accelerated form of progressive fibrotic lung disease. The etiology of pulmonary fibrosis associated with HPS-1 is unknown. To investigate the potential pathogenesis of pulmonary fibrosis in HPS-1, lung cells and proteins from individuals with HPS-1 were studied. Forty-one subjects with HPS-1 with and without pulmonary fibrosis were evaluated with pulmonary function tests, high-resolution computed tomography scan, and bronchoscopy. Bronchoalveolar lavage cells and analytes were analyzed. Concentrations of total bronchoalveolar lavage cells and alveolar macrophages were significantly higher in epithelial lining fluid from subjects with HPS-1 with and without pulmonary fibrosis compared with healthy research volunteers. Concentrations of cytokines and chemokines (i.e., monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha, and granulocyte-macrophage colony-stimulating factor) in alveolar epithelial lining fluid were significantly higher in subjects with HPS-1 with and without pulmonary fibrosis compared with healthy research volunteers (P system in which to study the pathogenesis and treatment of HPS pulmonary fibrosis.

  20. Alveolar Bone Housing- A Modified Wilkodontics Approach- A Case Report

    Science.gov (United States)

    Sanjay, Kothamachu; Bhongade, ML; Shrivastav, Sunita

    2016-01-01

    Accelerated orthodontic treatment is the need of the hour in current scenario as the conventional orthodontics is time taking. Corticotomy assisted orthodontics have been used for years to reduce the treatment duration by reducing the resistance provided by alveolar bone housing. This case report describes the orthodontic treatment combined with the modification in conventional wilkodontic technique in a patient to accelerate tooth movement and shorten the treatment time with an anterior open bite and flared and spaced upper and lower incisors. Firstly plaque control was achieved with supra and subgingival scaling. A modified approach using periodontal access flap followed by vertical bone cuts in the cortical bone from the crest of the alveolar bone margin to 2mm-3mm below the apices of all the anterior teeth extending from upper left canine to upper right canine were performed. These vertical cuts were joined by horizontal cuts apically and flap repositioned. An MBT 0.018 inch appliance was bonded. Orthodontic therapy proceeded with frequent activation of the appliances to retract the incisors every two weeks. The total treatment time was four and half months with active period of two months and no adverse effects were observed at the end of active treatment. The modified decortication technique reduced the treatment time to a considerable extent. The interdental spacing closed and optimum overjet and overbite was achieved. PMID:27656577

  1. Advances in multidisciplinary individualized treatment of refractory hepatic alveolar echinococcosis

    Directory of Open Access Journals (Sweden)

    ABUDUAINI Abulizi

    2015-04-01

    Full Text Available Hepatic alveolar echinococcosis (HAE is a zoonotic parasitic disease that seriously threatens the population in western China and compromises patients′ quality of life. With the continuous improvement in radical resection rate in recent years, late-stage HAE patients that were incurable in the past now have the opportunity for radical resection. However, patients who are not suitable candidates for radical resection still suffer from various complications and poor quality of life. Therefore, HAE is still considered a refractory and complex disease. The simple empirical treatment model provided by traditional professional discussion is unable to satisfy the treatment of advanced refractory HAE as it is unable to integrate specialized, standardized clinical skills for diagnosis and treatment. Multidisciplinary individualized treatment (MDT organically integrates the advantages of the available treatment into a reasonable individualized comprehensive treatment regimen. This review summarizes the advances in MDT for HAE as the best option to increase long-term survival, and suggests MDT as the first-line treatment for late-stage refractory hepatic alveolar echinococcosis.

  2. Peptide secreted by human alveolar macrophages releases neutrophil granule contents

    International Nuclear Information System (INIS)

    MacArthur, C.K.; Miller, E.J.; Cohen, A.B.

    1987-01-01

    A monoclonal antibody was developed against an 8000-kDa enzyme-releasing peptide (ERP) released from human alveolar macrophages. ERP was isolated on an immunoaffinity column containing the antibody bound to staphylococcal protein A-Sepharose, and by autoradiography. Release of ERP from the macrophages is not changed by plastic adherence, phagocytosis, calcium ionophore, or phorbol esters. The peptide was not antigenically similar to interferon-γ, tumor necrosis factor, or interleukin lα or 1β. The release of constituents from azurophilic and specific granules was the main identified biologic function of ERP. ERP was a more effective secretagogue in the untreated neutrophils and f-met-leu-phe was more effective in the cytochalasin B-treated neutrophils. Absorption of ERP from macrophage-conditioned medium removed a small amount of the chemotactic activity; however, the immunopurified peptide was not chemotactic or chemokinetic for neutrophils, and at high concentrations, it suppressed base line chemokinesis. Treatment of washed macrophages with trypsin released active ERP of approximately the same m.w. of spontaneously secreted ERP. These studies showed that human alveolar macrophages release a peptide which is a secretagogue for human neutrophils under conditions which may be encountered in the lungs during certain disease states. Proteolytic enzymes which are free in the lungs may release the peptide and lead to the secretion of neutrophil enzymes

  3. Primary pulmonary alveolar proteinosis: computed tomography features at diagnosis

    International Nuclear Information System (INIS)

    Berteloot, Laureline; Emond-Gonsard, Sophie; Mamou-Mani, Tania; Lambot, Karen; Grevent, David; Taam, Rola Abou; Le Bourgeois, Muriel; Elie, Caroline; Delacourt, Christophe; Blic, Jacques de; Brunelle, Francis

    2014-01-01

    Pulmonary alveolar proteinosis (PAP) is characterized by an abnormal accumulation of periodic acid-schiff-positive lipoproteinaceous material in the alveoli. Early diagnosis allows setting up of therapeutic lung lavages, which reduces the need for oxygen supplementation and weight gain. To provide a description of radiological features by CT at the onset of primary PAP in children. The clinical and radiological data of 24 patients, including 16 boys and 8 girls (median age: 12 months), diagnosed with a primary form of PAP between April 1992 and May 2012 in a tertiary referral hospital, were retrospectively reviewed. CT images were examined for the presence of alveolar and interstitial elementary lesions. Correlation between clinical and radiological findings was assessed. The types of elementary lesions detected were: ground-glass opacities (n = 24), intralobular lines (n = 24), thickened interlobular septa (n = 22), thickened fissures (n = 21), airspace consolidation (n = 16), hyperinflation (n = 16), cystic lesions (n = 2) and micronodules (n = 1). A crazy-paving pattern was found in 92% of cases. Consolidation and hyperinflation were especially detected in younger children (median age, 8 months, P < 0.01). A density dependent gradient was found. The distribution of the lesions was symmetrical. There was no correlation between radiological and clinical data of severity of the disease. CT findings are suggestive of diagnosis of PAP in immunocompetent children with chronic respiratory failure. (orig.)

  4. A 55 years old man with pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    Rebeen R Saeed

    2014-01-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a very rare diffuse chronic lung disease characterized by deposition of small spherules of calcium phosphate within the alveolar cavity. The disease is usually seen from birth up to 40 years of age and is usually diagnosed incidentally during radiography of the chest for other reasons. Most of patients are asymptomatic or having very mild symptoms and the majority of patients either have normal or restrictive pulmonary function test. Clinically, the course of the disease is different; it remains static in few patients or it may progress to pulmonary fibrosis, respiratory failure and cor pulmonale in others. In this case report, we present a 55-year-old man who presented with moderate shortness of breath which has progressed from mild symptoms with in the previous years. His chest high-resolution CT scan showed diffusely scattered, ill-defined little shadowy micronodules which involve the left lung; lingula and left lower lobe in particular. A lung biopsy confirmed the diagnosis of PAM. He was followed up for 1 year with treatment by steroid and alendronate, and no progression was noticed in fact improvement in pulmonary function test noticed. This is the first case report of PAM in Kurdistan.

  5. Evaluation of the Effect of Platelet-Rich Fibrin on the Alveolar ...

    African Journals Online (AJOL)

    2018-02-23

    Feb 23, 2018 ... nonsmokers or positively affect periodontal healing, but it positively affected postoperative pain levels. Keywords: Alveolar osteitis, mandibular third molar, platelet-rich fibrin, probing depth. Evaluation of the Effect of Platelet-Rich Fibrin on the Alveolar Osteitis. Incidence and Periodontal Probing Depth after ...

  6. Is 2 mm a safe distance from the inferior alveolar canal to avoid ...

    African Journals Online (AJOL)

    2015-10-30

    Oct 30, 2015 ... related to implants inserted closer than 2 mm to the inferior alveolar canal (IAC) with those inserted further than 2 ... KEYWORDS: Dental implants, inferior alveolar nerve injury, neurosensory complication. Department of .... such injury occurs, a complete healing is difficult if the extent of the injury is not minor ...

  7. Alveolar index as a means of skull classification: a radiological study ...

    African Journals Online (AJOL)

    Alveolar index is an important parameter in intra and inter-ethnic classification of skull and in defining the positional relation of the maxilla to the mandible. The objective of the study was to evaluate the alveolar index of Nigerians using radiographs. 130 (90 males and 40 females) normal lateral view skull radiographs of ...

  8. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation

    Directory of Open Access Journals (Sweden)

    João Paulo Schwartz

    2016-04-01

    Full Text Available ABSTRACT Objective: This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. Methods: The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years, Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0 and after Herbst treatment (T1. Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B, lingual (L and total (T bone thicknesses were assessed at crestal (1, midroot (2 and apical (3 levels of mandibular incisors. Student's t-test and Wilcoxon t-test were used to compare dependent samples in parametric and nonparametric cases, respectively. Pearson's and Spearman's rank correlation analyses were performed to determine the relationship of changes in alveolar bone thickness. Results were considered at a significance level of 5%. Results: Mandibular incisors showed no statistical significance for vertical alveolar bone level. Alveolar bone thickness of mandibular incisors significantly reduced after treatment at B1, B2, B3, T1 and significantly increased at L2. The magnitude of the statistically significant changes was less than 0.2 mm. The changes in alveolar bone thickness showed no statistical significance with incisor inclination degree. Conclusions: CBCT scans showed an association between the Herbst appliance and alveolar bone loss on the buccal surface of mandibular incisors; however, without clinical significance.

  9. Popliteal pterygium syndrome (PPS) with intra-alveolar syngnathia: a discussion of anesthetic and surgical considerations.

    Science.gov (United States)

    Gahm, Caroline; Kuylenstierna, Richard; Papatziamos, Georgios

    2007-10-01

    Popliteal pterygium syndrome (PPS) is a rare genetic disorder that involves the association of a popliteal web with a combination of craniofacial, genitourinary and extremity malformations. In this article, we describe a patient with PPS complicated with multiple intra-alveolar syngnathia. We discuss the anesthetic and the surgical management of this case and review the literature regarding PPS and intra-alveolar syngnathia.

  10. Morbidity of chin bone transplants used for reconstructing alveolar defects in cleft patients

    NARCIS (Netherlands)

    Booij, A; Raghoebar, GM; Jansma, J; Kalk, WWI; Vissink, A

    Objective: The aim of this study was to evaluate the objective and subjective morbidity of symphyseal chin bone harvesting used for reconstruction of alveolar defects in young cleft patients. Design: All patients who had undergone chin bone harvesting for alveolar cleft reconstruction in the period

  11. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation.

    Science.gov (United States)

    Schwartz, João Paulo; Raveli, Taisa Boamorte; Schwartz-Filho, Humberto Osvaldo; Raveli, Dirceu Barnabé

    2016-01-01

    This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years), Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0) and after Herbst treatment (T1). Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B), lingual (L) and total (T) bone thicknesses were assessed at crestal (1), midroot (2) and apical (3) levels of mandibular incisors. Student's t-test and Wilcoxon t-test were used to compare dependent samples in parametric and nonparametric cases, respectively. Pearson's and Spearman's rank correlation analyses were performed to determine the relationship of changes in alveolar bone thickness. Results were considered at a significance level of 5%. Mandibular incisors showed no statistical significance for vertical alveolar bone level. Alveolar bone thickness of mandibular incisors significantly reduced after treatment at B1, B2, B3, T1 and significantly increased at L2. The magnitude of the statistically significant changes was less than 0.2 mm. The changes in alveolar bone thickness showed no statistical significance with incisor inclination degree. CBCT scans showed an association between the Herbst appliance and alveolar bone loss on the buccal surface of mandibular incisors; however, without clinical significance.

  12. Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients

    DEFF Research Database (Denmark)

    Andersen, Kristian; Nørholt, Sven Erik; Knudsen, Johan

    Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients......Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients...

  13. Is there a relation between local bone quality as assessed on panoramic radiographs and alveolar bone level?

    Science.gov (United States)

    Nackaerts, Olivia; Gijbels, Frieda; Sanna, Anna-Maria; Jacobs, Reinhilde

    2008-03-01

    The aim was to explore the relation between radiographic bone quality on panoramic radiographs and relative alveolar bone level. Digital panoramic radiographs of 94 female patients were analysed (mean age, 44.5; range, 35-74). Radiographic density of the alveolar bone in the premolar region was determined using Agfa Musica software. Alveolar bone level and bone quality index (BQI) were also assessed. Relationships between bone density and BQI on one hand and the relative loss of alveolar bone level on the other were assessed. Mandibular bone density and loss of alveolar bone level were weakly but significantly negatively correlated for the lower premolar area (r = -.27). The BQI did not show a statistically significant relation to alveolar bone level. Radiographic mandibular bone density on panoramic radiographs shows a weak but significant relation to alveolar bone level, with more periodontal breakdown for less dense alveolar bone.

  14. A contemporary perspective on techniques for the clinical assessment of alveolar bone

    Energy Technology Data Exchange (ETDEWEB)

    Hausmann, E. (State Univ. of New York, Buffalo (USA))

    1990-03-01

    Radiographic techniques, traditional ones as well as newer ones under development, for clinically assessing alveolar bone are critically assessed. Traditional intraoral radiography is reexamined, in particular with regard to the accuracy with which the alveolar crest is seen. Evidence is presented for a more accurate representation of the alveolar crest on bitewings rather than periapical films. Application in periodontics of newer radiographic techniques, subtraction radiography, and single and dual photon aborptiometry presently under clinical development are discussed in regard to their potential and limitations. Similarly, radiopharmaceuticals to evaluate the metabolic status of alveolar bone are discussed as well as the potential for using analyses of gingival crevice fluid as a window for assessment of alveolar crest metabolism. 46 references.

  15. A contemporary perspective on techniques for the clinical assessment of alveolar bone

    International Nuclear Information System (INIS)

    Hausmann, E.

    1990-01-01

    Radiographic techniques, traditional ones as well as newer ones under development, for clinically assessing alveolar bone are critically assessed. Traditional intraoral radiography is reexamined, in particular with regard to the accuracy with which the alveolar crest is seen. Evidence is presented for a more accurate representation of the alveolar crest on bitewings rather than periapical films. Application in periodontics of newer radiographic techniques, subtraction radiography, and single and dual photon aborptiometry presently under clinical development are discussed in regard to their potential and limitations. Similarly, radiopharmaceuticals to evaluate the metabolic status of alveolar bone are discussed as well as the potential for using analyses of gingival crevice fluid as a window for assessment of alveolar crest metabolism. 46 references

  16. Clinical study of the alveolar bone height for the dental implant using preoperative computed tomographic examination

    International Nuclear Information System (INIS)

    Sekiya, Keiko; Mori, Shintaro; Sekiya, Kotaro

    2008-01-01

    CT examination is useful for preoperative dental implant, and many studies of concerning clinical studies using CT images have been reported. However, there are few reports comparing alveolar bone heights among age groups of many cases. The purpose of this study was to evaluate the clinical studies of preoperative CT examinations for alveolar bone heights and patient ages at our department of radiology using 64 multi-detector row CT. The subjects consisted of 5174 regions in 1312 (425 males and 887 females, mean age 55.5 yrs, 16-86 yrs) cases of preoperative CT examinations, between April 2006 and December 2007. CT machine used was the Aquilion TM 64 (Toshiba Medical Systems, Japan), and the workstation used was the ZIOSTATION (ZIOSOFT, Japan). All of CT examinations were performed the position of implant placement and disease examined from CT findings. Alveolar bone heights for dental implants were examined from the CT images. For the maxilla, the alveolar bone height was the distance from the alveolar crest to the base of the nasal cavity, or the base of the maxillary sinus. For the mandible, the alveolar bone height is the distance from the alveolar crest and the upper wall of the mandibular canal, or the distance between the alveolar crest and inferior border of mandible. The numbers of the implant position were 955 site for the first molar of the mandible (the average alveolar bone height is 13.9 mm), 652 site for the second molar of the mandible (12.8 mm), and 567 site for the first molar of the maxilla (6.8 mm). In conclusion, the position where implant were to placed the most was the first molar of the mandible, and it's alveolar bone height got lower with age for women. It is over 60% of the maxillary molar area were lower 8 mm, so some kind of osteogenetic treatment was required in many cases, and hence we reassured the importance of CT. (author)

  17. The use of digital periapical radiographs to study the prevalence of alveolar domes

    Energy Technology Data Exchange (ETDEWEB)

    Xambre, Pedro Augusto Oliveira Santos; Valerio, Claudia Scigliano; Alves Cardoso, Claudia Assuncoe; Custodio, Antonio Luis Neto; Manzi, Flavio Ricardo [Dept. of Oral Radiology, School of Dentistry, Pontifical Catholic University of Minas Gerais, Belo Horizonte (Brazil)

    2016-09-15

    In the present study, we coined the term 'alveolar dome' and aimed to demonstrate the prevalence of alveolar domes through digital periapical radiographs. This study examined 800 digital periapical radiographs in regard to the presence of alveolar domes. The periapical radiographs were acquired by a digital system using a photostimulable phosphor (PSP) plate. The χ2 test, with a significance level of 5%, was used to compare the prevalence of alveolar domes in the maxillary posterior teeth and, considering the same teeth, to verify the difference in the prevalence of dome-shaped phenomena between the roots. The prevalence of alveolar domes present in the first pre-molars was statistically lower as compared to the other maxillary posterior teeth (p<0.05). No statistically significant difference was observed in the prevalence of alveolar domes between the maxillary first and second molars. Considering the maxillary first and second molars, it was observed that the palatal root presented a lower prevalence of alveolar domes when compared to the distobuccal and mesiobuccal roots (p<0.05). The present study coined the term 'alveolar dome', referring to the anatomical projection of the root into the floor of the maxillary sinus. The maxillary first and second molars presented a greater prevalence of alveolar domes, especially in the buccal roots, followed by the third molars and second pre-molars. Although the periapical radiograph is a two-dimensional method, it can provide dentists with the auxiliary information necessary to identify alveolar domes, thus improving diagnosis, planning, and treatment.

  18. L’analisi come strumento pratico: un argomento da prendere in considerazione

    Directory of Open Access Journals (Sweden)

    William Drabkin

    2014-10-01

    Full Text Available Il campo dell’analisi musicale generalmente dà l’impressione che molti studi siano fatti in astratto, per dimostrare competenza nella tecnica analitica oppure per fare un omaggio ai grandi maestri. Gli studiosi, avendo passato molti anni nell’apprendimento dei repertori, delle teorie musicali e delle metodologie analitiche, naturalmente pensano che l’aspettativa nei loro confronti sia quella di saper fare un’analisi. Nello stesso tempo la ragione principale che li spinge a studiare la musica è che essi adorano la grande letteratura musicale e si sono formati nell’ammirazione per studiosi che in passato tentarono di scoprire i segreti di quei lavori. Il risultato di ciò, naturalmente, è che l’analisi musicale generalmente è "confezionata" nella forma di lavoro erudito; in altre parole i prodotti di un’analisi sono principalmente libri, capitoli di libri e articoli su riviste destinate ad una lettura professionale. L’analisi musicale, inoltre, compare in trattati designati principalmente per preparare futuri professionisti a scrivere più volte sullo stesso argomento, come prova della loro competenza specialistica e della loro dedizione all’arte. Pochi anni fa usai per la prima volta (per me! il metodo analitico schenkeriano con uno scopo più pratico e sono questi risultati che vorrei condividere con voi. Avevo ascoltato alcune registrazioni dei concerti per pianoforte di Mozart e, sebbene lo standard delle esecuzioni fosse molto alto, ero molto deluso dalle cadenze usate nei primi movimenti.

  19. An Optimised Human Cell Culture Model for Alveolar Epithelial Transport

    Science.gov (United States)

    Birch, Nigel P.; Suresh, Vinod

    2016-01-01

    Robust and reproducible in vitro models are required for investigating the pathways involved in fluid homeostasis in the human alveolar epithelium. We performed functional and phenotypic characterisation of ion transport in the human pulmonary epithelial cell lines NCI-H441 and A549 to determine their similarity to primary human alveolar type II cells. NCI-H441 cells exhibited high expression of junctional proteins ZO-1, and E-cadherin, seal-forming claudin-3, -4, -5 and Na+-K+-ATPase while A549 cells exhibited high expression of pore-forming claudin-2. Consistent with this phenotype NCI-H441, but not A549, cells formed a functional barrier with active ion transport characterised by higher electrical resistance (529 ± 178 Ω cm2 vs 28 ± 4 Ω cm2), lower paracellular permeability ((176 ± 42) ×10−8 cm/s vs (738 ± 190) ×10−8 cm/s) and higher transepithelial potential difference (11.9 ± 4 mV vs 0 mV). Phenotypic and functional properties of NCI-H441 cells were tuned by varying cell seeding density and supplement concentrations. The cells formed a polarised monolayer typical of in vivo epithelium at seeding densities of 100,000 cells per 12-well insert while higher densities resulted in multiple cell layers. Dexamethasone and insulin-transferrin-selenium supplements were required for the development of high levels of electrical resistance, potential difference and expression of claudin-3 and Na+-K+-ATPase. Treatment of NCI-H441 cells with inhibitors and agonists of sodium and chloride channels indicated sodium absorption through ENaC under baseline and forskolin-stimulated conditions. Chloride transport was not sensitive to inhibitors of the cystic fibrosis transmembrane conductance regulator (CFTR) under either condition. Channels inhibited by 5-nitro-1-(3-phenylpropylamino) benzoic acid (NPPB) contributed to chloride secretion following forskolin stimulation, but not at baseline. These data precisely define experimental conditions for the application of NCI

  20. Osteopontin regulates dentin and alveolar bone development and mineralization.

    Science.gov (United States)

    Foster, B L; Ao, M; Salmon, C R; Chavez, M B; Kolli, T N; Tran, A B; Chu, E Y; Kantovitz, K R; Yadav, M; Narisawa, S; Millán, J L; Nociti, F H; Somerman, M J

    2018-02-01

    The periodontal complex is essential for tooth attachment and function and includes the mineralized tissues, cementum and alveolar bone, separated by the unmineralized periodontal ligament (PDL). To gain insights into factors regulating cementum-PDL and bone-PDL borders and protecting against ectopic calcification within the PDL, we employed a proteomic approach to analyze PDL tissue from progressive ankylosis knock-out (Ank -/- ) mice, featuring reduced PP i , rapid cementogenesis, and excessive acellular cementum. Using this approach, we identified the matrix protein osteopontin (Spp1/OPN) as an elevated factor of interest in Ank -/- mouse molar PDL. We studied the role of OPN in dental and periodontal development and function. During tooth development in wild-type (WT) mice, Spp1 mRNA was transiently expressed by cementoblasts and strongly by alveolar bone osteoblasts. Developmental analysis from 14 to 240days postnatal (dpn) indicated normal histological structures in Spp1 -/- comparable to WT control mice. Microcomputed tomography (micro-CT) analysis at 30 and 90dpn revealed significantly increased volumes and tissue mineral densities of Spp1 -/- mouse dentin and alveolar bone, while pulp and PDL volumes were decreased and tissue densities were increased. However, acellular cementum growth was unaltered in Spp1 -/- mice. Quantitative PCR of periodontal-derived mRNA failed to identify potential local compensators influencing cementum in Spp1 -/- vs. WT mice at 26dpn. We genetically deleted Spp1 on the Ank -/- mouse background to determine whether increased Spp1/OPN was regulating periodontal tissues when the PDL space is challenged by hypercementosis in Ank -/- mice. Ank -/- ; Spp1 -/- double deficient mice did not exhibit greater hypercementosis than that in Ank -/- mice. Based on these data, we conclude that OPN has a non-redundant role regulating formation and mineralization of dentin and bone, influences tissue properties of PDL and pulp, but does not

  1. Interaction of rat alveolar macrophages with dental composite dust.

    Science.gov (United States)

    Van Landuyt, K L; Cokic, S M; Asbach, C; Hoet, P; Godderis, L; Reichl, F X; Van Meerbeek, B; Vennemann, A; Wiemann, M

    2016-11-26

    Dental composites have become the standard filling material to restore teeth, but during the placement of these restorations, high amounts of respirable composite dust (nano-sized particles may be released in the breathing zone of the patient and dental operator. Here we tested the respirable fraction of several composite particles for their cytotoxic effect using an alveolar macrophage model system. ​METHODS: Composite dust was generated following a clinical protocol, and the dust particles were collected under sterile circumstances. Dust was dispersed in fluid, and 5-μm-filtered to enrich the respirable fractions. Quartz DQ12 and corundum were used as positive and negative control, respectively. Four concentrations (22.5 μg/ml, 45 μg/ml, 90 μg/ml and 180 μg/ml) were applied to NR8383 alveolar macrophages. Light and electron microscopy were used for subcellular localization of particles. Culture supernatants were tested for release of lactate dehydrogenase, glucuronidase, TNF-α, and H 2 O 2 . Characterization of the suspended particles revealed numerous nano-sized particles but also many high volume particles, most of which could be removed by filtering. Even at the highest concentration (180 μg/ml), cells completely cleared settled particles from the bottom of the culture vessel. Accordingly, a mixture of nano- and micron-scaled particles was observed inside cells where they were confined to phagolysosomes. The filtered particle fractions elicited largely uniform dose-dependent responses, which were elevated compared to the control only at the highest concentration, which equaled a mean cellular dose of 120 pg/cell. A low inflammatory potential was identified due to dose-dependent release of H 2 O 2 and TNF-α. However, compared to the positive control, the released levels of H 2 O 2 and TNF-α were still moderate, but their release profiles depended on the type of composite. Alveolar macrophages are able to phagocytize respirable composite dust

  2. Hormonal regulation of alveolarization: structure-function correlation

    Directory of Open Access Journals (Sweden)

    Godinez Marye H

    2006-03-01

    Full Text Available Abstract Background Dexamethasone (Dex limits and all-trans-retinoic acid (RA promotes alveolarization. While structural changes resulting from such hormonal exposures are known, their functional consequences are unclear. Methods Neonatal rats were treated with Dex and/or RA during the first two weeks of life or were given RA after previous exposure to Dex. Morphology was assessed by light microscopy and radial alveolar counts. Function was evaluated by plethysmography at d13, pressure volume curves at d30, and exercise swim testing and arterial blood gases at both d15 and d30. Results Dex-treated animals had simplified lung architecture without secondary septation. Animals given RA alone had smaller, more numerous alveoli. Concomitant treatment with Dex + RA prevented the Dex-induced changes in septation. While the results of exposure to Dex + RA were sustained, the effects of RA alone were reversed two weeks after treatment was stopped. At d13, Dex-treated animals had increased lung volume, respiratory rate, tidal volume, and minute ventilation. On d15, both RA- and Dex-treated animals had hypercarbia and low arterial pH. By d30, the RA-treated animals resolved this respiratory acidosis, but Dex-treated animals continued to demonstrate blood gas and lung volume abnormalities. Concomitant RA treatment improved respiratory acidosis, but failed to normalize Dex-induced changes in pulmonary function and lung volumes. No differences in exercise tolerance were noted at either d15 or d30. RA treatment after the period of alveolarization also corrected the effects of earlier Dex exposure, but the structural changes due to RA alone were again lost two weeks after treatment. Conclusion We conclude that both RA- and corticosteroid-treatments are associated with respiratory acidosis at d15. While RA alone-induced changes in structure andrespiratory function are reversed, Dex-treated animals continue to demonstrate increased respiratory rate, minute

  3. [Evaluation with different measuring methods for the alveolar bone change of ridge preservation in molar sites].

    Science.gov (United States)

    Zhao, Li-ping; Zhan, Ya-lin; Hu, Wen-jie; Xu, Tao; Wei, Yi-ping; Zhen, Min; Wang, Cui

    2016-02-18

    To investigate the changes of the vertical height and width of the alveolar bone six months after the alveolar ridge preservation in periodontal compromised molar sites of severe alveolar bone defects with clinical direct measurement, parallel periapical radiographs, and cone-beam computed tomography (CBCT), and to analyze the effect of the three different methods of measurement. In this study, 20 subjects requiring tooth extraction on account of periodontal disease with a total of 23 extracted molars were enrolled. Extractions were performed atraumatically and patients were received alveolar ridge preservation procedure with Bio-Oss and Bio-Gide. Clinical direct measurements were taken after tooth extraction and during the implant surgery 6 months later, CBCT scans and parallel periapical radiographs were taken immediately after ridge preservation and 6 months later. The changes of alveolar ridge width and vertical height after six months were measured and analyzed through the above-mentioned three methods and the similarities and differences of the measured effect were compared. There were no significant difference of alveolar vertical height in the center of the extraction sites, the center of distal aspect, and distobuccal aspect between the clinical direct measurements and the CBCT measurements (P>0.05), alveolar vertical height in other points and alveolar width measurements were statically significant (Palveolar increased significantly and the changes of alveolar vertical height of clinical direct and CBCT measurement were (6.15 ± 1.73) mm and (6.59 ± 2.53) mm, respectively. The measurements of the width of the alveolar bone were (8.45 ± 1.18) mm and (8.52 ± 1.27) mm, respectively. The measurements of the two methods were not statistically significant (P>0.05). The change of the alveolar height in the center of the extraction socket after six months measured by parallel periapical was (5.84 ± 4.28) mm, which was closed to the clinical direct measurement

  4. ANALISIS INVENTORI REAKTOR DAYA EKSPERIMENTAL JENIS REAKTOR GAS TEMPERATUR TINGGI

    Directory of Open Access Journals (Sweden)

    Sri Kuntjoro

    2016-06-01

    Full Text Available ABSTRAK ANALISIS INVENTORI REAKTOR DAYA EKSPERIMENTAL JENIS REAKTOR GAS TEMPERATUR TINGGI. Berkaitan dengan rencana Badan Tenaga Nuklir Nasional (BATAN untuk mengoperasikan reaktor eksperimental jenis Reaktor Gas Temperatur Tinggi (RGTT, maka diperlukan analisis keselamatan terhadap reaktor terutama yang berkaitan dengan issue lingkungan. Analisis sebaran radionuklida dari reaktor ke lingkungan pada kondisi operasi normal atau abnormal diawali dengan estimasi sumber radionuklida di teras reaktor (inventori teras berdasarkan pada tipe, daya, dan operasi reaktor. Tujuan penelitian adalah melakukan analisis inventori teras untuk disain Reaktor Daya Eksperimental (RDE jenis reaktor gas temperature tinggi berdaya 10 MWt, 20 MWt dan 30 MWt. Analisis dilakukan menggunakan program ORIGEN2 berbasis pustaka penampang lintang pada temperatur tinggi. Perhitungan diawali dengan membuat modifikasi beberapa parameter pustaka tampang lintang berdasarkan temperatur rata-rata teras sebesar 5700 °C dan dilanjutkan dengan melakukan perhitungan inventori reaktor untuk reaktor RDE berdaya 10 MWt. Parameter utama reaktor RDE 10 MWt yang digunakan dalam perhitungan sama dengan parameter utama reaktor HTR-10. Setelah inventori reaktor RDE 10 MWt diperoleh, dilakukan perbandingan dengan hasil dari peneliti terdahulu. Berdasarkan kesesuaian hasil yang didapat dilakukan desain untuk reaktor RDE 20MWEt dan 30 MWt untuk memperoleh parameter utama reaktor tersebut berupa jumlah bahan bakar pebble bed di teras reaktor, tinggi dan diameter teras. Berdasarkan pareameter utama teras dilakukan perhitungan inventori teras RDE 20 MWt dan 30 MWt dengan metode yang sama dengan metode perhitungan pada RDE 10 MWt. Hasil yang diperoleh adalah inventori terbesar untuk reaktor RDE 10 MWt, 20 MWt dan 30 MWt secara berurutan untuk kelompok Kr adalah sekitar 1,00E+15 Bq, 1,20E+16 Bq, 1,70E+16 Bq untuk kelompok I sebesar 6,50E+16 Bq, 1,20E+17 Bq, 1,60E+17 Bq dan untuk

  5. Modified technique for preservation of inferior alveolar nerve during mandibulectomy.

    Science.gov (United States)

    Chen, Min-Jie; Yang, Chi; Huang, Dong; He, Dong-Mei; Wang, Yi-Wen; Zhang, Wen-Hao

    2017-12-01

    The purpose of this article is to introduce the modified technique of preservation of the inferior alveolar nerve (IAN) during mandibulectomy for a benign lesion. Five cases of osteofibrous hyperplasia and 3 cases of centricity osteomyelitis were included. During surgery, the IAN was marked using a planned cutting guide. Using an oscillating saw, the depth of the osteotomy along the IAN was controlled until the bone cortex was cut through. After splitting, the bony section was removed, leaving the neurovascular bundle intact. The sensation of the lower lip was evaluated using current perceptive threshold testing during follow-up. After follow-up for 6-27 months, no recurrence or secondary deformity was found. One patient had severe sensory disturbance. With the use of a cutting guide and osteotomy tricks, mandibulectomy with preservation of the IAN can be accurately performed. © 2017 Wiley Periodicals, Inc.

  6. Hepatic alveolar echinococcosis: correlative US and CT study

    Energy Technology Data Exchange (ETDEWEB)

    Didier, D.; Weiler, S.; Rohmer, P.; Lasseque, A.; Deschamps, J.P.; Vuitton, D.; Miguet, J.P.; Weill, F.

    1985-01-01

    A total of 24 cases of hepatic alveolar echinococcosis (HAE) due to Echinococcus multilocularis was assessed by US and CT. The diagnosis was confirmed in all cases by immunologic and histologic study. Both US and CT patterns of HAE showed changes of liver morphology in both contour and size. Abnormal areas of parenchyma were nodular or in fields, irregular, heterogeneous, and basically echogenic. Clustered microcalcifications were encountered within the abnormal parenchymal fields in 50% of cases, and necrotized zones occurred in 40% of cases. Dilatation of intrahepatic bile ducts was commonly seen, especially on US; hilar involvement was frequent. Follow-up by both techniques can display increases of primary lesions, occurrence of new foci, and local or regional extensions. Precise evaluations of the lesions arising from correlative use of US and CT permits adequate therapeutic management.

  7. Alveolar bone tissue engineering using composite scaffolds for drug delivery

    Directory of Open Access Journals (Sweden)

    Tomonori Matsuno

    2010-08-01

    Full Text Available For many years, bone graft substitutes have been used to reconstruct bone defects in orthopedic and dental fields. However, synthetic bone substitutes such as hydroxyapatite or β-tricalcium phosphate have no osteoinductive or osteogenic abilities. Bone tissue engineering has also been promoted as an alternative approach to regenerating bone tissue. To succeed in bone tissue engineering, osteoconductive scaffolding biomaterials should provide a suitable environment for osteogenic cells and provide local controlled release of osteogenic growth factors. In addition, the scaffold for the bone graft substitute should biodegrade to replace the newly formed bone. Recent advances in bone tissue engineering have allowed the creation of composite scaffolds with tailored functional properties. This review focuses on composite scaffolds that consist of synthetic ceramics and natural polymers as drug delivery carriers for alveolar bone tissue engineering.

  8. A case of pulmonary alveolar microlithiasis with Cor Pulmonale.

    Science.gov (United States)

    Chen, Wen; Gu, Tao

    2012-03-01

    Pulmonary alveolar microlithiasis (PAM) is a rare disease characterized by the formation and deposition of microliths within the alveoli and a paucity of symptoms in contrast to the imaging findings. It has familial tendency and is thought to be an autosomal recessive disorder with the mutation in the SLC34A2 gene. We describe a case of PAM with Cor Pulmonale. Ultrasonic cardiogram showed pulmonary hypertension (82 mmHg). Chest radiography revealed diffuse, bilateral sandstorm-like micronodules with greater density in the lower lung fields. HRCT scans demonstrated diffuse ground-grass opacities, thickening and calcification of interlobular septa and confluent calcified nodules. A diagnosis of PAM was suggested and confirmed by transbronchial lung biopsy (TBLB).

  9. Alveolar wound healing in rats fed on high sucrose diet.

    Science.gov (United States)

    Baró, María A; Rocamundi, Marina R; Viotto, Javier O; Ferreyra, Ruth S

    2013-01-01

    The potential for bone repair is influenced by various biochemical, biomechanical, hormonal, and pathological mechanisms and factors such as diet and its components, all of which govern the behavior and function of the cells responsible for forming new bone. Several authors suggest that a high sucrose diet could change the calcium balance and bone composition in animals, altering hard tissue mineralization. The mechanism by which it occurs is unclear. Alveolar healing following tooth extraction has certain characteristics making this type of wound unique, in both animals and humans. The general aim of this study was to evaluate and quantify the biological response during alveolar healing following tooth extraction in rats fed on high sucrose diets, by means of osteocyte lacunae histomorphometry, counting empty lacunae and measuring areas of bone quiescence, formation and resorption. Forty-two Wistar rats of both sexes were divided into two groups: an experimental group fed on modified Stephan Harris diet (43% sucrose) and a control group fed on standard balanced diet. The animals were anesthetized and their left and right lower molars extracted. They were killed at 0 hours, 14, 28, 60 and 120 days. Samples were fixed, decalcified in EDTA and embedded in paraffin to prepare sections for optical microscopy which were stained with hematoxylin/eosin. Histomorphometric analysis showed significant differences in the size of osteocyte lacunae between groups at 28 and 60 days, with the experimental group having larger lacunae. There were more empty lacunae in the experimental group at 14 days, and no significant difference in the areas of bone activity. A high sucrose diet could modify the morphology and quality of bone tissue formed in the alveolus following tooth extraction.

  10. Ontogeny of pulmonary alveolar epithelial markers of differentiation.

    Science.gov (United States)

    Joyce-Brady, M F; Brody, J S

    1990-02-01

    We studied differentiation of the pulmonary epithelium in the periphery of fetal rat lung in vivo and in vitro by comparing the ontogeny of cell-surface glycoconjugates with that of surfactant phospholipids. Apical surface binding of the lectin Maclura pomifera agglutinin (MPA) and expression of a 200-kDa MPA-binding glycoprotein (MPA-gp200) was evident at 20 days gestation in type 2 cells, but did not correlate with ultrastructural features of type 2 cell differentiation. Epithelial cells isolated from peripheral lung of 18-day gestation fetal rats displayed hormone-sensitive surfactant synthesis prior to the hormone-insensitive expression of MPA-gp200. Expression of MPA-gp200 occurred in association with the appearance of many new apical surface proteins suggesting a hormone-independent process of polar membrane differentiation. Thus membrane and secretory differentiation are discordant and can be dissociated. In vivo binding of Ricinus communis 1 agglutinin (RCA1), an apical marker of the differentiated alveolar type 1 cell occurred in undifferentiated peripheral lung epithelial cells as early as 18 days gestation, disappeared from differentiating type 2 cells and appeared in differentiated type 1 cells. Both undifferentiated fetal epithelial cells at 18 days gestation and fully differentiated type 1 cells express multiple glycoproteins with terminal beta-linked galactose residues which bind RCA1. Some of these RCA1-binding glycoproteins appear to be similar. These observations suggest that alveolar epithelial type 1 cells may derive directly from undifferentiated peripheral lung epithelial cells as well as from fully differentiated type 2 cells. In addition, terminal differentiation of fetal lung peripheral epithelium into type 1 and type 2 cells may involve repression as well as induction of differentiation-related genes.

  11. The Effects of Alveolar Ridge Preservation: A Meta-Analysis.

    Science.gov (United States)

    Willenbacher, Maximillian; Al-Nawas, Bilal; Berres, Manfred; Kämmerer, Peer W; Schiegnitz, Eik

    2016-12-01

    The aim of this article was to analyze the horizontal, vertical, and histological effects of alveolar ridge preservation (ARP) versus the ones of unassisted socket healing, in the format of an up-to-date review and meta-analysis. An extensive electronic search in the electronic databases of the National Library of Medicine was conducted for articles published up to June 2014 to identify literature presenting data on the topic of ARP. Only randomized controlled trials, controlled clinical trials, and prospective trials were included for meta-analysis. After screening 903 abstracts from the electronic database, we included 64 studies in qualitative and 18 in quantitative synthesis. Quality assessment characterized a medium risk of bias for the included literature. The meta-analysis showed a mean difference between test and control groups of approximately 1.31 to 1.54 mm in bucco-oral bone width and 0.91 to 1.12 mm in bone height. Additionally, the intergroup difference in percentage of vital bone was assessed to be inconclusive across the included studies. Implants could be inserted into the determined position without further augmentation in 90.1% of the experimental sites, while this was the case in only 79.2% of the control sockets. Resorption of the alveolar ridge cannot be totally stopped by ARP, while it still can be prevented compared with unassisted healing. No reliable predictions on the histological effects could be made due to limited data. Further on, no recommendation for a specific technique of ARP could be made. In conclusion, there is still need for ongoing research on the topic, even though the lower percentage of implant sites that needed additional augmentation in test sockets seemed to bring a patient benefit. © 2015 Wiley Periodicals, Inc.

  12. Laser microdissection of the alveolar duct enables single-cell genomic analysis

    Directory of Open Access Journals (Sweden)

    Robert eBennett

    2014-09-01

    Full Text Available Complex tissues such as the lung are composed of structural hierarchies such as alveoli, alveolar ducts and lobules. Some structural units, such as the alveolar duct, appear to selectively participate in tissue regeneration. Here, we demonstrate an approach to conduct laser microdissection of the lung alveolar duct for single-cell PCR analysis. Our approach involved three steps. 1 The initial preparation used mechanical sectioning of the lung tissue with sufficient thickness to encompass the structure of interest. In the case of the alveolar duct, the precision-cut lung slices were 200um thick; the slices were processed using near-physiologic conditions to preserve the state of viable cells. 2 The lung slices were examined by transmission light microscopy to target the alveolar duct. The air-filled lung was sufficiently accessible by light microscopy that counterstains or fluorescent labels were unnecessary to identify the alveolar duct. 3 The enzymatic and microfluidic isolation of single cells allowed for the harvest of as few as several thousand cells for PCR analysis. Microfluidics based arrays were used to measure the expression of selected marker genes in individual cells to characterize different cell populations. Preliminary work suggests the unique value of this approach to understanding the intra- and intercellular interactions within the regenerating alveolar duct.

  13. Mean alveolar bone crest height decrement in subjects with an osteoporosis risk

    Science.gov (United States)

    Effrianto, H. P. S.; Priminiarti, M.; Makes, B. N.

    2017-08-01

    People 40-75 years of age have an osteoporosis risk that may be signaled by a decrease in alveolar bone crest height. Thus, this measure can be used as an indicator of osteoporosis risk. This study was conducted to provide a database of decreased alveolar bone crest heights in ages at risk of osteoporosis by using intraoral radiographs. Forty periapical radiographs of the posterior region of tooth 36 (or 46) were measured twice at different times by two different observers. The interproximal decrease in alveolar bone crest height was measured from the alveolar bone crest to the cementoenamel junction (CEJ) for each tooth on the mesial and distal sides using a ruler (mm). The mean decrease in alveolar bone crest height in at-risk ages for osteoporosis was 3.50±1.085 mm, with a mean of 3.15±0.864 mm for those 45-59 years of age, and 3.90±1.156 mm for those aged 60-75 years. The mean decrease in alveolar bone crest height in people 60-75 years of age was larger than in people 45-59 years of age. There was a medium correlation between age and decreased alveolar bone crest height.

  14. Alveolar type II cell transplantation restores pulmonary surfactant protein levels in lung fibrosis.

    Science.gov (United States)

    Guillamat-Prats, Raquel; Gay-Jordi, Gemma; Xaubet, Antoni; Peinado, Victor I; Serrano-Mollar, Anna

    2014-07-01

    Alveolar Type II cell transplantation has been proposed as a cell therapy for the treatment of idiopathic pulmonary fibrosis. Its long-term benefits include repair of lung fibrosis, but its success partly depends on the restoration of lung homeostasis. Our aim was to evaluate surfactant protein restoration after alveolar Type II cell transplantation in an experimental model of bleomycin-induced lung fibrosis in rats. Lung fibrosis was induced by intratracheal instillation of bleomycin. Alveolar Type II cells were obtained from healthy animals and transplanted 14 days after bleomycin was administered. Furthermore, one group transplanted with alveolar macrophages and another group treated with surfactant were established to evaluate the specificity of the alveolar Type II cell transplantation. The animals were euthanized at 21 days after bleomycin instillation. Lung fibrosis was confirmed by a histologic study and an evaluation of the hydroxyproline content. Changes in surfactant proteins were evaluated by mRNA expression, Western blot and immunofluorescence studies. The group with alveolar Type II cell transplantation was the only one to show a reduction in the degree of lung fibrosis and a complete recovery to normal levels of surfactant proteins. One of the mechanisms involved in the beneficial effect of alveolar Type II cell transplantation is restoration of lung surfactant protein levels, which is required for proper respiratory function. Copyright © 2014 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  15. The Analisis Sentimen Sosial Media Twitter Dengan Algoritma Machine Learning Menggunakan Software R

    Directory of Open Access Journals (Sweden)

    Jaka Aulia Pratama

    2017-10-01

    Full Text Available Media sosial adalah wadah untuk mengungkapkan opini terhadap suatu topik tertentu. Ketersediaan informasi dan opini dari para pengguna media sosial merupakan kumpulan dokumen data berupa teks yang amat sangat besar dan berguna untuk kepentingan penelitian maupun membuat suatu keputusan bagi pihak – pihak tertentu. Text Mining bisa didefinisikan sebagai proses penggalian informasi di mana pengguna berinteraksi dengan kumpulan dokumen dari waktu ke waktu dengan menggunakan suatu alat analisis. Analisis sentimen atau Opinion Mining adalah salah satu studi di bidang komputasi yang berhubungan dengan kasus publik mengenai opini, penilaian, sikap, dan emosi. Penelitian ini akan menggunakan metode Machine Learning pada analisis sentimen pengguna layanan jejaring sosial Twitter terhadap Donald Trump dan Barack Obama dalam 20000 tweets. Nilai akurasi metode Machine Learning yang diperoleh cukup tinggi yaitu 87.52% untuk Data Training dan 87.4% untuk Data Testing.

  16. Prezzi di Offerta vs Prezzi di Mercato: un’analisi empirica

    Directory of Open Access Journals (Sweden)

    Rocco Curto

    2012-06-01

    Full Text Available Il problema della trasparenza del mercato immobiliare in Italia implica che molte analisi debbano essere fatte utilizzando i prezzi di offerta e che questi ultimi siano anche utilizzati dagli operatori del settore a fini estimativi. Nonostante l’importanza dei prezzi di offerta per l’interpretazione del mercato sia riconosciuta anche nella letteratura internazionale, si ritiene opportuno approfondire la loro relazione con i prezzi di transazione. A tal fine, in questo scritto si propone una metodologia di analisi che permetta di testare se e in quale misura i prezzi di offerta possano essere considerati una proxy per i prezzi di mercato. In particolare modo si vuole testare se la variabilità dei prezzi di offerta possa essere un riferimento per le analisi di variabilità sul mercato immobiliare. Il modello viene testato empiricamente su un caso studio: il mercato immobiliare di Torino ed i sottomercati geografici che lo compongono.

  17. ANALISIS DIMENSI EXTRAVERSION DAN DIMENSI CONSCIENTIOUSNESS (BIG FIVE PERSONALITY DENGAN ORGANIZATIONAL CITIZENSHIP BEHAVIOR

    Directory of Open Access Journals (Sweden)

    Fasya Rohmana

    2017-07-01

    Full Text Available Penelitian ini bertujuan untuk menguji hubungan antara dimensi ekstraversion dan dimensi conscientiousness dengan OCB pada karyawan produksi. Sampel dalam penelitian ini sebanyak 60 orang sampel dengan menggunakan random sampling. Metode pengumpulan data adalah dengan menggunakan skala OCB dan IPIP (lima kepribadian besar dari Goldberg. Teknik analisis data adalah dengan menggunakan analisis korelasi product moment. Berdasarkan hasil analisis data diperoleh hasil rxy = 0,383 (p <0,010 untuk dimensi ekstraversi dengan OCB dan rxy = 0,548 (p <0,010 untuk dimensi conscientiousness dengan OCB. Variabel dimensi ekstraversi memberikan kontribusi yang efektif sebesar 14,7% terhadap variabel dimensi OCB dan conscientiousness memberikan kontribusi efektif sebesar 30% untuk OCB. Kata Kunci: Dimensi Extraversion, Dimensi Conscientiousness, Organizational Citizenship Behavior

  18. Oral administration of 5-hydroxytryptophan aggravated periodontitis-induced alveolar bone loss in rats.

    Science.gov (United States)

    Li, Xianxian; Wu, Xiangnan; Ma, Yuanyuan; Hao, Zhichao; Chen, Shenyuan; Fu, Taozi; Chen, Helin; Wang, Hang

    2015-05-01

    5-Hydroxytryptophan (5-HTP) is the precursor of serotonin and 5-HTP has been widely used as a dietary supplement to raise serotonin level. Serotonin has recently been discovered to be a novel and important player in bone metabolism. As peripheral serotonin negatively regulates bone, the regular take of 5-HTP may affect the alveolar bone metabolism and therefore influence the alveolar bone loss induced by periodontitis. The aim of this study was to investigate the effect of 5-HTP on alveolar bone destruction in periodontitis. Male Sprague-Dawley rats were randomly divided into the following four groups: (1) the control group (without ligature); (2) the 5-HTP group (5-HTP at 25 mg/kg/day without ligature); (3) the L group (ligature+saline placebo); and (4) the L+5-HTP group (ligature+5-HTP at 25 mg/kg/day). Serum serotonin levels were determined by ELISA. The alveolar bones were evaluated with micro-computed tomography and histology. Tartrate-resistant acid phosphatase staining was used to assess osteoclastogenesis. The receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) expression in the periodontium as well as the interleukin-6 positive osteocytes were analysed immunohistochemically. 5-HTP significantly increased serum serotonin levels. In rats with experimental periodontitis, 5-HTP increased alveolar bone resorption and worsened the micro-structural destruction of the alveolar bone. 5-HTP also stimulated osteoclastogenesis and increased RANKL/OPG ratio and the number of IL-6 positive osteocytes. However, 5-HTP treatment alone did not cause alveolar bone loss in healthy rats. The present study showed that 5-HTP aggravated alveolar bone loss, deteriorated alveolar bone micro-structure in the presence of periodontitis, which suggests 5-HTP administration may increase the severity of periodontitis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Alveolar bone loss and mineralization in the pig with experimental periodontal disease

    Directory of Open Access Journals (Sweden)

    Mandee Yang

    2018-03-01

    Full Text Available Objective: To address how experimental periodontal disease affects alveolar bone mass and mineral apposition in a young pig model. Materials and methods: Seven three-month-old pigs were periodically inoculated with 4 types of periodontal bacteria, along with a ligature around the last maxillary deciduous molar for 8 weeks to induce periodontal disease (PG. Eight same-aged pigs served as the control (CG. Segmentations of 3D cone-beam CT images were performed to quantify volumes of the total alveolar bone, alveolar ridge, and all roots of the target molar. Calcein and alizarin were administered for labeling mineral apposition before euthanasia. The harvested molar blocks were sectioned and examined under epifluorescence. The inter-label distance between the two vital markers at regional bone surfaces were measured and mineral apposition rate (MAR was calculated. Results: A significant reduction of total alveolar bone volume was seen in PG with the major loss at the alveolar ridge. MAR was significantly higher at the root furcation region than those at both buccal and palatal ridges in CG. Compared with CG, PG animals showed more interrupted labeled bands with significantly lower MAR at the furcation region. MARs were positively associated with both the volumes of total alveolar bone and ridge in CG, but only with the total alveolar bone in PG. Conclusions: In young growing pigs, mineral apposition is region specific. The experimental periodontal disease not only leads to alveolar bone loss, but also perturbs mineral apposition for new bone formation, thus impairing the homeostasis of alveolar bone remodeling. Keyword: Dentistry

  20. HIV-1 transgene expression in rats causes oxidant stress and alveolar epithelial barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Jacob Barbara A

    2009-02-01

    Full Text Available Abstract Background HIV-infected individuals are at increased risk for acute and chronic airway disease even though there is no evidence that the virus can infect the lung epithelium. Although HIV-related proteins including gp120 and Tat can directly cause oxidant stress and cellular dysfunction, their effects in the lung are unknown. The goal of this study was to determine the effects of HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining lung liquid clearance in vivo and alveolar epithelial monolayer permeability in vitro. Oxidant stress in the alveolar space was determined by measuring the glutathione redox couple by high performance liquid chromatography, and the expression and membrane localization of key tight junction proteins were assessed. Finally, the direct effects of the HIV-related proteins gp120 and Tat on alveolar epithelial barrier formation and tight junction protein expression were determined. Results HIV-1 transgene expression caused oxidant stress within the alveolar space and impaired epithelial barrier function even though there was no evidence of overt inflammation within the airways. The expression and membrane localization of the tight junction proteins zonula occludens-1 and occludin were decreased in alveolar epithelial cells from HIV-1 transgenic rats. Further, treating alveolar epithelial monolayers from wild type rats in vitro with recombinant gp120 or Tat for 24 hours reproduced many of the effects on zonula occludens-1 and occludin expression and membrane localization. Conclusion Taken together, these data indicate that HIV-related proteins cause oxidant stress and alter the expression of critical tight junction proteins in the alveolar epithelium, resulting in barrier dysfunction.

  1. Diagnosis of alveolar and root fractures: an in vitro study comparing CBCT imaging with periapical radiographs

    Directory of Open Access Journals (Sweden)

    Solange KOBAYASHI-VELASCO

    Full Text Available Abstract Objective To compare periapical radiograph (PR and cone-beam computed tomography (CBCT in the diagnosis of alveolar and root fractures. Material and Methods Sixty incisor teeth (20 higid and 40 with root fracture from dogs were inserted in 60 anterior alveolar sockets (40 higid and 20 with alveolar fracture of 15 macerated canine maxillae. Each fractured socket had a root fractured tooth inserted in it. Afterwards, each maxilla was submitted to PR in two different vertical angulation incidences, and to CBCT imaging with a small field of view (FOV and high-definition protocol. Images were randomized and posteriorly analyzed by two oral and maxillofacial radiologists two times, with a two-week interval between observations. Results Sensitivity and specificity values were good for root fractures for PR and CBCT. For alveolar fractures, sensitivity ranged from 0.10 to 0.90 for PR and from 0.50 to 0.65 for CBCT. Specificity for alveolar fractures showed lower results than for root fractures for PR and CBCT. Areas under the ROC curve showed good results for both PR and CBCT for root fractures. However, results were fair for both PR and CBCT for alveolar fractures. When submitted to repeated measures ANOVA tests, there was a statistically significant difference between PR and CBCT for root fractures. Root fracture intraobserver agreement ranged from 0.90 to 0.93, and alveolar fracture intraobserver agreement ranged from 0.30 to 0.57. Interobserver agreement results were substantial for root fractures and poor/fair for alveolar fractures (0.11 for PR and 0.30 for CBCT. Conclusion Periapical radiograph with two different vertical angulations may be considered an accurate method to detect root fractures. However, PR showed poorer results than CBCT for the diagnosis of alveolar fractures. When no fractures are diagnosed in PR and the patient describes pain symptoms, the subsequent exam of choice is CBCT.

  2. Diagnosis of alveolar and root fractures: an in vitro study comparing CBCT imaging with periapical radiographs

    Science.gov (United States)

    KOBAYASHI-VELASCO, Solange; SALINEIRO, Fernanda Cristina Sales; GIALAIN, Ivan Onone; CAVALCANTI, Marcelo Gusmão Paraiso

    2017-01-01

    Abstract Objective To compare periapical radiograph (PR) and cone-beam computed tomography (CBCT) in the diagnosis of alveolar and root fractures. Material and Methods Sixty incisor teeth (20 higid and 40 with root fracture) from dogs were inserted in 60 anterior alveolar sockets (40 higid and 20 with alveolar fracture) of 15 macerated canine maxillae. Each fractured socket had a root fractured tooth inserted in it. Afterwards, each maxilla was submitted to PR in two different vertical angulation incidences, and to CBCT imaging with a small field of view (FOV) and high-definition protocol. Images were randomized and posteriorly analyzed by two oral and maxillofacial radiologists two times, with a two-week interval between observations. Results Sensitivity and specificity values were good for root fractures for PR and CBCT. For alveolar fractures, sensitivity ranged from 0.10 to 0.90 for PR and from 0.50 to 0.65 for CBCT. Specificity for alveolar fractures showed lower results than for root fractures for PR and CBCT. Areas under the ROC curve showed good results for both PR and CBCT for root fractures. However, results were fair for both PR and CBCT for alveolar fractures. When submitted to repeated measures ANOVA tests, there was a statistically significant difference between PR and CBCT for root fractures. Root fracture intraobserver agreement ranged from 0.90 to 0.93, and alveolar fracture intraobserver agreement ranged from 0.30 to 0.57. Interobserver agreement results were substantial for root fractures and poor/fair for alveolar fractures (0.11 for PR and 0.30 for CBCT). Conclusion Periapical radiograph with two different vertical angulations may be considered an accurate method to detect root fractures. However, PR showed poorer results than CBCT for the diagnosis of alveolar fractures. When no fractures are diagnosed in PR and the patient describes pain symptoms, the subsequent exam of choice is CBCT. PMID:28403364

  3. Analisis Kinerja Operasional Kereta Api Sriwedari Ekspress Jurusan Solo - Yogya

    Directory of Open Access Journals (Sweden)

    Bayu Rosida Sumantri

    2014-03-01

    Full Text Available Pada bulan Nopember 2012 PT. Kereta Api Indonesia (Persero DAOP 6 Yogyakarta mengoperasikan Kereta Api Sriwedari Ekspress dengan rute perjalanan Yogya – Solo, hal ini dilakukan untuk mengantisipasi lonjakan penumpang akibat pemangkasan rute perjalanan Kereta Api Prambanan Ekspress dari tiga belas kali perjalanan menjadi enam kali perjalanan. Menurut Humas PT. Kereta Api Indonesia (Persero DAOP 6 Yogyakarta, dibukanya rute baru Kereta Api Sriwedari Ekspress yang melayani delapan kali perjalanan hanya  dengan rute Yogya – Solo saja diharapkan kereta ini dapat memfasilitasi pergerakan penumpang antar dua daerah tersebut. Namun untuk mengetahui kinerja dari kereta api ini sesuai dengan Surat Keterangan Dirjen Perhubungan Darat No. 687 Tahun 2002, perlu ditinjau dari segi faktor muat, jumlah penumpang yang diangkut, waktu tunggu penumpang, ketepatan waktu kedatangan dan keberangkatan kereta dan kenyamanan penumpang. Dalam penelitian digunakan metode survey untuk mendapatkan nilai – nilai dari kinerja kereta api Sriwedari berupa survey observasi atau pengamatan lapangan.  Adapun  analisis yang digunakan untuk perhitungan waktu tempuh, waktu henti dan waktu tunda menggunakan uji hipotesis 1 sample t-test, karena uji ini paling memenuhi untuk melihat diterima atau tidaknya keterlambatan dari waktu kereta. Sedangkan untuk perhitungan load factor dan kenyamanan duduk dan berdiri berdasarkan perhitungan kapasitas dari Vukan R. Vuchic. Dari hasil analisis didapatkan waktu tempuh rata-rata untuk arah Yogyakarta selama 1 jam 14 menit dan untuk arah Solo selama 1 jam 12 menit. Waktu henti yang didapat dari seluruh jadwal perjalanan kereta arah Yogyakarta sebesar 3 menit, untuk arah Solo sebesar 5 menit. Waktu tunda dari seluruh perjalanan kereta Api Sriwedari untuk arah Yogyakarta didapat nilai waktu tunda kedatangan sebesar 22 menit dan nilai waktu tunda keberangkatan sebesar 20 menit, untuk arah Solo didapat nilai waktu tunda kedatangan sebesar 34

  4. LA COMUNICAZIONE POLITICA SUI SOCIAL NETWORK: UN’ANALISI LINGUISTICA

    Directory of Open Access Journals (Sweden)

    Daniele Spoladore

    2014-07-01

    Full Text Available Questo lavoro si propone di analizzare le scelte linguistiche dei soggetti politici che utilizzano Facebook e Twitter per rivolgersi al sempre più frammentato panorama dei potenziali elettori. In particolare, analizza le tendenze linguistiche comuni che questi social network hanno fatto emergere nel rapporto tra politica, web e lettori. Cominciando dall’analisi della presenza di parlamentari e senatori su Facebook e Twitter, si cerca di riassumere le principali caratteristiche delle due piattaforme, per giungere ad una classificazione dei testi prodotti attraverso di esse; si analizza la scrittura di post e tweet, sottolineando la presenza di espedienti tipici del mezzo e valutando il loro effetto sui lettori, e si studiano le scelte sintattiche e morfosintattiche in relazione alla struttura e alle possibilità dei due social network. In ultima analisi si osservano le scelte lessicali dei soggetti politici, studiandone i campi semantici e la quantità di tecnicismi. Infine, si cerca di compiere una valutazione delle due differenti tipologie di trasmesso scritto rinvenute nei campioni, osservando come ognuna di esse abbia uno scopo ben preciso nell’economia della comunicazione politica sui social network. Political communication policy in social networks: a language analysis  Daniele Spoladore This paper aims to analyze the linguistic choices of politicians who use Facebook and Twitter to address the increasingly fragmented landscape of potential voters. In particular, it analyzes the common language trends that these social networks have revealed in the relationship between politics, the web and readers. Starting from the analysis of the presence of MPs and senators on Facebook and Twitter, we try to summarize the key features of the two platforms, in order to arrive at a classification of the texts produced using them.  We analyzed posts and tweets, emphasizing the  typical characteristics of these means and evaluating their effect on

  5. Part II. Minimizing alveolar bone loss during and after extractions. Protocol and techniques for alveolar bone preservation.

    Science.gov (United States)

    Iyer, Shankar; Haribabu, Prashanth Konatham; Xing, Yi

    2014-01-01

    Alveolar ridge resorption accelerates following extraction of teeth and the residual defect varies from socket to socket. This article proposes a new treatment oriented classification of extraction defects. It also reviews several graft materials and membranes that aid in the decision for selecting an appropriate socket preservation technique. The algorithm developed by the authors helps design a potentially successful treatment plan based on the classification of extraction defects, with choices ranging from no treatment to complex grafting procedures (i.e. allogenic block grafts). In addition, the principles of wound healing and the ideal time points for utilizing the various types of graft materials and implants are discussed. This socket preservation treatment algorithm will guide clinicians to employ surgical procedures using various biomaterials to promote a successful outcome.

  6. Ozone Treatment of Alveolar Bone in the Cape Chacma Baboon Does Not Enhance Healing Following Trauma

    OpenAIRE

    Kotze, Marthinus; Bütow, Kürt-W; Olorunju, Steve A.; Kotze, Harry F.

    2013-01-01

    In the international literature, the role of Ozone (O3) in the advancement in alveolar bone healing in the absence of bone pathology was not tested before. The purpose of this study was to evaluate alveolar bone regeneration after a bone defect was created and treated with a single topical administration of O3. Alveolar bone defects were created on five healthy chacma baboons. One side of the maxilla and mandible was topically treated with a single treatment of an O3/O2 mixture (3,5–4 % O3), ...

  7. A preliminary study of the pathogenesis of malnutrition in patients with hepatic alveolar echinococcosis

    Directory of Open Access Journals (Sweden)

    MA Bao

    2018-01-01

    Full Text Available Hepatic echinococcosis has become a major threat to human health. Hepatic alveolar echinococcosis caused by Echinococcus multilocularis infection has the features of slow and insidious onset, a high probability of surgery, slow postoperative recovery, and many complications and thus does great harm to humans. Most of the patients with hepatic alveolar echinococcosis also have varying degrees of malnutrition on admission, which is closely associated with surgical tolerance, postoperative rehabilitation, and the development of complications. However, the pathogenesis of malnutrition in patients with hepatic alveolar echinococcosis remains unknown. This article elaborates on possible mechanisms and points out that malnutrition in such patients is a result of various factors and complex mechanisms.

  8. Evolución en el tratamiento de la atrofia alveolar

    OpenAIRE

    Oscar García-Roco Pérez; Miguel Arredondo López

    2002-01-01

    Con el objetivo de describir la evolución del tratamiento de la atrofia alveolar se realiza una revisión bibliográfica actualizada de 25 referencias, se destacan las vestibuloplastias, injertos óseos, biomateriales, implantes endóseos, regeneración ósea guiada y la distracción ósea, que corrigen o compensan la atrofia alveolar con sus indicaciones, ventajas y desventajas.An updated literature review of 25 references was made to describe the development in the treatment of dental alveolar atro...

  9. Mechanisms underlying the redistribution of particles among the lung's alveolar macrophages during alveolar phase clearance

    Energy Technology Data Exchange (ETDEWEB)

    Lehnert, B.E.; Oritz, J.B.; Steinkamp, J.A.; Tietjen, G.L.; Sebring, R.J. (Los Alamos National Lab., NM (United States)); Oberdorster, G. (Rochester Univ., NY (United States))

    1991-01-01

    In order to obtain information about the particle redistribution phenomenon following the deposition of inhaled particles, as well as to obtain information about some of the mechanisms that may be operable in the redistribution of particles, lavaged lung free cell analyses and transmission electron microscopic (TEM) analyses of lung tissue and were performed using lungs from rats after they were subchronically exposed to aerosolized dioxide (TiO{sub 2}). TEM analyses indicated that the in situ autolysis of particle-containing Alveolar Macropages (AM) is one important mechanism involved in the redistribution of particles. Evidence was also obtained that indicated that the engulfment of one particle-containing phagocyte by another phagocyte also occurs. Another prominent mechanism of the particle redistribution phenomenon may be the in situ proliferation of particle-laden AM. We used the macrophage cell line J774A.1 as a surrogate for AM to investigate how different particulate loads in macrophages may affect their abilities to proliferate. These in vitro investigations indicated that the normal rate of proliferation of macrophages is essentially unaffected by the containment of relatively high particulate burdens. Overall, the results of our investigations suggest that in situ autolysis of particle-containing AM and the rephagocytosis of freed particles by other phagocytes, the phagocytosis of effete and disintegrating particle-containing phagocytes by other AM, and the in situ division of particle-containing AM are likely mechanisms that underlie the post-depositional redistribution of particles among the lung's AM during alveolar phase clearance. 19 refs., 8 figs., 2 tabs.

  10. Analisis Reduksi Intensitas Cahaya Pada Smartphones’ Screen Protector Dan Dampaknya Pada Mata

    Directory of Open Access Journals (Sweden)

    Bhekti Kumorowati

    2017-04-01

    Full Text Available Analisis reduksi intensitas cahaya yang melewati screen protector dan identifikasi kemampuan screen protector sebagai pelindung mata dilakukan dengan mengukur reduksi intensitas cahaya menggunakan luxmeter, kemudian menetapkan fokus bahasan yang mencakup kemampuan cahaya menembus screen protector dan analisis fisis screen protector sebagai pelindung mata. Peran sebagai pelindung mata dikaji melalui pendekatan peristiwa polarisasi yaitu proses terserapnya sebagian arah getar cahaya. Dihasilkan sebagian arah getar cahaya layar smartphone sebelum masuk ke mata akan terserap oleh screen protector sehingga dapat memperlambat terjadinya degenerasi makula. Rekomendasi pemilihan screen protector bergantung pada besarnya koefisien atenuasi (koefisien penyerapan yang dimiliki masing-masing screen protector. Koefisien atenuasi terbesar dimiliki oleh screen protector jenis anti spy.

  11. Analisis dan Desain BI-Dashboard Monitoring Realisasi Daftar Isian Pelaksanaan Anggaran (DIPA pada Kantor Pelayanan Perbendaharaan Negara (KPPN

    Directory of Open Access Journals (Sweden)

    Ernestina Rahmanasari

    2013-09-01

    Full Text Available Transaksi keuangan badan pemerintahan tingkat daerah dipertanggungjawabkan kepada Kementrian Keuangan melalui Kantor Pelayanan Perbendaharaan Negara (KPPNsetiap bulan dalam bentuk Laporan Keuangan Pemerintah Pusat (LKPP. Laporan Keuangan, didukung dengan teknologi Business Intelligence(BI dashboarddapat dimanfaatkan sebagai data-driven decision support system yang mendorong performa kinerja. Analisis dan desainterhadap pembuatan BI dashboard menunjukkanbagaimana Laporan Keuangan dapat digunakan untuk monitoring realisasi penyerapan dana DIPA dan kinerja instansi secara tepat waktu dan interaktif.Analisis terdiri dari analisis Indikator Kinerja Utama (IKU dan analisis Laporan Keuangan. IKUpada analisis dan desain ini mencakup ketercapaian estimasi dengan penerimaan, ketercapaian pagu dengan belanja, ketepatan waktu pengiriman rekonsiliasi oleh instansi, validasi, akurasi, dan ketepatan data. Desain terdiri dari katalog dashboard, alur analisis, sumber data, desain User-Interface, dan desain objek dashboard. Sedangkan dashboard yang dirancang menggunakan aplikasi Vera sebagai Enterprise System, mengakses basis data MySQL, dan menampilkan data dengan teknologi data-driven business-intelligence Qlikview. Desain aplikasi yang telah dibuat akan menampilkan 4 (empat Tab yaitu: Dashboard utama, Analisis, Monitoring, dan Laporan

  12. Analisis Sistem Pengangkutan Sampah di Wilayah Surabaya Utara

    Directory of Open Access Journals (Sweden)

    Rizka Andriani Mahmudah

    2017-01-01

    Full Text Available Surabaya Utara merupakan wilayah dengan kepadatan penduduk tertinggi kedua setelah wilayah Surabaya Pusat. Hal ini mengakibatkan besarnya laju timbulan sampah di Surabaya Utara yang harus dikelola. Analisis sistem pengangkutan Sampah di Surabaya Utara bertujuan untuk memberikan informasi tentang kondisi eksisting sistem pengangkutan sampah yang meliputi rute dan jarak pengangkutan sampah, kecepatan pengangkutan sampah, waktu pengangkutan sampah dan jumlah timbulan sampah yang terangkut dari TPS Surabaya Utara menuju ke TPA. Pengangkutan di Surabaya Utara yang dianalisis terdiri dari pengangkutan dengan Arm Roll Truckdan Dump Truck. Jarak pengangkutan sampah di Surabaya Utara dipengaruhi oleh jumlah ritasi dan jarak TPS yang dilayani menuju ke TPA. Jumlah ritasi pengangkutan sampah pada truk DKP rata – rata yaitu 2 rit/hari dan pada truk rekanan yaitu 3 rit/hari. Alternatif jalan (jalan tol atau jalan biasa tidak memberikan pengaruh yang signifikan terhadap waktu pengangkutan sampah dikarenakan kecepatan rata – rata pengangkutan sampah yang digunakan adalah sama. Faktor offroute pengangkutan sampah di Surabaya <0,15 yaitu 0,07, namun sisa waktu kerja yang cukup banyak memunkinkan dilakukan penambahan jumlah ritasi. Densitas rata – rata sampah di truk pengangkutan sampah di Surabaya Utara  adalah 229,29 kg/m3 untuk kontainer masih ada tutup dan 361,85 kg/m3 untuk kontainer yang sudah lepas tutupnya.

  13. ANALISIS PENGARUH TINGKAT KESEHATAN BANK TERHADAP RETURN ON ASSET

    Directory of Open Access Journals (Sweden)

    Andy Setiawan

    2017-10-01

    Full Text Available Penelitian  ini  dilakukan  untuk  menganalisis pengaruh  tingkat kesehatan bank terhadap return on asset (ROA berdasarkan metode risk based bank rating (RBBR. Variabel independen yang diteliti adalah Non  Performing  Loan  (NPL, Loan to Deposit Ratio (LDR, Net Interest Margin (NIM, Capital Adequacy Ratio (CAR,  BOPO   (Biaya   Operasional/Pendapatan Operasional, Good Corporate Governance (GCG dan Posisi  Devisa  Netto  (PDN terhadap variabel dependen Return On Asset (ROA. Sampel yang digunakan  adalah  seluruh bank BUKU 4 di Indonesia selama periode 2007-2014. Teknik analisis data yang  digunakan  adalah  regresi  linier  berganda. Hasil penelitian ini menunjukkan bahwa tingkat kesehatan bank dengan metode RBBR berpengaruh signifikan secara bersama terhadap ROA. Secara parsial LDR, NIM, BOPO, dan PDN berpengaruh signifikan terhadap ROA. Sedangkan variabel NPL, GCG dan CAR tidak berpengaruh signifikan. Kemampuan prediksi dari ketujuh variabel  tersebut  terhadap  ROA  dalam  penelitian  ini  sebesar  93,7%,  sedangkan sisanya 6,3% dipengarui oleh faktor lain yang tidak dimasukkan ke dalam model penelitian.

  14. Analisis Vegetasi di Hutan Mbeji Daerah Wonosalam Jombang

    Directory of Open Access Journals (Sweden)

    Anita Munawwaroh

    2016-03-01

    Full Text Available Analisis vegetasi terhadap hutan perlu dilakukan untuk mengetahui keanekaragaman hayati yang terdapat di hutan tersebut sehingga mempermudah didalam melakukan pemeliharaan dan pemberdayaan hutan.Tujuan dari penelitian ini adalah untuk mengetahui keanekaragaman hayati dan struktur vegetasi (frekuensi, kerapatan, dominansi, dan Indeks Nilai Penting di hutan mbeji, Wonossalam, Jombang. Pada penelitian ini digunakan metode point centered quarter. Pennelitian dilakukan pada bulan Mei 2015. Hasil penelitian menujukkan padaHutan Mbeji terdapat 11 jenis pohon yang teridentifikasi dan 15 spesies tumbuhan, dimana ada 10 spesies yang telah teridentifikasiNilai penting  tumbuh-tumbuhan di Hutan Mbeji di daerah Wonosalam Jombang  pada tingkat pohon paling tinggi adalah pohon randu (Ceiba petandra  sebesar 57,42 % sedangkan nilai INP paling rendah dari jenis pohon andong (Rhadamnia cinerea yaitu sebesar 6,06 %. Pada sapling nilai penting yang paling tinggi adalah talas (Colocasia esculenta yaitu sebesar 49,23 %. Sedangkan, nilai INP paling rendah dari jenis nanas (Ananas comosus, nangka (Artocarpus heterophyllus, tapak liman (Elephantopus scaber, semak A, semak B, semak C, semak E, dan semak F yaitu sebesar 6,35 %. Tingginya nilai INP menunjukkan bahwa jenis-jenis tersebut dapat menyesuaikan diri dengan lingkungan sekitarnya yang lebih baik dibanding jenis lainnya.

  15. La malavita bergamasca. Analisi di un fenomeno criminale

    Directory of Open Access Journals (Sweden)

    Luca Bonzanni

    2017-04-01

    Full Text Available Durante gli anni Settanta e Ottanta, le aree della Val Seriana (la valle originata dal fiume Serio e la Val Cavallina (originata dal fiume Cherio, in provincia di Bergamo (Nord Italia, sono state attraversate da un fenomeno criminale genericamente denominato “malavita bergamasca”, una particolare organizzazione criminale autoctona. Lo scopo di questo articolo, sviluppato principalmente attraverso il ricorso a interviste in profondità a ex membri dell’organizzazione, è l’analisi delle origini di questa esperienza criminale, delle sue strutture e dei suoi codici culturali, oltre all’approfondimento dei rapporti tra essa e le organizzazioni mafiose insediate nell’area della Bergamasca. Parole chiave: Bergamo; criminalità organizzata; organizzazioni criminali del Nord Italia; rapina in banca; carcere e opportunità criminali   During Seventies and Eighties, the areas of Val Seriana (the valley originated from the Serio river and Val Cavallina (the valley originated from Cherio river, in the provence of Bergamo (Northern Italy, were crossed by a criminal phenomenon generically called “malavita bergamasca”, a particular autochthonous criminal organization. The aim of this article, developed especially through indepth interviews with former members of the organization, is trying to explore the origins of this criminal experience, its structures, cultural codes and the relations with mafia groups based in the area of Bergamo. Keywords: Bergamo, organized crime, Northern Italy criminal organization, bank robbery, imprisonmet and criminal opportunities

  16. ANALISIS FAKTOR PENENTU DALAM PENGELOLAAN BERKELANJUTAN ESTUARIA DAS TALLO

    Directory of Open Access Journals (Sweden)

    Muhammad Yusuf

    2016-06-01

    Full Text Available Peningkatan penduduk dapat menyebabkan terjadinya perubahan lahan secara drastis, terutama di daerah aliran sungai (DAS dan wilayah pesisir. Hal serupa terjadi pada estuaria DAS Tallo. Penelitian ini bertujuan untuk (1 menganalisis tingkat keberlanjutan pengelolaan estuaria DAS Tallo, dan (2 menganalisis variabel/atribut pengungkit dalam pengelolaan berkelanjutan estuaria DAS Tallo (3 pengembangan kebijakan pengelolaan berkelanjutan estuaria DAS Tallo. Hasil analisis menunjukkan bahwa status keberlanjutan pengelolaan estuaria DAS Tallo adalah kurang berkelanjutan (indeks keberlanjutan 49,20%. Indeks keberlanjutan dari masing-masing dimensi adalah; dimensi ekologi (46,51%, dimensi ekonomi (42,22%, dimensi sosial (43,90%, dimensi teknologi (45,99% dan dimensi kelembagaan (46,83%. Atribut pengungkit keberlanjutan pengelolaan estuaria DAS Tallo terdiri atas 12 (dua belas atribut meliputi; dimensi ekologi 2 atribut (vegetasi mangrove dan  laju konversi lahan, dimensi ekonomi 3 atribut ( akses terhadap sumber daya, marketable right dan pendapatan masyarakat, dimensi sosial 2 atribut (kepadatan penduduk dan tingkat partisipasi masyarakat, dimensi teknologi 3 atribut (teknologi budidaya perikanan/tambak, teknologi pemanfaatan sumber daya dan teknologi pertanian serta dimensi kelembagaan 2 atribut (property right dan kelengkapan kelembagaan. Arahan pengembangan kebijakan pengelolaan berkelanjutan estuaria DAS Tallo, meliputi, alternatif I yakni penguatan kelembagaan pengelola, dan alternatif II adalah pemanfaatan sumber daya secara berkelanjutan.

  17. Differential effects of hypoxic stress in alveolar epithelial cells and microvascular endothelial cells

    NARCIS (Netherlands)

    Signorelli, Sara; Jennings, Paul; Leonard, Martin O; Pfaller, Walter

    2010-01-01

    Under hypoxic conditions eukaryotic cells and tissues undergo adaptive responses involving glycolysis, angiogenesis, vasoconstriction and inflammation. The underlying molecular mechanisms are not yet fully elucidated and are most likely cell and tissue specific. In the lung, alveolar epithelial

  18. Long-term outcome of secondary alveolar bone grafting in cleft lip and palate patients

    DEFF Research Database (Denmark)

    Meyer, Steffen; Pedersen, Kirsten Mølsted

    2013-01-01

    The objective was to assess the long-term outcome of secondary alveolar bone grafting (SABG) in cleft lip and palate patients and to examine relationships between preoperative and postoperative factors and overall long-term bone graft success. The records of 97 patients with cleft lip and palate......, who had secondary alveolar bone grafting of 123 alveolar clefts, were examined. Interalveolar bone height was assessed radiographically a minimum of 10 years after grafting using a 4-point scale (I-IV), where types I and II were considered a success. After an average follow-up of 16 years after SABG...... to the cleft. No significant differences were found with regard to the other parameters investigated. The timing of secondary alveolar bone grafting is critical with regard to the age of the patient and the stage of eruption of the tooth distal to the cleft....

  19. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    National Research Council Canada - National Science Library

    Ribot, Wilson J; Panchal, Rekha G; Brittingham, Katherine C; Ruthel, Gordon; Kenny, Tara A; Lane, Douglas; Curry, Bob; Hoover, Timothy A; Friedlander, Arthur M; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses...

  20. Is 2 mm a safe distance from the inferior alveolar canal to avoid ...

    African Journals Online (AJOL)

    . Conclusion: When 2 mm is considered as a safety distance, the distance of the implants to the IAC did not yield any statistical difference regarding postoperative neurosensory complications. Keywords: Dental implants, inferior alveolar nerve ...

  1. Pulmonary Alveolar Proteinosis in Setting of Inhaled Toxin Exposure and Chronic Substance Abuse

    Directory of Open Access Journals (Sweden)

    Meirui Li

    2018-01-01

    Full Text Available Pulmonary alveolar proteinosis (PAP is a rare lung disorder in which defects in alveolar macrophage maturation or function lead to the accumulation of proteinaceous surfactant in alveolar space, resulting in impaired gas exchange and hypoxemia. PAP is categorized into three types: hereditary, autoimmune, and secondary. We report a case of secondary PAP in a 47-year-old man, whose risk factors include occupational exposure to inhaled toxins, especially aluminum dust, the use of anabolic steroids, and alcohol abuse, which in mice leads to alveolar macrophage dysfunction through a zinc-dependent mechanism that inhibits granulocyte macrophage-colony stimulating factor (GM-CSF receptor signalling. Although the rarity and vague clinical presentation of PAP can pose diagnostic challenges, clinician awareness of PAP risk factors may facilitate the diagnostic process and lead to more prompt treatment.

  2. Quantitative determination of alveolar bone density using digital image analysis of microradiographs

    International Nuclear Information System (INIS)

    Jaeger, A.; Radlanski, R.J.; Taufall, D.; Klein, C.; Steinhoefel, N.; Doeler, W.

    1990-01-01

    Horizontal 100 μm ground sections of 20 alveolar bone specimens from adult human mandibles obtained from autopsies were prepared for microradiography. Quantitative analysis of bone density of the alveolar cortex was performed using a semiautomatic digital image analysis system (KONTRON). The results demonstrated that bone density was higher in the lingual than in the labial alveolar cortex (p < 0.05). In addition, the coronal portion of alveolar cortical bone was significantly more porous than the medial and apical ones (p < 0.05). These variances were primarily due to increased canal size rather than to an increased number of canals. No significant age dependent changes in bone density could be determined. (author)

  3. Evolución en el tratamiento de la atrofia alveolar

    Directory of Open Access Journals (Sweden)

    Oscar García-Roco Pérez

    2002-08-01

    Full Text Available Con el objetivo de describir la evolución del tratamiento de la atrofia alveolar se realiza una revisión bibliográfica actualizada de 25 referencias, se destacan las vestibuloplastias, injertos óseos, biomateriales, implantes endóseos, regeneración ósea guiada y la distracción ósea, que corrigen o compensan la atrofia alveolar con sus indicaciones, ventajas y desventajas.An updated literature review of 25 references was made to describe the development in the treatment of dental alveolar atrophy. Some procedures that correct or compensate alveolar atrophies such as vestibuloplasty, bone grafting, biomaterials, endo-bone implants, guided bone regeneration and bone distraction. Their indications, advantages and disadvantages are set forth.

  4. Systemic Osteoporosis and Reduction of the Edentulous Alveolar Ridge

    Directory of Open Access Journals (Sweden)

    Srđan D. Poštić

    2013-09-01

    Full Text Available Systemic osteoporosis can damage skeletal bones to different degrees or remain persistent in intensity. The aim of this study was to determine the intensity and correlation of the osteoporotic changes in the bone density of the skeleton and body mass index (BMI with a reduction in edentulous mandibles. Material and Methods: In this study, 89 edentulous patients with decreased bone density comprised the experimental group, and 43 edentulous patients with normal bone densities formed the control. The age of the patients ranged between 53 and 73 years. Radiographs of the hands and panoramic radiographs were done for all the patients. The values of BMI, metacarpal index , density of lumbar spine (L2-L4, in the phalanx and segments of the mandibles as well as the heights of the edentulous alveolar ridges were measured, assessed and calculated.Results: The lowest value of the total skeletal density was established in the osteoporotic patients on the basis of the average T-score of -2.5 in men, and - 2.6 in women. Minimum values of the heights of the edentulous ridges (right/left, in mm were measured in both osteoporotic female (21.84/22.39 and male (24.90/24.96 patients. By comparison of the densities of the metacarpal bones, proximal phalanx, segments of the edentulous mandibles and based on the numerical values of the heights of the edentulous ridges, χ²=3.81 was found in men and χ²=4.03 was found in women with normal bone densities; χ²=5.92 was found in men and χ²=6.25 was found in women with osteopenia; χ²=2.63 was found in men and χ²=3.85 was found in women with osteoporosis, on the P level of probability of 0.05. Conclusion: Systemic osteoporosis causes a decrease of the jawbone density and induces residual edentulous alveolar ridge reduction.

  5. Alveolar soft-part sarcoma in paranasal sinuses

    Directory of Open Access Journals (Sweden)

    Jie ZHANG

    2015-07-01

    Full Text Available Objective To investigate clinicopathological features, immune phenotype, diagnosis and differential diagnosis of alveolar soft-part sarcoma (ASPS in paranasal sinuses. Methods Retrospective study of clinical manifestations, histopathological features and immunohistochemical features was conducted in one case of ASPS in paranasal sinuses.  Results A 28-year-old female presented with bulging forehead for 2 months. MRI revealed a well-circumscribed lesion in left frontal and ethmoid sinuses extending to anterior skull base that showed slightly hyperintense signal on T1WI and hypointense signal on T2WI without obvious enhancement after contrast administration. The patient subsequently underwent endoscopic open surgery on left ethmoid and bilateral frontal sinuses and performed partial resection of the lesion. Three months after the initial surgery, the patient received reoperation for total removal of residual lesion and reconstructive surgery of anterior skull base. Adjuvant chemotherapy and radiotherapy were not administered. Histologically, the tumor was composed of epithelioid cells arranged in organoid nests and/or alveolar structures varying in size and shape, which were separated by connective tissue richly containing sinusoidal vascular channels. The tumor cells were generally large-sized, round, oval or polygonal with abundant eosinophilic granular or translucent vacuolated cytoplasm. The nuclei showed round or oval shape containing centrally placed and obvious nucleoli. The presence a lot of mono- or multi-nuclear giant cells served as another striking feature. Mitotic activities were rare. Reticular fiber staining indicated that reticular fibers surrounded the nest of tumor cells, and diastase-resistant periodic acid-Schiff (PAS-positive crystalline inclusions were identified within the cytoplasm of tumor cells. Immunohistochemically, the tumor cells were reactive for TFE3, while were negative for glial fibrillary acidic protein (GFAP

  6. [Domiciliary noninvasive positive pressure ventilation in chronic alveolar hypoventilation].

    Science.gov (United States)

    Casas, J P; Robles, A M; Pereyra, M A; Abbona, H L; López, A M

    2000-01-01

    Effectiveness of treatment with domiciliary nocturnal noninvasive positive pressure ventilation is analyzed in a group of patients with chronic alveolar hypoventilation of different etiologies. It was applied with two levels of pressure (BiPAP) via nasal mask. Criteria for evaluation were symptomatology and improvement in gas exchange. Data were analyzed by Student t tests. A total of 13 patients were included, mean age 55.7 range 20 to 76 years (5 male 8 female). Main diagnosis was tuberculosis in 6, four of them having had surgical procedure (thoracoplasty 2, frenicectomy 1 and neumonectomy 1), myopathy 3 (myasthenia gravis 1, muscular dystrophy 1 and diaphragmatic paralysis 1), obesity-hypoventilation syndrome 1, escoliosis 1, bronchiectasis 1 and cystic fibrosis 1. These last two patients were on waiting list for lung transplantation. At the moment of consultation, the symptoms were: dysnea 13/13 (100%), astenia 13/13 (100%), hypersomnolency 10/13 (77%), cephalea 9/13 (69%), leg edema 6/13 (46%), loss of memory 6/13 (46%). Regarding gas exchange, they showed hypoxemia and hypercapnia. Mean follow up was of 2.2 years (range 6 months to 4 years). Within the year, all 13 patients became less dyspneic. Astenia, hypersomnolency, cephalea, leg edema and memory loss disappeared. Improvement in gas exchange was: PaO2/FiO2 from 269 +/- 65.4 (basal) to 336.7 +/- 75.3 post-treatment (p = 0.0018). PaCO2 from 70.77 +/- 25.48 mmHg (basal) to 46.77 +/- 8.14 mmHg (p = 0.0013). Ventilatory support was discontinued en 5 patients: three because of pneumonia requiring intubation and conventional mechanical ventilation, two of them died and one is still with tracheostomy; One patient with bronchiectasis and one with cystic fibrosis were transplanted. The remaining eight patients are stable. In conclusion, chronic alveolar hypoventilation can be effectively treated with domiciliary nocturnal noninvasive ventilation. Long term improvement in symptomatology and arterial blood gases

  7. Quantitative GPCR and ion channel transcriptomics in primary alveolar macrophages and macrophage surrogates

    Directory of Open Access Journals (Sweden)

    Groot-Kormelink Paul J

    2012-10-01

    Full Text Available Abstract Background Alveolar macrophages are one of the first lines of defence against invading pathogens and play a central role in modulating both the innate and acquired immune systems. By responding to endogenous stimuli within the lung, alveolar macrophages contribute towards the regulation of the local inflammatory microenvironment, the initiation of wound healing and the pathogenesis of viral and bacterial infections. Despite the availability of protocols for isolating primary alveolar macrophages from the lung these cells remain recalcitrant to expansion in-vitro and therefore surrogate cell types, such as monocyte derived macrophages and phorbol ester-differentiated cell lines (e.g. U937, THP-1, HL60 are frequently used to model macrophage function. Methods The availability of high throughput gene expression technologies for accurate quantification of transcript levels enables the re-evaluation of these surrogate cell types for use as cellular models of the alveolar macrophage. Utilising high-throughput TaqMan arrays and focussing on dynamically regulated families of integral membrane proteins, we explore the similarities and differences in G-protein coupled receptor (GPCR and ion channel expression in alveolar macrophages and their widely used surrogates. Results The complete non-sensory GPCR and ion channel transcriptome is described for primary alveolar macrophages and macrophage surrogates. The expression of numerous GPCRs and ion channels whose expression were hitherto not described in human alveolar macrophages are compared across primary macrophages and commonly used macrophage cell models. Several membrane proteins known to have critical roles in regulating macrophage function, including CXCR6, CCR8 and TRPV4, were found to be highly expressed in macrophages but not expressed in PMA-differentiated surrogates. Conclusions The data described in this report provides insight into the appropriate choice of cell models for

  8. Candidate salivary biomarkers associated with alveolar bone loss: cross-sectional and in vitro studies

    OpenAIRE

    Ng, Patricia Yen Bee; Donley, Maureen; Hausmann, Ernest; Hutson, Alan D.; Rossomando, Edward F.; Scannapieco, Frank A.

    2007-01-01

    This cross-sectional study evaluated the association between radiographic evidence of alveolar bone loss and the concentration of host-derived bone resorptive factors (interleukin-1 beta, tumor necrosis factor-alpha, interleukin-6, prostaglandin-E2), and markers of bone turnover [pyridinoline cross-linked carboxyterminal telopeptide of type I collagen (ICTP), osteocalcin, osteonectin] in stimulated human whole saliva collected from 110 untreated dental patients. Alveolar bone loss scores for ...

  9. Alveolar rhabdomyosarcoma originating between the fourth and fifth metatarsal--case report and literature review.

    LENUS (Irish Health Repository)

    Bolger, J C

    2010-09-01

    We report a case of alveolar rhabdomyosarcoma arising between the fourth and fifth metatarsal. A 13-year-old boy presented to outpatients with a history of pain and swelling in the lateral aspect of his left forefoot. Plain radiographs and MRI showed a soft tissue mass displacing the fourth metatarsal. Percutaneous biopsy revealed an alveolar rhabdomyosarcoma. Staging scans showed advanced metastatic disease. The patient was treated with chemotherapy. This highly malignant lesion remains challenging to diagnose, and difficult to treat successfully.

  10. Changes in Morphology of Alveolar Buccal Walls Following Atraumatic Internal Root Fragmentation

    OpenAIRE

    Engelke, Wilfried; Beltrán, Víctor; Decco, Oscar; Valdivia-Gandur, Iván; Navarro, Pablo; Fuentes, Ramón

    2015-01-01

    The buccal alveolar wall represents the most important structure to provide shape and volume of the alveolous following tooth extraction. The aim of the study was the evaluation of buccal alveolar bone structures following minimally invasive surgery. In 15 patients (3 male, 12 female), aged 20–67 years, 3 central incisors, 5 lateral incisors, and 7 bicuspids were removed using flapless enucleation. The enucleation comprised endoscopically assisted mesiodistal root sectioning with inw...

  11. Analisis Zona Permeabel Fluida Sistem Panas Bumi Gunungapi Slamet Berdasarkan Analisis Kerapatan Kelurusan Citra SRTM Dan Struktur Geologi

    Directory of Open Access Journals (Sweden)

    Sachrul Iswahyudi

    2016-03-01

    Full Text Available Keberadaan manifestasi panasbumi di sekitar Gunungapi Slamet tidak dapat dipisahkan dari zona-zona permeabilitas yang berkembang. Lokasi-lokasi lulus air tersebut (zona permeabel yang memungkinkan terbentuknya sirkulasi fluida tempat air masuk untuk mengisi reservoir panas bumi dan air keluar ke permukaan bumi sebagai manifesatasi mata air panasbumi di sekitar Gunungapi Slamet. Publikasi yang berupa hasil penelitian ini mencoba mengidentifikasi zona-zona permeabel tersebut berdasarkan anaslisis kerapatan kelurusan yang terekam dalam citra SRTM. Identifikasi kelurusan-kelurusan pada citra berdasarkan komponen-komponen interpretasi citra, yaitu tona, tekstur, pola, bentuk dan relief. Hasil analisis tersebut dikompilasi dengan data struktur geologi regional yang sebelumnya telah diidentifikasi dan data lapangan berupa manifestasi mata air panas. Lokasi-lokasi dengan kerapatan kelurusan yang tinggi pada citra SRTM umumnya bersesuaian dengan zona struktur geologi regional keberadaan manifestasi mata air panas. Daerah tersebut memanjang relatif utara-selatan di bagian barat dan timur-barat di bagian selatan peta. Daerah-daerah inilah yang merupakan daerah lulus air tempat fluida bersirkulasi membentuk sistem panasbumi Gunungapi Slamet.

  12. Alveolar process fractures in the permanent dentition. Part 2. The risk of healing complications in teeth involved in an alveolar process fracture

    DEFF Research Database (Denmark)

    Lauridsen, Eva; Gerds, Thomas; Andreasen, Jens Ove

    2016-01-01

    AIM: To analyze the risk of pulp canal obliteration (PCO), pulp necrosis (PN), repair-related resorption (RRR), infection-related resorption (IRR), ankylosis-related resorption (ARR), marginal bone loss (MBL), and tooth loss (TL) for teeth involved in an alveolar process fracture and to identify.......3-3.5), P = 0.003), and age >30 years (HR: 2.3 (95% CI: 1.1-4.6), P = 0.02). The type of splint (rigid or flexible), the duration of splinting (more or less than 4 weeks), and the administration of antibiotics did not affect the risk of PN. CONCLUSION: Teeth involved in alveolar process fractures appear...

  13. Silicoproteinosis and primary pulmonary alveolar proteinosis: high-resolution computed tomography criteria for differential diagnosis

    International Nuclear Information System (INIS)

    Marchiori, Edson; Mueller, Nestor L.; Martins, Erick Malheiro Leoncio; Souza Junior, Arthur Soares; Escuissato, Dante L.; Gasparetto, Emerson L.

    2003-01-01

    Pulmonary alveolar proteinosis is a rare disease of unknown etiology, in which the main histologic finding is the presence of alveolar filling with proteinaceous material, causing restrictive lung function hypoxaemia and several radiological abnormalities. In this manuscript we reviewed the (HRCT) findings in 13 patients with pulmonary alveolar proteinosis. The study included six patients with primary disease and seven with alveolar proteinosis secondary to silicosis in sandblasters. The aim of this work was to establish HRCT distinguishing features between these conditions, since the histological findings can be identical. The most common HRCT feature of primary alveolar proteinosis was patchy ground-glass attenuation associated with smooth interlobular septal thickening, resulting in a crazy paving pattern. There was no preferential regional lung distribution of this condition, HRCT manifestations of silicoproteinosis included areas of consolidation and foci of increased attenuation consistent with calcification, hilar lymph nodes enlargement and node calcification. We concluded that in the majority of patients the presence of foci of high attenuation in the parenchyma and lymph nodes allows a prompt distinction between silicoproteinosis and primary alveolar proteinosis. (author)

  14. Ultrastructural types of alveolar macrophages in bronchoalveolar lavages from patients with pulmonary sarcoidosis.

    Science.gov (United States)

    Burkhardt, Olaf; Lode, Hartmut; Welte, Tobias; Merker, Hans-Joachim

    2007-01-01

    By routine applied quantitative BAL methods are particularly helpful for the diagnosis of pulmonary sarcoidosis. Here the morphology of the alveolar cells does not play a role. However, morphological and especially electron microscopic investigations might contribute to the clarification of the aetiology of this disease. In a prospective study we investigated the bronchoalveolar lavages (BALs) from 10 patients with recently histologically diagnosed, untreated pulmonary sarcoidosis. Commonly applied cytological and immunological BAL diagnostic techniques were accompanied by morphological investigations of alveolar cells, especially alveolar macrophages, using light and electron microscopy. All patients showed lymphocytic alveolitis with an increased number of CD4 positive lymphocytes as well as an increased CD4/CD8 ratio. A striking light microscopic finding was the great morphological variety of the alveolar macrophages. Electron microscopy revealed typical lymphocytes, neutrophils, and eosinophils as well as three different types of alveolar macrophages in all 10 patients: type I (approx. 30%) with a normal macrophage morphology, a vacuole-rich type II (approx. 30%) with myelin-like structures and type III (approx. 40%) with electron-dense inclusions. The occurrence of intracellular myelin figures in type II macrophages is a hint for increased phagocytotic processes of surfactant with or without its overproduction in the sense of a secondary alveolar proteinosis. Numerous electron-dense inclusions in type III also indicate an increased macrophage activity that leads to an increased release of cytokines, which in turn can trigger an inflammatory reaction.

  15. Characterization of CD44 expressed on alveolar macrophages in patients with diffuse panbronchiolitis

    Science.gov (United States)

    Katoh, S; Matsubara, Y; Taniguchi, H; Fukushima, K; Mukae, H; Kadota, J; Matsukura, S; Kohno, S

    2001-01-01

    Interleukin (IL)-8 may play an important role in neutrophil infiltration in the airways of patients with diffuse panbronchiolitis (DPB). Furthermore, alveolar macrophages could produce IL-8 subsequent to CD44-hyaluronic acid (HA) interaction. The purpose of this study was to evaluate the contribution of CD44 expressed on alveolar macrophages to the pathogenesis of DPB. We examined the concentration of soluble CD44 (sCD44) in bronchoalveolar lavage fluid (BALF) and CD44 expression on macrophages in BALF from patients with DPB before and after low-dose, long-term macrolide therapy. We also assessed the HA-binding ability of alveolar macrophages as a functional analysis of the CD44 molecule. The sCD44 concentration in BALF was significantly lower in patients with DPB than in healthy volunteers. Percentages of alveolar macrophages expressing low CD44 (CD44 low+) and HA-nonbinding alveolar macrophages were higher in patients with DPB compared with healthy volunteers. Furthermore, macrolide therapy normalized CD44 expression and HA-binding ability of macrophages in BALF from DPB patients. Our findings suggest that alveolar macrophage dysfunction could result from abnormalities of CD44 expression in patients with DPB and that these events could contribute to the pathogenesis of DPB. PMID:11737075

  16. Alveolar soft-part sarcoma of the mediastinum: A case report

    Directory of Open Access Journals (Sweden)

    Yohei Kameda

    2017-02-01

    Full Text Available We report a 53-year-old man with metastases of alveolar soft-part sarcoma originated from the mediastinum. He was hospitalized due to lower extremities’ paralysis. Computed tomography scan findings revealed multiple nodules of bilateral lungs, swollen mediastinal lymph nodes, and osteolysis of thoracic vertebrae. We performed spinal decompression and biopsy from vertebra. And, we finally diagnosed this case as metastases of mediastinal alveolar soft-part sarcoma which was removed 10 years ago. Alveolar soft-part sarcoma is rare tumor accounted for 0.5%–1.0% of soft tissue sarcoma that often occurs primarily in the lower extremities and trunk. It is difficult to distinguish between alveolar soft-part sarcoma and paraganglioma, renal cell carcinoma and granular cell tumor morphologically. Periodic acid–Schiff stain and immunohistochemical staining of ASPL-TFE3 are useful in making a definitive diagnosis of alveolar soft-part sarcoma. This case is a rare case of alveolar soft-part sarcoma originated in the mediastinum with local recurrence and distant metastases 10 years after the initial surgery.

  17. ANALISIS PENGARUH STRATEGI PEMASARAN DALAM PENINGKATAN PANGSA PASAR PADA PT. SEMEN TONASA

    OpenAIRE

    ARIANSYAH, IRWIN

    2014-01-01

    2014 ABSTRAK ANALISIS PENGARUH STRATEGI PEMASARAN DALAM PENINGKATAN PANGSA PASAR PADA PT. SEMEN TONASA Analysis Affect of Marketing Strategy in Increasing of Market Share on Semen Tonasa Ltd. Irwin Ariansyah H. Cepi Pahlevi Wardhani Hakim Penelitian ini bertujuan untuk mengkaji dan menganalisis pengaruh strategi pemasaran yang terdiri atas segmentasi, target dan posisi pasar terhadap peningkatan pangsa pas...

  18. Analisis Teknis dan Ekonomis Pembangunan Galangan Kapal untuk ProduksiFPU (Floating Production Unit

    Directory of Open Access Journals (Sweden)

    Samsul Latif

    2017-03-01

    Full Text Available Potensi sumber daya minyak dan gas nasional saat ini cukup besar, namun hingga kini ketersediaan kapal untuk menunjang kegiatan operasi pengeboran minyak dan gas bumi di Indonesia masih sangat minim, padahal kebutuhannya sangat besar dari tahun ke tahun. Salah satu kebutuhan kapal penunjang tersebut adalah FPU (Floating Production Unit.  Tujuan dari studi ini adalah menganalisis secara teknis dan ekonomis pembangunan galangan kapal untuk produksi FPU. Pertama dilakukan analisis peluang pasar FPU. Kedua dilakukan analisis pada aspek teknis untuk menentukan fasilitas yang dibutuhkan serta tata letak galangan kapal untuk memproduksi FPU. Ketiga dilakukan analisis pada aspek ekonomis untuk mengukur kelayakan pembangunan galangan kapal. Dari hasil analisis yang telah dilakukan, didapatkan perencanaan galangan di Desa Sidokelar, Paciran, Lamongan dengan luas 350 m x 200 m. Sarana pokok galangan kapal yang dibutuhkan untuk menunjang proses produksi berupa slipway dan skidway (transfer lift system yang digunakan untuk proses load out topside processing module ke FPU hull melalui jetty pada galangan. Pembangunan galangan kapal untuk produksi FPU memerlukan biaya sekitar 336, 289 milyar rupiah dan perkiraan investasi kembali pada tahun ke-8 bulan ke-9 dengan nilai Return on Investment sekitar 11,754 milyar rupiah. Nilai Internal Rate of Return sebesar 11,07 % lebih besar dari bunga bank yang telah ditetapkan yakni 10,25%. Sehingga investasi pembangunan galangan kapal untuk produksi FPU layak dilakukan.

  19. Analisis Perluasan Merek (brand extension) Sampo Lifebuoy terhadap Sensitivitas Tanggapan Siswi Asrama Putri Santa Theresia Medan.

    OpenAIRE

    Amanita, Rika

    2011-01-01

    Tujuan dari penelitian ini adalah untuk mengetahui dan menganalisis seberapa besar tingkat sensitivitas tanggapan konsumen terhadap ekstensifikasi merek (brand extention) pada sampo merek Lifebuoy, dan untuk mengetahui dan menganalisis apakah arah tanggapan dari konsumen positif terhadap ekstensifikasi merek (brand extention) pada sampo merek Lifebuoy di Asrama Putri Santa Theresia Medan. Pengujian data dilakukan dengan menggunakan analisis sensitivitas tanggapan ; kekuatan tanggapan, perubah...

  20. Espacio y Territorio: desarrollo y evolucion del analisis territorial en la cuenca media del rio chicamocha.

    OpenAIRE

    Cárdenas Támara, Felipe

    2010-01-01

    El articulo estudia desde un marco comparativo tres momentos de analisis territorial, buscando con ello captar los prosesos de cambio, evolucion o transformacion que se bienen dando en las ciencias ambientales en lo referido a sus lecturas de procesos territoriales y a los insumos que se generan en lo que se denomina la "imagen cartografica".

  1. Perumusan Strategi Unggulan Jasa Bus Damri Berbasis Analisi Swot Dan Quality Function Deployment (Qfd)

    OpenAIRE

    Cahyadi, Achmad Barkah; Sugiono, Sugiono; Efranto, Remba Yanuar

    2014-01-01

    Penumpang bus DAMRI telah menurun dalam tiga tahun terakhir. Situasi ini perlu mendapatkan perhatian dari manajemen. Penurunan ini dikarenakan oleh adanya pesaing yang menyediakan layanan serupa. Untuk menghadapi kondisi ini, Perum DAMRI harus merumuskan strategi baru. Perumusan Strategi ini diharapkan dapat meningkatkan jumlah penumpang. Perumusan strategi menggunakan analisis SWOT (Strength, Weaknesses, Opportunities, dan Threats) dan QFD juga berdasarkan suara pelanggan di wilayah Jabotabe...

  2. Analisis Perencanaan Waktu Proyek Sistem Informasi Menggunakan Critical Path Method Dan Metode Kurva Pangkat

    OpenAIRE

    Wahyuni, Sri Ngudi; Hapsara, P.hD, Manik

    2015-01-01

    —Perencanaan proyek merupakan cara dalammengelola proyek agar dapat diselesaikan tepat waktu, sesuaidengan biaya dan sumberdaya yang dianggarkan. Critical PathMethode dan kurva pangkat merupakan metode matematis yangdapat digunakan untuk perencanaan waktu proyek agar lebihefisien. Penelitian bertujuan melakukan analisis perencanaanwaktu proyek Client Application Monitoring Systems (CAMS)yang akan dibangun berdasarkan pola pengembangan proyekpada tahun sebelumnya di Universitas X. Hasil Peneli...

  3. Cinemateca de Vertigo. El delirio de la mirada: Vertigo (1958, Alfred Hitchcock) Analisis de una secuencia

    OpenAIRE

    Castro de Paz, José Luis

    1992-01-01

    Castro De Paz, JL. (1992). Cinemateca de Vertigo. El delirio de la mirada: Vertigo (1958, Alfred Hitchcock) Analisis de una secuencia. Vértigo. Revista de cine. (2):43-48. http://hdl.handle.net/10251/42923. 43 48 2

  4. Inferior alveolar nerve cutting; legal liability versus desired patient outcomes.

    Science.gov (United States)

    Kim, Soung Min; Lee, Jong Ho

    2017-10-01

    Mandibular angle reduction or reduction genioplasty is a routine well-known facial contouring surgery that reduces the width of the lower face resulting in an oval shaped face. During the intraoral resection of the mandibular angle or chin using an oscillating saw, unexpected peripheral nerve damage including inferior alveolar nerve (IAN) damage could occur. This study analyzed cases of damaged IANs during facial contouring surgery, and asked what the basic standard of care in these medical litigation-involved cases should be. We retrospectively reviewed a total of 28 patients with IAN damage after mandibular contouring from August 2008 to July 2015. Most of the patients did not have an antipathy to medical staff because they wanted their faces to be ovoid shaped. We summarized three representative cases according to each patient's perceptions and different operation procedures under the approvement by the Institutional Review Board of Seoul National University. Most of the patients did not want to receive any further operations not due to fear of an operation but because of the changes in their facial appearance. Thus, their fear may be due to a desire for a better perfect outcome, and to avoid unsolicited patient complaints related litigation. This article analyzed representative IAN cutting cases that occurred during mandibular contouring esthetic surgery and evaluated a questionnaire on the standard of care for the desired patient outcomes and the specialized surgeon's position with respect to legal liability.

  5. Expanding the phenotype of alveolar capillary dysplasia (ACD).

    Science.gov (United States)

    Sen, Partha; Thakur, Nivedita; Stockton, David W; Langston, Claire; Bejjani, Bassem A

    2004-11-01

    To define the phenotype of congenital alveolar capillary dysplasia (ACD) as a first step toward mapping the responsible gene(s). Analysis of pathology reports and microscopic slides of 23 subjects with ACD and sequence analysis of two candidate genes. Our review of the pre- and postmortem records delineates both the natural history of this condition and the associated anomalies. Our collection of families corroborates the likely autosomal recessive nature of this condition in some families and provides additional data for genetic and prenatal counseling. Anomalies of many organ systems were detected either in the prenatal period or during the hospital course. However, some major anomalies were not detected until postmortem examination. Left-right asymmetry and gastrointestinal malrotation emerge as important, previously recognized but underappreciated phenotypic features of ACD. Finally, we used sequence analysis to exclude mutations in the coding region of two candidate genes, bone morphogenetic protein type II receptor (BMPR2) and endothelial monocyte-activating polypeptide II (EMAP II), as candidates for ACD. Understanding the clinical spectrum of ACD and the cloning of an "ACD gene" both have implications for counseling, for prenatal testing, and for understanding the molecular pathophysiology of ACD and other organ malformations that are associated with this condition.

  6. Gaining surgical access for repositioning the inferior alveolar neurovascular bundle.

    Science.gov (United States)

    Al-Siweedi, Saif Yousif Abdullah; Nambiar, P; Shanmuhasuntharam, P; Ngeow, W C

    2014-01-01

    This study is aimed at determining anatomical landmarks that can be used to gain access to the inferior alveolar neurovascular (IAN) bundle. Scanned CBCT (i-CAT machine) data of sixty patients and reconstructions performed using the SimPlant dental implant software were reviewed. Outcome variables were the linear distances of the mandibular canal to the inferior border and the buccal cortex of the mandible, measured immediately at the mental foramen (D1) and at 10, 20, 30, and 40 mm (D2-D5) distal to it. Predictor variables were age, ethnicity, and gender of subjects. Apicobasal assessment of the canal reveals that it is curving downward towards the inferior mandibular border until 20 mm (D3) distal to the mental foramen where it then curves upwards, making an elliptic-arc curve. The mandibular canal also forms a buccolingually oriented elliptic arc in relation to the buccal cortex. Variations due to age, ethnicity, and gender were evident and this study provides an accurate anatomic zone for gaining surgical access to the IAN bundle. The findings indicate that the buccal cortex-IAN distance was greatest at D3. Therefore, sites between D2 and D5 can be used as favorable landmarks to access the IAN bundle with the least complications to the patient.

  7. Arachidonic acid metabolism in silica-stimulated bovine alveolar macrophages

    International Nuclear Information System (INIS)

    Englen, M.D.

    1989-01-01

    The in vitro production of arachidonic acid (AA) metabolites in adherent bovine alveolar macrophages (BAM) incubated with silica was investigated. BAM were pre-labelled with 3 H-AA, and lipid metabolites released into the culture medium were analyzed by high performance liquid chromatography (HPLC). Lactate dehydrogenase (LDH) release was simultaneously assayed to provide an indication of cell injury. Increasing doses of silica selectively stimulated the 5-lipoxygenase pathway of AA metabolism, while cyclooxygenase metabolite output was suppressed. LDH release increased in a linear, dose-dependent fashion over the range of silica doses used. Moreover, within 15 min following addition of a high silica dose, a shift to the production of 5-lipoxygenase metabolites occurred, accompanied by a reduction in cyclooxygenase products. This rapid alteration in AA metabolism preceded cell injury. To examine the relationship between cytotoxicity and AA metabolite release by BAM exposed to silicas with different cytotoxic and fibrogenic activities, BAM were exposed to different doses of DQ-12, Minusil-5, and Sigma silicas, and carbonyl iron beads. The median effective dose (ED 50 ) of each particulate to stimulate the release of AA metabolites and LDH was calculated. The ED 50 values for DQ-12, Minusil-5, and Sigma silica showed that the relative cytotoxicities of the different silicas for BAM corresponded to the relative potencies of the silicas to elicit 5-lipoxygenase metabolites from BAM. These results indicate that the cytotoxic, and presumed fibrogenic potential, of a silica is correlated with the potency to stimulate the release of leukotrienes from AM

  8. Effect of Preoperative Pain on Inferior Alveolar Nerve Block

    Science.gov (United States)

    Aggarwal, Vivek; Singla, Mamta; Subbiya, Arunajatesan; Vivekanandhan, Paramasivam; Sharma, Vikram; Sharma, Ritu; Prakash, Venkatachalam; Geethapriya, Nagarajan

    2015-01-01

    The present study tested the hypothesis that the amount and severity of preoperative pain will affect the anesthetic efficacy of inferior alveolar nerve block (IANB) in patients with symptomatic irreversible pulpitis. One-hundred seventy-seven adult volunteer subjects, actively experiencing pain in a mandibular molar, participated in this prospective double-blind study carried out at 2 different centers. The patients were classified into 3 groups on the basis of severity of preoperative pain: mild, 1–54 mm on the Heft-Parker visual analog scale (HP VAS); moderate, 55–114 mm; and severe, greater than 114 mm. After IANB with 1.8 mL of 2% lidocaine, endodontic access preparation was initiated. Pain during treatment was recorded using the HP VAS. The primary outcome measure was the ability to undertake pulp access and canal instrumentation with no or mild pain. The success rates were statistically analyzed by multiple logistic regression test. There was a significant difference between the mild and severe preoperative pain group (P = .03). There was a positive correlation between the values of preoperative and intraoperative pain (r = .2 and .4 at 2 centers). The amount of preoperative pain can affect the anesthetic success rates of IANB in patients with symptomatic irreversible pulpitis. PMID:26650491

  9. Gaining Surgical Access for Repositioning the Inferior Alveolar Neurovascular Bundle

    Directory of Open Access Journals (Sweden)

    Saif Yousif Abdullah Al-Siweedi

    2014-01-01

    Full Text Available This study is aimed at determining anatomical landmarks that can be used to gain access to the inferior alveolar neurovascular (IAN bundle. Scanned CBCT (i-CAT machine data of sixty patients and reconstructions performed using the SimPlant dental implant software were reviewed. Outcome variables were the linear distances of the mandibular canal to the inferior border and the buccal cortex of the mandible, measured immediately at the mental foramen (D1 and at 10, 20, 30, and 40 mm (D2–D5 distal to it. Predictor variables were age, ethnicity, and gender of subjects. Apicobasal assessment of the canal reveals that it is curving downward towards the inferior mandibular border until 20 mm (D3 distal to the mental foramen where it then curves upwards, making an elliptic-arc curve. The mandibular canal also forms a buccolingually oriented elliptic arc in relation to the buccal cortex. Variations due to age, ethnicity, and gender were evident and this study provides an accurate anatomic zone for gaining surgical access to the IAN bundle. The findings indicate that the buccal cortex-IAN distance was greatest at D3. Therefore, sites between D2 and D5 can be used as favorable landmarks to access the IAN bundle with the least complications to the patient.

  10. Quality assessment of systematic reviews on alveolar ridge preservation.

    Science.gov (United States)

    De Buitrago, Juan G; Avila-Ortiz, Gustavo; Elangovan, Satheesh

    2013-12-01

    The authors conducted a study to assess the quality of systematic reviews (SRs) published on the topic of alveolar ridge preservation (ARP). The authors conducted a search for SRs on ARP on the basis of a set of eligibility criteria (only SRs involving ARP, with or without meta-analyses, written in English). The authors assessed the quality of the SRs independently of one another by using two established checklists. The authors selected eight SRs. The results of all of the SRs indicated that ARP was effective in preserving the ridge volume as compared with extraction alone, but it did not fully prevent bone-resorptive events. None of the SRs, however, received the highest possible score in either of the checklists. One SR that had a score of 5 (of a possible 11) using one checklist and 5 (of a possible 14) using the other checklist had the lowest overall score. The results of this assessment revealed that a significant proportion of the investigators in the SRs did not include non-English language articles, perform hand searching of published literature or evaluate the gray literature. Assessment of publication bias and reporting of conflicts of interest also was lacking in some studies. Practical Implications. Although ARP appears to be an effective approach to preventing resorption after tooth extraction, significant structural and methodological variability exists among SRs on this topic. Future SRs on ARP should consider the use of quality assessment checklists to minimize methodological shortcomings for better dissemination of scientific evidence.

  11. Determinants of alveolar ridge preservation differ by anatomic location.

    Science.gov (United States)

    Leblebicioglu, Binnaz; Salas, Mabel; Ort, Yirae; Johnson, Ashley; Yildiz, Vedat O; Kim, Do-Gyoon; Agarwal, Sudha; Tatakis, Dimitris N

    2013-04-01

    To investigate and compare outcomes following alveolar ridge preservation (ARP) in posterior maxilla and mandible. Twenty-four patients (54 ± 3 years) with single posterior tooth extraction were included. ARP was performed with freeze-dried bone allograft and collagen membrane. Clinical parameters were recorded at extraction and re-entry. Harvested bone cores were analysed by microcomputed tomography (micro-CT), histomorphometry and immunohistochemistry. In both jaws, ARP prevented ridge height loss, but ridge width was significantly reduced by approximately 2.5 mm. Healing time, initial clinical attachment loss and amount of keratinized tissue at extraction site were identified as determinants of ridge height outcome. Buccal plate thickness and tooth root length were identified as determinants of ridge width outcome. In addition, initial ridge width was positively correlated with ridge width loss. Micro-CT revealed greater mineralization per unit volume in new bone compared with existing bone in mandible (p < 0.001). Distributions of residual graft, new cellular bone and immature tissue were similar in both jaws. Within the limitations of this study, the results indicate that in different anatomic locations different factors may determine ARP outcomes. Further studies are needed to better understand determinants of ARP outcomes. © 2013 John Wiley & Sons A/S.

  12. Surgical techniques for alveolar socket preservation: a systematic review.

    Science.gov (United States)

    Vittorini Orgeas, Gianluca; Clementini, Marco; De Risi, Valeria; de Sanctis, Massimo

    2013-01-01

    To evaluate, through a systematic review of the literature, the efficacy of different surgical techniques in maintaining residual bone in the alveolar process following tooth extractions. MEDLINE/PubMed was searched through January 2010 and papers were selected according to the CONSORT statement and an independent three-stage screening process. The selected outcome variables were clinical width and height changes of the socket, and means and standard deviations were calculated from the included studies. For those studies that were randomized controlled trials, six meta-analyses were performed by dividing studies into three groups with regard to the use of barriers and grafting (barriers alone, graft alone, or both). Thirteen papers met the eligibility criteria and were included in the analyses. Statistically significant ridge preservation was found for studies that used barriers alone; the pooled weighted mean was 0.909 mm (95% confidence interval, 0.497554 to 1.320732 mm) for bone height, while the mean for bone width was 2.966 mm (95% confidence interval, 2.334770 to 3.598300 mm). Socket preservation procedures are effective in limiting horizontal and vertical ridge alterations in postextraction sites. The meta-analysis indicates that the use of barrier membranes alone might improve normal wound healing in extraction sites.

  13. Sulfite induces release of lipid mediators by alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Beck-Speier, I.; Dayal, N.; Maier, L. [GSF - National Research Center for Environment and Health, Neuherberg (Germany). Inst. for Inhalation Biology; Denzlinger, C. [Tuebingen Univ. (Germany). Dept. II, Medical Clinic; Haberl, C. [Tuebingen Univ. (Germany). Dept. III, Medical Clinic

    1998-03-01

    Air pollutants are supposed to modulate physiological responses of alveolar macrophages (AM). This study was addressed to the question whether at neutral pH sulfur(IV) species in comparison to sulfur(VI) species cause AM to release proinflammatory mediators and which pathways are involved in their generation. Supernatants obtained from canine AM treated with sulfite (0.1 mM to 2 mM) enhanced the respiratory burst of canine neutrophils, measured by lucigenin-dependent chemiluminescence, whereas supernatants derived from AM treated with sulfate (1 mM) did not. The neutrophil-stimulating activity released by sulfite-treated AM consisted of platelet-activating factor (PAF) and leukotriene B{sub 4} (LTB{sub 4}) as shown by desensitization of the platelet-activating factor (PAF) and leukotriene B{sub 4} (LTB{sub 4}) as shown by desensitization of the corresponding receptors. Inhibitors of phospholipase A{sub 2} substantially suppressed release of neutrophil-stimulating activity by sulfite-treated AM. Inhibition of 5-lipoxygenase in sulfite-treated AM also reduced neutrophil-stimulating activity, while inhibition of cyclooxygenase had no effect. In conclusion, sulfite induces AM to release lipid mediators via phospholipase A{sub 2}- and 5-lipoxygenase-dependent pathways. These mediators activate neutrophils via the receptors for PAF and LTB{sub 4}. (orig.)

  14. Antioxidant properties of taurine in rat alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Castranova, V.; Banks, M.A.; Porter, D.W.; Martin, W.G. (National Inst. for Occupational Safety and Health, Morgantown, WV (United States) West Virginia Univ., Morgantown (United States))

    1990-02-26

    Isolated rat alveolar macrophages (RAM) which had taken-up and accumulated extracellular (0-500 {mu}M) taurine (TAU) were exposed to 0.45 {plus minus} 0.05 ppm ozone for 30 minutes in a modified tissue culture flask containing TAU-supplemented medium. Recovered cells were assayed for oxidant damage and media analyzed for leakage of intracellular components. Cell viability significantly increased, while recovery of cells decreased (possibly due to increased adherence) with increasing TAU. At 100 {mu}M (rat plasma TAU level), TAU protected against the ozone-induced increase in zymosan-stimulated chemiluminescence, diminished leakages of lipid peroxidation products and protein into the medium, and partially restored the ozone-inactivated Na{sup +}/K{sup +} ATPase activity of RAM. Efflux of oxidized glutathione was maximized and K{sup +} leakage was minimized by the addition of 250 {mu}M TAU. At 250-500 {mu}M TAU, leakages of lipid peroxidation products and protein were enhanced, while the intracellular TAU content dramatically increased. These results indicate that TAU has both direct and indirect antioxidant properties at low levels and pro-oxidant properties at high levels in RAM.

  15. Pulmonary alveolar proteinosis: Quantitative CT and pulmonary functional correlations

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Yubao, E-mail: yubaoguan@163.com [Department of Radiology, the First Affiliated Hospital of Guangzhou Medical College, Guangzhou 510120 (China); State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); Zeng, Qingsi [Department of Radiology, the First Affiliated Hospital of Guangzhou Medical College, Guangzhou 510120 (China); Yang, Haihong; Zheng, Jinping; Li, Shiyue; Gao, Yi [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); Deng, Yu [Department of Radiology, the First Affiliated Hospital of Guangzhou Medical College, Guangzhou 510120 (China); Mei, Jiang [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); He, Jianxing, E-mail: jianxing63@163.com [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); Zhong, Nanshan, E-mail: nanshan@vip.163.com [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China)

    2012-09-15

    Objective: We assessed the relationship between quantitative computer tomography (qCT) and the pulmonary function test (PFT) or blood gas analysis in pulmonary alveolar proteinosis (PAP) patients, as well as the utility of these analyses to monitor responses to whole lung lavage (WLL) therapy. Methods: Thirty-eight PAP patients simultaneously received a CT scan and PFT. Fifteen of these patients, undergoing sequential WLL for a total of 20 lavages, also underwent chest CT scans and blood gas analysis before and after WLL, and 14 of 15 patients underwent simultaneous PFT analysis. Differences between the qCT and PFT results were analyzed by canonical correlation. Results: PAP patients with low predicted values for FVC, FEV1, D{sub LCO} and D{sub LCO}/VA indicated small airspace volume and mean lung inflation, low airspace volume/total lung volume ratio and high mean lung density. Correlation and regression analysis revealed a strong correlation between D{sub LCO} and PaO{sub 2} values with CT results. The qCT results indicated that WLL significantly decreased lung weights and mean lung densities, and improved the total airspace volume/total lung volume ratios and mean lung inflations. Conclusion: Quantitative CT may be a sensitive tool for measuring the response of PAP patients to medical interventions such as WLL.

  16. Automatic lung segmentation in the presence of alveolar collapse

    Directory of Open Access Journals (Sweden)

    Noshadi Areg

    2017-09-01

    Full Text Available Lung ventilation and perfusion analyses using chest imaging methods require a correct segmentation of the lung to offer anatomical landmarks for the physiological data. An automatic segmentation approach simplifies and accelerates the analysis. However, the segmentation of the lungs has shown to be difficult if collapsed areas are present that tend to share similar gray values with surrounding non-pulmonary tissue. Our goal was to develop an automatic segmentation algorithm that is able to approximate dorsal lung boundaries even if alveolar collapse is present in the dependent lung areas adjacent to the pleura. Computed tomography data acquired in five supine pigs with injured lungs were used for this purpose. First, healthy lung tissue was segmented using a standard 3D region growing algorithm. Further, the bones in the chest wall surrounding the lungs were segmented to find the contact points of ribs and pleura. Artificial boundaries of the dorsal lung were set by spline interpolation through these contact points. Segmentation masks of the entire lung including the collapsed regions were created by combining the splines with the segmentation masks of the healthy lung tissue through multiple morphological operations. The automatically segmented images were then evaluated by comparing them to manual segmentations and determining the Dice similarity coefficients (DSC as a similarity measure. The developed method was able to accurately segment the lungs including the collapsed regions (DSCs over 0.96.

  17. Comparison of digitized radiographic alveolar features with age

    International Nuclear Information System (INIS)

    Lee, Keon Il

    1997-01-01

    The purpose of the present study was to use digital profile image features and digital image analysis of fixed-dimension bone regions, extracted from standardized periapical radiographs of the maxilla, to determine whether differences exist in alveolar bone of younger women (mean age : 59.23 ± 7.34 years) and just menopaused women (mean age : 59.23 ± 7.34), Periapical films were used from two groups of 20 randomly selected women. None of the subjects had a remarkable medical history. To simplify protocol, we chose one interproximal bone area between the maxillary right canine and lateral incisor for study. Each film was digitized into a 1312 X 1024 pixel X 8 bit depth matrix by means of a Nikon 35 mm film scanner (LS-3510AF, Japan) with fixed gain and internal dark current correction to maintain constant illumination. The scanner was interfaced to a Macintosh LC III computer(Apple Computer, Charlotte, N.C.). Area and profile orientation were selected with a NIMH Image 1.37 (NIH Research Services Brach, Bethesda, Md.). Histogram features were extracted form each profile and area. The results of this study indicate that mean pixel intensities didn't differ significantly between two groups and there was a high correlation-coefficient between digitized radiographic profile features and area features.

  18. Alveolar Fracture Caused by Tooth Extraction at Home.

    Science.gov (United States)

    de Carvalho, Fabrício Kitazono; Xavier, Thaís Aparecida; Lima, Nicole Gonçalves; de Queiroz, Alexandra Mussolino; Vinhorte, Marcilene Coelho; Nelson-Filho, Paulo

    Injuries to the teeth and surrounding structures are relatively common. Although traumatic injuries caused by falls or activities related to sports are widely discussed, the same cannot be said regarding accidents arising from non-professional extraction of primary teeth. The present study reports a 6-year-old male child who underwent mandibular alveolar bone fracture during non-professional extraction of his central lower left incisor at home, performed by his 30-year-old aunt. The root of the tooth was with an irregular physiological resorption, which acted as a lever component for the mechanical force applied, leading to bone fracture. Although not common, the possibility that dental roots with irregular resorption can act as a possible risk factor for accidents if the parents or guardians of children during the period of transitional dentition try to perform intentional extraction of primary teeth should be highlighted. Parents should always consult a professional, preferably a pediatric dentist, for monitoring this period of transitional dentition.

  19. Evidence for particle transport between alveolar macrophages in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Benson, J.M.; Nikula, K.J.; Guilmette, R.A.

    1995-12-01

    Recent studies at this Institute have focused on determining the role of alveolar macrophages (AMs) in the transport of particles within and form the lung. For those studies, AMs previously labeled using the nuclear stain Hoechst 33342 and polychromatic Fluoresbrite microspheres (1 {mu}m diameter, Polysciences, Inc., Warrington, PA) were instilled into lungs of recipient F344 rats. The fate of the donor particles and the doubly labeled AMs within recipient lungs was followed for 32 d. Within 2-4 d after instillation, the polychromatic microspheres were found in both donor and resident AMs, suggesting that particle transfer occurred between the donor and resident AMs. However, this may also have been an artifact resulting from phagocytosis of the microspheres form dead donor cells or from the fading or degradation of Hoechst 33342 within the donor cells leading to their misidentification as resident AMs. The results support the earlier findings that microspheres in donor AMs can be transferred to resident AMs within 2 d after instillation.

  20. HES6 enhances the motility of alveolar rhabdomyosarcoma cells

    International Nuclear Information System (INIS)

    Wickramasinghe, Caroline M; Domaschenz, Renae; Amagase, Yoko; Williamson, Daniel; Missiaglia, Edoardo; Shipley, Janet; Murai, Kasumi; Jones, Philip H

    2013-01-01

    Absract: HES6, a member of the hairy-enhancer-of-split family of transcription factors, plays multiple roles in myogenesis. It is a direct target of the myogenic transcription factor MyoD and has been shown to regulate the formation of the myotome in development, myoblast cell cycle exit and the organization of the actin cytoskeleton during terminal differentiation. Here we investigate the expression and function of HES6 in rhabdomyosarcoma, a soft tissue tumor which expresses myogenic genes but fails to differentiate into muscle. We show that HES6 is expressed at high levels in the subset of alveolar rhabdomyosarcomas expressing PAX/FOXO1 fusion genes (ARMSp). Knockdown of HES6 mRNA in the ARMSp cell line RH30 reduces proliferation and cell motility. This phenotype is rescued by expression of mouse Hes6 which is insensitive to HES6 siRNA. Furthermore, expression microarray analysis indicates that the HES6 knockdown is associated with a decrease in the levels of Transgelin, (TAGLN), a regulator of the actin cytoskeleton. Knockdown of TAGLN decreases cell motility, whilst TAGLN overexpression rescues the motility defect resulting from HES6 knockdown. These findings indicate HES6 contributes to the pathogenesis of ARMSp by enhancing both proliferation and cell motility.

  1. Aumento del reborde alveolar residual mediante técnica de rollo Increase of residual alveolar ridge using roll technique

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Simancas Pallares

    2011-03-01

    Full Text Available La pérdida dentaria, asociada a factores sistémicos, patológicos y traumáticos, promueve el proceso de reabsorción ósea de los rebordes residuales y genera problemas funcionales, como la falta de estabilidad y retención de las prótesis dentarias removibles, y disturbios estéticos y psicológicos. Estos defectos varían en dependencia de la cantidad de pérdida ósea y de tejidos blandos que hayan alcanzado. En la actualidad son descritas diversas técnicas que permiten corregir estos defectos. Una de ellas es la técnica del rollo, la cual demuestra muy buenos resultados al aumentar el tamaño del reborde alveolar y disminuir los defectos estéticos que causa sobre todo en el sector anterior. El objetivo del presente artículo es describir el caso clínico de un paciente con pérdida ósea en el sector anterior, tipo III según Seibert, rehabilitado con prótesis parcial fija y sometido a un procedimiento quirúrgico con la técnica del rollo. Se alcanzaron los objetivos planteados y proporciona una mejoría estética así como una mejora en su calidad de vida. Se demostró que con esta técnica se obtienen resultados predecibles que devuelven la estética en zonas de alta exigencia por parte de los pacientes.Tooth loss associated with systemic factors, pathological and traumatic conditions, promotes the bone resorption of residual ridges, this, creates functional problems such as lack of stability and retention of removable dentures as well as aesthetic and psychological disturbances. These defects vary depending on the amount of bone loss and soft tissue they reach. At present there are described various techniques that can correct these defects. One of these is the roll technique which shows very good results by increasing the size of the alveolar ridge and decrease aesthetic defects in the anterior area of the maxilla. The aim of this article is to describe a case of a patient with Seibert bone loss type III, rehabilitated with

  2. Analisis Karaterisasi Konsentrasi dan Komposisi Partikulat Udara (Studi Case : Surabaya

    Directory of Open Access Journals (Sweden)

    Eka Fithriani Ahmad

    2016-12-01

    Full Text Available Abstrak Pencemaran udara merupakan dampak yang sangat merugikan, tidak hanya bagi manusia tetapi juga akan berdampak buruk bagi ekosistem hewan dan tumbuhan. Pada penelitian ini akan mengkaji pencemaran udara dari Oktober 2012 hingga Februari 2014 melalui penelitian konsentrasi dan komposisi dari partikulat udara dengan ukuran PM 2.5. Penelitian ini bertujuan untuk menentuan sumber asal pencemaran di Surabaya sehingga dapat dijadikan referensi berbasis ilmiah sebagai langkah untuk membuat keputusan dan kebijakan yang tepat dalam menanggulangi dampak pencemaran. Metode pengolahan data dalam penelitian ini adalah dengan menggunakan analisis reseptor modeling yaitu Positif Matrix Factorization (PMF untuk mengetahui sumber asal pencemaran. Hasil pengukuran yang diperoleh pada konsentrasi PM 2,5 adalah 15.05 μg/m3 sehingga telah melebihi baku mutu tahunan yang telah ditetapkan PP 41 tahun 1999, USEPA, maupun WHO. Dalam partikulat terdapat konsentrasi black carbon (BC sebesar 3.20 μg/m3 dan unsur Pb dengan konsentrasi 0.28 μg/m3 yang telah melebihi nilai baku mutu USEPA. Sedangkan hasil analisis reseptor modeling di dapatkan sumber asal polutan berasal dari biomass, vehicle, soil, industri Pb, industri Zn dan indutri Fe. Kata kunci: Partikulat mater 2.5, black carbon, Pb, positive matrix factorization, Surabaya   Abstract Air pollution is a very adverse impact, not only for humans but also the ecosystem of plants and animals. This research examine air pollution from October 2012 until February 2014 through the research of concentration and composition of airborne particulates with a size of PM 2.5 μm. This study aims to determine the origin and location of pollution sources in Surabaya so that it can be used as scientific reference as a step to make the right decisions and policies in tackling the impact of pollution. Data processing method in this research used analysis of receptor modeling that is Positive Matrix Factorization (PMF to determine

  3. MENENTUKAN PRIORITAS PILIHAN MAHASISWA DALAM MEMILIH KAMPUS MENGGUNAKAN ANALISIS CONJOINT

    Directory of Open Access Journals (Sweden)

    Maxsi Ary

    2016-03-01

    menganalisis preferensi mahasiswa Jurusan Manajemen Informatika AMIK BSI Bandung dalam memilih kampus. Penelitian preferensi mahasiswa dalam memilih kampus dilakukan dengan mengaplikasikan analisis conjoint menggunakan SPSS 17.0. Cara yang dilakukan adalah dengan memperoleh skor kegunaan yang dapat mewakili setiap aspek faktor jasa kampus yang dimiliki, sehingga dari skor tersebut dapat ditarik kesimpulan tentang atribut apa saja yang paling dipertimbangkan oleh mahasiswa dalam memilih kampus. Hasil preferensi responden yang bernilai paling tinggi adalah faktor Lapangan (14.92%, Kurikulum (13.21%, Akreditasi (12.75%, Dosen (12.13%, Gedung (11.96%, Perpustakaan (11.87%, Jarak (11.66%, dan Iklan (11.46%. Hasil utilitas agregat level faktor/atribut pilihan responden, bahwa responden menyukai jasa pendidikan dalam pemilihan kampus adalah kampus memiliki lapangan, kurikulum terbuka (pihak administasi menyampaikan terlebih dahulu diawal pendaftaran, kampus telah terakreditasi, pilihan dosen senior, ukuran gedung biasa saja (kurang diperhatikan, perpustakaan memiliki banyak koleksi buku, jarak antara rumah dan kampus dekat, dan iklan kurang diperhatikan. Kata Kunci: Statistik Multivariat, Analisis Conjoint, Preferensi

  4. Analisis Penerapan E-Government di Kabupaten Sragen

    Directory of Open Access Journals (Sweden)

    Yan Andriariza AS

    2013-09-01

    Full Text Available ABSTRAK Kabupaten Sragen merupakan salah satu pemerintah kabupaten yang menerapkan e-government dengan baik, dan merupakan kabupaten yang menjadi percontohan dalam suksesnya penerapan e-government. Karenanya perlu untuk dilakukan analisis penerapan e-government di Kabupaten Sragen, sebagai contoh bagi daerah lain dalam membangun e-government di daerah tersebut. Analisa yang dilakukan antara lain melihat seberapa jauh penerapan G2C, G2B dan G2G di Pemerintah Kabupaten Sragen. Selain itu juga dilakukan analisa menggunakan The UN Web Measure Index, dan analisa terakhir melakukan analisa deskriptif untuk 5 faktor kesuksesan penerapan e-government, yaitu Hukum dan Peraturan, Struktur Organisasi, Proses Bisnis, Teknologi Informasi dan Visi, Objektif dan Strategi. Dari hasil analisis diperoleh kesimpulan bahwa Kabupaten Sragen telah menerapkan G2B dan G2G, serta berada pada tahap awal penerapan G2C, selain itu Kabupaten Sragen juga telah mencapai pemerintahan yang online, tanpa kertas dan transparan. Implementasi e-government di kabupaten Sragen tersebut dapat dikatakan sukses karena telah memenuhi beberapa faktor dalam mencapai kesuksesan implementasi e-government, yaitu hukum dan peraturan, struktur organisasi, teknologi informasi dan visi, objektif dan strategi. Bila dilihat berdasarkan UN Web Measured Index, Kabupaten Sragen telah mencapai tahap 4. Saran yang dapat diberikan melalui penelitian ini adalah untuk unit kerja yang menangani TIK di Kabupaten Sragen akan lebih baik bila dipegang oleh unit kerja setingkat eselon 2 dan perlunya SOP dan peraturan tambahan terkait TIK di Kabupaten Sragen. ABSTRACT Sragen is one of the districts that implement well e-government, and being a model for the successful implementation of e-government. It is necessary to do the analysis of the application of e-government in Sragen, as an example for other regions in developing e-government in the area. Analysis was carried out to see how far the application of G2C

  5. Kembalikan Lagu Anak-anak Indonesia: Sebuah Analisis Struktur Musik

    Directory of Open Access Journals (Sweden)

    Ardipal - -

    2015-12-01

    . Yaitu musik sebagai pengembangan seni di lingkungan tertentu  dan musik sebagai seni komersial. Dari sisi musik komersial, hampir dua dekade terakhir  ini lagu anak-anak menghilang di media massa. Digantikan oleh lagu orang dewasa. Hal ini tentu mempengaruhi perkembangan psikologis, fisik, dan mental anak-anak. Secara teoritik, masalah ini hal ini dapat ditinjau dari produksi musik melalui pendekatan (1 konfik (hegemoni dan (2 interpretasi/makna. Penelitian ini bertujuan untuk membandingkan struktur musik lagu anak-anak dan struktur musik orang dewasa. Data diambil dari lagu anak-anak dan lagu pop orang dewasa. Metoda analisis difokuskan pada fitur lagu berdasarkan struktur musik dan dampaknya. Instrumen kunci dalam penelitian adalah peneliti sendiri dan instrumen pembantu berupa panduan kodifikasi data. Kemudian mendeskripsikan unsur-unsur tersebut yang terdapat dalam beberapa lagu anak-anak dan dewasa. Untuk menjaga keabsahan data, dilakukan kegiatan triangulasi data. Kegiatan analisis data dimulai dari tahap memilih dan mengodifikasi data, menganalisis data sesuai dengan fitur musiknya masing-masing, dan tahap menarik kesimpulan serta verifikasi. Dari data lagu yang diambil sebagai sampel penelitian, terlihat bahwa pola ritmis, melodis, interval, tempo, hingga rentang nada belum laik  dinyanyikan oleh anak-anak. Pemaksaan anak-anak untuk meniru lagu tersebut dapat berakibat fatal seperti kerusakan pita suara, kram otot rahang. Akhirnya, disarankan agar partisipan seni, dan juga Demikian juga jaringan infrastuktur seni, harus dapat memiliki pandangan yang sama dan kuat  dalam pengembangan seni musik di Indonesia, khususnya untuk lagu anak-anak. Kata Kunci: lagu anak-anak, lagu perjuangan, lagu orang dewasa, struktur musik

  6. ANALISIS DAYA SAING INDUSTRI BESI BAJA DALAM RANGKA MENGHADAPI ACFTA

    Directory of Open Access Journals (Sweden)

    Christiana Ari Cahyani

    2014-10-01

    Full Text Available Abstrak ___________________________________________________________________ Industri baja merupakan industri strategis karena merupakan salah satu pendorong utama pembangunan suatu negara. Hasil yang dihasilkan oleh industri baja masih cukup defisit karena ketergantungan yang tinggi terhadap impor baja lebih tinggi dari yang dihasilkan oleh ekspor. Nilai negara ekspor baja Indonesia dari 2008 sampai 2012, mencapai 9129400000000 Euro sedangkan impor negara baja Indonesia mencapai 42.874,70 miliar dolar AS. Metode menggunakan analisis CMS untuk menentukan faktor-faktor apa yang mempengaruhi daya saing, bagaimana pengaruh faktor-faktor tersebut. Dari analisis perhitungan Revealed Comparative Advantage (RCA yang membandingkan negara-negara ACFTA menunjukkan bahwa Indonesia berada di lima besar dengan rata-rata 2.003 hingga tahun 2012 adalah 0,5193. Hasil CMS bahwa efek daya saing sebagian besar pangsa pasar Indonesia diambil alih oleh negara pesaing. Efek distribusi pasar rata-rata selama bertahun-tahun 2003-2012 menghasilkan nilai positif menunjukkan bahwa ketika impor ACFTA pasar meningkat pertumbuhan Indonesia merespon dengan menaikkan volume industri baja Saran yang diberikan kebutuhan untuk perluasan cakupan di pasar dunia, untuk mengurangi ketergantungan pada Indonesia ke negara-negara lainnya yang diimpor. Hal ini ditunjukkan dengan besarnya pengaruh terhadap pertumbuhan distribusi pasar baja komoditas ekspor Indonesia ke negara-negara lain. Konsumsi masyarakat Indonesia terhadap industri baja tinggi perlu diimbangi dengan konsumsi baja nasional dengan kontribusi mampu meningkatkan baja nasional.. Abstract ___________________________________________________________________ Steel industry is a strategic industry because it is one of the main drivers of development of a country. Proceeds generated by the steel industry is still quite a deficit due to the high dependence on imported steel is higher than that generated by exports. State steel

  7. ANALISIS EFEKTIVITAS PEMBERIAN PINJAMAN PROGRAM PEMBIAYAAN UMKM OLEH KOPERASI

    Directory of Open Access Journals (Sweden)

    Hadi Ismanto

    2014-10-01

    Full Text Available Abstrak: Analisis Efektivitas Pemberian Pinjaman Program Pembiayaan UMKM Oleh Koperasi. Program Pembiayaan memiliki peran yang penting bagi UMKM, namun sering menghadapi masalah penunggakan dan kemacetan pembayaran angsuran. Penelitian ini berupaya untuk mengetahui sebab-sebab tidak lancarnya pengembalian Program Pembiayaan UJKS sehingga diharapkan dapat menyusun strategi yang lebih baik lagi dalam menyeleksi calon peminjam agar angka pinjaman bermasalah dapat ditekan. Populasi dalam penelitian ini adalah semua UMKM yang menjadi Peminjam (peminjam program pembiayaan UJKS Mitra Usaha dan masih tergolong aktif hingga bulan November 2013 dan telah memperoleh fasilitas pembiayaan sekurang-kurangnya enam bulan berjalan. Penelitian ini menemukan bahwa faktor-faktor yang berpengaruh positif terhadap tingkat pengembalian pinjaman (lancar atau menunggak adalah omzet usaha, lama usaha dan nilai plafon pinjaman. Hal ini dapat dijadikan bahan pertimbangan bagi UJKS dalam menjalankan program pembiayaan sehingga menjadi lebih efektif dalam menjalankannya.   Kata Kunci: UMKM, UJKS, Program Pembiayaan, Lancar, dan Macet.   Abstract: Effectiveness Analysis of SMEs Financing Program by Cooperative. Financing programs have an important role to SMEs, but often face the problem of repayment failures and installment payments. This study examines the causes of saving and loan cooperatives’ repayment problems. The population of this study is all SMEs borrowing from Mitra Usaha saving and loan cooperative. Furthermore these SMEs must be categorized as active SMEs until November 2013 and they had been receiving loan for at least six months. The study found that the variables such as: the length of the business, the business volume, and the value of the loan have a positive impact on repayment rate.   Keywords: SMEs, Saving and Loan Cooperative, Financing Program

  8. Analisis Kinerja Penerapan Container untuk Load Balancing Web Server

    Directory of Open Access Journals (Sweden)

    Muhammad Agung Nugroho

    2016-12-01

    Full Text Available Container merupakan teknologi virtualisasi terbaru. Container memudahkan system administrator dalam mengelola aplikasi pada server. Docker container dapat digunakan untuk membangun, mempersiapkan, dan menjalankan aplikasi. Dapat membuat aplikasi dari bahasa pemrograman yang berbeda pada lapisan apapun. Aplikasi dapat di bungkus dalam container, dan aplikasi dapat berjalan pada lingkungan apapun dimana saja.  Dalam perkembangannya container ini dapat digunakan untuk load balancing, dengan memanfaatkan HA Proxy. Load Balancing dapat digunakan untuk menyelesaikan permasalahan beban kinerja web server yang terlalu berat (overload terhadap permintaan. Load Balancing merupakan salah satu metode untuk meningkatkan skalabilitas web server sekaligus mengurangi beban kerja web server. Ujicoba dilakukan dengan memberikan beban request pada single container dan multi container, dan membandingkan kinerjanya. Analisis kinerja dapat dilakukan dengan menggunakan parameter performance pada processor, memori dan proses layanan. Penerapan ujicoba dilakukan pada raspberry pi. Hasil yang diperoleh multi container dapat digunakan untuk mengembangkan metode load balancing, hasil ujicoba menunjukkan performance raspberry pi dapat optimum karena pembagian beban processor.

  9. ANALISIS REKRUITMEN TENAGA PENDIDIK PADA SD KALAM KUDUS PEKANBARU

    Directory of Open Access Journals (Sweden)

    Murnawati Murnawati

    2015-04-01

    Full Text Available Abstrak: Penelitian ini dilakukan untuk mengetahui sistem rekrutmen tenaga pendidik pada SD kalam kudus kota Pekanbaru. Populasi dalam penelitian ini adalah tenaga pendidik di SD Kalam Kudus Kota Pekanbaru, kebutuhan guru sebanyak 65 sedangkan guru tetap sebanyak 40 guru dan sisanya guru honor sebanyak 25 guru. Dalam penelitian ini penulis mengambil sampel seluruh populasi. Pengambilan sampel dilakukan secara sensus. Data yang digunakan adalah data primer yang diperoleh dari wawancara langsung dan penyebaran kuesioner. Analisis data dalam penelitian ini adalah menggunakan metode deskriptif. Berdasarkan hasil penelitian dapat disimpulkan bahwa persyaratan administrasi dalam rekruitmen guru diperoleh rata – rata skor sebesar 3,49. Artinya persyaratan administrasi dalam rekruitmen guru pada SD Kalam Kudus Pekanbaru dinilai baik. Abstract: This research aimed to determine the system of teachers’s recruitment in Kalam Kudus elementary school of Pekanbaru. The population in this study were educators in in Kalam Kudus elementary school of Pekanbaru, the teacher needs as much as 65 while the teacher remains as much as 40 teachers and teacher salaries remaining 25 teachers. In this study the authors took samples of the entire population. Sampling was done by census. The data used is primary data obtained from interviews and questionnaires. Data analyzed by descriptive method. Based on the results of this study concluded that the administrative requirements for the recruitment of teachers obtained average - average score of 3.49. This means that the administrative requirements for the recruitment of teachers in elementary Holy Kalam Pekanbaru considered good. Kata Kunci : Rekruitmen, Tenaga Pendidik

  10. ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI IMPOR BAJA DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Jhonson Agustinus Pasaribu

    2017-06-01

    Full Text Available Impor baja terus mengalami peningkatan dari tahun 1980-2012, hal ini disebabkan karena tingkat produksi baja tidak mampu mengimbangi dan memenuhi tingkat konsumsi baja. Penelitian ini bertujuan untuk menganalisis faktor-faktor yang mempengaruhi impor baja di Indonesia. Metode analisis yang digunakan adalah Error Corection Model (ECM. Pengujian secara parsial digunakan uji t-statistik dan pengujian secara serempak digunakan uji F-statistik. Hasil penelitian ini menunjukan bahwa Produksi baja berpengaruh negatif dan signifikan terhadap impor baja dalam jangka panjang dan jangka pendek. Konsumsi baja menunjukan pengaruh positif dan signifikan terhadap impor baja dalam jangka panjang dan jangka pendek. Gross Domestic Product (GDP menunjukan pengaruh yang negatif dan tidak signifikan terhadap impor baja dalam jangka panjang dan jangka pendek. Nilai tukar rupiah (Kurs menunjukan pengaruh yang positif dan tidak signifikan terhadap impor baja dalam jangka panjang dan jangka pendek.  The steel import keep having enhancement from 1980 to 2012, it’s because of steel production level can’t fulfill the steel consumption level. If the high level of the steel import volume continues, domestic steel industries will run into a low impact for Indonesian’s economy. The goal of this research analize the affecting factors of steel import in Indonesia. The analytical method use the Error Correction Model (ECM. The partial test use t-statistic and the simultan test use F-statistic. The results showed that the steel production has negative and significant effect on steel import in the long term and short term. The steel consumption has positive and significant effect on steel import in the long term and short term. The Gross Domestic Product (GDP has negative and not significant effect on steel import in the long term and short term. The exchange rate indicates positive and not significant effect on steel import in the long term and short term.

  11. ANALISIS TINGKAT KEPUASAN NASABAH BANK, PENERAPANMETODEANALYTICAL HIERARCHY PROCESS

    Directory of Open Access Journals (Sweden)

    Ujang Arlian

    2016-01-01

    Full Text Available The development of the banking industry continues to progress over time. History has recorded that the banking industry advances occur after the deregulation package. Impact after the deregulation package that is increasing the number of private banks in Indonesia.Both private banks and state banks/enterprises vying to attract customers. Regional Development Bank (BPD, which has changed its name to the name of the province in Indonesia is also trying to implement a variety of strategies to encourage people to do deposits. The purpose of this study is to determine the level of satisfaction of bank customers who are in Lebong. The analytical method used is Analytical Hierarchy Process (AHP. Using four (4 criteria such as facilities, products, services, and security as a comparison between the two banks. The results showed that the criteria for the facility is a major factor in determining the level of customer satisfaction.Then followed the safety criteria for second place while the third and fourth position are the criteria of products and services.  Perkembangan industri perbankan terus mengalami kemajuan dari waktu ke waktu. Sejarah telah mencatat bahwa kemajuan industri perbankan terjadi setelah masa paket deregulasi. Dampak setelah masa paket deregulasi yaitu bertambah banyaknya bank swasta di Indonesia. Baik bank swasta maupun bank BUMN/BUMD berlomba-lomba untuk menarik nasabah. Bank Pembangunan Daerah (BPD yang telah berubah nama menjadi nama provinsi di Indonesia juga berupaya dengan menerapkan berbagai strategi untuk mengajak masyarakat melakukan simpanan. Tujuan penelitian ini yaitu untuk mengetahui tingkat kepuasan nasabah perbankan yang terdapat di Kabupaten Lebong. Metode analisis yang digunakan adalah Analytical Hierarchy Process (AHP. Menggunakan 4 (empat kriteria seperti fasilitas, produk, pelayanan, dan keamanan sebagai pembanding diantara kedua bank tersebut. Hasil penelitian menunjukkan bahwa kriteria fasilitas merupakan faktor

  12. Analisis Elektron Beam Profile Constancy pada Pesawat Linac

    Directory of Open Access Journals (Sweden)

    Edi Guritna

    2018-02-01

    Full Text Available Radioterapi adalah pengobatan penyakit terutama tumor atau kanker ganas dengan menggunakan radiasi elektromagnetik (Sinar-X dan Gamma dan radiasi partikel (elektron, proton, dan neutron. Salah satu alat radioterapi modern yang digunakan dalam pengobatan penyakit kanker adalah linear accelerator (linac. Alat radioterapi ini menghasilkan elektron dan sinar-X (foton yang dibangkitkan oleh generator dan mempunyai energi yang bervariasi. Dalam penelitian profil dosis, digunakan pesawat liner accelerator (linac Siemens Primus berkas elektron 5 MeV dengan luas lapangan radiasi berkisar dari 5×5 cm2 sampai 25×25 cm2. Pengukuran profil dosis dilakukan dengan menggunakan water phantom,  detektor farmer chamber dan condenser chamber yang dilengkapi dengan  computer control units (CCU serta dilakukan untuk arah crossline dan inline pada kedalaman Dmax dan kedalaman tertentu. Penelitian ini bertujuan untuk menganalisis profil berkas sinar elektron energi 5 MeV pada kedalaman tertentu dan Dmax dengan variasi luas lapangan 5×5 cm2, 10×10 cm2, 15×15 cm2, 20×20 cm2, 25×25 cm2. Hasil analisis profil dosis pada berkas elektron 5 MeV menunjukkan bahwa lapangan 5×5 cm2 memiliki nilai flatness yang cukup besar sehingga dalam kalibrasi maupun terapi radiasi perlu diperhatikan penggunaan  luas lapangan tersebut. Dalam penelitian ini juga didapatkan bahwa nilai flatness paling ideal (nilai flatness rendah terjadi pada lapangan 15×15 cm2. Sehingga ada luas lapangan lain yang bisa digunakan untuk treatment maupun kalibrasi selain 10×10 cm2 yaitu 15×15 cm2 yang memiliki nilai flatness rendah.

  13. ANALISIS JENIS, JUMLAH DAN MUTU SARAPAN PAGI SISWA SEKOLAH DASAR

    Directory of Open Access Journals (Sweden)

    Sopiyandi Sopiyandi

    2016-01-01

    Full Text Available Abstract: Type Analysis, Number and Quality Breakfast of Children on Elementary School. The research objective is to analyze the full breakfast at the elementary school students in District Rasau Jaya covering aspects of the type, quantity and quality of the breakfast. This research is an analytic with Cross sectional study design. Subjects were students at SDN 1 Rasau Jaya aged 8-12 years, a large sample of 215 respondents. The results showed that as many as 98.6% of students breakfasts with ten types of food most consumed by children during breakfast ie eggs, white rice, fried rice, yellow rice, tempeh, bulb meatballs, dumplings, bread, sausages and porridge. While the five types of beverage most consumed by children during breakfast was tea, milk, juice, water, and syrup. 54% of the number of good energy, 51% protein and 68.4% fat in both categories. 61.9% carbohydrate intake is not good. The nutritional quality of food is quite good kid. Abstrak : Analisis Jenis, Jumlah Dan Mutu Sarapan Pagi Siswa Sekolah Dasar. Tujuan penelitian yaitu untuk menganalisis sarapan pagi pada siswa Sekolah Dasar di Kecamatan Rasau Jaya meliputi aspek jenis, jumlah dan mutu sarapan. Penelitian ini bersifat analitik dengan desain penelitian Cross sectional. Subjek penelitian adalah siswa SDN 1 Rasau Jaya usia 8-12 tahun, besar sampel penelitian sebanyak 215 responden. Hasil penelitian menunjukkan bahwa sebanyak 98,6 % siswa sarapan dengan sepuluh jenis makanan yang paling banyak dikonsumsi oleh anak selama sarapan yaitu telur ayam, nasi putih, nasi goreng, nasi kuning, tempe, pentol bakso, siomay, roti, sosis, dan bubur. Sedangkan lima jenis minuman yang paling banyak dikonsumsi oleh anak selama sarapan adalah teh, susu, air jeruk, air putih, dan sirup. Sebanyak 54% jumlah energi baik, protein 51 % dan lemak 68,4% pada kategori baik. 61,9% asupan karbohidrat tidak baik. Mutu gizi pangan anak tergolong baik.

  14. ANALISIS STILISTIKA WACANA TERJEMAHAN RESMI NASKAH PRASASTI PLUMPUNGAN (KAJIAN HISTORIS

    Directory of Open Access Journals (Sweden)

    Hristina Nikolic

    2008-12-01

    Full Text Available This article mainly deals with the Plumpungan manuscript discourse, an ancient stone inscription found in the Salatiga area. The manuscript dates back to the 8th century and is one of the main historical sources of the Salatiga municipality. There is a tight connection involving the above mentioned inscription with the legitimacy of the Javanese court at that time, as well as with the monarch, who was seen as half- man, half-deity. The monarch drew on the labor of his subjects in maintaining reli- gious sites to ensure his place on earth, and in heaven. The Plumpungan manuscript was a ‘legal document’ used to reassure inhabitants of the area that the monarch is the legitimate ruler, and to prevent further revolt. The monarch’s subjects in the Salatiga area at the time were farmers disheartened with high taxes and the fear of volcanic eruptions, which later caused great migrations to East Java. Consequently, the mon- arch, using the Plumpungan manuscript as a medium, decreed that the Hampra vil- lage (present-day Salatiga become a tax-free area due to the excellent care that its citizens provided for the religious sites, in addition to the obeisance shown to the monarch. It becomes clear, however, that all the way through the discourse analysis, the king wanted to ensure his legitimacy. Socio-historical context confirms that the monarch, Bhanu, was a successful ruler who held power over four regions, analogi- cally with Indra, the king of all deities. Discourse analysis is detained under three main dimensions, which is grammatical, lexical and contextual, unified from be- ginning to end in a particular style that reveals genuinely hidden meaning.     Key words: manuscript, Plumpungan, kodikologi, dan analisis stilistika.

  15. APLIKASI METODE-METODE AGGLOMERATIVE DALAM ANALISIS KLASTER PADA DATA TINGKAT POLUSI UDARA

    Directory of Open Access Journals (Sweden)

    Dewi Rachmatin

    2014-09-01

    Full Text Available ABSTRAK   Analisis Klaster merupakan analisis pengelompokkan data yang mengelompokkan data berdasarkan informasi yang ditemukan pada data. Tujuan dari analisis klaster adalah agar objek-objek di dalam satu kelompok memiliki kesamaan satu sama lain sedangkan dengan objek-objek yang berbeda kelompok memiliki perbedaan. Analisis klaster dibagi menjadi dua metode yaitu metode hirarki dan metode non-hirarki. Metode hirarki dibagi menjadi dua, yaitu metode agglomerative (pemusatan dan metode divisive (penyebaran. Metode-metode yang termasuk dalam metode agglomerative adalah Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward’s Method, Centroid Method dan Median Method. Pada artikel ini dibahas metode-metode agglomerative tersebut yang diterapkan pada data tingkat polusi udara. Masing-masing metode tersebut memberikan jumlah klaster yang berbeda.   Kata Kunci : Analisis Klaster, Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward’s Method, Centroid Method dan Median Method.     ABSTRACT Cluster analysis is an analysis of the data classification based on information found in the data.The objective of cluster analysis is that the objects in the group have in common with each other, while the different objects have different groups. Cluster analysis is divided into two methods : the method of non-hierarchical and hierarchical methods.Hierarchical method is divided into two methods, namely agglomerative methods (concentration and divisive methods (deployment. The methods included in the agglomerative method is Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward 's Method, Method and Median Centroid Method. In this article discussed the agglomerative methods were applied to the data rate of air pollution. Each of these methods provides a different number of clusters.   Keywords: Cluster Analysis , Single Linkage Method, Complete Linkage Method, Average Linkage Method, Ward

  16. Intermittent PTH administration improves alveolar bone formation in type 1 diabetic rats with periodontitis.

    Science.gov (United States)

    Kim, Ji-Hye; Kim, Ae Ri; Choi, Yun Hui; Kim, Aeryun; Sohn, Yongsung; Woo, Gye-Hyeong; Cha, Jeong-Heon; Bak, Eun-Jung; Yoo, Yun-Jung

    2018-03-15

    Periodontitis is an infectious disease that manifests as alveolar bone loss surrounding the roots of teeth. Diabetes aggravates periodontitis-induced alveolar bone loss via suppression of bone formation. Intermittent parathyroid hormone (PTH) administration displays an anabolic effect on bone. In this study, we investigated the effect of intermittent PTH administration on alveolar bone loss in type 1 diabetic rats with periodontitis. Rats were divided into control (C), periodontitis (P), periodontitis treated with PTH (P + PTH), diabetes with periodontitis (DP), and diabetes with periodontitis treated with PTH (DP + PTH) groups. To induce type 1 diabetes, rats were injected with streptozotocin and periodontitis was induced bilaterally by applying ligatures to the mandibular first molars for 30 days. During the experimental period, the P + PTH and DP + PTH groups were subcutaneously injected with PTH (40 μg/kg) three times per week, whereas the C, P, and DP groups were injected with citrate buffer. To observe the mineralization of the alveolar bone, the DP and DP + PTH groups were injected with calcein on days 10 and 27, and with alizarin red on day 20. Thirty days after ligation, histological findings and fluorescence labeling were analyzed in the furcations of the mandibular first molars. Sclerostin-positive osteocytes were assessed by immunohistochemical analyses. The DP groups had smaller areas of alveolar bone than the other groups, and the DP + PTH group had a larger alveolar bone area than the DP group. The DP group had less osteoid formation than the C group, whereas the DP + PTH had greater osteoid formation than the DP group. Fluorescence labeling results revealed that the DP + PTH group had more mineral deposition on the alveolar bone than the DP group. The DP + PTH group exhibited lower percentage of sclerostin-positive osteocytes in alveolar bone than the DP group. Intermittent PTH administration diminishes

  17. ANALISIS IMPLEMENTASI KEBIJAKAN ELIMINASI MALARIA DI PROVINSI BALI

    Directory of Open Access Journals (Sweden)

    Betty Roosihermiatie

    2013-03-01

    to Ministry of Health strategy Interrelated sectors activities were directly or indirectly in synergy with malaria elimination policy Innovation strategy activities in supporting the malaria elimination had be en developed in the district. The budgetting for malaria elimination policy in Bali Province and Karangasem District still depend local budget. The roles of local governments to support policies are by issueing policies/regulations, financing and socialization activities. Treatment should be based on new treatment strategies using artemisinin or ACT to prevent primary drug resistance of malaria. The budgetting for malaria program in Bali Province should be increased, either the total or the source. Then, it needs to develop Malaria Working Group both at the provincial and district levels so interrelated sector activities could be coordinated and integrated with the Health Offices activities to achieve malaria elimination by year 2012. Key words: Malaria, elimination, policy ABSTRAK lndonesia di ASEAN merupakan salah satu dari tiga negara dengan morbiditas malaria tertinggi. Pada tahun 2007, di lndonesia 396 (80% dari total 495 kabupaten/kota merupakan daerah endemis malaria. Dalam rangka pengendalian penyakit malaria, Pemerintah mengeluarkan Surat Keputusan Menteri Kesehatan Nomor 293 tahun 2009 tentang Eliminasi malaria. Tujuan penelitian adalah mengkaji implementasi SK Menkes No. 293 tahun 2009 tentang kebijakan eliminasi malaria di Provinsi Bali, dengan tujuan khusus mengkaji pemahaman, penerapan, inovasi, pendanaan dan peran Pemda dalam mendukung kebijakan eliminasi malaria di Provinsi Bali. Jenis penelitian adalah observasional dengan disain cross sectional, dilaksanakan di Bali dan Kabupaten Karangasem. Pengumpulan data dilaksanakan bulan September 2011, dengan cara diskusi kelompok terarah baik di level provinsi dan kabupaten, dengan Dinas Kesehatan, Pemerintah Daerah (Bappedda dan lintas sektor terkait serta studi dokumen. Analisis data dengan cara

  18. Analisis Spasial Kejadian Filariasi di Kabupaten Demak Jawa Tengah

    Directory of Open Access Journals (Sweden)

    Nurjazuli Nurjazuli

    2018-04-01

    Full Text Available Latar Belakang: Filariasis merupakan salah satu penyakit tular vektor yang kurang mendapatkan perhatian, termasuk kelompok Neglected Tropical Diseases (NTDs. Kabupaten Demak merupakan salah satu wilayah di Propinsi Jawa Tengah  yang merupakan daerah endemis filarisis (mf rate>1%. Kejadian filarisis di daerah ini diduga berkaitan dengan kondisi lingkungan fisik dan biologis (nyamuk yang mempunyai peran penting dalam penyebaran penyakit filarisis. Penelitian ini bertujuan untuk menemukan adanya penderita baru,  mengidentifikasi kondisi lingkungan fisik dan biologi yang berkaitan dengan sebaran filarisis di Kabupaten Demak. Matede: Penelitian ini merupakan penelitian observasional dengan rancangan cross-sectional. Sebanyak 30 kasus filariasis dijadikan indek kasus yang selanjutnya dipilih secara purposif sebanyak 140 yang tinggal di sekitar 30 kasus tersebut untuk dilakukan pengamblan darah jari. Observasi lingkungan dilakukan untuk mengidentifikasi kondisi lingkungan (breeding places dan resting places dari yang diduga sebagai nyamuk vektor filariasis. Penangkapan nyamuk dilakukan di sekitar rumah penderita filariasis. Pengukuran koordinat kasus filariais dilakukan dengan pesawat Geographic Positioning System (GPS. Pemeriksaan darah jadi jari dilakukan di Laboratorium Kesehatan Daerah (LABKESDA Propinsi Jawa Tengah. Sedang bedah nyamuk dilakukan di Balai Penelitian Vektor Penyakit Banjarnegara. Analisis data dlakukan secara deskriptif, analisis spasial dilakukan dengan software ArcGis 9.3. Hasil: Penelitian ini tidak menemukan penderita baru filarisis (mf rate=0%. Sebanyak 129 ekor nyamuk telah dilakukan pembedahan dengan hasil semuanya negatip cacing filaria. Hasil identifikasi nyamuk menemukan spesies nyamuk Culex quinquefasciatus merupakan nyamuk yang dominan (72,86% di lokasi penelitian.Terdapat breeding places (40% berupa genangan air terbuka (SPAL dan resting places (83,3% berupa semak-semak di sekitar rumah penderita. Analisis spasial

  19. Analisis Kandungan Logam Berat Tembaga (Cu) Dan Timbal (Pb) Pada Sedimen Di Pulau Payung Kabupaten Banyuasin, Sumatera Selatan

    OpenAIRE

    Lyusta, Atik Hendika; Agustriani, Fitri; Surbakti, Heron

    2017-01-01

    Penelitian ini bertujuan untuk mengetahui kandungan logam berat Tembaga (Cu) danTimbal (Pb) pada sedimen di Pulau Payung. Penelitian ini telah dilaksanakan pada bulan Mei-Juli 2014. Metode yang digunakan dalam analisis logam berat adalah Atomic Absorption Spectrophotometry (AAS) sedangkan metode yang digunakan untuk analisis fraksi sedimen adalah pengayakan dan pemipetan. Hasil penelitian didapat bahwa kandungan logam berat Cu lebih tinggi dibandingkan Pb dengan kandungan Cu 2,3-11,6mg/kg dan...

  20. ANALISIS FAKTOR PEMANFAATAN POLINDES MENURUT KONSEP MODEL PERILAKU KESEHATAN ”ANDERSON” (Analisis Lanjut Data RISKESDAS 2007

    Directory of Open Access Journals (Sweden)

    Astridya Paramita

    2013-11-01

    dari kajian analisis lanjut data sekunder Riset Kesehatan Dasar (Riskesdas 2007. Tehnik analisis yang digunakan adalah uji chi square dan regresi logistik multiple untuk memperoleh gambaran hubungan antara karakteristik, status sosial rumah tangga, dan kemudahan akses Polindes terhadap pemanfaatan Polindes. Hasil kajian menunjukkan pemanfaaatan Polindes oleh rumah tangga di Indonesia masih rendah dengan alasan tidak butuh pelayanan Polindes. Uji Chi Square menunjukkan terdapat hubungan bermakna antara jarak tempuh, waktu tempuh, klasifikasi desa, pengeluaran per kapita, pekerjaan, pendidikan, dan umur kepala rumah tangga terhadap pemanfaatan Polindes. Hasil uji regresi logistik multiple menunjukkan adanya kecenderungan pemanfaatan Polindes oleh rumah tangga berdasarkan jarak tempuh, waktu tempuh, klasifikasi desa, pengeluaran per kapita, pekerjaan, pendidikan dan umur kepala rumah tangga. Kesimpulan yang dapat diambil dari tulisan ini adalah Polindes lebih tepat didesain untuk kelompok rumah tangga pra sejahtera, berpendidikan rendah, bermata pencaharian petani atau nelayan, dan berlokasi di pedesaan atau daerah terpencil dengan keterbatasan alat transportasi. Kata kunci: karakteristik dan status sosial rumah tangga, aksesibilitas Polindes, pemanfaatan Polindes

  1. Tissue factor deficiency increases alveolar hemorrhage and death in influenza A virus-infected mice.

    Science.gov (United States)

    Antoniak, S; Tatsumi, K; Hisada, Y; Milner, J J; Neidich, S D; Shaver, C M; Pawlinski, R; Beck, M A; Bastarache, J A; Mackman, N

    2016-06-01

    Essentials H1N1 Influenza A virus (IAV) infection is a hemostatic challenge for the lung. Tissue factor (TF) on lung epithelial cells maintains lung hemostasis after IAV infection. Reduced TF-dependent activation of coagulation leads to alveolar hemorrhage. Anticoagulation might increase the risk for hemorrhages into the lung during severe IAV infection. Background Influenza A virus (IAV) infection is a common respiratory tract infection that causes considerable morbidity and mortality worldwide. Objective To investigate the effect of genetic deficiency of tissue factor (TF) in a mouse model of IAV infection. Methods Wild-type mice, low-TF (LTF) mice and mice with the TF gene deleted in different cell types were infected with a mouse-adapted A/Puerto Rico/8/34 H1N1 strain of IAV. TF expression was measured in the lungs, and bronchoalveolar lavage fluid (BALF) was collected to measure extracellular vesicle TF, activation of coagulation, alveolar hemorrhage, and inflammation. Results IAV infection of wild-type mice increased lung TF expression, activation of coagulation and inflammation in BALF, but also led to alveolar hemorrhage. LTF mice and mice with selective deficiency of TF in lung epithelial cells had low basal levels of TF and failed to increase TF expression after infection; these two strains of mice had more alveolar hemorrhage and death than controls. In contrast, deletion of TF in either myeloid cells or endothelial cells and hematopoietic cells did not increase alveolar hemorrhage or death after IAV infection. These results indicate that TF expression in the lung, particularly in epithelial cells, is required to maintain alveolar hemostasis after IAV infection. Conclusion Our study indicates that TF-dependent activation of coagulation is required to limit alveolar hemorrhage and death after IAV infection. © 2016 International Society on Thrombosis and Haemostasis.

  2. Relationship of distraction rate with inferior alveolar nerve degeneration-regeneration shift

    Directory of Open Access Journals (Sweden)

    Ying-hua Zhao

    2018-01-01

    Full Text Available Distraction osteogenesis is an important technique for the treatment of maxillofacial abnormities and defects. However, distraction osteogenesis may cause the injury of the inferior alveolar nerve. The relationship between distraction rate and nerve degeneration-regeneration shift remains poorly understood. In this study, 24 rabbits were randomly divided into four groups. To establish the rabbit mandibular distraction osteogenesis model, the mandibles of rabbits in distraction osteogenesis groups were subjected to continuous osteogenesis distraction at a rate of 1.0, 1.5 and 2.0 mm/d, respectively, by controlling rounds of screwing each day in the distractors. In the sham group, mandible osteotomy was performed without distraction. Pin-prick test with a 10 g blunt pin on the labium, histological and histomorphometric analyses with methylene blue staining, Bodian's silver staining, transmission electron microscopy and myelinated fiber density of inferior alveolar nerve cross-sections were performed to assess inferior alveolar nerve conditions. At 28 days after model establishment, in the pin-prick test, the inferior alveolar nerve showed no response in the labium to a pin pricks in the 2 mm/d group, indicating a severe dysfunction. Histological and histomorphometric analyses indicated that the inferior alveolar nerve suffered more degeneration and injuries at a high distraction rate (2 mm/d. Importantly, the nerve regeneration, indicated by newborn Schwann cells and axons, was more abundant in 1.0 and 1.5 mm/d groups than in 2.0 mm/d group. We concluded that the distraction rate was strongly associated with the inferior alveolar nerve function, and the distraction rates of 1.0 and 1.5 mm/d had regenerative effects on the inferior alveolar nerve. This study provides an experimental basis for the relationship between distraction rate and nerve degeneration-regeneration shift during distraction osteogenesis, and may facilitate reducing nerve

  3. Impact of SMOFLipid on Pulmonary Alveolar Development in Newborn Guinea Pigs.

    Science.gov (United States)

    Lavoie, Jean-Claude; Mohamed, Ibrahim; Nuyt, Anne-Monique; Elremaly, Wesam; Rouleau, Thérèse

    2018-03-13

    Parenteral nutrition (PN) is associated with bronchopulmonary dysplasia in premature infants. In animals, PN leads to alveolar loss following stimulation of apoptosis by oxidative stress (oxidized redox potential). Peroxides and aldehydes generated in PN can induce hypo-alveolarization. The implication of peroxides, which is reduced by light protection, is demonstrated. The implication of aldehydes from omega-6 fatty acids oxidation is expected. The hypothesis is that composition and light exposure of PN influences bronchopulmonary dysplasia development. Since SMOFLipid (SMOF) contains a lower amount of omega-6 fatty acids than Intralipid (IL), the aim was to compare, the impacts of PN compounded with SMOF or IL, photo-protected or not, on alveolar development. Three-day-old Guinea pigs received PN, photo-protected or not, made with SMOF or IL through a jugular vein catheter. After 4 days, lungs were sampled for determinations of redox potential of glutathione, apoptosis (caspase-3, caspase-8, and caspase-9) and alveolarization index (histology: number of intercepts/mm). Compared with IL, SMOF induces a greater oxidation of redox potential (-200 ± 1 versus [vs] -205 ± 1 mV), apoptosis (caspase-3: 0.27 ± 0.04 vs 0.16 ± 0.02; caspase-9: 0.47 ± 0.03 vs 0.30 ± 0.03), and a lower alveolarization index (27.2 ± 0.8 vs 30.0 ± 0.9). Photo-protection prevented activation of caspase-9 and was statistically without effect on redox potential, caspase-3, and alveolarization index. In our model, SMOF is pro-oxidant and induces hypo-alveolarization following exaggerated apoptosis. These results highlight the need for further studies before introducing SMOFLipid in standard neonatal care. (Nutr Clin Pract. 2018;xx:xx-xx). © 2018 American Society for Parenteral and Enteral Nutrition.

  4. Alveolocapillary model system to study alveolar re-epithelialization

    Energy Technology Data Exchange (ETDEWEB)

    Willems, Coen H.M.P.; Zimmermann, Luc J.I.; Sanders, Patricia J.L.T.; Wagendorp, Margot; Kloosterboer, Nico [Department of Paediatrics, School for Oncology and Developmental Biology (GROW), Maastricht University Medical Centre, Maastricht (Netherlands); Cohen Tervaert, Jan Willem [Division of Clinical and Experimental Immunology, Department of Internal Medicine, Maastricht University Medical Centre, Maastricht (Netherlands); Duimel, Hans J.Q.; Verheyen, Fons K.C.P. [Electron Microscopy Unit, Department of Molecular Cell Biology, Maastricht University Medical Centre, Maastricht (Netherlands); Iwaarden, J. Freek van, E-mail: f.vaniwaarden@maastrichtuniversity.nl [Department of Paediatrics, School for Oncology and Developmental Biology (GROW), Maastricht University Medical Centre, Maastricht (Netherlands)

    2013-01-01

    In the present study an in vitro bilayer model system of the pulmonary alveolocapillary barrier was established to investigate the role of the microvascular endothelium on re-epithelialization. The model system, confluent monolayer cultures on opposing sides of a porous membrane, consisted of a human microvascular endothelial cell line (HPMEC-ST1.6R) and an alveolar type II like cell line (A549), stably expressing EGFP and mCherry, respectively. These fluorescent proteins allowed the real time assessment of the integrity of the monolayers and the automated analysis of the wound healing process after a scratch injury. The HPMECs significantly attenuated the speed of re-epithelialization, which was associated with the proximity to the A549 layer. Examination of cross-sectional transmission electron micrographs of the model system revealed protrusions through the membrane pores and close contact between the A549 cells and the HPMECs. Immunohistochemical analysis showed that these close contacts consisted of heterocellular gap-, tight- and adherens-junctions. Additional analysis, using a fluorescent probe to assess gap-junctional communication, revealed that the HPMECs and A549 cells were able to exchange the fluorophore, which could be abrogated by disrupting the gap junctions using connexin mimetic peptides. These data suggest that the pulmonary microvascular endothelium may impact the re-epithelialization process. -- Highlights: ► Model system for vital imaging and high throughput screening. ► Microvascular endothelium influences re-epithelialization. ► A549 cells form protrusions through membrane to contact HPMEC. ► A549 cells and HPMECs form heterocellular tight-, gap- and adherens-junctions.

  5. Human Alveolar Echinococcosis in Poland: 1990–2011

    Science.gov (United States)

    Nahorski, Wacław L.; Knap, Józef P.; Pawłowski, Zbigniew S.; Krawczyk, Marek; Polański, Jerzy; Stefaniak, Jerzy; Patkowski, Waldemar; Szostakowska, Beata; Pietkiewicz, Halina; Grzeszczuk, Anna; Felczak-Korzybska, Iwona; Gołąb, Elżbieta; Wnukowska, Natalia; Paul, Małgorzata; Kacprzak, Elżbieta; Sokolewicz-Bobrowska, Elżbieta; Niścigorska-Olsen, Jolanta; Czyrznikowska, Aleksandra; Chomicz, Lidia; Cielecka, Danuta; Myjak, Przemysław

    2013-01-01

    Background Alveolar echinococcosis (AE) caused by Echinococcus multilocularis infections is a dangerous old disease in the Northern Hemisphere. The aim of the paper was to collect and analyze data on human AE in Poland in the last two decades. Methodology/Principal Findings The sources of data were both the cases officially registered and detected by an active field and laboratory surveillance. The cases were verified by clinical, epidemiological, and laboratory criteria. Altogether 121 human cases of AE were detected. Among these 83 (68,6%) cases were classified as confirmed, 16 as probable and 22 as possible. During the two decades a continuous increase in detection rate was noticed. The cases were 6–82 years old at the time of diagnosis (mean - 47.7 years). Sex ratio M/F was 0.86/1.0. The AE was fatal in 23 (19%) patients (mean age at death - 54.1 years). Family agglomeration of AE was found in 4 foci, involving 9 patients. Seventy six of the cases were diagnosed in an advanced stage of disease. In all cases the liver was the primary location of AE. In 30 (24.8%) patients a spread to other organs was observed. Ninety four of the patients were treated with albendazole. In 73 (60%) patients a surgical operation was performed, including 15 liver transplantations. Conclusions/Significance The studies confirmed that AE is an emerging disease in Poland, which is the fourth country in Europe with over 120 cases detected. The results also indicate the need of a wider national programme for implementation of screening in the highest AE risk areas (north-eastern Poland) with an effort to increase the public awareness of the possibility of contracting E. multilocularis, and above all, training of the primary care physicians in the recognition of the risk of AE to allow for an early detection of this dangerous disease. PMID:23301116

  6. The inferior alveolar artery in the mandibular canal

    International Nuclear Information System (INIS)

    Kato, Hisanao

    1991-01-01

    The present study investigated the course of the inferior alveolar artery (IAA) of the mandibular canal (MC), as well as morphological structure of the vascular wall, and the effects of Co-60 gamma irradiation on it. Male Sprague-Dawley strain 7-week-old rats were used as experimental animals. Histopathological changes in the vascular wall were observed by both light and electron microscopy. A single gamma irradiation of 17.82 Gy (TDF 100), 27.97 Gy (TDF 200), or 36.41 Gy (TDF 300) was given to the mandibular area. The IAA/MC ratio on the cross section was 3.4% at the mandibular foramen, 0.1% at the area between the second and third molar teeth, and 0.1% at the mental foramen. The corresponding diameters for these sites were 100 μm, 30 μm, and 20 μm. Morphological examination revealed IAA to be the muscular type of artery. Trichrome staining revealed three layers, including the lamina intima (1.4 μm), lamina media (13.3 μm), and lamina adventitia (11.2 μm). Dilatation of IAA occurred immediately after irradiation, followed by marked contraction on Day 3 after irradiation in the 17.82 Gy group, on Day 5 in the 27.97 Gy group, and on Day 7 in the 36.41 Gy group. During the period between Weeks 2 and 7, however, the 17.82 Gy group showed IAA dilatation. None of radiation injuries, such as rupture, necrosis and stenosis, was seen, but both vacuolation of the lamina intima and media, and irregular arrangement of the fibrous layer were seen. The vasculonervous bundle in MC seemed to be supported with fibrous connective tissues, suggesting an effective buffer effect on the dilatation of the vascular wall and the resistance to traumatic injuries. (N.K.)

  7. Computed tomography of the alveolar bone; Computertomographie des Alveolarkammes

    Energy Technology Data Exchange (ETDEWEB)

    Schueller, H. [Bonn Univ. (Germany). Radiologische Klinik

    1996-03-01

    In addition to the conventional radiological methods used in odontology, computed tomography (CT) provides superposition-free images of the mandible and maxilla. Its value has been proved not only in cases of malignancy but also in many other problems. If an examination is performed with a slice thickness of less than 1.5 mm, the form and position of retained teeth in the alveolar bone, as well as subsequent lesions of neighboring permanent teeth, can be visualized so that early treatment can be planned. If the parodontal space of a retained tooth is visible, orthodontic intervention is possible. Precise assessment of horizontal or vertical bone loss is essential in inflammatory dental diseases. The morphology and extent of benign cystic lesions are also shown by CT. With CT surgical strategy of an intended implant therapy can take into account the remaining bone substance and the exact position of nerves and foramina. If such therapy is possible, the location, form and number of implants are easily defined. (orig.) [Deutsch] Die Computertomographie ermoeglicht in Ergaenzung zu den in der Zahnheilkunde gebraeuchlichen radiologischen Untersuchungsverfahren eine ueberlagerungsfreie Darstellung von Ober- und Unterkiefer. Neben der bereits etablierten Anwendung der CT bei malignen Erkrankungen hat sich ihr Einsatz bei weiteren Fragestellungen bewaehrt. Wird die Untersuchung mit einer Schichtdicke von weniger als 1,5 mm durchgefuehrt, lassen sich Form und Lage retinierter Zaehne im Kieferknochen und die durch die retinierten Zaehne verursachten Schaeden an bleibenden Zaehnen beurteilen, so dass eine fruehzeitige Therapie moeglich ist. Laesst sich der Parodontalspalt des retinierten Zahnes abgrenzen, ist eine kieferorthopaedische Einordnung moeglich. Bei entzuendlichen Zahnerkrankungen ist der horizontale und vertikale Knochenabbau genau zu bestimmen. Die Morphologie und Ausdehnung von benignen zystischen Raumforderungen ist mit der CT erfassbar. Vor einer beabsichtigten

  8. Pathogenetics of alveolar capillary dysplasia with misalignment of pulmonary veins.

    Science.gov (United States)

    Szafranski, Przemyslaw; Gambin, Tomasz; Dharmadhikari, Avinash V; Akdemir, Kadir Caner; Jhangiani, Shalini N; Schuette, Jennifer; Godiwala, Nihal; Yatsenko, Svetlana A; Sebastian, Jessica; Madan-Khetarpal, Suneeta; Surti, Urvashi; Abellar, Rosanna G; Bateman, David A; Wilson, Ashley L; Markham, Melinda H; Slamon, Jill; Santos-Simarro, Fernando; Palomares, María; Nevado, Julián; Lapunzina, Pablo; Chung, Brian Hon-Yin; Wong, Wai-Lap; Chu, Yoyo Wing Yiu; Mok, Gary Tsz Kin; Kerem, Eitan; Reiter, Joel; Ambalavanan, Namasivayam; Anderson, Scott A; Kelly, David R; Shieh, Joseph; Rosenthal, Taryn C; Scheible, Kristin; Steiner, Laurie; Iqbal, M Anwar; McKinnon, Margaret L; Hamilton, Sara Jane; Schlade-Bartusiak, Kamilla; English, Dawn; Hendson, Glenda; Roeder, Elizabeth R; DeNapoli, Thomas S; Littlejohn, Rebecca Okashah; Wolff, Daynna J; Wagner, Carol L; Yeung, Alison; Francis, David; Fiorino, Elizabeth K; Edelman, Morris; Fox, Joyce; Hayes, Denise A; Janssens, Sandra; De Baere, Elfride; Menten, Björn; Loccufier, Anne; Vanwalleghem, Lieve; Moerman, Philippe; Sznajer, Yves; Lay, Amy S; Kussmann, Jennifer L; Chawla, Jasneek; Payton, Diane J; Phillips, Gael E; Brosens, Erwin; Tibboel, Dick; de Klein, Annelies; Maystadt, Isabelle; Fisher, Richard; Sebire, Neil; Male, Alison; Chopra, Maya; Pinner, Jason; Malcolm, Girvan; Peters, Gregory; Arbuckle, Susan; Lees, Melissa; Mead, Zoe; Quarrell, Oliver; Sayers, Richard; Owens, Martina; Shaw-Smith, Charles; Lioy, Janet; McKay, Eileen; de Leeuw, Nicole; Feenstra, Ilse; Spruijt, Liesbeth; Elmslie, Frances; Thiruchelvam, Timothy; Bacino, Carlos A; Langston, Claire; Lupski, James R; Sen, Partha; Popek, Edwina; Stankiewicz, Paweł

    2016-05-01

    Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes LINC01081 and LINC01082. Using custom-designed array comparative genomic hybridization, Sanger sequencing, whole exome sequencing (WES), and bioinformatic analyses, we studied 22 new unrelated families (20 postnatal and two prenatal) with clinically diagnosed ACDMPV. We describe novel deletion CNVs at the FOXF1 locus in 13 unrelated ACDMPV patients. Together with the previously reported cases, all 31 genomic deletions in 16q24.1, pathogenic for ACDMPV, for which parental origin was determined, arose de novo with 30 of them occurring on the maternally inherited chromosome 16, strongly implicating genomic imprinting of the FOXF1 locus in human lungs. Surprisingly, we have also identified four ACDMPV families with the pathogenic variants in the FOXF1 locus that arose on paternal chromosome 16. Interestingly, a combination of the severe cardiac defects, including hypoplastic left heart, and single umbilical artery were observed only in children with deletion CNVs involving FOXF1 and its upstream enhancer. Our data demonstrate that genomic imprinting at 16q24.1 plays an important role in variable ACDMPV manifestation likely through long-range regulation of FOXF1 expression, and may be also responsible for key phenotypic features of maternal uniparental disomy 16. Moreover, in one family, WES revealed a de novo missense variant in ESRP1, potentially implicating FGF signaling in the etiology of ACDMPV.

  9. Effect of single and contiguous teeth extractions on alveolar bone remodeling: a study in dogs.

    Science.gov (United States)

    Al-Askar, Mansour; O'Neill, Rory; Stark, Paul C; Griffin, Terrence; Javed, Fawad; Al-Hezaimi, Khalid

    2013-08-01

    Tooth extraction is associated with dimensional changes in the alveolar ridge. The aim was to examine the effect of single versus contiguous teeth extractions on the alveolar ridge remodeling. Five female beagle dogs were randomly divided into three groups on the basis of location (anterior or posterior) and number of teeth extracted - exctraction socket classification: group 1 (one dog): single-tooth extraction; group 2 (two dogs): extraction of two teeth; and group 3 (two dogs): extraction of three teeth in four anterior sites and four posterior sites in both jaws. The dogs were sacrificed after 4 months. Sagittal sectioning of each extraction site was performed and evaluated using microcomputed tomography. Buccolingual or palatal bone loss was observed 4 months after extraction in all three groups. The mean of the alveolar ridge width loss in group 1 (single-tooth extraction) was significantly less than those in groups 2 and 3 (p < .001) (multiple teeth extraction). Three-teeth extraction (group 3) had significantly more alveolar bone loss than two-teeth extraction (group 2) (p < .001). The three-teeth extraction group in the upper and lower showed more obvious resorption on the palatal/lingual side especially in the lower group posterior locations. Contiguous teeth extraction caused significantly more alveolar ridge bone loss as compared with when a single tooth is extracted. © 2011 Wiley Periodicals, Inc.

  10. In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Dao-Cai [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Department of Stomatology, The 291st Hospital of P.L.A, Baotou (China); Li, De-Hua [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Ji, Hui-Cang [Military Sanatorium of Retired Cadres, Baotou (China); Rao, Guo-Zhou [Center of Laboratory, School of Stomatology, Xi' an Jiaotong University, Xi' an (China); Liang, Li-Hua [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Ma, Ai-Jie [Xi' an Technology University, Xi' an (China); Xie, Chao; Zou, Gui-Ke; Song, Ying-Liang [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China)

    2012-04-05

    In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones.

  11. [Establishment and experimental study of alveolar preservation before dental implantation in Beagle dogs].

    Science.gov (United States)

    Han, Xue-song; Li, Xiu-juan; Huang, Yuan-liang; Zhu, Guo-guang; You, Su-lan; Tan, Luan-jun

    2013-02-01

    To establish the model of alveolar ridge preservation after tooth extraction for dental implant replacement, and to observe the effect of tissue engineered bone on osseointegration. Isolated BMSCs were expanded and osteogenically induced in vitro. The tissue engineering complex was constructed with BMSCs/A-PCPC in vitro. Six extraction sockets, with three on each side, were created in the mandibles of four Beagle dogs by extracting the second, third and fourth premolars. BMSCs/A-PCPC were placed on one side of the extraction sockets, while autogenous bone, A-PCPC and nothing were placed on the other side as control. X-ray and CT scans were conducted 1day, 4 and 12 weeks after operation to detect the change of the alveolar ridge. The bone of sockets were harvested at 8-week post-implantation and subject to histological for evaluating. SPSS17.0 software package was used for data analysis. Radiographs demonstrated higher radiodensity in group of complex than in simple materials group, autogenous bone group after 4 weeks. Hard tissue biopsy at 12-week showed that bone activity of BMSCs/A-PCPC complex was better than the other groups. Spiral CT analysis showed that alveolar ridge of each group experienced a certain degree of absorption. At 12-week, the alveolar ridge height reduction values in A-PCPC group was smaller than in A-PCPC group, autogenous bone group and blank group (Ppreservation of alveolar ridge.

  12. Preclinical Testing of Erlotinib in a Transgenic Alveolar Rhabdomyosarcoma Mouse Model

    Directory of Open Access Journals (Sweden)

    Jinu Abraham

    2011-01-01

    Full Text Available Rhabdomyosarcoma is an aggressive childhood malignancy, accounting for more than 50% of all soft-tissue sarcomas in children. Even with extensive therapy, the survival rate among alveolar rhabdomyosarcoma patients with advanced disease is only 20%. The receptor tyrosine kinase Epidermal Growth Factor Receptor (EGFR has been found to be expressed and activated in human rhabdomyosarcomas. In this study we have used a genetically engineered mouse model for alveolar rhabdomyosarcoma (ARMS which faithfully recapitulates the human disease by activating the pathognomic Pax3:Fkhr fusion gene and inactivating p53 in the maturing myoblasts. We have demonstrated that tumors from our mouse model of alveolar rhabdomyosarcoma express EGFR at both the mRNA and protein levels. We then tested the EGFR inhibitor, Erlotinib, for its efficacy in this mouse model of alveolar rhabdomyosarcoma. Surprisingly, Erlotinib had no effect on tumor progression, yet mice treated with Erlotinib showed 10–20% loss of body weight. These results suggest that EGFR might not be an a priori monotherapy target in alveolar rhabdomyosarcoma.

  13. Depletion of alveolar macrophages in CD11c diphtheria toxin receptor mice produces an inflammatory response

    Science.gov (United States)

    Roberts, Lydia M; Ledvina, Hannah E; Tuladhar, Shraddha; Rana, Deepa; Steele, Shaun P; Sempowski, Gregory D; Frelinger, Jeffrey A

    2015-01-01

    Alveolar macrophages play a critical role in initiating the immune response to inhaled pathogens and have been shown to be the first cell type infected following intranasal inoculation with several pathogens, including Francisella tularensis. In an attempt to further dissect the role of alveolar macrophages in the immune response to Francisella, we selectively depleted alveolar macrophages using CD11c.DOG mice. CD11c.DOG mice express the diphtheria toxin receptor (DTR) under control of the full CD11c promoter. Because mice do not express DTR, tissue restricted expression of the primate DTR followed by treatment with diphtheria toxin (DT) has been widely used as a tool in immunology to examine the effect of acute depletion of a specific immune subset following normal development. We successfully depleted alveolar macrophages via intranasal administration of DT. However, alveolar macrophage depletion was accompanied by many other changes to the cellular composition and cytokine/chemokine milieu in the lung that potentially impact innate and adaptive immune responses. Importantly, we observed a transient influx of neutrophils in the lung and spleen. Our experience serves as a cautionary note to other researchers using DTR mice given the complex changes that occur following DT treatment that must be taken into account when analyzing data. PMID:26029367

  14. Barrier-protective effects of activated protein C in human alveolar epithelial cells.

    Directory of Open Access Journals (Sweden)

    Ferranda Puig

    Full Text Available Acute lung injury (ALI is a clinical manifestation of respiratory failure, caused by lung inflammation and the disruption of the alveolar-capillary barrier. Preservation of the physical integrity of the alveolar epithelial monolayer is of critical importance to prevent alveolar edema. Barrier integrity depends largely on the balance between physical forces on cell-cell and cell-matrix contacts, and this balance might be affected by alterations in the coagulation cascade in patients with ALI. We aimed to study the effects of activated protein C (APC on mechanical tension and barrier integrity in human alveolar epithelial cells (A549 exposed to thrombin. Cells were pretreated for 3 h with APC (50 µg/ml or vehicle (control. Subsequently, thrombin (50 nM or medium was added to the cell culture. APC significantly reduced thrombin-induced cell monolayer permeability, cell stiffening, and cell contraction, measured by electrical impedance, optical magnetic twisting cytometry, and traction microscopy, respectively, suggesting a barrier-protective response. The dynamics of the barrier integrity was also assessed by western blotting and immunofluorescence analysis of the tight junction ZO-1. Thrombin resulted in more elongated ZO-1 aggregates at cell-cell interface areas and induced an increase in ZO-1 membrane protein content. APC attenuated the length of these ZO-1 aggregates and reduced the ZO-1 membrane protein levels induced by thrombin. In conclusion, pretreatment with APC reduced the disruption of barrier integrity induced by thrombin, thus contributing to alveolar epithelial barrier protection.

  15. In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics

    International Nuclear Information System (INIS)

    Sun, Dao-Cai; Li, De-Hua; Ji, Hui-Cang; Rao, Guo-Zhou; Liang, Li-Hua; Ma, Ai-Jie; Xie, Chao; Zou, Gui-Ke; Song, Ying-Liang

    2012-01-01

    In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones

  16. Minimum alveolar concentration of isoflurane in green iguanas and the effect of butorphanol on minimum alveolar concentration.

    Science.gov (United States)

    Mosley, Craig A E; Dyson, Doris; Smith, Dale A

    2003-06-01

    To determine minimum alveolar concentration (MAC) of isoflurane in green iguanas and effects of butorphanol on MAC. Prospective randomized trial. 10 healthy mature iguanas. in each iguana, MAC was measured 3 times: twice after induction of anesthesia with isoflurane and once after induction of anesthesia with isoflurane and IM administration of butorphanol (1 mg/kg [0.45 mg/lb]). A blood sample was collected from the tail vein for blood-gas analysis at the beginning and end of the anesthetic period. The MAC was determined with a standard bracketing technique; an electrical current was used as the supramaximal stimulus. Animals were artificially ventilated with a ventilator set to deliver a tidal volume of 30 mL/kg (14 mL/lb) at a rate of 4 breaths/min. Mean +/- SD MAC values during the 3 trials (2 without and 1 with butorphanol) were 2.0 +/- 0.6, 2.1 +/- 0.6, and 1.7 +/- 0.7%, respectively, which were not significantly different from each other. Heart rate and end-tidal partial pressure of CO2 were also not significantly different among the 3 trials. Mean +/- SD heart rate was 48 +/- 10 beats/min; mean end-tidal partial pressure of CO2 was 22 +/- 10 mm Hg. There were no significant differences in blood-gas values for samples obtained at the beginning versus the end of the anesthetic period. Results suggest that the MAC of isoflurane in green iguanas is 2.1% and that butorphanol does not have any significant isoflurane-sparing effects.

  17. ANALISIS HOMOGENITAS DATA CURAH HUJAN TAHUNAN KOTA MAKASSAR

    Directory of Open Access Journals (Sweden)

    Wahidah Sanusi

    2016-12-01

    Full Text Available Abstract. Homogeneity Analysis Of Annual Rainfall Data Of Makassar City. Testing the homogeneity of rainfall series is often required in climate and hydrology studies to ensure that rainfall data can be used reliability. The objective of this study is to identify homogeneity of annual rainfall data for three rainfall stations in Makassar for the period from 1985 to 2014. These stations are Paotere station, station of Biring Romang, and station of  BBMKG region IV. Four tests for homogeneity were applied for each station. These tests include the Standard Normal Homogeneity (SNH test, Buishand Range (BR test, Pettitt test and the von Neumann Ratio test. The SNH, BR, and Pettitt tests indicate that there was no break point for all station, except at Paotere station, Pettitt test shows that there was a break point in 1994. However, based on four homogeneity tests, the results reveal that rainfall series of Makassar city is homogeneous. The study results are usefull information for rainfall modeling of Makassar city.Abstrak. Analisis Homogenitas Data Curah Hujan Tahunan Kota Makassar. Pengujian homogenitas data runtun curah hujan sering diperlukan dalam kajian iklim dan hidrologi untuk menjamin kehandalan data yang digunakan. Tujuan penelitian ini adalah untuk mendeteksi kehomogenan data jumlah curah hujan tahunan di tiga stasiun hujan di kota Makassar dalam kurun waktu 1985 hingga 2014. Ketiga stasiun hujan tersebut adalah stasiun Paotere, stasiun Biring Romang, dan stasiun BBMKG wilayah IV. Ada empat uji homogenitas yang digunakan pada setiap stasiun, yaitu uji Standard Normal Homogeneity (SNH, uji Rentang Buishand (BR, uji Pettitt, dan uji Rasio von Neumann. Uji SNH, BR, dan Pettitt menunjukkan bahwa tidak terjadi perubahan jumlah curah hujan tahunan pada semua stasiun kajian, kecuali di stasiun Paotere, uji Pettitt menunjukan bahwa telah terjadi perubahan pada tahun 1994. Namun demikian, berdasarkan empat uji homogenitas tersebut menunjukkan

  18. ANALISIS TRANSIEN PADA PASSIVE COMPACT MOLTEN SALT REACTOR (PCMSR

    Directory of Open Access Journals (Sweden)

    M. Makrus Imron

    2015-04-01

    Full Text Available Penggunaan bahan bakar cair berupa garam LiF-BeF2-ThF4-UF4 pada Passive Compact Molten Salt Reactor (PCMSR meyebabkan pengendalian daya pada PCMSR dapat dilakukan dengan mengendalikan laju aliran bahan bakar dan pendingin. Sedangkan dari sistem keselamatan, penggunaan bahan bakar cair menjadikan PCMSR memiliki karakter keselamatan melekat (inherent safety yang baik. Pada penelitian ini telah dilakukan analisis transien PCMSR pada tiga kondisi, yaitu: ketika terjadi perubahan laju aliran bahan bakar, ketika terjadi perubahan laju aliran pendingin dan ketika terdapat kegagalan pada sistem pelepasan panas (loss of heat sink. Penelitian dilakukan dengan memodelkan reaktor pada kondisi tunak menggunakan paket program. Standart Reactor Analysis Code (SRAC. Selanjutnya dari keluaran paket program SRAC diperoleh data data yang meliputi fluks netron,konstanta grup, kontanta peluran prekusor netron, fraksi netron kasip untuk perhitungan transien. Penelitian ini menunjukkan bahwa penurunan laju aliran bahan bakar sebesar 50 % dari laju bahan bakar sebelumnya, menyebabkan daya pada PCMSR turun menjadi 78 % dari daya sebelumnya. Dan penurunan laju aliran pendingin sebesar 50 % dari laju pendingin sebelumnya, menyebabkan daya pada PCMSR turun menjadi 63 % dari daya sebelumnya. Sedangkan pada saat terjadi loss of heat sink daya PCMSR menunjukkan penurunan. Kata kunci: PCMSR, transien, daya, laju aliran.   The use of liquid fuels in the form of molten salts LiF-BeF2-ThF4-UF4 in Passive Compact Molten Salt Reactor (PCMSR makes power control at PCMSR can be done by controlling the flow rate of fuel and coolant. In addition, from safety systems aspect, the use of liquid fuels makes PCMSR has good inherent safety characteristics. In this study transient analysis has been carried out on three conditions of PCMSR, namely when the fuel flow rate is changing, when the coolant flow rate is changing and when there is loss of heat sink condition. This research is

  19. ANALISIS PARITAS DAYA BELI KURS RUPIAH TERHADAP DOLLAR AMERIKA SERIKAT

    Directory of Open Access Journals (Sweden)

    Elysa Pernika Simanjuntak

    2017-06-01

    Full Text Available Penelitian ini bertujuan untuk menganalisis bagaimana penerapan teori paritas daya beli kurs Rupiah terhadap Dollar AS dalam jangka panjang maupun jangka pendek dan pengaruh tingkat inflasi, produk domestik bruto, jumlah uang beredar, dan cadangan devisa terhadap kurs Rp/USD dengan menggunakan alat analisis Error Correction Model Engle-Granger. Variabel dependen dalam penelitian ini adalah kurs, sedangkan variabel independennya adalah inflasi, produk domesti bruto, jumlah uang beredar, dan cadangan devisa. Hasil penelitian ini menunjukkan bahwa dalam jangka panjang maupun jangka pendek, teori paritas daya beli berlaku pada kurs Rupiah terhadap Dollar Amerika Serikat. Variabel independen secara bersama-sama berpengaruh terhadap kurs Rupiah dalam jangka pendek maupun jangka panjang kecuali variabel jumlah uang beredar tidak berpengaruh dalam jangka panjang dan cadangan devisa tidak berpengaruh terhadap kurs dalam jangka pendek. Rekomendasi dari penelitian ini adalah Bank Indonesia selaku bank sentral Republik Indonesia diharapkan lebih berhati- hati dalam mengambil kebijakan yang tepat demi menjaga kestabilan nilai tukar Rupiah. Salah satunya tetap mengawasi kebijakan yang ditetapkan pemerintah mengenai pemakaian Rupiah untuk seluruh transaksi dalam negeri.  This research aims to analyze how the application of the theory of purchasing power parity exchange rate of the Rupiah against the US Dollar in the long term and short term and influence the rate of inflation, GDP, money supply, and the foreign exchange reserves of the exchange rate of Rp/USD by using analytical tools Error Correction Model Engle-Granger. Dependent variable in this study is the exchange rate, while the independent variables are inflation, gross domestic product, money supply, and the foreign exchange reserves. The results of this study indicated that in the long term and short term, the theory of purchasing power parity exchange rate prevailing at the Rupiah against the US

  20. Evaluasi dan Analisis Dampak Program Corporate Social Responsibility Badak LNG

    Directory of Open Access Journals (Sweden)

    Hanes Utama

    2017-08-01

    Full Text Available Program CSR Badak LNG telah melibatkan masyarakat dalam proses perencanaan, pelaksanaan, sampai pada proses monitoring dan evaluasi. Hal ini tentu berdampak pada peningkatan kualitas program serta meningkatkan peran partisipasi masyarakat sebagai kelompok sasaran penerima program CSR. Tujuan dari penelitian ini adalah mengukur tingkat kepuasan masyarakat terhadap program CSR yang telah dijalankan dan mengevaluasi dampak program CSR yang telah dilakukan. Adapun metode yang digunakan adalah  melalui pendekatan kajian input, output, outcome dan impact melalui analisis Indeks Kepuasan Masyarakat, Importance Performance Analysis, dan Compass Sustainability Analysis. Hasil penelitian menunjukkan secara keseluruhan kepuasan masyarakat terhadap pelayanan program CSR Badak LNG menunjukkan parameter sangat baik. Tingkat kesesuaian antara kepuasan kinerja dengan tingkat kepentingan masyarakat masuk dalam kategori sangat baik. Indikator kejelasan petugas pendamping,  tanggung jawab petugas pendamping, kemampuan petugas pendamping,  kesopanan petugas pendamping, dan kepastian biaya pelayanan adalah indikator yang memiliki harapan tinggi dari masyarakat penerima manfaat, dan perusahaan memiliki kinerja yang sangat baik dalam hal tersebut. Dampak positif yang diterima dari  kegiatan CSR pada dimensi nature, wellbeing, economy, social di Kota Bontang sangat tinggi, di antaranya terjadinya peningkatan kualitas lingkungan, pemanfaatan potensi alam, peningkatan pendapatan masyarakat, pengentasan kemiskinan, peningkatan kemandirian UMKM, semakin dikenalnya kebudayaan masyarakat, dan tingginya tingkat kepuasan masyarakat terhadap kegiatan-kegiatan CSR Badak LNG. The CSR program from Badak LNG has been involving the society in the planning, implementation, monitoring and evaluation process. It has an impact to the improvement quality program and increase peoples participation as a CSR awardee. This research aims to measure the peoples satisfactory towards CSR

  1. ANALISIS KANDUNGAN GARAM GUNUNG ASAL KRAYAN KABUPATEN NUNUKAN KALIMANTAN TIMUR

    Directory of Open Access Journals (Sweden)

    Herman Herman

    2012-06-01

    Full Text Available Has been studied composition of mountain salt from Krayan, Nunukan, East Kalimantan. This study aims to determine the composition of the minerals contained in the  mountain salt. Mountain salt is obtained from wells Krayan District residents were further prepared for analysis using a technique using Atomic Absorption Spectrometer (AAS, further by looking at the pattern of X-ray Diffraction (XRD and Scanning electron microscopic (SEM. Based on the results obtained AAS has identified mineral deposits include: Na, K, Mg, Al, Cu, Zn, Fe, Ba, and Sr. From the results of XRD shows that the main peak of the salt Krayan shows major peaks for NaCl crystals with impurities such as KCl, CaCl2, MgCl2, and AlCl3. SEM observation showed that morphology of Krayan salt have cube shape which is the shape of NaCl crystals with space group Fm3m and lattice parameter (a 5.620 Å Keywords : Mountain Salt, krayan, AAS, XRD, SEM   Abstrak Telah dilakukan penelitian analisis kandungan garam gunung asal Krayan Kabupaten Nunukan Kalimantan Timur. Penelitian ini bertujuan untuk mengetahui komposisi mineral yang terkandung dalam garam gunung. Garam gunung diperoleh dari sumur warga Kecamatan Krayan yang selanjutnya dipreparasi untuk dianalisis dengan menggunakan menggunakan teknik Spektrometer Serapan Atom (SSA, selanjutnya dengan melihat pola Difraksi Sinar X (XRD, dan Scanning Elektron Microscopy (SEM. Berdasarkan hasil SSA telah diidentifikasi diperoleh kandungan mineral antara lain: Na, K, Mg, Al, Cu,  Zn, Fe, Ba, dan Sr. Dari hasil XRD terlihat bahwa puncak utama dari  garam krayan tersebut menunjukkan puncak utama untuk Kristal NaCl, dengan impurities antara lain KCl, CaCl2, MgCl2, dan AlCl3. Selain itu hal ini didukung pula oleh pengamatan SEM, bahwa morfologi SEM garam krayan memperlihatkan bentuk kristal kubus yang merupakan  bentuk dari  Kristal NaCl  dengan  grup ruang  Fm3m  dengan panjang  kisi kristal 5,620 Å. Kata Kunci : Garam Gunung, Krayan

  2. Evaluasi Konsumen di "RM. Pak Kardi" Pemalang dengan Analisis Diskriminan

    Directory of Open Access Journals (Sweden)

    Tuis Susanto

    2017-02-01

    Full Text Available Penelitian ini bertujuan mengetahui apakah ada perbedaan yang siqnifikan dalam variabel dependen (Y yang meliputi konsumen sering Beli (YO, Cukup (Y I dan Jarang Beli (Y2, serta bertujuan mengetahui perilaku konsumen yang benar-benar berbeda, perbedaan dalam  arti perilaku   mereka  sering  membeli, cukup dan jarang membeli. Metode analisis  yang digunakan adalah dengan Wilk's Lambda, Pairwise, F test. Canonical  corellation,   untuk  mencari ada dan tidak perbedaan antar group variabel dependen dan  menginterpretasikan     berdasarkan function at group centroid untuk mengetahui variabel independen mana yang   menjadi  faktor diskriminannya. Hasil yang didapat dari penelitian ini adalah  bahwa  variabel  menu  merupakan faktor pembeda (diskriminan.  Artinya konsumen grup (sering  beli,  cukup  dan jarang   beli  tidak terpengaruh   dengan  usia,  harga,  pendapatan,   dan pelayanan  yang  diberikan oleh RM. Pak Kardi ditunjukkan dengan tanda (+ padafunction I. Jadi  konsumen  yang  membeli  di RM. Pak  Kardi adalah  mereka  yang  benar-benar   menyukai menu  (masakan  khas kepiting RM. Pak Kardi.  Jarak antara  grup  Sering  Beli  dengan grup  Jarang   Beli  adalah yang  terbesar, yakni 7,350. Sedangkan jarak   terkecil   adalah antara grup  Cukup  dengan  grup  Jarang   Beli  (0.522. Dengan demikian dapat  dikatakan   bahwa  Konsumen   di grup  Sering  Beli paling berbeda  selera  Menu  masakannya. Sebaliknya   Menu yang  disukai  oleh  konsumen di RM. Pak Kardi yang termasuk konsumen Cukup mempunyai perbedaan yang  kecil dengan  mereka  yang jarang membeli

  3. Analisis Profil Daerah Kabupaten Klaten Tahun 2002-2005

    Directory of Open Access Journals (Sweden)

    Priyono Priyono

    2016-05-01

    Full Text Available Klaten Regency is a regency that owning very strategic situation, that is lay between 3 (three metropolis (Jogjakarta, Surakarta, and Semarang. This Regency is having immeasurable properties, there are agriculture area, tourism, mining, and so on. This condition is obliging that this regency have to make an inventarisation of their properties to make a profile so thisregency can make a good decision to their region especially to their peoples. This research use secondary data analisys that collected from region statistics and by collecting data from many related institution and than it can gives some resource balance of this sub-province. Topographic condition of Klaten Regency predominated with flat and landuse which is rice field areal still majority, designate that this area is compatible used for agriculture. This condition is proved with big paddy supply which reach 300 ton per year while other agriculture product just only about tens of thousand ton. Agriculture sector is a potential sector to buils but the condition is worsed by the degradation of rice field areal with 26 hectare per year and also the increasing of the amount of resident every year that is proving the high requirement of land. Besides agriculture, this sub-province is also supported with mine and tourism sector. Mining sector are stone, clay, and sand are caused by the location of this area is in volcanic hill side. Tourism sector also contribute big Region Original Income to this Regency which progressively mount every year. By 3 (three tourism object type, this sector can contribute Region Original Income equal to 773.674.000 rupiahs and supported with hotel facility, restaurant, and accessibility which mounting every year. However, amount of terminal which in this time there is not yet supported the demand.This Regency also experience of the increasing of economic sector, that is the financial that is the amount of Foreign Capital Proyect and Nation Capital Proyect

  4. ANALISIS FAKTOR-FAKTOR YANG MEMPENGARUHI IMPOR KAPAS DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Ari Budi Basuki

    2017-06-01

    Full Text Available Penelitian ini bertujuan untuk menganalisis pengaruh produksi kapas domestik, konsumsi kapas, GDP riil dan kurs rupiah ke dollar AS terhadap impor kapas. Jenis penelitian ini adalah penelitian kuantitatif dengan data time series berdasarkan tahun 1980-2013. Data diperoleh dari Indexmundi, International Monetary Fund dan United Nations Conference on Trade and Development (UNSCAD. Hasil analisis Error Correction Model (ECM menunjukkan bahwa variabel produksi kapas domestik dalam jangka pendek dan jangka panjang tidak berpengaruh terhadap impor kapas, variabel konsumsi kapas dalam jangka pendek dan jangka panjang berpengaruh positif terhadap impor kapas, variabel GDP riil dalam jangka pendek dan jangka panjang tidak berpengaruh terhadap impor kapas, dan variabel kurs rupiah terhadap dollar dalam jangka pendek dan jangka panjang tidak berpengaruh terhadap impor kapas. Kesimpulan dari penelitian ini adalah faktor produksi kapas, GDP riil dan kurs dalam jangka pendek dan jangka panjang tidak berpengaruh terhadap impor kapas, namun dalam jangka pendek dan jangka panjang faktor konsumsi kapas mempengaruhi impor kapas. Saran yang berkaitan dengan hasil penelitian ini adalah Pemerintah perlu meningkatkan total produksi kapas dalam negeri dengan cara mengembangkan penelitian dan pembenihan kapas dalam negeri termasuk jenis transgenic. Pemerintah perlu mengurangi penggunaan kapas terutama dengan cara mensubtitusi kapas tersebut dengan kapas sintetis This study aimed to analyze the influence of domestic cotton production, cotton consumption, real GDP and the exchange rate rupiah to the US dollar against the import of cotton. This research is a quantitative study with time series data based on years of 1980-2013. Data obtained from Indexmundi, International Monetary Fund and the United Nations Conference on Trade and Development (UNSCAD. Results of analysis Error Correction Model (ECM shows that domestic cotton production variables in the short term and the

  5. ANALISIS KELAYAKAN INVESTASI PENAMBAHAN MESIN FRAIS BARU PADA CV. XYZ

    Directory of Open Access Journals (Sweden)

    Febri Muhammad Rachadian

    2013-04-01

    Full Text Available Perkembangan teknologi sangat pesat sehingga dunia perindustrian harus mengikuti perkembangannya. Penerapan teknologi diharapkan dapat meningkatkan proses produksi sehingga dapat menghasilkan produk yang berkualitas. Pada industri pembuatan mesin cetak di CV XYZ, mesin-mesin yang digunakan telah hampir lebih dari 20 tahun. Ada indikasi bahwa mesin-mesin tersebut sudah lewat umur pakainya. Alternatif yang digunakan selama ini ialah penggantian komponen yang rusak. Peneliti ingin membandingkan alternative tersebut dengan  penambahan mesin frais baru. Untuk itu diperlukan analisis kelayakan investasi penambahan mesin baru. Dalam perkiraan kurun waktu 10 tahun dan suku bunganya 15 % dengan menggunakan NPV, penambahan mesin frais menarik sebesar Rp 461.201.000 dibandingkan penggantian komponen yang rusak sebesar Rp 211.227.000. Sebaliknya pada PBP, penggantian komponen yang rusak masih mengungguli dengan 1 tahun 4 bulan dibandingkan penambahan mesin frais baru selama 2 tahun 1 bulan. Begitupun juga PI penggantian komponen yang rusak masih menarik sebesar 4,2 dibandingkan PI penambahan mesin frais baru sebesar 2,56. Dapat disimpulkan bahwa dalam jangka waktu 10 tahun, alternatif penggantian komponen yang rusak masih lebih baik dibandingkan penambahan mesin frais baru. Namun, untuk investasi jangka panjang, mungkin saja alternatif penambahan mesin frais baru lebih menarik. Kata Kunci: penggantian komponen rusak, mesin frais baru, mesin cetak Abstract The rapid development of technology makes the world of industry must follow its development. Application of technology is expected to improve the production process so it can be produce a quality product. On the industrial manufacture of printing machines in CV XYZ, the machines have been used almost more than 20 years. There are indications that those machines passed the age lifetime. The alternatives that have been used during this time are the replacement of defective parts. Researchers wanted to

  6. Estudio histológico comparativo de la reparación ósea entre hueso alveolar y extra-alveolar en los cerdos sometidos a osteotomía con alta y baja velocidad, con refrigeración líquida Comparative study of bone repair between alveolar and extra-alveolar bone in pigs subjected to osteotomy at low speed and high speed with liquid refrigeration

    Directory of Open Access Journals (Sweden)

    Henrique José Baldo de Toledo

    2012-03-01

    Full Text Available Introducción: Teniendo en cuenta que el proceso de reparación ósea en los cerdos se muestra en una mayor proximidad entre las variables histológicas estudiadas en comparación con otros modelos biológicos, el presente estudio tenía como objetivo evaluar el proceso histológico de la reparación ósea de osteotomías realizadas en huesos alveolares y extra-alveolar, utilizando instrumentos rotatorios con refrigeración líquida. Material y método: Dieciocho cerdos Large White con peso comprendido entre 20 y 25Kg fueron divididos en tres grupos de seis animales cada uno, con cada grupo formado por tres animales para evaluar la reparación de osteotomías con baja y alta velocidades en el hueso alveolar y tres en área extra-alveolar en los períodos de estudio de 7, 14 y 28 días. Resultados: Se observó que en el hueso alveolar en los tiempos post-operatorio de 14 y 28 días, los mejores resultados de reparación fueron en las osteotomías realizadas con baja velocidad, mientras que en el período post-operatorio de siete días, los resultados con alta velocidad fueron ligeramente mejores tanto en áreas alveolares como extra-alveolares. Para la metodología utilizada, no se encontraron diferencias estadísticamente significativas en el proceso de reparación ósea alveolar y extra-alveolar. Conclusiones: El proceso de reparación, por medio de análisis microscópico en la región alveolar y extra-alveolar, son similares con mejores resultados observados en osteotomías hechas con taladros en baja velocidad en los tiempos de catorce y veintiocho días y en el post-operatorio de siete días, los resultados con taladros de alta velocidad y la refrigeración fueron ligeramente mejores. Los trabajos de investigación utilizando cerdos como modelo animal son perfectamente viables.Introduction: Taking into account the bone repair process in pigs has shown a greater similarity among the histological variables studied compared to other biological

  7. High resolution computed tomographic features of pulmonary alveolar microlithiasis

    International Nuclear Information System (INIS)

    Deniz, Omer; Ors, Fatih; Tozkoparan, Ergun; Ozcan, Ayhan; Gumus, Seyfettin; Bozlar, Ugur; Bilgic, Hayati; Ekiz, Kudret; Demirci, Necmettin

    2005-01-01

    Background: Pulmonary alveolar microlithiasis (PAM) is a rare, chronic lung disease with unknown etiology and with a nonuniform clinical course. Nonuniformity of clinical course might be related to the degree of pulmonary parenchymal alterations, which can be revealed with high resolution computed tomography (HRCT). However, HRCT findings of PAM were not fully described in the current literature. Aim: The aim of this study was to interpret and to contribute to describe HRCT findings of PAM and to investigate a correlation between profusion of micro nodules (MN) and pulmonary parenchymal alterations in patients with PAM. Material and methods: Ten male patients with PAM (mean age: 22 ± 3.2) were included into the study. HRCT images were assessed for patterns, distribution, and profusion of pulmonary abnormalities. Dividing the lungs into three zones, profusion of abnormalities was assessed. A profusion score (1-4) was given and the scores of each zone were then summed to obtain a global profusion score for HRCT ranging from 0 to 12. Also a parenchymal alteration score (PAS) was defined with respect to profusion of abnormalities. Chest X-rays were also scored. Results: All of ten patients with PAM had findings of interstitial lung disease in varying degrees on their HRCTs. HRCT findings of patients with PAM were as following: MN, parenchymal bands (PB), ground glass opacity (GGO) and, sub pleural interstitial thickening (SPIT) in 10 patients; interlobular septal thickening (ILST), in 9 patients; paraseptal emphysema (PSA) in 8 patients; centrilobular emphysema (CLA) in 7 patients; bronchiectasis (BE), confluent micro nodules (CMN) in 6 patients; peri bronchovascular interstitial thickening (PBIT) in 5 patients; panacinar emphysema (PANAA) in 3 patients; pleural calcification (PC) in 2 patients. A significant correlation between MN scores and PAS (r = 0.68, p = 0.031, MN scores and GGO scores (r = 0.69, p = 0.027) and, MN scores and CLA scores (r = 0.67, p = 0

  8. Long-term experience on surgical treatment of alveolar echinococcosis.

    Science.gov (United States)

    Buttenschoen, Klaus; Carli Buttenschoen, Daniela; Gruener, Beate; Kern, Peter; Beger, Hans G; Henne-Bruns, Doris; Reuter, Stefan

    2009-07-01

    Alveolar echinococcosis (AE) is life-threatening and reports on surgical procedures and results are rare, but essential. Longitudinal surveillance and long-term follow-up of patients surgically treated for AE during the periods 1982-1999 (group A) and 2000-2006 (group B). University hospital within an endemic area. The median (min-max) follow-up period was 141 (5-417) months. Forty-eight surgical procedures were performed in 36 patients with AE: 63% were partial resections of the liver (additional extrahepatic resection in ten of them), 17% just extrahepatic resections, 10% biliodigestive anastomosis, and 10% exploratory laparotomies. Seventy-five percent of the operations were first-time procedures, 25% done due to a relapse. Forty-two percent of the operations were estimated to be curative (R0), whereas 58% were palliative (R1, R2). All patients had additional medical treatment and periodical follow-up. Two out of 18 (11%) patients, estimated to have had curative surgery, developed a relapse 42 and 54 months later. R0-resection rates depended on the primary, neighboring, metastasis stage of AE (S1, 100%; S2, 100%; S3a, 33%; S3b, 27%; S4, 11%). During the period 2000-2006 elective radical surgery for AE was done only if a safe distance of at least 2 cm was attainable. This concept was associated with an increased R0-resection rate of 87% for group B compared to 24% for group A. Operative procedures done to control complicated courses of AE (jaundice, cholangitis, vascular compression, bacterial superinfection) have not been curative (R2) in 82% because the disease had spread into irresectable structures. Morbidity was 19%. All patients with curative resections are alive. Fifty-six percent of the patients with palliative treatment are alive as long as 14-237 months, 28% died from AE 164-338 months after diagnosis (late lethality), and 17% died due to others diseases 96-417 months after diagnosis of AE. One out of seven (14%) patients suffering from suppurative

  9. Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Price, Richard L; Harkins, Lualhati; Chiocca, Ennio A; Zhang, Paul J; Kurt, Habibe; Iwenofu, Obiajulu H

    2017-10-01

    Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that

  10. 1H MR spectroscopy characteristics of cerebral alveolar echinococcosis

    International Nuclear Information System (INIS)

    Wang Jian; Yibanu Abudureheman; Jiang Chunhui; Yao Weihong; Tian Xiongling; Zhang Deqing; Liu Chen; Liu Wenya; Wen Hao

    2014-01-01

    Objective: To investigate the characteristics of proton magnetic resonance spectroscopy ( 1 H MRS) in patients with cerebral alveolar echinococcosis (CAE). Methods: Thirteen patients with 33 lesions proven to be CAE histologically and clinically were examined by conventional MRI and 2D multi-voxel spectroscopy with a 3.0 T double gradient superconductivity magnetic resonance scanner. Concentrations of the metabolites containing N-acetyl-aspartic-acid (NAA), Choline (Cho), Creatine (Cr), lipids and lactic acid (Lip + Lac), myo-Inositol (mI) were detected and the value of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr, mI/Cr were calculated. The values of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr, mI/Cr were compared between the lesions and the contralateral normal brain parenchyma. Statistical analysis was performed using the Wilcoxon signed-rank test. Results: CAE 1 H MRS in the lesions was characterized by the decrease of Cho, NAA to varying degrees, and a visible lipid with or without lactate peak. Compared with the control group, the ratio of NAA/Cr was decreased markedly, whereas Cho/Cr, mI/Cr increased mildly and (Lip + Lac)/Cr increased markedly in the lesions. The medians and interquartile ranges of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr and mI/Cr in the lesions were: 1.88 (1.24-2.23), 1.32 (1.07-1.58), 32.96 (24.59-47.30) and 0.91 (0.67-1.08), respectively. The medians and interquartile ranges of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr and mI/Cr of control group were 0.84 (0.704-0.98), 2.00 (1.80-2.18), 0.90 (0.74-0.99) and 0.26 (0.18-0.31), respectively. There were statistically significant differences of the measures between the lesions and the control regions (Z=-5.932, -6.086, -6.946, -6.984, P<0.01). Conclusions: Multi-voxel 1 H MRS can reflect pathological characteristics of CAE. 1 H MRS provides metabolic information for diagnosis of CAE and may be a supplement to conventional magnetic resonance examination. (authors)

  11. Lung Metastasis of Primary Alveolar Soft-Part Sarcoma Occurring 20 Years after Initial Treatment

    Directory of Open Access Journals (Sweden)

    R. F. Falkenstern-Ge

    2013-01-01

    Full Text Available A 30-year old woman was referred to our center because of suspicion of a primary lung tumor of the right upper lobe. Histological examination of the lung lesion revealed lung metastasis of a previously treated alveolar soft part sarcoma of the musculus vastus medialis of the right femur, which was resected 20 years ago. Alveolar soft-part sarcoma is a rare malignant tumor that occurs most often in the soft tissue of lower limbs. It is a slow-growing malignant soft tissue tumor arising in muscle tissue, usually in young adults. Due to pleural and extensive mediastinal infiltration with bilateral lung metastases, a systemic treatment with chemotherapy doxorubicin and ifosfamide was initiated. Late metastases from previously treated alveolar part sarcoma should be considered in patients with suspicious lung lesions even if surgical treatment was performed a long time ago.

  12. Menopause-related oral alveolar bone resorption: a review of relatively unexplored consequences of estrogen deficiency.

    Science.gov (United States)

    Birkenfeld, L; Yemini, M; Kase, N G; Birkenfeld, A

    1999-01-01

    The alveolar processes of the maxilla and mandible provide the bony framework for tooth support. Osteoporotic changes of these bones may directly affect tooth stability and retention. This report reviews studies that have evaluated the relationship between systemic osteoporosis and oral alveolar bone mass as well as the effect of estrogen use on oral alveolar bone and tooth retention. Ten years (1989-1998) literature review. Studies reviewed demonstrate a positive correlation between systemic bone mass and systemic osteoporosis to oral bone resorption. Estrogen replacement therapy affects oral bone in a manner similar to the way it affects other sites. It is evident that postmenopausal estrogen users may retain more teeth after menopause. Sustained oral health and better tooth retention are potentially additional benefits for hormone replacement therapy users after menopause.

  13. Alveolar bone preservation subsequent to miniscrew implant placement in a canine model

    DEFF Research Database (Denmark)

    Melsen, Birte; Huja, Sarandeep; Chien, Hua-Hong

    2015-01-01

    -implant across the healing alveolar process results in increased density not only adjacent to the screws, but also in the region where a potential dental implant would be inserted. In humans, the insertion of transcortical screws may maintain bone when for various reasons insertion of a permanent dental implant......Abstract OBJECTIVE: To assess the effects of transcortical screws on alveolar (bone) ridge preservation following extraction. DESIGN: Four adult beagle dogs had mandibular premolars extracted bilaterally. After 6 weeks, using a split-mouth design, two transcortical screws were inserted unilaterally...... below the alveolar crest on the experimental side in the region of the extraction. The dogs were killed after 12 weeks. The bone at the extraction sites was analyzed using μCT and 3D analysis. A cylindrical core was placed around the actual and a virtual screw placed in the identical location...

  14. An Experimental Study of Radiographic Density of Alveolar Bone and Cortical Thickness of Mandible by Osteoporosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Byeong Do [Dept. of Oral and Maxillofacial Radiology, School of Dentistry, Wonkwang University, Iksan (Korea, Republic of)

    2000-12-15

    To evaluate the effect of the systemic osteoporosis on radiographic density of alveolar bone and cortical thickness of mandible. The bone mineral density values of lumbar and femur were measured by dual-energy X-ray absorptiometry and T scores of lumbar, femur were obtained respectively. Radiographic densities of alveolar bones and panorama mandibular index (PMI, represents as cortical thickness) were analysed statistically according to age and T score variavles. The radiographic density of alveolar bone of maxillary molar showed significant difference by age and femur T group. That of mandibular molar showed significant difference between femur T group. Panorama mandibular index showed significant difference between age groups. The radiographic density of alvealar bones was more dependent on age femur T than lumbar T. Cortical thickness of mandible was correlated with increasing age.

  15. Placement of fin type dental implant in three different surgical situations of alveolar bone

    Directory of Open Access Journals (Sweden)

    Coen Pramono D

    2007-03-01

    Full Text Available Three different dental implant placements according to surgical implant bed situations were observed in its bone integration 3 months after dental implant insertion. This observation was done on implant system which has plateau or fin system. Elf implants were placed in the upper jaw in two patients. In case one, two implants were inserted immediately after tooth extraction, and the other six implants were placed in the alveolar crest regions in delayed implantation or in which the teeth had been extracted over 6 months of period. In case two, three implants were inserted in the post trauma region in the anterior maxilla, which the labial plate had been lost and reconstructed with bone grafting procedure using a mixture of alloplastic and autogenous bones. The alveolar reconstruction was needed to be performed due to only thin alveolar crest width was left intact. All of those implants observed showed in good integration.

  16. Legionella pneumonia associated with severe acute respiratory distress syndrome and diffuse alveolar hemorrhage - A rare association

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2017-01-01

    Full Text Available Legionella pneumophila is a common, usually underreported and undiagnosed cause of community acquired pneumonia which can lead to significant morbidity and mortality. Diffuse alveolar hemorrhage rarely have been associated with legionella infection. We present a 61-year-old man with hypertension, diabetes mellitus and obesity admitted with severe acute respiratory distress syndrome. He was found to have Legionella pneumonia with associated diffuse alveolar hemorrhage diagnosed with bronchoscopic sequential bronchoalveolar lavage. He was successfully managed with antibiotics, lung protective strategies and intravenous pulse dose steroids. This patient highlights the unusual association of Legionella infection and diffuse alveolar hemorrhage. Additionally, the case re-enforces the need for early and aggressive evaluation and management of patients presenting with pneumonia and progressive hypoxia despite adequate treatment.

  17. Pulmonary Alveolar Proteinosis and tuberculosis in a diabetic patient: a rare or a seldom diagnosed association

    Directory of Open Access Journals (Sweden)

    Pereira-Silva J.L.

    2002-01-01

    Full Text Available A case of Pulmonary Alveolar Proteinosis (PAP, in association with tuberculosis, is described in a 35-year-old diabetic patient. Lung biopsy showed an intra-alveolar accumulation of PAS-positive material, and multifocal granulomas compatible with tuberculosis. The bronchoalveolar culture was positive for Mycobacterium tuberculosis. PAP results from an imbalance of the mechanisms that regulate the homeostasis of the surfactant, where specific proteins are involved, especially SP-A and SP-D, the cytokines, IL-10 and GM-CSF, in addition to alveolar macrophages and type-II pneumocytes. Chemotaxis and phagocytic capacity are reduced. PAP and diabetes share several immunological disfunctions that may increase the risk for tuberculosis. Although there are no controlled studies, the diagnosis of PAP in diabetic patients with tuberculosis must be considered.

  18. Alveolar cleft bone grafts: results and imprecisions of the dental radiograph.

    Science.gov (United States)

    Lee, C; Crepeau, R J; Williams, H B; Schwartz, S

    1995-12-01

    Alveolar cleft bone grafts customarily have been evaluated by one-dimensional dental radiographic measurements. Based on the dental radiograph, remarkable successes with just a single bone graft have been reported in the literature. At the Montreal Children's Hospital, the experience with 101 alveolar bone grafts in 62 cleft lip and palate patients was retrospectively reviewed to determine (1) the precision of dental radiographs at evaluating the clinical outcome, (2) the effect of dental maturation on alveolar bone grafts, and (3) the effect of augmentation bone grafts. The dental radiograph significantly overestimated the number of clefts that could be managed orthodontically (p orthodontic closure of the dental gap. Bone grafts performed during the preeruptive canine dentition yielded significantly better results (p < 0.05, chi-squared test). With each subsequent augmentation bone-graft procedure performed, there existed a trend toward improved dental arch stability and radiographic and clinical outcomes.

  19. New regenerative treatment for tooth and periodontal bone defect associated with posttraumatic alveolar bone crush fracture.

    Science.gov (United States)

    Kiyokawa, Kensuke; Kiyokawa, Munekatsu; Takagi, Mikako; Rikimaru, Hideaki; Fukaya, Takuji

    2009-05-01

    We developed a new regenerative treatment of tooth and periodontal defect and tooth dislocation associated with posttraumatic alveolar bone crush fracture in the region of the maxillary anterior teeth. Using this method, dislocated teeth are first extracted and crushed alveolar bone is debrided. The dislocated teeth are then reimplanted, and cancellous iliac bone (bone marrow) is grafted to the area surrounding the teeth to regenerate periodontal bone. Tooth reimplantation was completely successful in 2 cases, and periodontal bone regenerated to a sufficient height with the iliac bone graft. Compared with the general method of treatment with a prosthesis (bridge), when using this method to treat cases such as these, there is no sacrifice of healthy teeth adjacent to the defect, and sufficient esthetic and functional recovery is possible. It is thought that this method could be applied as a new treatment of alveolar bone fracture in the future.

  20. PPAR{gamma} regulates the expression of cholesterol metabolism genes in alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S. [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Department of Microbiology and Immunology, East Carolina University (United States)

    2010-03-19

    Peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPAR{gamma} has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPAR{gamma} regulates cholesterol influx, efflux, and metabolism. PPAR{gamma} promotes cholesterol efflux through the liver X receptor-alpha (LXR{alpha}) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPAR{gamma} knockout (PPAR{gamma} KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXR{alpha} and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPAR{gamma} would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPAR{gamma}) to restore PPAR{gamma} expression in the alveolar macrophages of PPAR{gamma} KO mice. Our results show that the alveolar macrophages of PPAR{gamma} KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPAR{gamma} (1) induced transcription of LXR{alpha} and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPAR{gamma} regulates cholesterol metabolism in alveolar macrophages.

  1. Predictors of Alveolar Process Remodeling Following Ridge Preservation in High-Risk Patients.

    Science.gov (United States)

    Cosyn, Jan; Cleymaet, Roberto; De Bruyn, Hugo

    2016-04-01

    (1) To clinically evaluate horizontal remodeling of the alveolar process (hard and soft tissues) following ridge preservation in high-risk patients and (2) to identify predictors of such remodeling. Periodontally healthy nonsmoking patients with a failing tooth in the anterior maxilla (15-25) were selected for a prospective case series. All were in need of a single implant and demonstrated high risk for aesthetic complications given an incomplete buccal bone wall and/or thin-scalloped gingival biotype. Following flapless tooth extraction, ridge preservation was performed using one or more collagen-enriched, bovine-derived block grafts (Geistlich Bio-Oss® Collagen® 100 mg, Geistlich Pharma AG, Wolhusen, Switzerland) without the additional use of membranes or soft tissue grafts. The change in buccopalatal dimension of the alveolar process between baseline (prior to tooth extraction) and 4 months was assessed on the basis of superimposed occlusal slides. Regression analysis was performed to identify predictors of alveolar process remodeling. Forty-two patients (21 females, 21 males; mean age 38) met the selection criteria and consented to the treatment. Mean alveolar process remodeling was 14% (SD 7, range 4-30) with minimal remodeling (≤ 10%) in 16 patients (38%) and advanced remodeling (>20%) in 10 patients (24%). A single implant could be installed in all subjects without additional guided bone regeneration. Connective tissue grafting was performed later on in the treatment for aesthetic purposes, hereby compensating for tissue loss at the buccal aspect. Predictors of alveolar process remodeling were tooth location (central incisors and cuspids > laterals incisors and premolars), tooth abscess (p = .025), and buccal bone loss (p = .035). Alveolar process remodeling seems inevitable yet acceptable following ridge preservation in high-risk patients. Proper case selection may reduce the incidence of advanced remodeling. © 2014 Wiley Periodicals, Inc.

  2. Connexin 43 contributes to ectopic orofacial pain following inferior alveolar nerve injury.

    Science.gov (United States)

    Kaji, Kaori; Shinoda, Masamichi; Honda, Kuniya; Unno, Syumpei; Shimizu, Noriyoshi; Iwata, Koichi

    2016-01-01

    Clinically, it is well known that injury of mandibular nerve fiber induces persistent ectopic pain which can spread to a wide area of the orofacial region innervated by the uninjured trigeminal nerve branches. However, the exact mechanism of such persistent ectopic orofacial pain is not still known. The present study was undertaken to determine the role of connexin 43 in the trigeminal ganglion on mechanical hypersensitivity in rat whisker pad skin induced by inferior alveolar nerve injury. Here, we examined changes in orofacial mechanical sensitivity following inferior alveolar nerve injury. Furthermore, changes in connexin 43 expression in the trigeminal ganglion and its localization in the trigeminal ganglion were also examined. In addition, we investigated the functional significance of connexin 43 in relation to mechanical allodynia by using a selective gap junction blocker (Gap27). Long-lasting mechanical allodynia in the whisker pad skin and the upper eyelid skin, and activation of satellite glial cells in the trigeminal ganglion, were induced after inferior alveolar nerve injury. Connexin 43 was expressed in the activated satellite glial cells encircling trigeminal ganglion neurons innervating the whisker pad skin, and the connexin 43 protein expression was significantly increased after inferior alveolar nerve injury. Administration of Gap27 in the trigeminal ganglion significantly reduced satellite glial cell activation and mechanical hypersensitivity in the whisker pad skin. Moreover, the marked activation of satellite glial cells encircling trigeminal ganglion neurons innervating the whisker pad skin following inferior alveolar nerve injury implies that the satellite glial cell activation exerts a major influence on the excitability of nociceptive trigeminal ganglion neurons. These findings indicate that the propagation of satellite glial cell activation throughout the trigeminal ganglion via gap junctions, which are composed of connexin 43, plays a

  3. Myricetin Prevents Alveolar Bone Loss in an Experimental Ovariectomized Mouse Model of Periodontitis

    Directory of Open Access Journals (Sweden)

    Jialiang Huang

    2016-03-01

    Full Text Available Periodontitis is a common chronic inflammatory disease, which leads to alveolar bone resorption. Healthy and functional alveolar bone, which can support the teeth and enable their movement, is very important for orthodontic treatment. Myricetin inhibited osteoclastogenesis by suppressing the expression of some genes, signaling pathways, and cytokines. This study aimed to investigate the effects of myricetin on alveolar bone loss in an ovariectomized (OVX mouse model of periodontitis as well as in vitro osteoclast formation and bone resorption. Twenty-four healthy eight-week-old C57BL/J6 female mice were assigned randomly to four groups: phosphate-buffered saline (PBS control (sham OVX + ligature + PBS (vehicle, and OVX + ligature + low or high (2 or 5 mg∙kg−1∙day−1, respectively doses of myricetin. Myricetin or PBS was injected intraperitoneally (i.p. every other day for 30 days. The maxillae were collected and subjected to further examination, including micro-computed tomography (micro-CT, hematoxylin and eosin (H&E staining, and tartrate-resistant acid phosphatase (TRAP staining; a resorption pit assay was also performed in vitro to evaluate the effects of myricetin on receptor activator of nuclear factor κ-B ligand (RANKL-induced osteoclastogenesis. Myricetin, at both high and low doses, prevented alveolar bone resorption and increased alveolar crest height in the mouse model and inhibited osteoclast formation and bone resorption in vitro. However, myricetin was more effective at high dose than at low dose. Our study demonstrated that myricetin had a positive effect on alveolar bone resorption in an OVX mouse model of periodontitis and, therefore, may be a potential agent for the treatment of periodontitis and osteoporosis.

  4. Study of the inferior alveolar canal and mental foramen on digital panoramic images.

    Science.gov (United States)

    Pria, Carlos M; Masood, Farah; Beckerley, Joy M; Carson, Robert E

    2011-07-01

    To study the radiographic location of the mental foramen and appearance of the inferior alveolar canal and the relationship between image gray values and the clarity of inferior alveolar canal on the digital panoramic images and to evaluate if the histogram equalization of the digital image would improve the visualization of the inferior alveolar canal outline on the digital panoramic images in the mandible. Five hundred digital panoramic images were evaluated by two examiners using a specific inclusion criteria. Only the right side of the mandible was studied. Chi-square analyses were used for comparisons of distributions. Mean and median pixel values were analyzed separately with a one-way analysis of variance. Also, percentages were calculated to report the usefulness of the histogram equalization for visualization of canal. RESULTS show variation in location of mental foramen. Most frequent location of the mental foramen was reported as first and second premolar region. Chi-square analysis showed that the frequency of occurrence of the mental foramen was equally probable for any of the three locations. The study did not find significant usefulness of the gray values obtained from the histogram equalization in predicting the clarity of inferior alveolar canal outlines. Knowing the normal relationship and the anatomical variation of the maxillofacial structures for each patient is important for surgical implant treatment planning to avoid future complications. It is also important to be familiar with the advantages and limitations of diagnostic aids available before making treatment planning decisions based on such findings. Digital imaging, Panoramic, Inferior alveolar canal, Mental foramen. How to cite this article: Pria CM, Masood F, Beckerley JM, Carson RE. Study of the Inferior Alveolar Canal and Mental Foramen on Digital Panoramic Images. J Contemp Dent Pract 2011;12(4):265-271. Source of support: Nil Conflict of interest: None declared.

  5. ANALISIS PENGARUH KOMPENSASI DAN LINGKUNGAN KERJA TERHADAP KINERJA GURU DI SMA NEGERI 1 KLATEN

    Directory of Open Access Journals (Sweden)

    Rina Oktaviani

    2016-10-01

      Kompensasi merupakan faktor yang penting untuk meningkatkan kinerja karyawan. Lingkungan kerja, baik fisik maupun non-fisik juga merupakan variabel penting yang mempengaruhi secara langsung maupun tidak langsung terhadap kinerja karyawan dalam melaksanakan tugasnya. Penelitian ini dilakukan di SMA Negeri 1 Karangdowo Klaten Jawa Tengah, menggunakan penelitian kuantitatif. Sampel penelitian ini sama dengan populasi yaitu 62 guru. Metode analisis regresi berganda digunakan untuk menganalisis dampak kompensasi dan lingkungan kerja terhadap kinerja guru. Hasil analisis menunjukkan bahwa terdapat pengaruh yang signifikan dari kompensasi dan kondisi kerja terhadap kinerja guru dengan nilai R2 sebesar 0,642. Hal ini menunjukkan bahwa peningkatan kompensasi dan kondisi kerja akan meningkatkan kinerja guru.   Kata kunci: Kompensasi, Lingkungan Kerja, Dan Kinerja.

  6. Il Corso Sperimentale di Teoria e Analisi tenuto al Conservatorio di Messina

    Directory of Open Access Journals (Sweden)

    Francesco Scarpellini Pancrazi

    2014-10-01

    Full Text Available Il Corso Sperimentale di Teoria e Analisi tenuto al Conservatorio “Arcangelo Corelli” di Messina da Mario Musumeci compie in quest’anno accademico 1999/2000 il suo dodicesimo anno di età. Il corso gode di ottima salute ed è oggi uno dei fiori all’occhiello del Conservatorio messinese. Soprattutto rappresenta per gli allievi un punto fermo per l’adeguata comprensione del linguaggio musicale: subito messi di fronte al testo musicale, sono obbligati, di volta in volta, ad interagire attivamente con esso prendendo in considerazione tutti i suoi parametri, scomponendolo e ricomponendolo, anche con l’uso creativo e innovativo della corrupta lectio (la prassi del modificare l’oggetto in analisi per conferirgli una più precisa identità.

  7. ANALISIS KUALITAS REPRESENTASI VISUAL BUKU BIOLOGI SMA KELAS XI KURIKULUM 2013 PADA MATERI SEL

    Directory of Open Access Journals (Sweden)

    Vivi Sophie Elfada

    2015-07-01

    Full Text Available Representasi Visual (RV yang ditampilkan di dalam buku teks akan menambah nilai estetika buku, namun buku yang berkualis akan memperhatikan seluruh aspek tampilan buku agar bermanfaat dalam penyampaian materi, termasuk tampilan RV. Penggunaan RV yang tepat akan mempermudah pembaca dalam mempelajari konsep materi dan menghindari terjadinya miskonsepsi. Keberadaan RV sangat signifikan di dalam buku teks, oleh karena itu perlu adanya penelitian RV pada buku teks.Penelitian analisis RV bertujuan untuk mengetahui kualitas buku teks dari segi ketepatan RV yang digunakan di dalam buku teks. Analisis yang dilakukan meliputi: 1 ketepatan konsep; 2 tipe RV; 3 hubungan RV dengan konten materi; 4 hubungan RV dengan realitas; dan 5 fungsi RV. Buku teks yang dianalisis meliputi tiga penerbit buku kurikulum 2013 yaitu penerbit Erlangga  (buku sampel A, Platinum (buku sampel B, dan Yrama Widya (buku sampel C. Analisis RV yang dilakukan yaitu pada materi sel kelas XI semester I. Penelitian ini termasuk ke dalam penelitian kualitatif yang bersifat deskriptif. Instrumen yang digunakan pada penelitian ini ialah tabel daftar (list table yang terdiri dari tabel analisis ketepatan konsep dan tabel analisis RV. Konsep materi sel terlebih dahulu dianalisis, kemudian dilakukan analisis RV.   Penelitian menghasilkan data bahwa buku sampel yang memiliki ketepatan konsep memadai yang tertinggi ialah buku sampel A sebesar 65,85%. Buku sampel B memiliki ketepatan konsep memadai sebesar 51,22%, dan buku sampel C sebesar 41,46%. Buku sampel A, B, dan C ditinjau dari segi tipe RV, masing – masing sudah relatif tepat dalam menampilkan tipe RV karena disesuaikan dengan kebutuhan bacaan. Tipe RV buku sampel A, B, dan C yang tertinggi ialah tipe sketsa – komik sebesar 30,00% pada buku sampel A; 28,26% pada buku sampel B; dan  28,99% pada buku sampel C. Analisis hubungan RV dengan konten materi menghasilkan data bahwa Buku sampel B memiliki hubungan bermakna dengan konten

  8. Deteksi Kerusakan Batang Rotor Pada Motor Induksi Menggunakan Analisis Arus Mula Berbasis Hilbert Transform

    Directory of Open Access Journals (Sweden)

    Isti Qomah

    2017-01-01

    Full Text Available Kerusakan batang rotor merupakan salah satu jenis kerusakan pada motor induksi yang dapat menyebabkan masalah serius. Kerusakan tersebut dapat mencapai 5% - 10% dari seluruh kasus gangguan motor induksi. Oleh karena itu, perlu adanya diagnosis awal yang mendeteksi adanya gangguan pada rotor motor induksi, agar dapat dilakukan perbaikan lebih cepat dan tanggap sebelum terjadi gangguan yang lebih besar. Tugas Akhir ini membahas terkait teknik deteksi kerusakan batang rotor pada motor induksi dengan menggunakan analisis arus mula. Sistem yang digunakan berbasis  decomposition wavelet transform terlebih dahulu kemudian dilanjutkan dengan analisis berbasis hilbert transform sebagai perangkat pengolahan sinyal sehingga mampu mendeteksi motor dalam keadaan sehat atau mengalami kerusakan. Pengujian sistem dilakukan dalam beberapa kondisi, yaitu kondisi tanpa beban dan berbeban. Selain itu, kondisi yang diberikan adalah kecacatan mulai dai 1BRB hingga 3BRB. Hasil pengujian membuktikan bahwa decomposition wavelet transform dan Hilbert transform mampu mendeteksi perbedaan kondisi pada motor induksi normal ataupun rusak pada batang rotor.

  9. ANALISIS KEMAMPUAN DAN DAYA DUKUNG LAHAN UNTUK PENATAGUNAAN LAHAN SUBDAS DENGKENG DAS BENGAWAN SOLO

    Directory of Open Access Journals (Sweden)

    Senawi Senawi

    2016-10-01

    Full Text Available ABSTRAK Tujuan penelitian ini mengetahui kemampuan dan daya dukung lahan untuk penatagunaan lahan di Sub-DAS Dengkeng. Analisis kemampuan lahan dilakukan secara matching per satuan lahan hasil overlay peta kerniringan lahan dan jenis tanah. Karakteristik satuan lahan diperoleh dari survei di lapangan dan analisis tanah di laboratorium. Daya dukung lahan ditentukan berdasarkan nilai tekanan penduduk. Hasil penelitian menunjukkan Sub-DAS Dengkeng rnemiliki enarn kelas kemampuan lahan dan telah mengalami tekanan penduduk dengan nilai daya dukung lahan tahun 2004, 2007, dan 2012 menurun menjadi 0,69; 067 dan 0.65. Penatagunaan lahan untuk rehabilitasi lahan yang disarankan adalah nzerubah bentuk penggunaan lahan sawah tadah hujan, tegalan, dan perkebunan pada kelas kemampuan lahan I, III, dan IV menjadi lahan agroforestri, pada kelas kemampuan lahan VI menjadi hutan rakyat produksi biasa sedangkan pada kelas kemampuan lahan VII dan VIII menjadi hutan rakyat dengan fungsi lindung.

  10. Analisis Sifat Lasing Bahan Optical Amplifier untuk Sistem Komunikasi Optik Menggunakan Aplikasi Berbasis MATLAB

    Directory of Open Access Journals (Sweden)

    Rudi Susanto

    2017-09-01

    Full Text Available Artikel ini berisi tahapan pembuatan aplikasi dengan GUI Matlab yang digunakan untuk menganalis sifat lasing kaca tellurite yang didadah ion erbium dengan teori Judd Ofelt. Tahapan pembuatan aplikasi terdiri dari 1 analisis kebutuhan fungsional, 2 melakukan kajian formulasi model matematis judd ofelt, 3 membuat aplikasi perhitungan parameter judd ofelt dengan Matlab dan 4  Pengujian. Hasil pengujian menunjukkan rata rata error terbesar adalah 5,79% pada komposisi x=1,0 sedangkan rata rata error terkecil adalah 0,17% dari hasil ini aplikasi yang dibuat dapat digunakan untuk menganalis sifat lasing. Berdasarkan analisis parameter Judd Ofelt memiliki trend Ω2> Ω6> Ω4 yang bersesuaian dengan komposisi  lain yaitu TBZNbEr10, SALSFEr, LBTAFEr, TZN dan PKBAEr. Berdasarkan hal tersebut, kaca memiliki potensi untuk dikembangkan sebagai penguat optik dalam sistem komunikasi optik .

  11. The effect of therapeutic radiation on canine alveolar ridges augmented with hydroxylapatite

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1992-01-01

    on the alveolar ridge. Following 4 months of healing, 12 dogs (experimental group) underwent therapeutic radiation therapy (Co60, 4,000 rad [40 Gy]) to the head and neck region. Four dogs were not irradiated and served as controls. Four animals (three experimental and one control) were killed at 5,6,7, and 8......The purpose of this investigation was to evaluate the effect of radiation on hydroxylapatite (HA) implanted subperiosteally for alveolar ridge augmentation in dogs. All bicuspids and molars were extracted from 16 dogs. After 6 weeks, nonporous HA granules were implanted subperiosteally...

  12. Chemical, physical, and histologic studies on four commercial apatites used for alveolar ridge augmentation

    DEFF Research Database (Denmark)

    Pinholt, E M; Ruyter, I E; Haanaes, H R

    1992-01-01

    The purpose of this study was to evaluate four commercial apatite products. Subperiosteal alveolar ridge augmentation was performed on the maxilla of rats by implantation of granules of two dense products and of two porous products, and the tissue response was compared with the material character......The purpose of this study was to evaluate four commercial apatite products. Subperiosteal alveolar ridge augmentation was performed on the maxilla of rats by implantation of granules of two dense products and of two porous products, and the tissue response was compared with the material...

  13. Automatic methods for alveolar bone loss degree measurement in periodontitis periapical radiographs.

    Science.gov (United States)

    Lin, P L; Huang, P Y; Huang, P W

    2017-09-01

    Periodontitis involves progressive loss of alveolar bone around the teeth. Hence, automatic alveolar bone loss measurement in periapical radiographs can assist dentists in diagnosing such disease. In this paper, we propose an automatic length-based alveolar bone loss measurement system with emphasis on a cementoenamel junction (CEJ) localization method: CEJ_LG. The bone loss measurement system first adopts the methods TSLS and ABLifBm, which we presented previously, to extract teeth contours and bone loss areas from periodontitis radiograph images. It then applies the proposed methods to locate the positions of CEJ, alveolar crest (ALC), and apex of tooth root (APEX), respectively. Finally the system computes the ratio of the distance between the positions of CEJ and ALC to the distance between the positions of CEJ and APEX as the degree of bone loss for that tooth. The method CEJ_LG first obtains the gradient of the tooth image then detects the border between the lower enamel and dentin (EDB) from the gradient image. Finally, the method identifies a point on the tooth contour that is horizontally closest to the EDB. Experimental results on 18 tooth images segmented from 12 periodontitis periapical radiographs, including 8 views of upper-jaw teeth and 10 views of lower-jaw teeth, show that 53% of the localized CEJs are within 3 pixels deviation (∼ 0.15 mm) from the positions marked by dentists and 90% have deviation less than 9 pixels (∼ 0.44 mm). For degree of alveolar bone loss, more than half of the measurements using our system have deviation less than 10% from the ground truth, and all measurements using our system are within 25% deviation from the ground truth. Our results suggest that the proposed automatic system can effectively estimate degree of horizontal alveolar bone loss in periodontitis radiograph images. We believe that our proposed system, if implemented in routine clinical practice, can serve as a valuable tool for early and accurate

  14. Ontogenesis of the alveolar walls of the tooth germ according to orthopantomography

    Directory of Open Access Journals (Sweden)

    Okushko M.R.

    2015-12-01

    Full Text Available Objective: to identify changes of the configuration and size of the walls of the alveolar stages of ontogenesis. Materials and Methods. Orthopantomograms studied 196 children aged 5 to 12 years. We used visual and morphometric methods. Results. The data on the three diameters of the dental alveoli (proximal, middle and distal has been presented, under which subsequently the main stages of age transformation have been highlighted. Conclusion. Transformation of the alveolar walls radiologically determined and its advancing character in relation to the macroprocesses in the germ tooth have made it possible to consider alveolus as one of the leading biological tools of odontogenesis.

  15. Alveolar Bone Expansion for Implant Placement in Compromised Aesthetic Zone – Case Series

    Science.gov (United States)

    Mohamed, Jumshad B; Alam, Md Nazish; Singh, Gurudeep; Chandrasekaran, S.N

    2014-01-01

    Implant placement and restoration of compromised alveolar ridges in the aesthetic zone has always been a challenge to the oral implantologists. The use of bone expanders and bone condensers without the use of traditional drilling sequences in this scenario is becoming popular because of its predictable results. Xenograft along with Platelet-rich fibrin (PRF) used as scaffold also provides growth factors to accelerate both soft and hard tissue healing as well as regeneration. The paper highlights this combined approach in the placement of implants in compromised alveolar ridges with good results. All implants were successfully restored and followed up for one year. PMID:24701543

  16. Distracción osteogénica alveolar: una alternativa en la reconstrucción de rebordes alveolares atróficos: Descripción de 10 casos Alveolar distraction osteogenesis: an alternative in the reconstruction of atrophic alveolar ridges: Report of 10 cases

    Directory of Open Access Journals (Sweden)

    P.E. Maurette O’Brien

    2004-02-01

    Full Text Available La distracción osteogénica alveolar (DOA es un método alternativo para la reconstrucción de rebordes alveolares atróficos que ofrece un resultado previsible y que disminuye los tiempo de espera entre la reconstrucción del reborde alveolar atrófico y la colocación de los implantes óseo-integrados, en comparación con los métodos tradicionalmente utilizados. Fueron atendidos 10 pacientes que presentaban deficiencia de reborde alveolar mandibular y/o maxilar por medio de distracción osteogénica, utilizando un dispositivo yuxtaoseo (Conexión Implant System® - SP-Brasil. Todos los pacientes fueron atendidos de forma ambulatoria, bajo anestesia local y sedación conciente, comenzando la activación del dispositivo a los 7 días posteriores a la instalación, con un patrón de activación de 1 mm diarios hasta alcanzar la altura ósea deseada. Posteriormente se aguardaron 10 semanas como parte del periodo de consolidación ósea y se realizo la colocación de los implantes oseointegrados y local y el retiro del dispositivo de distracción, pudiéndose comprobar clínica y radiográficamente la ganancia de la altura y volumen óseo necesario para la rehabilitación por medio de implantes.The alveolar distraction osteogenesis is an alternative method for the reconstruction of atrophic alveolar ridges with success, that decrease the time of wait between the reconstruction of the alveolar ridge and the placement of the osseointegrated implants in comparison with the traditionally used methods. 10 patients that presented deficiency of the alveolar ridge in the maxilla and/or mandible were assisted by means of distraction osteogenesis, using a juxtaosseous device (Conexion Implant System® - SP-Brazil. All the patients were assisted of form ambulatory, under local anesthesia and conscientious sedation, beginning the activation from the device 7 days later to the installation, with a pattern of activation 1 mm diary until reaching the wanted

  17. An integrative approach for comparing microcirculation between normal and alveolar cleft gingiva in children scheduled for secondary bone grafting procedures

    NARCIS (Netherlands)

    Milstein, Dan M. J.; Cheung, Yuk Wah; Žiūkaitė, Laura; Ince, Can; van den Akker, Hans P.; Lindeboom, Jérôme A. H.

    2013-01-01

    The aim of this study was to compare microcirculatory parameters in normal versus alveolar cleft gingiva in children selected for secondary bone grafting procedures. This study included 11 consecutive patients with complete unilateral alveolar clefts who required secondary bone grafting procedures.

  18. An integrative approach for comparing microcirculation between normal and alveolar cleft gingiva in children scheduled for secondary bone grafting procedures

    NARCIS (Netherlands)

    Milstein, D.M.J.; Cheung, Y.W.; Ziukaite, L.; Ince, C.; van den Akker, H.P.; Lindeboom, J.A.H.

    2013-01-01

    Objective The aim of this study was to compare microcirculatory parameters in normal versus alveolar cleft gingiva in children selected for secondary bone grafting procedures. Study Design This study included 11 consecutive patients with complete unilateral alveolar clefts who required secondary

  19. Early secondary closure of alveolar clefts with mandibular symphyseal bone grafts and beta-tri calcium phosphate (beta-TCP).

    NARCIS (Netherlands)

    Weijs, W.L.J.; Siebers, T.J.H.; Kuijpers-Jagtman, A.M.; Berge, S.J.; Meijer, G.J.; Borstlap, W.A.

    2010-01-01

    Alveolar reconstruction of bony defects in cleft lip and palate patients is a widely accepted treatment regimen for which multiple donor sites can be used. For 25 years, autogeneous bicortical mandibular symphyseal bone grafts have been used at the authors' centre. In cases in which the alveolar

  20. Pre-operative assessment of impacted mandibular third molar and inferior alveolar canal using orthopantomograhpy and cone beam computed tomography

    Directory of Open Access Journals (Sweden)

    Mahmuda Akter

    2016-12-01

    Full Text Available The aim of this study was to assess the proximity and relation of impacted mandibular third molar and inferior alveolar canal on orthopantomogram and cone beam computed tomography (CBCT. Sixty impacted mandibular third molars having close proximity with the  inferior alveolar canal were included. CBCT images were done to determine the exact location and relationship of impacted third molar tooth and inferior alveolar canal. We assessed the radiographic signs from orthopantomogram, the course of  inferior alveolar canal and proximity to the third molar tooth in CBCT. The buccal course of  inferior alveolar canal was most frequently detected (n=36 in CBCT findings. The impacted lower third molar roots were 55% contact with the  inferior alveolar canal and 45% separate from the canal. On orthopantomogram, the following signs were strongly correlated with actual contact: Superimposed relationship between the third molar and the inferior alveolar canal. CBCT is useful as a presurgical planning in patients with impacted mandibular third molar showing close proximity to the  inferior alveolar canal.

  1. An Unusual Radiologic Manifestation of Pulmonary Tuberculosis with Bilateral Multiple Lung Nodules and Diffuse Alveolar Hemorrhage: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Seo In; Seon, Hyun Ju; Kim, Yun Hyeon [Dept. of Radiology, Chunnam National University Hospital, Gwangju (Korea, Republic of); Choi, Sung [Dept. of Radiology, Chunnam National University Hwasun Hospital, Hwasun(Korea, Republic of)

    2011-12-15

    Pulmonary tuberculosis presenting as bilateral multiple lung nodules or diffuse alveolar hemorrhage is very rare. Here, we report a case of pulmonary tuberculosis presenting as bilateral multiple lung nodules and diffuse alveolar hemorrhage mimicking granulomatous vasculitis, such as Wegener's granulomatosis.

  2. Development of a lung slice preparation for recording ion channel activity in alveolar epithelial type I cells

    Directory of Open Access Journals (Sweden)

    Crandall Edward D

    2005-04-01

    Full Text Available Abstract Background Lung fluid balance in the healthy lung is dependent upon finely regulated vectorial transport of ions across the alveolar epithelium. Classically, the cellular locus of the major ion transport processes has been widely accepted to be the alveolar type II cell. Although evidence is now emerging to suggest that the alveolar type I cell might significantly contribute to the overall ion and fluid homeostasis of the lung, direct assessment of functional ion channels in type I cells has remained elusive. Methods Here we describe a development of a lung slice preparation that has allowed positive identification of alveolar type I cells within an intact and viable alveolar epithelium using living cell immunohistochemistry. Results This technique has allowed, for the first time, single ion channels of identified alveolar type I cells to be recorded using the cell-attached configuration of the patch-clamp technique. Conclusion This exciting new development should facilitate the ascription of function to alveolar type I cells and allow us to integrate this cell type into the general model of alveolar ion and fluid balance in health and disease.

  3. Osteogenesis effect of guided bone regeneration combined with alveolar cleft grafting: assessment by cone beam computed tomography.

    Science.gov (United States)

    Xiao, W-L; Zhang, D-Z; Chen, X-J; Yuan, C; Xue, L-F

    2016-06-01

    Cone beam computed tomography (CBCT) allows for a significantly lower radiation dose than conventional computed tomography (CT) scans and provides accurate images of the alveolar cleft area. The osteogenic effect of guided bone regeneration (GBR) vs. conventional alveolar bone grafting alone for alveolar cleft defects was evaluated in this study. Sixty alveolar cleft patients were divided randomly into two groups. One group underwent GBR using acellular dermal matrix film combined with alveolar bone grafting using iliac crest bone grafts (GBR group), while the other group underwent alveolar bone grafting only (non-GBR group). CBCT images were obtained at 1 week and at 3 months following the procedure. Using Simplant 11.04 software, the bone resorption rate was calculated and compared between the two groups. The bone resorption rate from 1 week to 3 months following bone grafting without the GBR technique was 36.50±5.04%, whereas the bone resorption rate using the GBR technique was 31.69±5.50% (P=0.017). The application of autogenous iliac bone combined with the GBR technique for alveolar bone grafting of alveolar cleft patients can reduce bone resorption and result in better osteogenesis. Copyright © 2016. Published by Elsevier Ltd.

  4. Productividad del trabajo en la industria maquiladora del norte de Mexico: Un analisis de convergencia

    OpenAIRE

    Jorge Eduardo Mendoza Cota

    2004-01-01

    En este estudio se analiza la productividad del trabajo en la industria maquiladora de exportacion por divisiones y por estados, comparando la region de la frontera norte de Mexico con el resto de los estados. Se utiliza un analisis econometrico de panel, partiendo del enfoque de convergencia condicional. Se aprecia una heterogeneidad de la productividad del trabajo, lo que sugiere diferencias regionales en los procesos tecnologicos y en la dotacion del capital. Los estados del centro mostrar...

  5. ANALISIS PENERAPAN PSAK NO. 102 UNTUK PEMBIAYAAN MURABAHAH PADA KPN IAIN SAMARINDA

    OpenAIRE

    Parno, Parno; Tikawati, Tikawati

    2017-01-01

    Penelitian ini dilakukan di KPN IAIN Samarinda dengan judul: Analisis Penerapan PSAK No. 102 Untuk Pembiayaan Murabahah Pada KPN IAIN Samarinda. Penelitian ini bertujuan untuk mengetahui adalah untuk mengetahui kesesuaian penerapan akuntansi murabahah pada KPN IAIN Samarinda dengan Pernyataan Standar Akuntansi Keuangan Syariah No.102 Tentang Akuntansi Murabahah. Metode pengumpulan data menggunakan studi pustaka dan wawancara. Salah satu pendekatan dalam penelitian yang berbasis literatur yait...

  6. Analisi Pengaruh Store Name, Brand Name, Dan Price Discounts Terhadap Purchase Intentions Konsumen Infinite Tunjungan Plaza

    OpenAIRE

    Gunawan, Andy

    2013-01-01

    Andy Gunawan:SkripsiAnalisis pengaruh store name, brand name dan price discounts terhadap purchase intention konsumen infnite tunjungan plaza Di era globalisasi ini, persaingan dagang antara Perusahaan – Perusahaan baik lokal maupun global menjadi semakin ketat, oleh karena itu Perusahaan selalu berusaha untuk meningkatkan ketertarikan minat beli konsumen. Beberapa variabel yang menjadi fokus Perusahaan adalah store name, brand name, dan price discount. Tujuan penelitian ini adalah untuk meng...

  7. Analisis Biaya, Volume, Laba sebagai Alat Bantu Perencanaan Laba pada Hotel Sedona Manado

    OpenAIRE

    Samahati, Ricky Budiman

    2013-01-01

    Manado sebagai kota pariwisata menyediakan sarana dan prasarana kepariwisataan termasuk jasa perhotelan. Hotel Sedona merupakan salah satu hotel yang ada di Kota Manado dan merupakan objek yang dipilih penulis dengan menggunakan data operasional penjualan yang terjadi pada tahun 2011 dan 2012. Tujuan penelitian ini yaitu untuk mengetahui titik break even point, jumlah volume penjualan pada tingkat laba yang direncanakan, serta tingkat margin of safety pada Hotel Sedona Manado. Metode analisi...

  8. ANALISIS POTENSI PENGEMBANGAN PUSAT PERTUMBUHAN EKONOMI DI KABUPATEN KARANGANYAR 2009-2013

    Directory of Open Access Journals (Sweden)

    Arumpaka Priangga

    2017-06-01

    Full Text Available Penelitian ini bertujuan untuk menentukan kecamatan yang berpotensi sebagai pusat pertumbuhan ekonomi di Kabupaten Karanganyar. Data yang digunakan dalam penelitian ini adalah data sekunder yaitu berupa data times series dengan periode waktu tahun 2009-2013 yang bersumber dari BPS Provinsi Jawa Tengah, BPS Kabupaten Karanganyar dan jurnal serta literatur yang berkaitan dengan penelitian. Metode analisis yang digunakan yaitu Tipologi Klassen, Analisis Location Quotient (LQ, Model Rasio Pertumbuhan (MRP, Analisis Overlay, Analisis Skalogram. Hasil penelitian ini menunjukkan bahwa yang menjadi pusat pertumbuhan ekonomi di Kabupaten Karanganyar dan kawasan kerjasamanya adalah Kawasan Barat dengan pusat pertumbuhan ekonomi Kecamatan Gondangrejo, Kawasan Tengah dengan pusat pertumbuhan Kecamatan Karanganyar, Kawasan Timur dengan pusat pertumbuhan Kecamatan Matesih, dan Kawasan Selatan dengan pusat pertumbuhan Kecamatan Jumantono. Kesimpulan dari penelitian ini bahwa terdapat empat kecamatan pusat pertumbuhan yang saling berinteraksi dengan kecamatan di sekitarnya. This study aims to determine the potential districts as centers of economic growth in Karanganyar. The data used in this research is secondary data in the form of data time series with the time period of 2009-2013 taken from BPS Central Java province, BPS Karanganyar as well as journals and any other literatures which are related to the research. The analytical methods being used are Typology Klassen, Location Quotient analysis (LQ, Growth Ratio Model (MRP, Overlay analysis, and Schallogram analysis. The results of this study indicate that the center of economic growth in Karanganyar and its regional cooperation are the Western Region with the center of economic growth is in the District Gondangrejo, Central Region with the growth center is in Karanganyar, Eastern Region with Subdistrict Matesih as its center of economic growth, and South Region with Subdistrict Jumantono as its center. The

  9. Analisis Sifat Listrik Komposit Polianilin (Pani) Terhadap Penambahan Bottom Ash Sebagai Elektroda Superkapasitor

    OpenAIRE

    Susmita, Ria; Muttaqin, Afdal

    2013-01-01

    Telah dilakukan pembuatan dan analisis sifat listrik elektroda superkapasitor berbahan dasar polimer PANi dengan penambahan bottom ash. Penelitian ini bertujuan untuk mempelajari sifat listrik polimer konduktif polianilin terhadap penambahan bottom ash dibawah pengaruh temperatur antara 308 K hingga 373 K. Sampel komposit PANi-bottom ash dibuat dalam bentuk tablet dengan ukuran tebal 0,324 cm, luas permukaan 1,3143 cm2 dan massa jenis ± 1,3624 g/cm3, dengan komposisi penambahan bottom ash 0 ...

  10. Analisis Penggunaan Power System Stabilizer (PSS) Dalam Perbaikan Stabilitas Dinamik Sistem Tenaga Listrik Multimesin

    OpenAIRE

    Rudi Masrul

    2009-01-01

    Tugas akhir ini menganalisis perbaikan stabilitas dinamis sistem tenaga listrik yang dilakukan dengan pemasangan Power System Stabilizer (PSS) yang diterapkan pada sistem eksitasi. Model sistem yang digunakan ialah sistem tenaga listrik multimesin, yang terdiri dari tiga generator atau pembangkit. Analisis dan simulasi ini diawali dengan pembuatan model matematik sistem tenaga listrik tanpa pemasangan Power System Stabilizer (PSS) ke dalam persamaan variabel keadaan, dan kemudian dibentuk ...

  11. Analisis Kelayakan Usaha Unit Penangkapan Pukat Cumi di Perairan Selat Makassar Kabupaten Pangkep

    OpenAIRE

    ASIB, Ahlan Jaya; NAJAMUDDIN; KURNIA, Muhammad

    2016-01-01

    Alat tangkap pukat cumi merupakan salah satu alat tangkap yang banyak digunakan nelayan di kabupaten Pangkep dengan hasil tangkapan utama adalah cumi-cumi (loligo sp). Analisis usaha unit penangkapan pukat cumi bertujuan untuk mengetahui keuntungan dan kelayakan unit usaha pukat cumi ditinjau dari aspek finansial. Penelitian ini dilakukan di Perairan Selat Makassar Kabupaten Pangkep pada bulan Mei sampai Juli 2013 dengan metode pengambilan data melalui observasi dan wawancara. Data dibagi da...

  12. Salam Dan Ungkapan Perpisahan Dalam Bahasa Inggris Dan Bahasa Sangihe (Suatu Analisis Kontrastif)

    OpenAIRE

    SRIJONO, AMELIA PRATIWI

    2017-01-01

    This title of this research is “Salam dan Ungkapan Perpisahan dalam Bahasa Inggris dan Bahasa Sangihe : Suatu Analisis Kontrastif”. The aims of this study are to identify, describe and contrast the forms and pattern of greetings and leave-takings in English and Sangiric Language. This research uses descriptive and contrastive analysis. The data in English were collected from books related to sociolinguistics, book of speaking, and source from internet, the data in Sangiric Language were co...

  13. ANALISIS GOL TIM FUTSAL PUTRI UNIVERSITAS NEGERI JAKARTA PADA LIGA FUTSAL WANITA PROFESIONAL TAHUN 2017

    OpenAIRE

    Fitranto, Nur

    2018-01-01

    Penelitian ini dilaksanakan di Jakarta, pengambilan data dilaksanakan di  Gor Universitas Negeri Jakarta pada bulan Agustus 2017. Pengambilan data menggunakan metode deskriptif dengan teknik analisis. Populasi penelitian ini adalah Tim Futsal Putri Universitas Negeri Jakarta Pada Liga Futsal Wanita Profesional Tahun 2017. Sampelnya adalah gol yang terjadi pada Tim Futsal Putri Universitas Negeri Jakarta. Proses gol kemasukkan yang terjadi pada Tim Futsal UNJ di Liga Futsal Wanita Profesi...

  14. ANALISIS STRUKTUR AKTANSIAL DAN FUNGSIONAL DALAM VOYAGE AUCENTREDELA TERRE KARYA JULES VERNE

    OpenAIRE

    Ade Yolanda Latjuba, Dr. M.A

    2017-01-01

    Berdasarkan hasil analisis, maka dapat disimpulkan sebagai berikut: 1. Roman Voyage au centre de la terre menceritakan tentang Prof. Lidenbrock, Axel, dan Hans Bjelke melakukan perjalanan luar biasa menuju pusat bumi berdasarkan petunjuk dari Ame Saknussemm yang Axel dan si Professor dapatkan secara tidak sengaja terselip di dalam sebuah buku tua karya Snorre Tarlesson. 2. Prof. Lidenbrock, Axel dan Hans Bjelke memulai perjalanan mereka menuju pusat bumi dengan cara menuruni gunung bera...

  15. Analisis Algoritma Pergantian Cache Pada Proxy Web Server Internet Dengan Simulasi

    OpenAIRE

    Nurwarsito, Heru

    2007-01-01

    Pertumbuhan jumlah client internet dari waktu ke waktu terus bertambah, maka respon akses internet menjadi semakin lambat. Untuk membantu kecepatan akses tersebut maka diperlukan cache pada Proxy Server. Penelitian ini bertujuan untuk menganalisis performansi Proxy Server pada Jaringan Internet terhadap penggunaan algoritma pergantian cache-nya.Analisis Algoritma Pergantian Cache Pada Proxy Server didesain dengan metoda pemodelan simulasi jaringan internet yang terdiri dari Web server, Proxy ...

  16. ANALISIS DEKONSTRUKSI TOKOH TAKESHI DAN MITSUSABURO DALAM NOVEL SILENT CRY KARYA KENZABURO OE PERSPEKTIF JACQUES DERRIDA

    Directory of Open Access Journals (Sweden)

    Abd. Ghofur

    2015-12-01

    Full Text Available This article is a little result done by the writer, in which critical analisys discourse study as a tool to learn literature. It is Kenzaburo Oe’s writing, a Japan writer who got Pulitzer or noble in literature. It employs Jaques Derrida deconstructive theory, while the researcher focuses on binary opposition.  When deconstruction used, it will expose inside of the text, furthermore it produces other meaning or different point of view from the real text.

  17. ANALISIS POTENSI PEMUNGUTAN PAJAK HOTEL DALAM RANGKA PENINGKATAN PENDAPATAN ASLI DAERAH KOTA MAKASSAR

    OpenAIRE

    -, MUHAMMAD TRY DHARSANA AMBO ALA DEPARTEMEN AKUNTANSI FAKULTAS EKONOMI DAN BISNIS UNIVERSITAS HASANUDDIN MAKASSAR 2017

    2017-01-01

    Analisis Potensi Pemungutan Pajak Hotel dalam Rangka Peningkatan Pendapatan Asli Daerah Kota Makassar Analysis of Hotels Tax Collection Potency in Makkasar???s Own-Source Revenue Increase Muhammad Try Dharsana Ambo Ala Andi Kusumawati Yulianus Sampe Tujuan penelitian ini adalah untuk mengetahui besar potensi pajak hotel dan seberapa jauh bentuk usaha yang di lakukan oleh pemerintah daerah dalam menggali potensi pajak hotel di kota Makassar. Untuk menghitung potensi, efektivi...

  18. ANALISIS PERILAKU PENYUSUN ANGGARAN DALAM PERSPEKTIF KEAGENAN PADA KABUPATEN DAN KOTA DI PROVINSI SULAWESI SELATAN

    OpenAIRE

    ILMI, A. NURUL

    2016-01-01

    2016 Analisis Perilaku Penyusun Anggaran dalam Perspektif Keagenan pada Kabupaten dan Kota di Provinsi Sulawesi Selatan Analysis of Budget Compiler???s Behavior within the Agency Perspective in Regency and City of South Sulawesi Province A. Nurul Ilmi Mediaty Aini Indrijawati Penelitian ini bertujuan untuk menganalisis pengaruh perubahan Pendapatan Asli Daerah dan perubahan Dana Perimbangan terhadap perilaku oportunistik penyusun anggaran yang menjelaskan mengenai hubungan k...

  19. Analisis Pengaruh Experiential Marketing Dan Customer Satisfaction Terhadap Customer Loyalty Comedy Kopi Di Surabaya

    OpenAIRE

    Lokito, Sheila Amanda

    2013-01-01

    Tujuan penelitian ini adalah untuk mengetahui pengaruh Strategic Experiential Moduls (SEMs) sebagai kerangka Experiential Markerting, yang terdiri dari: Sense, Feel, Think, Act, Relate; dan Customer Satisfaction Terhadap Customer Loyalty Comedy Kopi di Surabaya. Jumlah sampel yang diteliti dalam penelitian ini adalah sebanyak 250 responden. Teknik analisis data yang digunakan dalam penelitian ini adalah Structural Equation Modelling (SEM). Hasil penelitian ini menunjukkan bahwa dari keenam hi...

  20. Analisis Kontrastif Kata Ganti Orang dalam Bahasa Indonesia dan Bahasa Mandarin.

    OpenAIRE

    Ginting, Rindi Alfabina

    2011-01-01

    The title of this thesis is “ Analisis Kontrastif Kata Ganti Orang dalam Bahasa Mandarin dan Bahasa Indonesia”. The writer is trying to analyze the similarities and differences between personal pronoun in Mandarin and Indonesia. The concept are part of speech and personal pronoun. Contrastive analysis is the theory used in this paper to see similarities and differences of personal pronoun in Mandarin and Indonesia. The methodology on the paper is descriptive analysis. The result of th...

  1. Limited Evidence Suggests That Alveolar Ridge Preservation is More Favorable Than Unassisted Socket Healing in Minimizing Alveolar Ridge Dimensional Changes After Extraction.

    Science.gov (United States)

    Tu, Victor; Kumar, Satish

    2018-03-01

    Alveolar ridge preservation after tooth extraction: a Bayesian Network meta-analysis of grafting materials efficacy on prevention of bone height and width reduction. Iocca O, Farcomeni A, Pardiñas Lopez S, Talib HS. J Clin Periodontol 2017; 44(1):104-14. Self-funded by the authors and their institutions TYPE OF STUDY/DESIGN: Meta-analysis and Bayesian network meta-analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Analisis Model Penelusuran Backward Chaining dalam Mendeteksi Tingkat Kecanduan Game pada Anak

    Directory of Open Access Journals (Sweden)

    Anastasya Latubessy

    2017-10-01

    Full Text Available Game addiction rate can be detected by applying expert system. This study developed a model of game addiction analysis using backward chaining. This model uses six types of game addiction behavior, among others, salience, euphoria, conflict, tolerance, withdrawal, relapse and reinstatement. Someone is said to be addicted to the game if it meets at least three types of game addiction behavior. Testing the validity of the model is done by testing the closeness of the agreement between the model analysis and expert analysis, resulting in a value of 0.78 which means having a strong agreement. Tingkat kecanduan game dapat dideteksi dengan mengaplikasikan sistem pakar. Penelitian ini mengembangkan model analisis tingkat kecanduan game menggunakan backward chaining. Model ini menggunakan enam jenis perilaku kecanduan game antara lain, salience, euphoria, conflict, tolerance, withdrawal, relapse dan reinstatement. Seseorang dikatakan kecanduan game jika memenuhi paling sedikit tiga jenis perilaku kecanduan game. Pengujian validitas model dilakukan dengan menguji keeratan kesepakatan antara analisis model dan analisis pakar, menghasilkan nilai 0,78 yang berarti memiliki keeratan kesepakatan kuat.

  3. ANALISIS FAKTOR YANG MEMPENGARUHI IMPULSE BUYING WISATAWAN DOMESTIK TERHADAP PRODUK PARIWISATA DI BIRO PERJALANAN WISATA BALI

    Directory of Open Access Journals (Sweden)

    Bayu Anggriawan

    2016-07-01

    Full Text Available Biro Perjalanan Wisata (BPW yang saat ini banyak tersebar di Bali merupakan salah satu sarana pokok yang dapat dimanfaatkan oleh wisatawan sebagai konsumen dalam memudahkan melakukan perjalanan wisata. Sebagai produsen produk pariwisata tentunya BPW memiliki target untuk menuai keuntungan sebanyak-banyaknya. Salah satu caranya adalah dengan memahami pola- pola pembelian konsumen agar strategi, trik, dan pengualaran yang dikerahkan efektif dan efisien. Fenomena impulse buying pada era globalisasi ini marak terjadi, Indonesia sendiri menurut Nielsen.com menempati posisi 3 besar dalam jumlah konsumen yang melakukan impulse buying, setelah India dan Cina. Penelitian ini bertujuan untuk membeberkan faktor-faktor apa sajakah yang mempengaruhi impulse buying wisatawan domestik terhadap produk pariwisata BPW di Bali. Penelitian ini menggunakan pendekatan kuantitaif melalui analisis faktor dan dikombinasikan dengan pendekatan kualitatif melalui pendekatan emik untuk mengkonfirmasi ulang hasil yang didapat didalam analisis faktor. Hasil analisis faktor yang kemudian di re-confirm melalui pendekatan emik menunjukan bahwa terdapat 4 faktor yang mempengaruhi impulse buying wisatawan domestik di BPW Bali yaitu (1 faktor psikologi, (2 faktor kegiatan promosi, (3 faktor finansial, (4 faktor kekerabatan, dengan faktor yang dominan adalah faktor psikologi.

  4. ANALISIS KINERJA HEAT EXCHANGER SHELL & TUBE PADA SISTEM COG BOOSTER DI INTEGRATED STEEL MILL KRAKATAU

    Directory of Open Access Journals (Sweden)

    Jajat Sudrajat

    2017-11-01

    Full Text Available Penggunaan heat exchanger pada sistem COG booster bertujuan untuk mendinginkan temperatur oli yang akan digunakan sebagai pelumasan dan pendinginan bearing. Semakin lama heat exchanger digunakan akan menyebabkan terjadinya fouling (pengotoran di bagian dalam heat exchanger. Semakin besar fouling yang terjadi akan menyebabkan terjadi penurunan kinerja heat exchanger seperti besarnya laju perpindahan panas aktual dan efektivitas. Oleh karena itu dilakukan analisis heat exchanger untuk mengetahui pengaruh fouling terhadap laju perpindahan panas aktual dan efektivitas heat exchanger dengan rentang waktu 1 tahun setelah booster beroperasi yang dibagi menjadi 2 periode. Analisis dilakukan dengan membuat perhitungan parameter-parameter yang dibutuhkan. Dari hasil perhitungan dan analisis, ditunjukan bahwa terjadi penurunan pada laju perpindahan panasnya hingga sebesar 0,411 kW atau 19,45%, setara dengan energi yang dihasilkan dari penggunaan solar sejumlah 0,036 liter selama satu jam. Fouling yang terjadi mengalami kenaikan hingga sebesar 0,561 m2.K/kW. Sedangkan efektivitasnya mengalami penurunan sebesar 3,7%.

  5. ANALISIS TINGKAT KAPABILITAS SISTEM INFORMASI RUMAH SAKIT BERDASARKAN COBIT 5 (MEA01 PADA RSUD TUGUREJO SEMARANG

    Directory of Open Access Journals (Sweden)

    Ariel Bagus Nugroho

    2015-11-01

    Full Text Available RSUD Tugurejo Semarang merupakan Rumah Sakit kelas B milik pemerintah Provinsi Jawa Tengah yang menyediakan pelayanan jasa untuk masyarakat. Dalam manajemen pengolahan data, RSUD Tugurejo Semarang telah menggunakan sistem informasi rumah sakit. Untuk mengetahui apakah sistem informasi telah berjalan seperti yang diharapkan, maka perlu dilakukan analisis tatakelola teknologi informasi. Pada penelitian ini analisis tatakelola teknologi informasi berfokus pada proses pengawasan, evaluasi dan penilaian kinerja, dan kesesuaian kinerja teknologi informasi, yaitu domain MEA01 pada framework COBIT 5.Tujuan penelitian ini untuk mengetahui tingkat kapabilitas dan strategi perbaikan untuk proses pengawasan, evaluasi dan penilaian kinerja dan kesesuaian TI. Metode pengumpulan  data penelitian ini dengan menggunakan studi dokumen, kuesioner dan wawancara kemudian dianalisis tingkat kapabilitas dan kesenjangan. Tingkat kapabilitas yang didapat dari hasil penelitian yaitu berada level 2 (managed. Untuk menaikkan tingkat kapabilitas pada level 3 maka maka perlu dilakukan secara bertahap strategi perbaikan pada PA 2.1, PA2.2, PA 3.1, dan 3.2. Kata kunci: Analisis Tata Kelola TI, COBIT 5, MEA01, Tingkat Kapabilitas, Rumah Sakit.

  6. Analisis Tata Kelola Teknologi Informasi Menggunakan Kerangka Kerja COBIT 4.1 pada Fakultas Teknik Undip

    Directory of Open Access Journals (Sweden)

    Arini Arumana

    2014-06-01

    Full Text Available Peran teknologi informasi dalam suatu instansi sudah tidak dapat dielakkan lagi, mengingat perkembangannya yang begitu pesat seiring berjalannya waktu. Namun masalah yang sering terjadi di instansi adalah penggunaan teknologi informasi yang kadang tidak sesuai dengan harapan. Oleh karena itu diperlukan tata kelola terhadap penggunaan teknologi informasi yang biasa disebut dengan IT Governance. Fakultas teknik UNDIP adalah salah satu fakultas yang dalam operasionalnya sangat mengandalkan teknologi informasi, baik dalam aktifitas belajar mengajar maupun dalam menjalankan operasional bisnis. Kondisi sekarang di Fakultas Teknik sendiri tidak terdapat suatu indikator yang dapat menyatakan bahwa kinerja TI yang berjalan telah sesuai dengan visi dan misi Fakultas Teknik, oleh karena itu perlu dilakukan analisis tata kelola teknologi informasi, guna mengetahui performa TI sekarang sesuai dengan yang diharapkan oleh managemen atau tidak. Hasil dari analisis ini berupa tingkat kematangan tata kelola TI yang mecerminkan kondisi tata kelola TI di Fakultas Teknik dengan mengacu pada maturity level yang disediakan kerangka kerja COBIT 4.1, yakni dari level 0 (non-existent sampai 5 (optimized. Berdasarkan analisis yang dilakukan, secara garis besar kondisi kematangan tata kelola TI Fakultas Teknik berada pada level 2 yakni repeatable but intuitive. Kondisi ini mengacu pada beberapa kelemahan dalam proses-proses TI yang berjalan, diantaranya penetapan dan dokumentasi tindakan, kebijakan dan prosedur yang minim, serta tidak tersedianya service level yang disetujui bersama.

  7. PENGGUNAAN METODE STRUCTURAL EQUATION MODELLING UNTUK ANALISIS FAKTOR YANG MEMPENGARUHI MOTIVASI BELAJAR MAHASISWA FIP UMJ

    Directory of Open Access Journals (Sweden)

    Ririn Widiyasari

    2018-02-01

    Full Text Available Tujuan yang ingin dicapai dalam penelitian ini adalah mengetahui faktor apa saja  yang mempengaruhi motivasi belajar mahasiswa, apakah terdapat pengaruh yang signifikan antara cara belajar, fasilitas belajar dan lingkungan belajar terhadap motivasi belajar mahasiswa, serta faktor mana yang paling berpengaruh terhadap motivasi belajar mahasiswa. Jumlah sampel dalam penelitian ini adalah 192 mahasiswa (FIP UMJ angkatan tahun 2013-2015 yang aktif mengikuti perkuliahan. Metode penelitian yang dilakukan adalah metode kuantitatif survey. Metode pengambilan data menggunakan  kuesioner dengan skala likert. Metode analisis data yang digunakan adalah analisis deskriptif, dan analisis  Structural Equation Modeling (SEM berbantuan program LISREL 8.3. Uji hipotesis yang digunakan dalam penelitian ini adalah uji Chi-square dan uji t. Hasil penelitian menunjukkan bahwa variabel cara belajar memiliki kontribusi yang paling besar, selanjutnya variabel kedua yang berkontribusi meningkatkan motivasi belajar adalah lingkungan belajar dan terakhir fasilitas belajar memberikan pengaruh yang paling kecil terhadap motivasi belajar. Jadi, variabel laten cara belajar dan lingkungan belajar berpengaruh positif terhadap motivasi belajar dan fasilitas belajar berpengaruh negatif terhadap motivasi belajar.

  8. ANALISIS KEPUASAN PELAYANAN PERGURUAN TINGGI (Kasus pada Prodi Magister Pendidikan Ekonomi Unnes

    Directory of Open Access Journals (Sweden)

    Kardoyo Kardoyo

    2016-06-01

    Full Text Available Abstrak: Fokus penelitian ini adalah pengukuran kepuasan pelayanan terhadap mahasiswa, penelusuran lulusan, dan kepuasan pengguna lulusan. Populasi penelitian adalah mahasiswa Prodi Magister Pendidikan Ekonomi PPs Unnes yang aktif pada semester gasal 2015/2016, lulusan, dan pengguna lulusan. Alat yang digunakan adalah instrumen SERVQUAL yang dikembangkan dari Parasuraman et al. (1994 untuk mengukur kepuasan mahasiswa. Instrumen pengukuran kesesuaian lulusan dan kepuasan pengguna lulusan berdasarkan pedoman akreditasi BAN PT. Analisis data dilakukan dengan analisis statistik deskriptif dan importance-performance analysis (IPA. Hasil penelitian menunjukkan bahwa berdasarkan analisis kepuasan layanan terdapat dua dimensi layanan yang harus menjadi prioritas utama untuk segera diperbaiki, yaitu dimensi acces dan reliability. Hasil lainnya menunjukkan bidang pekerjaan alumni telah sesuai dengan visi misi prodi dan alumni berpendapat materi dan proses perkuliahan sangat relevan dengan bidang pekerjaan yang digeluti sekarang sehingga sangat membantu menyelesaikan pekerjaan. Terakhir, kepuasan pengguna terhadap kompetensi lulusan termasuk dalam kategori sangat bagus. Kata kunci : mahasiswa, lulusan, pengguna lulusan, kualitas layanan, Importance-Performance Analysis

  9. Risk analysis in the chemical industry; Analisis de riesgos en la industria quimica

    Energy Technology Data Exchange (ETDEWEB)

    Rea Soto, Rogelio; Sandoval Valenzuela, Salvador [Instituto de Investigaciones Electricas, Temixco, Morelos (Mexico)

    2000-07-01

    The Instituto de Investigaciones Electricas has a group of risk analysis (GAR), specialized in the most advanced methodologies to apply them in diverse industries of the productive sector, such as the nuclear, the oil and the chemical industries. In this work the integrated methodology that the GAR uses to make risk analysis in the chemical and oil industries is described. These analyses have as an objective to make a meticulous evaluation of the system design, the operation practices, the maintenance and inspection policies and the emergency plans. [Spanish] El Instituto de Investigaciones Electricas cuenta con un grupo de analisis de riesgo (GAR), especializado en las metodologias mas avanzadas para aplicarlas en diversas industrias del sector productivo, como lo son la nuclear, la petrolera y la quimica. En este trabajo se describe la metodologia integrada que el GAR utiliza para realizar analisis de riesgos en las industrias quimica y petrolera. Estos analisis tienen como objetivo realizar una minuciosa evaluacion del diseno del sistema, las practicas de operacion, las politicas de mantenimiento e inspeccion y los planes de emergencia.

  10. Analisis Kandungan Bakteri Fecal Coliform pada Sungai Kuin Kota Banjarmasin

    Directory of Open Access Journals (Sweden)

    Deasy Ari Santy

    2017-12-01

    Full Text Available ABSTRAK Sungai Kuin merupakan anak Sungai Martapura yang yang bermuara di Sungai Barito. Sungai ini terdapat di Kota Banjarmasin, Kalimantan Selatan. Kejadian diare tertinggi di Kota Banjarmasin terjadi di bantaran Sungai Kuin, sehingga perlu dilakukan penelitian mengenai kandungan bakteri fecal coliform pada sungai ini. Penelitian ini bertujuan menganalisis jumlah kandungan bakteri fecal coliform di Sungai Kuin dan menganalisis cara mengatasi penurunan kualitas air Sungai Kuin akibat keberadaan bakteri fecal coliform. Data diambil sepanjang Sungai Kuin dengan panjang 3.909,00 m yang terbagi menjadi 20 segmen (10 segmen berada di bagian kanan sungai dan 10 segmen berada di bagian kiri sungai. Pembagian segmen berdasarkan panjang sungai per 390 meter, dengan sampel sebanyak 5 segmen yang mewakili segmen lainnya. Teknik analisis yang digunakan yaitu dengan menggunakan hasil uji laboratorium, perbandingan terhadap Peraturan Gubernur Kalimantan Selatan No 5 tahun 2007 dan referensi dari katalog informasi pilihan jamban sehat. Hasil penelitian menunjukkan bahwa kualitas air Sungai Kuin adalah berwarna kecoklatan, dan terkadang tercium bau terutama pada saat hujan turun. Jumlah rerata kandungan bakteri fecal coliform di Sungai Kuin adalah 210/100 ml pada saat pasang naik dan 780/100 ml pada saat pasang surut. Kualitas air Sungai Kuin tidak tidak memenuhi baku mutu air minum karena kandungan bakteri fecal coliform berada di atas baku mutu 100/100 ml.  Penurunan kualitas air Sungai Kuin dapat dilakukan dengan pembangunan jamban yang sesuai dengan lingkungan perairan pasang surut. ABSTRACT Kuin River is a tributary of Martapura River, which flows into Barito River. It traverses Banjarmasin City, South Kalimantan Province. The highest diarrhea incidence in this city was found in the banks of Kuin River. Therefore, this research, focusing on fecal coliform bacteria in Kuin River, becomes necessary. Aside from analyzing the concentration of fecal coliform

  11. ANALISIS PENGENDALIAN DAYA REAKTOR PCMSR DENGAN LAJU ALIR PENDINGIN

    Directory of Open Access Journals (Sweden)

    Iqbal Syafin Noha

    2015-03-01

    Full Text Available Passive Compact Molten Salt Reactor (PCMSR merupakan pengembangan dari Molten Salt Reactor (MSR yang memiliki karakter berbeda dengan lima reaktor generasi IV lainnya, yaitu menggunakan bahan bakar leburan garam. Pada reaktor MSR, garam lebur tidak digunakan sebagai pendingin tetapi digunakan sebagai medium pembawa bahan bakar. Dengan fase bahan bakar yang berupa garam lebur LiF-BeF2-ThF4-UF4, maka dapat dilakukan pengendalian daya dengan mengatur laju aliran bahan bakar dan pendingin. Tujuan penelitian ini adalah untuk mengetahui pengaruh perubahan laju alir pendingin terhadap daya reaktor PCMSR. Analisis dilakukan dengan empat jenis masukan untuk perubahan laju alir pendingin, yaitu masukan step, ramp, eksponensial, dan sinusoidal. Untuk masukan step, laju alir pendingin dibuat berubah secara mendadak. Selanjutnya untuk masukan ramp dan eksponensal, perubahan laju alir masing-masing dibuat perlahan secara linear dan mengikuti fungsi eksponensial. Kemudian untuk masukan sinusoidal, laju alir berubah naik turun secara periodik dengan memvariasikan frekuensi dari perubahan laju alir tersebut. Hasil penelitian menunjukkan bahwa penurunan laju alir pendingin sebesar 50% dari laju pendingin sebelumnya, menyebabkan daya pada reaktor PCMSR turun sebesar 63% dari daya sebelumnya. Jika terjadi fluktuasi laju aliran pendingin, maka semakin cepat perubahan tersebut, maka respon daya yang diberikan semakin kecil. Pada frekuensi yang sangat cepat, daya reaktor menjadi konstan dan cenderung tidak memiliki respon terhadap laju aliran. Hal ini merupakan salah satu aspek keselamatan reaktor, karena reaktor tidak merespon perubahan yang terlalu cepat. Kemampuan reaktor mengatur daya menyesuaikan laju aliran pendingin merupakan aspek keselamatan lainnya. Kata kunci : PCMSR, pengendalian daya, laju alir pendingin, uji respon   Passive Compact Molten Salt Reactor (PCMSR is the development of Molten Salt Reactor (MSR which has different character from other five

  12. ANALISIS DAN MODEL STRATEGI PENINGKATAN DAYA SAING PRODUK EDAMAME BEKU

    Directory of Open Access Journals (Sweden)

    Sandryas Alief Kurniasanti

    2015-03-01

    penelitian ini adalah untuk menganalisis daya saing dan merumuskan prioritas alternatif strategi peningkatan daya saing produk edamame beku di PT MT 27. Metode yang digunakan dalam penelitian ini adalah Revealed Comparative Advantage untuk mengetahui kinerja ekspor dari produk edamame beku di pasar dunia, kemudian menganalisis faktor persaingan dengan menggunakan Diamond Porter’s Theory. Alternatif strategi dihasilkan dari analisis SWOT dan ditentukan prioritasnya dengan menggunakan analytical hierarchy process dari satu narasumber ahli. Hasil penelitian menunjukkan bahwa prioritas alternatif strategi peningkatan daya saing produk edamame beku PT MT 27 secara berurutan meliputi: (1 diversifikasi pasar, (2 diversifikasi produk, (3 meningkatkan kerjasama luar negeri, (4 pengembangan divisi Research and Development, (5 mengembangkan program Corporate Social Responsibility, (6 pengelolaan keuangan secara baik dan benar, serta (7 mengembangkan areal pertanian yang berbasis rumah kaca untuk menghindari cuaca buruk karena beriklim tropis. Implikasi Manajerial dari penelitian ini adalah mengembangkan pasar yang sudah ada, dan mengembangkan jenis produk yang diproduksi untuk memenuhi selera pasar ekspor dan juga penghematan biaya produksi. Kata kunci: daya saing, edamame beku, Mitratani Dua Tujuh, strategi daya saing

  13. ANALISIS PENGARUH KREDIBILITAS MEREK TERHADAP SENSITIVITAS HARGA KONSUMEN

    Directory of Open Access Journals (Sweden)

    Anik - Kusmintarti

    2012-05-01

    Full Text Available ABSTRAKS   Informasi yang tidak sempurna dan tidak simetris mengakibatkan timbulnya ketidakpastian yang dihadapi konsumen tentang atribut dan/ atau manfaat apa yang didapat dari sebuah produk.  Dalam kondisi seperti ini penting bagi perusahaan untuk menyampaikan informasi terpercaya kepada konsumen, yaitu informasi yang jujur dan perusahaan harus bersedia dan mampu menyampaikan apa yang telah dijanjikan. Merek yang kredibel berpengaruh terhadap  kesan kualitas, resiko yang diterima dan biaya informasi. Kemudian kesan kualitas, resiko yang diterima dan biaya informasi akan mempengaruhi manfaat yang diharapkan.  Dan selanjutnya akan mempengaruhi sensitivitas harga konsumen. Populasi dalam penelitian ini adalah wanita dewasa yang berdomisili di kota Malang dan sampelnya adalah wanita berumur 17 sampai sengan 45 tahun yang menggunakan shampo Anti Ketombe dari satu atau lebih merek-merek yang sedang diteliti. Jumlah responden 100 orang dan metode pengambilan sampel yang digunakan adalah nonprobability sampling, dan teknik pengambilan sampel yang digunakan adalah quota sampling. Uji empiris menggunakan Metode Analisis Jalur. Hasil penelitian menunjukkan bahwa kredibilitas merek berpengaruh terhadap sensitivitas harga konsumen. Selain itu kredibilitas merek berpengaruh secara tak langsung terhadap sensitivitas harga konsumen melalui kesan kualitas dan manfaat yang diharapkan; Kredibilitas merek berpengaruh tak langsung terhadap sensitivitas harga konsumen melalui melalui biaya informasi dan manfaat yang diharapkan. Pengaruh kredibilitas merek terhadap sensitivitas harga konsumen melalui resiko yang dirasakan dan manfaat yang diharapkan tidak signifikan. Temuan ini tidak konsisten dengan temuan dari penelitian yang dilakukan Erdem dan Swait (1998. Hal ini menurut peneliti disebabkan oleh responden dari penelitian yang peneliti lakukan cenderung mudah percaya dengan informasi-informasi yang ada disekelilingnya dan kurang peduli dengan keberadaan

  14. Analisis Daya Saing Ekspor Sektor Unggulan di Jawa Tengah

    Directory of Open Access Journals (Sweden)

    Wiwit Santi Wahyuningsih

    2017-08-01

    Full Text Available Penelitian ini bertujuan untuk mengidentifikasi industri unggulan yang ada di Jawa Tengah, dan kemudian industri unggulan tersebut diidentifikasi mana saja yang mempunyai daya saing ekspor. Penelitian ini menggunakan data PDRB Jawa Tengah dan PDB Tahun 2010-2015, Tabel Input Output Jawa Tengah Tahun 2013, serta data Ekspor-Impor Jawa Tengah Tahun 1997-2015. Data tersebut diperoleh dari data sekunder, yaitu dengan memanfaatkan data yang telah tersedia pada instansi terkait. Penelitian ini mengunakan alat analisis Indeks Daya Penyebaran (IDP, Indeks Derajat Kepekaan (IDK dan Revealed Comparative Advantage (RCA. Dari hasil IDP dan IDK terdapat 9 industri unggulan di Jawa Tengah yaitu industri pengolahan dan pengawetan ikan, industri minyak dan lemak, industri penggilingan padi, industri tepung terigu dan tepung lainnya, industri makanan ternak, industri pemintalan, industri tekstil, industri kayu dan bahan bangunan dari kayu, serta industri karet dan barang dari karet. Tetapi dari 9 industri unggulan tersebut yang memiliki daya saing ekspor tinggi hanya ada 3 industri yaitu industri dengan IDP>1, IDK>1 dan RCA>1 yang meliputi industri pemintalan, industri tekstil, dan industri kayu dan bahan bangunan dari kayu. Dari penelitian ini dapat disimpulkan bahwa sektor industri yang dapat diandalkan untuk meningkatkan pertumbuhan ekonomi melalui ekspor dan memiliki daya saing ekspor yang sangat bagus serta memilki harga jual tinggi yaitu hanya industri pemintalan, industri tekstil, dan industri kayu dan bahan bangunan dari kayu. Maka dari itu sebaiknya kebijakan pemerintah lebih ditekankan pada sektor hulu dan sektor hilir dari industri-industri tersebut. This research’s aim is to identify the leading manufactures in central Java then identify which of those industries have the export competitiveness. This study used data of Central Java’s Gross Domestic Regional Product (GDRP and Gross National Product (GNP on 2010-2015, Input Output Table on 2013, as

  15. ANALISIS DAYA SAING EKSPOR SEKTOR UNGGULAN DI JAWA TENGAH

    Directory of Open Access Journals (Sweden)

    Wiwit Santi Wahyuningsih

    2017-06-01

    Full Text Available Penelitian ini bertujuan untuk mengidentifikasi industri unggulan yang ada di Jawa Tengah, dan kemudian industri unggulan tersebut diidentifikasi mana saja yang mempunyai daya saing ekspor. Penelitian ini menggunakan data PDRB Jawa Tengah dan PDB Tahun 2010-2015, Tabel Input Output Jawa Tengah Tahun 2013, serta data Ekspor-Impor Jawa Tengah Tahun 1997-2015. Data tersebut diperoleh dari data sekunder, yaitu dengan memanfaatkan data yang telah tersedia pada instansi terkait. Penelitian ini mengunakan alat analisis Indeks Daya Penyebaran (IDP, Indeks Derajat Kepekaan (IDK dan Revealed Comparative Advantage (RCA. Dari hasil IDP dan IDK terdapat 9 industri unggulan di Jawa Tengah yaitu industri pengolahan dan pengawetan ikan, industri minyak dan lemak, industri penggilingan padi, industri tepung terigu dan tepung lainnya, industri makanan ternak, industri pemintalan, industri tekstil, industri kayu dan bahan bangunan dari kayu, serta industri karet dan barang dari karet. Tetapi dari 9 industri unggulan tersebut yang memiliki daya saing ekspor tinggi hanya ada 3 industri yaitu industri dengan IDP>1, IDK>1 dan RCA>1 yang meliputi industri pemintalan, industri tekstil, dan industri kayu dan bahan bangunan dari kayu. Dari penelitian ini dapat disimpulkan bahwa sektor industri yang dapat diandalkan untuk meningkatkan pertumbuhan ekonomi melalui ekspor dan memiliki daya saing ekspor yang sangat bagus serta memilki harga jual tinggi yaitu hanya industri pemintalan, industri tekstil, dan industri kayu dan bahan bangunan dari kayu. Maka dari itu sebaiknya kebijakan pemerintah lebih ditekankan pada sektor hulu dan sektor hilir dari industri-industri tersebut. This research’s aim is to identify the leading manufactures in central Java then identify which of those industries have the export competitiveness. This study used data of Central Java’s Gross Domestic Regional Product (GDRP and Gross National Product (GNP on 2010-2015, Input Output Table on 2013, as

  16. ANALISIS KEMAMPUAN MENATA ARSIP SISWA JURUSAN ADMINISTRASI PERKANTORAN

    Directory of Open Access Journals (Sweden)

    Bunga Aprilia Kartini

    2016-02-01

    Full Text Available Salah satu kemampuan yang harus dimiliki Program Administrasi Perkantoran adalah kompetensi dasar penataan dokumen. Kompetensi yang diharapkan dari kompetensi penataan dokumen adalah dapat menyimpan dan menemukan kembali dokumen/arsip sesuai dengan sistem yang diterapkan dalam perusahaan. Pembelajaran yang terjadi di SMK PGRI 2 Salatiga, siswa jurusan Administrasi Perkantoran tidak mendapatkan praktik menemukan kembali arsip/dokumen serta tidak ada laboratorium khusus kearsipan. Hal ini tentu akan mempengaruhi kemampuan lulusan dari siswa-siswanya. Kemampuan tersebut akan berujung pada kemampuan lulusan dalam memenuhi standar kerja suatu perusahaan atau organisasi. Populasi dalam penelitian ini yaitu seluruh siswa kelas XI Jurusan Administrasi Perkantoran SMK PGRI 2 Salatiga yang terdiri dari 2 kelas dengan jumlah 64 siswa. Penelitian ini merupakan penelitian deskriptif kuantitatif dengan teknik pengumpulan data menggunakan metode wawancara, observasi dan kuesioner. Teknik analisis data yang digunakan adalah dengan angka indeks. Hasil Penelitian menunjukan bahwa rata-rata kemampuan siswa dalam menata dokumen/arsip dengan angka indeks adalah sebesar 68,85 hal tersebut menunjukkan bahwa siswa umumnya memiliki kemampuan yang sedang, walaupun secara teori pemahaman siswa sudah cukup baik namun secara praktik siswa masih memiliki kekurangan yaitu siswa kurang menguasai dalam praktik mengindeks, memberikan kode penyimpanan, pencatatan kartu pinjam arsip, membaca kode penyimpanan dan prosedur penemuan kembali arsip/dokumen. Siswa juga belum diajarkan praktik penyimpanan sistem wilayah, sistem nomor dan sistem subjek/perihal sehingga kemampuan meraka dalam sistem penyimpanan tersebut masih kurang serta siswa juga belum diajarkan praktik penemuan kembali surat/arsip. Office Administration program is one of the must have skills that are the basis of the competencies document setup. Learning happens in SMK PGRI 2 Salatiga , students in Administrative

  17. ANALISIS COSTEFFECTIVENESS PENGENDALIAN HAYATI MENGGUNAKAN Bacillusthuringiensis H-14 GALUR LOKAL

    Directory of Open Access Journals (Sweden)

    Retno Ambar Yuniarti

    2014-06-01

    .Costeffectiveness analysis(CEA merupakan salah satu alat untukmembantumengambil keputusan. Analisis tersebutdipergunakanuntukmembandingkantingkatefisiensi beberapaprogram. Tujuan umum penelitian adalah mendapatkan cost effectivenessmodel pengendalian vektor malaria secara hayati menggunakanB.thuringiensisH-14galurlokal.Tujuan khusus penelitian adalah Membandingkancost effectiveness penggunaan Bacillusthuringiensis H-14 galur lokal denganB.thuringiensis H-14 galur luar dalam mengendalikanjentiknyamuk vektor malariaAnophelessp.Penelitian dilakukan pada Bulan Maret sampai Desember 2006 di Balai Besar Penelitiandan PengembanganVektor dan Reservoir Penyakit (B2P2VRP, Salatiga. Desainpenelitianadalahpenelitianobservasional(observational research.Data dikumpulkan secararetrospektif,selama 1tahun penelitian. Datadianalisis secara statistik menggunakanprogramExceluntukmenghitungCost effectiveness ratio(CER dengan discount rate 10%. Dalammenganalisisefektivitasbiaya(CEA dengancaramenghitungrasio efektivitasbiaya(CER. ApabilanilaiCERdariagenpengendalianvektoryangdigunakanlebih tinggi daripadayangdiperbandingkanmakadikatakanagentersebutlebih efisien daripadaagen yangdiperbandingkanatausebaliknya.Hasilpenelitianmenunjukkanbahwamodelpengendalianvektormalaria An. sundaicusmenggunakanB. thuringiensisH-14galurlokal lebih cost effective daripadamenggunakanB.thuringiensisH-14galurluar, dengan Cost effectiveness ratio(CER padaB. thuringiensisH-14galurlokal sebesar6,49x10"7danpadafi.thuringiensisH-14galurluar sebesar3,23x10"7.Katakunci: Costeffectivenessanalysis,B.thuringiensis,An.sundaicus

  18. ANALISIS KARAKTER WISATAWAN MANCANEGARA TERHADAP FASILITAS WISATA KAWASAN PRAWIROTAMAN

    Directory of Open Access Journals (Sweden)

    Reiza Miftah Wirakusuma

    2016-03-01

    , pengrajin batik dan suasana akomodasi yang santai menjadikan nilai yang sangat berharga bagi suatu daya tarik wisata. Dengan adanya perkembangan teknologi dan semakin tingginya persaingan perhotelan di Yogyakarta, Lalu bagaimanakah dengan kondisi saat ini? penelitian ini akan mengungkap apa yang mempengaruhi wisatawan mancanegara datang ke kawasan Prawirotaman. Temuan-temuan yang dihasilkan yaitu Wisatawan Mancanegara didominasi 5 besar kewarganegaraan: Belanda, Jerman, Perancis, USA, dan Jepang. Dari hasil analisis dapat disimpulkan bahwa (1 Adanya pengaruh secara parsial antara variabel daya tarik terhadap kunjungan wisatawan mancanegara. Hal ini menyatakan bahwa variabel Daya Tarik dapat berpengaruh secara mandiri tanpa variabel lain. Hal ini juga menandakan bahwa kekuatan daya tarik kawasan yang utama adalah keragaman kompleks kuliner internasional dengan harga yang terjangkau disamping suasana dan ketersediaan akomodasi. (2 Karakter wisatawan mancanegara mempengaruhi kombinasi dari produk wisata yang ditawarkan Kawasan Prawirotaman. Perlu diketahui bahwa karakter segmentasi demografis ternyata lebih dominan untuk menentukan pola perjalanan. kesimpulannya, wisatawan mancanegara dibagi berdasarkan usia seperti Youth Travelers (Independent or Couple, Honeymooners, Retirement, and Family with infant or younger children. Berdasarkan data sekunder dan pengamatan, segmentasi Youth Travelers bersifat sangat sensitif terhadap harga dan pengguna internet yang sangat aktif, lalu segmentasi Retirement and Family lebih berorientasi pada kenyamanan fasilitas dan privacy. Terakhir, Honeymooners merupakan kombinasi dari keduanya. Kata kunci: Produk Wisata, Prawirotaman, Persepsi, Karakter, Wisatawan Mancanegara

  19. Analisis Model Relasional Jejaring Sebagai Katalisator Dalam Membangun Kinerja Bisnis

    Directory of Open Access Journals (Sweden)

    Ahmad Sidiq

    2018-01-01

    Full Text Available Abstrak Kesuksesan entrepreneur diukur dari kehandalannya menggabungkan atau mengkombinasikan aset berwujud dan tak berwujud yang dimiliki UKM sehingga mampu mendobrak semua hambatan yang dihadapi UKM yaitu keterbatasan akses pasar dan akses modal, sumber daya yang cenderung rendah, minimnya modal kerja maupun rendahnya kemampuan untuk memanfaatkan peluang pasar yang ada. Berbagai perilaku yang digunakan entrepreneur dalam menjalankan bisnisnya maupun berinteraksi dengan stakeholder mengarah pada relasional jejaring dan kompetensi sosial yang harus dimiliki oleh seorang entrepreneur. Penelitian ini bertujuan untuk menguji faktor yang mampu memperluas relasional jejaring entrepreneur dan faktor konsekuensi dari adanya relasional jejaring yang dimiliki oleh seorang entrepreneur. Faktor-faktor tersebut sangat berkaitan dengan pencapaian kinerja bisnis pada UKM. Populasi penelitian ini adalah UKM sektor manufaktur di wilayah Surakarta dengan sampel sebanyak 127 UKM. Metode pemilihahan sampel adalah convenience sampling dan dianalisis menggunakan Structural Equation Modeling (SEM dengan bantuan Partial Least Square (PLS dalam pengolahan data penelitian. Hasil analisis data menunjukkan kinerja bisnis dapat dijelaskan oleh kompetensi sosial, relasional jejaring dan orientasi berbagi pengetahuan sebesar 69.5%. Adapun hasil pengujian hipotesis menunjukkan kinerja bisnis dipengaruhi oleh kompetensi sosial, relasional jejaring dan orientasi berbagi pengetahuan. Selain itu kompetensi sosial berpengaruh pada relasional jejaring dan relasional jejaring memberi pengaruh pada orientasi berbagi pengetahuan.  Kata Kunci : kompetensi sosial, relasional jejaring, berbagi pengetahuan, kinerja bisnis Abstract The success of the entrepreneur is measured by reliability merge or combine the tangible assets and intangible owned by SMEs so as to break down all the barriers faced by SMEs is limited access to markets and access to capital, resources tend to be low, the

  20. ANALISIS PENGARUH UMUR, PENDIDIKAN, DAN UPAH TERHADAP PRODUKTIVITAS TENAGA KERJA

    Directory of Open Access Journals (Sweden)

    Zakaria Firmansyah

    2017-06-01

    Full Text Available Produktivitas merupakan salah satu indikator yang paling penting dari kegiatan ekonomi. Produktivitas merupakan pendorong utama pertumbuhan ekonomi penting, yaitu sebagai leverage (leverage untuk pertumbuhan ekonomi nasional dalam jangka panjang. Itulah salah satu alasan mengapa negara-negara saat ini banyak telah berusaha untuk meningkatkan  produktivitas. Masalah ketenagakerjaan didominasi oleh kemampuan produktivitas tenaga kerja masih belum memadai baik dari segi pendidikan, pengalaman kerja dan lain-lain Satu hanya untuk pekerja di mitra industri rambut Purbalingga bahwa sebagian besar pekerja perempuan tersebut. Data dianalisis menggunakan analisis deskriptif kuantitatif, Regresi Pengujian, dan Asumsi Klasik Uji. Hasil yang diperoleh menunjukkan bahwa secara bersama-sama Umur, Pendidikan, dan Upah dampak positif dan signifikan terhadap produktivitas tenaga kerja di rambut Industri Mitra Purbalingga dibuktikan dari hasil uji F untuk dan nilai prob. F-hitung (0.000000 <5%. R2 = 0,98673. berarti bahwa 98,6 persen dari kemampuan variasi set variabel independen (independent yang digunakan dalam model ini dapat menjelaskan variasi dalam produktivitas tenaga kerja di mitra industri rambut di Purbalingga. Sedangkan 1,4 persen sisanya  dipengaruhi  oleh  variasi dalam variabel dependen dijelaskan oleh variabel lain di luar model yang digunakan dalam penelitian ini. Kesimpulan dari penelitian ini adalah sebagian yaitu 3 variabel independen digunakan untuk memiliki pengaruh yang signifikan pada α = 5% dari produktivitas tenaga kerja di mitra Industri Rambut di Purbalingga variabel ini adalah usia, pendidikan, dan Upah. Productivity is one of the most important indicator of economic activity . Productivity is a key driver of economic growth vital , namely as leverage ( leverage for national economic growth in the long term. That's one reason why today many countries have sought to improve productivity. Employment issues are dominated by the

  1. Evaluation of Inflammatory Cytokine Secretion by Human Alveolar Macrophages

    Directory of Open Access Journals (Sweden)

    J. E. Losa García

    1999-01-01

    Full Text Available The alveolar macrophage (AM secretes interleukin 1β (IL-1β, tumour necrosis factor-α (TNF-α, interleukin-6 (IL-6 and interleukin-8 (IL-8, all of them inflammatory cytokines involved in the pathogenesis of many lung diseases. The aim of the present work was to evaluate the basal and stimulated secretion of these cytokines by human AMs. Human AMs were collected by bronchoalveolar lavage (BAL from four healthy controls and 13 patients with diffuse interstitial lung disease (five cases of sarcoidosis, three of hypersensitivity pneumonitis and five of idiopathic pulmonary fibrosis. AMs were cultured in the presence or absence of different concentrations of lipopolysaccharide (LPS, phorbolmyristate and gammainterferon. IL-1β, TNF-α, IL-6 and IL-8 levels were measured in BAL fluid and culture supernatant using specific enzyme-linked immunosorbent assays. The substance found to stimulate the secretion of inflammatory cytokines to the greatest extent was LPS at a concentration of 10 μg/ml. Regarding the secretion of IL-1β, four observations were of interest: basal secretion was very low; LPS exerted a potent stimulatory effect; considerable within-group variability was observed; and there were no significant differences in the comparisons among groups. With respect to TNF-α secretion, the results were similar. The only striking finding was the higher basal secretion of this cytokine with respect to that of IL-1β. Regarding the secretion of IL-6, the same pattern followed by TNF-α was found. However, it should be stressed that the increase induced by LPS was smaller than in the two previous cytokines. Regarding the secretion of IL-8, three findings were patent: the strong basal secretion of this cytokine; the moderate increase induced by LPS; and the existence of significant differences among the different groups with respect to the stimulated secretion of this cytokine, which reached maximum values in patients with idiopathic pulmonary

  2. Alveolar epithelial type II cells induce T cell tolerance to specific antigen

    DEFF Research Database (Denmark)

    Lo, Bernice; Hansen, Søren; Evans, Kathy

    2008-01-01

    The lungs face the immunologic challenge of rapidly eliminating inhaled pathogens while maintaining tolerance to innocuous Ags. A break in this immune homeostasis may result in pulmonary inflammatory diseases, such as allergies or asthma. The observation that alveolar epithelial type II cells (Ty...

  3. Inflammatory response and barrier properties of a new alveolar type 1-like cell line (TT1).

    NARCIS (Netherlands)

    Bogaard, E.H.J. van den; Dailey, L.A.; Thorley, A.J.; Tetley, T.D.; Forbes, B.

    2009-01-01

    PURPOSE: To evaluate the inflammatory response and barrier formation of a new alveolar type 1-like (transformed type I; TT1) cell line to establish its suitability for toxicity and drug transport studies. METHODS: TT1 and A549 cells were challenged with lipopolysaccharide (LPS). Secretion of

  4. Healing of Horizontal Intra-alveolar Root Fractures after Endodontic Treatment with Mineral Trioxide Aggregate.

    Science.gov (United States)

    Kim, Dohyun; Yue, Wonyoung; Yoon, Tai-Cheol; Park, Sung-Ho; Kim, Euiseong

    2016-02-01

    The purpose of this retrospective study was to evaluate the healing type and assess the outcome of horizontal intra-alveolar root fractures after endodontic treatment with mineral trioxide aggregate (MTA) as filling material. The clinical database of the Department of Conservative Dentistry at Yonsei University Dental Hospital, Seoul, Korea, was searched for patients with histories of intra-alveolar root fractures and endodontic treatments with MTA between October 2005 and September 2014. Radiographic healing at the fracture line was evaluated independently by 2 examiners and was classified into 4 types according to Andreasen and Hjørting-Hansen. Of the 22 root-fractured teeth that received endodontic treatment with MTA, 19 cases participated in the follow-up after a period of at least 3 months. Seventeen of the 19 teeth (89.5%) exhibited healing of the root fractures. For each healing type, 7 teeth (36.8%) showed healing with calcified tissue, 8 teeth (42.1%) showed interposition of connective tissue, 2 teeth (10.5%) showed interposition of connective tissue and bone, and 2 teeth (10.5%) showed interposition of granulation tissue without healing. Within the limitations of this study, intra-alveolar root fractures showed satisfactory healing outcomes after endodontic treatment with MTA. MTA could be considered to be suitable filling material for the endodontic treatment of horizontal intra-alveolar root fractures. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  5. ALVEOLAR BONE REGENERATION AFTER DEMINERALIZED FREEZE DRIED BONE ALOGRAFT (DFDBA BONE GRAFTING

    Directory of Open Access Journals (Sweden)

    Sri Oktawati

    2006-04-01

    Full Text Available Periodontal treatment by conventional way will result in healing repair, which easily cause recurrence. Modification of treatment should be done to get an effective result, that is the regeneration of alveolar bone and to reduce inflammation. The objective of this study is to determine the alveolar bone regeneration after using DFDBA (Demineralized Freeze Dried Bone Allograft. Quasi experimental designs with pre and post test method was used in this study. From 13 patients, 26 defects got conventional or regenerative treatment. The indicator of alveolar bone regenaration in bone height in radiographic appearance and level of osteocalsin in gingival crevicular fluid (GCF were checked before and after the treatment, then the changes that occurred were analyzed. The result of the research showed that alveolar bone regeneration only occurred to the group of regenerative treatment using DFDBA. The conclusion is the effective periodontal tissue regeneration occurred at regenerative treatment by using DFDBA, and the osteocalsin in GCF can be used as indicator of bone growth.

  6. Post-extraction application of beta-tricalcium phosphate in alveolar socket

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Corcuera

    2015-03-01

    Full Text Available Aim The objective of this study was to assess the capacity of beta-tricalcium phosphate to facilitate bone formation in the socket and prevent post-extraction alveolar resorption. Materials and methods After premolar extraction in 16 patients, the sockets were filled with beta-tricalcium phosphate. Six months later, during the implant placement surgery, a trephine was used to harvest the bone samples which were processed for histological and histomorphometrical analyses. Data were gathered on patient, clinical, histological and histomorphometric variables at the extraction and implant placement sessions, using data collection forms and pathological reports. Results Clinical outcomes were satisfactory, the biomaterial was radio-opaque on X-ray. Histological study showed: partial filling with alveolar bone of appropriate maturation and mineralization for the healing time, osteoblastic activity and bone lacunae containing osteocytes. The biomaterial was not completely resorbed at six months. Conclusion Beta-tricalcium phosphate is a material capable of achieving preservation of the alveolar bone when it is positioned in the immediate post-extraction socket followed by suture; it also helps the formation of new bone in the socket. Further studies are needed comparing this technique with other available biomaterials, with growth factors and with sites where no alveolar preservation techniques are performed.

  7. beta-TCP Versus Autologous Bone for Repair of Alveolar Clefts in a Goat Model.

    NARCIS (Netherlands)

    Ruiter, A. de; Meijer, G.J.; Dormaar, T.; Janssen, N.; Bilt, A. van der; Slootweg, P.J.; Bruijn, J. de; Rijn, L. van; Koole, R.A.

    2011-01-01

    Objective : The aim of this study in goats was to test the hypothesis that a novel synthetic bone substitute beta tricalcium phosphate (beta-TCP) can work as well as autologous bone harvested from the iliac crest for grafting and repair of alveolar clefts. Design : Ten adult Dutch milk goats ( Capra

  8. Evaluation of the effect of platelet-rich fibrin on the alveolar osteitis ...

    African Journals Online (AJOL)

    Evaluation of the effect of platelet-rich fibrin on the alveolar osteitis incidence and periodontal probing depth after extracting partially erupted mandibular third ... Conclusions: PRF significantly reduced the AO incidence among smokers and had a positive effect on postoperative pain levels but not on periodontal healing.

  9. B Cell IgD Deletion Prevents Alveolar Bone Loss Following Murine Oral Infection

    Directory of Open Access Journals (Sweden)

    Pamela J. Baker

    2009-01-01

    and CD4+ T cells in immune normal mice compared to IgD deficient mice. These data suggest that IgD is an important mediator of alveolar bone resorption, possibly through antigen-specific coactivation of B cells and CD4+ T cells.

  10. The sloping alveolar plateau of tracer gases washed out from mixed venous blood in man

    NARCIS (Netherlands)

    Schrikker, A.C.M.; Vries, W.R. de; Zwart, A.; Luijendijk, S.C.M.

    1989-01-01

    We have investigated the slope of the alveolar plateau for inert tracer gases that were washed out from mixed venous blood. Two pairs of tracer gases were used (He, SFe) and (C2H2, Freon 22). The gases of each pair share almost the same blood-gas partition coefïicient but they have different

  11. Crazy paving pattern caused by pulmonary alveolar proteinosis: CT findings and the pathologic basis.

    Science.gov (United States)

    Luo, Jianguang; Yang, Dongyi; Zhou, Shunke; Xiao, Enhua; Chen, Ping; Fan, Songqing; Liu, Jun

    2014-09-01

    To explore CT findings and pathologic basis of crazy paving pattern caused by pulmonary alveolar proteinosis. Twenty-four patients who were diagnosed pathologically as pulmonary alveolar proteinosis by transbronchial lung biopsy and bronchoalveolar lavage fluid from June 2006 to May 2012 were included in this retrospective study. All patients underwent a 64-slice CT of the lungs. CT findings: crazy paving pattern was observed on CT imaging of all 24 patients. In 23 patients, crazy paving pattern displayed strip-shaped opacities with smooth edges, and there was a clear boundary between the pathological and normal lung tissues. The reticular opacities were connected with peripheral blood vessels and the branches were formed, and their diameters decreased slightly. Microscopically, hemangiectasis were seen in 17 patients. Crazy paving pattern caused by pulmonary alveolar proteinosis displayed clear edges, and smooth reticular opacities, most of which were due to hemangiectasis of interlobular, interacinar and interalveolar septa. These findings of CT are helpful for the specific diagnosis of pulmonary alveolar proteinosis.

  12. Inferior alveolar nerve injury with laryngeal mask airway: a case report.

    LENUS (Irish Health Repository)

    Hanumanthaiah, Deepak

    2011-01-01

    The incidence of damage to the individual cranial nerves and their branches associated with laryngeal mask airway use is low; there have been case reports of damage to the lingual nerve, hypoglossal nerve and recurrent laryngeal nerve. To the best of our knowledge we present the first reported case of inferior alveolar nerve injury associated with laryngeal mask airway use.

  13. Massive gingival enlargement and alveolar bone loss: report of two cases.

    Science.gov (United States)

    Schmidt, B L; Pogrel, M A; Perrott, D H; Regezi, J A

    1995-09-01

    We present two cases of massive gingival enlargement and osteolysis of alveolar bone in a 30-year-old female and a 36-year-old male. The etiology could not be established in either case. Histologically, both lesions contained hyperplastic fibrous connective tissue and intense plasma cell infiltrates. Both patients responded well to extensive gingivectomy, extraction of all teeth, and alveoplasty.

  14. Alveolar Capillary Dysplasia with Misalignment of Pulmonary Veins (ACD/MPV): A Case Series.

    Science.gov (United States)

    Miranda, Joana; Rocha, Gustavo; Soares, Henrique; Vilan, Ana; Brandão, Otília; Guimarães, Hercília

    2013-01-01

    Alveolar capillary dysplasia with misalignment of pulmonary veins (ACD/MPV) is a rare, fatal, developmental lung disorder, which usually presents as persistent pulmonary hypertension of the newborn (PPHN) unresponsive to treatment. The authors present their own experience with three cases admitted during the last 15 years.

  15. Differential gene expression profiling of Actinobacillus pleuropneumoniae during induction of primary alveolar macrophage apoptosis in piglets

    NARCIS (Netherlands)

    Wang, Lei; Qin, Wanhai; Ruidong, Zhai; Liu, Shiting; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P. R.; Lei, Liancheng

    2015-01-01

    Actinobacillus pleura pneumoniae (A. pleuropneumoniae) is the causative agent of porcine pleuropneumonia, a disease that causes serious problems for the swine industry. Successful infection by this bacterium requires breaking the first line of defence in the lungs, the primary alveolar macrophages

  16. A multivariate statistical analysis on variables affecting inferior alveolar nerve damage during third molar surgery.

    Science.gov (United States)

    Pippi, R; Santoro, M

    2015-08-28

    The risk factors associated with inferior alveolar nerve damage during third molar surgery were investigated. Surgeries performed during a period of 50 months by a single expert surgeon were reviewed. Only those surgeries that met the selected inclusion criteria were considered for this study. The following tests were applied for the statistical analysis: the Kolmogorov-Smirnov test, the principal components analysis, the Mann-Whitney U test, the two-tailed exact Fisher test and the Bonferroni sequential correction. The surgical difficulty index, multi-rooted third molars and changes in the inferior alveolar nerve running in relation to the tooth roots are predictors of nerve damage. Computed tomography is mandatory when the nerve is superimposed on the tooth root on the ortopantomography. SCIENTIFIC RATIONALE FOR STUDY: Lower third molar extraction is one of the most common procedures in oral and maxillofacial surgery, and it is burdened by the risk of inferior alveolar nerve damage. Understanding which factors are able to predict this complication is therefore essential in correctly programming surgery. Surgical difficulty index, multi-rooted third molars and changes in inferior alveolar nerve running in relation to the tooth roots are predictors of nerve damage. If, on the orthopantomography, the nerve is superimposed on the tooth root, a computed tomography is mandatory to define all of these variables.

  17. 3D computed tomographic evaluation of secondary alveolar bone grafts in cleft lip and palate patients

    International Nuclear Information System (INIS)

    Ohkubo, Fumio; Akai, Hidemi; Hosaka, Yoshiaki

    2001-01-01

    Alveolar bone grafting in patients with cleft lip and palate has becomes a routine part of most treatment regimes. This study was undertaken to estimate how much bone needs to be grafted into the cleft cavity and to evaluate the grafted bone using 3-DCT over a period from the early postoperative stage to after one year. Seventy-five patients divided into four groups according to the type of cleft were studied. All patients underwent secondary alveolar bone grafting using particulate cancellous bone from the anterior iliac crest. The bone graft areas were divided into two regions: the extra-cleft region and the intra-cleft region. The weight and the volume of the grafted bone were correlated and the average density was 1.5 g/ml regardless of the cleft type. The bone in the extra-cleft region could be seen in almost all slices of the CT scans, from the lower alveolar process to the piriform aperture. The extra-cleft graft ratio of unilateral and bilateral cleft lip and palate is higher than that of cleft lip and alveolus. The extra-cleft grafting is necessary to restore facial symmetry. The grafted bone was decreased in both height and volume following three months and adequate bone bridging was maintained for one year. We concluded that 3-DCT findings are one of the most valuable methods to evaluate postoperative conditions after alveolar bone grafting. (author)

  18. 3D computed tomographic evaluation of secondary alveolar bone grafts in cleft lip and palate patients

    Energy Technology Data Exchange (ETDEWEB)

    Ohkubo, Fumio; Akai, Hidemi; Hosaka, Yoshiaki [Showa Univ., Tokyo (Japan). School of Medicine

    2001-04-01

    Alveolar bone grafting in patients with cleft lip and palate has becomes a routine part of most treatment regimes. This study was undertaken to estimate how much bone needs to be grafted into the cleft cavity and to evaluate the grafted bone using 3-DCT over a period from the early postoperative stage to after one year. Seventy-five patients divided into four groups according to the type of cleft were studied. All patients underwent secondary alveolar bone grafting using particulate cancellous bone from the anterior iliac crest. The bone graft areas were divided into two regions: the extra-cleft region and the intra-cleft region. The weight and the volume of the grafted bone were correlated and the average density was 1.5 g/ml regardless of the cleft type. The bone in the extra-cleft region could be seen in almost all slices of the CT scans, from the lower alveolar process to the piriform aperture. The extra-cleft graft ratio of unilateral and bilateral cleft lip and palate is higher than that of cleft lip and alveolus. The extra-cleft grafting is necessary to restore facial symmetry. The grafted bone was decreased in both height and volume following three months and adequate bone bridging was maintained for one year. We concluded that 3-DCT findings are one of the most valuable methods to evaluate postoperative conditions after alveolar bone grafting. (author)

  19. Mast cell-associated alveolar inflammation in patients with atopic uncontrolled asthma

    OpenAIRE

    Andersson, Cecilia; Bergqvist, Anders; Mori, Michiko; Mauad, Thais; Bjermer, Leif; Erjefält, Jonas

    2011-01-01

    Background: A significant proportion of patients with asthma have persistent symptoms despite treatment with inhaled glucocorticosteroids. Objective: We hypothesized that in these patients, the alveolar parenchyma is subjected to mast cell-associated alterations. Methods: Bronchial and transbronchial biopsies from healthy controls (n = 8), patients with allergic rhinitis (n = 8), and patients with atopic uncontrolled asthma (symptoms despite treatment with inhaled glucocorticosteroids; mean d...

  20. Alveolar Antral Artery: Review of Surgical Techniques Involving this Anatomic Structure

    Directory of Open Access Journals (Sweden)

    Amin Rahpeyma

    2014-04-01

    Full Text Available Introduction: The horizontal bony canal in the lateral maxillary wall is the site of anastomosis between the arterial branches from the posterior superior alveolar artery (PSAa and the infraorbital artery. This anatomic structure is known as the ‘alveolar antral artery’.   Materials and Methods: We performed a literature review. The anatomic location of the alveolar antral artery in the lateral maxillary sinus wall was researched and its importance in surgical procedures routinely performed on this bony wall discussed.   Results: This artery can be accidentally involved during surgical procedures on the lateral maxillary sinus wall, such as open sinus lift surgery, horizontal osteotomy of the maxilla, Le Fort I fracture treatment, and Caldwell-Luc surgeries.   Conclusion: The alveolar antral artery is an important anatomic structure in the lateral maxillary sinus wall. A preoperative cone beam computed tomography (CBCT scan can be used as a good diagnostic procedure to reduce surgical complications in suspected cases as well as conditions that may involve this artery. 

  1. The Ovariectomized Rat as a Model for Studying Alveolar Bone Loss in Postmenopausal Women

    Directory of Open Access Journals (Sweden)

    Bryan D. Johnston

    2015-01-01

    Full Text Available In postmenopausal women, reduced bone mineral density at the hip and spine is associated with an increased risk of tooth loss, possibly due to a loss of alveolar bone. In turn, having fewer natural teeth may lead to compromised food choices resulting in a poor diet that can contribute to chronic disease risk. The tight link between alveolar bone preservation, tooth retention, better nutritional status, and reduced risk of developing a chronic disease begins with the mitigation of postmenopausal bone loss. The ovariectomized rat, a widely used preclinical model for studying postmenopausal bone loss that mimics deterioration of bone tissue in the hip and spine, can also be used to study mineral and structural changes in alveolar bone to develop drug and/or dietary strategies aimed at tooth retention. This review discusses key findings from studies investigating mandible health and alveolar bone in the ovariectomized rat model. Considerations to maximize the benefits of this model are also included. These include the measurement techniques used, the age at ovariectomy, the duration that a rat is studied after ovariectomy and habitual diet consumed.

  2. EFFECTS OF DIESEL EXHAUST PARTICLES ON HUMAN ALVEOLAR MACROPHAGE RESPONSIVENESS TO LIPOPOLYSACCHARIDE

    Science.gov (United States)

    Effects of diesel exhaust particles on human alveolar macrophage responsiveness to lipopolysaccharideS. Mundandhara1 , S. Becker2 and M. Madden2, 1UNC Center for Environmental Medicine, Asthma, and Lung Biology, 2US EPA, NHEERL, HSD, Chapel Hill, NC, USEpidemiological...

  3. Validation of a dental image analyzer tool to measure alveolar bone loss in periodontitis patients

    NARCIS (Netherlands)

    Teeuw, W.J.; Coelho, L.; de Silva, A.; van der Palen, C.J.N.M.; Lessmann, F.G.J.M.; van der Velden, U.; Loos, B.G.

    2009-01-01

    Background and Objective:  Radiographs are an essential adjunct to the clinical examination for periodontal diagnoses. Over the past few years, digital radiographs have become available for use in clinical practice. Therefore, the present study investigated whether measuring alveolar bone loss,

  4. Stimulation of DNA synthesis in cultured rat alveolar type II cells

    International Nuclear Information System (INIS)

    Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

    1985-01-01

    Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated 3 H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of 3 H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture

  5. Outcomes of Alveolar Ridge Preservation With Recombinant Human Bone Morphogenetic Protein-2: A Systematic Review.

    Science.gov (United States)

    Moslemi, Neda; Khoshkam, Vahid; Rafiee, Sahar; Bahrami, Naghmeh; Aslroosta, Hoori

    2018-02-01

    The main focused question of this systematic review was as follows: Does the application of recombinant human bone morphogenetic protein-2 (rhBMP-2) placed in extraction sockets reduce the alveolar ridge changes? A systematic literature search was performed up to February 2017. Clinical studies published in English were included. Outcome variables of interest were as follows: changes in alveolar ridge width and height, the quality of new bone, patient's safety, adverse events, and postoperative complications. Seven articles were included. Because of the vast heterogeneity and high risk of bias among the studies, performing a meta-analysis deemed not feasible. Application of rhBMP-2 in the extraction socket was more effective in the reduction of ridge width compared with that of ridge height. The superiority of 1.5 mg/mL rhBMP-2/absorbable collagen sponge over the carrier alone on alveolar ridge width/height remodeling was more significant when it was applied in the sockets with ≥50% buccal bone dehiscence. The limited available data showed that rhBMP-2 did not improve the quality of new bone. Antibodies against rhBMP-2 were detected in the serum in 1 trial. Within the limits of this review, 1.5 mg/mL rhBMP-2 might be beneficial for preserving the alveolar ridge width within extraction sockets given as to whether the cost-effectiveness is justifiable. Studies with lower risk of bias should be performed to confirm the above findings.

  6. Post traumatic immediate GBR: alveolar ridge preservation after a comminuted fracture of the anterior maxilla.

    Science.gov (United States)

    Kim, Yongsoo; Leem, Dae Ho

    2015-04-01

    Without a proper intervention, a crushed alveolar process fracture can cause significant dimensional changes on affected hard and soft tissue that lead to difficult circumstances for post traumatic bone augmentation and dental implant placement. We present herein the cases of immediate guided bone regeneration (GBR) for the maxillary anterior alveolar process with comminuted fracture. Shortly after the hospital visit, guided bone regeneration was conducted for three patients using only xenograft material and bone fragments from traumatic site, without an additional donor site. Resorbable collagen membrane was used on the bone graft site, and titanium mesh was also used if significant bone loss were expected. Radiographic evaluation 6 months after GBR confirmed that all three cases had sufficiently preserved alveolar bone which is clinically required for implant placement. Dental implant installation was carried out for two patients and no specific findings were noted in follow-up after the placement. In this method, additional operation sites for bone collection are not necessary and the number of surgical steps before implant placement can be reduced. Furthermore, this immediate intervention can effectively minimize the alveolar ridge shrinkage of anterior maxilla after injury. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Titanium implant insertion into dog alveolar ridges augmented by allogenic material

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Donath, K

    1994-01-01

    The purpose of this investigation was to evaluate whether titanium endosseous implants would osseointegrate in dog alveolar ridges augmented by allogenic material. In 8 dogs en bloc resection, including 2 pre-molars, was performed bilaterally in the maxilla and the mandible. After a healing period...

  8. Endogenous opioids regulate alveolar bone loss in a periodontal disease model.

    Science.gov (United States)

    Queiroz-Junior, Celso M; Maltos, Kátia L M; Pacheco, Daniela F; Silva, Tarcília Aparecida; Albergaria, Juliano D S; Pacheco, Cinthia M F

    2013-10-06

    The anti-inflammatory effects of exogenous opioid compounds have been demonstrated in several conditions. Nevertheless, the function of endogenous opioid peptides released by the host during inflammatory processes deserves further characterization. The aim of this study was to verify whether endogenous opioids are involved in the progression of the inflammatory alveolar bone loss induced by ligature in rats. The experimental model of periodontal disease (PD) induced by ligature in rats was used throughout the study. A silk ligature was placed around the 2nd upper molar of male Holtzman rats, for 7 days. Rats received different doses of either the non-selective opioid antagonist naloxone or vehicle, locally into the afflicted gingival tissue, from the 3rd to the 5th day after ligature placement. In the 7th experimental day, rats were euthanized and their maxillae were collected for evaluation of alveolar bone and fiber attachment loss, presence of neutrophils (myeloperoxidase assay), osteoclast amount, and levels of cytokines IL-6, TNF-α, IL-8 and IL-10 in periodontal tissues. Naloxone increased alveolar bone loss significantly, in a dose-dependent manner, in relation to vehicle-treated rats. In contrast, the opioid antagonist did not affect the loss of fiber attachment. The treatment with naloxone also induced a significant increase in myeloperoxidase levels, osteoclast number and cytokines in periodontal tissues of rats with ligature-induced PD. Endogenous opioids protect the host from the progression of inflammatory alveolar bone loss that occurs in chronic periodontitis. © 2013.

  9. A Potent Tartrate Resistant Acid Phosphatase Inhibitor to Study the Function of TRAP in Alveolar Macrophages

    NARCIS (Netherlands)

    Boorsma, Carian E; van der Veen, T. Anienke; Putri, Kurnia S S; de Almeida, Andreia; Draijer, Christina; Mauad, Thais; Fejer, Gyorgy; Brandsma, Corry-Anke; van den Berge, Maarten; Bossé, Yohan; Sin, Don; Hao, Ke; Reithmeier, Anja; Andersson, Göran; Olinga, Peter; Timens, Wim; Casini, Angela; Melgert, Barbro N

    2017-01-01

    The enzyme tartrate resistant acid phosphatase (TRAP, two isoforms 5a and 5b) is highly expressed in alveolar macrophages, but its function there is unclear and potent selective inhibitors of TRAP are required to assess functional aspects of the protein. We found higher TRAP activity/expression in

  10. p53 alterations in atypical alveolar hyperplasia of the human lung

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M. J.; Offerhaus, G. J.; Askin, F. B.; Hruban, R. H.; Westra, W. H.

    1998-01-01

    Atypical alveolar hyperplasia (AAH) is a potential precursor lesion from which lung adenocarcinomas arise and may be a good target for studying the early events of lung tumorigenesis. We have previously shown that AAHs are neoplastic epithelial proliferations that often harbor activating mutations

  11. Alveolar soft-part sarcoma of the orbit | Rose | African Journal of ...

    African Journals Online (AJOL)

    Alveolar soft-part sarcoma (ASPS) is a rare soft tissue tumour of uncertain cellular origin. It accounts for only 1% of all sarcomas, which themselves represent only a small proportion of human tumours. ASPS can arise in any soft tissue of the body, but there is an unexplained predilection for the right side. The most common ...

  12. Mammary alveolar epithelial cells convert to brown adipocytes in post-lactating mice

    DEFF Research Database (Denmark)

    Giordano, Antonio; Perugini, Jessica; Kristensen, David Møbjerg

    2017-01-01

    found close to the mammary alveoli contain milk protein granules. Use of the Cre-loxP recombination system allowed showing that the involuting mammary gland of whey acidic protein-Cre/R26R mice, whose secretory alveolar cells express the lacZ gene during pregnancy, contains some X...

  13. Diesel and biodiesel exhaust particle effects on rat alveolar machrophages with in vitro exposure

    Science.gov (United States)

    We conducted in vitro exposures of Wistar rat alveolar macrophages (AM) to compare and contrast the toxicity of particulate matter (PM) produced in combustion of biodiesel blend (B20) and petroleum diesel (PDEP). The PM contain detectable levels of transition metals and ions howe...

  14. [Alveolar echinococcosis in the French province of Ardennes: isolated case or new focus?].

    Science.gov (United States)

    Depaquit, J; Gallego, A; Usseglio, F; Liance, M; Favriel, J M

    1998-09-01

    The first three autochthonous cases of alveolar echinococcosis were diagnosed in the Ardennes area (France). This is the most occidental localization of this disease in Northern Europe. The authors discuss these cases with an epidemiological regard. They are looking for relationships with natural parasitic cycle in the neighbouring country Belgium and their consequences on local public health in the future.

  15. Rapid host defense against Aspergillus fumigatus involves alveolar macrophages with a predominance of alternatively activated phenotype.

    Directory of Open Access Journals (Sweden)

    Shikha Bhatia

    Full Text Available The ubiquitous fungus Aspergillus fumigatus is associated with chronic diseases such as invasive pulmonary aspergillosis in immunosuppressed patients and allergic bronchopulmonary aspergillosis (ABPA in patients with cystic fibrosis or severe asthma. Because of constant exposure to this fungus, it is critical for the host to exercise an immediate and decisive immune response to clear fungal spores to ward off disease. In this study, we observed that rapidly after infection by A. fumigatus, alveolar macrophages predominantly express Arginase 1 (Arg1, a key marker of alternatively activated macrophages (AAMs. The macrophages were also found to express Ym1 and CD206 that are also expressed by AAMs but not NOS2, which is expressed by classically activated macrophages. The expression of Arg1 was reduced in the absence of the known signaling axis, IL-4Rα/STAT6, for AAM development. While both Dectin-1 and TLR expressed on the cell surface have been shown to sense A. fumigatus, fungus-induced Arg1 expression in CD11c(+ alveolar macrophages was not dependent on either Dectin-1 or the adaptor MyD88 that mediates intracellular signaling by most TLRs. Alveolar macrophages from WT mice efficiently phagocytosed fungal conidia, but those from mice deficient in Dectin-1 showed impaired fungal uptake. Depletion of macrophages with clodronate-filled liposomes increased fungal burden in infected mice. Collectively, our studies suggest that alveolar macrophages, which predominantly acquire an AAM phenotype following A. fumigatus infection, have a protective role in defense against this fungus.

  16. The effect of osteoporosis on periodontal status, alveolar bone and orthodontic tooth movement. A literature review.

    Science.gov (United States)

    Sidiropoulou-Chatzigiannis, Sossani; Kourtidou, Maria; Tsalikis, Lazaros

    2007-07-01

    Osteoporosis, an age-related condition, is defined as a systemic skeletal disease characterized by low bone mass and micro-architectural deterioration with a consequent increase in bone fragility and susceptibility to fracture. It is considered the most common bone metabolic disease and it constitutes a major public health problem. Several studies indicate that osteoporosis may be related to decreased oral bone density and alveolar bone loss. In osteoporotic patients, uncoupling of bone resorption and bone formation has taken place. Both bone resorption and bone formation are accelerated, and excessive bone resorption usually leads to loss of attachment. Osteoporosis could also affect the rate of tooth movement through the involvement of alveolar bone. In healthy individuals, bone is constantly being remodeled in the coupled sequence of bone resorption and formation. When a force is applied to a tooth, alveolar bone formation and resorption occur predominantly on the tension and pressure sides of the root, respectively, and the tooth moves with increased alveolar bone remodeling. Experimental studies suggest that systemic-osteoporotic hormone imbalance increases bone turnover and accelerates tooth movement while under orthodontic treatment. Based on these observations it can be concluded that deviations in bone turnover and consequent periodontal problems influence the response to orthodontic forces, and this should be taken into consideration when planning orthodontic treatment in adult patients with metabolic bone disease, especially postmenopausal females or those on chronic medication affecting bone metabolism.

  17. Evidence for an intracellular niche for Bordetella pertussis in broncho-alveolar lavage cells of mice

    NARCIS (Netherlands)

    Hellwig, SMM; Hazenbos, WLW; van de Winkel, JGJ; Mooi, FR

    1999-01-01

    Bordetella pertussis can attach, invade and survive intracellularly in human macrophages in vitro. To study the significance of this bacterial feature in vivo, we analyzed the presence of viable bacteria in broncho-alveolar lavage (BAL) cells of mice infected with B, pertussis. We found B. pertussis

  18. Alveolar dimensional changes relevant to implant placement after minimally traumatic tooth extraction with primary closure.

    Science.gov (United States)

    Carranza, Nelson; Bonta, Hernan; Gualtieri, Ariel F; Rojas, Mariana A; Galli, Federico G; Caride, Facundo

    2016-09-01

    The purpose of this study is to evaluate the dimensional changes that occur in the alveolar ridge after minimally traumatic tooth extraction by means of computed tomography (CT), with special focus on the portion of bone supporting the gingival zenith. Twenty subjects with indication for singlerooted tooth extraction and preserved alveolar walls were selected for this study. After a minimally traumatic extraction, two CT scans were performed; the first within 24 hours postextraction (TC1) and the second 6 months (TC2) later. A radiographic guide with a radiopaque marker was used to obtain references that enabled accurate measurements over time, in both vertical and horizontal directions. The bone crest immediately apical to the gingival zenith was identified and termed "osseous zenith". The displacement of the osseous zenith in horizontal and vertical direction was analyzed and correlated with several alveolar anatomical variables with the aim of identifying possible predictors for bone remodeling. Dimensional changes that occur in postextraction sockets within a 6month period showed significant vertical and horizontal displacement of the osseous zenith (p 3 mm) should be expected. The present study suggests that the width of the alveolar crest at its midlevel, rather than crestal width, may be correlated with the displacement of the osseous zenith. Sociedad Argentina de Investigación Odontológica.

  19. Combined influence of implant diameter and alveolar ridge width on crestal bone stress: a quantitative approach.

    Science.gov (United States)

    Yu, Wonjae; Jang, Yoon-Je; Kyung, Hee-Moon

    2009-01-01

    To quantitatively evaluate the combined influence of implant diameter and alveolar ridge width on crestal bone stress. ITI solid-screw implants, 10 mm in length and 3.3, 4.1, and 4.8 mm in diameter, and the alveolar bone were modeled using axisymmetric finite elements. Four different alveolar ridge geometries were selected for each implant: 5-, 6-, 7-, and 8-mm-wide ridges for the 3.3-mm implants; 6-, 7-, 8-, and 9-mm-wide ridges for the 4.1-mm implants; and 7-, 8-, 9-, and 10-mm-wide ridges for the 4.8-mm implants. A nonaxial oblique load of 100 N was applied at 30 degrees to the implant axis. Regression analysis was used to avoid ambiguity when estimating the peak stress occurring at the coronal contact point between the implant and the crestal bone, ie, the singularity point. Peak stresses were dependent on both implant diameter and alveolar ridge width. Substantially lower stresses were recorded around the implants placed in narrower ridges. A regression analysis may be used to quantify the peak stress at the singularity point. An implant with a diameter that is at least half the ridge width is recommended to reduce the stress concentration in the crestal bone.

  20. RAGE-induced changes in the proteome of alveolar epithelial cells.

    Science.gov (United States)

    Downs, Charles A; Johnson, Nicholle M; Tsaprailis, George; Helms, My N

    2018-02-12

    The receptor for advanced glycation end-products (RAGE) is a pattern recognition receptor and member of the immunoglobulin superfamily. RAGE is constitutively expressed in the distal lung where it co-localizes with the alveolar epithelium; RAGE expression is otherwise minimal or absent, except with disease. This suggests RAGE plays a role in lung physiology and pathology. We used proteomics to identify and characterize the effects of RAGE on rat alveolar epithelial (R3/1) cells. LC-MS/MS identified 177 differentially expressed proteins and the PANTHER Classification System further segregated proteins. Proteins involved in gene transcription (RNA and mRNA splicing, mRNA processing) and transport (protein, intracellular protein) were overrepresented; genes involved in a response to stimulus were underrepresented. Immune system processes and response to stimuli were downregulated with RAGE knockdown. Western blot confirmed RAGE-dependent changes in protein expression for NFκB and NLRP3 that was functionally supported by a reduction in IL-1β and phosphorylated p65. We also assessed RAGE's effect on redox regulation and report that RAGE knockdown attenuated oxidant production, decreased protein oxidation, and increased reduced thiol pools. Collectively the data suggest that RAGE is a critical regulator of epithelial cell response and has implications for our understanding of lung disease, specifically acute lung injury. In the present study, we undertook the first proteomic evaluation of RAGE-dependent processes in alveolar epithelial cells. The alveolar epithelium is a primary target during acute lung injury, and our data support a role for RAGE in gene transcription, protein transport, and response to stimuli. More over our data suggest that RAGE is a critical driver of redox regulation in the alveolar epithelium. The conclusions of the present work assist to unravel the molecular events that underlie the function of RAGE in alveolar epithelial cells and have