WorldWideScience

Sample records for alveolar soft part

  1. Alveolar soft part sarcoma: A rare diagnosis

    Directory of Open Access Journals (Sweden)

    Priyanka Sarkar

    2013-01-01

    Full Text Available Alveolar soft-part sarcoma (ASPS is an extremely rare disease arising from connective tissues with a propensity for recurrence and metastasis. Clinically, it can be confused with hemangioma or arterio-venous malformations. Thus, a high index of suspicion and histopathological examination are required to make a definitive diagnosis. We report a case of recurrent ASPS in a young female with multiple sites involvement without any features of metastasis who has been treated with excision of the symptomatic lesions followed by chemotherapy.

  2. Case report 501: Alveolar soft parts sarcoma with pulmonary metastases

    International Nuclear Information System (INIS)

    Munk, P.L.; Connell, D.G.; Mueller, N.L.; Lentle, B.C.

    1988-01-01

    Alveolar soft part sarcoma (ASPS) is a rare, soft tissue malignancy, usually presenting in young adults. We report a patient with ASPS in the thigh, evaluated with plain films, computed tomography, and a radionuclide scan. The findings in this patient and those in which CT findings have been reported in the literature, show a similar appearance which we believe is highly suggestive of this unusual tumor. The combination of a soft tissue lesion, that on CT appears highly vascular, with features suggestive of an arteriovenous malformation, in association with multiple pulmonary nodules and a bone scan with features suggestive of infection should lead to a consideration of this rare entity. (orig./GDG)

  3. Alveolar soft-part sarcoma in paranasal sinuses

    Directory of Open Access Journals (Sweden)

    Jie ZHANG

    2015-07-01

    Full Text Available Objective To investigate clinicopathological features, immune phenotype, diagnosis and differential diagnosis of alveolar soft-part sarcoma (ASPS in paranasal sinuses. Methods Retrospective study of clinical manifestations, histopathological features and immunohistochemical features was conducted in one case of ASPS in paranasal sinuses.  Results A 28-year-old female presented with bulging forehead for 2 months. MRI revealed a well-circumscribed lesion in left frontal and ethmoid sinuses extending to anterior skull base that showed slightly hyperintense signal on T1WI and hypointense signal on T2WI without obvious enhancement after contrast administration. The patient subsequently underwent endoscopic open surgery on left ethmoid and bilateral frontal sinuses and performed partial resection of the lesion. Three months after the initial surgery, the patient received reoperation for total removal of residual lesion and reconstructive surgery of anterior skull base. Adjuvant chemotherapy and radiotherapy were not administered. Histologically, the tumor was composed of epithelioid cells arranged in organoid nests and/or alveolar structures varying in size and shape, which were separated by connective tissue richly containing sinusoidal vascular channels. The tumor cells were generally large-sized, round, oval or polygonal with abundant eosinophilic granular or translucent vacuolated cytoplasm. The nuclei showed round or oval shape containing centrally placed and obvious nucleoli. The presence a lot of mono- or multi-nuclear giant cells served as another striking feature. Mitotic activities were rare. Reticular fiber staining indicated that reticular fibers surrounded the nest of tumor cells, and diastase-resistant periodic acid-Schiff (PAS-positive crystalline inclusions were identified within the cytoplasm of tumor cells. Immunohistochemically, the tumor cells were reactive for TFE3, while were negative for glial fibrillary acidic protein (GFAP

  4. Alveolar soft-part sarcoma of the mediastinum: A case report

    Directory of Open Access Journals (Sweden)

    Yohei Kameda

    2017-02-01

    Full Text Available We report a 53-year-old man with metastases of alveolar soft-part sarcoma originated from the mediastinum. He was hospitalized due to lower extremities’ paralysis. Computed tomography scan findings revealed multiple nodules of bilateral lungs, swollen mediastinal lymph nodes, and osteolysis of thoracic vertebrae. We performed spinal decompression and biopsy from vertebra. And, we finally diagnosed this case as metastases of mediastinal alveolar soft-part sarcoma which was removed 10 years ago. Alveolar soft-part sarcoma is rare tumor accounted for 0.5%–1.0% of soft tissue sarcoma that often occurs primarily in the lower extremities and trunk. It is difficult to distinguish between alveolar soft-part sarcoma and paraganglioma, renal cell carcinoma and granular cell tumor morphologically. Periodic acid–Schiff stain and immunohistochemical staining of ASPL-TFE3 are useful in making a definitive diagnosis of alveolar soft-part sarcoma. This case is a rare case of alveolar soft-part sarcoma originated in the mediastinum with local recurrence and distant metastases 10 years after the initial surgery.

  5. Alveolar soft-part sarcoma of the orbit | Rose | African Journal of ...

    African Journals Online (AJOL)

    Alveolar soft-part sarcoma (ASPS) is a rare soft tissue tumour of uncertain cellular origin. It accounts for only 1% of all sarcomas, which themselves represent only a small proportion of human tumours. ASPS can arise in any soft tissue of the body, but there is an unexplained predilection for the right side. The most common ...

  6. Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Price, Richard L; Harkins, Lualhati; Chiocca, Ennio A; Zhang, Paul J; Kurt, Habibe; Iwenofu, Obiajulu H

    2017-10-01

    Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that

  7. Lung Metastasis of Primary Alveolar Soft-Part Sarcoma Occurring 20 Years after Initial Treatment

    Directory of Open Access Journals (Sweden)

    R. F. Falkenstern-Ge

    2013-01-01

    Full Text Available A 30-year old woman was referred to our center because of suspicion of a primary lung tumor of the right upper lobe. Histological examination of the lung lesion revealed lung metastasis of a previously treated alveolar soft part sarcoma of the musculus vastus medialis of the right femur, which was resected 20 years ago. Alveolar soft-part sarcoma is a rare malignant tumor that occurs most often in the soft tissue of lower limbs. It is a slow-growing malignant soft tissue tumor arising in muscle tissue, usually in young adults. Due to pleural and extensive mediastinal infiltration with bilateral lung metastases, a systemic treatment with chemotherapy doxorubicin and ifosfamide was initiated. Late metastases from previously treated alveolar part sarcoma should be considered in patients with suspicious lung lesions even if surgical treatment was performed a long time ago.

  8. Primary alveolar soft part sarcoma of vertebra: a case report and literature review

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Fei-Peng [Nanjing University, Department of Medical Imaging, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Xuzhou Medical College, Xuzhou, Jiangsu Province (China); Lu, Guang-Ming; Zhang, Long-Jiang [Nanjing University, Department of Medical Imaging, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Wang, Jian-Dong [Nanjing University, Department of Pathology, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); An, Xiao-Jing [Nanjing University, Department of Pathology, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Nanjing University, Medical College, Nanjing, Jiangsu Province (China); Dong, Ying-Chun [Nanjing Stomatology Hospital/The Affiliated Stomatology Hospital of Medical School of Nanjing University, Department of Anesthesiology, Nanjing, Jiangsu Province (China)

    2009-08-15

    Alveolar soft part sarcoma (ASPS) is a rare malignant soft tissue tumor, which rarely occurs in bone. We present a case of ASPS in a 23-year-old man with a 2-month history of back pain. Computed tomography scanning and magnetic resonance images demonstrated a destructive process in the 12th thoracic vertebra associated with a unilateral soft tissue mass. The tumor showed evidence of hypervascularity on MRI; it obviously was enhanced on T1-weighted images after injection of Gd-GDPA, and signal voids were shown on all pulse sequences which may help to differentiate ASPS from other tumors of the vertebra. We believe that this is the first case of ASPS arising in a vertebra. (orig.)

  9. Alveolar soft-part sarcoma: a rare soft-tissue malignancy with distinctive clinical and radiological features

    International Nuclear Information System (INIS)

    Pang, L.M.; Griffith, J.F.; Metreweli, C.; Roebuck, D.J.; Kumta, S.M.

    2001-01-01

    Alveolar soft-part sarcoma (ASPS) is a rare tumour. Certain distinctive clinical and radiological features suggest the correct diagnosis. There is moderate predilection for young women. ASPS almost always arises in skeletal muscle and occurs most frequently in the lower limbs. There is often a long clinical history and a large mass at presentation. Two young females with ASPS presented with very vascular tumours in the thigh, with prominent intra- and extra-tumoural blood vessels. The imaging findings and the existing literature are reviewed. (orig.)

  10. Prominent Intracytoplasmic Crystals in Alveolar Soft Part Sarcoma (ASPS): An Aid in Cytological Diagnosis.

    Science.gov (United States)

    Mannan, Rahul; Bhasin, Tejinder Singh; Kaur, Parampreet; Manjari, Mridu; Gill, Karamjit Singh

    2014-02-01

    Alveolar soft part sarcoma (ASPS) is a rare neoplasm of unknown histogenesis with poor prognosis. Due to the epithelioid appearance of the neoplastic cells, ASPS may resemble many neoplastic conditions, such as metastatic epithelial cell tumours with clear cell change, metastatic renal cell carcinoma, granular cell tumour, epithelioid sarcoma, malignant melanoma and even paragangliomas. Presence of abundant, rod like crystals in the cytoplasm of tumour cells is an important finding characteristic of this tumour, which helps in differentiating it from the other entities. The case study highlights the importance of correlating cytological features that help in reaching the diagnosis such as the background, cell morphology and presence of characteristic rod shaped crystals as immunohistochemical studies are often non-conclusive. The case also is unique as it demonstrates presence of intra-cytoplamic crystals in such abundance.

  11. Primary alveolar soft part sarcoma of fibula demonstrating ASPL-TFE3 fusion: a case report and review of the literature

    International Nuclear Information System (INIS)

    Aisner, Seena C.; Mirani, Neena; Hameed, Meera; Beebe, Kathleen; Blacksin, Marcia

    2008-01-01

    Alveolar soft part sarcoma is a rare soft tissue tumor typically affecting young adults. These tumors are most often seen in the deep soft tissues of the extremities and patients generally present with advanced disease. Primary bone involvement is extremely rare and has only been reported in seven cases. This is the first case of alveolar soft part sarcoma in bone documenting the ASPL-TFE3 gene product. Herein, we report a rare presentation of alveolar soft part sarcoma presenting as a primary bone neoplasm involving the proximal fibula in a 41-year-old woman. (orig.)

  12. Primary alveolar soft part sarcoma of fibula demonstrating ASPL-TFE3 fusion: a case report and review of the literature

    Energy Technology Data Exchange (ETDEWEB)

    Aisner, Seena C.; Mirani, Neena; Hameed, Meera [University Hospital, Department of Pathology, Newark, NJ (United States); New Jersey Medical School, Newark (United States); Beebe, Kathleen [University Hospital, Department of Orthopedic Surgery, Newark, NJ (United States); New Jersey Medical School, Newark (United States); Blacksin, Marcia [University Hospital, Department of Radiology, Newark, NJ (United States); New Jersey Medical School, Newark (United States)

    2008-11-15

    Alveolar soft part sarcoma is a rare soft tissue tumor typically affecting young adults. These tumors are most often seen in the deep soft tissues of the extremities and patients generally present with advanced disease. Primary bone involvement is extremely rare and has only been reported in seven cases. This is the first case of alveolar soft part sarcoma in bone documenting the ASPL-TFE3 gene product. Herein, we report a rare presentation of alveolar soft part sarcoma presenting as a primary bone neoplasm involving the proximal fibula in a 41-year-old woman. (orig.)

  13. Alveolar Soft Part Sarcoma of Urinary Bladder Occurring as a Second Primary Malignancy: A Case Report and Literature Review

    Directory of Open Access Journals (Sweden)

    Manint Usawachintachit

    2016-01-01

    Full Text Available We report a case of bladder alveolar soft part sarcoma in an 18-year-old Thai male patient who had been treated with testicular radiation and systemic chemotherapy for acute lymphoblastic leukemia with testicular relapse. He presented with recurrent dysuria and gross hematuria. Cystoscopy revealed a 2-centimeter irregular sessile mass at the bladder base adjacent to left ureteral orifice. Transurethral resection of the tumor was performed. The histopathological diagnosis was alveolar soft part sarcoma. Chest and abdominal computed tomography showed no evidence of metastasis. He was treated with partial cystectomy and left ureteral reimplantation with negative surgical margin. No evidence of recurrence was found during a 28-month follow-up period with surveillance cystoscopy and computed tomography of the chest and abdomen.

  14. Alveolar soft part sarcoma: the new primary intracranial malignancy : A case report and review of the literature.

    Science.gov (United States)

    Kumar, Aditaya; Alrohmain, B; Taylor, W; Bhattathiri, P

    2017-07-26

    The purpose of this paper is to serve as a reference to aid in the management of this poorly understood intracranial malignancy. The authors report their experience treating the eighth ostensible case of a primary intracranial alveolar soft part sarcoma (ASPS). A 21-year-old man presented to hospital after collapsing. He gave a 1-year history of headache, a 2-month history of reduced visual acuity and on examination had left facial paraesthesia with left-sided incoordination. MRI of the brain revealed a large left posterior fossa mass. The patient underwent resection of the tumour with good recovery in function. Immunohistochemical analysis of the tumour specimen confirmed an ASPS, and multimodal imaging in search of an extra-cranial disease primary was negative. A review of the literature yielded only seven other cases of primary intracranial ASPS. A variety of diagnostic imaging modalities were employed in search of a disease primary, as were various combinations of surgical resection, chemotherapy and radiotherapy as treatment. Half of the cases documented delayed disease recurrence. The authors discuss the following: the unique radiological and immunohistological characteristics of this disease including the potential for its misdiagnosis; the investigations required to diagnose a primary intracranial ASPS; the efficacy of current medical and surgical treatment options and the factors that will aid in prognostication. This is the first review of this new primary intracranial malignancy. From our analysis, we offer a joint radiological and immunohistochemical algorithm for the diagnosis of primary intracranial ASPS and specific operative considerations prior to resection.

  15. Exploring the Histogenesis and Diagnostic Strategy Using Immunoassay and RT-PCR in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Ju, Xinxin; Sun, Kunming; Liu, Ruixue; Li, Shugang; Abulajiang, Gulinaer; Zou, Hong; Lan, Jiaojiao; Ren, Yan; Jiang, Jinfang; Liang, Weihua; Pang, Lijuan; Li, Feng

    2017-08-01

    Alveolar soft part sarcoma (ASPS) is a rare soft tissue sarcoma, but it's easily misdiagnosed in rare locations. The derivation of ASPS is still uncertain, therefore we conducted this study to explore the histogenesis of ASPS by analyzing stem cell markers (ALDH1, CD29, CD133 and Nestin). Protein TFE3 and fusion gene ASPS-TFE3 were tested in paraffin to explore diagnostic strategy and molecular pathological features. In this study, nine cases of ASPS were immunostained with stem cell surface markers (ALDH1, CD29, CD133 and Nestin) and protein TFE3. Seven cases of ASPS mRNA were successfully extracted from nine paraffin-embedded tissues. The expression of fusion gene ASPL-TFE3 was examined by reverse transcriptase-polymerase chain reaction. The immunohistochemical staining of nine patients showed that CD29 and Nestin were negative in all nine cases (0/9). CD133 was weakly positive in one cases (1/9) and ALDH1 was weakly positive in one cases (1/9). TFE3 was positive in nine cases (9/9). Seven paraffin tissues could be successfully extracted with mRNA in nine cases. The results of Reverse Transcription Polymerase Chain Reaction (RT-PCR) showed that ASPL-TFE3 fusion transcripts could be tested in the seven cases (four cases being type 2 and three cases being type 1). The positive rate of CD133 and ALDH1 were less than 1% and the expression of CD29 and Nestin were negative in ASPS. Immunohistochemistry results indicated that the histogenesis of ASPS maybe not derive from mesenchymal stem cells. Immunohistochemistry staining showed that TFE3 protein expression was highly sensitive in ASPS. Furthermore, RT-PCR results showed that fusion gene ASPL-TFE3 (ASPL-TFE3 type 1 and ASPL-TFE3 type 2) was expressed in ASPS, which could provide information for clinical molecular pathological diagnosis and improve the diagnosis rate of rare atypical ASPS.

  16. Soft tissue healing in alveolar socket preservation technique: histologic evaluations.

    Science.gov (United States)

    Pellegrini, Gaia; Rasperini, Giulio; Obot, Gregory; Farronato, Davide; Dellavia, Claudia

    2014-01-01

    After tooth extraction, 14 alveolar sockets were grafted with porous bovine bone mineral particles and covered with non-cross-linked collagen membrane (test group), and 14 alveolar sockets were left uncovered. At 5 and 12 weeks, microvascular density (MVD), collagen content, and amount of lymphocytes (Lym) T and B were analyzed in soft tissue. At 5 weeks, MVD was significantly lower and Lym T was significantly higher in tests than in controls (P healing process of the soft tissue.

  17. A methodological approach to assessing alveolar ridge preservation procedures in humans: soft tissue profile.

    Science.gov (United States)

    Vanhoutte, Vanessa; Rompen, Eric; Lecloux, Geoffrey; Rues, Stefan; Schmitter, Marc; Lambert, France

    2014-03-01

    The aesthetic results of implant restoration in the anterior maxilla are particularly related to the soft tissue profile. Although socket preservation techniques appear to reduce bone remodelling after tooth extraction, there is still few investigations assessing the external soft tissue profile after such procedures. The goal of this study was to describe an accurate technique to evaluate soft tissue contour changes after performing socket preservation procedures. The secondary objective was to apply the newly developed measuring method to a specific socket preservation using a "saddled" connective tissue graft combined with the insertion of slowly resorbable biomaterials into the socket. A total of 14 patients needing tooth replacement in the aesthetic region were included to receive a socket preservation procedure using a connective tissue graft. Impressions were taken before the tooth extraction (baseline) and at 2, 4, and 12 weeks after the procedure. The corresponding plaster casts were scanned, and the evolution of the soft tissue profile in relation to the baseline situation was assessed using imaging software. The measuring technique allowed assessing the soft tissue profiles accurately at different levels of the alveolar process. The insertion of a saddled connective tissue appeared to compensate for the horizontal and vertical bone remodelling after a socket preservation procedure in most regions of the alveolar crest. After 12 weeks, the only significant change was located in the more cervical and central region of the alveolar process and reached a median drop of 0.62 mm from baseline. Within the limitations of this study, we found that a saddled connective tissue graft combined with a socket preservation procedure could almost completely counteract the bone remodelling in terms of the external soft tissue profile. The minor changes found in the cervical region might disappear with the emergence profile of the prosthodontic components. The described

  18. Hard and soft tissue changes following alveolar ridge preservation: a systematic review.

    Science.gov (United States)

    MacBeth, Neil; Trullenque-Eriksson, Anna; Donos, Nikolaos; Mardas, Nikos

    2017-08-01

    : -0.554 to 0.239) for socket grafting. A proximal vertical bone height reduction of -0.356 mm (95% CI: -0.490 to -0.222) was recorded for GBR, with a horizontal dimensional reduction of -1.45 mm (95% CI: -1.892 to -1.008) measured following GBR and -1.613 mm (95% CI: -1.989 to -1.238) for socket grafting procedures. Five papers reported on histological findings after ARP. Two papers indicated an increase in the width of the keratinised tissue following GBR, with two papers reporting a reduction in the thickness of the keratinised tissue following GBR. Histological examination revealed extensive variations in the treatment protocols and biomaterials materials used to evaluate extraction socket healing. GBR studies reported a variation in total bone formation of 47.9 ± 9.1% to 24.67 ± 15.92%. Post-operative complications were reported by 29 papers, with the most common findings soft tissue inflammation and infection. ARP results in a significant reduction in the vertical bone dimensional change following tooth extraction when compared to unassisted socket healing. The reduction in horizontal alveolar bone dimensional change was found to be variable. No evidence was identified to clearly indicate the superior impact of a type of ARP intervention (GBR, socket filler and socket seal) on bone dimensional preservation, bone formation, keratinised tissue dimensions and patient complications. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Hard and Soft Tissue Management of a Localized Alveolar Ridge Atrophy with Autogenous Sources and Biomaterials: A Challenging Clinical Case

    OpenAIRE

    C. Maiorana; D. Andreoni; P. P. Poli

    2016-01-01

    Particularly in the premaxillary area, the stability of hard and soft tissues plays a pivotal role in the success of the rehabilitation from both a functional and aesthetic aspect. The present case report describes the clinical management of a localized alveolar ridge atrophy in the area of the upper right canine associated with a thin gingival biotype with a lack of keratinized tissue. An autogenous bone block harvested from the chin associated with heterologous bone particles was used to re...

  20. Pleomorphic Hyalinizing Angiectatic Tumor of Soft Parts

    Directory of Open Access Journals (Sweden)

    Hui-Chin Peng

    2010-08-01

    Full Text Available Pleomorphic hyalinizing angiectatic tumor (PHAT of soft parts is a rare, nonmetastasizing tumor of uncertain lineage which was first reported in 1996. Here, we report a case of PHAT and review the literature. A 49-year-old man presented with a soft and progressively enlarging mass over the right buttock for several years. On suspicion that the mass was a right gluteal lipoma, he underwent surgical excision. The excised lesion measured 14 × 6 × 3.5 cm. It had a variegated appearance with a white-tan to yellowish color on the cut surface. Some punctate hemorrhage and vessel thrombosis were seen. Microscopically, the tumor was a PHAT characterized by clusters of ectatic, fibrin-lined, thin-walled vessels, which were surrounded by a mitotically inert, spindled, pleomorphic, neoplastic stroma that contained a variable inflammatory component. Immunohistochemical study showed that the tumor cells were positive for CD34, and negative for S-100, HMB45 and actin. The patient experienced local recurrence 6 months later. The recurrent tumor was widely excised. No evidence of metastasis was found during the 18 months after the second operation. The recurrent lesion had a microscopic appearance that was similar to the initial lesion.

  1. Hard and Soft Tissue Management of a Localized Alveolar Ridge Atrophy with Autogenous Sources and Biomaterials: A Challenging Clinical Case

    Directory of Open Access Journals (Sweden)

    C. Maiorana

    2016-01-01

    Full Text Available Particularly in the premaxillary area, the stability of hard and soft tissues plays a pivotal role in the success of the rehabilitation from both a functional and aesthetic aspect. The present case report describes the clinical management of a localized alveolar ridge atrophy in the area of the upper right canine associated with a thin gingival biotype with a lack of keratinized tissue. An autogenous bone block harvested from the chin associated with heterologous bone particles was used to replace the missing bone, allowing for a prosthetic driven implant placement. Soft tissues deficiency was corrected by means of a combined epithelialized and subepithelial connective tissue graft. The 3-year clinical and radiological follow-up demonstrated symmetric gingival levels of the upper canines, with physiological peri-implant probing depths and bone loss. Thus, the use of autogenous tissues combined with biomaterials might be considered a reliable technique in case of highly aesthetic demanding cases.

  2. Medical students' perceptions of their development of 'soft skills' Part ...

    African Journals Online (AJOL)

    Medical students' perceptions of their development of 'soft skills' Part II : The development of 'soft skills' through 'guiding and growing' ... Soft skills include professional interpersonal and social skills, communication skills, and professional and ethical attitudes. ... Interaction with patients was considered the most important.

  3. Histological Features and Biocompatibility of Bone and Soft Tissue Substitutes in the Atrophic Alveolar Ridge Reconstruction

    Directory of Open Access Journals (Sweden)

    Carlo Maiorana

    2016-01-01

    Full Text Available The reconstruction of the atrophic alveolar ridges for implant placement is today a common procedure in dentistry daily practice. The surgical reconstruction provides for the optimization of the supporting bone for the implants and a restoration of the amount of keratinized gingiva for esthetic and functional reasons. In the past, tissue regeneration has been performed with autogenous bone and free gingival or connective tissue grafts. Nowadays, bone substitutes and specific collagen matrix allow for a complete restoration of the atrophic ridge without invasive harvesting procedures. A maxillary reconstruction of an atrophic ridge by means of tissue substitutes and its histological features are then presented.

  4. Part II. Minimizing alveolar bone loss during and after extractions. Protocol and techniques for alveolar bone preservation.

    Science.gov (United States)

    Iyer, Shankar; Haribabu, Prashanth Konatham; Xing, Yi

    2014-01-01

    Alveolar ridge resorption accelerates following extraction of teeth and the residual defect varies from socket to socket. This article proposes a new treatment oriented classification of extraction defects. It also reviews several graft materials and membranes that aid in the decision for selecting an appropriate socket preservation technique. The algorithm developed by the authors helps design a potentially successful treatment plan based on the classification of extraction defects, with choices ranging from no treatment to complex grafting procedures (i.e. allogenic block grafts). In addition, the principles of wound healing and the ideal time points for utilizing the various types of graft materials and implants are discussed. This socket preservation treatment algorithm will guide clinicians to employ surgical procedures using various biomaterials to promote a successful outcome.

  5. Hard and soft tissue changes around implants installed in regular-sized and reduced alveolar bony ridges. An experimental study in dogs.

    Science.gov (United States)

    Baffone, Gabriele; Lang, Niklaus P; Pantani, Fabio; Favero, Giovanni; Ferri, Mauro; Botticelli, Daniele

    2015-01-01

    To study bony and soft tissue changes at implants installed in alveolar bony ridges of different widths. In 6 Labrador dogs, the mandibular premolars and first molars were extracted, and a buccal defect was created in the left side at the third and fourth premolars by removing the buccal bone and the inter-radicular and interdental septa. Three months after tooth extraction, full-thickness mucoperiosteal flaps were elevated, and implants were installed, two at the reduced (test) and two at the regular-sized ridges (control). Narrow or wide abutments were affixed to the implants. After 3 months, biopsies were harvested, and ground sections prepared for histological evaluation. A higher vertical buccal bony crest resorption was found at the test (1.5 ± 0.7 mm and 1.0 ± 0.7 mm) compared to the control implants (1.0 ± 0.5 mm and 0.7 ± 0.4 mm), for both wide and narrow abutment sites. A higher horizontal alveolar resorption was identified at the control compared to the test implants. The difference was significant for narrow abutment sites. The peri-implant mucosa was more coronally positioned at the narrow abutment, in the test sites, while for the control sites, the mucosal adaptation was more coronal at the wide abutment sites. These differences, however, did not reach statistical significance. Implants installed in regular-sized alveolar ridges had a higher horizontal, but a lower vertical buccal bony crest resorption compared to implants installed in reduced alveolar ridges. Narrow abutments in reduced ridges as well as wide abutments in regular-sized ridges yielded less soft tissue recession compared to their counterparts. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Alveolar process fractures in the permanent dentition. Part 1. Etiology and clinical characteristics. A retrospective analysis of 299 cases involving 815 teeth

    DEFF Research Database (Denmark)

    Andreasen, Jens Ove; Lauridsen, Eva

    2015-01-01

    AIM: To describe the etiology and clinical characteristics of alveolar process fractures treated in a regional trauma clinic. MATERIAL AND METHOD: The study is a retrospective descriptive analysis of 299 patients (180 males, 119 females; 815 permanent teeth) diagnosed with fractures of the alveolar...... process. RESULTS: Violence was the overall most frequent cause of injury in men (44%), whereas the three most common causes of this type of injury in women were violence (33%), falls (32%), or traffic injuries (26%). Fracture of the alveolar process occurred most frequently in the maxilla (74%) and less...... frequently in the mandible (26%). The majority of the fractures involved only two teeth (57%) but occasionally involved up to seven teeth. The age at fracture ranged from 5 to 90 years; alveolar process fractures occurred most frequently between 15 and 25 years of age (43%). Concomitant soft tissue injuries...

  7. Malignant melanoma of soft parts. A "non plastic surgeon's land"?

    Science.gov (United States)

    Rivera, J C; Lesimple, T; Garin, E; Laurent, J-F; Watier, E; Hu, W

    2008-08-01

    Malignant melanoma of soft parts (MMSP) (or "clear cell sarcoma") is a very rare tumour that shows up without primitive skin involvement (except in subcutaneous prolongations of deep tumours), mostly predominant in the extremities of young adults. Eight files of MMSP were studied retrospectively. The mean patient is a male of 35 years old affected in an extremity (four upper, three lower and one gluteal), according to classical descriptions. The importance of radical surgery in these cases has been extensively established. Confronted with these cases, the plastic surgeon must be aware of the specifics of this rare entity to ensure its proper inclusion in his clinical suspicion. Just in case.

  8. Inferior Alveolar Nerve Lateralization and Transposition for Dental Implant Placement. Part I: a Systematic Review of Surgical Techniques

    Directory of Open Access Journals (Sweden)

    Boris Abayev

    2015-03-01

    Full Text Available Objectives: The purpose of this first part of a two-part series was to review the literature concerning the indications, contraindications, advantages, disadvantages and surgical techniques of the lateralization and transposition of the inferior alveolar nerve, followed by the placement of an implant in an edentulous atrophic posterior mandible. Material and Methods: A comprehensive review of the current literature was conducted according to the PRISMA guidelines by accessing the NCBI PubMed and PMC database, academic sites and books. The articles were searched from January 1997 to July 2014 and comprised English-language articles that included adult patients between 18 and 80 years old with minimal residual bone above the mandibular canal who had undergone inferior alveolar nerve (IAN repositioning with a minimum 6 months of follow-up. Results: A total of 16 studies were included in this review. Nine were related to IAN transposition, 4 to IAN lateralization and 3 to both transposition and lateralization. Implant treatment results and complications were presented. Conclusions: Inferior alveolar nerve lateralization and transposition in combination with the installation of dental implants is sometimes the only possible procedure to help patients to obtain a fixed prosthesis, in edentulous atrophic posterior mandibles. With careful pre-operative surgical and prosthetic planning, imaging, and extremely precise surgical technique, this procedure can be successfully used for implant placement in edentulous posterior mandibular segments.

  9. Alveolar process fractures in the permanent dentition. Part 2. The risk of healing complications in teeth involved in an alveolar process fracture.

    Science.gov (United States)

    Lauridsen, Eva; Gerds, Thomas; Andreasen, Jens Ove

    2016-04-01

    To analyze the risk of pulp canal obliteration (PCO), pulp necrosis (PN), repair-related resorption (RRR), infection-related resorption (IRR), ankylosis-related resorption (ARR), marginal bone loss (MBL), and tooth loss (TL) for teeth involved in an alveolar process fracture and to identify possible risk factors. A total of 91 patients with 223 traumatized teeth. The risks of PCO, PN, RRR, IRR, ARR, MBL, and TL were analyzed separately for teeth with immature and mature root development using Kaplan-Meier and Aalen-Johansen methods. Possible risk factors for PN (age, fracture in relation to apex, displacement, gingival injury, degree of repositioning, type of splint, duration of splinting, treatment delay, and antibiotics) were analyzed for mature teeth using Cox regression. The level of significance was 5%. Immature: No severe complications (PN, IRR, ARR, MBL, or TL) were diagnosed during follow up. Mature: Estimated risk after a 10-year follow up: PN: 56% (95% confidence interval (CI): 48.1-63.9), IRR: 2.5% (95% CI: 0-5.1), ARR: 2.1% (95% CI: 0.1-4.1), MBL: 2.4% (95% CI: 0.3-4.4), and TL: 7.8% (95% CI: 0-15.7). The following factors significantly increased the risk of PN in teeth with mature root development: fracture in relation to apex (hazard ratio (HR): 2.6 (95% CI: 0.2 - 5.7), P = 0.01), displacement in the horizontal part of the fracture >2 mm (HR: 1.8; 95% CI: 1.1-3.2, P = 0.03), incomplete repositioning (HR: 2.1 (95% CI: 1.3-3.5), P = 0.003), and age >30 years (HR: 2.3 (95% CI: 1.1-4.6), P = 0.02). The type of splint (rigid or flexible), the duration of splinting (more or less than 4 weeks), and the administration of antibiotics did not affect the risk of PN. Teeth involved in alveolar process fractures appear, apart from PN, to have a good prognosis. A conservative treatment approach is recommended. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Inferior Alveolar Nerve Lateralization and Transposition for Dental Implant Placement. Part II: a Systematic Review of Neurosensory Complications

    Directory of Open Access Journals (Sweden)

    Boris Abayev

    2015-03-01

    Full Text Available Objectives: This article, the second in a two-part series, continues the discussion of inferior alveolar nerve lateralization/transposition for dental implant placement. The aim of this article is to review the scientific literature and clinical reports in order to analyse the neurosensory complications, risks and disadvantages of lateralization/transposition of the inferior alveolar nerve followed by implant placement in an edentulous atrophic posterior mandible. Material and Methods: A comprehensive review of the current literature was conducted according to the PRISMA guidelines by accessing the NCBI PubMed and PMC databases, as well as academic sites and books. The articles were searched from January 1997 to July 2014. Articles in English language, which included adult patients between 18 - 80 years of age who had minimal residual bone above the mandibular canal and had undergone inferior alveolar nerve (IAN repositioning, with minimum 6 months of follow-up, were included. Results: A total of 21 studies were included in this review. Ten were related to IAN transposition, 7 to IAN lateralization and 4 to both transposition and lateralization. The IAN neurosensory disturbance function was present in most patients (99.47% [376/378] for 1 to 6 months. In total, 0.53% (2/378 of procedures the disturbances were permanent. Conclusions: Inferior alveolar nerve repositioning is related to initial transient change in sensation in the majority of cases. The most popular causes of nerve damage are spatula-caused traction in the mucoperiosteal flap, pressure due to severe inflammation or retention of fluid around the nerve and subsequent development of transient ischemia, and mandibular body fracture.

  11. Bimaxillary protrusion with an atrophic alveolar defect: orthodontics, autogenous chin-block graft, soft tissue augmentation, and an implant.

    Science.gov (United States)

    Chiu, Grace S C; Chang, Chris H N; Roberts, W Eugene

    2015-01-01

    Bimaxillary protrusion in a 28-year-old woman was complicated by multiple missing, restoratively compromised, or hopeless teeth. The maxillary right central incisor had a history of avulsion and replantation that subsequently evolved into generalized external root resorption with Class III mobility and severe loss of the supporting periodontium. This complex malocclusion had a discrepancy index of 21, and 8 additional points were scored for the atrophic dental implant site (maxillary right central incisor). The comprehensive treatment plan included extraction of 4 teeth (both maxillary first premolars, the maxillary right central incisor, and the mandibular right first molar), orthodontic closure of all spaces except for the future implant site (maxillary right central incisor), augmentation of the alveolar defect with an autogenous chin-block graft, enhancement of the gingival biotype with a connective tissue graft, and an implant-supported prosthesis. Orthodontists must understand the limitations of bone grafts. Augmented alveolar defects are slow to completely turn over to living bone, so they are usually good sites for implants but respond poorly to orthodontic space closure. However, postsurgical orthodontic treatment is often indicated to optimally finish the esthetic zone before placing the final prosthesis. The latter was effectively performed for this patient, resulting in a total treatment time of about 36 months for comprehensive interdisciplinary care. An excellent functional and esthetic result was achieved. Copyright © 2015 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  12. Alveolar process fractures in the permanent dentition. Part 2. The risk of healing complications in teeth involved in an alveolar process fracture

    DEFF Research Database (Denmark)

    Lauridsen, Eva; Gerds, Thomas; Andreasen, Jens Ove

    2016-01-01

    AIM: To analyze the risk of pulp canal obliteration (PCO), pulp necrosis (PN), repair-related resorption (RRR), infection-related resorption (IRR), ankylosis-related resorption (ARR), marginal bone loss (MBL), and tooth loss (TL) for teeth involved in an alveolar process fracture and to identify.......3-3.5), P = 0.003), and age >30 years (HR: 2.3 (95% CI: 1.1-4.6), P = 0.02). The type of splint (rigid or flexible), the duration of splinting (more or less than 4 weeks), and the administration of antibiotics did not affect the risk of PN. CONCLUSION: Teeth involved in alveolar process fractures appear...

  13. Soft and Hard Tissue Response to Zirconia versus Titanium One-Piece Implants Placed in Alveolar and Palatal Sites: A Randomized Control Trial.

    Science.gov (United States)

    Siddiqi, Allauddin; Kieser, Jules August; De Silva, Rohana Kumara; Thomson, William Murray; Duncan, Warwick John

    2015-06-01

    Titanium (Ti) implants have been used in the last four decades to replace missing teeth. Alternatives to Ti such as zirconia (Zr) may offer aesthetic advantages and be more acceptable to patients and clinicians concerned about Ti allergy but must show equivalent biological acceptability to Ti. The research aimed to investigate soft and hard tissue response to Ti and Zr implants in edentulous patients. The research included 24 participants (Ti = 12, Zr = 12) restored with one-piece ball-abutment implants to support overdentures. Participants received four maxillary implants (two in the premolar alveolus, one off center in the alveolar midline, and one wide-diameter implant in the anterior median palate) and three mandibular implants (one in the midline and bilateral posterior implants). Success rates for both Ti and Zr implants were low, 67.9% for all alveolar implants and a survival rate of 50.0% for the palatal implants. Only 11 (52.4%) of 21 palatal implants survived the follow-up period. Peri-implant health was equivalent for Ti and Zr implants and showed no statistically significant changes from loading to the 1-year follow-up. Statistically significant differences were noted in radiographic bone level between Ti and Zr implants (p = .02), with Zr showing greater bone loss. Although the failure rates with the one-piece Zr implants were higher than with the Ti ones, suggesting that the former's clinical usage as in this study cannot be recommended, it should be borne in mind that the fault may also lie with the novel prosthodontic design which was used. © 2013 Wiley Periodicals, Inc.

  14. Paediatric laser dentistry. Part 4: Soft tissue laser applications.

    Science.gov (United States)

    Olivi, G; Caprioglio, C; Olivi, M; Genovese, M D

    2017-12-01

    Lasers can provide effective soft tissues applications in children. All the wavelengths produce incision and vaporisation of oral tissues, together with a high bactericidal effect. The haemosthatic effect varys according to the wavelength used, and the choice of a visibile, near, medium or far infrared laser allows a better interaction with specific targets, gingiva, mucosa, frenum, or oral pathology.

  15. Partial Extraction Therapies (PET) Part 1: Maintaining Alveolar Ridge Contour at Pontic and Immediate Implant Sites.

    Science.gov (United States)

    Gluckman, Howard; Salama, Maurice; Du Toit, Jonathan

    2016-01-01

    Buccopalatal collapse of the postextraction ridge is a significant challenge in restorative and implant dentistry. A variety of ridge preservation techniques using tissue and augmentative materials have been proposed in the literature. A slightly different approach is to use the tooth itself. Root submergence has been reported in the literature for more than 4 decades, and it has been demonstrated that the submerged tooth root retains the periodontal tissues and preserves the bone in pontic sites or below dentures to retain the ridge. The socket-shield technique entails preparing a tooth root section simultaneous to immediate implant placement and has demonstrated histologic and clinical results that are highly promising to esthetic implant treatment. The pontic shield technique preserves the alveolar ridge at sites intended for pontic development where the root submergence technique is not possible. The aforementioned techniques collectively may be termed partial extraction therapies (PET), a term newly introduced into the literature and clinical environment. This article is a review of these ridge preservation therapies, providing a classification and a guide to their application.

  16. Medical students' perceptions of their development of 'soft skills' Part I

    African Journals Online (AJOL)

    Medical students' perceptions of their development of 'soft skills' Part I: A qualitative research methodology. ... South African Family Practice ... a research project was undertaken to study interpersonal skills, professional attitudes, teamwork, ethics and related topics – which have come to be known collectively as 'soft skills'.

  17. Anatomy of Mandibular Vital Structures. Part I: Mandibular Canal and Inferior Alveolar Neurovascular Bundle in Relation with Dental Implantology

    Directory of Open Access Journals (Sweden)

    Hom-Lay Wang

    Full Text Available Objectives: It is critical to determine the location and configuration of the mandibular canal and related vital structures during the implant treatment. The purpose of the present study was to review the literature concerning the mandibular canal and inferior alveolar neurovascular bundle anatomical variations related to the implant surgery.Material and Methods: Literature was selected through the search of PubMed, Embase and Cochrane electronic databases. The keywords used for search were mandibular canal, inferior alveolar nerve, and inferior alveolar neurovascular bundle. The search was restricted to English language articles, published from 1973 to November 2009. Additionally, a manual search in the major anatomy, dental implant, prosthetic and periodontal journals and books were performed.Results: In total, 46 literature sources were obtained and morphological aspects and variations of the anatomy related to implant treatment in posterior mandible were presented as two entities: intraosseous mandibular canal and associated inferior alveolar neurovascular bundle.Conclusions: A review of morphological aspects and variations of the anatomy related to mandibular canal and mandibular vital structures are very important especially in implant therapy since inferior alveolar neurovascular bundle exists in different locations and possesses many variations. Individual, gender, age, race, assessing technique used and degree of edentulous alveolar bone atrophy largely influence these variations. It suggests that osteotomies in implant dentistry should not be developed in the posterior mandible until the position of the mandibular canal is established.

  18. Soft power as part of China's strategy for national image cultivation

    DEFF Research Database (Denmark)

    Overgaard, Signe

    In recent years soft power has become a key issue at the highest political level in China, focusing especially on cultural soft power. This is reflected in important political documents, such as five year plans, plenum meeting summaries, as well as speeches by Hu Jintao and other politicians at t...... remains whether it is really a softer identity, rather than soft power in the usual sense China is looking for? And is this image actually directed towards a foreign audience, or is it to some extent China’s own population this softer identity is directed at?......In recent years soft power has become a key issue at the highest political level in China, focusing especially on cultural soft power. This is reflected in important political documents, such as five year plans, plenum meeting summaries, as well as speeches by Hu Jintao and other politicians...... at the highest level. This interest in soft power is generally seen as part of an important foreign policy shift, and the huge amounts of money spent by the government on cultural diplomacy testify to the importance attached to it. Understanding what might be the goal of China’s soft power strategy is however...

  19. Pulmonary alveolar proteinosis

    Science.gov (United States)

    PAP; Alveolar proteinosis; Pulmonary alveolar phospholipoproteinosis; Alveolar lipoproteinosis phospholipidosis ... PAP is unknown. In others, it occurs with lung infection or an immune problem. It also can ...

  20. Diagnostic imaging of the equine tarsal region using radiography and ultrasonography. Part 1: the soft tissues.

    Science.gov (United States)

    Vanderperren, Katrien; Raes, Els; Hoegaerts, Michel; Saunders, Jimmy H

    2009-02-01

    The equine tarsus is the most commonly affected hindlimb region associated with lameness. Diagnostic imaging is routinely applied but because of its complexity, being composed of 10 multifaceted bones and different joints, multiple ligaments, tendons and bursae, imaging this region can be a challenge. This is the first part of a two-part review of the structures and disorders of the equine tarsus. It describes the principal disorders affecting the soft tissues of the tarsal region and addresses some of the technical aspects in taking radiographic, ultrasonographic and scintigraphic images of the different soft tissue lesions. Where applicable, comments on the diagnostic use of contrast radiography, arthroscopy and tenoscopy are made. In current clinical practice a combination of radiography and ultrasonography is still most frequently used to arrive at a diagnosis.

  1. Alveolar ridge dimensional changes following ridge preservation procedure: part-2 - CBCT 3D analysis in non-human primate model.

    Science.gov (United States)

    Omran, Mostafa; Min, Seiko; Abdelhamid, Alaa; Liu, Yi; Zadeh, Homayoun H

    2016-07-01

    The aim of this study was to evaluate the efficacy of ridge preservation involving novel devices used for obturation of socket orifice (Socket cap; SocketKAP(™) ) and resorbable cage used for space maintenance in sites with facial wall dehiscence (Socket cage; SocketKAGE(™) ). Eight teeth were extracted in each of six Macaca fascicularis non-human primates. Six intervention groups consisted of the following: Group A: intact socket negative control. Group B: intact socket: socket cap. Group C: intact socket filled with anorganic bovine bone mineral (ABBM) + socket cap. Group D: dehiscence: negative control. Group E: dehiscence: socket cap + socket cage. Group F: dehiscence: filled with ABBM + socket cap + socket cage. CBCT scans were obtained preoperatively and at 6 and 12 weeks following intervention. The pre- and postoperative scans were superimposed, to quantify 3D volumetric alveolar bone changes. Volumetric bone loss occurred in all sockets, not only within the cretal zone (0-3 mm) to the ridge crest, as has been commonly reported by other investigators, but significant bone loss was also detected in the zone which was 3-6 mm apical to the alveolar crest. For intact sockets, socket cap + ABBM led to significantly greater percentages of remaining bone volume when compared to groups A and B. A significant difference favoring socket cap + socket cage + ABBM treatment was observed for sockets with facial dehiscence defects compared to groups D and E. Socket cap in conjunction with ABBM appears effective in limiting post-extraction volumetric bone loss in intact sockets, while socket cap + socket cage + ABBM appears effective in limiting post-extraction bone loss in sockets with dehiscence defects. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Protective phenotypes of club cells and alveolar macrophages are favored as part of endotoxin-mediated prevention of asthma

    Science.gov (United States)

    García, Luciana N; Leimgruber, Carolina; Uribe Echevarría, Elisa M; Acosta, Patricio L; Brahamian, Jorge M; Polack, Fernando P; Miró, María S; Quintar, Amado A; Sotomayor, Claudia E

    2014-01-01

    Atopic asthma is a chronic allergic disease that involves T-helper type 2 (Th2)-inflammation and airway remodeling. Bronchiolar club cells (CC) and alveolar macrophages (AM) are sentinel cells of airway barrier against inhaled injuries, where allergy induces mucous metaplasia of CC and the alternative activation of AM, which compromise host defense mechanisms and amplify Th2-inflammation. As there is evidence that high levels of environmental endotoxin modulates asthma, the goal of this study was to evaluate if the activation of local host defenses by Lipopolysaccharide (LPS) previous to allergy development can contribute to preserving CC and AM protective phenotypes. Endotoxin stimulus before allergen exposition reduced hallmarks of allergic inflammation including eosinophil influx, Interleukin-4 and airway hyperreactivity, while the T-helper type 1 related cytokines IL-12 and Interferon-γ were enhanced. This response was accompanied by the preservation of the normal CC phenotype and the anti-allergic proteins Club Cell Secretory Protein (CCSP) and Surfactant-D, thereby leading to lower levels of CC metaplasia and preventing the increase of the pro-Th2 cytokine Thymic stromal lymphopoietin. In addition, classically activated alveolar macrophages expressing nitric oxide were promoted over the alternatively activated ones that expressed arginase-1. We verified that LPS induced a long-term overexpression of CCSP and the innate immune markers Toll-like receptor 4, and Tumor Necrosis Factor-α, changes that were preserved in spite of the allergen challenge. These results demonstrate that LPS pre-exposition modifies the local bronchioalveolar microenvironment by inducing natural anti-allergic mechanisms while reducing local factors that drive Th2 type responses, thus modulating allergic inflammation. PMID:25504013

  3. Mitochondrial catalase overexpressed transgenic mice are protected against lung fibrosis in part via preventing alveolar epithelial cell mitochondrial DNA damage.

    Science.gov (United States)

    Kim, Seok-Jo; Cheresh, Paul; Jablonski, Renea P; Morales-Nebreda, Luisa; Cheng, Yuan; Hogan, Erin; Yeldandi, Anjana; Chi, Monica; Piseaux, Raul; Ridge, Karen; Michael Hart, C; Chandel, Navdeep; Scott Budinger, G R; Kamp, David W

    2016-12-01

    Alveolar epithelial cell (AEC) injury and mitochondrial dysfunction are important in the development of lung fibrosis. Our group has shown that in the asbestos exposed lung, the generation of mitochondrial reactive oxygen species (ROS) in AEC mediate mitochondrial DNA (mtDNA) damage and apoptosis which are necessary for lung fibrosis. These data suggest that mitochondrial-targeted antioxidants should ameliorate asbestos-induced lung. To determine whether transgenic mice that express mitochondrial-targeted catalase (MCAT) have reduced lung fibrosis following exposure to asbestos or bleomycin and, if so, whether this occurs in association with reduced AEC mtDNA damage and apoptosis. Crocidolite asbestos (100µg/50µL), TiO 2 (negative control), bleomycin (0.025 units/50µL), or PBS was instilled intratracheally in 8-10 week-old wild-type (WT - C57Bl/6J) or MCAT mice. The lungs were harvested at 21d. Lung fibrosis was quantified by collagen levels (Sircol) and lung fibrosis scores. AEC apoptosis was assessed by cleaved caspase-3 (CC-3)/Surfactant protein C (SFTPC) immunohistochemistry (IHC) and semi-quantitative analysis. AEC (primary AT2 cells from WT and MCAT mice and MLE-12 cells) mtDNA damage was assessed by a quantitative PCR-based assay, apoptosis was assessed by DNA fragmentation, and ROS production was assessed by a Mito-Sox assay. Compared to WT, crocidolite-exposed MCAT mice exhibit reduced pulmonary fibrosis as measured by lung collagen levels and lung fibrosis score. The protective effects in MCAT mice were accompanied by reduced AEC mtDNA damage and apoptosis. Similar findings were noted following bleomycin exposure. Euk-134, a mitochondrial SOD/catalase mimetic, attenuated MLE-12 cell DNA damage and apoptosis. Finally, compared to WT, asbestos-induced MCAT AT2 cell ROS production was reduced. Our finding that MCAT mice have reduced pulmonary fibrosis, AEC mtDNA damage and apoptosis following exposure to asbestos or bleomycin suggests an important role

  4. Alveolar ridge preservation in the esthetic zone.

    Science.gov (United States)

    Jung, Ronald E; Ioannidis, Alexis; Hämmerle, Christoph H F; Thoma, Daniel S

    2018-02-27

    In the esthetic zone, in the case of tooth extraction, the clinician is often confronted with a challenge regarding the optimal decision-making process for providing a solution using dental implants. This is because, after tooth extraction, alveolar bone loss and structural and compositional changes of the covering soft tissues, as well as morphological alterations, can be expected. Ideally, the therapeutic plan starts before tooth extraction and it offers three options: spontaneous healing of the extraction socket; immediate implant placement; and techniques for preserving the alveolar ridge at the site of tooth removal. The decision-making process mainly depends on: (i) the chosen time-point for implant placement and the ability to place a dental implant; (ii) the quality and quantity of soft tissue in the region of the extraction socket; (iii) the remaining height of the buccal bone plate; and (iv) the expected rates of implant survival and success. Based on scientific evidence, three time-periods for alveolar ridge preservation are described in the literature: (i) soft-tissue preservation with 6-8 weeks of healing after tooth extraction (for optimization of the soft tissues); (ii) hard- and soft-tissue preservation with 4-6 months of healing after tooth extraction (for optimization of the hard and soft tissues); and (iii) hard-tissue preservation with > 6 months of healing after tooth extraction (for optimization of the hard tissues). © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Segment distraction to reduce a wide alveolar cleft before alveolar bone grafting.

    NARCIS (Netherlands)

    Binger, T.; Katsaros, C.; Rucker, M.; Spitzer, W.J.

    2003-01-01

    OBJECTIVE: To demonstrate a method for reduction of wide alveolar clefts prior to bone grafting. This method aims to facilitate bone grafting and achieve adequate soft tissue coverage of the graft with attached gingiva. CASE REPORT: Treatment of a patient with bilateral cleft lip and palate with a

  6. [Epidemiology of bone and soft-part tumors of the foot and knee].

    Science.gov (United States)

    Delgado Cedillo, Ernesto Andrés; Rico Martínez, Genaro; Linares González, Luis Miguel; Estrada Villaseñor, Eréndira; León Hernández, Saúl Renán; Ble Campos, Raul

    2007-01-01

    Report of cases. Review of the cases in a period of 10 years with bone and soft tumors in foot and ankle, to knowing epidemilogical, clinic and patologic anatomy parameters to describe the behavior. Review of 166 cases from 1991 to 2000 and been analyze with descriptive statistic, association measurment for inside stratum, with odds ratio, hipótesis test with chi square for qualitative date and t to Student for quantitative date. 166 patients within 2 years to 78 years old, 81 with bone tumors and 79 with soft tumors, mostly benign, the most frequent was in the soft tissue ganglion and oseal benign exostosis in bone, 6 different malignant tumors, the principal affected zone were the toes, as a difference to literature, the most affected age group was 10 to 20 years followed to the 30 to 40 years old, we report 42 different patological diagnostics results to soft tissue and osseous tissue. clinical features is not a useful parameter to differentiate between malign or benign tumors and does not allow to establish the biological behavior, we propose the diagnostic algorithm that includes the intentional clinical probe, comparative X-ray in three projections with soft technique, in suspicion to malignant lesion may require CT scan, MRI, osseous scan and finally biopsy which will improve the final outcome.

  7. Diagnostic imaging of the equine fetlock region using radiography and ultrasonography. Part 1: Soft tissues.

    Science.gov (United States)

    Vanderperren, Katrien; Saunders, Jimmy H

    2009-08-01

    The equine fetlock is the joint most commonly associated with lameness. Although the fetlock is regarded as a simple joint, diagnosis of a fetlock disorder can be a challenge and various imaging modalities are routinely used to arrive at an accurate diagnosis. This review describes the principal disorders affecting the soft tissues of the fetlock region and addresses some of the technical aspects involved in taking radiographic and ultrasonographic images of the different soft tissue lesions. A combination of radiography and ultrasonography is still the most commonly used diagnostic approach in clinical practice.

  8. Clinic-radiology findings at limp-sparing surgery of alveolar sarcoma

    International Nuclear Information System (INIS)

    Tzekov, A.; Penchev, V.; Niagolova, S.; Kovachev, V.

    2007-01-01

    Soft-tissue sarcomas are a rare and heterogeneous group of tumors. Alveolar soft part sarcoma is a rare sarcoma of an unclear cause. It is representing 0.2-1 percent of soft tissue sarcomas. Unique biologic behaviors of soft-tissue sarcomas features include formation of a reactive zone, intra-compartmental growth, and, rarely, the presence of skip metastases. Although the soft-tissue sarcomas have a unique morphology, biological behavior, and prognosis, they share biological characteristics and are treated in a similar fashion. The concept of limb-sparing surgery, or limb salvage, has gradually evolved over the past 25 years. Prior to this the basic principles of surgical oncology for the extremities consisted solely of determining the correct level at which to perform an amputation. The three stages of a limb-sparing procedure are as follows: tumor resection skeletal reconstruction and soft-tissue coverage and muscle transfers to restore function. Imaging diagnostic is a key step in the limp-sparing surgery of a soft tissue sarcomas at relation of: preoperatively - the diagnosis of lesion, the decision for biopsy, about location of the lesion and what is the safest anatomic route to that location, possibly lung and bone metastases; postoperative - checking the position of the prosthesis, inflammatory, mechanic and oncology complications. (authors)

  9. Proteinosis alveolar pulmonar Pulmonary alveolar proteinosis

    Directory of Open Access Journals (Sweden)

    Concepción Sánchez Infante

    2011-12-01

    Full Text Available La proteinosis alveolar pulmonar es una enfermedad respiratoria crónica, caracterizada por alteración en el metabolismo del surfactante, lo que determina su acumulación anormal en el espacio alveolar. Es una enfermedad extremadamente rara. Se han reportado solamente 500 casos en la literatura. Se describió por primera vez en 1958. Se presenta un caso de proteinosis alveolar pulmonar en un lactante de 2 meses, con desnutrición proteico energética, que ingresa por dificultad respiratoria e hipoxemia, y, con imágenes radiológicas de tipo retículo-nodulillar, en vidrio deslustrado, en el cual se plantea inicialmente el diagnóstico de bronconeumonía. Ante la evolución desfavorable y no respuesta al tratamiento, se realizó un estudio para descartar enfermedades pulmonares crónicas. El paciente fallece y se confirma el diagnóstico por anatomía patológica. Se realiza una revisión del tema.The pulmonary alveolar proteinosis is a chronic respiratory disease characterized by surfactant metabolism alteration determining its abnormal accumulation in the alveolar space. It is a disease very rare and in literature only 500 cases have been reported; it was described for the first time in 1958. This is a case presentation of pulmonary alveolar proteinosis in an infant aged 2 months with energetic protein malnutrition admitted due to respiratory difficulty and hypoxemia and with radiologic images of the reticulonodulillary, in frosting glass, where initially is made the diagnosis of bronchopneumonia. In the face of unfavorable evolution and no response to treatment, a study was conducted to rule out chronic pulmonary diseases. Patient died confirming the diagnosis according to the pathologic anatomy. A review on subject is carried out.

  10. Regenerative potential of leucocyte- and platelet-rich fibrin. Part B: sinus floor elevation, alveolar ridge preservation and implant therapy. A systematic review.

    Science.gov (United States)

    Castro, Ana B; Meschi, Nastaran; Temmerman, Andy; Pinto, Nelson; Lambrechts, Paul; Teughels, Wim; Quirynen, Marc

    2017-02-01

    To analyse the effect of leucocyte- and platelet-rich fibrin (L-PRF) on bone regeneration procedures and osseointegration. An electronic and hand search was conducted in three databases (MEDLINE, EMBASE and Cochrane). Only randomized clinical trials, written in English where L-PRF was applied in bone regeneration and implant procedures, were selected. No follow-up restrictions were applied. A total of 14 articles were included and processed. Three subgroups were created depending on the application: sinus floor elevation (SFE), alveolar ridge preservation and implant therapy. In SFE, for a lateral window as well as for the trans-alveolar technique, histologically faster bone healing was reported when L-PRF was added to most common xenografts. L-PRF alone improved the preservation of the alveolar width, resulting in less buccal bone resorption compared to natural healing. In implant therapy, better implant stability over time and less marginal bone loss were observed when L-PRF was applied. Meta-analyses could not be performed due to the heterogeneity of the data. Despite the lack of strong evidence found in this systematic review, L-PRF might have a positive effect on bone regeneration and osseointegration. © 2016 The Authors. Journal of Clinical Periodontology Published by John Wiley & Sons Ltd.

  11. BiomaSoft: data processing system for monitoring and evaluating food and energy production. Part I

    International Nuclear Information System (INIS)

    Quevedo, J. R.; Suárez, J.

    2015-01-01

    The integrated food and energy production in Cuba demands to process diverse and voluminous information to make local, sectoral and national decisions, in order to have incidence on public policies, for which the support of automated systems that facilitate the monitoring and evaluation (M&E) of the integrated food and energy production in Cuban municipalities is necessary. The objective of this research was to identify the tools for the design of the data processing system BiomaSoft and to contextualize its application environment. The software development methodology was RUP (Rational Unified Process), with UML (Unified Modeling Language) as modeling language and PHP (Hypertext Pre-Processor) as programming language. The environment was conceptualized through a dominion model and the functional and non-functional requisites that should be fulfilled, as well as the Use Case Diagram of the system, with the description of actors, were specified. For the display of BiomaSoft a configuration based on two types of physical nodes (a web server and client computers) was conceived, in the municipalities that participate in the project «Biomass as renewable energy source for Cuban rural areas» (BIOMAS-CUBA). It is concluded that the monitoring and evaluation of integrated food and energy production under Cuban conditions can be made through the automated system BiomaSoft, and the identification of tools for its design and the contextualization of its application environment contribute to this purpose. (author)

  12. Soft and Hard Tissue Management in Implant Therapy—Part I: Surgical Concepts

    Directory of Open Access Journals (Sweden)

    Antonio D'Addona

    2012-01-01

    Full Text Available Implant therapy has become a reliable and predictable treatment alternative for the replacement of missing teeth with conventional removable and fixed partial dentures. Recently though, in the pursuit for improved esthetics, the literature has dedicated a considerable amount of its research on the successful maintenance and regeneration of the surrounding gingiva and bone, which are lost following extraction of a tooth. Thoroughly analyzing the anatomic situation and well-planned treatment has become a requirement, because incorrectly planned and positioned implants may jeopardize long-term esthetic and functional prognosis. In addition, many types of biocompatible materials, autogenous hard and soft tissue grafts, and different surgical techniques have been developed, and their viability has been investigated. As a result, implant specialists have gained a greater understanding of the dynamics and anatomical and biological concepts of the periodontium and peri-implant tissues both at the surgical and prosthetic phases of treatment, which contributes to better soft and hard tissue management (SHTM. This may further contribute to achieving a superior final result which is obtained by having a harmonious soft tissue profile, a correctly placed and contoured final restoration, and the reestablishment of masticatory function and phonetics.

  13. Three-dimensional soft tissue prediction using finite elements. Part I: Implementation of a new procedure.

    Science.gov (United States)

    Holberg, Christof; Schwenzer, Katja; Rudzki-Janson, Ingrid

    2005-03-01

    The prediction of soft tissue esthetics is important for achieving an optimal esthetic outcome in orthodontic treatment planning. Applicable procedures have so far been restricted to two-dimensional profile predictions that have not proven to be very reliable. The goal of this investigation was therefore to develop a novel finite element-based procedure that allows a three-dimensional, easily visualized, quantitative analysis and prediction of soft tissue behavior for the clinician. The procedure to be developed should be easy to handle and not entail any additional radiation exposure for the patient. Using a three-dimensional scanner, the facial surfaces of 20 probands were digitalized and individual FEM models were generated. After reduction of data redundancy via several conversion steps, a patient-specific simulation model was prepared consisting of 20,000 to 40,000 individual elements to which specific physical properties could be assigned. The average time required for generating a virtual model was 50 minutes. Problems occurring during model generation were rare (mainly shadowing phenomena and movement artifacts). The procedure outlined herein makes the reliable generation of patient-specific simulation models possible for facial soft tissue prediction in orthodontics.

  14. Alveolar ridge dimensional changes following ridge preservation procedure with novel devices: part 3 - histological analysis in non-human primate model.

    Science.gov (United States)

    Su, Yingying; Tang, Jianxia; Min, Seiko; Guo, Lijia; Liu, Yitong; Xie, Yilin; Xiong, Jimin; Wang, Songlin; Araújo, Mauricio G; Zadeh, Homayoun H; Liu, Yi

    2017-11-01

    This study sought to investigate the histological changes following tooth extraction, ridge preservation and augmentation, using novel devices designed to obturate the oral orifice of extraction sockets (SocketKAP™) and provide structural support for sockets with defective bony walls (SocketKAGE™) in a non-human primate model. Six Macaca fascicularis were imaged by cone beam computed tomography to register their preoperative alveolar bone. Three teeth were extracted in each animal, yielding intact socket walls and were divided into three intervention groups: unassisted healing negative control (Group A); SocketKAP™ (Group B); filled with anorganic bovine bone mineral (ABBM) + SocketKAP™ (Group C). Three additional teeth were extracted in each animal, followed by surgical resection of the entire buccal alveolar bone and divided into three groups: negative control (Group D); SocketKAP™ + SocketKAGE™ (Group E); ABBM + SocketKAP™ + SocketKAGE™ (Group F). Animals were euthanized after 12 weeks, and treatment sites were examined by histology and histomorphometric analysis. Control sockets with unassisted healing (Groups A and D) underwent severe loss of bone width, height and total area (approximately 40-60% loss). Application of SocketKAP™ in sites with intact walls, as well as SocketKAP™ plus SocketKAGE™ in sites with defective buccal walls lead to higher preservation of alveolar bone height after 12 weeks post-intervention. Addition of ABBM leads to the highest degree of alveolar bone dimensional preservation. Control sites with unassisted healing (Groups A and D), as well as sites treated with extraction socket devices (Groups B and E) without ABBM yielded higher percentage of vital bone, compared with sites filled with ABBM (Groups C and F). No adverse histological responses were noted to SocketKAP™ or SocketKAGE™ devices. SocketKAP™ + SocketKAGE™ devices proved effective in reducing post-extraction alveolar bone resorption

  15. Alveolar ridge dimensional changes following ridge preservation procedure with novel devices: Part 1--CBCT linear analysis in non-human primate model.

    Science.gov (United States)

    Min, Seiko; Liu, Yi; Tang, Jianxia; Xie, Yilin; Xiong, Jimin; You, Hyung-Keun; Zadeh, Homayoun H

    2016-01-01

    This study sought to investigate dimensional changes to the alveolar bone following extraction and application of novel devices used for obturation of socket orifice (socket cap) and space maintenance in sockets with facial dehiscence (socket cage). Six Macaca fascicularis had six teeth each removed according to the following intervention groups (groups A-C intact alveolar bone; D-E facial dehiscence): negative control (A); socket obturated with cap (B); filled with anorganic bovine bone mineral (ABBM) + socket cap (C); dehiscence negative control (D); socket cap + socket cage (E); ABBM + socket cap + socket cage (F). Serial CBCT scans at preoperatively, 6 and 12 weeks following intervention were compared to quantify linear alveolar bone alterations. Without therapeutic intervention, intact sockets exhibited significant reduction in width at the crestal 2 mm of the ridge crest within 6 weeks. Compared with the negative control sites which lost up to 52% of crestal bone width, sites treated with socket cap + ABBM lost at most 4% of bone width at the crestal 2 mm. Similar results were seen in the dehiscence groups, with the combination of socket cap + socket cage + ABBM maintaining the greatest socket width and height dimensions. Results from the current non-human primate study suggest that the socket cap and socket cage devices, when used in conjunction with xenograft proved effective in minimizing post-extraction socket width loss and height seen in both intact sockets and sockets with facial dehiscence defects. © 2015 The Authors. Clinical Oral Implants Research Published by John Wiley & Sons Ltd.

  16. Minor rheumatology: Nonsystemic rheumatic disease of juxta-articular soft tissues of the upper extremity. Part 1

    Directory of Open Access Journals (Sweden)

    A. E. Karateev

    2015-01-01

    Full Text Available Rheumatic diseases of juxta-articular soft tissues (RDJAST (tendinitis, tenosynovitis, bursitis, etc. are one of the most common causes of disability and one the most common reasons for seeking medical advice. To manage patients with RDJAST is an important part of practising rheumatologists’ work. But unfortunately, the issues of diagnosis and therapy of this pathology have been relatively rarely discussed on the pages of Russian medical journals and at the scientific congresses and conferences of rheumatologists in recent years. This review is to refresh physicians’interest in this problem. Part 1 of this review briefly considers the general issues relating to the epidemiology, pathogenesis, and diagnosis of RDJAST of the upper extremity, such as rotator cuff tendinitis, lateral and medial epicondylitis, stenosing flexor tenosynovitis, de Quervain’s syndrome, and carpal tunnel syndrome.

  17. Pulmonary alveolar proteinosis in a child from an informal settlement

    African Journals Online (AJOL)

    clinical, histopathological, biochemical and genetic data.[3]. Surfactant homeostasis is critical for lung function and is tightly regulated, in part by pulmonary granulocyte-macrophage colony- stimulating factor (GM-CSF), which is required for surfactant clearance by alveolar macrophages and alveolar macrophage maturation.

  18. Proteomic Analysis of Gingival Tissue and Alveolar Bone during Alveolar Bone Healing*

    OpenAIRE

    Yang, Hee-Young; Kwon, Joseph; Kook, Min-Suk; Kang, Seong Soo; Kim, Se Eun; Sohn, Sungoh; Jung, Seunggon; Kwon, Sang-Oh; Kim, Hyung-Seok; Lee, Jae Hyuk; Lee, Tae-Hoon

    2013-01-01

    Bone tissue regeneration is orchestrated by the surrounding supporting tissues and involves the build-up of osteogenic cells, which orchestrate remodeling/healing through the expression of numerous mediators and signaling molecules. Periodontal regeneration models have proven useful for studying the interaction and communication between alveolar bone and supporting soft tissue. We applied a quantitative proteomic approach to analyze and compare proteins with altered expression in gingival sof...

  19. Accelerated orthodontics with alveolar decortication and augmentation: a case report.

    Science.gov (United States)

    Yezdani, A Arif

    2012-01-01

    This case report reiterates the fact that selective alveolar decortication in conjunction with periodontal alveolar augmentation with a bone graft indubitably and efficaciously produces rapid orthodontic tooth movement. A 29-year-old woman presented with a Class I malocclusion and increased bidentoalveolar protrusion with increased spacing between the maxillary and mandibular incisors. She readily agreed to selective alveolar decortication in conjunction with periodontal alveolar augmentation with a bone graft when presented with the proposal that her malocclusion could be corrected in one-third the treatment time required for conventional orthodontics. A preadjusted edgewise appliance (Roth prescription, 0.022 x 0.028-inch slot) was placed prior to the surgical procedure. One week later, full-thickness labial and lingual flaps were reflected in the maxillary and mandibular arches. The alveolar bone was selectively decorticated and periodontally augmented with a bone graft. Starting 1 week postsurgically, orthodontic adjustments were carried out every 2 weeks. From bracketing to debracketing, the entire orthodontic treatment took 7 months. The rapid orthodontic tooth movement was attributed to the regional acceleratory phenomenon, triggered by selective alveolar decortication. The subsequent periodontal alveolar augmentation with the bone graft repaired the bony dehiscences and enhanced the bone volume and dramatically improved the patient's soft tissue profile.

  20. Human movement analysis using stereophotogrammetry. Part 3. Soft tissue artifact assessment and compensation.

    Science.gov (United States)

    Leardini, Alberto; Chiari, Lorenzo; Della Croce, Ugo; Cappozzo, Aurelio

    2005-02-01

    When using optoelectronic stereophotogrammetry, skin deformation and displacement causes marker movement with respect to the underlying bone. This movement represents an artifact, which affects the estimation of the skeletal system kinematics, and is regarded as the most critical source of error in human movement analysis. A comprehensive review of the state-of-the-art for assessment, minimization and compensation of the soft tissue artifact (STA) is provided. It has been shown that STA is greater than the instrumental error associated with stereophotogrammetry, has a frequency content similar to the actual bone movement, is task dependent and not reproducible among subjects and, of lower limb segments, is greatest at the thigh. It has been shown that in in vivo experiments only motion about the flexion/extension axis of the hip, knees and ankles can be determined reliably. Motion about other axes at those joints should be regarded with much more caution as this artifact produces spurious effects with magnitudes comparable to the amount of motion actually occurring in those joints. Techniques designed to minimize the contribution of and compensate for the effects of this artifact can be divided up into those which model the skin surface and those which include joint motion constraints. Despite the numerous solutions proposed, the objective of reliable estimation of 3D skeletal system kinematics using skin markers has not yet been satisfactorily achieved and greatly limits the contribution of human movement analysis to clinical practice and biomechanical research. For STA to be compensated for effectively, it is here suggested that either its subject-specific pattern is assessed by ad hoc exercises or it is characterized from a large series of measurements on different subject populations. Alternatively, inclusion of joint constraints into a more general STA minimization approach may provide an acceptable solution.

  1. Advanced Alveolar Rhabdomyosarcoma of the Uterus: A Case Report

    African Journals Online (AJOL)

    Alveolar rhabdomyosarcoma is an uncommon malignant soft tissue tumour rarely found in the female genital tract and carries a very poor prognosis especially in adults. A 44 year old premenopausal woman was evaluated for a lower abdominal mass, intermittent unprovoked vaginal bleeding and weight loss. Examination ...

  2. Pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    Surender Kashyap

    2013-01-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a rare, chronic lung disease with bilateral intra-alveolar calcium and phosphate deposition throughout the lung parenchyma with predominance to lower and midzone. Although, etiology and pathogenesis of PAM is not fully understood, the mutation in SLC34A2 gene that encodes a sodium-phosphate co-transporter in alveolar type II cells resulting in the accumulation and forming of microliths rich in calcium phosphate (due to impaired clearance are considered to be the cause of the disease. Chest radiograph and high-resolution CT of thorax are nearly pathognomonic for diagnosing PAM. HRCT demonstrates diffuse micronodules showing slight perilobular predominance resulting in calcification of interlobular septa. Patients with PAM are asymptomatic till development of hypoxemia and cor-pulmonale. No therapy has been proven to be beneficial except lung transplantation.

  3. Benthic variability in intertidal soft-sediments in the mesohaline part of the Schelde estuary

    NARCIS (Netherlands)

    Ysebaert, T.; Fettweis, M.; Meire, P.; Sas, M.

    2005-01-01

    The benthic (zoobenthos and microphytobenthos) and physical characteristics of intertidal sediments were studied in April and September 1997 on 10 locations, differing in elevation and exposure to tidal currents, situated on three mudflats in the mesohaline part of the Schelde estuary. Sediment

  4. Dento-alveolar and maxillofacial injuries: a 5-year multi-center study. Part 1: general vs facial and dental trauma.

    Science.gov (United States)

    Lin, Shaul; Levin, Liran; Goldman, Sharon; Peleg, Kobi

    2008-02-01

    Maxillofacial injuries are a significant cause of morbidity and demand meticulously planned treatment. The aim of this present multi-center study was to evaluate the occurrence of dento-alveolar and maxillofacial injuries over a 5-year period. A retrospective cohort study of data from the Israel Trauma Registry was conducted for the years 2000-2004. The registry includes all trauma patients admitted and hospitalized due to an injury. Of the 111,010 hospitalized trauma patients, 5886 (5.3%) were diagnosed with maxillofacial or dental injuries. The main causes of injuries for hospitalized trauma patients were falls (48.1%) and motor vehicle accidents (25.2%), while the major causes of facial and dental injuries were vehicle accidents (39.6%, 56.8%, respectively) and falls (32.1%, 26.7%, respectively). High-risk age groups for dental and facial trauma were 10-18 years and 19-28 years, respectively, while for other trauma, ages for the greatest risk ranged from 0 to 9 years and over 59 years. Males were injured two to three times more frequently than females. A better understanding of the etiology of maxillofacial and dental injuries and identifying the high-risk groups should lead to appropriate prevention programs and treatment methods.

  5. A case of a pleomorphic hyalinizing angiectatic tumor of soft parts with intracytoplasmic hemosiderin pigment apparent upon fine-needle aspiration cytology.

    Science.gov (United States)

    Yorita, Kenji; Ishihara, Akira; Tokumitsu, Takako; Minematsu, Eiko; Ohno, Akinobu; Ikejiri, Hiroshi; Kataoka, Hiroaki

    2015-05-01

    Pleomorphic hyalinizing angiectatic tumors of soft parts are extremely rare low-grade mesenchymal lesions that frequently occur subcutaneously, especially in the lower extremity. The tumor is histologically characterized by sheets of plump, spindled or rounded cells, and clusters of ectatic blood vessels. It also has a number of previously characterized cytological features such as pleomorphic cells, intranuclear pseudoinclusion, and intracytoplasmic hemosiderin pigments. However, intracytoplasmic hemosiderin has not been carefully evaluated in cytology specimens. Here, we report the case of a 56-year-old Japanese man with an encapsulated pleomorphic hyalinizing angiectatic tumor of soft parts that included fine and coarse hemosiderin-laden tumor cells. The tumor was clinically followed up as a hematoma, but malignant tumors, including malignant melanoma, were suspected because aspiration cytology specimens contained pleomorphic cells with intracytoplasmic brown pigments. The tumor was closely associated with an intratumoral hematoma and a few microscopic satellite lesions. Pleomorphic hyalinizing angiectatic tumor of soft parts should be included in the differential cytological diagnosis of soft tissue tumors if the three cytological features described earlier are present. Enucleation therapy could facilitate local recurrence, as the tumor may have the potential to infiltrate surrounding soft tissue or form satellite lesions. © 2014 The Authors. Diagnostic Cytopathology Published by Wiley Periodicals, Inc.

  6. Effect of monopolar radiofrequency treatment over soft-tissue fillers in an animal model: part 2.

    Science.gov (United States)

    Shumaker, Peter R; England, Laura J; Dover, Jeffrey S; Ross, E Victor; Harford, Robert; Derienzo, Damian; Bogle, Melissa; Uebelhoer, Nathan; Jacoby, Mark; Pope, Karl

    2006-03-01

    Monopolar radiofrequency (RF) treatment is used by physicians to heat skin and promote tissue tightening and contouring. Cosmetic fillers are used to soften deep facial lines and wrinkles. Patients who have had dermal fillers implanted may also benefit from or are candidates for monopolar RF skin tightening. This study examined the effect of RF treatment on various dermal filler substances. This is the second part of a two-part study. A juvenile farm pig was injected with dermal fillers including cross-linked human collagen (Cosmoplast), polylactic acid (PLA) (Sculptra), liquid injectable silicone (Silikon 1000), calcium hydroxylapatite (CaHA) (Radiesse), and hyaluronic acid (Restylane). Skin injected with dermal fillers was RF-treated using a 1.5-cm2 treatment tip and treatment levels typically used in the clinical setting. Fillers were examined histologically 5 days, 2 weeks, or 1 month after treatment. Histological specimens were scored for inflammatory response, foreign body response, and fibrosis in order to assess the effect of treatment on early filler processes, such as inflammation and encapsulation. Each filler substance produced a characteristic inflammatory response. No immediate thermal effect of RF treatment was observed histologically. RF treatment resulted in statistically significant increases in the inflammatory, foreign body, and fibrotic responses associated with the filler substances. Monopolar RF treatment levels that are typically used in the clinical setting were employed in this animal study. RF treatment resulted in measurable and statistically significant histological changes associated with the various filler materials. Additional clinical and histological studies are required to determine the optimal timing of monopolar RF treatment and filler placement for maximal potential aesthetic outcome. 2006 Wiley-Liss, Inc.

  7. Contemporary Approaches in the Repair of Alveolar Clefts

    Directory of Open Access Journals (Sweden)

    Ufuk Tatli

    2014-08-01

    Full Text Available Cleft lip and palate is one of the most common craniofacial anomalies. The repair of the alveolar clefts is an important part of the treatment for patients with cleft lip and palate. The treatment concepts of alveolar bone grafting are still controversial. The corresponding controversial issues are; timing of alveolar bone grafting, graft materials, and timing of the orthodontic expansion. In the present article, aforementioned controversial issues and contemporary treatment modalities of the maxillary alveolar clefts were reviewed in the light of current literature. In conclusion, the most suitable time for alveolar bone grafting is mixed dentition period. Grafting procedure may be performed in the early or late phases of this period depending on some clinical features. Adjunct orthodontic expansion procedures should be performed before and/or after grafting depending on the patient's current features. [Archives Medical Review Journal 2014; 23(4.000: 563-574

  8. Radionuclide study of the action of cadmium on alveolar macrophages

    International Nuclear Information System (INIS)

    Reulet, Maryse.

    1976-01-01

    The experimental toxicity of cadmium was studied on the lung, using cadmium sulfate, cadmium acetate and the radioactive isotope cadmium 109 in chloride or acetate form. The results are given in the following order: part one is devoted to the results of investigations on chronic cadmium poisoning and the role of alveolar macrophages in this poisoning; in part two the uptake of cadmium on alveolar macrophages is studied with cadmium 109, administered intraperitoneally; in part three the action of cadmium on the phospholipid metabolism of alveolar macrophages is examined. The cadmium, as sulfate or acetate, is administered in several ways: by intraperitoneal injection; or by inhalation of cadmium dusts or aerosols. The effect of cadmium on the oxidative metabolism of alveolar macrophages is studied in part four. This work is carried out 'in vitro' and 'in vivo' after cadmium oxide dusting of the air [fr

  9. Evidence-based knowledge on the aesthetics and maintenance of peri-implant soft tissues: Osteology Foundation Consensus Report Part 1-Effects of soft tissue augmentation procedures on the maintenance of peri-implant soft tissue health.

    Science.gov (United States)

    Giannobile, William V; Jung, Ronald E; Schwarz, Frank

    2018-03-01

    The goal of Working Group 1 at the 2nd Consensus Meeting of the Osteology Foundation was to comprehensively assess the effects of soft tissue augmentation procedures on peri-implant health or disease. A systematic review and meta-analysis on the effects of soft tissue augmentation procedures included a total of 10 studies (mucosal thickness: n = 6; keratinized tissue: n = 4). Consensus statements, clinical recommendations, and implications for future research were based on structured group discussions and a plenary session approval. Soft tissue grafting to increase the width of keratinized tissue around implants was associated with greater reductions in gingival and plaque indices when compared to non-augmented sites. Statistically significant differences were noted for final marginal bone levels in favor of an apically positioned flap plus autogenous graft vs. all standard-of-care control treatments investigated. Soft tissue grafting (i.e., autogenous connective tissue) to increase the mucosal thickness around implants in the aesthetic zone was associated with significantly less marginal bone loss over time, but no significant changes in bleeding on probing, probing depths, or plaque scores when compared to sites without grafting. The limited evidence available supports the use of soft tissue augmentation procedures to promote peri-implant health. © 2018 The Authors. Clinical Oral Implants Research Published by John Wiley & Sons Ltd.

  10. Evaluation of the esthetic results of 64 nonfunctional immediately loaded postextraction implants in the maxilla: correlation between interproximal alveolar crest and soft tissues at 3 years of follow-up.

    Science.gov (United States)

    Malchiodi, Luciano; Cucchi, Alessandro; Ghensi, Paolo; Nocini, Pier Francesco

    2013-02-01

    Many authors have emphasized that immediate loading protocols enable better esthetic results to be achieved compared with delayed loading, especially in the case of postextraction implants that are capable of maintaining the original esthetics of soft tissues. The aim of this study was to establish correlations between the interproximal crest, interproximal papilla, and marginal facial gingiva of immediately loaded postextraction implants by evaluating clinical and radiographic data. Fifty-eight consecutive patients underwent a tooth extraction and immediate implant placement with 64 postextraction implants, which were immediately loaded using a provisional single crown from June 2005 to December 2006. At 6 months after surgery, all implants were restored with a definitive single crown. Clinical and radiographic data were recorded at the time of surgery, at the time of definitive restoration, and after 3 years of functioning, in order to evaluate soft tissues esthetics and bone tissue condition. Statistical analysis was used to assess significant correlations between the interproximal crest, interproximal papilla, and marginal facial gingiva (p = 0.05). After 3 years of functioning, the implant success rate was 100% because no implants had failed. All parameters were stable and steady during the 3-year follow-up. The regression test revealed a statistically significant correlation between interproximal crest levels and interproximal papilla volume (p = 0.0134), and also between interproximal crest levels and marginal gingiva levels (p = 0.0226). Postextraction immediately loaded implants represent a predictable technique that should be considered the treatment of choice in cases of single anterior tooth restoration and other cases. Esthetic results seem to depend on correct positioning of the implants, considering the correlation between bone tissue and related soft tissues. Maintaining the original condition of both bone and soft tissues around

  11. Proteinosis alveolar pulmonar

    Directory of Open Access Journals (Sweden)

    Concepción Sánchez Infante

    2011-12-01

    Full Text Available La proteinosis alveolar pulmonar es una enfermedad respiratoria crónica, caracterizada por alteración en el metabolismo del surfactante, lo que determina su acumulación anormal en el espacio alveolar. Es una enfermedad extremadamente rara. Se han reportado solamente 500 casos en la literatura. Se describió por primera vez en 1958. Se presenta un caso de proteinosis alveolar pulmonar en un lactante de 2 meses, con desnutrición proteico energética, que ingresa por dificultad respiratoria e hipoxemia, y, con imágenes radiológicas de tipo retículo-nodulillar, en vidrio deslustrado, en el cual se plantea inicialmente el diagnóstico de bronconeumonía. Ante la evolución desfavorable y no respuesta al tratamiento, se realizó un estudio para descartar enfermedades pulmonares crónicas. El paciente fallece y se confirma el diagnóstico por anatomía patológica. Se realiza una revisión del tema.

  12. Alveolar development and disease.

    Science.gov (United States)

    Whitsett, Jeffrey A; Weaver, Timothy E

    2015-07-01

    Gas exchange after birth is entirely dependent on the remarkable architecture of the alveolus, its formation and function being mediated by the interactions of numerous cell types whose precise positions and activities are controlled by a diversity of signaling and transcriptional networks. In the later stages of gestation, alveolar epithelial cells lining the peripheral lung saccules produce increasing amounts of surfactant lipids and proteins that are secreted into the airspaces at birth. The lack of lung maturation and the associated lack of pulmonary surfactant in preterm infants causes respiratory distress syndrome, a common cause of morbidity and mortality associated with premature birth. At the time of birth, surfactant homeostasis begins to be established by balanced processes involved in surfactant production, storage, secretion, recycling, and catabolism. Insights from physiology and engineering made in the 20th century enabled survival of newborn infants requiring mechanical ventilation for the first time. Thereafter, advances in biochemistry, biophysics, and molecular biology led to an understanding of the pulmonary surfactant system that made possible exogenous surfactant replacement for the treatment of preterm infants. Identification of surfactant proteins, cloning of the genes encoding them, and elucidation of their roles in the regulation of surfactant synthesis, structure, and function have provided increasing understanding of alveolar homeostasis in health and disease. This Perspective seeks to consider developmental aspects of the pulmonary surfactant system and its importance in the pathogenesis of acute and chronic lung diseases related to alveolar homeostasis.

  13. Soft Clouding

    DEFF Research Database (Denmark)

    Søndergaard, Morten; Markussen, Thomas; Wetton, Barnabas

    2012-01-01

    Soft Clouding is a blended concept, which describes the aim of a collaborative and transdisciplinary project. The concept is a metaphor implying a blend of cognitive, embodied interaction and semantic web. Furthermore, it is a metaphor describing our attempt of curating a new semantics of sound...... archiving. The Soft Clouding Project is part of LARM - a major infrastructure combining research in and access to sound and radio archives in Denmark. In 2012 the LARM infrastructure will consist of more than 1 million hours of radio, combined with metadata who describes the content. The idea is to analyse...... the concept of ‘infrastructure’ and ‘interface’ on a creative play with the fundamentals of LARM (and any sound archive situation combining many kinds and layers of data and sources). This paper will present and discuss the Soft clouding project from the perspective of the three practices and competencies...

  14. Alveolar rhabdomyosarcoma originating between the fourth and fifth metatarsal--case report and literature review.

    LENUS (Irish Health Repository)

    Bolger, J C

    2010-09-01

    We report a case of alveolar rhabdomyosarcoma arising between the fourth and fifth metatarsal. A 13-year-old boy presented to outpatients with a history of pain and swelling in the lateral aspect of his left forefoot. Plain radiographs and MRI showed a soft tissue mass displacing the fourth metatarsal. Percutaneous biopsy revealed an alveolar rhabdomyosarcoma. Staging scans showed advanced metastatic disease. The patient was treated with chemotherapy. This highly malignant lesion remains challenging to diagnose, and difficult to treat successfully.

  15. [Treatment of dental accidents and associated alveolar fractures].

    Science.gov (United States)

    Teerijoki-Oksa, Tuija; Karjalainen, Sára; Soukka, Tero

    2010-01-01

    Diagnosis of dental accidents is based on patient history, clinical examination and imaging. A completely avulsed tooth should immediately be reimplanted, and a dislodged tooth urgently repositioned to the original position. Avulsed primary teeth will never be reimplanted, and primary teeth of children under three years are not repositioned. Furthermore, fractures of the alveolar process and various soft tissue injuries but not dental fractures require urgent treatment. All dental accident patients should be referred to dental consultation for further examinations and treatment.

  16. Strategies for alveolar ridge reconstruction and preservation for implant therapy.

    Science.gov (United States)

    Masaki, Chihiro; Nakamoto, Tetsuji; Mukaibo, Taro; Kondo, Yusuke; Hosokawa, Ryuji

    2015-10-01

    In dental implant treatment, ridge preservation and immediate or early implant placement are recommended to minimize bone resorption after tooth extraction and achieve esthetic outcomes. However, there is no consensus concerning the efficacy of this surgical method. There is also no consensus on the efficacy of bone and soft tissue grafts and surgical methods for alveolar ridge reconstruction. This paper reports ridge alteration in the anterior maxilla after tooth extraction, and summarizes the efficacy of various ridge preservation methods and immediate or early implant placement as alveolar ridge preservation methods to minimize bone resorption after tooth extraction. The advantages and complications of alveolar ridge reconstruction methods, and the efficacy and surgical method of soft tissue graft are reviewed. The anterior maxilla is in the esthetic zone, and the thickness of the bone on the labial side around the natural tooth is less than 1mm in many cases. Therefore, it is impossible to prevent bone resorption completely, even if ridge preservation and immediate or early implant placement are performed after tooth extraction. It is necessary to obtain stable and long-term esthetics by combining connective tissue and free gingival grafts, in addition to hard tissue augmentation. It is important to consider the burden and level of satisfaction of patients, such as in terms of donor site morbidity in hard and soft tissue grafting, and to pay attention to appropriate indications to avoid overtreatment. Copyright © 2015 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

  17. Distracción osteogénica alveolar como método de aumento del reborde alveolar Alveolar osteogenic distraction as method to increase the alveolar ridge

    Directory of Open Access Journals (Sweden)

    Denia Morales Navarro

    2011-03-01

    , disadvantages and complications. A bibliographic review was made by database search of reference systems as MEDLINE and PubliMed using the descriptors "alveolar distraction" o "osteogenic distraction". The published bibliographic sources mainly over 5 years concluding that this technique is an excellent alternative for the bone and soft tissues formation in zones of alveolar atrophy including three stages: latency, distraction and consolidation; being a foreseeable method and with low rates of bone reabsorption compared to other techniques of increase of alveolar ridge. It has its main indication in implant therapy to provide bone volume. We must to individualize each case and to use the more appropriate method according the clinical and personal features of patient. A proper case selection and a better understand of technique are essential to achieve successful results by alveolar osteogenic distraction. In Cuba the alveolar distraction has been not much applied being necessary to expand the studies on this subject matter.

  18. Bone resorption and complications in alveolar distraction osteogenesis.

    Science.gov (United States)

    Ettl, Tobias; Gerlach, Till; Schüsselbauer, Thomas; Gosau, Martin; Reichert, Torsten E; Driemel, Oliver

    2010-10-01

    Distraction osteogenesis presents an alternative procedure for augmentation of atrophic alveolar bone prior to inserting dental implants. The aim of this retrospective study was to evaluate complications of this method with specific focus on bone resorption during the consolidation period and the follow-up period after dental implant insertion into distracted bone. Thirty partially edentulous patients underwent a total of 36 vertical alveolar distractions with an extraosseous distraction system. Eleven devices were placed in the maxilla and 25 in the mandible. Eighty-two dental implants were inserted after a mean consolidation period of 4.5 months. Treatment results were evaluated by means of panoramic radiographs for distraction follow-up and periapical radiographs for implant follow-up. The mean length of the transport segment was 19 mm. The average alveolar height achieved was 6.4 mm with a mean resorption of 1.8 mm (21.1%) at the time of dental implant insertion. Main problems comprised oral displacement of the transport segment (n = 15) and inadequate soft tissue extension (n = 13). Eighty-two dental implants were inserted with an overall survival rate of 95.1% after 45.8 months. For periimplant marginal bone, an average resorption of 3.5 mm was recorded 50.4 months after implant insertion. Although alveolar distraction osteogenesis seems to be an effective tool to treat vertical defects of the alveolar ridge, it is not an uncomplicated procedure. A combination with vestibular augmentation of autogenous bone grafts should be considered. Overcorrection of 20% may compensate bone relapse during the consolidation period of the distracted alveolar bone. Further bone resorption after dental implantation is common.

  19. «Charts Power» - International Ratings as an Economic Weapon and a Tool of Soft Power. Part II

    Directory of Open Access Journals (Sweden)

    Владимир Геннадьевич Иванов

    2015-12-01

    Full Text Available In the given article, the authors propose and operationalize the notion of “charts power” (or “index power”, “ratings power” as a significant component of soft power of national states and international institutions. The authors prove that numerous comparative ratings of different countries that have become extremely popular in recent decades could be used as an economic weapon and an effective tool of influence. The article analyses the mechanisms of ratings power and emergence of “rating thinking”. The authors conclude about the importance of actual and potential threats to national security of the Russian Federation from charts power of the foreign states.

  20. Characterization of part of the toxic effects due to alpha irradiation and to the physico-chemical properties of some actinides. An in vitro study on the alveolar macrophage

    International Nuclear Information System (INIS)

    Lizon, Celine

    1999-01-01

    The aim of this work was to characterize the specific effects due to radiotoxicity of α irradiation and the chemical toxicity of actinides. This was performed on alveolar macrophages extracted from rats and primates by pulmonary lavage. This was done by an in vitro study using either α irradiation from electrodeposited sources, or soluble actinides and lanthanides added to the culture medium. Necrosis and apoptosis induction were quantified after vital staining. For each treatment, cells were studied 1 or 7 days after plating. After either α irradiation or exposure to elements, the main route of death induced was apoptosis. After α irradiation, alveolar macrophages are very radioresistant cells. The observed D0 was between 30 and 100 Gy, depending on the species studied and the time in culture at exposure. In fact, alveolar macrophages irradiated after 1 week in culture have show less radioresistance than those treated after 1 day. The chemical toxicity of Uranium and Neptunium was independent both of time in culture at exposure and the animal species. The threshold we observed were respectively at 5 10 -4 and 3 10 -6 M. Moreover, within the concentrations studied, Thorium have not shown any toxicity towards alveolar macrophages. 1 day after plating macrophages, lanthanides exerts a higher chemical toxicity than actinides (threshold : 5 10 -6 M, Gadolinium, 5 10 -5 M, Cerium). These toxicities decreases more than 10 times after exposure 7 days after plating or for primates cells. This phenomenon seems to be due to cell harvesting and/or to cell adaptation to culture. Preliminary results show an impairment of cytokines production, which could be specific of the toxic studied. This was observed at concentrations which appeared non toxic as regards to apoptosis induction. The use of primates alveolar macrophages allow us to extrapolate some of the obtained results to Human. (author) [fr

  1. Fenxiang biota: a new Early Ordovician shallow-water fauna with soft-part preservation from China.

    Science.gov (United States)

    Balinski, Andrzej; Sun, Yuanlin

    Our perception of biodiversity in the geological past is incomplete and biased because most organisms did not have mineralized skeletons and therefore had little chance of fossilization. This especially refers to shallow-water marine environments, rarely represented by localities with exceptional preservation of fossil material (known as taphonomic windows or Konservat-Lagerstätten). Such extraordinary "windows" may markedly broaden our knowledge of biodiversity of the past. Here, we show a review of the invertebrate fossils from recently discovered locality in the Lower Ordovician Fenxiang Formation of Hubei Province in southern China revealing exceptional preservation of soft tissues. The fauna, generally of shallow-water aspect, contains linguloid brachiopods with a remarkably preserved pedicle, the oldest traces of nematode life activities, the oldest reliable record of hydroids, the first fossil antipatharian corals, a pyritized colonial organism of unknown affinity, supposed arthropod appendages, probable phosphatized scalidophoran worm embryo and other fossils. Our discovery supports the opinion that the famous soft-bodied preservation of Burgess Shale- or Chengjiang-type did not vanish from the fossil record in post-Cambrian times. The new finding represents a prelude to the Great Ordovician Biodiversification Event and provides evidence for calibration of molecular clock of several invertebrate lineages.

  2. Development and validation of a numerical model for cross-section optimization of a multi-part probe for soft tissue intervention.

    Science.gov (United States)

    Frasson, L; Neubert, J; Reina, S; Oldfield, M; Davies, B L; Rodriguez Y Baena, F

    2010-01-01

    The popularity of minimally invasive surgical procedures is driving the development of novel, safer and more accurate surgical tools. In this context a multi-part probe for soft tissue surgery is being developed in the Mechatronics in Medicine Laboratory at Imperial College, London. This study reports an optimization procedure using finite element methods, for the identification of an interlock geometry able to limit the separation of the segments composing the multi-part probe. An optimal geometry was obtained and the corresponding three-dimensional finite element model validated experimentally. Simulation results are shown to be consistent with the physical experiments. The outcome of this study is an important step in the provision of a novel miniature steerable probe for surgery.

  3. Aumento del reborde alveolar residual mediante técnica de rollo Increase of residual alveolar ridge using roll technique

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Simancas Pallares

    2011-03-01

    Full Text Available La pérdida dentaria, asociada a factores sistémicos, patológicos y traumáticos, promueve el proceso de reabsorción ósea de los rebordes residuales y genera problemas funcionales, como la falta de estabilidad y retención de las prótesis dentarias removibles, y disturbios estéticos y psicológicos. Estos defectos varían en dependencia de la cantidad de pérdida ósea y de tejidos blandos que hayan alcanzado. En la actualidad son descritas diversas técnicas que permiten corregir estos defectos. Una de ellas es la técnica del rollo, la cual demuestra muy buenos resultados al aumentar el tamaño del reborde alveolar y disminuir los defectos estéticos que causa sobre todo en el sector anterior. El objetivo del presente artículo es describir el caso clínico de un paciente con pérdida ósea en el sector anterior, tipo III según Seibert, rehabilitado con prótesis parcial fija y sometido a un procedimiento quirúrgico con la técnica del rollo. Se alcanzaron los objetivos planteados y proporciona una mejoría estética así como una mejora en su calidad de vida. Se demostró que con esta técnica se obtienen resultados predecibles que devuelven la estética en zonas de alta exigencia por parte de los pacientes.Tooth loss associated with systemic factors, pathological and traumatic conditions, promotes the bone resorption of residual ridges, this, creates functional problems such as lack of stability and retention of removable dentures as well as aesthetic and psychological disturbances. These defects vary depending on the amount of bone loss and soft tissue they reach. At present there are described various techniques that can correct these defects. One of these is the roll technique which shows very good results by increasing the size of the alveolar ridge and decrease aesthetic defects in the anterior area of the maxilla. The aim of this article is to describe a case of a patient with Seibert bone loss type III, rehabilitated with

  4. Hard tissue augmentation for alveolar defects before implant placement

    Directory of Open Access Journals (Sweden)

    Mutia Rochmawati

    2017-08-01

    Full Text Available Background. Often when planning implant therapy, there is a need to augment or  replace  bone  that  has  been  lost. The alveolar defects may occur as a result of tooth loss due to extraction, advanced periodontal diseases or trauma, long term use of removable appliances, dehiscence and fenestration defects, developmental defects/clefts, congenitally missing teeth and odontogenic cysts and tumors. Insufficient bone volume can be brought about by hard tissue augmentation. This techniques have led to increased predictability in reconstruction of alveolar ridge defects and functional implant placement. Purpose. To describe the methods of hard tissue augmentation which can be done with block grafts (autografts and allografts, particulate grafts (cortical and cancellous, xenografts, or synthetic materials. Review. The reconstruction of a normal alveolar housing, in height and width, is imperative to achieve a harmonious balance between biology, function, and aesthetics. Depending on the size and morphology of the defect, horizontal or vertical, various augmentation procedures can be used. Soft tissue management is a critical aspect of hard tissue augmentation procedures. Incisions, reflection, and manipulation should be designed to optimize blood supply and wound closure. The design and management of mucoperiosteal flaps must consider the increased dimensions of the ridge after augmentation as well as esthetics and approximation of the wound margins. The surgical procedure needs to be executed with utmost care to preserve the maximum vascularity to the flap and minimize tissue injury. Conclusion. Alveolar ridge defects can be classified by using Seibert’s classification or HVC System. The treatment of alveolar ridge defect before implant placement can be done with hard tissue augmentation.

  5. Treatment of sharp mandibular alveolar process with hybrid prosthesis

    Directory of Open Access Journals (Sweden)

    Sukaedi Sukaedi

    2010-09-01

    Full Text Available Background: Losing posterior teeth for a long time would occasionally lead to the sharpening of alveolar process. The removable partial denture usually have problems when used during mastication, because of the pressure on the mucosa under the alveolar ridge. Purpose: The purpose of this case report was to manage patients with sharp mandibular alveolar process by wearing hybrid prosthesis with extra coronal precision attachment retention and soft liner on the surface base beneath the removable partial denture. Case: A 76 years old woman visited the Prosthodontic Clinic Faculty of Dentistry Airlangga University. The patient had a long span bridge on the upper jaw and a free end acrylic removable partial denture on the lower jaw. She was having problems with mastication. The patient did not wear her lower denture because of the discomfort with it during mastication. Hence, she would like to replace it with a new removable partial denture. Case management: The patient was treated by wearing a hybrid prosthesis with extra coronal precision attachment on the lower jaw. Soft liner was applied on the surface of the removable partial denture. Hybrid prosthesis is a complex denture consisting of removable partial denture and fixed bridge. Conclusion: It concluded that after restoration, the patient had no problems with sharp alveolar process with her new denture, and she was able to masticate well.Latar belakang: Kehilangan geligi posterior dapat menimbulkan processus alveolaris tajam. Gigi tiruan sebagian lepasan mempunyai masalah selama pengunyahan karena adanya tekanan di mukosa di bawah alveolar ridge. Tujuan: Tujuan laporan kasus ini adalah untuk menjelaskan cara menangani pasien yang mempunyai prosesus alveolaris yang tajam di rahang bawah dengan dibuatkan protesis hybrid dengan daya tahan extra coronal precision attachment dan soft liner di permukaan bawah basis gigi tiruan sebagian lepasan. Kasus: Pasien wanita berumur 76 tahun datang di klinik

  6. Pleomorphic hyalinizing angiectatic tumor of soft parts: case report with unusual ganglion-like cells and review of the literature.

    Science.gov (United States)

    Changchien, Yi-Che; Bocskai, Pál; Kovács, Ilona; Hargitai, Zoltán; Kollár, Sándor; Török, Miklós

    2014-12-01

    Pleomorphic hyalinizing angiectatic tumor (PHAT) is a recently described, non-metastasizing tumor of uncertain lineage. This tumor distributes equally between the genders and has a predilection for the subcutaneous soft tissue, particularly in lower extremity, other locations are rare. Based on the recent literature, PHAT is suspected to encompass the morphological spectrum with other tumors such as myxoinflammatory fibroblastic sarcoma (MIFS) and hemosiderotic fibrolipomatous tumor (HFLT), although cytogenetic data remain inconsistent. We report a case of PHAT that arose in the upper arm with unusual morphology which showed ganglion-like cells similar to Reed-Sternberg-like cells found in MIFS. The tumor had strong immunohistochemical expression of CD34, CD99, and was negative for S-100. The ganglion-like cells were positive for both CD34 and CD68 but negative for CD30. The translocation between chromosome 1 and 10, a frequent finding of MIFS and HFLT, was not identified by FISH excluding the possibility of hybrid PHAT and MIFS. We conclude FISH can be a potential useful tool to separate PHAT with atypical morphology from hybrid tumor in doubted cases. Due to the rarity of PHAT and lack of consistent pathogenetic signatures, more cases and further studies will be needed to elucidate the pathogenesis and nature of this tumor. Copyright © 2014 Elsevier GmbH. All rights reserved.

  7. Charge and softness of the outer part of the cell wall of Thiobacillus ferrooxidans in the low ionic strength medium

    Directory of Open Access Journals (Sweden)

    Škvarla Jiří

    2002-03-01

    Full Text Available The surface charge and surface potential are parameters influencing the microbial adhesion phenomenon through the electrostatic interaction between bacteria and substrates. The Smoluchowski equation, originally developed for estimating the above parameters from the experimentally accessible electrophoretic mobility of rigid colloid particles, is however inapplicable to the elastic bacterial cells. The problem is that the outer cell wall of bacteria is a layer with a complex polyelectrolyte structure. In this article, the OhshimaLs model of the gsofth particle is applied to describe the surface electrostatics of Thiobacillus ferrooxidans cells by measuring their electrophoretic mobility in distilled water as a function of a (low ionic strength and pH. In this model, the rigid core is considered to be covered with a charged ion-penetrable layer of polyelectrolytes. Two model parameters have been determined by the curve fitting at pH from 3.2 to 5.8, namely the number density of the dissociated groups N and the softness parameter 1/ƒÉ of the polyelectrolyte layer of the bacterium. A disagreement of the best fit parameters (evaluated by the correlation coefficient with the analogous parameters determined for other colloids (including bacterial cells in aqueous solutions of a high ionic strength is discussed.

  8. Alveolar bone resorption after tooth extraction

    OpenAIRE

    Dimova, Cena; Popovski, Stipica

    2012-01-01

    Alveolar ridge resorption has long been considered an unavoidable consequence of tooth extraction. Atrophy of the alveolar bone may cause significant esthetic and surgical problems in implantation, as well as at prosthetic and restorative dentistry. Alveolar ridge prophylaxis immediately upon tooth extraction may reduce such sequelae for both, the treating dentist and the patient. Attempts to reduce alveolar bone resorption have included the placement of natural roots, root analogues, and...

  9. Intravascular bronchio-alveolar tumor

    International Nuclear Information System (INIS)

    Mata, J.M.; Caceres, J.; Prat, J.; Lopez, J.I.; Velilla, O.

    1991-01-01

    In 1975 Dail and Liebow described the clinical and pathological characteristics of a pulmonary tumor which they dominated intravascular bronchio-alveolar tumor (IVBAT). Our aim is to acquaint radiologists with the existence of this tumor by describing the radiologic findings in 2 patients with IVBAT, 1 with hepatic involvement ant the other with pulmonary osteoarthropathy. (author). 7 refs.; 2 figs

  10. Human alveolar echinococcosis in Kyrgyzstan.

    Science.gov (United States)

    Usubalieva, Jumagul; Minbaeva, Gulnara; Ziadinov, Iskender; Deplazes, Peter; Torgerson, Paul R

    2013-07-01

    Human echinococcosis is a reportable disease in Kyrgyzstan. Between 1995 and 2011, human alveolar echinococcosis increased from 60 cases per year. The origins of this epidemic, which started in 2004, may be linked to the socioeconomic changes that followed the dissolution of the former Soviet Union.

  11. True Fibroma of Alveolar Mucosa

    Directory of Open Access Journals (Sweden)

    Shankargouda Patil

    2014-01-01

    Full Text Available Benign fibrous overgrowths are often found in the oral cavity, almost always being reactive/irritational in nature. However, benign mesenchymal neoplasms of the fibroblasts are extremely uncommon. Here we report a case of “True Fibroma of Alveolar Mucosa” for its rarity.

  12. Soft Neutrosophic Loops and Their Generalization

    Directory of Open Access Journals (Sweden)

    Mumtaz Ali

    2014-06-01

    Full Text Available Soft set theory is a general mathematical tool for dealing with uncertain, fuzzy, not clearly defined objects. In this paper we introduced soft neutrosophic loop,soft neutosophic biloop, soft neutrosophic N -loop with the discuission of some of their characteristics. We also introduced a new type of soft neutrophic loop, the so called soft strong neutrosophic loop which is of pure neutrosophic character. This notion also found in all the other corresponding notions of soft neutrosophic thoery. We also given some of their properties of this newly born soft structure related to the strong part of neutrosophic theory.

  13. Soft Connected Spaces and Soft Paracompact Spaces

    OpenAIRE

    Fucai Lin

    2013-01-01

    Soft topological spaces are considered as mathematical tools for dealing with uncertainties, and a fuzzy topological space is a special case of the soft topological space. The purpose of this paper is to study soft topological spaces. We introduce some new concepts in soft topological spaces such as soft closed mapping, soft open mappings, soft connected spaces and soft paracompact spaces. We also redefine the concept of soft points such that it is reasonable in soft topological spaces. Mo...

  14. Alveolar Bone Expansion for Implant Placement in Compromised Aesthetic Zone – Case Series

    Science.gov (United States)

    Mohamed, Jumshad B; Alam, Md Nazish; Singh, Gurudeep; Chandrasekaran, S.N

    2014-01-01

    Implant placement and restoration of compromised alveolar ridges in the aesthetic zone has always been a challenge to the oral implantologists. The use of bone expanders and bone condensers without the use of traditional drilling sequences in this scenario is becoming popular because of its predictable results. Xenograft along with Platelet-rich fibrin (PRF) used as scaffold also provides growth factors to accelerate both soft and hard tissue healing as well as regeneration. The paper highlights this combined approach in the placement of implants in compromised alveolar ridges with good results. All implants were successfully restored and followed up for one year. PMID:24701543

  15. Alveolar socket healing: what can we learn?

    Science.gov (United States)

    Araújo, Mauricio G; Silva, Cléverson O; Misawa, Mônica; Sukekava, Flavia

    2015-06-01

    Tooth extraction induces a series of complex and integrated local changes within the investing hard and soft tissues. These local alterations arise in order to close the socket wound and to restore tissue homeostasis, and are referred to as '"socket healing". The aims of the present report were twofold: first, to describe the socket-healing process; and, second, to discuss what can be learned from the temporal sequence of healing events, in order to improve treatment outcomes. The socket-healing process may be divided into three sequential, and frequently overlapping, phases: inflammatory; proliferative; and modeling/remodeling. Several clinical and experimental studies have demonstrated that the socket-healing process promotes up to 50% reduction of the original ridge width, greater bone resorption at the buccal aspect than at the lingual/palatal counterpart and a larger amount of alveolar bone reduction in the molar region. In conclusion, tooth extraction, once a simple and straightforward surgical procedure, should be performed in the knowledge that ridge reduction will follow and that further clinical steps should be considered to compensate for this, when considering future options for tooth replacement. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. MR imaging of clear cell sarcoma (malignant melanoma of the soft parts): a multicenter correlative MRI-pathology study of 21 cases and literature review

    International Nuclear Information System (INIS)

    Beuckeleer, L.H. de; Schepper, A.M. de; Vandevenne, J.E.; Bloem, J.L.; Davies, A.M.; Oudkerk, M.; Hauben, E.; Marck, E. van; Somville, J.; Vanel, D.; Steinbach, L.S.; Guinebretiere, J.M.; Hogendoorn, P.C.W.; Mooi, W.J.; Verstraete, K.; Zaloudek, C.; Jones, H.

    2000-01-01

    Objective. To evaluate MR imaging and pathology findings in order to define the characteristic features of clear cell sarcoma of the soft tissues (malignant melanoma of the soft parts).Design and patients. MR examinations of 21 patients with histologically proven clear cell sarcoma of the musculoskeletal system were retrospectively reviewed and assessed for shape, homogeneity, delineation, signal intensities on T1- and T2-weighted images, contrast enhancement, relationship with adjacent fascia or tendon, secondary bone involvement, and intratumoral necrosis. In 19 cases the pathology findings were available for review and for a comparative MR-pathology study.Results. On T1-weighted images, lesions were isointense (n=3), hypointense (n=7) or slightly hyperintense to muscle (n=11). Immunohistochemical examination was performed in 17 patients. All 17 specimens showed positivity for HMB-45 antibody. In nine of 11 lesions with slightly increased signal intensity on T1-weighted images, a correlative MR imaging-pathology study was possible. All nine were positive to HMB-45 antibody.Conclusions. Clear cell sarcoma of the musculoskeletal system often has a benign-looking appearance on MR images. In up to 52% of patients, this lesion with melanocytic differentiation has slightly increased signal intensity on T1-weighted images compared with muscle. As the presence of this relative higher signal intensity on T1-weighted images is rather specific for tumors displaying melanocytic differentiation, radiologists should familiarize themselves with this rare entity and include it in their differential diagnosis when confronted with a well-defined, homogeneous, strongly enhancing mass with slightly higher signal intensity compared with muscle on native T1-weighted images. (orig.)

  17. A new pair of hard-soft plastic combination for precision manufacturing of two component plastic parts

    DEFF Research Database (Denmark)

    Islam, Aminul; Hansen, Hans Nørgaard; Marhöfer, David Maximilian

    2011-01-01

    Two component (2k) injection moulding is growing rapidly even in the field of precision micro moulding. Besides combining different material properties in the same product, two component moulding can eliminate many assembly steps in manufacturing process chain. One of the biggest technical...... and functional properties of the materials proved to be suitable for precision hearing aid applications. Replication quality of the 2k parts was investigated by visual and microscopic investigation. The adhesion of the two plastic materials was characterized by moulding 2k tensile bar test specimens by both...... sequential and simultaneous injection of two materials and afterwards by using a precision tensile testing machine. To characterize the sealing properties of the sealing ring material, a sealing test device was developed. It could provide hydraulic pressure inside the socket house and precisely detect...

  18. Soft leptogenesis

    International Nuclear Information System (INIS)

    D'Ambrosio, Giancarlo; Giudice, Gian F.; Raidal, Martti

    2003-01-01

    We study 'soft leptogenesis', a new mechanism of leptogenesis which does not require flavour mixing among the right-handed neutrinos. Supersymmetry soft-breaking terms give a small mass splitting between the CP-even and CP-odd right-handed sneutrino states of a single generation and provide a CP-violating phase sufficient to generate a lepton asymmetry. The mechanism is successful if the lepton-violating soft bilinear coupling is unconventionally (but not unnaturally) small. The values of the right-handed neutrino masses predicted by soft leptogenesis can be low enough to evade the cosmological gravitino problem

  19. Influence of platelet-rich fibrin on alveolar ridge preservation.

    Science.gov (United States)

    Suttapreyasri, Srisurang; Leepong, Narit

    2013-07-01

    The aim of this study was to investigate the influence of platelet-rich fibrin (PRF) on early wound healing and preservation of the alveolar ridge shape following tooth extraction. In this clinical trial, 20 symmetrical, premolar extraction sockets using split-mouth design were randomly selected with PRF or blood clot. The evaluations of wound healing, alveolar ridge contour changes, and crestal bone resorption were performed in dental casts and periapical radiographs (T0, initial; T1, 1 week; T2, 2 weeks; T4, 4 weeks; T6, 6 weeks; T8, 8 weeks). Platelet-rich fibrin clinically showed early healing of soft tissue covering socket orifices in the first 4 weeks. At the first week, the horizontal resorption on buccal aspect of PRF (1.07 ± 0.31 mm) was significantly less than that of the control (1.81 ± 0.88 mm). Platelet-rich fibrin demonstrated the tendency to enter the steady stage after the fourth week following tooth extraction, whereas in the control group the progression of buccal contour contraction was still detected through the eighth week. Radiographically, the overall resorption of marginal bone levels at mesial and distal to the extraction site in PRF (0.70, 1.23 mm) was comparable to that of the control (1.33, 1.14 mm). Although the PRF group demonstrated faster bone healing compared with the control, no statistically significant difference was detected. This preliminary result demonstrated neither better alveolar ridge preservation nor enhanced bone formation of PRF in the extraction socket. The use of PRF revealed limited effectiveness by accelerated soft-tissue healing on the first 4 weeks.

  20. Alveolar ridge atrophy related to facial morphology in edentulous patients

    Directory of Open Access Journals (Sweden)

    Kuć J

    2017-09-01

    Full Text Available Joanna Kuć,1 Teresa Sierpińska,2 Maria Gołębiewska1 1Department of Prosthodontics, 2Department of Dental Technology, Medical University of Bialystok, Bialystok, Poland Objectives: The morphology of the alveolar process determines the retention and stability of prosthetic restorations, thereby determining the result of the therapy. Considering that the edentulous jaws may be affected by the atrophy process, it was hypothesized that the morphology of the alveolar process of the maxilla may be dependent on the anterior facial height and anatomy of the mandible. Subjects and methods: Twenty-five healthy edentulous Caucasian individuals were randomly chosen. Each subject underwent a lateral cephalogram before and after prosthetic rehabilitation. During exposition, newly made prostheses were placed in the patient’s mouth. Teeth remained in maximal intercuspidation. Morphological parameters were evaluated according to the Ricketts, McNamara, and Tallgren’s method. Results: An inversely proportional association was observed between patient age and the distal part of the maxilla. A statistically significant connection was noted between the vertical dimension of alveolar ridge and anterior total and lower facial height conditioned by prosthetic rehabilitation. Conclusion: The height of the lateral part of the alveolar ridge of the maxilla remains in connection with the anterior total and lower facial height obtained in the course of prosthetic rehabilitation. The vertical dimension of the alveolar ridge of the maxilla seems to be in close relationship with the morphology of the lower jaw. Keywords: anterior facial height, cephalometric analysis, complete dentures, vertical occlusal dimension

  1. An open randomized controlled clinical trial to evaluate ridge preservation and repair using SocketKAP(™) and SocketKAGE(™) : part 2 - three-dimensional alveolar bone volumetric analysis of CBCT imaging.

    Science.gov (United States)

    Abdelhamid, Alaa; Omran, Mostafa; Bakhshalian, Neema; Tarnow, Dennis; Zadeh, Homayoun H

    2016-06-01

    The aims of this study were (i) to evaluate the efficacy of ridge preservation and repair procedures involving the application of SocketKAP(™) and SocketKAGE(™) devices following tooth removal and (ii) to evaluate alveolar bone volumetric changes at 6 months post-extraction in intact sockets or those with facial wall dehiscence defects using 3-dimensional pre- and postoperative CBCT data. Thirty-six patients required 61 teeth extracted. Five cohorts were established: Group A: Intact Socket Negative Control Group B: Intact Socket + SocketKAP(™) Group C: Intact Socket Filled with Anorganic Bovine Bone Mineral (ABBM) + SocketKAP(™) Group D: Facial Dehiscence Socket Negative Control Group E: Facial Dehiscence Socket Filled with ABBM + SocketKAP(™) + SocketKAGE(™) . Preoperative CBCT scans were obtained followed by digital subtraction of the test teeth. At 6 months post-extraction, another CBCT scan was obtained. The pre- and postoperative scans were then superimposed, allowing highly accurate quantitative determination of the 3D volumetric alveolar bone volume changes from baseline through 6 months. Significant volumetric bone loss occurred in all sockets, localized mainly in the 0-3 mm zone apical to the ridge crest. For intact sockets, SocketKAP(™) + ABBM treatment led to a statistically significant greater percentage of remaining mineralized tissue volume when compared to negative control group. A significant difference favoring SocketKAP(™) + SocketKAGE(™) + ABBM treatment was observed for sockets with facial dehiscence defects compared to the negative control group. SocketKAP(™) , with ABBM, appears effective in limiting post-extraction volumetric bone loss in intact sockets, while SocketKAP(™) + SocketKAGE + ABBM appears effective in limiting post-extraction bone loss in sockets with dehiscence defects. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Predictors of Alveolar Process Remodeling Following Ridge Preservation in High-Risk Patients.

    Science.gov (United States)

    Cosyn, Jan; Cleymaet, Roberto; De Bruyn, Hugo

    2016-04-01

    (1) To clinically evaluate horizontal remodeling of the alveolar process (hard and soft tissues) following ridge preservation in high-risk patients and (2) to identify predictors of such remodeling. Periodontally healthy nonsmoking patients with a failing tooth in the anterior maxilla (15-25) were selected for a prospective case series. All were in need of a single implant and demonstrated high risk for aesthetic complications given an incomplete buccal bone wall and/or thin-scalloped gingival biotype. Following flapless tooth extraction, ridge preservation was performed using one or more collagen-enriched, bovine-derived block grafts (Geistlich Bio-Oss® Collagen® 100 mg, Geistlich Pharma AG, Wolhusen, Switzerland) without the additional use of membranes or soft tissue grafts. The change in buccopalatal dimension of the alveolar process between baseline (prior to tooth extraction) and 4 months was assessed on the basis of superimposed occlusal slides. Regression analysis was performed to identify predictors of alveolar process remodeling. Forty-two patients (21 females, 21 males; mean age 38) met the selection criteria and consented to the treatment. Mean alveolar process remodeling was 14% (SD 7, range 4-30) with minimal remodeling (≤ 10%) in 16 patients (38%) and advanced remodeling (>20%) in 10 patients (24%). A single implant could be installed in all subjects without additional guided bone regeneration. Connective tissue grafting was performed later on in the treatment for aesthetic purposes, hereby compensating for tissue loss at the buccal aspect. Predictors of alveolar process remodeling were tooth location (central incisors and cuspids > laterals incisors and premolars), tooth abscess (p = .025), and buccal bone loss (p = .035). Alveolar process remodeling seems inevitable yet acceptable following ridge preservation in high-risk patients. Proper case selection may reduce the incidence of advanced remodeling. © 2014 Wiley Periodicals, Inc.

  3. Orthodontically guided bone transport in the treatment of alveolar cleft: A case report

    Science.gov (United States)

    Gómez, Elena; Otero, Marta; Berraquero, Rosario; Wucherpfennig, Begona; Hernández-Godoy, Juan; Guiñales, Jorge; Vincent, Germán; Burgueño, Miguel

    2016-01-01

    Introduction Conventional treatments are sometimes not possible in certain alveolar cleft cases due to the severity of the gap which separates the fragments. Various management strategies have been proposed, including sequential surgical interventions or delaying treatment until adulthood to then carry out maxillary osteotomies. A further alternative approach has also been proposed, involving the application of bone transport techniques to mobilise the osseous fragments and thereby reduce the gap between lateral fragments and the premaxilla. Case Report We introduce the case of a 10-year-old patient who presented with a bilateral alveolar cleft and a severe gap. Stable occlusion between the premaxilla and the mandible was achieved following orthodontic treatment, making it inadvisable to perform a retrusive osteotomy of the premaxilla in order to close the alveolar clefts. Faced with this situation, it was decided we would employ a bone transport technique under orthodontic guidance using a dental splint. This would enable an osseous disc to be displaced towards the medial area and reduce the interfragmentary distance. During a second surgical intervention, closure of the soft tissues was performed and the gap was filled in using autogenous bone. Conclusions The use of bone transport techniques in selected cases allows closure of the osseous defect, whilst also preserving soft tissues and reducing the amount of bone autograft required. In our case, we were able to respect the position of the premaxilla and, at the same time, generate new tissues at both an alveolar bone and soft tissue level with results which have remained stable over the course of time. Key words:Alveolar cleft, bone transport, graft. PMID:26855699

  4. Alveolar type II cell transplantation restores pulmonary surfactant protein levels in lung fibrosis.

    Science.gov (United States)

    Guillamat-Prats, Raquel; Gay-Jordi, Gemma; Xaubet, Antoni; Peinado, Victor I; Serrano-Mollar, Anna

    2014-07-01

    Alveolar Type II cell transplantation has been proposed as a cell therapy for the treatment of idiopathic pulmonary fibrosis. Its long-term benefits include repair of lung fibrosis, but its success partly depends on the restoration of lung homeostasis. Our aim was to evaluate surfactant protein restoration after alveolar Type II cell transplantation in an experimental model of bleomycin-induced lung fibrosis in rats. Lung fibrosis was induced by intratracheal instillation of bleomycin. Alveolar Type II cells were obtained from healthy animals and transplanted 14 days after bleomycin was administered. Furthermore, one group transplanted with alveolar macrophages and another group treated with surfactant were established to evaluate the specificity of the alveolar Type II cell transplantation. The animals were euthanized at 21 days after bleomycin instillation. Lung fibrosis was confirmed by a histologic study and an evaluation of the hydroxyproline content. Changes in surfactant proteins were evaluated by mRNA expression, Western blot and immunofluorescence studies. The group with alveolar Type II cell transplantation was the only one to show a reduction in the degree of lung fibrosis and a complete recovery to normal levels of surfactant proteins. One of the mechanisms involved in the beneficial effect of alveolar Type II cell transplantation is restoration of lung surfactant protein levels, which is required for proper respiratory function. Copyright © 2014 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  5. Preclinical Testing of Erlotinib in a Transgenic Alveolar Rhabdomyosarcoma Mouse Model

    Directory of Open Access Journals (Sweden)

    Jinu Abraham

    2011-01-01

    Full Text Available Rhabdomyosarcoma is an aggressive childhood malignancy, accounting for more than 50% of all soft-tissue sarcomas in children. Even with extensive therapy, the survival rate among alveolar rhabdomyosarcoma patients with advanced disease is only 20%. The receptor tyrosine kinase Epidermal Growth Factor Receptor (EGFR has been found to be expressed and activated in human rhabdomyosarcomas. In this study we have used a genetically engineered mouse model for alveolar rhabdomyosarcoma (ARMS which faithfully recapitulates the human disease by activating the pathognomic Pax3:Fkhr fusion gene and inactivating p53 in the maturing myoblasts. We have demonstrated that tumors from our mouse model of alveolar rhabdomyosarcoma express EGFR at both the mRNA and protein levels. We then tested the EGFR inhibitor, Erlotinib, for its efficacy in this mouse model of alveolar rhabdomyosarcoma. Surprisingly, Erlotinib had no effect on tumor progression, yet mice treated with Erlotinib showed 10–20% loss of body weight. These results suggest that EGFR might not be an a priori monotherapy target in alveolar rhabdomyosarcoma.

  6. Pulmonary alveolar microlithiasis in children

    International Nuclear Information System (INIS)

    Schmidt, H.; Loercher, U.; Kitz, R.; Zielen, S.; Ahrens, P.; Koenig, R.

    1996-01-01

    Two asymptomatic Turkish sibs are presented, a 4-year-old boy and his 7-year-old sister, with pulmonary alveolar microlithiasis (PAM) confirmed by transbronchial lung biopsy and bronchoalveolar lavage. Chest radiographs and high resolution CT demonstrated wide-spread intra-alveolar calcifications in both lungs. The lesions were sharply defined and less than 1 mm in diameter. CT documented a high concentration of microliths along the bronchovascular bundles, the intralobular fissue and the (sub)pleural lung parenchyma. The combination of bronchoalveolar lavage and roentgenographic appearance in high resolution CT are characteristic and pathognomonic, and can confirm the diagnosis. The more severe changes in the elder sib and the radiographic controls suggest that the pulmonary disease may be progressive in our patients. The described family of consanguineous, unaffected parents with two affected and one healthy child confirmed the autosomal recessive inheritance of PAM (McKusick 265100). In addition, the affected girl had autosomal recessive Waardenburg-anophthalmia syndrome (McKusick 206920), raising the question of whether this is a chance occurrence or possibly a contiguous gene syndrome. (orig.)

  7. Soft Robotics.

    Science.gov (United States)

    Whitesides, George M

    2018-04-09

    This description of "soft robotics" is not intended to be a conventional review, in the sense of a comprehensive technical summary of a developing field. Rather, its objective is to describe soft robotics as a new field-one that offers opportunities to chemists and materials scientists who like to make "things" and to work with macroscopic objects that move and exert force. It will give one (personal) view of what soft actuators and robots are, and how this class of soft devices fits into the more highly developed field of conventional "hard" robotics. It will also suggest how and why soft robotics is more than simply a minor technical "tweak" on hard robotics and propose a unique role for chemistry, and materials science, in this field. Soft robotics is, at its core, intellectually and technologically different from hard robotics, both because it has different objectives and uses and because it relies on the properties of materials to assume many of the roles played by sensors, actuators, and controllers in hard robotics. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy

    OpenAIRE

    Kaya, Bülent; Yildiz, Ibrahim; Baha, Reshat Mehmet; Zeytun, Neslihan Ebru Eryaşar; Yetisgen, Azize

    2015-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  9. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy.

    Science.gov (United States)

    Kaya, Bülent; Yildiz, Ibrahim; Baha, Reshat Mehmet; Zeytun, Neslihan Ebru Eryaşar; Yetisgen, Azize

    2015-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  10. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy

    Directory of Open Access Journals (Sweden)

    Bülent Kaya

    2015-01-01

    Full Text Available Diffuse alveolar hemorrhage (DAH is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  11. CT quantification of pulmonary alveolar microlithiasis

    International Nuclear Information System (INIS)

    Wurche, K.D.; Kubale, R.; Vallee, D.; Ostertag, H.

    1987-01-01

    Pulmonary alveolar microlithiasis is a rare, familial disease with massive symmetrical intra-alveolar calcium deposition. Conventional CT findings and CT measurements with a dual energy technique were carried out in a 26-year-old patient suffering from this disease. The importance of the findings in the differential diagnosis and for estimating the progression and prognosis of the disease is discussed. (orig.) [de

  12. NFκB signaling in alveolar rhabdomyosarcoma

    Directory of Open Access Journals (Sweden)

    Megan M. Cleary

    2017-09-01

    Full Text Available Alveolar rhabdomyosarcoma (aRMS is a pediatric soft tissue cancer commonly associated with a chromosomal translocation that leads to the expression of a Pax3:Foxo1 or Pax7:Foxo1 fusion protein, the developmental underpinnings of which may give clues to its therapeutic approaches. In aRMS, the NFκB–YY1–miR-29 regulatory circuit is dysregulated, resulting in repression of miR-29 and loss of the associated tumor suppressor activity. To further elucidate the role of NFκB in aRMS, we first tested 55 unique sarcoma cell lines and primary cell cultures in a large-scale chemical screen targeting diverse molecular pathways. We found that pharmacological inhibition of NFκB activity resulted in decreased cell proliferation of many of the aRMS tumor cultures. Surprisingly, mice that were orthotopically allografted with aRMS tumor cells exhibited no difference in tumor growth when administered an NFκB inhibitor, compared to control. Furthermore, inhibition of NFκB by genetically ablating its activating kinase inhibitor, IKKβ, by conditional deletion in a mouse model harboring the Pax3:Foxo1 chimeric oncogene failed to abrogate spontaneous tumor growth. Genetically engineered mice with conditionally deleted IKKβ exhibited a paradoxical decrease in tumor latency compared with those with active NFκB. However, using a synthetic-lethal approach, primary cell cultures derived from tumors with inactivated NFκB showed sensitivity to the BCL-2 inhibitor navitoclax. When used in combination with an NFκB inhibitor, navitoclax was synergistic in decreasing the growth of both human and IKKβ wild-type mouse aRMS cells, indicating that inactivation of NFκB alone may not be sufficient for reducing tumor growth, but, when combined with another targeted therapeutic, may be clinically beneficial.

  13. Improving oral rehabilitation through the preservation of the tissues through alveolar preservation

    OpenAIRE

    Afrashtehfar, Kelvin Ian; Kurtzman, Gregori Michael; Mahesh, Lanka

    2012-01-01

    When performing a tooth extraction, imminent collapse of the tissue by resorption and remodeling of the socket is a natural occurrence. The procedure for the preservation of the alveolar ridge has been widely described in the dental literatures and aims to maintain hard and soft tissues in the extraction site for optimal rehabilitation either with conventional fixed or removable prosthetics or implant-supported prosthesis.

  14. Improving oral rehabilitation through the preservation of the tissues through alveolar preservation.

    Science.gov (United States)

    Afrashtehfar, Kelvin Ian; Kurtzman, Gregori Michael; Mahesh, Lanka

    2012-08-01

    When performing a tooth extraction, imminent collapse of the tissue by resorption and remodeling of the socket is a natural occurrence. The procedure for the preservation of the alveolar ridge has been widely described in the dental literatures and aims to maintain hard and soft tissues in the extraction site for optimal rehabilitation either with conventional fixed or removable prosthetics or implant-supported prosthesis.

  15. Correction: Inferior alveolar nerve injury with laryngeal mask airway: a case report.

    LENUS (Irish Health Repository)

    Hanumanthaiah, Deepak

    2011-11-30

    ABSTRACT: Following the publication of our article [Inferior alveolar nerve injury with laryngeal mask airway: a case report. Journal of Medical Case Reports 2011, 5:122] it was brought to our attention that we inadvertently used the registered trademark of the Laryngeal Mask Company Limited (LMA) as the abbreviation for laryngeal mask airway. A Portex(R) Soft Seal(R) Laryngeal Mask was used and not a device manufactured by the Laryngeal Mask Company.

  16. Horizontal alveolar bone loss: A periodontal orphan

    Directory of Open Access Journals (Sweden)

    Jayakumar A

    2010-01-01

    Full Text Available Background: Attempts to successfully regenerate lost alveolar bone have always been a clinician′s dream. Angular defects, at least, have a fairer chance, but the same cannot be said about horizontal bone loss. The purpose of the present study was to evaluate the prevalence of horizontal alveolar bone loss and vertical bone defects in periodontal patients; and later, to correlate it with the treatment modalities available in the literature for horizontal and vertical bone defects. Materials and Methods: The study was conducted in two parts. Part I was the radiographic evaluation of 150 orthopantomographs (OPGs (of patients diagnosed with chronic periodontitis and seeking periodontal care, which were digitized and read using the AutoCAD 2006 software. All the periodontitis-affected teeth were categorized as teeth with vertical defects (if the defect angle was ≤45° and defect depth was ≥3 mm or as having horizontal bone loss. Part II of the study comprised search of the literature on treatment modalities for horizontal and vertical bone loss in four selected periodontal journals. Results: Out of the 150 OPGs studied, 54 (36% OPGs showed one or more vertical defects. Totally, 3,371 teeth were studied, out of which horizontal bone loss was found in 3,107 (92.2% teeth, and vertical defects were found only in 264 (7.8% of the teeth, which was statistically significant (P<.001. Search of the selected journals revealed 477 papers have addressed the treatment modalities for vertical and horizontal types of bone loss specifically. Out of the 477 papers, 461 (96.3% have addressed vertical bone loss, and 18 (3.7% have addressed treatment options for horizontal bone loss. Two papers have addressed both types of bone loss and are included in both categories. Conclusion: Horizontal bone loss is more prevalent than vertical bone loss but has been sidelined by researchers as very few papers have been published on the subject of regenerative treatment

  17. Post-neonatal drop in alveolar SP-A expression

    DEFF Research Database (Denmark)

    Stray-Pedersen, Arne; Vege, Ashild; Stray-Pedersen, Asbjorg

    2008-01-01

    BACKGROUND: Surfactant protein A (SP-A) is synthesized in the lung and is a part of the innate immune system. The aim of this study was to evaluate the expression of SP-A in lung tissue from fetuses, infants, children and adults with special regard to sudden infant death syndrome (SIDS). METHODS......: A total of 160 cases were studied; 19 fetuses and neonates, 59 SIDS and 49 explained infant deaths below 1 year of age, 19 toddlers and 14 adults. Immunohistochemical detection of SP-A using monoclonal antibodies was performed by microscopy of lung tissue specimens collected at autopsy. A scoring system...... was developed enabling semi-quantitative estimation of staining intensity and distribution. RESULTS: SP-A was detected in the terminal bronchioles and alveolar spaces of fetuses >35 weeks gestation. The intra-alveolar SP-A expression increased in the perinatal period followed by a marked drop in infants aged...

  18. Relationship between viscoelastic properties of soft denture liners and clinical efficacy

    OpenAIRE

    Hiroshi Murata; Taizo Hamada; Shinsuke Sadamori

    2008-01-01

    Soft denture liners are applied for denture wearers who cannot tolerate a hard-based denture due to a thin and non-resilient oral mucosa and/or severe alveolar resorption. This material distributes and absorbs masticatory forces by means of the cushioning effect. Clinical success of the materials depends both on their viscoelastic properties and on durability. Acrylic resins and silicones are mainly available for permanent soft liners. The acrylic permanent soft liners demonstrate viscoelasti...

  19. Soft Neutrosophic Groupoids and Their Generalization

    Directory of Open Access Journals (Sweden)

    Mumtaz Ali

    2014-12-01

    Full Text Available Soft set theory is a general mathematical tool for dealing with uncertain, fuzzy, not clearly defined objects. In this paper we introduced soft neutrosophic groupoid and their generalization with the discuissionf of some of their characteristics. We also introduced a new type of soft neutrophic groupoid, the so called soft strong neutrosophic goupoid which is of pure neutrosophic character. This notion also found in all the other corresponding notions of soft neutrosophic thoery. We also given some of their properties of this newly born soft structure related to the strong part of neutrosophic theory.

  20. Soft Neutrosophic Ring and Soft Neutrosophic Field

    Directory of Open Access Journals (Sweden)

    Mumtaz Ali

    2014-04-01

    Full Text Available In this paper we extend the theory of neutrosophic rings and neutrosophic fields to soft sets and construct soft neutrosophic rings and soft neutrosophic fields. We also extend neutrosophic ideal theory to form soft neutrosophic ideal over a neutrosophic ring and soft neutrosophic ideal of a soft neutrosophic ring. We have given many examples to illustrate the theory of soft neutrosophic rings and soft neutrosophic fields and display many properties of these. At the end of this paper we gave soft neutrosophic ring homomorphism.

  1. A Semi-automatic Algorithm for Preliminary Assessment of Labial Gingiva and Alveolar Bone Thickness of Maxillary Anterior Teeth.

    Science.gov (United States)

    Chen, Sheng-Hong; Chan, Hsun-Liang; Lu, Yongning; Ong, Sim-Heng; Wang, Hom-Lay; Ko, Eng Hong; Chang, Po-Chun

    Soft and hard tissue volumes are critical for implant placement and long-term stability. Although the literature has adequately addressed tissue biotypes of Western populations, pertinent information about Asian populations is limited. This study aimed to evaluate the soft and hard tissue profiles of the maxillary anterior teeth of the Taiwanese population using a semi-automatic algorithm. Cone beam computed tomography images of 11 adults with well-aligned maxillary anterior teeth were overlaid with those of cast models, based on the tooth crowns manually outlined by two independent observers. Each tooth was digitally trisected mesiodistally and apicocoronally. The thicknesses of the labial gingiva and alveolar bone were measured using a customized software program. No obvious difference between the observers was noted regarding the dimension of tooth crowns. The average thicknesses of the labial gingiva, the labial alveolar bone, and the palatal alveolar bone were 1.76 ± 0.11 mm, 1.02 ± 0.12 mm, and 1.80 ± 0.31 mm, respectively, with no significant differences between teeth. All parameters were thicker in the apical region than in the cervical region, and the alveolar bone was thinner in the midlabial region of incisors than in the interproximal regions. The thinnest areas were the midcervical compartment of the right central incisor (0.53 ± 0.33 mm) for the labial gingiva, the midcervical compartment of the right lateral incisor (0.23 ± 0.10 mm) for the labial alveolar bone, and the mesiocervical compartment of the left central incisor (0.33 ± 0.09 mm) for the palatal alveolar bone. This study presents an objective and comprehensive methodology for evaluating the soft and hard tissue profiles of maxillary anterior teeth and may be of value for presurgical planning for immediate implant placement. The results suggest that profiles of the Taiwanese subjects are similar to profiles of Western populations.

  2. Influence of lip closure on alveolar cleft width in patients with cleft lip and palate

    Directory of Open Access Journals (Sweden)

    Schmelzle Rainer

    2011-01-01

    Full Text Available Abstract Background The influence of surgery on growth and stability after treatment in patients with cleft lip and palate are topics still under discussion. The aim of the present study was to investigate the influence of early lip closure on the width of the alveolar cleft using dental casts. Methods A total of 44 clefts were investigated using plaster casts, 30 unilateral and 7 bilateral clefts. All infants received a passive molding plate a few days after birth. The age at the time of closure of the lip was 2.1 month in average (range 1-6 months. Plaster casts were obtained at the following stages: shortly after birth, prior to lip closure, prior to soft palate closure. We determined the width of the alveolar cleft before lip closure and prior to soft palate closure measuring the alveolar cleft width from the most lateral point of the premaxilla/anterior segment to the most medial point of the smaller segment. Results After lip closure 15 clefts presented with a width of 0 mm, meaning that the mucosa of the segments was almost touching one another. 19 clefts showed a width of up to 2 mm and 10 clefts were still over 2 mm wide. This means a reduction of 0% in 5 clefts, of 1-50% in 6 clefts, of 51-99% in 19 clefts, and of 100% in 14 clefts. Conclusions Early lip closure reduces alveolar cleft width. In most cases our aim of a remaining cleft width of 2 mm or less can be achieved. These are promising conditions for primary alveolar bone grafting to restore the dental bony arch.

  3. Flapless Postextraction Socket Implant Placement, Part 2: The Effects of Bone Grafting and Provisional Restoration on Peri-implant Soft Tissue Height and Thickness- A Retrospective Study.

    Science.gov (United States)

    Chu, Stephen J; Salama, Maurice A; Garber, David A; Salama, Henry; Sarnachiaro, Guido O; Sarnachiaro, Evangelina; Gotta, Sergio Luis; Reynolds, Mark A; Saito, Hanae; Tarnow, Dennis P

    2015-01-01

    This article presents the results of evaluating the changes in peri-implant soft tissue dimensions associated with immediate implant placement into anterior postextraction sockets for four treatment groups: no BGPR (no bone graft, no provisional restoration), PR (no bone graft, provisional restoration), BG (bone graft, no provisional restoration), and BGPR (bone graft, provisional restoration). The vertical distance of the peri-implant soft tissue was greater for grafted sites than for nongrafted ones (2.72 mm vs 2.29 mm, P provisional restorations compared to sites without them (2.81 mm vs 2.37 mm, P provisional restoration.

  4. A historical view of alveolar echinococcosis, 160 years after the discovery of the first case in humans: part 1. What have we learnt on the distribution of the disease and on its parasitic agent?

    Science.gov (United States)

    Vuitton, Dominique Angèle; Wang, Qian; Zhou, Hong-Xia; Raoul, Francis; Knapp, Jenny; Bresson-Hadni, Solange; Wen, Hao; Giraudoux, Patrick

    2011-09-01

    Since the first 2 cases observed in southern Germany and the correct identification of a parasite at the origin of the disease by the famous scientist Rudolf Virchow in 1855, the borders of the endemic area of alveolar echinococcosis (AE) have never stopped to expand. The parasite was successively recognized in Switzerland, then in Russia, Austria and France which were long considered as the only endemic areas for the disease. Cases were disclosed in Turkey in 1939; then much attention was paid to Alaska and to Hokkaido, in Japan. The situation totally changed in 1991 after the recognition of the Chinese endemic areas by the international community of scientists. The world map was completed in the beginning of the 21st century by the identification of AE in most of the countries of central/eastern Europe and Baltic States, and by the recognition of cases in central Asia. Up to now, the disease has however never been reported in the South hemisphere and in the United Kingdom. In the mid-1950s, demonstration by Rausch and Schiller in Alaska, and by Vogel in Germany, of the distinction between 2 parasite species responsible respectively for cystic echinococcosis (“hydatid disease”) and AE put an end to the long-lasting debate between the "dualists", who believed in that theory which eventually proved to be true, and the "unicists", who believed in a single species responsible for both diseases. At the end of the 20th century, molecular biology fully confirmed the "dualist" theory while adding several new species to the initially described E. granulosus; within the past decade, it also confirmed that little variation existed within Echinococcus (E.) multilocularis species, and that AE-looking infection in some intermediate animal hosts on the Tibetan plateau was indeed due to a new species, distinct from E. multilocularis, named E. shiquicus. Since the 1970s, the unique ecological interactions between the landscape, the hosts, and E. multilocularis have

  5. Soft Clouding

    DEFF Research Database (Denmark)

    Søndergaard, Morten; Markussen, Thomas; Wetton, Barnabas

    2012-01-01

    Soft Clouding is a blended concept, which describes the aim of a collaborative and transdisciplinary project. The concept is a metaphor implying a blend of cognitive, embodied interaction and semantic web. Furthermore, it is a metaphor describing our attempt of curating a new semantics of sound a...

  6. Effect of Alveolar Segmental Sandwich Osteotomy on Alveolar Height: A Preliminary Study.

    Science.gov (United States)

    Mehta, Karan S; Prasad, Kavitha; Shetty, Vibha; Ranganath, Krishnappa; Lalitha, R M; Dexith, Jayashree; Munoyath, Sejal K; Kumar, Vineeth

    2017-12-01

    Bone loss following extraction is maximum in horizontal dimension. Height is also reduced which is pronounced on the buccal aspect. Various surgical procedures are available to correct the bone volume viz. GBR, onlay bone grafting, alveolar distraction and sandwich osteotomy. Sandwich osteotomy has been found to increase the vertical alveolar bone height successfully. The objective of the study was to assess the effect of alveolar segmental sandwich osteotomy on alveolar height and crestal width. A prospective study was undertaken from December 2012 to August 2014. Seven patients with 12 implant sites with a mean age of 36 years were recruited. All seven patients with 12 implant sites underwent alveolar segmental sandwich osteotomy and interpositional bone grafting. Alveolar bone height was assessed radiographically preoperatively, immediate post-op, and at 3 months post-op. Alveolar bone width was assessed radiographically preoperatively and at 3 months post-op. Statistical significance was inferred at p  Sandwich osteotomy can be used as an alternative technique to increase alveolar bone height prior to implant placement. Moderate alveolar deficiency can be predictably corrected by this technique.

  7. Alveolar ridge augmentation by osteoinduction in rats

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1990-01-01

    The purpose of this study was to evaluate bone substitutes for alveolar ridge augmentation by osteoinduction. Allogenic, demineralized, and lyophilized dentin and bone was tested for osteoinductive properties in order to establish an experimental model for further studies. Implantations were...

  8. Soft Matter Characterization

    CERN Document Server

    Borsali, Redouane

    2008-01-01

    Progress in basic soft matter research is driven largely by the experimental techniques available. Much of the work is concerned with understanding them at the microscopic level, especially at the nanometer length scales that give soft matter studies a wide overlap with nanotechnology. This 2 volume reference work, split into 4 parts, presents detailed discussions of many of the major techniques commonly used as well as some of those in current development for studying and manipulating soft matter. The articles are intended to be accessible to the interdisciplinary audience (at the graduate student level and above) that is or will be engaged in soft matter studies or those in other disciplines who wish to view some of the research methods in this fascinating field. Part 1 contains articles with a largely (but, in most cases, not exclusively) theoretical content and/or that cover material relevant to more than one of the techniques covered in subsequent volumes. It includes an introductory chapter on some of t...

  9. Post traumatic immediate GBR: alveolar ridge preservation after a comminuted fracture of the anterior maxilla.

    Science.gov (United States)

    Kim, Yongsoo; Leem, Dae Ho

    2015-04-01

    Without a proper intervention, a crushed alveolar process fracture can cause significant dimensional changes on affected hard and soft tissue that lead to difficult circumstances for post traumatic bone augmentation and dental implant placement. We present herein the cases of immediate guided bone regeneration (GBR) for the maxillary anterior alveolar process with comminuted fracture. Shortly after the hospital visit, guided bone regeneration was conducted for three patients using only xenograft material and bone fragments from traumatic site, without an additional donor site. Resorbable collagen membrane was used on the bone graft site, and titanium mesh was also used if significant bone loss were expected. Radiographic evaluation 6 months after GBR confirmed that all three cases had sufficiently preserved alveolar bone which is clinically required for implant placement. Dental implant installation was carried out for two patients and no specific findings were noted in follow-up after the placement. In this method, additional operation sites for bone collection are not necessary and the number of surgical steps before implant placement can be reduced. Furthermore, this immediate intervention can effectively minimize the alveolar ridge shrinkage of anterior maxilla after injury. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Effect of high intensity vs. soft-start halogen irradiation on light-cured resin-based composites. Part I. Temperature rise and polymerization shrinkage.

    Science.gov (United States)

    Hofmann, Norbert; Markert, Tanja; Hugo, Burkard; Klaiber, Bernd

    2003-12-01

    To determine polymerization shrinkage kinetics and temperature rise of light-cured resin-based composites after high intensity vs. soft-start quartz tungsten halogen irradiation. Shrinkage kinetics was evaluated using the "deflecting disk technique", modified for simultaneous measurement of temperature within the resin-based composite using a thermocouple. Additional irradiations after 60 and 65 minutes allowed the determination of temperature rises caused by radiation or by reaction heat. Four hybrids (Filtek Z250, Herculite, Solitaire 2, Tetric Ceram), an inhomogeneously filled hybrid (InTen-S) and a microfill (Filtek A110, formerly Silux Plus) were cured using the quartz tungsten halogen units Astralis 10 and Optilux 501 in the high intensity (A10 HiPo: 10 seconds at 1300 mW/cm2; OL Boost: 10 seconds at 1140 mW/cm2) or soft-start modes (A10 Pulse: increase to 700 mW/cm2 within 10 seconds, three periods of 2 seconds at 1300 mW/cm2 alternating with two periods of 2 seconds at 700 mW/cm2; OL Ramp: exponential increase within 10 seconds, followed by 10 seconds at 1140 mW/cm2). The soft-start protocols produced less contraction, and polymerization shrinkage started later and progressed slower (or: more slowly), compared to high intensity irradiation [correction]. The lowest shrinkage was observed for InTen-S, followed by Filtek Z250 and A110, whereas Solitaire 2, Herculite and Tetric Ceram scored highest for this parameter. Temperature rise was caused more or less equally by radiation and by reaction heat and reached values of up to 28.9 degrees C relative to a baseline of 37 degrees C. For some combinations of curing modes and resin-based composites, less heat was generated by the soft-start protocols and by Optilux 501.

  11. Mineralization of soft-part anatomy and invading microbes in the horseshoe crab Mesolimulus from the Upper Jurassic Lagerstätte of Nusplingen, Germany.

    Science.gov (United States)

    Briggs, Derek E G; Moore, Rachel A; Shultz, Jeffrey W; Schweigert, Günter

    2005-03-22

    A remarkable specimen of Mesolimulus from the Upper Jurassic (Kimmeridgian) of Nusplingen, Germany, preserves the musculature of the prosoma and associated microbes in three dimensions in calcium phosphate (apatite). The musculature of Mesolimulus conforms closely to that of modern horseshoe crabs. Associated with the muscles are patches of mineralized biofilm with spiral and coccoid forms. This discovery emphasizes the potential of soft-bodied fossils as a source for increasing our knowledge of the diversity of fossil microbes in particular settings.

  12. Application of coenzyme Q10 for accelerating soft tissue wound healing after tooth extraction in rats.

    Science.gov (United States)

    Yoneda, Toshiki; Tomofuji, Takaaki; Kawabata, Yuya; Ekuni, Daisuke; Azuma, Tetsuji; Kataoka, Kota; Kunitomo, Muneyoshi; Morita, Manabu

    2014-12-10

    Accelerating wound healing after tooth extraction is beneficial in dental treatment. Application of antioxidants, such as reduced coenzyme Q10 (rCoQ10), may promote wound healing after tooth extraction. In this study, we examined the effects of topical application of rCoQ10 on wound healing after tooth extraction in rats. After maxillary first molars were extracted, male Fischer 344 rats (8 weeks old) (n = 27) received topical application of ointment containing 5% rCoQ10 (experimental group) or control ointment (control group) to the sockets for 3 or 8 days (n = 6-7/group). At 3 days after extraction, the experimental group showed higher collagen density and lower numbers of polymorphonuclear leukocytes in the upper part of socket, as compared to the control group (p healing in the soft tissue of the alveolar socket, but that rCoQ10 has a limited effect on bone remodeling in rats.

  13. [Cleft lip, alveolar and palate sequelae. Proposal of new alveolar score by the Alveolar Cleft Score (ACS) classification].

    Science.gov (United States)

    Molé, C; Simon, E

    2015-06-01

    The management of cleft lip, alveolar and palate sequelae remains problematic today. To optimize it, we tried to establish a new clinical index for diagnostic and prognostic purposes. Seven tissue indicators, that we consider to be important in the management of alveolar sequelae, are listed by assigning them individual scores. The final score, obtained by adding together the individual scores, can take a low, high or maximum value. We propose a new classification (ACS: Alveolar Cleft Score) that guides the therapeutic team to a prognosis approach, in terms of the recommended surgical and prosthetic reconstruction, the type of medical care required, and the preventive and supportive therapy to establish. Current studies are often only based on a standard radiological evaluation of the alveolar bone height at the cleft site. However, the gingival, the osseous and the cellular areas bordering the alveolar cleft sequelae induce many clinical parameters, which should be reflected in the morphological diagnosis, to better direct the surgical indications and the future prosthetic requirements, and to best maintain successful long term aesthetic and functional results. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Brain Metastasis in Bone and Soft Tissue Cancers: A Review of Incidence, Interventions, and Outcomes

    Directory of Open Access Journals (Sweden)

    Faris Shweikeh

    2014-01-01

    Full Text Available Bone and soft tissue malignancies account for a small portion of brain metastases. In this review, we characterize their incidence, treatments, and prognosis. Most of the data in the literature is based on case reports and small case series. Less than 5% of brain metastases are from bone and soft tissue sarcomas, occurring most commonly in Ewing’s sarcoma, malignant fibrous tumors, and osteosarcoma. Mean interval from initial cancer diagnosis to brain metastasis is in the range of 20–30 months, with most being detected before 24 months (osteosarcoma, Ewing sarcoma, chordoma, angiosarcoma, and rhabdomyosarcoma, some at 24–36 months (malignant fibrous tumors, malignant peripheral nerve sheath tumors, and alveolar soft part sarcoma, and a few after 36 months (chondrosarcoma and liposarcoma. Overall mean survival ranges between 7 and 16 months, with the majority surviving < 12 months (Ewing’s sarcoma, liposarcoma, malignant fibrous tumors, malignant peripheral nerve sheath tumors, angiosarcoma and chordomas. Management is heterogeneous involving surgery, radiosurgery, radiotherapy, and chemotherapy. While a survival advantage may exist for those given aggressive treatment involving surgical resection, such patients tended to have a favorable preoperative performance status and minimal systemic disease.

  15. Soft And Hard Skills of Social Worker

    OpenAIRE

    HANTOVÁ, Libuše

    2011-01-01

    The work deals with soft and hard skills relevant to the profession of social worker. The theoretical part at first evaluates and analyzes important soft and hard skills necessary for people working in the field of social work. Then these skills are compared. The practical part illustrates the use of soft and hard skills in practice by means of model scenes and deals with the preferences in three groups of people ? students of social work, social workers and people outside the sphere, namely ...

  16. Soft Robotics Week

    CERN Document Server

    Rossiter, Jonathan; Iida, Fumiya; Cianchetti, Matteo; Margheri, Laura

    2017-01-01

    This book offers a comprehensive, timely snapshot of current research, technologies and applications of soft robotics. The different chapters, written by international experts across multiple fields of soft robotics, cover innovative systems and technologies for soft robot legged locomotion, soft robot manipulation, underwater soft robotics, biomimetic soft robotic platforms, plant-inspired soft robots, flying soft robots, soft robotics in surgery, as well as methods for their modeling and control. Based on the results of the second edition of the Soft Robotics Week, held on April 25 – 30, 2016, in Livorno, Italy, the book reports on the major research lines and novel technologies presented and discussed during the event.

  17. Perawatan Ortodontik Gigi Anterior Berjejal dengan Tulang Alveolar yang Tipis

    Directory of Open Access Journals (Sweden)

    Miesje K. Purwanegara

    2015-09-01

    Full Text Available Anterior teeth movement in orthodontic treatment is limited to labiolingual direction by very thin alveolar bone. An uncontrolled anterior tooth movement to labiolingual direction can cause alveolar bone perforation at its root segment. This case report is to remind us that alveolar bone thickness limits orthodontc tooth movement. A case of crowded anterior teeth with thin alveolar bone in malocclusion I is reported. This case is treated using adgewise orthodontic appliance. Protraction of anterior teeth is anticipated due to thin alveolar bone on the anterior surface. The conclusion is although the alveolar bone surrounding the crowded anterior teeth is thin, by controlling the movement the teeth reposition is allowed.

  18. Lateralization Technique and Inferior Alveolar Nerve Transposition

    Directory of Open Access Journals (Sweden)

    Angélica Castro Pimentel

    2016-01-01

    Full Text Available Bone resorption of the posterior mandible can result in diminished bone edge and, therefore, the installation of implants in these regions becomes a challenge, especially in the presence of the mandibular canal and its contents, the inferior alveolar nerve. Several treatment alternatives are suggested: the use of short implants, guided bone regeneration, appositional bone grafting, distraction osteogenesis, inclined implants tangential to the mandibular canal, and the lateralization of the inferior alveolar nerve. The aim was to elucidate the success rate of implants in the lateralization technique and in inferior alveolar nerve transposition and to determine the most effective sensory test. We conclude that the success rate is linked to the possibility of installing implants with long bicortical anchor which favors primary stability and biomechanics.

  19. Complications related to bone augmentation procedures of localized defects in the alveolar ridge. A retrospective clinical study

    DEFF Research Database (Denmark)

    Jensen, Anders Torp; Jensen, Simon Storgård; Worsaae, Nils

    2016-01-01

    PURPOSE: This retrospective clinical study aims to evaluate complications after augmentation of localized bone defects of the alveolar ridge. METHODS: From standardized registrations, the following complications related to bone augmentation procedures were recorded: soft tissue dehiscence......, infection, sensory disturbance, additional augmentation procedures needed, and early implant failure. RESULTS: A total of 223 patients (132 women, 91 men; mean age 23.5 years; range 17-65 years) with 331 bone defects had bone augmentation performed into which 350 implants were placed. Soft tissue dehiscence.......7 %), four after GBR procedures (1.6 %), and two (12 %) after staged vertical ridge augmentation. CONCLUSIONS: Predictable methods exist to augment localized defects in the alveolar ridge, as documented by low complication rates and high early implant survival rates....

  20. Modeling of Trabecular Bone and Lamina Dura Following Selective Alveolar Decortication in Rats

    Science.gov (United States)

    Sebaoun, Jean-David; Kantarci, Alpdogan; Turner, John W.; Carvalho, Roberto S.; Van Dyke, Thomas E.; Ferguson, Donald J.

    2008-01-01

    Background: Modifying the balance between resorption and apposition through selectively injuring the cortical plate of the alveolus has been an approach to speed tooth movement and is referred to as periodontally accelerated osteogenic orthodontics. The aim of this study was to investigate the alveolar response to corticotomy as a function of time and proximity to the surgical injury in a rat model. Methods: Maxillary buccal and lingual cortical plates were injured in 36 healthy adult rats adjacent to the upper left first molars. Twenty-four animals were euthanized at 3, 7, or 11 weeks. In one group, the maxillae were removed and stripped of soft tissues, and histomorphometric analysis was performed to study alveolar spongiosa and periodontal ligament (PDL) modeling dynamics. Catabolic activity was analyzed with tartrate-resistant acid phosphatase–positive osteoclasts and preosteoclasts. Anabolic actions were measured using a fluorescent vital bone stain series followed by sacrifice at 30 and 51 days. To further analyze the new bone formation, a separate group of animals were fed with calcein fluorescent stain and processed for non-decalcified fluorescent stain histology. Results: At 3 weeks, the surgery group had significantly (P <0.05) less calcified spongiosa bone surface, greater periodontal ligament surface, higher osteoclast number, and greater lamina dura apposition width. The catabolic activity (osteoclast count) and anabolic activity (apposition rate) were three-fold greater, calcified spongiosa decreased by two-fold, and PDL surface increased by two-fold. Surgical injury to the alveolus that induced a significant increase in tissue turnover by week 3 dissipated to a steady state by postoperative week 11. The impact of the injury was localized to the area immediately adjacent to the decortication injury. Conclusion: Selective alveolar decortication induced increased turnover of alveolar spongiosa, and the activity was localized; dramatic escalation of

  1. Bone graft healing in alveolar osteoplasty in patients with unilateral lip, alveolar process, and palate clefts.

    Science.gov (United States)

    Rychlik, Dariusz; Wójcicki, Piotr

    2012-01-01

    Secondary osteoplasty by means of autogenic spongy bone grafting is the most common procedure used in the reconstruction of the continuity of the maxillary alveolar process. The aim of the study was to analyze retrospectively the effect of certain factors on the course of the bone graft healing process in patients with unilateral complete clefts of the lip, alveolar process, and palate. The investigations involved 62 children aged 8 to 14 years (mean age, 11 years) with unilateral complete cleft of the lip, alveolar process, and palate operated on at the Clinic of Plastic Surgery in Polanica Zdrój from November 2007 to April 2009. All the procedures consisted in the reconstruction of the maxillary alveolar process by means of autogenic spongy bone grafting from the iliac bone. The analysis was performed on the basis of computed tomography scans presenting maxillary alveolar processes in the horizontal cross-sectional planes performed on the second or third postoperative day and after 6 months. They were used as the basis for the measurement of the volume and density (condensation) of the bone graft, the surface of its adhesion to the maxillary alveolar bone, and the volume and density of the healed bone. The following correlation coefficients were determined: between the adhesion surface of the bone to the alveolar bone and the volume of the healed bone, between the adhesion surface of the bone to the alveolar bone and the density of the healed bone, and between the density of the graft and the volume of the healed bone. Increasing the surface of the graft adhesion to the bone ridges of the alveolar cleft contributes to increased volume of the healed bone and slows down the increase in its density (on 6-month follow-up). Crushing of the bone graft increases its resorption and reduces volume of the healed bone.

  2. Correlations between initial cleft size and dental anomalies in unilateral cleft lip and palate patients after alveolar bone grafting.

    Science.gov (United States)

    Jabbari, Fatima; Reiser, Erika; Thor, Andreas; Hakelius, Malin; Nowinski, Daniel

    2016-01-01

    Objective To determine in individuals with unilateral cleft lip and palate the correlation between initial cleft size and dental anomalies, and the outcome of alveolar bone grafting. Methods A total of 67 consecutive patients with non-syndromic unilateral complete cleft lip and palate (UCLP) were included from the cleft lip and palate-craniofacial center, Uppsala University Hospital, Sweden. All patients were operated by the same surgeon and treated according to the Uppsala protocol entailing: lip plasty at 3 months, soft palate closure at 6 months, closure of the residual cleft in the hard palate at 2 years of age, and secondary alveolar bone grafting (SABG) prior to the eruption of the permanent canine. Cleft size was measured on dental casts obtained at the time of primary lip plasty. Dental anomalies were registered on radiographs and dental casts obtained before bone grafting. Alveolar bone height was evaluated with the Modified Bergland Index (mBI) at 1 and 10-year follow-up. Results Anterior cleft width correlated positively with enamel hypoplasia and rotation of the central incisor adjacent to the cleft. There was, however, no correlation between initial cleft width and alveolar bone height at either 1 or 10 years follow-up. Conclusions Wider clefts did not seem to have an impact on the success of secondary alveolar bone grafting but appeared to be associated with a higher degree of some dental anomalies. This finding may have implications for patient counseling and treatment planning.

  3. A comparative assessment of heavy metal accumulation in soft parts and byssus of mussels from subarctic, temperate, subtropical and tropical marine environments

    International Nuclear Information System (INIS)

    Szefer, P.; Fowler, S.W.; Ikuta, K.; Osuna, F. Paez; Ali, A.A.; Kim, B.-S.; Fernandes, H.M.; Belzunce, M.-J.; Guterstam, B.; Kunzendorf, H.; Wolowicz, M.; Hummel, H.; Deslous-Paoli, M.

    2006-01-01

    Existing data on metal concentrations in mussels from subarctic, temperate, subtropical and tropical waters were analyzed using multivariate statistics in order to assess regional variations in metal contamination. Potential errors were reduced by only analyzing data from surveys that employed the same protocols, analytical methodologies and analysts. Factor analysis demonstrated that mussels inhabiting extremely contaminated areas (e.g. from Japanese and Swedish metallurgy sources) could be separated from mussels from other contaminated areas, and that metals such as Cd, Pb, Cu and Zn could be used to identify heavily contaminated samples while Co, Fe, Cr and Ni concentrations were good markers for exposure to inputs from different industrial sources. Furthermore byssus, like soft tissue, selectively and sensitively reflects variations of certain metal concentrations in ambient waters and thus serves as a reliable biomonitor for these contaminants in a variety of coastal and estuarine areas. - Byssus of mytilids, like soft tissues can be used as efficient biomonitor for heavy metals in the marine environment

  4. Alveolar Ridge Carcinoma. Two Cases Report

    International Nuclear Information System (INIS)

    Pupo Triguero, Raul J; Vivar Bauza, Miriam; Alvarez Infante, Elisa

    2008-01-01

    Two cases with alveolar ridge carcinoma due to prosthetist traumatism are discussed in this paper, after 9 and 10 years of using dental prosthesis. Both patients began with disturbance in the alveolar ridge. The clinical examination and biopsy showed a well differenced carcinoma. The treatment was radical surgery and radiotherapy in the first patient, and conservative surgery with radiotherapy in the second case .The patients had xerostomia after radiotherapy and the woman had difficulties with mastication. The advantages and disadvantages of the treatment were discussed, focused on the prevention and treatment for oral

  5. Soft, Embodied, Situated & Connected

    DEFF Research Database (Denmark)

    Tomico, Oscar; Wilde, Danielle

    2016-01-01

    to material detail; an eye for fit and comfort on bodies with diverse shapes and movement capabilities; openness to a diversity of meanings that may be generated; as well as consideration of wearers’ intimate relations with technology. Soft wearables allow for greater scope within these requirements....... In this article, we discuss the opportunities and challenges of designing soft wearables, applying notions of situatedness and personal meaning-making to understand and posit values in relation to outcomes. We present three design cases that focus on body, material, and context; and reflect on how the different......; diverse capabilities and meanings of the body; as well as the qualities and capabilities afforded by smart and programmable elements. Textiles behave in particular ways. They are part of culture. No matter a person’s views on fashion, dress, their own or others’ body, they will have an intimate...

  6. Rehabilitation of maxillary anterior esthetics by alveolar distraction osteogenesis with immediate implant placement: a case report.

    Science.gov (United States)

    Gozneli, Rifat; Ozkan, Yasar; Akalin, Zerrin Fidan; Ozkan, Yasemin

    2010-12-01

    Esthetic reconstruction of severe soft and hard tissue deficiencies is the utmost challenge in implant dentistry. To prevent postoperative bone resorption and to control the amount of hard and soft tissue volume, distraction osteogenesis followed by immediate implant placement has been proven to be a promising combined technique. The aim of this report is to introduce a treatment strategy to maintain anterior esthetics and to control hard and soft tissue volume in a case, treated with the combined technique of vertical alveolar distraction and immediate implant placement. An osteotomy was performed by the use of an oscillating saw. Cut alveolar segment was mobilized, and a distractor device was inserted in between the segments. During the activation and consolidation periods of distraction, anterior esthetics was provided with removable acrylic provisional crowns placed on the distractor's rod. In 2 weeks of distraction period, vertically 10 mm of new bony segment was obtained, and 2 weeks after the removal of distractor, maxillary incisors were extracted. Four dental implants were placed according to the immediate placement protocol. In osseointegration period, provisional restorations were fabricated on abutments to form harmonious gingival contours and to maintain maxillary anterior esthetics until the fabrication of final restorations.

  7. Soft mappings space.

    Science.gov (United States)

    Ozturk, Taha Yasin; Bayramov, Sadi

    2014-01-01

    Various soft topologies are being introduced on a given function space soft topological spaces. In this paper, soft compact-open topology is defined in functional spaces of soft topological spaces. Further, these functional spaces are studied and interrelations between various functional spaces with soft compact-open topology are established.

  8. Osteopontin regulates dentin and alveolar bone development and mineralization.

    Science.gov (United States)

    Foster, B L; Ao, M; Salmon, C R; Chavez, M B; Kolli, T N; Tran, A B; Chu, E Y; Kantovitz, K R; Yadav, M; Narisawa, S; Millán, J L; Nociti, F H; Somerman, M J

    2018-02-01

    The periodontal complex is essential for tooth attachment and function and includes the mineralized tissues, cementum and alveolar bone, separated by the unmineralized periodontal ligament (PDL). To gain insights into factors regulating cementum-PDL and bone-PDL borders and protecting against ectopic calcification within the PDL, we employed a proteomic approach to analyze PDL tissue from progressive ankylosis knock-out (Ank -/- ) mice, featuring reduced PP i , rapid cementogenesis, and excessive acellular cementum. Using this approach, we identified the matrix protein osteopontin (Spp1/OPN) as an elevated factor of interest in Ank -/- mouse molar PDL. We studied the role of OPN in dental and periodontal development and function. During tooth development in wild-type (WT) mice, Spp1 mRNA was transiently expressed by cementoblasts and strongly by alveolar bone osteoblasts. Developmental analysis from 14 to 240days postnatal (dpn) indicated normal histological structures in Spp1 -/- comparable to WT control mice. Microcomputed tomography (micro-CT) analysis at 30 and 90dpn revealed significantly increased volumes and tissue mineral densities of Spp1 -/- mouse dentin and alveolar bone, while pulp and PDL volumes were decreased and tissue densities were increased. However, acellular cementum growth was unaltered in Spp1 -/- mice. Quantitative PCR of periodontal-derived mRNA failed to identify potential local compensators influencing cementum in Spp1 -/- vs. WT mice at 26dpn. We genetically deleted Spp1 on the Ank -/- mouse background to determine whether increased Spp1/OPN was regulating periodontal tissues when the PDL space is challenged by hypercementosis in Ank -/- mice. Ank -/- ; Spp1 -/- double deficient mice did not exhibit greater hypercementosis than that in Ank -/- mice. Based on these data, we conclude that OPN has a non-redundant role regulating formation and mineralization of dentin and bone, influences tissue properties of PDL and pulp, but does not

  9. Alveolar Bone Fracture: Pathognomonic Sign for Clinical Diagnosis

    OpenAIRE

    Gutmacher, Zvi; Peled, Eli; Norman, Doron; Lin, Shaul

    2017-01-01

    Aim: Dental injuries, especially luxation and avulsion, are common. Dental trauma can cause alveolar bone fracture that can lead to tooth loss and malocclusion. Single tooth alveolar bone fractures are difficult to identify unless it protrudes through the overlying mucosa and can be visualized. Pain, malocclusion, and tooth mobility provide signs of suspected alveolar bone fractures. Integrity of the proximate alveolar bone should be examined for fractures where avulsion, luxation, or other t...

  10. Influence of Injection-Molding Process Parameters on Part Replication of Microstructures with Additively-Manufactured Soft Tooling Inserts WCMNM 2017 No

    DEFF Research Database (Denmark)

    Mischkot, Michael; Zhang, Yang; Segebrecht Gøtje, Asger

    The objective of this research is to investigate the influence of injection molding parameters on the dimensional replication of microstructure surfaces in injection molding with additively manufactured soft tooling inserts in a photopolymer material. The replication degree of micropillars...... on injection-molded tine rings was assessed and a Design of Experiments (DOE) approach was used to investigate which factors influence the replication. A full factorial analysis with three factors at two levels lead to the conclusion that a high mold temperature increases the replication degree of the pillar...... in the replication degree between inserts on the injection side and the ejector side of the mold respectively. Also, a position closer to the injection gate supports a higher replication degree. Insert wear was found insignificant within the experimental range of up to 100 injection cycles....

  11. Soft Tissue Sarcoma

    Science.gov (United States)

    ... muscles, tendons, fat, and blood vessels. Soft tissue sarcoma is a cancer of these soft tissues. There ... have certain genetic diseases. Doctors diagnose soft tissue sarcomas with a biopsy. Treatments include surgery to remove ...

  12. Teaching Alveolar Ventilation with Simple, Inexpensive Models

    Science.gov (United States)

    DiCarlo, Stephen E.

    2008-01-01

    When teaching and learning about alveolar ventilation with our class of 300 first-year medical students, we use four simple, inexpensive "models." The models, which encourage research-oriented learning and help our students to understand complex ideas, are distributed to the students before class. The students anticipate something new every day,…

  13. Alveolar ridge augmentation by osteoinduction in rats

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1990-01-01

    The purpose of this study was to evaluate bone substitutes for alveolar ridge augmentation by osteoinduction. Allogenic, demineralized, and lyophilized dentin and bone was tested for osteoinductive properties in order to establish an experimental model for further studies. Implantations were perf...

  14. Alveolar proteinosis associated with aluminium dust inhalation.

    Science.gov (United States)

    Chew, R; Nigam, S; Sivakumaran, P

    2016-08-01

    Secondary alveolar proteinosis is a rare lung disease which may be triggered by a variety of inhaled particles. The diagnosis is made by detection of anti-granulocyte-macrophage colony-stimulating factor antibodies in bronchoalveolar lavage fluid, which appears milky white and contains lamellar bodies. Aluminium has been suggested as a possible cause, but there is little evidence in the literature to support this assertion. We report the case of a 46-year-old former boilermaker and boat builder who developed secondary alveolar proteinosis following sustained heavy aluminium exposure. The presence of aluminium was confirmed both by histological examination and metallurgical analysis of a mediastinal lymph node. Despite cessation of exposure to aluminium and treatment with whole-lung lavage which normally results in improvements in both symptoms and lung function, the outcome was poor and novel therapies are now being used for this patient. It may be that the natural history in aluminium-related alveolar proteinosis is different, with the metal playing a mediating role in the disease process. Our case further supports the link between aluminium and secondary alveolar proteinosis and highlights the need for measures to prevent excessive aluminium inhalation in relevant industries. © The Author 2016. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  15. Oblique lip-alveolar banding in patients with cleft lip and palate.

    Science.gov (United States)

    Naidoo, S; Bütow, K-W

    2015-04-01

    We report an oblique lip-alveolar band, a rare banding of soft tissue that involves the lip and alveolus, which we have found in five patients with cleft lip and palate (0.2%), compared with an incidence of the Simonartz lip-lip band of 5.7%). To our knowledge this has not been reported previously. In two patients the bands affected the cleft lip and alveolus bilaterally, with or without the palatal cleft, and in three the bands were unilateral cleft lip and alveolus with or without the palatal cleft. Copyright © 2015 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  16. Distracción osteogénica alveolar: una alternativa en la reconstrucción de rebordes alveolares atróficos: Descripción de 10 casos Alveolar distraction osteogenesis: an alternative in the reconstruction of atrophic alveolar ridges: Report of 10 cases

    Directory of Open Access Journals (Sweden)

    P.E. Maurette O’Brien

    2004-02-01

    Full Text Available La distracción osteogénica alveolar (DOA es un método alternativo para la reconstrucción de rebordes alveolares atróficos que ofrece un resultado previsible y que disminuye los tiempo de espera entre la reconstrucción del reborde alveolar atrófico y la colocación de los implantes óseo-integrados, en comparación con los métodos tradicionalmente utilizados. Fueron atendidos 10 pacientes que presentaban deficiencia de reborde alveolar mandibular y/o maxilar por medio de distracción osteogénica, utilizando un dispositivo yuxtaoseo (Conexión Implant System® - SP-Brasil. Todos los pacientes fueron atendidos de forma ambulatoria, bajo anestesia local y sedación conciente, comenzando la activación del dispositivo a los 7 días posteriores a la instalación, con un patrón de activación de 1 mm diarios hasta alcanzar la altura ósea deseada. Posteriormente se aguardaron 10 semanas como parte del periodo de consolidación ósea y se realizo la colocación de los implantes oseointegrados y local y el retiro del dispositivo de distracción, pudiéndose comprobar clínica y radiográficamente la ganancia de la altura y volumen óseo necesario para la rehabilitación por medio de implantes.The alveolar distraction osteogenesis is an alternative method for the reconstruction of atrophic alveolar ridges with success, that decrease the time of wait between the reconstruction of the alveolar ridge and the placement of the osseointegrated implants in comparison with the traditionally used methods. 10 patients that presented deficiency of the alveolar ridge in the maxilla and/or mandible were assisted by means of distraction osteogenesis, using a juxtaosseous device (Conexion Implant System® - SP-Brazil. All the patients were assisted of form ambulatory, under local anesthesia and conscientious sedation, beginning the activation from the device 7 days later to the installation, with a pattern of activation 1 mm diary until reaching the wanted

  17. Alveolar Bone Fracture: Pathognomonic Sign for Clinical Diagnosis.

    Science.gov (United States)

    Gutmacher, Zvi; Peled, Eli; Norman, Doron; Lin, Shaul

    2017-01-01

    Dental injuries, especially luxation and avulsion, are common. Dental trauma can cause alveolar bone fracture that can lead to tooth loss and malocclusion. Single tooth alveolar bone fractures are difficult to identify unless it protrudes through the overlying mucosa and can be visualized. Pain, malocclusion, and tooth mobility provide signs of suspected alveolar bone fractures. Integrity of the proximate alveolar bone should be examined for fractures where avulsion, luxation, or other tooth trauma is detected. Any suggestion of alveolar fractures should be further investigated with an appropriate radiograph. This case report shows a pathognomonic sign that detects and diagnosis single tooth alveolar bone fractures, i.e. , a localized hematoma crossing the attached gingiva from the free gingival margin to the vestibular mucosa. This should serve as a warning for localized alveolar bone fracture. A visualized hematoma and gentle, careful palpation may help detect covered fractures when the overlying mucosa is not perforated.

  18. Minor rheumatology: Nonsystemic rheumatic disease of juxta-articular soft tissues of the pelvis and lower extremity: Diagnosis and treatment. Part 3

    Directory of Open Access Journals (Sweden)

    A. E. Karateev

    2015-01-01

    Full Text Available Pain associated with rheumatic diseases of juxta-articular soft tissues (RDJAST of the pelvis and lower extremity is a frequent reason for seeking advice from general practitioners and rheumatologists. However, the true cause of painful sensations is often overlooked by a physician and the patient is long and frequently treated unsuccessfully for lumbago, coxarthrosis, or gonarthrosis.The complexities of topical diagnosis are largely associated with the fact that instrumental methods virtually always determine these or those degenerative changes in the lumbar spine and hip joint (HJ, which formally supports the presence of nonspecific low back pain and coxarthrosis. Differential diagnosis can be made between these conditions if their clinical features are considered, by discriminating symptoms, such as pains in the back or buttock, and those located predominantly in the hip and groin area.The most known forms of RDJAST of the pelvis and HJ may include trochanteritis, hip abductor and adductor syndromes, iliopectineal bursitis, and ischial tuberosity bursitis.This review briefly describes the major forms of RDJAST of the mentioned area, their clinical manifestations, and topical diagnostic techniques. It also considers main therapeutic approaches: the administration of nonsteroidal antiinflammatory drugs, local injections of glucocorticoids and plateletrich plasma, and physiotherapy.

  19. Soft Interfaces

    International Nuclear Information System (INIS)

    Strzalkowski, Ireneusz

    1997-01-01

    This book presents an extended form of the 1994 Dirac Memorial Lecture delivered by Pierre Gilles de Gennes at Cambridge University. The main task of the presentation is to show the beauty and richness of structural forms and phenomena which are observed at soft interfaces between two media. They are much more complex than forms and phenomena existing in each phase separately. Problems are discussed including both traditional, classical techniques, such as the contact angle in static and dynamic partial wetting, as well as the latest research methodology, like 'environmental' scanning electron microscopes. The book is not a systematic lecture on phenomena but it can be considered as a compact set of essays on topics which particularly fascinate the author. The continuum theory widely used in the book is based on a deep molecular approach. The author is particularly interested in a broad-minded rheology of liquid systems at interfaces with specific emphasis on polymer melts. To study this, the author has developed a special methodology called anemometry near walls. The second main topic presented in the book is the problem of adhesion. Molecular processes, energy transformations and electrostatic interaction are included in an interesting discussion of the many aspects of the principles of adhesion. The third topic concerns welding between two polymer surfaces, such as A/A and A/B interfaces. Of great worth is the presentation of various unsolved, open problems. The kind of topics and brevity of description indicate that this book is intended for a well prepared reader. However, for any reader it will present an interesting picture of how many mysterious processes are acting in the surrounding world and how these phenomena are perceived by a Nobel Laureate, who won that prize mainly for his investigations in this field. (book review)

  20. Dissecting soft radiation with factorization

    International Nuclear Information System (INIS)

    Stewart, Iain W.; Tackmann, Frank J.; Waalewijn, Wouter J.; Amsterdam Univ.

    2014-05-01

    An essential part of high-energy hadronic collisions is the soft hadronic activity that underlies the primary hard interaction. It can receive contributions from soft radiation from the primary hard partons, secondary multiple parton interactions (MPI), and factorization violating effects. The invariant mass spectrum of the leading jet in Z+jet and H+jet events is directly sensitive to these effects. We use a QCD factorization theorem to predict the dependence on the jet radius R, jet p T , jet rapidity, and partonic process for both the perturbative and nonperturbative components of primary soft radiation. The nonperturbative contributions involve only odd powers of R, and the linear R term is universal for quark and gluon jets. The hadronization model in PYTHIA8 agrees well with these properties. The perturbative soft initial state radiation (ISR) has a contribution that depends on the jet area in the same way as the underlying event. This degeneracy is broken by the jet p T dependence. The size of this soft ISR contribution is proportional to the color state of the initial partons, yielding the same positive contribution for gg→Hg and gq→Zq, but a negative interference contribution for q anti q→Zg. Hence, measuring these dependencies allows one to separate hadronization, soft ISR, and MPI contributions in the data.

  1. Dimensional alterations of extraction sites after different alveolar ridge preservation techniques - a volumetric study.

    Science.gov (United States)

    Thalmair, Tobias; Fickl, Stefan; Schneider, David; Hinze, Marc; Wachtel, Hannes

    2013-07-01

    The aim of this randomized controlled clinical study was to assess soft tissue contour changes after different alveolar ridge preservation procedures. Following tooth extraction, 30 patients were randomly assigned to the following treatments (Tx) - Tx 1: xenogenic bone substitute (pre-hydrated collagenated cortico-cancellous porcine bone) and free gingival graft; Tx 2: free gingival graft alone; Tx 3: xenogenic bone substitute; Tx 4: no further treatment (control). Impressions were obtained before tooth extraction (baseline) and 4 months after surgery. Cast models were optically scanned, digitally superimposed and horizontal measurements of the contour alterations between time points were performed using digital imaging analysis. All groups displayed contour shrinkage at the buccal aspect ranging from a mean horizontal reduction of -0.8 ± 0.5 mm (Tx 1) to -2.3 ± 1.1 mm (control). Statistically significant differences were found between Tx 1 and Tx 4 as well as Tx 2 and Tx 4. A significant positive influence of the free gingival graft on the maintenance of the ridge width was recorded (p alveolar ridge preservation techniques were not able to entirely compensate for alveolar ridge reduction. Covering the orifice of the extraction socket with a free gingival tissue graft seems to have the potential to limit but not avoid the post-operative external contour shrinkage based on optical scans. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. HES6 enhances the motility of alveolar rhabdomyosarcoma cells

    International Nuclear Information System (INIS)

    Wickramasinghe, Caroline M; Domaschenz, Renae; Amagase, Yoko; Williamson, Daniel; Missiaglia, Edoardo; Shipley, Janet; Murai, Kasumi; Jones, Philip H

    2013-01-01

    Absract: HES6, a member of the hairy-enhancer-of-split family of transcription factors, plays multiple roles in myogenesis. It is a direct target of the myogenic transcription factor MyoD and has been shown to regulate the formation of the myotome in development, myoblast cell cycle exit and the organization of the actin cytoskeleton during terminal differentiation. Here we investigate the expression and function of HES6 in rhabdomyosarcoma, a soft tissue tumor which expresses myogenic genes but fails to differentiate into muscle. We show that HES6 is expressed at high levels in the subset of alveolar rhabdomyosarcomas expressing PAX/FOXO1 fusion genes (ARMSp). Knockdown of HES6 mRNA in the ARMSp cell line RH30 reduces proliferation and cell motility. This phenotype is rescued by expression of mouse Hes6 which is insensitive to HES6 siRNA. Furthermore, expression microarray analysis indicates that the HES6 knockdown is associated with a decrease in the levels of Transgelin, (TAGLN), a regulator of the actin cytoskeleton. Knockdown of TAGLN decreases cell motility, whilst TAGLN overexpression rescues the motility defect resulting from HES6 knockdown. These findings indicate HES6 contributes to the pathogenesis of ARMSp by enhancing both proliferation and cell motility.

  3. Monitoring the Microgravity Environment Quality On-board the International Space Station Using Soft Computing Techniques. Part 2; Preliminary System Performance Results

    Science.gov (United States)

    Jules, Kenol; Lin, Paul P.; Weiss, Daniel S.

    2002-01-01

    and unknown vibratory disturbance sources. Several soft computing techniques such as Kohonen's Self-Organizing Feature Map, Learning Vector Quantization, Back-Propagation Neural Networks, and Fuzzy Logic were used to design the system.

  4. Rare Lung Diseases II: Pulmonary Alveolar Proteinosis

    Directory of Open Access Journals (Sweden)

    Stephen C Juvet

    2008-01-01

    Full Text Available The present article is the second in a series on rare lung diseases. It focuses on pulmonary alveolar proteinosis (PAP, a disorder in which lipoproteinaceous material accumulates in the alveolar space. PAP was first described in 1958, and for many years the nature of the material accumulating in the lungs was unknown. Major insights into PAP have been made in the past decade, and these have led to the notion that PAP is an autoimmume disorder in which autoantibodies interfere with signalling through the granulocyte-macrophage colony-stimulating factor receptor, leading to macrophage and neutrophil dysfunction. This has spurred new therapeutic approaches to this disorder. The discussion of PAP will begin with a case report, then will highlight the classification of PAP and review recent insights into the pathogenesis of PAP. The approach to therapy and the prognosis of PAP will also be discussed.

  5. Silver Nanoparticles in Alveolar Bone Surgery Devices

    Directory of Open Access Journals (Sweden)

    Stefano Sivolella

    2012-01-01

    Full Text Available Silver (Ag ions have well-known antimicrobial properties and have been applied as nanostrategies in many medical and surgical fields, including dentistry. The use of silver nanoparticles (Ag NPs may be an option for reducing bacterial adhesion to dental implant surfaces and preventing biofilm formation, containing the risk of peri-implant infections. Modifying the structure or surface of bone grafts and membranes with Ag NPs may also prevent the risk of contamination and infection that are common when alveolar bone augmentation techniques are used. On the other hand, Ag NPs have revealed some toxic effects on cells in vitro and in vivo in animal studies. In this setting, the aim of the present paper is to summarize the principle behind Ag NP-based devices and their clinical applications in alveolar bone and dental implant surgery.

  6. Alveolar ridge preservation immediately after tooth extraction.

    Science.gov (United States)

    Feller, L; Khammissa, R A G; Bouckaert, M; Lemmer, J

    2013-10-01

    Ridge preservation procedures immediately after tooth extraction, are commonly used with a view to minimising remodelling and shrinkage of the alveolar ridge, associated with socket healing. These procedures may sometimes be effective, but they cannot completely prevent reduction in dimension of the ridge. Certain biomater als used may actually hamper normal deposition of bone within the healing socket, reducing bone trabeculae that can integrate with the implant surface. However, in extraction sockets in alveolar ridges of low bone density, particles of implanted bone substitute incorporated in the healing bone, may enhance the mechanical support for the implant, provided by normal healed bone of low trabecular density alone. This paper reviews biological rationales and procedures for ridge preservation immediately after extraction and comments on their clinical use.

  7. Soft set theory and topology

    Directory of Open Access Journals (Sweden)

    D. N. Georgiou

    2014-04-01

    Full Text Available In this paper we study and discuss the soft set theory giving new definitions, examples, new classes of soft sets, and properties for mappings between different classes of soft sets. Furthermore, we investigate the theory of soft topological spaces and we present new definitions, characterizations, and properties concerning the soft closure, the soft interior, the soft boundary, the soft continuity, the soft open and closed maps, and the soft homeomorphism.

  8. Fuzzy Soft Topological Groups

    Directory of Open Access Journals (Sweden)

    S. Nazmul

    2014-03-01

    Full Text Available Notions of Lowen type fuzzy soft topological space are introduced and some of their properties are established in the present paper. Besides this, a combined structure of a fuzzy soft topological space and a fuzzy soft group, which is termed here as fuzzy soft topological group is introduced. Homomorphic images and preimages are also examined. Finally, some definitions and results on fuzzy soft set are studied.

  9. Modeling Soft Matter

    Science.gov (United States)

    Kremer, Kurt

    Soft matter science or soft materials science is a relatively new term for the science of a huge class of rather different materials such as colloids, polymers (of synthetic or biological origin), membranes, complex molecular assemblies, complex fluids, etc. and combinations thereof. While many of these systems are contained in or are even the essential part of everyday products ("simple" plastics such as yoghurt cups, plastic bags, CDs, many car parts; gels and networks such as rubber, many low fat foods, "gummi" bears; colloidal systems such as milk, mayonnaise, paints, almost all cosmetics or body care products, the border lines between the different applications and systems are of course not sharp) or as biological molecules or assemblies (DNA, proteins, membranes and cytoskeleton, etc.) are central to our existence, others are basic ingredients of current and future high tech products (polymers with specific optical or electronic properties, conducting macromolecules, functional materials). Though the motivation is different in life science rather than in materials science biomolecular simulations, the basic structure of the problems faced in the two fields is very similar.

  10. [Clinical research on repairing alveolar cleft with osteoinduction active material].

    Science.gov (United States)

    She, Xiao-ming; Zhang, Qian; Tian, Kun; Yang, Li; Xiong, Gui-fa

    2010-08-01

    To study the feasibility and authenticity of repairing alveolar defects in alveolar cleft patients with osteoinduction active material (OAM) in clinic. Twenty-seven cases of alveolar defect chosen from clinic were divided into two groups (test group and control group). For test group (12 cases), OAM was transplanted to repair the alveolar cleft. For control group (15 cases), autogenous ilium cancellous bone were transplanted into the defect region to repair alveolar cleft. At 6 months after operation, CT and three-dimensional reconstruction were used to observe alveolar appearance, and the effect and clinical success rate of recover alveolar cleft by using different repair material were compared. In the 27 cases, all the maxillary continuity was restored except two of test group and two of control group. There was no significant difference between test group and control group regarding the clinical success rate of the alveolar cleft repair (P = 1.000). OAM was used to repair the alveolar cleft that can result in new bone formations and the burgeon of canines from the bone grafted areas. There is no significant difference between OAM and autogenous ilium cancellous bone regarding the effect of the alveolar cleft repair.

  11. Dimensional changes in soft tissues around dental implants following free gingival grafting: an experimental study in dogs.

    Science.gov (United States)

    Bengazi, Franco; Lang, Niklaus P; Caroprese, Marino; Urbizo Velez, Joaquin; Favero, Vittorio; Botticelli, Daniele

    2015-02-01

    To study the buccal dimensional tissue changes at oral implants following free gingival grafting, with or without including the keratin layer, performed at the time of implant installation into alveolar mucosa. The mandibular premolars and first molars were extracted bilaterally in six Beagle dogs. In the right side of the mandible (Test), flaps were first elevated, and the buccal as well as part of the lingual masticatory mucosa was removed. An incision of the periosteum at the buccal aspect was performed to allow the flap to be coronally repositioned. Primary wound closure was obtained. In the left side, the masticatory (keratinized) mucosa was left in situ, and no sutures were applied (Control). After 3 months of healing, absence of keratinized mucosa was confirmed at the test sites. Two recipient sites were prepared at each side of the mandible in the region of the third and fourth premolars. All implants were installed with the shoulder placed flush with the buccal alveolar bony crest, and abutments were connected to allow a non-submerged healing. Two free gingival mucosal grafts were harvested from the buccal region of the maxillary canines. One graft was left intact (gingival mucosal graft), while for the second, the epithelial layer was removed (gingival connective tissue graft). Subsequently, the grafts were fixed around the test implants in position of the third and fourth premolars, respectively. After 3 months, the animals were euthanized and ground sections obtained. Similar bony crest resorption and coronal extension of osseointegration were found at test and control sites. Moreover, similar dimensions of the peri-implant soft tissues were obtained at test and control sites. The increase in the alveolar mucosal thickness by means of a gingival graft affected the peri-implant marginal bone resorption and soft tissue recession around implants. This resulted in outcomes that were similar to those at implants surrounded by masticatory mucosa, indicating

  12. Piperine inhibit inflammation, alveolar bone loss and collagen fibers breakdown in a rat periodontitis model.

    Science.gov (United States)

    Dong, Y; Huihui, Z; Li, C

    2015-12-01

    Piperine exhibits anti-inflammatory activity, and has a long history of medicinal use. The objective of this study was to investigate the protective effects of piperine on inflammation, alveolar bone and collagen fibers in experimental periodontitis. We evaluated the related expression of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, matrix metalloproteinase (MMP)-8 and MMP-13 to enhance insight into these effects. Thirty-two Wistar rats were divided into four groups of eight animals each: control group, periodontitis group, periodontitis plus 50 mg/kg piperine group and periodontitis plus 100 mg/kg piperine group. Histopathologic changes were detected by hematoxylin and eosin staining. Alveolar bone loss and trabecula microstructures were evaluated by micro-computed tomography. Changes in collagen fibers were assessed by picrosirius red staining. Western blot analysis was conducted to determine the levels of IL-1β, TNF-α, MMP-8 and MMP-13. Piperine clearly inhibited alveolar bone loss and reformed trabecula microstructures in a dose-dependent manner. Histological staining showed that piperine significantly reduced the infiltration of inflammation in soft tissues. Both doses of piperine limited the fractions of degraded areas in collagen fibers. Piperine (100 mg/kg) significantly downregulated the expressions of IL-1β, MMP-8 and MMP-13 in periodontitis, but not that of TNF-α. Piperine displays significantly protective effects on inflammation, alveolar bone loss, bone microstructures and collagen fiber degradation in experimental periodontitis. The effects may be ascribed to its inhibitory activity on the expressions of IL-1β, MMP-8 and MMP-13. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Alveolar socket preservation with demineralised bovine bone mineral and a collagen matrix.

    Science.gov (United States)

    Maiorana, Carlo; Poli, Pier Paolo; Deflorian, Matteo; Testori, Tiziano; Mandelli, Federico; Nagursky, Heiner; Vinci, Raffaele

    2017-08-01

    The aim of the present study was to evaluate the healing of post-extraction sockets following alveolar ridge preservation clinically, radiologically, and histologically. Overall, 7 extraction sockets in 7 patients were grafted with demineralised bovine bone mineral and covered with a porcine-derived non-crosslinked collagen matrix (CM). Soft tissue healing was clinically evaluated on the basis of a specific healing index. Horizontal and vertical ridge dimensional changes were assessed clinically and radiographically at baseline and 6 months after implant placement. For histological and histomorphometric analysis, bone biopsies were harvested from the augmented sites during implant surgery 6 months after the socket preservation procedure. Clinically, healing proceeded uneventfully in all the sockets. A trend towards reduced horizontal and vertical socket dimensions was observed from baseline to the final examination. The mean width and height of resorption were 1.21 mm ( P =0.005) and 0.46 mm ( P =0.004), respectively. Histologically, residual xenograft particles (31.97%±3.52%) were surrounded by either newly formed bone (16.02%±7.06%) or connective tissue (50.67%±8.42%) without fibrous encapsulation. The CM underwent a physiological substitution process in favour of well-vascularised collagen-rich connective tissue. Socket preservation using demineralised bovine bone mineral in combination with CM provided stable dimensional changes of the alveolar ridge associated with good re-epithelialisation of the soft tissues during a 6-month healing period.

  14. The soft notion of China's 'soft power'

    OpenAIRE

    Breslin, Shaun

    2011-01-01

    · Although debates over Chinese soft power have increased in\\ud recent years, there is no shared definition of what ‘soft power’\\ud actually means. The definition seems to change depending on\\ud what the observer wants to argue.\\ud · External analyses of soft power often include a focus on\\ud economic relations and other material (hard) sources of power\\ud and influence.\\ud · Many Chinese analyses of soft power focus on the promotion of a\\ud preferred (positive) understanding of China’s inter...

  15. 3D computed tomographic evaluation of secondary alveolar bone grafts in cleft lip and palate patients

    International Nuclear Information System (INIS)

    Ohkubo, Fumio; Akai, Hidemi; Hosaka, Yoshiaki

    2001-01-01

    Alveolar bone grafting in patients with cleft lip and palate has becomes a routine part of most treatment regimes. This study was undertaken to estimate how much bone needs to be grafted into the cleft cavity and to evaluate the grafted bone using 3-DCT over a period from the early postoperative stage to after one year. Seventy-five patients divided into four groups according to the type of cleft were studied. All patients underwent secondary alveolar bone grafting using particulate cancellous bone from the anterior iliac crest. The bone graft areas were divided into two regions: the extra-cleft region and the intra-cleft region. The weight and the volume of the grafted bone were correlated and the average density was 1.5 g/ml regardless of the cleft type. The bone in the extra-cleft region could be seen in almost all slices of the CT scans, from the lower alveolar process to the piriform aperture. The extra-cleft graft ratio of unilateral and bilateral cleft lip and palate is higher than that of cleft lip and alveolus. The extra-cleft grafting is necessary to restore facial symmetry. The grafted bone was decreased in both height and volume following three months and adequate bone bridging was maintained for one year. We concluded that 3-DCT findings are one of the most valuable methods to evaluate postoperative conditions after alveolar bone grafting. (author)

  16. 3D computed tomographic evaluation of secondary alveolar bone grafts in cleft lip and palate patients

    Energy Technology Data Exchange (ETDEWEB)

    Ohkubo, Fumio; Akai, Hidemi; Hosaka, Yoshiaki [Showa Univ., Tokyo (Japan). School of Medicine

    2001-04-01

    Alveolar bone grafting in patients with cleft lip and palate has becomes a routine part of most treatment regimes. This study was undertaken to estimate how much bone needs to be grafted into the cleft cavity and to evaluate the grafted bone using 3-DCT over a period from the early postoperative stage to after one year. Seventy-five patients divided into four groups according to the type of cleft were studied. All patients underwent secondary alveolar bone grafting using particulate cancellous bone from the anterior iliac crest. The bone graft areas were divided into two regions: the extra-cleft region and the intra-cleft region. The weight and the volume of the grafted bone were correlated and the average density was 1.5 g/ml regardless of the cleft type. The bone in the extra-cleft region could be seen in almost all slices of the CT scans, from the lower alveolar process to the piriform aperture. The extra-cleft graft ratio of unilateral and bilateral cleft lip and palate is higher than that of cleft lip and alveolus. The extra-cleft grafting is necessary to restore facial symmetry. The grafted bone was decreased in both height and volume following three months and adequate bone bridging was maintained for one year. We concluded that 3-DCT findings are one of the most valuable methods to evaluate postoperative conditions after alveolar bone grafting. (author)

  17. Soft b-compact spaces

    Directory of Open Access Journals (Sweden)

    Alkan Özkan

    2016-04-01

    Full Text Available In this paper, a new class of generalized soft open sets in soft generalized topological spaces as a generalization of compact spaces, called soft b-compact spaces, is introduced and studied. A soft generalized topological space is soft b-compact if every soft b-open soft cover of (F,E contains a finite soft subcover. We characterize soft b-compact space and study some of their basic properties.

  18. Intranasal Fentanyl Intoxication Leading to Diffuse Alveolar Hemorrhage.

    Science.gov (United States)

    Ruzycki, Shannon; Yarema, Mark; Dunham, Michael; Sadrzadeh, Hossein; Tremblay, Alain

    2016-06-01

    Increasing rates of opioid abuse, particularly fentanyl, may lead to more presentations of unusual effects of opioid toxicity. Diffuse alveolar hemorrhage is a rare complication of fentanyl overdose. A 45-year-old male presented in hypoxic respiratory failure secondary to diffuse alveolar hemorrhage requiring intubation. Comprehensive drug screening detected fentanyl without exposure to cocaine. Further history upon the patient's recovery revealed exposure to snorted fentanyl powder immediately prior to presentation. Diffuse alveolar hemorrhage is a potential, though rare, presentation of opioid intoxication. Recognition of less common complications of opioid abuse such as diffuse alveolar hemorrhage is important in proper management of overdoses.

  19. PERFORATION OF INFERIOR ALVEOLAR NERVE BY MAXILLARY ARTERY. LA PERFORACION DEL NERVIO ALVEOLAR INFERIOR POR LA ARTERIA MAXILAR

    OpenAIRE

    Vanishree S Nayak; Ramachandra Bhat K; Prakash Billakanti Babu

    2011-01-01

    Infratemporal fossa is clinically important anatomical area for the delivery of local anesthetic agents in dentistry and maxillofacial surgery. Variations in the anatomy of the inferior alveolar nerve and maxillary artery were studied in infratemporal dissection. During routine dissection of the head in an adult male cadaver an unusual variation in the origin of the inferior alveolar nerve and its relationship with the surrounding structures was observed. The inferior alveolar nerve originate...

  20. Multiscale CT-Based Computational Modeling of Alveolar Gas Exchange during Artificial Lung Ventilation, Cluster (Biot and Periodic (Cheyne-Stokes Breathings and Bronchial Asthma Attack

    Directory of Open Access Journals (Sweden)

    Andrey Golov

    2017-02-01

    Full Text Available An airflow in the first four generations of the tracheobronchial tree was simulated by the 1D model of incompressible fluid flow through the network of the elastic tubes coupled with 0D models of lumped alveolar components, which aggregates parts of the alveolar volume and smaller airways, extended with convective transport model throughout the lung and alveolar components which were combined with the model of oxygen and carbon dioxide transport between the alveolar volume and the averaged blood compartment during pathological respiratory conditions. The novel features of this work are 1D reconstruction of the tracheobronchial tree structure on the basis of 3D segmentation of the computed tomography (CT data; 1D−0D coupling of the models of 1D bronchial tube and 0D alveolar components; and the alveolar gas exchange model. The results of our simulations include mechanical ventilation, breathing patterns of severely ill patients with the cluster (Biot and periodic (Cheyne-Stokes respirations and bronchial asthma attack. The suitability of the proposed mathematical model was validated. Carbon dioxide elimination efficiency was analyzed in all these cases. In the future, these results might be integrated into research and practical studies aimed to design cyberbiological systems for remote real-time monitoring, classification, prediction of breathing patterns and alveolar gas exchange for patients with breathing problems.

  1. Complex fuzzy soft multisets

    Science.gov (United States)

    Alkouri, Abd Ulazeez M.; Salleh, Abdul Razak

    2014-09-01

    In this paper we combine two definitions, namely fuzzy soft multiset and complex fuzzy set to construct the definition of a complex fuzzy soft multiset and study its properties. In other words, we study the extension of a fuzzy soft multiset from real numbers to complex numbers. We also introduce its basic operations, namely complement, union and intersection. Some examples are given.

  2. Nostril Base Augmentation Effect of Alveolar Bone Graft

    Directory of Open Access Journals (Sweden)

    Woojin Lee

    2013-09-01

    Full Text Available Background The aims of alveolar bone grafting are closure of the fistula, stabilization ofthe maxillary arch, support for the roots of the teeth adjacent to the cleft on each side.We observed nostril base augmentation in patients with alveolar clefts after alveolar bonegrafting. The purpose of this study was to evaluate the nostril base augmentation effect ofsecondary alveolar bone grafting in patients with unilateral alveolar cleft.Methods Records of 15 children with alveolar clefts who underwent secondary alveolar bonegrafting with autogenous iliac cancellous bone between March of 2011 and May of 2012 werereviewed. Preoperative and postoperative worm’s-eye view photographs and reconstructedthree-dimensional computed tomography (CT scans were used for photogrammetry. Thedepression of the nostril base and thickness of the philtrum on the cleft side were measuredin comparison to the normal side. The depression of the cleft side pyriform aperture wasmeasured in comparison to the normal side on reconstructed three-dimensional CT.Results Significant changes were seen in the nostril base (P=0.005, the philtrum length(P=0.013, and the angle (P=0.006. The CT measurements showed significant changes in thepyriform aperture (P<0.001 and the angle (P<0.001.Conclusions An alveolar bone graft not only fills the gap in the alveolar process but alsoaugments the nostril base after surgery. In this study, only an alveolar bone graft was performedto prevent bias from other procedures. Nostril base augmentation can be achieved byperforming alveolar bone grafts in children, in whom invasive methods are not advised.

  3. Three-Dimensional Radiological Assessment of Alveolar Bone Volume Preservation Using Bovine Bone Xenograft.

    Science.gov (United States)

    Al Qabbani, Ali; Al Kawas, Sausan; A Razak, Noor Hayati; Al Bayatti, Saad Wahby; Enezei, Hamid Hammad; Samsudin, A Rani; Sheikh Ab Hamid, Suzina

    2018-03-01

    Alveolar bone is critical in supporting natural teeth, dental implants as well as a removable and fixed prosthesis. Alveolar bone volume diminishes when its associated natural tooth is lost. The aim of this study is to evaluate the effectiveness of bovine bone granules on alveolar bone socket augmentation for ridge preservation following atraumatic tooth extraction. Twenty medically fit patients (12 males and 8 females aged between 18 and 40 years) who needed noncomplicated tooth extraction of 1 mandibular premolar tooth were divided randomly and equally into 2 groups. In control group I, the empty extraction socket was left untreated and allowed to heal in a conventional way. In group II, the empty extraction socket wound was filled with lyophilized bovine bone xenograft granules 0.25 to 1 mm of size, 1 mL/vial. A resorbable pericardium membrane was placed to cover the defect. Clinical and 3-dimensional radiological assessments were performed at day 0, 3 months, and 9 months postoperative. There were no clinical differences in general wound healing between the groups. Comparisons within the groups showed a significant difference of bone resorption of 1.49 mm (95% confidence interval, 0.63-2.35) at 3 months, and further resorption of 1.84 mm (P ≤ 0.05) at 9 months in the control group. No significant changes of bone resorption were observed in group II during the same time interval. Comparison between groups showed a significant difference of bone resorption at 3 and 9 months (2.40 and 2.88 mm, respectively). The use of lyophilized demineralized bovine bone granules in socket preservation to fill in the extraction socket seems essential in preserving the alveolar bone dimension as it showed excellent soft and hard tissue healing. This study concludes that the alveolar bone socket exhibited a dynamic process of resorption from the first day of tooth extraction. Evidence shows the possibility of using bovine bone granules routinely in socket volume

  4. Alveolar bone loss in obese subjects.

    Science.gov (United States)

    Alabdulkarim, Maher; Bissada, Nabil; Al-Zahrani, Mohammad; Ficara, Anthony; Siegel, Burton

    2005-04-01

    Obesity was found to be significantly associated with periodontal disease prevalence as measured by probing depth and clinical attachment loss. The aim of this study was to examine if obesity correlates with chronic periodontitis as diagnosed by radiographic alveolar bone loss. Four hundred subjects > or =18 years old were included; 200 with body mass index (BMI) > or =30 kg/m2 (obese) and 200 with BMI periodontitis. Obesity was found to be significantly associated with periodontitis in the uni-variate regression analysis (OR = 2.37, 95% CI, 1.55-3.63). After adjusting for age, gender, smoking, employment, diabetes, marital status, and number of teeth present, obese subjects were found to be 1.86 times more likely to have periodontitis (95% CI, 0.99-3.51) than non-obese ones. When the sample was stratified based on age, the multivariate association was statistically significant among individuals or = 40 years of age the association was statistically insignificant (OR = 1.06, 95% CI, 0.57-1.95). Stratifying the sample based on gender and smoking status revealed a stronger association among females than males (OR = 3.14 vs. 1.95) and among non-smokers than smokers (OR = 3.36 vs. 2.22). Obesity is associated with increased prevalence of periodontitis as measured by radiographic alveolar bone loss, especially among younger individuals. Prevention and management of obesity may be considered to promote better systemic and periodontal health.

  5. Fuzzy Soft Multiset Theory

    Directory of Open Access Journals (Sweden)

    Shawkat Alkhazaleh

    2012-01-01

    Full Text Available In 1999 Molodtsov introduced the concept of soft set theory as a general mathematical tool for dealing with uncertainty. Alkhazaleh et al. in 2011 introduced the definition of a soft multiset as a generalization of Molodtsov's soft set. In this paper we give the definition of fuzzy soft multiset as a combination of soft multiset and fuzzy set and study its properties and operations. We give examples for these concepts. Basic properties of the operations are also given. An application of this theory in decision-making problems is shown.

  6. Prevention of Alveolar Osteitis After Third Molar Surgery ...

    African Journals Online (AJOL)

    2017-05-16

    May 16, 2017 ... development of alveolar osteitis were obtained and analyzed. Comparative statistics were done using ... KEY WORDS: Alveolar osteitis, chlorhexidine, prevention, warm saline. Department of Dental. Surgery .... healing by inducing vasodilatation of the vasculature of oral cavity, and thus enhances migration ...

  7. Increased alveolar soluble Annexin V promotes lung inflammation and fibrosis

    OpenAIRE

    Buckley, S.; Shi, W.; Xu, W.; Frey, M.R.; Moats, R.; Pardo, A.; Selman, M.; Warburton, D.

    2015-01-01

    The causes underlying the self-perpetuating nature of idiopathic pulmonary fibrosis (IPF), a progressive and usually lethal disease, remain unknown. We hypothesized that alveolar soluble Annexin V contributes to lung fibrosis, based on the observation that human IPF BALF containing high Annexin V levels promoted fibroblast involvement in alveolar epithelial wound healing that was reduced when Annexin V was depleted from the BALF.

  8. Alveolar ridge augmentation by osteoinductive materials in goats

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Roervik, M

    1992-01-01

    The purpose of the present study was to determine whether alveolar ridge augmentation could be induced in goats. In 12 male goats allogenic, demineralized, and lyophilized dentin or bone was implanted subperiosteally on the buccal sides of the natural edentulous regions of the alveolar process...

  9. Tongue-Palate Contact of Perceptually Acceptable Alveolar Stops

    Science.gov (United States)

    Lee, Alice; Gibbon, Fiona E.; O'Donovan, Cliona

    2013-01-01

    Increased tongue-palate contact for perceptually acceptable alveolar stops has been observed in children with speech sound disorders (SSD). This is a retrospective study that further investigated this issue by using quantitative measures to compare the target alveolar stops /t/, /d/ and /n/ produced in words by nine children with SSD (20 tokens of…

  10. Classification of alveolar bone destruction patterns on maxillary ...

    African Journals Online (AJOL)

    Objective: The defective diagnosis of alveolar structures is one of most serious handicaps when assessing available periodontal treatment options for the prevention of tooth loss. The aim of this research was to classify alveolar bone defects in the maxillary molar region which is a challenging area for dental implant ...

  11. Alveolar ridge preservation and biologic width management for ...

    African Journals Online (AJOL)

    Alveolar bone atrophy is a chronically progressive, irreversible process which results in bone loss in both the buccal, lingual and apico-coronal region. Without bone preservation measures, bone resorption is experienced and continues for life. Preservation of alveolar ridge is indicated when a tooth-supported fixed partial ...

  12. Diffuse alveolar hemorrhage in a young woman with systemic lupus ...

    African Journals Online (AJOL)

    Diffuse Alveolar Hemorrhage (DAH) is rarely reported complication of Systemic Lupus Erythematosus (SLE). A young woman diagnosed SLE, with a previously normal plain chest radiograph, developed acute onset cough, dyspnoea and hemoptysis. The repeat urgent chest radiograph revealed alveolar opacities. The triad ...

  13. RUSSIAN SOFT POWER: ORIGINS, INSTITUTIONS, EFFECTIVENESS

    Directory of Open Access Journals (Sweden)

    A. A. Sergunin

    2014-10-01

    Full Text Available Purpose: The paper examines conceptual and institutional aspects ofRussia’s soft power strategy over the last decade.Methodology: research is made on the basis of the institutional approach which requires the analysis of both configuration and internal structure of the object. The study of an institution’s behavior and its interaction with the external environment is an integral part of this approach as well.Results: The sources of Moscow's interest in the soft power strategy are explained. Various methods, techniques and institutional mechanisms that are used by Moscow to exercise its soft power in its geopolitical neighborhood are explored. The effectiveness of Russia’s soft power politics is evaluated.Practical implications: the results of this research can be taken into consideration by the Russian governmental agencies responsible for the soft power strategies (e.g. the Rossotrudnichestvo and ‘Russian world’.

  14. Prospective Clinical and Radiographic Study of Alveolar Ridge Preservation Combining Freeze-Dried Bone Allograft With Two Xenogeneic Collagen Matrices.

    Science.gov (United States)

    Parashis, Andreas O; Hawley, Charles E; Stark, Paul C; Ganguly, Rumpa; Hanley, James B; Steffensen, Bjorn

    2016-04-01

    Tooth extractions are followed by significant dimensional changes in the alveolar crest that may preclude implant placement. This randomized, controlled, prospective compares the preservation of soft and hard tissue dimensional changes after alveolar ridge preservation (ARP) using two membranes consisting of collagen matrix (CM) or extracellular matrix (ECM) as barriers over freeze-dried bone allograft (FDBA). Standardized clinical and radiographic measurements of soft and hard tissues were recorded by means of a stent before and 4 months after ARP. The surgery entailed sulcular incisions with minimal flap elevation and repositioning without advancement. Of 11 patients in the CM group and 12 in the ECM group who completed the study, gingival thickness (GT) increased from 0.1 to 0.2 mm for both groups along with a 0.5-mm decrease in the width of keratinized tissue after healing. Reductions in ridge width were most pronounced on the coronal aspect, 1.8 mm for CM and 2.0 mm for ECM, whereas vertical reduction was most pronounced on the buccal aspect, 0.7 to 1.0 mm. Differences between groups were not statistically significant. However, significant correlation for changes in GT (P = 0.001) and crestal bone width (P = 0.002) with preoperative buccal plate thickness (BPT) was observed. Both xenogeneic collagen matrices combined with FDBA were effective in maintaining soft tissues and minimizing ridge resorption in all dimensions after ARP. BPT was an important determinant for amount of change in crestal GT and ridge width.

  15. Deletion of SMARCA4 impairs alveolar epithelial type II cells proliferation and aggravates pulmonary fibrosis in mice

    Directory of Open Access Journals (Sweden)

    Danyi Peng

    2017-12-01

    Full Text Available Alveolar epithelial cells (AECs injury and failed reconstitution of the AECs barrier are both integral to alveolar flooding and subsequent pulmonary fibrosis (PF. Nevertheless, the exact mechanisms regulating the regeneration of AECs post-injury still remain unclear. SMARCA4 is a part of the large ATP-dependent chromatin remodelling complex SWI/SNF, which is essential for kidney and heart fibrosis. We investigates SMARCA4 function in lung fibrosis by establishing PF mice model with bleomycin firstly and found that the expression of SMARCA4 was mainly enhanced in alveolar type II (ATII cells. Moreover, we established an alveolar epithelium-specific SMARCA4-deleted SP-C-rtTA/(tetO7-Cre/SMARCA4f/f mice (SOSM4Δ/Δ model, as well as a new SMARCA4-deleted alveolar type II (ATII-like mle-12 cell line. We found that the bleomycin-induced PF was more aggressive in SOSM4Δ/Δ mice. Also, the proliferation of ATII cells was decreased with the loss of SMARCA4 in vivo and in vitro. In addition, we observed increased proliferation of ATII cells accompanied by abnormally high expression of SMARCA4 in human PF lung sections. These data uncovered the indispensable role of SMARCA4 in the proliferation of ATII cells, which might affect the progression of PF.

  16. Soft hair as a soft wig

    Science.gov (United States)

    Bousso, Raphael; Porrati, Massimo

    2017-10-01

    We consider large gauge transformations of gravity and electromagnetism in D=4 asymptotically flat spacetime. Already at the classical level, we identify a canonical transformation that decouples the soft variables from the hard dynamics. We find that only the soft dynamics is constrained by BMS or large U(1) charge conservation. Physically this corresponds to the fact that sufficiently long-wavelength photons or gravitons that are added to the in-state will simply pass through the interaction region; they scatter trivially in their own sector. This implies in particular that the large gauge symmetries bear no relevance to the black hole information paradox. We also present the quantum version of soft decoupling. As a consistency check, we show that the apparent mixing of soft and hard modes in the original variables arises entirely from the long range field of the hard charges, which is fixed by gauge invariance and so contains no additional information.

  17. PERFORATION OF INFERIOR ALVEOLAR NERVE BY MAXILLARY ARTERY. Perforation of inferior alveolar nerve by maxillary artery

    OpenAIRE

    Prakash B Billakanti

    2016-01-01

    La fosa infratemporal es un área anatómica clínicamente importante para la administración de agentes anestésicos locales en odontología y cirugía maxilofacial. Fueron estudiadas variaciones en la anatomía del nervio alveolar inferior y la arteria maxilar en la disección infratemporal. Durante la disección rutinaria de la cabeza en el cadáver de un varón adulto, fue observada una variación excepcional en el origen del nervio alveolar inferior y su relación con las estructuras circundantes. El ...

  18. Simplified type 3 implant placement, after alveolar ridge preservation: a case study.

    Science.gov (United States)

    Cecchetti, F; Germano, F; Bartuli, F N; Arcuri, L; Spuntarelli, M

    2014-01-01

    Alveolar ridge, after tooth extraction, could reduce its volume up to 50% in buccal-lingual width in the first twelve months and residual dimensions could interfere with correct three dimensional placement of implants and influence negatively treatment outcomes with regard to function and aesthetic aspects. Over the last decades, several approaches have been proposed and tested in order to prevent ridge volumetric contraction and provide maximum bone availability for implant procedure. This article presents a case study with a single anterior tooth replacement, illustrating socket seal technique followed by a type 3 timing implant placement. Immediately after tooth extraction, residual socket was grafted using Deproteinized Bovine Bone Mineral and a free gingival punch harvested from palate. After 3 months, a root-form titanium implant was inserted without additional regenerative procedures. Follow-up examination revealed favourable preservation of soft tissue width and height in the aesthetic area. Socket seal approach maximizes soft tissue healing, preserving ridge envelope and the subsequent implant placement, furthermore, results simplified, as any augmentation techniques are required. Clinical advantages of this method include predictable preservation of the soft tissues, favourable healing features, easy handling of graft materials and a positive benefit-cost ratio.

  19. The effect of therapeutic radiation on canine alveolar ridges augmented with hydroxylapatite

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1992-01-01

    The purpose of this investigation was to evaluate the effect of radiation on hydroxylapatite (HA) implanted subperiosteally for alveolar ridge augmentation in dogs. All bicuspids and molars were extracted from 16 dogs. After 6 weeks, nonporous HA granules were implanted subperiosteally...... on the alveolar ridge. Following 4 months of healing, 12 dogs (experimental group) underwent therapeutic radiation therapy (Co60, 4,000 rad [40 Gy]) to the head and neck region. Four dogs were not irradiated and served as controls. Four animals (three experimental and one control) were killed at 5,6,7, and 8...... reaction. This reaction decreased significantly as time elapsed after implantation. Osteoclastic activity was seen at the junction of HA and periosteum and as part of bone remodeling. Dissolution of the HA granules and the granulomatous inflammatory reaction were not significantly increased by therapeutic...

  20. Hemorragia alveolar associada a nefrite lúpica Alveolar hemorrhage associated with lupus nephritis

    Directory of Open Access Journals (Sweden)

    Ricardo Henrique de Oliveira Braga Teixeira

    2003-12-01

    Full Text Available Hemorragia alveolar, como causa de insuficiência respiratória, é pouco freqüente, com diversas etiologias possíveis. Entre elas, o lúpus eritematoso sistêmico, que se apresenta geralmente como síndrome pulmão-rim, possui alta morbimortalidade. Acredita-se que a patogênese da microangiopatia, tanto renal como pulmonar, esteja associada ao depósito de imunocomplexos, que ativariam as vias de apoptose celular. Relatam-se dois casos de pacientes com nefrite lúpica que evoluíram com hemorragia alveolar associada à insuficiência respiratória necessitando de ventilação mecânica com evoluções totalmente distintas frente às terapias farmacológicas. O achado de anticorpos antimembrana basal em um dos casos evidencia a multiplicidade de mecanismos fisiopatológicos possivelmente envolvidos, que poderiam justificar as respostas heterogêneas frente aos tratamentos disponíveis.Alveolar hemorrhage leading to respiratory failure is uncommon. Various etiologies have been reported, including systemic lupus erythematosus, which generally presents as pulmonary-renal syndrome. It is believed that the pathogenesis of microangiopathy is related to deposits of immune complexes that lead to activation of cellular apoptosis. The authors report two cases of alveolar hemorrhage and respiratory failure, both requiring mechanical ventilation. The two cases had opposite outcomes after pharmacological therapy. The presence of anti-glomerular basement membrane antibodies in one of the cases demonstrates the multiplicity of physiopathological mechanisms that may be involved. This multiplicity of mechanisms provides a possible explanation for the heterogeneous responses to the available treatments.

  1. [Massive alveolar haemorrhage in Wegener's granulomatosis].

    Science.gov (United States)

    Valero-Roldán, J; Nuñez-Castillo, D; Fernández-Fígares, C; López-Leiva, I

    2014-01-01

    Wegener's granulomatosis is a systemic vasculitis with involvement of primary granulomatous upper and lower respiratory tract, glomerulonephritis and vasculitis of small vessels. The lung disease ranges from asymptomatic pulmonary nodules to pulmonary infiltrates and fulminant alveolar haemorrhage. The prognosis is poor due to kidney and respiratory failure, although the data are changing due to new treatments with glucocorticoids and cyclophosphamide. We report a case with severe lung disease, which after appropriate anamnesis, multiple tests, and optimal sequential action, the patient was diagnosed with Wegener's granulomatosis. This disease has a low incidence in the Emergency Department, where the patient history supported by the appropriate additional provides a diagnostic suspicion. It is important that the Emergency Department has the skills to manage the stability in these patients in order to resolve their symptoms. Copyright © 2013 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

  2. Dietary lipids, prostaglandin E2 levels, and tooth movement in alveolar bone of rats.

    Science.gov (United States)

    Kokkinos, P P; Shaye, R; Alam, B S; Alam, S Q

    1993-11-01

    A previous study showed that certain dietary lipids can alter arachidonic acid concentrations in alveolar bone. Because arachidonic acid is a precursor of prostaglandin (PG) E2, which is known to play an important role in orthodontic tooth movement, the purpose of the present study was to determine the effect of dietary lipids on PGE2 levels and tooth movement. Two groups of male Sprague-Dawley rats (20/group) were fed nutritionally adequate purified diets containing 10% corn oil (group I, rich in n-6 fatty acids) or 9% ethyl ester concentrate of n-3 fatty acids + 1% corn oil (group II rich in n-3 fatty acids). After 5 weeks of feeding the diets, orthodontic force of 56 g was applied to the maxillary incisors to tip them distally. Prior to killing the rats at day 4 and 8 of orthodontic force application, tooth movement was measured by computerized image analysis. Premaxillae were dissected out free of soft tissue and incisors. The alveolar bone was frozen in liquid nitrogen, pulverized, and lipids were extracted. The concentrations of arachidonic acid and fatty acid composition of total phospholipids were measured by gas chromatography. PGE2 levels were measured by enzyme immunoassay. Arachidonic acid and PGE2 concentration were significantly lower (P orthodontic tooth movement can be affected by the type of dietary fat.

  3. Soft matter physics

    CERN Document Server

    Doi, Masao

    2013-01-01

    Soft matter (polymers, colloids, surfactants and liquid crystals) are an important class of materials in modern technology. They also form the basis of many future technologies, for example in medical and environmental applications. Soft matter shows complex behaviour between fluids and solids, and used to be a synonym of complex materials. Due to the developments of the past two decades, soft condensed matter can now be discussed on the same sound physical basis as solid condensedmatter. The purpose of this book is to provide an overview of soft matter for undergraduate and graduate students

  4. Integrating soft sensor systems using conductive thread

    Science.gov (United States)

    Teng, Lijun; Jeronimo, Karina; Wei, Tianqi; Nemitz, Markus P.; Lyu, Geng; Stokes, Adam A.

    2018-05-01

    We are part of a growing community of researchers who are developing a new class of soft machines. By using mechanically soft materials (MPa modulus) we can design systems which overcome the bulk-mechanical mismatches between soft biological systems and hard engineered components. To develop fully integrated soft machines—which include power, communications, and control sub-systems—the research community requires methods for interconnecting between soft and hard electronics. Sensors based upon eutectic gallium alloys in microfluidic channels can be used to measure normal and strain forces, but integrating these sensors into systems of heterogeneous Young’s modulus is difficult due the complexity of finding a material which is electrically conductive, mechanically flexible, and stable over prolonged periods of time. Many existing gallium-based liquid alloy sensors are not mechanically or electrically robust, and have poor stability over time. We present the design and fabrication of a high-resolution pressure-sensor soft system that can transduce normal force into a digital output. In this soft system, which is built on a monolithic silicone substrate, a galinstan-based microfluidic pressure sensor is integrated with a flexible printed circuit board. We used conductive thread as the interconnect and found that this method alleviates problems arising due to the mechanical mismatch between conventional metal wires and soft or liquid materials. Conductive thread is low-cost, it is readily wetted by the liquid metal, it produces little bending moment into the microfluidic channel, and it can be connected directly onto the copper bond-pads of the flexible printed circuit board. We built a bridge-system to provide stable readings from the galinstan pressure sensor. This system gives linear measurement results between 500-3500 Pa of applied pressure. We anticipate that integrated systems of this type will find utility in soft-robotic systems as used for wearable

  5. Alveolar Ridge Preservation Using Leukocyte and Platelet-Rich Fibrin: A Report of a Case

    Directory of Open Access Journals (Sweden)

    Mogammad Thabit Peck

    2011-01-01

    Full Text Available In order for a dental implant to be restored optimally, it must be placed in an ideal anatomic position. However, this is not always possible, since physiological wound healing after tooth removal, often results in hard and soft tissue changes which ultimately compromises ideal implant placement. With the aim of minimising the need for tissue augmentation, several alveolar ridge preservation (ARP techniques have been developed. These often require the use of grafting material and therefore increase the risk of disease transmission. Leukocyte and platelet-rich fibrin (L-PRF is a newly developed platelet concentrate that is prepared from the patient's own blood. Clinical research has indicated that it improves wound healing and stimulates bone formation. We present a case where L-PRF was successfully used in an ARP procedure to facilitate implant placement in a compromised extraction socket.

  6. Sheet Bending using Soft Tools

    Science.gov (United States)

    Sinke, J.

    2011-05-01

    Sheet bending is usually performed by air bending and V-die bending processes. Both processes apply rigid tools. These solid tools facilitate the generation of software for the numerical control of those processes. When the lower rigid die is replaced with a soft or rubber tool, the numerical control becomes much more difficult, since the soft tool deforms too. Compared to other bending processes the rubber backed bending process has some distinct advantages, like large radius-to-thickness ratios, applicability to materials with topcoats, well defined radii, and the feasibility of forming details (ridges, beads). These advantages may give the process exclusive benefits over conventional bending processes, not only for industries related to mechanical engineering and sheet metal forming, but also for other disciplines like Architecture and Industrial Design The largest disadvantage is that also the soft (rubber) tool deforms. Although the tool deformation is elastic and recovers after each process cycle, the applied force during bending is related to the deformation of the metal sheet and the deformation of the rubber. The deformation of the rubber interacts with the process but also with sheet parameters. This makes the numerical control of the process much more complicated. This paper presents a model for the bending of sheet materials using a rubber lower die. This model can be implemented in software in order to control the bending process numerically. The model itself is based on numerical and experimental research. In this research a number of variables related to the tooling and the material have been evaluated. The numerical part of the research was used to investigate the influence of the features of the soft lower tool, like the hardness and dimensions, and the influence of the sheet thickness, which also interacts with the soft tool deformation. The experimental research was focused on the relation between the machine control parameters and the most

  7. Proteinase-activated receptor 4 stimulation-induced epithelial-mesenchymal transition in alveolar epithelial cells

    Directory of Open Access Journals (Sweden)

    Araki Hiromasa

    2007-04-01

    Full Text Available Abstract Background Proteinase-activated receptors (PARs; PAR1–4 that can be activated by serine proteinases such as thrombin and neutrophil catepsin G are known to contribute to the pathogenesis of various pulmonary diseases including fibrosis. Among these PARs, especially PAR4, a newly identified subtype, is highly expressed in the lung. Here, we examined whether PAR4 stimulation plays a role in the formation of fibrotic response in the lung, through alveolar epithelial-mesenchymal transition (EMT which contributes to the increase in myofibroblast population. Methods EMT was assessed by measuring the changes in each specific cell markers, E-cadherin for epithelial cell, α-smooth muscle actin (α-SMA for myofibroblast, using primary cultured mouse alveolar epithelial cells and human lung carcinoma-derived alveolar epithelial cell line (A549 cells. Results Stimulation of PAR with thrombin (1 U/ml or a synthetic PAR4 agonist peptide (AYPGKF-NH2, 100 μM for 72 h induced morphological changes from cobblestone-like structure to elongated shape in primary cultured alveolar epithelial cells and A549 cells. In immunocytochemical analyses of these cells, such PAR4 stimulation decreased E-cadherin-like immunoreactivity and increased α-SMA-like immunoreactivity, as observed with a typical EMT-inducer, tumor growth factor-β (TGF-β. Western blot analyses of PAR4-stimulated A549 cells also showed similar changes in expression of these EMT-related marker proteins. Such PAR4-mediated changes were attenuated by inhibitors of epidermal growth factor receptor (EGFR kinase and Src. PAR4-mediated morphological changes in primary cultured alveolar epithelial cells were reduced in the presence of these inhibitors. PAR4 stimulation increased tyrosine phosphorylated EGFR or tyrosine phosphorylated Src level in A549 cells, and the former response being inhibited by Src inhibitor. Conclusion PAR4 stimulation of alveolar epithelial cells induced epithelial

  8. Tri-Layered Nanocomposite Hydrogel Scaffold for the Concurrent Regeneration of Cementum, Periodontal Ligament, and Alveolar Bone.

    Science.gov (United States)

    Sowmya, S; Mony, Ullas; Jayachandran, P; Reshma, S; Kumar, R Arun; Arzate, H; Nair, Shantikumar V; Jayakumar, R

    2017-04-01

    A tri-layered scaffolding approach is adopted for the complete and concurrent regeneration of hard tissues-cementum and alveolar bone-and soft tissue-the periodontal ligament (PDL)-at a periodontal defect site. The porous tri-layered nanocomposite hydrogel scaffold is composed of chitin-poly(lactic-co-glycolic acid) (PLGA)/nanobioactive glass ceramic (nBGC)/cementum protein 1 as the cementum layer, chitin-PLGA/fibroblast growth factor 2 as the PDL layer, and chitin-PLGA/nBGC/platelet-rich plasma derived growth factors as the alveolar bone layer. The tri-layered nanocomposite hydrogel scaffold is cytocompatible and favored cementogenic, fibrogenic, and osteogenic differentiation of human dental follicle stem cells. In vivo, tri-layered nanocomposite hydrogel scaffold with/without growth factors is implanted into rabbit maxillary periodontal defects and compared with the controls at 1 and 3 months postoperatively. The tri-layered nanocomposite hydrogel scaffold with growth factors demonstrates complete defect closure and healing with new cancellous-like tissue formation on microcomputed tomography analysis. Histological and immunohistochemical analyses further confirm the formation of new cementum, fibrous PDL, and alveolar bone with well-defined bony trabeculae in comparison to the other three groups. In conclusion, the tri-layered nanocomposite hydrogel scaffold with growth factors can serve as an alternative regenerative approach to achieve simultaneous and complete periodontal regeneration. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Differential expression of Snail1 transcription factor and Snail1-related genes in alveolar and embryonal rhabdomyosarcoma subtypes

    Directory of Open Access Journals (Sweden)

    Miroslawa Püsküllüoglu

    2010-04-01

    Full Text Available Rhabdomyosarcoma (RMS represents the most common sarcoma of soft tissue among children. Two main RMSsubtypes are alveolar (ARMS and embryonal (ERMS. The major goal of this study was to find differentially expressedgenes between RMS subtypes that could explain higher metastatic potential in ARMS and would be useful for the differentialdiagnosis. Using RQ-PCR analysis we compared expression of Snail1 and Snail-related genes among 7 ARMS and 8ERMS patients' samples obtained from the primary tumors and among 2 alveolar and 2 embryonal cell lines. Our resultsshow that Snail1 is highly expressed both in ARMS patients' samples and the alveolar cell lines. We also found that theexpression of E-Cadherin was downregulated and the expression of Matrix Metalloproteinases 2 and 9 (MMP-2 and MMP-9 was upregulated in ARMS. We assume that, as in many tumors, also in RMS Snail1 acts as a regulator for pathwaysknown for their role in cells' metastasis and that Snail1 activity results in increased MMPs and decreased E-Cadherin expression.Our findings may explain higher ARMS aggressiveness. Moreover, we suggest that further studies should be performedto verify if Snail1 can be considered as a potential target for ARMS therapy.

  10. New Concepts and Applications in Soft Computing

    CERN Document Server

    Fodor, János; Várkonyi-Kóczy, Annamária

    2013-01-01

                  The book provides a sample of research on the innovative theory and applications of soft computing paradigms.             The idea of Soft Computing was initiated in 1981 when Professor Zadeh published his first paper on soft data analysis and constantly evolved ever since. Professor Zadeh defined Soft Computing as the fusion of the fields of fuzzy logic (FL), neural network theory (NN) and probabilistic reasoning (PR), with the latter subsuming belief networks, evolutionary computing including DNA computing, chaos theory and parts of learning theory into one multidisciplinary system. As Zadeh said the essence of soft computing is that unlike the traditional, hard computing, soft computing is aimed at an accommodation with the pervasive imprecision of the real world. Thus, the guiding principle of soft computing is to exploit the tolerance for imprecision, uncertainty and partial truth to achieve tractability, robustness, low solution cost and better rapport with reality. ...

  11. Time matters in soft proofing

    Directory of Open Access Journals (Sweden)

    Jon Y. Hardeberg

    2007-11-01

    Full Text Available One of latest developments for pre-press applications is the concept of soft proofing, which aims to provide an accurate preview on a monitor of how the final document will appear once it is printed. At the core of this concept is the problem of identifying, for any printed color, the most similar color the monitor can display. This problem is made difficult by such factors as varying viewing conditions, color gamut limitations, or the less studied color memory shift.Color matching experiments are usually done by examining samples viewed simultaneously. However, in soft proofing applications, the proof and the print are not always viewed together. This paper attempts to shed more light on the difference between simultaneous and time-spaced color matching, in order to contribute to improving the accuracy of soft proofs. A color matchingexperiment setup has been established in which observers were asked to match a color patch displayed on a LCD monitor, by adjusting its RGB values, to another color patch printed out on paper. In the first part of the experiment the two colors were viewed simultaneously. In the second part, the observers were asked to produce the match according to a previously memorized color. According to the obtained results, the color appearance attributes lightness and chroma were the most difficult components for the observers to remember, generating huge differences with the simultaneous match, whereas hue was the component which varied the least. This indicates that for soft proofing, getting the hues right is of primordial importance.

  12. Alveolar process preservation at implants installed immediately into extraction sockets using deproteinized bovine bone mineral - an experimental study in dogs.

    Science.gov (United States)

    Caneva, Marco; Botticelli, Daniele; Morelli, Fabrizio; Cesaretti, Gianfranco; Beolchini, Marco; Lang, Niklaus P

    2012-07-01

    To evaluate the soft tissue and the dimensional changes of the alveolar bony crest at sites where deproteinized bovine bone mineral (DBBM) particles, concomitantly with the placement of a collagen membrane, were used at implants installed into sockets immediately after tooth extraction. The pulp tissue of the mesial roots of (3) P(3) was removed in six Labrador dogs, and the root canals were filled. Flaps were elevated bilaterally, the premolars hemi-sectioned, and the distal roots removed. Recipient sites were prepared in the distal alveolus, and implants were placed. At the test sites, DBBM particles were placed in the residual marginal defects concomitantly with the placement of a collagen membrane. No treatment augmentation was performed at the control sites. A non-submerged healing was allowed. Impressions were obtained at baseline and at the time of sacrifice performed 4 months after surgery. The cast models obtained were analyzed using an optical system to evaluate dimensional variations. Block sections of the implant sites were obtained for histological processing and soft tissue assessments. After 4 months of healing, no differences in soft tissue dimensions were found between the test and control sites based on the histological assessments. The location of the soft tissue at the buccal aspect was, however, more coronal at the test compared with the control sites (1.8 ± 0.8 and 0.9 ± 0.8 mm, respectively). At the three-dimensional evaluation, the margin of the soft tissues at the buccal aspect appeared to be located more apically and lingually. The vertical dislocation was 1 ± 0.6 and 2.7 ± 0.5 mm at the test and control sites, respectively. The area of the buccal shrinkage of the alveolar crest was significantly smaller at the test sites (5.9 ± 2.4 mm(2) ) compared with the control sites (11.5 ± 1.7 mm(2) ). The use of DBBM particles concomitantly with the application of a collagen membrane used at implants placed into sockets immediately after

  13. Evaluating six soft approaches

    DEFF Research Database (Denmark)

    Sørensen, Lene; Vidal, Rene Victor Valqui

    2006-01-01

    ’s interactive planning principles to be supported by soft approaches in carrying out the principles in action. These six soft approaches are suitable for supporting various steps of the strategy development and planning process. These are the SWOT analysis, the Future Workshop, the Scenario methodology...

  14. learning and soft skills

    DEFF Research Database (Denmark)

    Rasmussen, Lauge Baungaard

    2000-01-01

    Learning of soft skills are becoming more and more necessary due to the complexe development of modern companies and their environments. However, there seems to be a 'gap' between intentions and reality regarding need of soft skills and the possiblities to be educated in this subject in particular...... at some of the Technical Universities....

  15. Evaluating six soft approaches

    DEFF Research Database (Denmark)

    Sørensen, Lene Tolstrup; Vidal, Rene Victor Valqui

    2008-01-01

    's interactive planning principles to be supported by soft approaches in carrying out the principles in action. These six soft approaches are suitable forsupporting various steps of the strategy development and planning process. These are the SWOT analysis, the Future Workshop, the Scenario methodology...

  16. Evaluating Six Soft Approaches

    DEFF Research Database (Denmark)

    Sørensen, Lene Tolstrup; Valqui Vidal, René Victor

    2008-01-01

    's interactive planning principles to be supported by soft approaches in carrying out the principles in action. These six soft approaches are suitable forsupporting various steps of the strategy development and planning process. These are the SWOT analysis, the Future Workshop, the Scenario methodology...

  17. Soft Tissue Sarcoma

    Science.gov (United States)

    ... removed Causes In most cases, it's not clear what causes soft tissue sarcoma. In general, cancer occurs when cells develop ... of cell that develops the genetic mutation determines what type of soft tissue sarcoma you have. For example, angiosarcoma begins in ...

  18. Alveolar-derived exhaled nitric oxide is reduced in obstructive sleep apnea syndrome.

    Science.gov (United States)

    Foresi, Antonio; Leone, Clementina; Olivieri, Dario; Cremona, George

    2007-09-01

    Obstructive sleep apnea syndrome (OSAS) is associated with cardiovascular diseases, in particular systemic arterial hypertension. We postulated that intermittent nocturnal hypoxia in OSAS may be associated to decreased fractional exhaled nitric oxide (FENO) levels from distal airspaces. Multiple flow rate measurements have been used to fractionate nitric oxide (NO) from alveolar and bronchial sources in 34 patients with OSAS, in 29 healthy control subjects, and in 8 hypertensive non-OSAS patients. The effect of 2 days of treatment with nasal continuous positive airway pressure (nCPAP) on FENO was examined in 18 patients with severe OSAS. We found that the mean [+/- SE] concentrations of exhaled NO at a rate of 50 mL/s was 21.8 +/- 1.9 parts per billion (ppb) in patients with OSAS, 25.1 +/- 3.3 ppb in healthy control subjects, and 15.4 +/- 1.7 ppb in hypertensive control patients. The mean fractional alveolar NO concentration (CANO) in OSAS patients was significantly lower than that in control subjects (2.96 +/- 0.48 vs 5.35 +/- 0.83 ppb, respectively; p bronchial FENO, is impaired in patients with OSAS and that this impairment is associated with an increased risk of hypertension. NO production within the alveolar space is modified by treatment with nCPAP.

  19. Alveolar cleft closure with iliac bone graft: A case report.

    Directory of Open Access Journals (Sweden)

    Tichvy Tammama

    2017-04-01

    Conclusion: The timing of alveolar bone grafting usually associated with the state of the developing of dentition. Post operative management is important to get a good result, and to prevent any complications.

  20. Soft buckling actuators

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Dian; Whitesides, George M.

    2017-12-26

    A soft actuator is described, including: a rotation center having a center of mass; a plurality of bucklable, elastic structural components each comprising a wall defining an axis along its longest dimension, the wall connected to the rotation center in a way that the axis is offset from the center of mass in a predetermined direction; and a plurality of cells each disposed between two adjacent bucklable, elastic structural components and configured for connection with a fluid inflation or deflation source; wherein upon the deflation of the cell, the bucklable, elastic structural components are configured to buckle in the predetermined direction. A soft actuating device including a plurality of the soft actuators and methods of actuation using the soft actuator or soft actuating device disclosed herein are also described.

  1. The Relationships of the Maxillary Sinus With the Superior Alveolar Nerves and Vessels as Demonstrated by Cone-Beam CT Combined With μ-CT and Histological Analyses.

    Science.gov (United States)

    Kasahara, Norio; Morita, Wataru; Tanaka, Ray; Hayashi, Takafumi; Kenmotsu, Shinichi; Ohshima, Hayato

    2016-05-01

    There are no available detailed data on the three-dimensional courses of the human superior alveolar nerves and vessels. This study aimed to clarify the relationships of the maxillary sinus with the superior alveolar nerves and vessels using cone-beam computed tomography (CT) combined with μ-CT and histological analyses. Digital imaging and communication in medicine data obtained from the scanned heads/maxillae of cadavers used for undergraduate/postgraduate dissection practice and skulls using cone-beam CT were reconstructed into three-dimensional (3D) images using software. The 3D images were compared with μ-CT images and histological sections. Cone-beam CT clarified the relationships of the maxillary sinus with the superior alveolar canals/grooves. The main anterior superior alveolar canal/groove ran anteriorly through the upper part of the sinus and terminated at the bottom of the nasal cavity near the piriform aperture. The main middle alveolar canal ran downward from the upper part of the sinus to ultimately join the anterior one. The main posterior alveolar canal ran through the lateral lower part of the sinus and communicated with the anterior one. Histological analyses demonstrated the existence of nerves and vessels in these canals/grooves, and the quantities of these structures varied across each canal/groove. Furthermore, the superior dental nerve plexus exhibited a network that was located horizontally to the occlusal plane, although these nerve plexuses appeared to be the vertical network that is described in most textbooks. In conclusion, cone-beam CT is suggested to be a useful method for clarifying the superior alveolar canals/grooves including the nerves and vessels. © 2016 Wiley Periodicals, Inc.

  2. Alveolar lymphangioma in infants: report of two cases.

    LENUS (Irish Health Repository)

    FitzGerald, Kirsten

    2012-02-01

    The alveolar lymphangioma is a benign but relatively rare condition found only in the oral cavities of black infants. Dentists practising in Ireland may be unaware of this condition due to its racial specificity. This paper presents two case reports of multiple alveolar lymphangiomas found in black infants in a children\\'s hospital in Ireland. The epidemiology, aetiology, clinical presentation, histology, and management options are discussed. The photographs should aid the practitioner in recognising these lesions.

  3. Dynamic thermal performance of alveolar brick construction system

    International Nuclear Information System (INIS)

    Gracia, A. de; Castell, A.; Medrano, M.; Cabeza, L.F.

    2011-01-01

    Highlights: → Even though U-value does not measure thermal inertia, it is the commonly used parameter. → The thermal performance analysis of buildings must include the evaluation of transient parameters. → Transient parameters of alveolar brick constructive system show good agreement with its low energy consumption. -- Abstract: Alveolar bricks are being introduced in building sector due to the simplicity of their construction system and to the elimination of the insulation material. Nevertheless, it is not clear if this new system is energetically efficient and which is its thermal behaviour. This paper presents an experimental and theoretical study to evaluate the thermal behaviour of the alveolar brick construction system, compared with a traditional Mediterranean brick system with insulation. The experimental study consists of measuring the thermal performance of four real house-like cubicles. The thermal transmittance in steady-state, also known as U-value, is calculated theoretically and experimentally for each cubicle, presenting the insulated cubicles as the best construction system, with differences around 45% in comparison to the alveolar one. On the other hand, experimental results show significantly smaller differences on the energy consumption between the alveolar and insulated construction systems during summer period (around 13% higher for the alveolar cubicle). These values demonstrate the high thermal efficiency of the alveolar system. In addition, the lack of agreement between the measured energy consumption and the calculated U-values, guides the authors to analyze the thermal inertia of the different building components. Therefore, several transient parameters, extracted from the heat transfer matrix and from experimental data, are also evaluated. It can be concluded that the alveolar brick construction system presents higher thermal inertia than the insulated one, justifying the low measured energy consumption.

  4. Alveolar ridge augmentation by osteoinductive materials in goats

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Roervik, M

    1992-01-01

    The purpose of the present study was to determine whether alveolar ridge augmentation could be induced in goats. In 12 male goats allogenic, demineralized, and lyophilized dentin or bone was implanted subperiosteally on the buccal sides of the natural edentulous regions of the alveolar process of...... of the mandible. Light microscopic evaluation revealed fibrous encapsulation, a few multinuclear giant cells, little inflammatory reaction, and no osteoinduction. It was concluded that no osteoinduction took place in goats....

  5. Postextraction Alveolar Ridge Preservation: Biological Basis and Treatments

    OpenAIRE

    Pagni, Giorgio; Pellegrini, Gaia; Giannobile, William V.; Rasperini, Giulio

    2012-01-01

    Following tooth extraction, the alveolar ridge undergoes an inevitable remodeling process that influences implant therapy of the edentulous area. Socket grafting is a commonly adopted therapy for the preservation of alveolar bone structures in combination or not with immediate implant placement although the biological bases lying behind this treatment modality are not fully understood and often misinterpreted. This review is intended to clarify the literature support to socket grafting in ord...

  6. Alveolar lymphangioma in infants: report of two cases.

    LENUS (Irish Health Repository)

    FitzGerald, Kirsten

    2009-06-01

    The alveolar lymphangioma is a benign but relatively rare condition found only in the oral cavities of black infants. Dentists practising in Ireland may be unaware of this condition due to its racial specificity. This paper presents two case reports of multiple alveolar lymphangiomas found in black infants in a children\\'s hospital in Ireland. The epidemiology, aetiology, clinical presentation, histology, and management options are discussed. The photographs should aid the practitioner in recognising these lesions.

  7. Fuzzy soft connected sets in fuzzy soft topological spaces II

    Directory of Open Access Journals (Sweden)

    A. Kandil

    2017-04-01

    Full Text Available In this paper, we introduce some different types of fuzzy soft connected components related to the different types of fuzzy soft connectedness and based on an equivalence relation defined on the set of fuzzy soft points of X. We have investigated some very interesting properties for fuzzy soft connected components. We show that the fuzzy soft C5-connected component may be not exists and if it exists, it may not be fuzzy soft closed set. Also, we introduced some very interesting properties for fuzzy soft connected components in discrete fuzzy soft topological spaces which is a departure from the general topology.

  8. Nonlinear Properties of Soft Glass Waveguides

    DEFF Research Database (Denmark)

    Steffensen, Henrik

    -infrared applications and the THz applications. In the mid-infrared, it is investigated whether soft glasses are a suitable candidate for supercontinuum generation (SCG). A few commercially available fluoride fibers are tested for their zero dispersion wavelength (ZDW), a key property when determining the possibility......This thesis builds around the investigation into using soft glass materials for midinfrared and THz applications. Soft glasses is a term that cov ers a wide range of chemical compositions where many are yet to be fully investigated. The work in this thesis is separated in two parts, the mid...... of SCG in a fiber. A group of soft glasses, namely the chalcogenides, are known to display two photon absorption (TPA) which could potentially limit the SCG when this is initiated within the frequency range where this nonlinear process occur. An analytic model is presented to estimate the soliton self...

  9. [Fatal alveolar haemorrhage following a "bang" of cannabis].

    Science.gov (United States)

    Grassin, F; André, M; Rallec, B; Combes, E; Vinsonneau, U; Paleiron, N

    2011-09-01

    The new methods of cannabis consumption (home made water pipe or "bang") may be responsible for fatal respiratory complications. We present a case, with fatal outcome, of a man of 19 years with no previous history other than an addiction to cannabis using "bang". He was admitted to intensive care with acute dyspnoea. A CT scan showed bilateral, diffuse alveolar shadowing. He was anaemic with an Hb of 9.3g/l. Bronchoalveolar lavage revealed massive alveolar haemorrhage. Investigations for infection and immunological disorder were negative and toxicology was negative except for cannabis. Antibiotic treatment was given and favourable progress allowed early discharge. Death occurred 15 days later due to alveolar haemorrhage following a further "bang" of cannabis. Autopsy showed toxic alveolar haemorrhage. The probable mechanism is pulmonary damage due to acid anhydrides released by the incomplete combustion of cannabis in contact with plastic. These acids have a double effect on the lungs: a direct toxicity with severe inflammation of the mucosa leading to alveolar haemorrhage and subsequently the acid anhydrides may lead to the syndrome of intra-alveolar haemorrhage and anaemia described in occupational lung diseases by Herbert in Oxford in 1979. It manifests itself by haemoptysis and intravascular haemolysis. We draw attention to the extremely serious potential consequences of new methods of using cannabis, particularly the use of "bang" in homemade plastic materials. Copyright © 2011 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  10. Inferior alveolar canal course: a radiographic study.

    Science.gov (United States)

    Liu, Tie; Xia, Bing; Gu, Zhiyuan

    2009-11-01

    To describe the morphology and course of the inferior alveolar canal (IAC) as it appears in digital panoramic radiographs. Three hundred and eighty-six digital rotational panoramic radiographs (OPG) were studied using the Clinview Software (6.1.3.7 version, Instrumentarium). Among the 386 radiographs, 86 radiographs with 5-mm steel balls were used to calculate the magnification. The average magnification of radiographs in this study was 7.24+/-7.55%. The course of IAC as seen in the panoramic radiograph may be classified into four types: (1) linear curve, 12.75%, (2) spoon-shaped curve, 29.25%, (3) elliptic-arc curve, 48.5%, and (4) turning curve, 9.5%. On panoramic radiographs, the IAC appeared closest to the inferior border of the mandible in the region of the first molar. In relation to the teeth, on panoramic radiographs, the IAC appeared closest to the distal root tip of the third molar and furthest from the mesial root tip of the first molar. In the OPG, there are four types of IAC: linear, spoon shape, elliptic-arc, and turning curve. The data found in the study may be useful for dental implant, mandibule surgery, and dental anesthesia. The limitations of the panoramic radiograph in depicting the true three-dimensional (3D) morphology of the IAC are recognized, computed tomography (CT) and cone beam (CB)3D imaging being more precise.

  11. Populations at Risk for Alveolar Echinococcosis, France

    Science.gov (United States)

    Piarroux, Martine; Piarroux, Renaud; Knapp, Jenny; Bardonnet, Karine; Dumortier, Jérôme; Watelet, Jérôme; Gerard, Alain; Beytout, Jean; Abergel, Armand; Bresson-Hadni, Solange

    2013-01-01

    During 1982–2007, alveolar echinococcosis (AE) was diagnosed in 407 patients in France, a country previously known to register half of all European patients. To better define high-risk groups in France, we conducted a national registry-based study to identify areas where persons were at risk and spatial clusters of cases. We interviewed 180 AE patients about their way of life and compared responses to those of 517 controls. We found that almost all AE patients lived in 22 départements in eastern and central France (relative risk 78.63, 95% CI 52.84–117.02). Classification and regression tree analysis showed that the main risk factor was living in AE-endemic areas. There, most at-risk populations lived in rural settings (odds ratio [OR] 66.67, 95% CI 6.21–464.51 for farmers and OR 6.98, 95% CI 2.88–18.25 for other persons) or gardened in nonrural settings (OR 4.30, 95% CI 1.82–10.91). These findings can help sensitization campaigns focus on specific groups. PMID:23647623

  12. Computed tomography of the alveolar bone

    International Nuclear Information System (INIS)

    Schueller, H.

    1996-01-01

    In addition to the conventional radiological methods used in odontology, computed tomography (CT) provides superposition-free images of the mandible and maxilla. Its value has been proved not only in cases of malignancy but also in many other problems. If an examination is performed with a slice thickness of less than 1.5 mm, the form and position of retained teeth in the alveolar bone, as well as subsequent lesions of neighboring permanent teeth, can be visualized so that early treatment can be planned. If the parodontal space of a retained tooth is visible, orthodontic intervention is possible. Precise assessment of horizontal or vertical bone loss is essential in inflammatory dental diseases. The morphology and extent of benign cystic lesions are also shown by CT. With CT surgical strategy of an intended implant therapy can take into account the remaining bone substance and the exact position of nerves and foramina. If such therapy is possible, the location, form and number of implants are easily defined. (orig.) [de

  13. Regeneración ósea guiada para el aumento vertical del reborde alveolar Guided osseous regeneration for the vertical augmentation of the alveolar ridge

    Directory of Open Access Journals (Sweden)

    CE Nappe

    2013-04-01

    Full Text Available Se considera como aumento óseo vertical, cualquier técnica que apunte a crear una mayor altura del reborde alveolar. A inicios de la década de los 90’s se empezó a utilizar la regeneración ósea guiada (ROG en mandíbulas atróficas, con el fin de permitir la instalación de implantes óseointegrados. Con el fin de evaluar y exponer parte de la evidencia disponible en la actualidad, con respecto a la ROG para aumento óseo vertical, se realizó la siguiente revisión bibliográfica.Any technique aimed to improve the alveolar ridge height is considered as a vertical bone augmentation procedure. In the early 90’s guided bone regeneration (GBR procedures began to be used in atrophic mandibles to allow the installation of osseointegrated dental implants. The following bibliographic review was made with the purpose of evaluating and exposing part of the available evidence at present in this field.

  14. Bipolar soft connected, bipolar soft disconnected and bipolar soft compact spaces

    Directory of Open Access Journals (Sweden)

    Muhammad Shabir

    2017-06-01

    Full Text Available Bipolar soft topological spaces are mathematical expressions to estimate interpretation of data frameworks. Bipolar soft theory considers the core features of data granules. Bipolarity is important to distinguish between positive information which is guaranteed to be possible and negative information which is forbidden or surely false. Connectedness and compactness are the most important fundamental topological properties. These properties highlight the main features of topological spaces and distinguish one topology from another. Taking this into account, we explore the bipolar soft connectedness, bipolar soft disconnectedness and bipolar soft compactness properties for bipolar soft topological spaces. Moreover, we introduce the notion of bipolar soft disjoint sets, bipolar soft separation, and bipolar soft hereditary property and study on bipolar soft connected and disconnected spaces. By giving the detailed picture of bipolar soft connected and disconnected spaces we investigate bipolar soft compact spaces and derive some results related to this concept.

  15. Distracción osteogénica. Una alternativa para la reconstrucción de rebordes alveolares en sector mandibular. Meta-análisis

    Directory of Open Access Journals (Sweden)

    Iván Manotas

    2013-10-01

    Full Text Available Title: Distraction osteogenic. An alternative for reconstruction in sector mandibular alveolar ridge. Meta-analysis.ResumenLa distracción osteogénica es una técnica quirúrgica utilizada para la reconstrucción de reborde alveolar, para incrementar cantidades de hueso y tejidos blandos como consecuencia del desplazamiento gradual de fracturas óseas quirúrgicamente realizadas. Como las técnicas de distracción generan hueso nuevo y evitan por tanto la morbilidad del traslado de injertos, se trata de un procedimiento que presenta muchas ventajas en comparación con los otros tipos de tratamientos realizados en esta clase de deformidades óseas. Mediante este artículo de revisión de literatura queremos demostrar que es el tratamiento ideal cuando se trata de reducir la deformidad ósea. (DUAZARY 20112 No. 1, 49 - 59AbstractDistraction osteogenesis is a surgical technique which is used for the reconstruction of the alveolar ridge, to increase amounts of bone and soft tissue due to the gradual displacement of bone fractures surgically performed. Because distraction techniques generate new bone avoids the morbidity of moving grafts, this technique has many advantages over other types of treatment carried out in such bone deformities, which by this article were view literature demonstrate that the treatment issue when it comes to reducing bone deformity.Keywords: Osteogénesis distraction; alveolar ridge augmentation; bone lengthening.

  16. Application of Coenzyme Q10 for Accelerating Soft Tissue Wound Healing after Tooth Extraction in Rats

    Directory of Open Access Journals (Sweden)

    Toshiki Yoneda

    2014-12-01

    Full Text Available Accelerating wound healing after tooth extraction is beneficial in dental treatment. Application of antioxidants, such as reduced coenzyme Q10 (rCoQ10, may promote wound healing after tooth extraction. In this study, we examined the effects of topical application of rCoQ10 on wound healing after tooth extraction in rats. After maxillary first molars were extracted, male Fischer 344 rats (8 weeks old (n = 27 received topical application of ointment containing 5% rCoQ10 (experimental group or control ointment (control group to the sockets for 3 or 8 days (n = 6–7/group. At 3 days after extraction, the experimental group showed higher collagen density and lower numbers of polymorphonuclear leukocytes in the upper part of socket, as compared to the control group (p < 0.05. Gene expression of interleukin-1β, tumor necrosis factor-α and nuclear factor-κB were also lower in the experimental group than in the control group (p < 0.05. At 8 days after tooth extraction, there were no significant differences in collagen density, number of polymorphonuclear leukocytes and bone fill between the groups. Our results suggest that topical application of rCoQ10 promotes wound healing in the soft tissue of the alveolar socket, but that rCoQ10 has a limited effect on bone remodeling in rats.

  17. Modeling Alveolar Epithelial Cell Behavior In Spatially Designed Hydrogel Microenvironments

    Science.gov (United States)

    Lewis, Katherine Jean Reeder

    The alveolar epithelium consists of two cell phenotypes, elongated alveolar type I cells (AT1) and rounded alveolar type II cells (ATII), and exists in a complex three-dimensional environment as a polarized cell layer attached to a thin basement membrane and enclosing a roughly spherical lumen. Closely surrounding the alveolar cysts are capillary endothelial cells as well as interstitial pulmonary fibroblasts. Many factors are thought to influence alveolar epithelial cell differentiation during lung development and wound repair, including physical and biochemical signals from the extracellular matrix (ECM), and paracrine signals from the surrounding mesenchyme. In particular, disrupted signaling between the alveolar epithelium and local fibroblasts has been implicated in the progression of several pulmonary diseases. However, given the complexity of alveolar tissue architecture and the multitude of signaling pathways involved, designing appropriate experimental platforms for this biological system has been difficult. In order to isolate key factors regulating cellular behavior, the researcher ideally should have control over biophysical properties of the ECM, as well as the ability to organize multiple cell types within the scaffold. This thesis aimed to develop a 3D synthetic hydrogel platform to control alveolar epithelial cyst formation, which could then be used to explore how extracellular cues influence cell behavior in a tissue-relevant cellular arrangement. To accomplish this, a poly(ethylene glycol) (PEG) hydrogel network containing enzymatically-degradable crosslinks and bioadhesive pendant peptides was employed as a base material for encapsulating primary alveolar epithelial cells. First, an array of microwells of various cross-sectional shapes was photopatterned into a PEG gel containing photo-labile crosslinks, and primary ATII cells were seeded into the wells to examine the role of geometric confinement on differentiation and multicellular arrangement

  18. Soft Robotics: from scientific challenges to technological applications

    Science.gov (United States)

    Laschi, C.

    2016-05-01

    Soft robotics is a recent and rapidly growing field of research, which aims at unveiling the principles for building robots that include soft materials and compliance in the interaction with the environment, so as to exploit so-called embodied intelligence and negotiate natural environment more effectively. Using soft materials for building robots poses new technological challenges: the technologies for actuating soft materials, for embedding sensors into soft robot parts, for controlling soft robots are among the main ones. This is stimulating research in many disciplines and many countries, such that a wide community is gathering around initiatives like the IEEE TAS TC on Soft Robotics and the RoboSoft CA - A Coordination Action for Soft Robotics, funded by the European Commission. Though still in its early stages of development, soft robotics is finding its way in a variety of applications, where safe contact is a main issue, in the biomedical field, as well as in exploration tasks and in the manufacturing industry. And though the development of the enabling technologies is still a priority, a fruitful loop is growing between basic research and application-oriented research in soft robotics.

  19. Proteinose alveolar pulmonar: série de quatro casos Pulmonary alveolar proteinosis: four cases

    Directory of Open Access Journals (Sweden)

    João Carlos Thompson

    2006-06-01

    Full Text Available OBJETIVO: Apresentar a evolução de quatro casos de proteinose alveolar pulmonar atendidos na Faculdade de Medicina da Universidade Estadual de Londrina, enfocando a importância da lavagem pulmonar total como tratamento de escolha. MÉTODOS: Trata-se de um estudo retrospectivo de quatro pacientes, sendo três do gênero feminino, com idades de 22 a 34 anos, e histórias semelhantes de dispnéia progressiva e tosse seca. O diagnóstico final foi realizado por biópsia pulmonar a céu aberto. A lavagem pulmonar total foi realizada em três pacientes em centro cirúrgico, com anestesia geral e sonda de duplo lúme. RESULTADOS: Um paciente apresentou regressão espontânea da proteinose alveolar pulmonar, não sendo necessária a lavagem pulmonar. Nos outros três casos, o número de lavagens variou: uma única lavagem unilateral com remissão completa do quadro bilateralmente, três lavagens sem melhora significativa e quatro procedimentos intercalados com períodos de melhora. CONCLUSÃO: Constatamos em nossa casuística que a lavagem pulmonar se mostrou eficiente, apesar de alguns pacientes apresentarem certa resistência ao procedimento, enquanto que outros podem ter remissão completa da doença.OBJECTIVE: The aim of this study was to present the evolution of four patients presenting pulmonary alveolar proteinosis and treated at the State University of Londrina School of Medicine. We focus on the importance of whole-lung lavage as the treatment of choice. METHODS: A retrospective study of four patients, three females and one male, 22 to 34 years old, presenting similar histories of progressive dyspnea and dry cough. The final diagnosis was established through open-lung biopsy. Three of the patients underwent whole-lung lavage in the Department of Surgery. The procedures were performed under general anesthesia and using a double-lumen endotracheal tube. RESULTS: One patient presented spontaneous regression of the pulmonary alveolar proteinosis

  20. Partial pulmonary embolization disrupts alveolarization in fetal sheep

    Directory of Open Access Journals (Sweden)

    Hooper Stuart B

    2010-04-01

    Full Text Available Abstract Background Although bronchopulmonary dysplasia is closely associated with an arrest of alveolar development and pulmonary capillary dysplasia, it is unknown whether these two features are causally related. To investigate the relationship between pulmonary capillaries and alveolar formation, we partially embolized the pulmonary capillary bed. Methods Partial pulmonary embolization (PPE was induced in chronically catheterized fetal sheep by injection of microspheres into the left pulmonary artery for 1 day (1d PPE; 115d gestational age; GA or 5 days (5d PPE; 110-115d GA. Control fetuses received vehicle injections. Lung morphology, secondary septal crests, elastin, collagen, myofibroblast, PECAM1 and HIF1α abundance and localization were determined histologically. VEGF-A, Flk-1, PDGF-A and PDGF-Rα mRNA levels were measured using real-time PCR. Results At 130d GA (term ~147d, in embolized regions of the lung the percentage of lung occupied by tissue was increased from 29 ± 1% in controls to 35 ± 1% in 1d PPE and 44 ± 1% in 5d PPE fetuses (p VEGF and Flk-1, although a small increase in PDGF-Rα expression at 116d GA, from 1.00 ± 0.12 in control fetuses to 1.61 ± 0.18 in 5d PPE fetuses may account for impaired differentiation of alveolar myofibroblasts and alveolar development. Conclusions PPE impairs alveolarization without adverse systemic effects and is a novel model for investigating the role of pulmonary capillaries and alveolar myofibroblasts in alveolar formation.

  1. Asymmetric [14C]albumin transport across bullfrog alveolar epithelium

    International Nuclear Information System (INIS)

    Kim, K.J.; LeBon, T.R.; Shinbane, J.S.; Crandall, E.D.

    1985-01-01

    Bullfrog lungs were prepared as planar sheets and bathed with Ringer solution in Ussing chambers. In the presence of a constant electrical gradient (20, 0, or -20 mV) across the tissue, 14 C-labeled bovine serum albumin or inulin was instilled into the upstream reservoir and the rate of appearance of the tracer in the downstream reservoir was monitored. Two lungs from the same animal were used to determine any directional difference in tracer fluxes. An apparent permeability coefficient was estimated from a relationship between normalized downstream radioactivities and time. Results showed that the apparent permeability of albumin in the alveolar to pleural direction across the alveolar epithelial barrier is 2.3 X 10(-7) cm/s, significantly greater (P less than 0.0005) than that in the pleural to alveolar direction (5.3 X 10(-8) cm/s) when the tissue was short circuited. Permeability of inulin, on the other hand, did not show any directional dependence and averaged 3.1 X 10(-8) cm/s in both directions. There was no effect on radiotracer fluxes permeabilities of different electrical gradients across the tissue. Gel electrophoretograms and corresponding radiochromatograms suggest that the large and asymmetric isotope fluxes are not primarily due to digestion or degradation of labeled molecules. Inulin appears to traverse the alveolar epithelial barrier by simple diffusion through hydrated paracellular pathways. On the other hand, [ 14 C]albumin crosses the alveolar epithelium more rapidly than would be expected by simple diffusion. These asymmetric and large tracer fluxes suggest that a specialized mechanism is present in alveolar epithelium that may be capable of helping to remove albumin from the alveolar space

  2. Alveolar ridge sockets preservation with bone grafting--review.

    Science.gov (United States)

    Allegrini, Sergio; Koening, Bruno; Allegrini, Marcia Rivellino Facci; Yoshimoto, Marcelo; Gedrange, Tomasz; Fanghaenel, Jochen; Lipski, Mariusz

    2008-01-01

    Alveolar bone seems to play a key role in providing support to the teeth, which are anchored to the bone by desmodontal fibers. The progressive alveolar bone resorption process occurs due to a loss of anatomic, biologic and mechanical factors. Mechanical stimulation of alveolar bone during mastication is crucial in keeping the teeth and underlying bone healthy. Tooth extraction leads to typical bone deficiency of ridge width and height of alveolar crest and reduces the possibility of placing screw titanium implants. When tooth extraction is necessary, trauma should be minimized during the procedure and bone preservation should receive careful attention. The literature has shown that early bone loss can be significantly reduced by socket grafting. The process of socket grafting requires an understanding of wound healing and an appreciation of the biological properties of the products available for socket grafting. Augmentative measures may, thus, be required to guarantee optimal prosthetic replacement of the lost tissue. Success or failure of augmentation procedures is dependent on revascularization and remodelling of the grafted bone into a vital, load bearing bone. In contrast to a visible three-dimensional change, the concept of remodelling refers to the internal turnover of bone, which is a coupled process where osteoclastic resorption and osteoblastic formation are more or less balanced. To restore alveolar bone loss and support efficient placement of dental implants, many different bone substitute such as autografts, allografts, xenografts, synthetic biomaterials and osteoactive agents have been proposed. In order to avoid harvesting an autograft, and thereby eliminating additional surgical procedures and risks, bone grafting materials and substitutes are alternative filler materials to be used for ridge augmentation. To present a literature review about biomaterials applicable in alveolar ridge sockets preservation to future implants insertion. The

  3. ATLAS soft QCD results

    CERN Document Server

    Sykora, Tomas; The ATLAS collaboration

    2018-01-01

    Recent results of soft QCD measurements performed by the ATLAS collaboration are reported. The measurements include total, elastic and inelastic cross sections, inclusive spectra, underlying event and particle correlations in p-p and p-Pb collisions.

  4. Soft morphological image resizing

    Science.gov (United States)

    Maltseff, Pavel A.

    1997-04-01

    One important problem in computer vision and image processing is image resizing. Current techniques are generally based on different interpolation methods. These methods are convenient but the downsampled or upsampled image will include new gray values which are not present in the original image. Soft morphological interpolation is a new technique for resampling discrete data. The soft morphological operations are an alternative to the standard morphological operation. The generic description of hierarchical soft morphological transformations was done previously. The further development of soft morphological operations by a hierarchical structural system uses the relaxation of the requirement that the result of the operation must be the r-th largest or smallest value of the corresponding multiset, where r is an order index of the internal hard center. We will assume that any reasonable integer value is acceptable. The purpose of this paper is to derive the sot morphological convolution and compare the result of this convolution with the cubic convolution and Gaussian pyramid.

  5. Dynamics of Soft Matter

    CERN Document Server

    García Sakai, Victoria; Chen, Sow-Hsin

    2012-01-01

    Dynamics of Soft Matter: Neutron Applications provides an overview of neutron scattering techniques that measure temporal and spatial correlations simultaneously, at the microscopic and/or mesoscopic scale. These techniques offer answers to new questions arising at the interface of physics, chemistry, and biology. Knowledge of the dynamics at these levels is crucial to understanding the soft matter field, which includes colloids, polymers, membranes, biological macromolecules, foams, emulsions towards biological & biomimetic systems, and phenomena involving wetting, friction, adhesion, or micr

  6. Three dimensional evaluation of alveolar bone changes in response to different rapid palatal expansion activation rates

    Directory of Open Access Journals (Sweden)

    Brian LaBlonde

    Full Text Available ABSTRACT Introduction: The aim of this multi-center retrospective study was to quantify the changes in alveolar bone height and thickness after using two different rapid palatal expansion (RPE activation protocols, and to determine whether a more rapid rate of expansion is likely to cause more adverse effects, such as alveolar tipping, dental tipping, fenestration and dehiscence of anchorage teeth. Methods: The sample consisted of pre- and post-expansion records from 40 subjects (age 8-15 years who underwent RPE using a 4-banded Hyrax appliance as part of their orthodontic treatment to correct posterior buccal crossbites. Subjects were divided into two groups according to their RPE activation rates (0.5 mm/day and 0.8 mm/day; n = 20 each group. Three-dimensional images for all included subjects were evaluated using Dolphin Imaging Software 11.7 Premium. Maxillary base width, buccal and palatal cortical bone thickness, alveolar bone height, and root angulation and length were measured. Significance of the changes in the measurements was evaluated using Wilcoxon signed-rank test and comparisons between groups were done using ANOVA. Significance was defined at p ≤ 0.05. Results: RPE activation rates of 0.5 mm per day (Group 1 and 0.8 mm per day (Group 2 caused significant increase in arch width following treatment; however, Group 2 showed greater increases compared to Group 1 (p < 0.01. Buccal alveolar height and width decreased significantly in both groups. Both treatment protocols resulted in significant increases in buccal-lingual angulation of teeth; however, Group 2 showed greater increases compared to Group 1 (p < 0.01. Conclusion: Both activation rates are associated with significant increase in intra-arch widths. However, 0.8 mm/day resulted in greater increases. The 0.8 mm/day activation rate also resulted in more increased dental tipping and decreased buccal alveolar bone thickness over 0.5 mm/day.

  7. Soft tissue wound healing around teeth and dental implants.

    Science.gov (United States)

    Sculean, Anton; Gruber, Reinhard; Bosshardt, Dieter D

    2014-04-01

    To provide an overview on the biology and soft tissue wound healing around teeth and dental implants. This narrative review focuses on cell biology and histology of soft tissue wounds around natural teeth and dental implants. The available data indicate that: (a) Oral wounds follow a similar pattern. (b) The tissue specificities of the gingival, alveolar and palatal mucosa appear to be innately and not necessarily functionally determined. (c) The granulation tissue originating from the periodontal ligament or from connective tissue originally covered by keratinized epithelium has the potential to induce keratinization. However, it also appears that deep palatal connective tissue may not have the same potential to induce keratinization as the palatal connective tissue originating from an immediately subepithelial area. (d) Epithelial healing following non-surgical and surgical periodontal therapy appears to be completed after a period of 7–14 days. Structural integrity of a maturing wound between a denuded root surface and a soft tissue flap is achieved at approximately 14-days post-surgery. (e) The formation of the biological width and maturation of the barrier function around transmucosal implants requires 6–8 weeks of healing. (f) The established peri-implant soft connective tissue resembles a scar tissue in composition, fibre orientation, and vasculature. (g) The peri-implant junctional epithelium may reach a greater final length under certain conditions such as implants placed into fresh extraction sockets versus conventional implant procedures in healed sites. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Assessing fluoride levels of carbonated soft drinks.

    Science.gov (United States)

    Heilman, J R; Kiritsy, M C; Levy, S M; Wefel, J S

    1999-11-01

    Dental fluorosis occurs as a result of excessive total fluoride intake during tooth development. Some children may receive substantial intake from soft drinks, but few studies have reported fluoride levels in soft drinks. The authors examined the fluoride concentrations of 332 soft drinks. Soft drinks were purchased from Iowa grocery stores. To identify production sites, the authors recorded product details and batch numbers. After decarbonating the drinks, the authors assayed samples for fluoride content using a fluoride ion-specific electrode, and reported the results in parts per million, or ppm, using appropriate standards and duplicate assessments. Descriptive statistics were used to summarize the findings. The fluoride levels of the products ranged from 0.02 to 1.28 ppm, with a mean level of 0.72 ppm. Fluoride levels exceeded 0.60 ppm for 71 percent of the products. Results varied substantially by production site, even within the same company and for the same product. There were no substantial differences between flavors or between diet and regular soft drinks. The majority of soft drinks had fluoride levels exceeding 0.60 ppm. Variation in fluoride levels probably is due largely to the different water sources used in production. With no fluoride levels marked on the soft drink products or easily available from the manufacturers, it is not possible for clinicians or consumers to directly estimate fluoride ingestion from carbonated beverages. Therefore, to reduce the risk of dental fluorosis, dental and medical practitioners should be cautious about prescribing dietary fluoride supplements to preschool-aged children in nonfluoridated areas who consume large quantities of carbonated soft drinks.

  9. Teaching Soft Skills Employers Need

    Science.gov (United States)

    Ellis, Maureen; Kisling, Eric; Hackworth, Robbie G.

    2014-01-01

    This study identifies the soft skills community colleges teach in an office technology course and determines whether the skills taught are congruent with the soft skills employers require in today's entry-level office work. A qualitative content analysis of a community college office technology soft skills course was performed using 23 soft skills…

  10. Alveolar targeting of aerosol pentamidine. Toward a rational delivery system

    Energy Technology Data Exchange (ETDEWEB)

    Simonds, A.K.; Newman, S.P.; Johnson, M.A.; Talaee, N.; Lee, C.A.; Clarke, S.W. (Royal Free Hospital, London (England))

    1990-04-01

    Nebulizer systems that deposit a high proportion of aerosolized pentamidine on large airways are likely to be associated with marked adverse side effects, which may lead to premature cessation of treatment. We have measured alveolar deposition and large airway-related side effects (e.g., cough, breathlessness, and effect on pulmonary function) after aerosolization of 150 mg pentamidine isethionate labeled with {sup 99m}Tc-Sn-colloid. Nine patients with AIDS were studied using three nebulizer systems producing different droplet size profiles: the Acorn System 22, Respirgard II, and Respirgard II with the inspiratory baffle removed. Alveolar deposition was greatest and side effects least with the nebulizer producing the smallest droplet size profile (Respirgard II), whereas large airway-related side effects were prominent and alveolar deposition lowest with the nebulizer producing the largest droplet size (Acorn System 22). Values for alveolar deposition and adverse airway effects were intermediate using the Respirgard with inspiratory baffle removed, thus indicating the importance of the baffle valve in determining droplet size. Addition of a similar baffle valve to the Acorn System 22 produced a marked improvement in droplet size profile. Selection of a nebulizer that produces an optimal droplet size range offers the advantage of enhancing alveolar targeting of aerosolized pentamidine while reducing large airway-related side effects.

  11. Hypocapnic but Not Metabolic Alkalosis Impairs Alveolar Fluid Reabsorption

    Science.gov (United States)

    Myrianthefs, Pavlos M.; Briva, Arturo; Lecuona, Emilia; Dumasius, Vidas; Rutschman, David H.; Ridge, Karen M.; Baltopoulos, George J.; Sznajder, Jacob Iasha

    2005-01-01

    Acid-base disturbances, such as metabolic or respiratory alkalosis, are relatively common in critically ill patients. We examined the effects of alkalosis (hypocapnic or metabolic alkalosis) on alveolar fluid reabsorption in the isolated and continuously perfused rat lung model. We found that alveolar fluid reabsorption after 1 hour was impaired by low levels of CO2 partial pressure (PCO2; 10 and 20 mm Hg) independent of pH levels (7.7 or 7.4). In addition, PCO2 higher than 30 mm Hg or metabolic alkalosis did not have an effect on this process. The hypocapnia-mediated decrease of alveolar fluid reabsorption was associated with decreased Na,K-ATPase activity and protein abundance at the basolateral membranes of distal airspaces. The effect of low PCO2 on alveolar fluid reabsorption was reversible because clearance normalized after correcting the PCO2 back to normal levels. These data suggest that hypocapnic but not metabolic alkalosis impairs alveolar fluid reabsorption. Conceivably, correction of hypocapnic alkalosis in critically ill patients may contribute to the normalization of lung ability to clear edema. PMID:15764729

  12. Is alveolar cleft reconstruction still controversial? (Review of literature

    Directory of Open Access Journals (Sweden)

    Sameh A. Seifeldin

    2016-01-01

    Full Text Available Cleft lip and palate (CL/P is a frequent congenital malformation that manifests in several varieties including unilateral or bilateral and complete or incomplete. Alveolar cleft reconstruction remains controversial with regard to timing, graft materials, surgical techniques, and methods of evaluation. Many studies have been conducted addressing these points to develop an acceptable universal protocol for managing CL/P. The primary goal of alveolar cleft reconstruction in CL/P patients is to provide a bony bridge at the cleft site that allows maxillary arch continuity, oronasal fistula repair, eruption of the permanent dentition into the newly formed bone, enhances nasal symmetry through providing alar base support, orthodontic movement and placement of osseointegrated implants when indicated. Other goals include improving speech, improvement of periodontal conditions, establishing better oral hygiene, and limiting growth disturbances. In order to rehabilitate oral function in CL/P patients alveolar bone grafting is necessary. Secondary bone grafting is the most widely accepted method for treating alveolar clefts. Autogenous bone graft is the primary source for reconstructing alveolar cleft defects and is currently the preferred grafting material.

  13. Significance of Soft Zone Sediments at the SRS

    Energy Technology Data Exchange (ETDEWEB)

    Aadland, R.K.

    2000-02-03

    The purpose of this report is to provide information on the origin, extent and stability of ''soft zones'' in the carbonate bearing strata at the Savannah River Site (SRS). As part of this study, a comprehensive historical compendium of how soft zones have been addressed during the past 47 years at SRS is reviewed.

  14. Soft Skills Training: An Annotated Guide to Selected Programs.

    Science.gov (United States)

    Leigh, Wilhelmina A.; Lee, Deitra H.; Lindquist, Malinda A.

    This guidebook presents data from a two-part study that reviewed existing literature on soft work skills, defined soft skills, and determined their importance to employers. The study also identified programs that were teaching those skills. Researchers contacted 90 organizations, asking for detailed written materials about themselves. The 53 that…

  15. Soft Dielectric Elastomer Oscillators Driving Bioinspired Robots.

    Science.gov (United States)

    Henke, E-F Markus; Schlatter, Samuel; Anderson, Iain A

    2017-12-01

    Entirely soft robots with animal-like behavior and integrated artificial nervous systems will open up totally new perspectives and applications. To produce them, we must integrate control and actuation in the same soft structure. Soft actuators (e.g., pneumatic and hydraulic) exist but electronics are hard and stiff and remotely located. We present novel soft, electronics-free dielectric elastomer oscillators, which are able to drive bioinspired robots. As a demonstrator, we present a robot that mimics the crawling motion of the caterpillar, with an integrated artificial nervous system, soft actuators and without any conventional stiff electronic parts. Supplied with an external DC voltage, the robot autonomously generates all signals that are necessary to drive its dielectric elastomer actuators, and it translates an in-plane electromechanical oscillation into a crawling locomotion movement. Therefore, all functional and supporting parts are made of polymer materials and carbon. Besides the basic design of this first electronic-free, biomimetic robot, we present prospects to control the general behavior of such robots. The absence of conventional stiff electronics and the exclusive use of polymeric materials will provide a large step toward real animal-like robots, compliant human machine interfaces, and a new class of distributed, neuron-like internal control for robotic systems.

  16. Soft-Capture Mechanism For Collet Joint

    Science.gov (United States)

    Huff, John E., Jr.

    1992-01-01

    Soft-capture mechanism part of latching-and-rigidifying mechanism joining strut rigidly to node on truss. Latching-and-rigidifying mechanism of spreading-collet type, in which collet inserted into base that mates with collet to assure proper alignment, then collet spread to rigidify joint, fixing alignment. Designed to be operable by heavily gloved hand or by robot.

  17. Development of artificial soft rock

    International Nuclear Information System (INIS)

    Kishi, Kiyoshi

    1995-01-01

    When foundation base rocks are deeper than the level of installing structures or there exist weathered rocks and crushed rocks in a part of base rocks, often sound artificial base rocks are made by substituting the part with concrete. But in the construction of Kashiwazaki Kariwa Nuclear Power Station of Tokyo Electric Power Co., Inc., the foundation base rocks consist of mudstone, and the stiffness of concrete is large as compared with the surrounding base rocks. As the quality of the substituting material, the nearly same stiffness as that of the surrounding soft rocks and long term stability are suitable, and the excellent workability and economical efficiency are required, therefore, artificial soft rocks were developed. As the substituting material, the soil mortar that can obtain the physical property values in stable form, which are similar to those of Nishiyama mudstone, was selected. The mechanism of its hardening and the long term stability, and the manufacturing plant are reported. As for its application to the base rocks of Kashiwazaki Kariwa Nuclear Power Station, the verification test at the site and the application to the base rocks for No. 7 plant reactor building and other places are described. (K.I.)

  18. Ghrelin ameliorates the human alveolar epithelial A549 cell apoptosis induced by lipopolysaccharide

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Chunrong; Zheng, Haichong; He, Wanmei; Lu, Guifang; Li, Xia [Department of Medical Intensive Care Unit, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080 (China); Deng, Yubin, E-mail: dengyub@mail.sysu.edu.cn [Research Center of Translational Medicine, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080 (China); Zeng, Mian, E-mail: zengmian2004@163.com [Department of Medical Intensive Care Unit, The First Affiliated Hospital, Sun Yat-Sen University, Guangzhou 510080 (China)

    2016-05-20

    Ghrelin is a gastric acyl-peptide that plays an inhibitory role in cell apoptosis. Herein we investigate the protective effects of ghrelin in LPS-induced apoptosis of human alveolar epithelial A549 cells, along with the possible molecular mechanisms. LPS exposure impaired cell viability and increased apoptosis of A549 cells significantly in concentration- and time-dependent manners embodied in increased Bax and cleaved caspase-3 production, coupled with decreased Bcl-2 levels. Simultaneously, LPS remarkably decreased the expression of phosphatidylinositol 3 kinase/protein kinase B (PI3K/Akt) and extracellular signal-regulated kinas (ERK) in A549 cells. However, ghrelin'pretreatment ameliorated LPS-caused alterations in the ratio of Bax/Bcl-2 and cleaved caspase-3 expression, whereas activated the PI3K/Akt and ERK signaling. These results demonstrate that ghrelin lightens LPS-induced apoptosis of human alveolar epithelial cells partly through activating the PI3K/Akt and ERK pathway and thereby might benefit alleviating septic ALI. -- Graphical abstract: Ghrelin ameliorates the human alveolar epithelial A549 cells apoptosis induced by lipopolysaccharide partly through activating the PI3K/Akt and ERK pathway. Display Omitted -- Highlights: •It has been observed that LPS insult significantly increased apoptosis in A549 cells. •Both Akt and ERK signaling are critical adapter molecules to mediate the ghrelin-mediated proliferative effect. •Ghrelin may have a therapeutic effect in the prevention of LPS-induced apoptosis.

  19. Diffuse bronchiolo-alveolar carcinoma in a dog.

    Science.gov (United States)

    Bertazzolo, W; Zuliani, D; Pogliani, E; Caniatti, M; Bussadori, C

    2002-06-01

    An eight-year-old female German wirehaired pointer was presented with signs of respiratory distress. Clinical examination, laboratory results, thoracic radiography and echocardiography indicated the presence of a diffuse interstitial lung disease with secondary appropriate erythrocytosis, pulmonary hypertension and cor pulmonale. Transthoracic fine needle aspiration biopsy of the lung suggested malignant epithelial neoplasia. A primary lung cancer with an unusually diffuse distribution of miliary/micronodular lesions was found at postmortem examination. Histological diagnosis was bronchiolo-alveolar carcinoma. Bronchiolo-alveolar carcinoma can occasionally occur in a diffuse fashion involving most or all of the lung parenchyma. In man, diffuse bronchiolo-alveolar carcinoma is considered a great imitator of other, more common diffuse interstitial forms of lung disease. This case report indicates that it is also a differential diagnosis to consider in dogs.

  20. Alveolar bone width preservation after decoronation of ankylosed anterior incisors.

    Science.gov (United States)

    Lin, Shaul; Schwarz-Arad, Dvorah; Ashkenazi, Malka

    2013-12-01

    The aim of the study was to assess the alteration of alveolar ridge dimensions after decoronation procedures in children and adolescents at least 1 year after surgery. Twelve children who underwent decoronation of ankylosed maxillary anterior incisors with at least 1 year after surgery follow-up were recalled for reevaluation. All decoronations were performed when the ankylosed teeth were submerged 1-1.5 mm. During the recall appointment, impressions of the upper arch were obtained. The bucco-palatal alveolar dimensions of the decoronated teeth were measured on the cast at the mid-mesiodistal distance from the missing tooth and were compared with the distance from the contralateral healthy incisor. Overall, 12 children (9 male and 3 female) were reevaluated up to 82 months after decoronation (mean, 49.58 ± 24 months). The mean age of the patients at the time of trauma was 9.83 ± 2.8 years. The average bucco-palatal dimension of the alveolar ridge at the mid-decoronation area was 9 ± 1 mm compared with 10.17 ± 0.9 mm at the contralateral homologous tooth (difference of 1.67 ± 1.12, P = .004). The findings show a positive statistical correlation between the duration of the follow-up period and the bucco-palatal dimension of the alveolar ridge (P = .027). Although decoronation of ankylosed young permanent incisors resulted in a decrease in the bucco-palatal dimension with time, it did not prevent additional alveolar growth that occurs with age in a developing child and thus may help maintain the alveolar bone ridge width, height, and continuity and assist in future rehabilitation with less invasive ridge augmentation procedures required for implant placement. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  1. ON SOME DECOMPOSITIONS OF FUZZY SOFT CONTINUITY

    OpenAIRE

    Gain, Pradip Kumar; Mukherjee, Prakash; Chakraborty, Ramkrishna Prasad

    2015-01-01

    – In this article, some open-like fuzzy soft sets such as fuzzy soft semi-open set, fuzzy soft preopen set, fuzzy soft α-open set and corresponding variants of fuzzy soft continuous functions are introduced and discussed. Some other variants of fuzzy soft sets such as fuzzy soft semi-preclosed set, fuzzy soft t-set, fuzzy soft α*-set, fuzzy soft regular open set, fuzzy soft B-set, fuzzy soft C-set and fuzzy soft D(α)-set are defined and some properties of these sets are studied and investigat...

  2. Proximal alveolar bone loss in a longitudinal radiographic investigation

    International Nuclear Information System (INIS)

    Bolin, A.; Lavstedt, S.; Henrikson, C.O.; Frithiof, L.

    1986-01-01

    The difference in proximal alveolar bone height between 1970 and 1980, the ''ABD index'', has been measured longitudinally in radiographs from an unselected material. The group constitutes 406 individuals born in 1904 - 1952 in the county of Stockholm. 13 of 18 predictors determined in 1970 were significantly related to the ABD index in the simple correlation analyses. The predictor ''the alveolar bone loss 1970'' (ABL index 1970) had the strongest correlation to the ABD index. In the stepwise multiple regression analysis the predictor ABL index 1970 and three other predictors reached significant levels. These were age, number of lost teeth and Russell's Periodontal Index

  3. Postextraction alveolar ridge preservation: biological basis and treatments.

    Science.gov (United States)

    Pagni, Giorgio; Pellegrini, Gaia; Giannobile, William V; Rasperini, Giulio

    2012-01-01

    Following tooth extraction, the alveolar ridge undergoes an inevitable remodeling process that influences implant therapy of the edentulous area. Socket grafting is a commonly adopted therapy for the preservation of alveolar bone structures in combination or not with immediate implant placement although the biological bases lying behind this treatment modality are not fully understood and often misinterpreted. This review is intended to clarify the literature support to socket grafting in order to provide practitioners with valid tools to make a conscious decision of when and why to recommend this therapy.

  4. Repopulation of denuded tracheal grafts with alveolar type II cells

    International Nuclear Information System (INIS)

    Johnson, N.F.

    1988-01-01

    Repopulation of denuded heterotopic tracheal grafts with populations of specific epithelial cell types is one approach to study the differentiation potential of various cell types. This technique has been adopted to delineate the differentiation pathways of alveolar type II cells isolated from rat lungs. Under the conditions of this experiment, the reestablished epithelial lining was alveolar-like, however, ultrastructural analysis of the cells showed them to be like Clara cells. These preliminary results suggest that the secretary cells of the lung parenchyma and terminal airways may share a common ancestry. (author)

  5. Interference screw fixation of soft tissue grafts in anterior cruciate ligament reconstruction: part 1: effect of tunnel compaction by serial dilators versus extraction drilling on the initial fixation strength.

    Science.gov (United States)

    Nurmi, Janne T; Kannus, Pekka; Sievänen, Harri; Järvelä, Timo; Järvinen, Markku; Järvinen, Teppo L N

    2004-03-01

    Compaction of the bone-tunnel walls by serial dilation is believed to enhance the interference screw fixation strength of the soft tissue grafts in anterior cruciate ligament (ACL) reconstruction. Serial dilation enhances the fixation strength of soft tissue grafts in ACL reconstruction over extraction drilling. Randomized experimental study. Initial fixation strength of the doubled anterior tibialis tendon grafts (fixed with a bioabsorbable interference screw) was assessed in 21 pairs of human cadaver tibiae with either serially dilated or extraction-drilled bone tunnels. The specimens were subjected to a cyclic-loading test, and those surviving were then tested using the single-cycle load-to-failure test. During the cyclic-loading test, there were 3 fixation failures in the serially dilated and 6 failures in the extraction-drilled specimens but no significant stiffness or displacement differences between the groups. In the subsequent load-to-failure test, the average yield loads were 473 +/- 110 N and 480 +/- 115 N for the 2 groups respectively (P =.97) and no difference with regard to stiffness or mode of failure. Serial dilation does not increase the strength of interference fixation of soft tissue grafts in ACL reconstruction over extraction drilling. The results of this experiment do not support the use of serial dilators in ACL reconstruction.

  6. Vascularization of soft tissue engineering constructs

    DEFF Research Database (Denmark)

    Pimentel Carletto, Rodrigo

    with mechanical properties in the range of soft tissues has not been fully achieved. My project focused on the fabrication and the active perfusion of hydrogel constructs with multi-dimensional vasculature and controlled mechanical properties targeting soft tissues. Specifically, the initial part of the research...... nanotechnology-based paradigm for engineering vascularised liver tissue for transplantation”) and the Danish National Research Foundation and Villum Foundation’s Center for Intelligent Drug delivery and sensing Using microcontainers and Nanomechanics (Danish National Research Foundation (DNRF122)....

  7. On Soft Biometrics

    DEFF Research Database (Denmark)

    Nixon, Mark; Correia, Paulo; Nasrollahi, Kamal

    2015-01-01

    Innovation has formed much of the rich history in biometrics. The field of soft biometrics was originally aimed to augment the recognition process by fusion of metrics that were sufficient to discriminate populations rather than individuals. This was later refined to use measures that could be used...... to discriminate individuals, especially using descriptions that can be perceived using human vision and in surveillance imagery. A further branch of this new field concerns approaches to estimate soft biometrics, either using conventional biometrics approaches or just from images alone. These three strands...... combine to form what is now known as soft biometrics. We survey the achievements that have been made in recognition by and in estimation of these parameters, describing how these approaches can be used and where they might lead to. The approaches lead to a new type of recognition, and one similar...

  8. Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients

    DEFF Research Database (Denmark)

    Andersen, Kristian

    2012-01-01

    Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients......Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients...

  9. Secondary bone grafting for alveolar cleft in children with cleft lip or cleft lip and palate

    NARCIS (Netherlands)

    Guo, J.; Li, C.; Zhang, Q.; Wu, G.; Deacon, S.A.; Chen, J.; Hu, H.; Zou, S.; Ye, Q.

    2011-01-01

    BACKGROUND: Secondary alveolar bone grafting has been widely used to reconstruct alveolar cleft. However, there is still some controversy. OBJECTIVES: To compare the effectiveness and safety of different secondary bone grafting methods. SEARCH STRATEGY: The final electronic and handsearches were

  10. Advances in soft computing, intelligent robotics and control

    CERN Document Server

    Fullér, Robert

    2014-01-01

    Soft computing, intelligent robotics and control are in the core interest of contemporary engineering. Essential characteristics of soft computing methods are the ability to handle vague information, to apply human-like reasoning, their learning capability, and ease of application. Soft computing techniques are widely applied in the control of dynamic systems, including mobile robots. The present volume is a collection of 20 chapters written by respectable experts of the fields, addressing various theoretical and practical aspects in soft computing, intelligent robotics and control. The first part of the book concerns with issues of intelligent robotics, including robust xed point transformation design, experimental verification of the input-output feedback linearization of differentially driven mobile robot and applying kinematic synthesis to micro electro-mechanical systems design. The second part of the book is devoted to fundamental aspects of soft computing. This includes practical aspects of fuzzy rule ...

  11. Soft and hard pomerons

    International Nuclear Information System (INIS)

    Maor, Uri; Tel Aviv Univ.

    1995-09-01

    The role of s-channel unitarity screening corrections, calculated in the eikonal approximation, is investigated for soft Pomeron exchange responsible for elastic and diffractive hadron scattering in the high energy limit. We examine the differences between our results and those obtained from the supercritical Pomeron-Regge model with no such corrections. It is shown that screening saturation is attained at different scales for different channels. We then proceed to discuss the new HERA data on hard (PQCD) Pomeron diffractive channels and discuss the relationship between the soft and hard Pomerons and the relevance of our analysis to this problem. (author). 18 refs, 9 figs, 1 tab

  12. Mechanics of soft materials

    CERN Document Server

    Volokh, Konstantin

    2016-01-01

    This book provides a concise introduction to soft matter modelling. It offers an up-to-date review of continuum mechanical description of soft and biological materials from the basics to the latest scientific materials. It includes multi-physics descriptions, such as chemo-, thermo-, electro- mechanical coupling. It derives from a graduate course at Technion that has been established in recent years. It presents original explanations for some standard materials and features elaborated examples on all topics throughout the text. PowerPoint lecture notes can be provided to instructors. .

  13. Relationship between viscoelastic properties of soft denture liners and clinical efficacy

    Directory of Open Access Journals (Sweden)

    Hiroshi Murata

    2008-10-01

    Full Text Available Soft denture liners are applied for denture wearers who cannot tolerate a hard-based denture due to a thin and non-resilient oral mucosa and/or severe alveolar resorption. This material distributes and absorbs masticatory forces by means of the cushioning effect. Clinical success of the materials depends both on their viscoelastic properties and on durability. Acrylic resins and silicones are mainly available for permanent soft liners. The acrylic permanent soft liners demonstrate viscoelastic behavior while silicone permanent soft liners demonstrate elastic behavior. The improvement in masticatory function is greater in dentures lined with the acrylic materials than in those lined with silicone products. However, the acrylic materials exhibit a more marked change in viscoelastic properties and loss of cushioning effect over time than silicones. From the standpoint of durability, the silicones are preferred. It is important to understand viscoelastic properties and durability of each soft denture liner and to select the material according to the clinical situations and purposes. The ideal permanent soft liners have a relatively high value of loss tangent and storage modulus, and high durability. Further research is necessary to develop the ideal soft denture liner.

  14. Fuzzy logic, neural networks, and soft computing

    Science.gov (United States)

    Zadeh, Lofti A.

    1994-01-01

    The past few years have witnessed a rapid growth of interest in a cluster of modes of modeling and computation which may be described collectively as soft computing. The distinguishing characteristic of soft computing is that its primary aims are to achieve tractability, robustness, low cost, and high MIQ (machine intelligence quotient) through an exploitation of the tolerance for imprecision and uncertainty. Thus, in soft computing what is usually sought is an approximate solution to a precisely formulated problem or, more typically, an approximate solution to an imprecisely formulated problem. A simple case in point is the problem of parking a car. Generally, humans can park a car rather easily because the final position of the car is not specified exactly. If it were specified to within, say, a few millimeters and a fraction of a degree, it would take hours or days of maneuvering and precise measurements of distance and angular position to solve the problem. What this simple example points to is the fact that, in general, high precision carries a high cost. The challenge, then, is to exploit the tolerance for imprecision by devising methods of computation which lead to an acceptable solution at low cost. By its nature, soft computing is much closer to human reasoning than the traditional modes of computation. At this juncture, the major components of soft computing are fuzzy logic (FL), neural network theory (NN), and probabilistic reasoning techniques (PR), including genetic algorithms, chaos theory, and part of learning theory. Increasingly, these techniques are used in combination to achieve significant improvement in performance and adaptability. Among the important application areas for soft computing are control systems, expert systems, data compression techniques, image processing, and decision support systems. It may be argued that it is soft computing, rather than the traditional hard computing, that should be viewed as the foundation for artificial

  15. A novel semi-automatic segmentation protocol for volumetric assessment of alveolar cleft grafting procedures

    NARCIS (Netherlands)

    Janssen, Nard G.; Schreurs, Ruud; Bittermann, Gerhard K.P.; Borstlap, Wilfred A.; Koole, Ronald; Meijer, Gert J.; Maal, Thomas J.J.

    2017-01-01

    A novel protocol for volumetric assessment of alveolar cleft grafting procedures is presented. Eleven cone-beam computed tomography (CBCT) datasets of patients who underwent secondary alveolar cleft reconstructive surgery for a unilateral alveolar cleft were evaluated by two investigators. Residual

  16. A novel semi-automatic segmentation protocol for volumetric assessment of alveolar cleft grafting procedures.

    NARCIS (Netherlands)

    Janssen, N.G.; Schreurs, R.; Bittermann, G.K.P.; Borstlap, W.A.; Koole, R.A.; Meijer, G.J.; Maal, T.J.J.

    2017-01-01

    A novel protocol for volumetric assessment of alveolar cleft grafting procedures is presented. Eleven cone-beam computed tomography (CBCT) datasets of patients who underwent secondary alveolar cleft reconstructive surgery for a unilateral alveolar cleft were evaluated by two investigators. Residual

  17. Serial bronchoscopic lung lavage in pulmonary alveolar proteinosis under local anesthesia

    Directory of Open Access Journals (Sweden)

    K Rennis Davis

    2015-01-01

    Full Text Available Pulmonary alveolar proteinosis (PAP is a rare disease, characterized by alveolar accumulation of surfactant composed of proteins and lipids due to defective surfactant clearance by alveolar macrophages. Mainstay of treatment is whole lung lavage, which requires general anesthesia. Herein, we report a case of primary PAP, successfully treated with serial bronchoscopic lung lavages under local anesthesia.

  18. Some Properties of Fuzzy Soft Proximity Spaces

    Science.gov (United States)

    Demir, İzzettin; Özbakır, Oya Bedre

    2015-01-01

    We study the fuzzy soft proximity spaces in Katsaras's sense. First, we show how a fuzzy soft topology is derived from a fuzzy soft proximity. Also, we define the notion of fuzzy soft δ-neighborhood in the fuzzy soft proximity space which offers an alternative approach to the study of fuzzy soft proximity spaces. Later, we obtain the initial fuzzy soft proximity determined by a family of fuzzy soft proximities. Finally, we investigate relationship between fuzzy soft proximities and proximities. PMID:25793224

  19. The effect of peri-implant bone exposure on soft tissue healing and bone loss in two adjacent implants

    Science.gov (United States)

    Shin, Seung-Yun; Kye, Seung-Boem; Hong, Jongrak; Paeng, Jun-Young

    2012-01-01

    Purpose The purpose of this study was to evaluate the soft tissue and bone change around two adjacent implants in one-stage implant surgery. Methods Eleven subjects (7 males, 4 females) who were needed placement of 2 adjacent implants in the molar area were included. The two implants were placed with the platform at the level of the alveolar crest. The interproximal bone between the 2 implants was not covered with gingiva. After surgery, an alginate impression was taken to record the gingival shape and radiographs were taken to evaluate implant placement. Using a master cast, the gingival height was measured at baseline, 4 weeks, and 12 weeks. In the radiograph, the alveolar bone level was measured at the mesial and distal side of both implants at baseline and 12 weeks. Results The exposed bone was covered with gingiva at both 4 and 12 weeks. Loss of alveolar bone around implants was found in all areas. The alveolar bone level in the exposed bone area did not differ from that in the non-exposed area. Conclusions This study showed that the alveolar bone level and gingival height around 2 adjacent implants in the exposed bone area did not differ from that in unexposed bone area. PMID:22413070

  20. Soft actuators and soft actuating devices

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Dian; Whitesides, George M.

    2017-10-17

    A soft buckling linear actuator is described, including: a plurality of substantially parallel bucklable, elastic structural components each having its longest dimension along a first axis; and a plurality of secondary structural components each disposed between and bridging two adjacent bucklable, elastic structural components; wherein every two adjacent bucklable, elastic structural components and the secondary structural components in-between define a layer comprising a plurality of cells each capable of being connected with a fluid inflation or deflation source; the secondary structural components from two adjacent layers are not aligned along a second axis perpendicular to the first axis; and the secondary structural components are configured not to buckle, the bucklable, elastic structural components are configured to buckle along the second axis to generate a linear force, upon the inflation or deflation of the cells. Methods of actuation using the same are also described.

  1. Stretchable and Soft Electronics using Liquid Metals.

    Science.gov (United States)

    Dickey, Michael D

    2017-07-01

    The use of liquid metals based on gallium for soft and stretchable electronics is discussed. This emerging class of electronics is motivated, in part, by the new opportunities that arise from devices that have mechanical properties similar to those encountered in the human experience, such as skin, tissue, textiles, and clothing. These types of electronics (e.g., wearable or implantable electronics, sensors for soft robotics, e-skin) must operate during deformation. Liquid metals are compelling materials for these applications because, in principle, they are infinitely deformable while retaining metallic conductivity. Liquid metals have been used for stretchable wires and interconnects, reconfigurable antennas, soft sensors, self-healing circuits, and conformal electrodes. In contrast to Hg, liquid metals based on gallium have low toxicity and essentially no vapor pressure and are therefore considered safe to handle. Whereas most liquids bead up to minimize surface energy, the presence of a surface oxide on these metals makes it possible to pattern them into useful shapes using a variety of techniques, including fluidic injection and 3D printing. In addition to forming excellent conductors, these metals can be used actively to form memory devices, sensors, and diodes that are completely built from soft materials. The properties of these materials, their applications within soft and stretchable electronics, and future opportunities and challenges are considered. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. A method for measuring post-extraction alveolar dimensional changes with volumetric computed tomography.

    Science.gov (United States)

    Bontá, Hernán; Galli, Federico G; Caride, Facundo; Carranza, Nelson

    2012-01-01

    The aim of this study is to present a predictable method for evaluating dimensional changes in the alveolar ridge through cone beam computed tomography (CT). Twenty subjects with single-rooted tooth extraction indication were selected for this preliminary report, which is part of a larger ongoing investigation. After extraction, two CT scans were performed; the first within 24 hours post-extraction (TC1) and the second 6 months (TC2) later. A radiographic guide with a radiopaque element placed along the tooth axis was developed to locate the same plane of reference in two different CT scans. For each patient, backtrack analysis was performed in order to establish the reproducibility error of a predetermined point in space between two CT scans. Briefly, an anatomical landmark was selected and its coordinates to the radiopaque marker were recorded. One week later, the coordinates were followed backwards in the same CT scan to obtain the position where the reference point should be located. A similar process was carried out between two different CT scans taken 6 months apart. The distance between the anatomical reference and the obtained point of position was calculated to establish the accuracy of the method. Additionally, a novel method for evaluating dimensional changes of the alveolus after tooth extraction is presented. The backtrack analysis determined an average within-examiner discrepancy between both measurements from the same CT scan of 0.19 mm. SD +/- 0.05. With the method presented herein, a reference point in a CT scan can be accurately backtracked and located in a second CT scan taken six months later. Taken together they open the possibility of calculating dimensional changes that occur in the alveolar ridge over time, such as post-extraction alveolar resorption, or the bone volume gained after different augmentation procedures.

  3. Regeneración ósea guiada para el aumento vertical del reborde alveolar Guided osseous regeneration for the vertical augmentation of the alveolar ridge

    OpenAIRE

    CE Nappe; CE Baltodano

    2013-01-01

    Se considera como aumento óseo vertical, cualquier técnica que apunte a crear una mayor altura del reborde alveolar. A inicios de la década de los 90’s se empezó a utilizar la regeneración ósea guiada (ROG) en mandíbulas atróficas, con el fin de permitir la instalación de implantes óseointegrados. Con el fin de evaluar y exponer parte de la evidencia disponible en la actualidad, con respecto a la ROG para aumento óseo vertical, se realizó la siguiente revisión bibliográfica.Any techniqu...

  4. Soft Tissue Extramedullary Plasmacytoma

    Directory of Open Access Journals (Sweden)

    Fernando Ruiz Santiago

    2010-01-01

    Full Text Available We present the uncommon case of a subcutaneous fascia-based extramedullary plasmacytoma in the leg, which was confirmed by the pathology report and followed up until its remission. We report the differential diagnosis with other more common soft tissue masses. Imaging findings are nonspecific but are important to determine the tumour extension and to plan the biopsy.

  5. Soft tissue mixed tumor

    Directory of Open Access Journals (Sweden)

    Eiichi Hiraishi

    2009-12-01

    Full Text Available Mixed tumors are relatively common in the skin and salivary glands, but extremely rare in soft tissues, often resulting in diagnostic problems. The occurrence of these tumors in the hand is especially limited. In this article we report the clinical, radiological, and histological features of a mixed tumor of the hypothenar region of the right hand.

  6. Autochthonous human alveolar echinococcosis in a Hungarian patient.

    Science.gov (United States)

    Dezsényi, Balázs; Strausz, Tamás; Makrai, Zita; Csomor, Judit; Danka, József; Kern, Peter; Rezza, Giovanni; Barth, Thomas F E; Casulli, Adriano

    2017-02-01

    Alveolar echinococcosis is a zoonotic parasitic disease causing a severe clinical condition and is known as the most deadly of all helminth infections. Moreover, this disease is also an increasing concern in Northern and Eastern Europe due to its spread in the wildlife animal host. An asymptomatic 70-year-old woman from south-western Hungary was diagnosed with multiple liver lesions. Imaging techniques (ultrasound, computed tomography and magnetic resonance imaging), serology (ELISA, indirect hemagglutination and Western blot), and conventional staining methods (hematoxylin-eosin and periodic acid-Schiff) were used for the detection of the disease. A histopathological re-evaluation of formalin-fixed paraffin block by immunohistochemical staining with the monoclonal antibody Em2G11 definitively confirmed the diagnosis of alveolar echinococcosis. To our knowledge, this is the first confirmed autochthonous case of human alveolar echinococcosis in Hungary. To what extent diagnostic difficulties may contribute to underestimate this zoonosis in Eastern Europe is unknown. Differential diagnosis with alveolar echinococcosis should be considered for patients with multiple, tumor-like cystic lesions of the liver, in countries where this parasite is emerging.

  7. Three‑dimensional Evaluation of Alveolar Bone Thickness of ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... mandibular anterior teeth are going to be retracted, mechanics for torque control should be preferred not to have uncontrolled tipping. In Class I, light orthodontic forces should be applied using elastic arch wires, and time must be allowed for the remodeling and healing of the alveolar bone in these patient ...

  8. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings

    Directory of Open Access Journals (Sweden)

    Pilar Eguía-Aguilar

    2016-11-01

    The aggressive behavior of alveolar rhabdomyosarcoma has been associated with the expression of oncogenic fusion proteins resulting from chromosomal translocations, particularly t(2;13 (q35;q14 PAX3/FOXO1, and t(1;13 (p36;q14 PAX7/FOXO1 which were present in this patient.

  9. Complications in alveolar distraction osteogenesis of the atrophic mandible.

    NARCIS (Netherlands)

    Perdijk, F.B.T.; Meijer, G.J.; Strijen, P.J. van; Koole, R.A.

    2007-01-01

    To improve the starting point for placement of dental implants, 45 patients suffering from atrophied edentulous mandibles, with a vertical height varying between 7.3 and 15.8mm, were treated by alveolar vertical distraction osteogenesis (VDO). The mean follow-up period was 3 years, ranging from 1 to

  10. Alveolar pulmonary proteinosis: case report and literature review

    International Nuclear Information System (INIS)

    Vergara, Erika; Saenz, Alberto; Ojeda, Paulina

    2009-01-01

    We describe the case of a young women with primary alveolar proteinosis, with a short period of symptoms that are uncommon for this disease, without risk factors for this entity, the clinical evolution of the patient and some complications with the treatment. We review the literature for this entity.

  11. Buccal Infiltration versus Inferior Alveolar Nerve Block in Mandibular ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... Purpose: The purpose of this study is to compare the success rates of inferior alveolar nerve block (IANB) and buccal infiltration anesthesia of mandibular second premolar with irreversible pulpitis and to evaluate the level of patient discomfort with these methods. Matherials and Methods: Forty patients, who.

  12. Alveolar Bone Housing- A Modified Wilkodontics Approach- A Case Report

    OpenAIRE

    Awasthi, Eshan; Sanjay, Kothamachu; Bhongade, ML; Shrivastav, Sunita

    2016-01-01

    Accelerated orthodontic treatment is the need of the hour in current scenario as the conventional orthodontics is time taking. Corticotomy assisted orthodontics have been used for years to reduce the treatment duration by reducing the resistance provided by alveolar bone housing.

  13. Three‑dimensional evaluation of alveolar bone thickness of ...

    African Journals Online (AJOL)

    Aim: The aim of this randomized study was to compare the alveolar bone thickness (ABT) of the mandibular incisor teeth of dental and skeletal Class I, II, and III adult patients at labial and lingual aspects of the bone and develop recommendations for the associated movements of teeth in this region, taking vertical facial type ...

  14. Alveolar ridge augmentation in rats by Bio-Oss

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1991-01-01

    The purpose of the study was to examine if Bio-Oss initiated osteoinduction or osteoconduction when implanted into rats. Sintered and unsintered granules of the anorganic bovine bone Bio-Oss was implanted subperiosteally for alveolar ridge augmentation purposes and heterotopically in the abdominal...

  15. The Effect of Astragalus Extractive on Alveolar Bone Rebuilding ...

    African Journals Online (AJOL)

    Background: Postmenopausal osteoporosis (PMO) is an estrogen deficiency condition that causes severe loss of bone mass in the vertebrae and long bones. We explored the effect and the possible underlying mechanism of the extracts of Astragalus (AE) on the tooth alveolar bone rebuilding progress of postmenopausal ...

  16. Contribution of the tooth bud mesenchyme to alveolar bone

    Czech Academy of Sciences Publication Activity Database

    Diep, L.; Matalová, Eva; Mitsiadis, T. A.; Tucker, A. S.

    312B, č. 5 (2009), 510-517 ISSN 1552-5007 R&D Projects: GA ČR GC524/08/J032; GA AV ČR KJB500450802 Institutional research plan: CEZ:AV0Z50450515 Keywords : tooth * alveolar bone * bud Subject RIV: FF - HEENT, Dentistry Impact factor: 2.938, year: 2009

  17. Alveolar occupation infiltrations, eosinophilia in peripheral blood and bronchoalveolar lavage

    International Nuclear Information System (INIS)

    Hincapie Diaz, Gustavo Adolfo; Yama Mosquera, Erica; Guevara, Jairo

    2006-01-01

    A case of a patient of 25 years old is shown with the antecedent of no potable water consumption who entered for having pulmonary symptoms. Fever, presence of alveolar occupation infiltrations and eosinophilia in peripheral blood a treatment with antiparasitary started with a significant improvement of the symptoms, infiltrations and eosinophilia. it is considered eosinophilic pneumonia diagnostic by parasitary infection (Loeffler's syndrome)

  18. Pulmonary alveolar hemorrhage mimicking a pneumopathy: a rare ...

    African Journals Online (AJOL)

    Diffuse alveolar hemorrhage after percutaneous coronary intervention (PCI) is a rare complication. The diagnosis is difficult and can mimic by clinical and radiological features other diagnosis as pneumopathy. We herein report the case of a 63-year-old female admitted to the hospital for ST elevation myocardial infarction.

  19. Alveolar Ridge Split Technique Using Piezosurgery with Specially Designed Tips

    Directory of Open Access Journals (Sweden)

    Alessandro Moro

    2017-01-01

    Full Text Available The treatment of patients with atrophic ridge who need prosthetic rehabilitation is a common problem in oral and maxillofacial surgery. Among the various techniques introduced for the expansion of alveolar ridges with a horizontal bone deficit is the alveolar ridge split technique. The aim of this article is to give a description of some new tips that have been specifically designed for the treatment of atrophic ridges with transversal bone deficit. A two-step piezosurgical split technique is also described, based on specific osteotomies of the vestibular cortex and the use of a mandibular ramus graft as interpositional graft. A total of 15 patients were treated with the proposed new tips by our department. All the expanded areas were successful in providing an adequate width and height to insert implants according to the prosthetic plan and the proposed tips allowed obtaining the most from the alveolar ridge split technique and piezosurgery. These tips have made alveolar ridge split technique simple, safe, and effective for the treatment of horizontal and vertical bone defects. Furthermore the proposed piezosurgical split technique allows obtaining horizontal and vertical bone augmentation.

  20. Modulation of epithelial sodium channel in human alveolar epithelial ...

    African Journals Online (AJOL)

    Modulation of epithelial sodium channel in human alveolar epithelial cells by lipoxin A4 through AhR-cAMP-dependent pathway. Bi-Huan Cheng, Li-Wei Pan, Sheng-Rong Zhang, Bin-Yu Ying, Ben-Ji Wang, Guo-Liang Lin, Shi-Fang Ding ...

  1. Structural changes and effect of denopamine on alveolar fluid ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... sectioning plane, and D = the mean caliper diameter of pulmonary cell nuclei. The frequency of occurrence of nuclear profiles per unit area of a random sectioning plane (NA) was determined using the electron microscope. ..... Chronic pulmonary artery occlusion increases alveolar fluid clearance in rats.

  2. Pulmonary alveolar proteinosis — a case report and review

    African Journals Online (AJOL)

    Enrique

    with granular, eosinophilic, proteina- ceous material (Fig. 2) with preserva- tion of the alveolar architecture. The patient was treated by whole-lung lavage, followed by a 4-week trial of subcutaneous granulocyte-macro- phage colony-stimulating factor. (GM-CSF). The trial of GM-CSF failed, however, and the patient is cur-.

  3. Alveolar occupation infiltrations, eosinophilia in peripheral blood and bronchoalveolar lavage

    International Nuclear Information System (INIS)

    Hincapie Diaz, Gustavo Adolfo; Yama Mosquera, Erica; Guevara, Jairo

    2006-01-01

    A case of a patient of 25 years old is shown with the antecedent of no potable water consumption who entered for having pulmonary symptoms, fever, presence of alveolar occupation infiltrations and eosinophilia in peripheral blood treatment with antiparasitary started with a significant improvement of the symptoms, infiltrations and eosinophilia. It is considered eosinophilic pneumonia diagnostic by parasitary infection (Loefffers Syndrome)

  4. Buccal infiltration versus inferior alveolar nerve block in mandibular ...

    African Journals Online (AJOL)

    Purpose: The purpose of this study is to compare the success rates of inferior alveolar nerve block (IANB) and buccal infiltration anesthesia of mandibular second premolar with irreversible pulpitis and to evaluate the level of patient discomfort with these methods. Materials and Methods: Forty patients, who had irreversible ...

  5. The development and plasticity of alveolar type 1 cells

    Science.gov (United States)

    Yang, Jun; Hernandez, Belinda J.; Martinez Alanis, Denise; Narvaez del Pilar, Odemaris; Vila-Ellis, Lisandra; Akiyama, Haruhiko; Evans, Scott E.; Ostrin, Edwin J.; Chen, Jichao

    2016-01-01

    Alveolar type 1 (AT1) cells cover >95% of the gas exchange surface and are extremely thin to facilitate passive gas diffusion. The development of these highly specialized cells and its coordination with the formation of the honeycomb-like alveolar structure are poorly understood. Using new marker-based stereology and single-cell imaging methods, we show that AT1 cells in the mouse lung form expansive thin cellular extensions via a non-proliferative two-step process while retaining cellular plasticity. In the flattening step, AT1 cells undergo molecular specification and remodel cell junctions while remaining connected to their epithelial neighbors. In the folding step, AT1 cells increase in size by more than 10-fold and undergo cellular morphogenesis that matches capillary and secondary septa formation, resulting in a single AT1 cell spanning multiple alveoli. Furthermore, AT1 cells are an unexpected source of VEGFA and their normal development is required for alveolar angiogenesis. Notably, a majority of AT1 cells proliferate upon ectopic SOX2 expression and undergo stage-dependent cell fate reprogramming. These results provide evidence that AT1 cells have both structural and signaling roles in alveolar maturation and can exit their terminally differentiated non-proliferative state. Our findings suggest that AT1 cells might be a new target in the pathogenesis and treatment of lung diseases associated with premature birth. PMID:26586225

  6. Arterial-alveolar oxygen partial pressure ratio: a theoretical reappraisal.

    Science.gov (United States)

    Viale, J P; Percival, C J; Annat, G; Rousselet, B; Motin, J

    1986-02-01

    The relationship between the arterial-alveolar oxygen partial pressure ratio (PaO2/PAO2) and different fractions of inspired oxygen (FIO2) was studied using a bicompartmental computer model. PaO2/PAO2 was found to be less stable than in previous clinical works probably because the venous admixture varied with changes in the FIO2.

  7. A Soft Parallel Kinematic Mechanism.

    Science.gov (United States)

    White, Edward L; Case, Jennifer C; Kramer-Bottiglio, Rebecca

    2018-02-01

    In this article, we describe a novel holonomic soft robotic structure based on a parallel kinematic mechanism. The design is based on the Stewart platform, which uses six sensors and actuators to achieve full six-degree-of-freedom motion. Our design is much less complex than a traditional platform, since it replaces the 12 spherical and universal joints found in a traditional Stewart platform with a single highly deformable elastomer body and flexible actuators. This reduces the total number of parts in the system and simplifies the assembly process. Actuation is achieved through coiled-shape memory alloy actuators. State observation and feedback is accomplished through the use of capacitive elastomer strain gauges. The main structural element is an elastomer joint that provides antagonistic force. We report the response of the actuators and sensors individually, then report the response of the complete assembly. We show that the completed robotic system is able to achieve full position control, and we discuss the limitations associated with using responsive material actuators. We believe that control demonstrated on a single body in this work could be extended to chains of such bodies to create complex soft robots.

  8. Soft matrices on soft multisets in an optimal decision process

    Science.gov (United States)

    Coskun, Arzu Erdem; Aras, Cigdem Gunduz; Cakalli, Huseyin; Sonmez, Ayse

    2016-08-01

    In this paper, we introduce a concept of a soft matrix on a soft multiset, and investigate how to use soft matrices to solve decision making problems. An algorithm for a multiple choose selection problem is also provided. Finally, we demonstrate an illustrative example to show the decision making steps.

  9. The contribution of intrapulmonary shunts to the alveolar-to-arterial oxygen difference during exercise is very small

    DEFF Research Database (Denmark)

    Vogiatzis, Ioannis; Zakynthinos, Spyros; Boushel, Robert

    2008-01-01

    Exercise is well known to cause arterial PO2 to fall and the alveolar-arterial PO2 difference(Aa PO2 ) to increase. Until recently, the physiological basis for this was considered to be mostly ventilation/perfusion ((.)VA/(.)Q) inequality and alveolar-capillary diffusion limitation. Recently......, arterio-venous shunting through dilated pulmonary blood vessels has been proposed to explain a significant part of the Aa PO2 during exercise. To test this hypothesis we determined venous admixture during 5 min of near-maximal, constant-load, exercise in hypoxia (in inspired O2 fraction, FIO2 , 0...... venous admixture, Aa PO2 and hypoxaemia during heavy exercise....

  10. Inclusion of periodontal ligament fibres in mandibular finite element models leads to an increase in alveolar bone strains.

    Directory of Open Access Journals (Sweden)

    Steven W McCormack

    Full Text Available Alveolar bone remodelling is vital for the success of dental implants and orthodontic treatments. However, the underlying biomechanical mechanisms, in particular the function of the periodontal ligament (PDL in bone loading and remodelling, are not well understood. The PDL is a soft fibrous connective tissue that joins the tooth root to the alveolar bone and plays a critical role in the transmission of loads from the tooth to the surrounding bone. However, due to its complex structure, small size and location within the tooth socket it is difficult to study in vivo. Finite element analysis (FEA is an ideal tool with which to investigate the role of the PDL, however inclusion of the PDL in FE models is complex and time consuming, therefore consideration must be given to how it is included. The aim of this study was to investigate the effects of including the PDL and its fibrous structure in mandibular finite element models. A high-resolution model of a human molar region was created from micro-computed tomography scans. This is the first time that the fibrous structure of the PDL has been included in a model with realistic tooth and bone geometry. The results show that omission of the PDL creates a more rigid model, reducing the strains observed in the mandibular corpus which are of interest when considering mandibular functional morphology. How the PDL is modelled also affects the strains. The inclusion of PDL fibres alters the strains in the mandibular bone, increasing the strains in the tooth socket compared to PDL modelled without fibres. As strains in the alveolar bone are thought to play a key role in bone remodelling during orthodontic tooth movement, future FE analyses aimed at improving our understanding and management of orthodontic treatment should include the fibrous structure of the PDL.

  11. Soft X-ray Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Seely, John

    1999-05-20

    The contents of this report cover the following: (1) design of the soft x-ray telescope; (2) fabrication and characterization of the soft x-ray telescope; and (3) experimental implementation at the OMEGA laser facility.

  12. The role of alveolar type II cells in swine leptospirosis

    Directory of Open Access Journals (Sweden)

    Ângela P. Campos

    2015-07-01

    Full Text Available Abstract: This study aimed to investigate a possible relationship between alveolar type II cells and the inflammatory response to infection with Leptospira spp., and thus comprise a further element that can be involved in the pathogenesis of lung injury in naturally infected pigs. The study group consisted of 73 adult pigs that were extensively reared and slaughtered in Teresina, Piauí state, and Timon, Maranhão state, Brazil. The diagnosis of leptospirosis was made using the microscopic agglutination test (MAT aided by immunohistochemistry and polymerase chain reaction. The MAT registered the occurrence of anti-Leptospira antibodies in 10.96% (8/73 of the pigs. Immunohistochemistry allowed for the visualization of the Leptospira spp. antigen in the lungs of 87.67% (64/73 of the pigs. There was hyperplasia of bronchus-associated lymphoid tissue and circulatory changes, such as congestion of alveolar septa, parenchymal hemorrhage and edema within the alveoli. Lung inflammation was more intense (p = 0.0312 in infected animals, which also showed increased thickening of the alveolar septa (p = 0.0006. Evaluation of alveolar type II (ATII cells using an anti-TTF-1 (Thyroid Transcription Factor-1 antibody showed that there were more immunostained cells in the non-infected pigs (53.8% than in the infected animals (46.2% and that there was an inverse correlation between TTF-1 positive cells and the inflammatory infiltrate. There was no amplification of Leptospira DNA in the lung samples, but leptospiral DNA amplification was observed in the kidneys. The results of this study showed that a relationship exists between a decrease in alveolar type II cells and a leptospire infection. Thus, this work points to the importance of studying the ATII cells as a potential marker of the level of lung innate immune response during leptospirosis in pigs.

  13. Soft skills and dental education

    OpenAIRE

    Gonzalez, M. A. G.; Abu Kasim, N. H.; Naimie, Z.

    2014-01-01

    Soft skills and hard skills are essential in the practice of dentistry. While hard skills deal with technical proficiency, soft skills relate to a personal values and interpersonal skills that determine a person's ability to fit in a particular situation. These skills contribute to the success of organisations that deal face-to-face with clients. Effective soft skills benefit the dental practice. However, the teaching of soft skills remains a challenge to dental schools. This paper discusses ...

  14. Hesitant intuitionistic fuzzy soft sets

    Science.gov (United States)

    Nazra, Admi; Syafruddin; Lestari, Riri; Catur Wicaksono, Gandung

    2017-09-01

    This paper aims to extend the hesitant fuzzy soft sets to hesitant intuitionistic fuzzy soft sets by merging the concept of hesitant intuitionistic fuzzy sets and soft sets. The authors define some operations on hesitant intuitionistic fuzzy sets, such as complement, union and intersection, and obtain related properties. The similar operations are defined on hesitant intuitionistic fuzzy soft sets, and also some properties such as assosiative and De Morgan’s laws are obtained.

  15. Alveolar but not intravenous S-ketamine inhibits alveolar sodium transport and lung fluid clearance in rats

    NARCIS (Netherlands)

    Berger, Marc M.; Pitzer, Bernhard; Zügel, Stefanie; Wieland, Catharina W.; Vlaar, Alexander P.; Schultz, Marcus J.; Dahan, Albert; Bärtsch, Peter; Hollmann, Markus W.; Mairbäurl, Heimo

    2010-01-01

    BACKGROUND: S-ketamine is frequently used for analgosedation, especially during sepsis and cardiovascular instability. Because S-ketamine blocks voltage-gated sodium (Na+) channels in neurons and skeletal muscle, it is conceivable that S-ketamine also blocks alveolar epithelial Na+ channels that are

  16. On Neutrosophic Soft Topological Space

    Directory of Open Access Journals (Sweden)

    Tuhin Bera

    2018-03-01

    Full Text Available In this paper, the concept of connectedness and compactness on neutrosophic soft topological space have been introduced along with the investigation of their several characteristics. Some related theorems have been established also. Then, the notion of neutrosophic soft continuous mapping on a neutrosophic soft topological space and it’s properties are developed here.

  17. Joint and Soft Tissue Injections

    Science.gov (United States)

    ... Injections Joint and Soft Tissue Injections Share Print What is a joint and soft tissue injection? Joint and soft tissue injections are shots ... many injections do I need and how often? What restrictions do I have after an ... tissue injection, treatment April 1, 2004 Copyright © American Academy ...

  18. Distracción osteogénica alveolar como método de aumento del reborde alveolar

    Directory of Open Access Journals (Sweden)

    Denia Morales Navarro

    2011-03-01

    Full Text Available La distracción osteogénica alveolar, como proceso biológico de neoformación de hueso alveolar, nos motivó a la realización de la presente revisión bibliográfica, con el objetivo enfatizar en el análisis de las variables: antecedentes históricos en Cuba, clasificación de los distractores, fases de la distracción (latencia, distracción y consolidación, indicaciones, contraindicaciones, ventajas, desventajas y complicaciones. Se realizó una revisión bibliográfica mediante la consulta de bases de datos de los sistemas referativos, como MEDLINE y PubMed con la utilización de descriptores "alveolar distraction" y "osteogenic distraction". Se consultaron las fuentes bibliográficas publicadas fundamentalmente en los últimos 5 años, lo que reveló que esta técnica es una excelente alternativa para la formación de huesos y tejidos blandos en zonas de atrofia alveolar, que consta de tres etapas: latencia, distracción y consolidación; un método previsible y con bajas tasas de reabsorción ósea en comparación con otras técnicas de aumento del reborde alveolar. Tiene su principal indicación en la terapia de implantes al proveer volumen óseo. Debemos individualizar cada caso y usar el método más adecuado según las características clínicas y personales del paciente. Una adecuada selección de los casos y una mejor comprensión de la técnica son los puntales para lograr exitosos resultados mediante la distracción osteogénica alveolar. En Cuba se ha aplicado poco la distracción alveolar, por lo que ha sido necesario ampliar los estudios sobre esta temática.

  19. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  20. Survival of 534 incisors after intra-alveolar root fracture in patients aged 7-17 years

    DEFF Research Database (Denmark)

    Cvek, M.; Tsilingaridis, G.; Andreasen, Jens Ove

    2008-01-01

    was recorded for 32 teeth, and in 11 of these, the looseness of the fragment was so pronounced that the teeth had to be extracted. No healing, i.e. radiolucency in the alveolar bone, adjacent to fracture, took place in 109 teeth (22%). Of these teeth, 34 were extracted during the observation time while 75 (69......-third of the root, and root development was categorized into five stages. Altogether, 383 (78%) showed healing of the fracture, with either formation of hard tissue or interposition of soft tissue between the fragments. In these teeth, no significant difference was found between positions in the root or types...... of healing. In 325 teeth, the healing remained unchanged throughout the control period, while 58 teeth showed a posthealing complication. A new injury occurred in 47 teeth; in 21 of these, the injury healed spontaneously, in four after endodontic treatment. Increased mobility of the coronal fragment...

  1. Flapless alveolar ridge preservation utilizing the "socket-plug" technique: clinical technique and review of the literature.

    Science.gov (United States)

    Kotsakis, Georgios; Chrepa, Vanessa; Marcou, Nicolas; Prasad, Hari; Hinrichs, James

    2014-12-01

    It has been documented that after every extraction of one or more teeth, the alveolar bone of the respective region undergoes resorption and atrophy. Therefore, ridge preservation techniques are often employed after tooth extraction to limit this phenomenon. The benefits of a flapless procedure include maintenance of the buccal keratinized gingiva, prevention of alterations to the gingival contours, and migration of the mucogingival junction that are often experienced after raising a flap. The purpose of this article is to review the literature concerning flapless ridge preservation techniques with the aid of collagen plugs for occlusion of the socket. The term "socket-plug" technique is introduced to describe these techniques. The basic steps of the "socket-plug" technique consist of atraumatic tooth extraction, placement of the appropriate biomaterials in the extraction site, preservation of soft tissue architecture employing a flapless technique, and placement and stabilization of the collagen plug. A case example is presented that illustrates the steps used in this technique.

  2. Esthetic consideration for alveolar socket preservation prior to implant placement: description of a technique and 80-case series report.

    Science.gov (United States)

    Kutkut, Ahmad; Andreana, Sebastiano; Monaco, Edward

    2012-01-01

    An esthetic restoration supported by dental implant rehabilitation is a major challenge to restorative dentists. The ultimate goal of a dental implant is to restore missing or extracted teeth by placing implants in anatomically, esthetically, and long-term functional restorations. Alveolar ridge preservation and site enhancement following tooth extraction has a major impact on the hard and soft tissue volume. Extraction socket preservation is technique sensitive, not 100% successful, and at times unpredictable. Current techniques may delay surgical implant placement for a few months, and the quality of new bone regeneration is questionable. The aim of this report was to describe a minimally traumatic extraction socket preservation technique using different types of bone graft as a preserver prior to implant placement applied for 80 consecutive cases.

  3. Alveolar Ridge Preservation with nc-HA and d-PTFE Membrane: A Clinical, Histologic, and Histomorphometric Study.

    Science.gov (United States)

    Laurito, Domenica; Lollobrigida, Marco; Gianno, Francesca; Bosco, Sandro; Lamazza, Luca; De Biase, Alberto

    Alveolar ridge preservation has become a very common procedure following tooth extraction. This study presents a clinical, histologic, and histomorphometric analysis of postextraction bone changes using nanocrystalline hydroxyapatite (nc-HA) and exposed high-density polytetrafluoroethylene (d-PTFE) membrane. A total of 10 extraction sockets were treated. Clinical measurements were taken after tooth extraction with a customized acrylic stent to ensure the same measurement points. At 6 months, clinical measurements were repeated and bone specimens taken. An overall bone reduction was observed. The histologic and histomorphometric analysis revealed newly formed bone (25.92% ± 18.78%), soft tissue (28.55% ± 9.73%), and residual graft particles (15.43% ± 11.08%). Further studies are necessary to evaluate the efficacy of this technique over the long term.

  4. Bilocular Stafne Bone Defect above And Below the Inferior Alveolar Canal Assessed by Cone Beam Computed Tomography: A Case Report

    Directory of Open Access Journals (Sweden)

    Mahrokh Imanimoghaddam

    2015-09-01

    Full Text Available Stafne bone defect is a bone depression containing salivary gland or fatty soft tissue on the lingual surface of the mandible. The most common location is within the submandibular gland fossa and often close to the inferior border of the mandible. This defect is asymptomatic and generally discovered only incidentally during radiographic examination of the area. Stafne bone defect appears as a well-defined, corticated, unilocular radiolucency below the mandibular canal. Although it is not uncommon for this defect to appear as a round or ovoid radiolucency, it is rarely seen as a multilocular radiolucency. This report presents a case of a developmental salivary gland defect with multilocular radiolucency above the inferior alveolar canal in a male patient

  5. Effect of buccal gap distance on alveolar ridge alteration after immediate implant placement: a microcomputed tomographic and morphometric analysis in dogs.

    Science.gov (United States)

    Pluemsakunthai, Warunee; Le, Bach; Kasugai, Shohei

    2015-02-01

    The buccal bone resorption and the deformation of soft tissue contour are major problems of immediate implant treatment. This study aims to examine the changes of alveolar bone and soft tissue after immediate implant placement in different buccal gap distances. Eight implants were placed randomly in the mandibular premolar sockets of 6 hybrid dogs with 1, 2, and 3 mm buccal gap distances. The dogs were killed after 2 or 4 months for morphometric and microcomputed tomography analyses. After 2 months, the 3-mm group had the highest buccal bone volume (BV), buccal bone/soft tissue thickness, and the lowest bone resorption. The wider the buccal gap, the more buccal bone and soft tissue were formed in this experimental setting. After 4 months, the buccal BV had decreased significantly in the 1-mm and the 2-mm groups, whereas the 3-mm group resisted to buccal bone resorption. This difference was more pronounced at the crest. The 3 mm is the optimal gap distance among the groups examined, which drastically influences the healing of bone and soft tissue surrounding the implants.

  6. From Soft Sculpture to Soft Robotics: Retracing a Physical Aesthetics of Bio-Morphic Softness

    DEFF Research Database (Denmark)

    Jørgensen, Jonas

    2017-01-01

    the soft sculpture that started proliferating in the late 1960s. Critical descriptions of these works, interestingly, frequently emphasize their similarities with living organisms and bodies as a central tenet of their aesthetics. The paper seeks to articulate aspects of a contiguity between softness...... science. Recently, soft robotics technology has also started to make its way into art, design, and architecture. This paper attempts to think an aesthetics of softness and the life-like through an artistic tradition deeply imbricated with an interrogation of softness and its physical substrates, namely...... and the life-like in these works through readings that draw on concepts from technical soft robotics research and the description of life in physics (via entropy). It is argued, that fractions of soft sculpture anticipate central interests and notions present in contemporary technical soft robotics research....

  7. Characteristic aspects of alveolar proteinosis diagnosis Aspectos característicos do diagnóstico da proteinose alveolar

    Directory of Open Access Journals (Sweden)

    Thiago Prudente Bártholo

    2012-02-01

    Full Text Available Alveolar proteinosis is an uncommon pulmonary disease characterized by an accumulation of surfactant in terminal airway and alveoli, thereby impairing gas exchange and engendering respiratory insufficiency in some cases. Three clinically and etiologically distinct forms of pulmonary alveolar proteinosis are recognized: congenital, secondary and idiopathic, the latter corresponding to 90% of the cases. In this case report we present a young male patient that was diagnosed with alveolar proteinosis. Computed tomography of the thorax, bronchoscopy and transbronchial biopsy were performed. The histopathologic aspect was characteristic. The patient was discharged in good health conditions and remains asymptomatic to date.Proteinose alveolar é uma doença pulmonar incomum caracterizada pelo acúmulo de surfactante nas vias aéreas terminais e nos alvéolos, alterando a troca gasosa e, em alguns casos, promovendo insuficiência respiratória. Três formas clínicas e etiologicamente distintas de proteinose alveolar são reconhecidas: congênitas, secundárias e idiopáticas (mais de 90% dos casos são de etiologia idiopática. Neste relato, apresentamos um homem jovem que foi diagnosticado com proteinose pulmonar. Tomografia computadorizada de tórax, broncoscopia e biópsia transbrônquica foram realizadas. O aspecto histopatológico foi característico. O paciente teve alta, com boas condições de saúde, e encontra-se assintomático nos dias de hoje.

  8. Clinical management of soft tissue sarcomas

    International Nuclear Information System (INIS)

    Pinedo, H.M.; Verweij, J.

    1986-01-01

    This book is concerned with the clinical management of soft tissue sarcomas. Topics covered include: Radiotherapy; Pathology of soft tissue sarcomas; Surgical treatment of soft tissue sarcomas; and Chemotherapy in advanced soft tissue sarcomas

  9. Soft Expert Sets

    Directory of Open Access Journals (Sweden)

    Shawkat Alkhazaleh

    2011-01-01

    Full Text Available In 1999, Molodtsov introduced the concept of soft set theory as a general mathematical tool for dealing with uncertainty. Many researchers have studied this theory, and they created some models to solve problems in decision making and medical diagnosis, but most of these models deal only with one expert. This causes a problem with the user, especially with those who use questionnaires in their work and studies. In our model, the user can know the opinion of all experts in one model. So, in this paper, we introduce the concept of a soft expert set, which will more effective and useful. We also define its basic operations, namely, complement, union intersection AND, and OR. Finally, we show an application of this concept in decision-making problem.

  10. Hard and Soft Governance

    DEFF Research Database (Denmark)

    Moos, Lejf

    2009-01-01

    The governance and leadership at transnational, national and school level seem to be converging into a number of isomorphic forms as we see a tendency towards substituting 'hard' forms of governance, that are legally binding, with 'soft' forms based on persuasion and advice. This article analyses...... of Denmark, and finally the third layer: the leadership used in Danish schools. The use of 'soft governance' is shifting the focus of governance and leadership from decisions towards influence and power and thus shifting the focus of the processes from the decision-making itself towards more focus...... the understanding of relations and the coherence of processes of influence/power/governance, the article introduces a communications model of decision-making processes as processes of influence....

  11. Soft-sediment mullions

    Science.gov (United States)

    Ortner, Hugo

    2015-04-01

    In this contribution I describe the appearance, formation and significance of soft-sediment mullions. I use several examples from synorogenic turbidites of the Alps and the Pyrenees to show their appearance in the field. Soft-sediment mullions are elongate, slightly irregular bulges at the base of coarse-grained clastic beds (sand to conglomerate), separated by narrow, elongate flames of fine-grained material (mud) protruding into the coarse-grained bed. Various processes may lead to the formation of such structures: (1) longitudinal furrows parallel to the sediment transport direction may form by spiral motion in flow rolls during sediment transport (Dzulinski, 1966; Dzulinski & Simpson, 1966). (2) Loading combined with downslope movement can produce elongate structures parallelling the dowslope direction (Anketell et al., 1970). (3) Soft-sediment mullions are oriented perpendicular or oblique to the downslope direction, and show evidence of bedding-parallel shortening. Thus, they resemble cuspate-lobate folds or mullions, which are well-known in ductile structural geology (e.g. Urai et al., 2001). Soft-sediment mullions have been observed in two cases: Either bedding-parallel shortening can be achieved by slump processes, or by active tectonic shortening. Slumping is characterized by an alternation of stretching and shortening (e.g. Ortner, 2007; Alsop & Marco 2014), and therefore mullions do overprint or are overprinted by normal faults. In active depositional systems that are subject to tectonic shortening growth strata will form, but sediments already deposited will be shortened during lithification. In some cases, the formation of soft-sediment mullions predates folding, but the most widespread expression of syn-lithification shortening seems to be soft-sediment mullions, that form in the inner arcs of fold hinges. In the examples documented so far, the size of soft-sediment mullions is dependent on the grain-size of the coarse-grained layer, in which the

  12. Fracture in Soft Materials

    DEFF Research Database (Denmark)

    Hassager, Ole

    Fracture is a phenomenon that is generally associated with solids. A key element in fracture theory is the so-called weakest link idea that fracture initiates from the largest pre-existing material imperfection. However, recent work has demonstrated that fracture can also happen in liquids, where...... surface tension will act to suppress such imperfections. Therefore, the weakest link idea does not seem immediately applicable to fracture in liquids. This presentation will review fracture in liquids and argue that fracture in soft liquids is a material property independent of pre-existing imperfections....... The following questions then emerge: What is the material description needed to predict crack initiation, crack speed and crack shape in soft materials and liquids....

  13. Biological Soft Robotics.

    Science.gov (United States)

    Feinberg, Adam W

    2015-01-01

    In nature, nanometer-scale molecular motors are used to generate force within cells for diverse processes from transcription and transport to muscle contraction. This adaptability and scalability across wide temporal, spatial, and force regimes have spurred the development of biological soft robotic systems that seek to mimic and extend these capabilities. This review describes how molecular motors are hierarchically organized into larger-scale structures in order to provide a basic understanding of how these systems work in nature and the complexity and functionality we hope to replicate in biological soft robotics. These span the subcellular scale to macroscale, and this article focuses on the integration of biological components with synthetic materials, coupled with bioinspired robotic design. Key examples include nanoscale molecular motor-powered actuators, microscale bacteria-controlled devices, and macroscale muscle-powered robots that grasp, walk, and swim. Finally, the current challenges and future opportunities in the field are addressed.

  14. Natural soft leptogenesis

    International Nuclear Information System (INIS)

    Grossman, Yuval; Kitano, Ryuichiro; Murayama, Hitoshi

    2005-01-01

    Successful soft leptogenesis requires small B-terms for the right-handed sneutrinos and a large CP violating phase between the A- and B-terms. We show that this situation is realized naturally within the framework of gauge mediated supersymmetry breaking. The A-term is dominated by contribution from gauge mediation, while supergravity effects are more important for the B-term. The different origins naturally explain simultaneously the smallness of the B-term and the large CP violating phase. The most stringent bounds on the model come from the cosmological gravitino problem. We find a viable parameter region with very light gravitino m 3/2 ∼< 16 eV, providing a consistent framework for supersymmetry phenomenology, soft leptogenesis and cosmology

  15. Towards Soft Computing Agents

    Czech Academy of Sciences Publication Activity Database

    Neruda, Roman; Krušina, Pavel; Petrová, Zuzana

    2000-01-01

    Roč. 10, č. 5 (2000), s. 859-868 ISSN 1210-0552. [SOFSEM 2000 Works hop on Soft Computing. Milovy, 27.11.2000-28.11.2000] R&D Projects: GA ČR GA201/00/1489; GA ČR GA201/99/P057 Institutional research plan: AV0Z1030915 Keywords : hybrid systems * intelligent agents Subject RIV: BA - General Mathematics

  16. BiomaSoft: sistema informático para el monitoreo y evaluación de la producción de alimentos y energía. Parte I

    Directory of Open Access Journals (Sweden)

    J. R Quevedo

    Full Text Available La producción integrada de alimentos y energía en Cuba exige procesar una diversa y voluminosa información para tomar decisiones locales, sectoriales y nacionales, con el propósito de incidir en políticas públicas, por lo que es necesario el apoyo de sistemas automatizados que faciliten el monitoreo y evaluación (ME de la producción integrada de alimentos y energía en municipios cubanos. El objetivo de esta investigación fue identificar las herramientas de diseño del sistema informático BiomaSoft y contextualizar su entorno de aplicación. La metodología de desarrollo de software fue RUP (Proceso Racional Unificado, del inglés Rational Unified Process, con UML (Lenguaje Unificado de Modelado, del inglés Unified Modeling Language como lenguaje de modelado y PHP (Pre-Procesador de Hipertexto, del inglés Hypertext Pre-Processor como lenguaje de programación. El entorno se conceptualizó mediante un modelo de dominio y se especificaron los requisitos funcionales y no funcionales que se debían cumplir, así como el Diagrama de Casos de Uso del sistema, con la descripción de actores. Para el despliegue de BiomaSoft se concibió una configuración basada en dos tipos de nodos físicos (un servidor web y ordenadores clientes, en los municipios que participan en el proyecto «La biomasa como fuente renovable de energía para el medio rural cubano» (BIOMAS-CUBA. Se concluye que el monitoreo y evaluación de la producción integrada de alimentos y energía en las condiciones cubanas puede ser realizado mediante el sistema automatizado BiomaSoft, y a este propósito contribuye la identificación de las herramientas para su diseño y la contextualización de su entorno de aplicación.

  17. Holiday fun with soft gluons

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    Emissions of soft gluons from energetic particles play an important role in collider processes. While the basic physics of soft emissions is simple, it gives rise to a variety of interesting and intricate phenomena (non-global logs, Glauber phases, super-leading logs, factorization breaking). After an introduction, I will review progress in resummation methods such as Soft-Collinear Effective Theory driven by a better understanding of soft emissions. I will also show some new results for computations of soft-gluon effects in gap-between-jets and isolation-cone cross sections.

  18. Scar Tissue Formation Following Alveolar Ridge Preservation: A Case Control Study.

    Science.gov (United States)

    Fickl, Stefan; Kauffmann, Frederic; Stappert, Christian F; Kauffmann, Anke; Schlagenhauf, Ulrich

    The aim of this retrospective case control study was to compare a porcine collagen matrix (Mucograft Seal, Geistlich) with a free gingival punch graft with respect to size, invagination, and color of resulting soft tissue scar formation. Following definition of inclusion and exclusion criteria, 22 patients were retrospectively included in this study. The patients were divided into two groups. In group A, the extraction socket was filled with bovine bone mineral (Bio-Oss, Geistlich) and covered with a free gingival punch graft. In group B, the extraction socket was filled with bovine bone mineral (Bio-Oss) and covered with porcine collagen matrix. After final prosthetic reconstruction (18 implant-retained crowns and 4 fixed partial dentures), two independent examiners evaluated the size, invagination, and color of the soft tissue scar using a modified scar-evaluation scale originally developed for dermal wounds (lower values correspond to less scarring). Patient satisfaction was recorded using a questionnaire. Patient records were screened for frequency and costs of scar removal treatment. The average scar score for groups A and B was 1.33 and 4.3, respectively, revealing significantly less scarring in group B (P = .000295). Frequency and costs of scar removal treatment were statistically significantly higher in Group A (P = .000234). Patient satisfaction was not statistically significantly different between the treatment groups (P = .711 for group A and P = .809 for group B. The results suggest that alveolar ridge preservation using bovine bone mineral and porcine collagen matrix leads to less scar tissue formation when compared with bovine bone mineral and free gingival punch grafts from the palate.

  19. Some Results on Fuzzy Soft Topological Spaces

    Directory of Open Access Journals (Sweden)

    Cigdem Gunduz (Aras

    2013-01-01

    Full Text Available We introduce some important properties of fuzzy soft topological spaces. Furthermore, fuzzy soft continuous mapping, fuzzy soft open and fuzzy soft closed mappings, and fuzzy soft homeomorphism for fuzzy soft topological spaces are given and structural characteristics are discussed and studied.

  20. Composite Alginate-Hyaluronan Sponges for the Delivery of Tranexamic Acid in Postextractive Alveolar Wounds.

    Science.gov (United States)

    Catanzano, Ovidio; D'Esposito, Vittoria; Formisano, Pietro; Boateng, Joshua S; Quaglia, Fabiana

    2018-02-01

    The management of wounds in patients on anticoagulant therapy who require oral surgical procedures is problematic and often results in a nonsatisfactory healing process. Here, we report a method to prepare an advanced dressing able to avoid uncontrolled bleeding by occluding the postextractive alveolar wounds, and simultaneously, capable of a fast release of tranexamic acid (TA). Composite alginate/hyaluronan (ALG/HA) sponge dressings loaded with TA were prepared by a straightforward internal gelation method followed by a freeze-drying step. Both blank and drug-loaded sponges were soft, flexible, and elegant in appearance and nonbrittle in nature. Scanning electron microscopy analysis confirmed the porous nature of these dressings. The integration of HA influenced the microstructure, reducing the porosity, modifying the water uptake kinetic, and increasing the resistance to compression. TA release from ALG/HA sponges showed a controlled release up to 3 h, and it was faster in the presence of HA. Finally, an in vitro clotting test performed on human whole blood confirmed that the TA-loaded sponges significantly reduce the blood clotting index by 30% compared with ALG/HA 20 sponges. These results suggest that, if placed in a socket cavity, these dressings could give a relevant help to the blood hemostasis after dental extractions, especially in patients with coagulation disorders. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  1. Alveolar ridge preservation with autologous particulated dentin-a case series.

    Science.gov (United States)

    Valdec, Silvio; Pasic, Pavla; Soltermann, Alex; Thoma, Daniel; Stadlinger, Bernd; Rücker, Martin

    2017-12-01

    Ridge preservation can be performed with autologous bone, alloplastic bone substitute material or a combination of both. Dentin is similar to bone in its chemical composition. In its use as bone substitute material, it undergoes a remodelling process and transforms to bone. The presented case report introduces a technique in which the extraction socket is augmented with autologous, particulated dentin. The fractured, non-savable mesial incisor of the upper jaw was carefully extracted in axial direction. After the extraction, the tooth was cleared from remaining periodontal tissue. The vital pulp tissue or a root canal filling, enamel and cementum were also removed. Following the particulation of the remaining dentin in a bone mill, the dentin particles were immediately filled orthotope into the alveolar socket. The soft tissue closure was performed with a free gingival graft of the palate. After an observation period of 4 months, an implant was placed in the augmented area, which osseointegrated successfully and could be restored prosthodontically in the following. The results of this method showed a functional and aesthetic success. The pre-implantological, autologous ridge preservation with dentin could be performed successfully. For the establishment of dentin as augmentation material for jaw augmentation procedures, a prospective, clinical trial is now necessary.

  2. Alveolar nerve repositioning with rescue implants for management of previous treatment. A clinical report.

    Science.gov (United States)

    Amet, Edward M; Uehlein, Chris

    2013-12-01

    The goal of modern implant dentistry is to return patients to oral health in a rapid and predictable fashion, following a diagnostically driven treatment plan. If only a limited number of implants can be placed, or some fail and the prosthetic phase of implant dentistry is chosen to complete the patient's treatment, the final outcome may result in partial patient satisfaction and is commonly referred to as a "compromise." Previous All-on-4 implant treatment for the patient presented here resulted in a compromise, with an inadequate support system for the mandibular prosthesis and a maxillary complete denture with poor esthetics. The patient was unable to function adequately and also was disappointed with the resulting appearance. Correction of the compromised treatment consisted of bilateral inferior alveolar nerve elevation and repositioning without bone removal for lateral transposition, to gain room for rescue implants for a totally implant-supported and stabilized prosthesis. Treatment time to return the patient to satisfactory comfort, function, facial esthetics, and speech was approximately 2 weeks. The definitive mandibular prosthesis was designed for total implant support and stability with patient retrievability. Adequate space between the mandibular bar system and the soft tissue created a high water bridge effect for self-cleansing. Following a short interim mandibular healing period, the maxillary sinuses were bilaterally grafted to compensate for bone inadequacies and deficiencies for future maxillary implant reconstruction. © 2013 by the American College of Prosthodontists.

  3. Evaluation of alveolar crest bone loss via premolar bitewing radiographs: presentation of a new method.

    Science.gov (United States)

    Safi, Yaser; Kadkhodazadeh, Mahdi; Safai, Pooria; Esmaeelinejad, Mohammad; Shamloo, Nafiseh

    2014-10-01

    This study aimed to assess the interdental bone level in premolar bitewing radiographs while retracting the cheeks. Seventy-two horizontal bone defects were created on dried mandibles and maxillae. The distance from the bone level to the cement-enamel junction of premolars was detected by a modified digital caliper (considered the gold standard). The reliability of all radiographs was assessed by intraclass correlation coefficient (ICC), and the validity was compared to the gold standard using the analysis of variance test. P-values less than 0.05 were considered statistically significant. This study showed that the reliability of radiographs without a cheek simulator and with 0.16 second exposure time was significantly higher than that of the two other groups (ICC=0.96 compared to 0.93 and 0.88, respectively). The results from the radiographs without a cheek simulator and with 0.16 second exposure time were more similar to the gold standard measures than those of the two other groups, although the difference was not statistically significant. Retracting the buccal soft tissue plays an important role in increasing the accuracy of radiographs in detecting the interdental alveolar bone level and produces more accurate results than increasing the exposure time, although it does not have a significant role in reliability of results.

  4. Soft Ultrathin Electronics Innervated Adaptive Fully Soft Robots.

    Science.gov (United States)

    Wang, Chengjun; Sim, Kyoseung; Chen, Jin; Kim, Hojin; Rao, Zhoulyu; Li, Yuhang; Chen, Weiqiu; Song, Jizhou; Verduzco, Rafael; Yu, Cunjiang

    2018-02-05

    Soft robots outperform the conventional hard robots on significantly enhanced safety, adaptability, and complex motions. The development of fully soft robots, especially fully from smart soft materials to mimic soft animals, is still nascent. In addition, to date, existing soft robots cannot adapt themselves to the surrounding environment, i.e., sensing and adaptive motion or response, like animals. Here, compliant ultrathin sensing and actuating electronics innervated fully soft robots that can sense the environment and perform soft bodied crawling adaptively, mimicking an inchworm, are reported. The soft robots are constructed with actuators of open-mesh shaped ultrathin deformable heaters, sensors of single-crystal Si optoelectronic photodetectors, and thermally responsive artificial muscle of carbon-black-doped liquid-crystal elastomer (LCE-CB) nanocomposite. The results demonstrate that adaptive crawling locomotion can be realized through the conjugation of sensing and actuation, where the sensors sense the environment and actuators respond correspondingly to control the locomotion autonomously through regulating the deformation of LCE-CB bimorphs and the locomotion of the robots. The strategy of innervating soft sensing and actuating electronics with artificial muscles paves the way for the development of smart autonomous soft robots. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Genomic organization of the human PAX 3 gene: DNA sequence analysis of the region disrupted in alveolar rhabdomyosarcoma

    Energy Technology Data Exchange (ETDEWEB)

    Macina, R.A.; Galili, N.; Riethman, H.C. [Wistar Inst., Philadelphia, PA (United States)] [and others

    1995-03-01

    Mutations in the human PAX3 gene have previously been associated with two distinct diseases, Waardenburg syndrome and alveolar rhabdomyosarcoma. In this report the authors establish that the normal human PAX3 gene is encoded by 8 exons. Intron-exon boundary sequences were obtained for PAX 3 exons 5, 6, 7, and 8 and together with previous work provide the complete genomic sequence organization for PAX3. Difficulties in obtaining overlapping genomic clone coverage of PAX3 were circumvented in part by RARE cleavage mapping, which showed that the entire PAX3 gene spans 100 kb of chromosome 2. Sequence analysis of the last intron of PAX3, which contains the previously mapped t(2;13)(q35;q14) translocation breakpoints of alveolar rhabdomyosarcoma, revealed the presence of a pair of inverted Alu repeats and a pair of inverted (GT){sub n}-rich microsatellite repeats with in a 5k-kb region. This work establishes the complete structure of PAX 3 and will permit high-resolution analyses of this locus for mutations associated with Waardenburg syndrome, alveolar rhabdomyosarcoma, and other phenotypes for which PAX3 may be a candidate locus.31 refs., 5 figs., 1 tab.

  6. CT findings of extrahepatic alveolar echinococcus (report of 12 cases)

    International Nuclear Information System (INIS)

    Liu Wenya; Shang Ge; Dang Jun

    2000-01-01

    Objective: To analyze the CT findings of extrahepatic alveolar echinococcus (EAE), and assess the value of CT scanning for the diagnosis of such cases. Methods: 12 patients with hepatic alveolar echinococcus (HAE) verified by operation and histology were examined by CT because of new complains. It was found that multiple organs were involved by the same lesions. Results: Brain AE (7 cases) showed single or multiple cerebral nodules, characterized by honeycombed hypodense structures or target sign after enhancement. Lung AE (3 cases) appeared as irregular, peripherally scattered nodules, with small vacuoles or cavities inside. The only 1 case with heart AE demonstrated a multiple calcifications and vacuoles within the mass. Adrenal gland AE (2 cases) presented as plaques containing different sizes of hypodense areas and calcifications. Retroperitoneal AE (2 cases) exhibited mass with plentiful calcifications. Conclusion: CT can define the location and morphology of the lesion, providing a reliable method for the diagnosis and treatment of the disease

  7. Tranexamic acid in diffuse alveolar hemorrhage (case report

    Directory of Open Access Journals (Sweden)

    Owlia MB

    2007-05-01

    Full Text Available Background: Wagener's granulomatosis (WG is a systemic necrotizing vasculitis characterized by upper and lower respiratory tract involvement and glomerulonephritis in most instances. Case Report: We report a 36 years old man with DAH secondary to WG, as the presenting feature. He successfully treated with standard immune suppressive agents including pulse methylprednisolone and cyclophospha-mide, along with tranexamic acid as adjunctive therapy for control of active bleeding. Laboratory results showed mild to moderate anemia, increased serum lactate dehydrogenase and very high c-ANCA titer. Chest radiograph showed bilateral alveolar infilterates. Conclusion: Diffuse Alveolar hemorrhage (DAH is a dread complication of Wagener’s granulomatosis. Control of acute phase of hemorrhage with tranexamic acid can improve out come of patients.

  8. Diffuse alveolar hemorrhage resulting from Pauci-immune pulmonary capillaritis

    Directory of Open Access Journals (Sweden)

    Andreia Salarini Monteiro

    2003-08-01

    Full Text Available A 27 year-old female patient, cocaine user, presenting hemoptysis and progressive dyspnea with onset 48 hours prior to hospital admission, without any other signs or symptoms. Serum tests for infectious diseases, collagen disorders and vasculitis were negative. Urinalysis was normal. Computed tomography of the chest showed diffuse alveolar infiltrate, affecting mainly the lower left lobe. A thoracoscopic lung biopsy was performed to clarify the diagnosis. The histopathological findings showed capillaritis and diffuse intra-alveolar hemorrhage. Treated with steroid and cyclophosphamide pulse therapy, a good clinical and radiographical response was obtained. The recently described pauci-immune pulmonary capillaritis is characterized by the presence of isolated pulmonary capillaritis and negative serum testing for auto-immune diseases.

  9. AUTOMATIC SEGMENTATION AND CLASSIFICATION OF CELLS FROM BRONCHO ALVEOLAR LAVAGE

    Directory of Open Access Journals (Sweden)

    Olivier Lezoray

    2011-05-01

    Full Text Available Broncho alveolar lavage is the most commonly used diagnostic tool for confirming alveolar hemorrhage. Golde has introduced a ranking score, based on the hemosiderin content of macrophages which enables ranking cells from 0 to 4 based on the degree of Prussian blue stain. We propose a complete image analysis scheme to automatically perform both the extraction of the cellular objects and the ranking of each cell according to the Golde score. The image analysis techniques used mainly involve clustering and mathematical morphology. A 2D histogram is clustered to extract the main cellular components, a color watershed is used to determine and refine the regions. Finally, the cellular components of interest are firstly classified according to their hue and secondly according to their staining repartition. The proposed image analysis technique is very fast and produces reliable and accurate results.

  10. Soft Sensors - Modern Chemical Engineering Tool

    Directory of Open Access Journals (Sweden)

    N. Bolf

    2011-04-01

    Full Text Available Control systems and optimization procedures require regular and reliable measurements at the appropriate frequency. At the same time, legal regulations dictate strict product quality specifications and refinery emissions. As a result, a greater number of process variables need to be measured and new expensive process analyzers need to be installed to achieve efficient process control. This involves synergy between plant experts, system analysts and process operators. One of the common problems in industrial plants is the inability of the real time and continuous measurement of key process variables.Absence of key value measurement in a timely manner aggravates control, but it does not mean that it is always an impossible step. As an alternative, the use of soft sensors as a substitute for process analyzers and laboratory testing is suggested. With the soft sensors, the objective is to develop an inferential model to estimate infrequently measured variables and laboratory assays using the frequently measured variables. By development of soft sensors based on measurement of continuous variables (such as flow, temperature, pressure it is possible to estimate the difficult- -to-measure variables as well as product quality and emissions usually carried by laboratory assays.Software sensors, as part of virtual instrumentation, are focused on assessing the system state variables and quality products by applying the model, thus replacing the physical measurement and laboratory analysis. Multiple linear/nonlinear regression methods and artificial intelligence methods (such as neural network, fuzzy logic and genetic algorithms are usually applied in the design of soft sensor models for identification of nonlinear processes.Review of published research and industrial application in the field of soft sensors is given with the methods of soft sensor development and nonlinear dynamic model identification. Based on soft sensors, it is possible to estimate

  11. Alveolar ridge augmentation in rats by Bio-Oss

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1991-01-01

    The purpose of the study was to examine if Bio-Oss initiated osteoinduction or osteoconduction when implanted into rats. Sintered and unsintered granules of the anorganic bovine bone Bio-Oss was implanted subperiosteally for alveolar ridge augmentation purposes and heterotopically in the abdominal...... muscles of rats. Light microscopic evaluation revealed no osteoinduction or osteoconduction in connection with sintered or unsintered Bio-Oss. A foreign body reaction was observed around both forms....

  12. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings

    OpenAIRE

    Eguía-Aguilar, Pilar; López-Martínez, Briceida; Retana-Contreras, Carmen; Perezpeña-Diazconti, Mario

    2016-01-01

    We present the case of a 2-year-old male patient with a facial tumor partially treated with chemotherapy before his admission to our institution. The tumor involved from the frontal region to the maxillary floor, the orbit, and the maxillary and sphenoid sinuses. The histopathological diagnosis revealed a stage IV alveolar rhabdomyosarcoma with infiltration to bone marrow and cerebrospinal fluid. He was managed with four cycles of adriamycin, actinomycin, cyclophosphamide and vincristine; cis...

  13. Nerve damage associated with inferior alveolar nerve blocks.

    Science.gov (United States)

    Pogrel, M A; Bryan, J; Regezi, J

    1995-08-01

    The authors reviewed 12 cases in which altered sensation occurred in the distribution of the inferior alveolar or lingual nerves following injection of a local anesthetic for restorative treatment only. Most patients suffered only partial damage, but recovery was poor. The exact mechanism of the nerve damage is unknown, but a number of theories are proposed. The extent of this problem is also unknown, but many more cases probably exist than have been reported to date.

  14. Modulation of epithelial sodium channel in human alveolar epithelial ...

    African Journals Online (AJOL)

    Modulation of epithelial sodium channel in human alveolar epithelial cells by lipoxin A4 through AhR-cAMP-dependent pathway. Bi-Huan Cheng1,2, Li-Wei Pan2, Sheng-Rong Zhang3, Bin-Yu Ying2, Ben-Ji. Wang2, Guo-Liang Lin2 and Shi-Fang Ding1*. 1Department of Critical Care Medicine, Qilu Hospital of Shandong ...

  15. Oxidative Stress, Cell Death, and Other Damage to Alveolar Epithelial Cells Induced by Cigarette Smoke

    Directory of Open Access Journals (Sweden)

    Nagai A

    2003-09-01

    Full Text Available Abstract Cigarette smoking is a major risk factor in the development of various lung diseases, including pulmonary emphysema, pulmonary fibrosis, and lung cancer. The mechanisms of these diseases include alterations in alveolar epithelial cells, which are essential in the maintenance of normal alveolar architecture and function. Following cigarette smoking, alterations in alveolar epithelial cells induce an increase in epithelial permeability, a decrease in surfactant production, the inappropriate production of inflammatory cytokines and growth factors, and an increased risk of lung cancer. However, the most deleterious effect of cigarette smoke on alveolar epithelial cells is cell death, i.e., either apoptosis or necrosis depending on the magnitude of cigarette smoke exposure. Cell death induced by cigarette smoke exposure can largely be accounted for by an enhancement in oxidative stress. In fact, cigarette smoke contains and generates many reactive oxygen species that damage alveolar epithelial cells. Whether apoptosis and/or necrosis in alveolar epithelial cells is enhanced in healthy cigarette smokers is presently unclear. However, recent evidence indicates that the apoptosis of alveolar epithelial cells and alveolar endothelial cells is involved in the pathogenesis of pulmonary emphysema, an important cigarette smoke-induced lung disease characterized by the loss of alveolar structures. This review will discuss oxidative stress, cell death, and other damage to alveolar epithelial cells induced by cigarette smoke.

  16. Simulation of lung alveolar epithelial wound healing in vitro.

    Science.gov (United States)

    Kim, Sean H J; Matthay, Michael A; Mostov, Keith; Hunt, C Anthony

    2010-08-06

    The mechanisms that enable and regulate alveolar type II (AT II) epithelial cell wound healing in vitro and in vivo remain largely unknown and need further elucidation. We used an in silico AT II cell-mimetic analogue to explore and better understand plausible wound healing mechanisms for two conditions: cyst repair in three-dimensional cultures and monolayer wound healing. Starting with the analogue that validated for key features of AT II cystogenesis in vitro, we devised an additional cell rearrangement action enabling cyst repair. Monolayer repair was enabled by providing 'cells' a control mechanism to switch automatically to a repair mode in the presence of a distress signal. In cyst wound simulations, the revised analogue closed wounds by adhering to essentially the same axioms available for alveolar-like cystogenesis. In silico cell proliferation was not needed. The analogue recovered within a few simulation cycles but required a longer recovery time for larger or multiple wounds. In simulated monolayer wound repair, diffusive factor-mediated 'cell' migration led to repair patterns comparable to those of in vitro cultures exposed to different growth factors. Simulations predicted directional cell locomotion to be critical for successful in vitro wound repair. We anticipate that with further use and refinement, the methods used will develop as a rigorous, extensible means of unravelling mechanisms of lung alveolar repair and regeneration.

  17. Diffuse alveolar hemorrhage in isolated pulmonary capillaritis: Case report

    Directory of Open Access Journals (Sweden)

    Medenica Milić

    2014-01-01

    Full Text Available Introduction. Pulmonary capillaritis is a small-diameter vessel vasculitis of the lung, which may occur in isolation as in isolated pauci-immune capillaritis, usually associated with the systemic vasculitis but it could be also related to collagen vascular diseases and in lung transplant rejection. Pulmonary capillaritis leads to diffuse alveolar hemorrhage. The clinical presentation includes symptoms like dyspnea, cough, pleuritic chest pain, fever and hemoptysis. Case Outline. A 48 year-old female patient, smoker, presented with progressive dyspnea. Serum tests for infectious diseases, collagen disorders and vasculitis were negative. Radiography and computed tomography of the chest showed diffuse alveolar infiltrates. Cytology of bronchoalveolar lavage showed presence of siderophages. A thoracoscopic lung biopsy was performed to clarify the diagnosis. The histopathological findings showed capillaritis and diffuse intraalveolar hemorrhage. Patient was treated with steroids, and good clinical and minimal radiographic response was obtained. Recently described pauci-immune pulmonary capillaritis has been characterized as p-ANCA (antineutrophil cytoplasmic antibodies negative isolated pulmonary capillaritis. Conclusion. Isolated pauci-immune pulmonary capillaritis is a rare disease. First clinical manifestations of the isolated pulmonary capillaritis were the symptoms of progressive dyspnea, radiographic and functional signs of the interstitial fibrosis. At the same time, the signs of extrapulmonary diseases were not found. Presence of siderophages in bronchoalveolar lavage indicated alveolar hemorrhage. Histopathological tests of the sample of the lung pointed to pulmonary capillaritis and intraalveolar hemorrhage. Prolonged treatment with corticosteroids was necessary.

  18. Quality assessment of systematic reviews on alveolar socket preservation.

    Science.gov (United States)

    Moraschini, V; Barboza, E Dos S P

    2016-09-01

    The aim of this overview was to evaluate and compare the quality of systematic reviews, with or without meta-analysis, that have evaluated studies on techniques or biomaterials used for the preservation of alveolar sockets post tooth extraction in humans. An electronic search was conducted without date restrictions using the Medline/PubMed, Cochrane Library, and Web of Science databases up to April 2015. Eligibility criteria included systematic reviews, with or without meta-analysis, focused on the preservation of post-extraction alveolar sockets in humans. Two independent authors assessed the quality of the included reviews using AMSTAR and the checklist proposed by Glenny et al. in 2003. After the selection process, 12 systematic reviews were included. None of these reviews obtained the maximum score using the quality assessment tools implemented, and the results of the analyses were highly variable. A significant statistical correlation was observed between the scores of the two checklists. A wide structural and methodological variability was observed between the systematic reviews published on the preservation of alveolar sockets post tooth extraction. None of the reviews evaluated obtained the maximum score using the two quality assessment tools implemented. Copyright © 2016 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  19. Effect of Alveolar Ridge Preservation after Tooth Extraction

    Science.gov (United States)

    Avila-Ortiz, G.; Elangovan, S.; Kramer, K.W.O.; Blanchette, D.; Dawson, D.V.

    2014-01-01

    Alveolar ridge preservation strategies are indicated to minimize the loss of ridge volume that typically follows tooth extraction. The aim of this systematic review was to determine the effect that socket filling with a bone grafting material has on the prevention of postextraction alveolar ridge volume loss as compared with tooth extraction alone in nonmolar teeth. Five electronic databases were searched to identify randomized clinical trials that fulfilled the eligibility criteria. Literature screening and article selection were conducted by 3 independent reviewers, while data extraction was performed by 2 independent reviewers. Outcome measures were mean horizontal ridge changes (buccolingual) and vertical ridge changes (midbuccal, midlingual, mesial, and distal). The influence of several variables of interest (i.e., flap elevation, membrane usage, and type of bone substitute employed) on the outcomes of ridge preservation therapy was explored via subgroup analyses. We found that alveolar ridge preservation is effective in limiting physiologic ridge reduction as compared with tooth extraction alone. The clinical magnitude of the effect was 1.89 mm (95% confidence interval [CI]: 1.41, 2.36; p preservation. PMID:24966231

  20. Effects of alveolar ridge preservation on delayed implant osseointegration.

    Science.gov (United States)

    Shao, Shan; Li, Bin; Xue, Hui-Min; Huang, Hai-Yun; Liu, Gang-Li

    2015-01-01

    To evaluate the effects of alveolar ridge preservation with Bio-Oss bone substitute (Geistlich Pharma) on delayed implant osseointegration. The 3rd and 4th left and right mandibular premolars were extracted from four adult healthy male and female dogs. For the experimental group, we randomly selected two extraction sockets in each dog to be filled with Bio-Oss bone substitute (Geistlich Pharma). The two remaining extraction sockets remained untreated and served as the control group. Three months after Bio-Oss placement, dental implants were inserted into the alveolar bone of the experimental group and the control group. The osteogenic activity of the bone around the implants was assessed by evaluating the histological morphology and by estimating histomorphometric parameters at 3 and 6 months after delayed implantation. At 3 months, Goldner's trichrome staining analysis showed that the bone-implant contact rate and mineralised bone area around the implant were significantly higher in the experimental group (75.98% ± 8.97% and 69.52% ± 9.63%, respectively) than in the control group (56.13% ± 8.18% and 52.82% ± 7.25%, respectively; P alveolar ridge preservation by using Bio-Oss placement can promote osseointegration of delayed implantation. This may be a promising option for clinical use.

  1. Pulmonary alveolar microlithiasis: review of the 1022 cases reported worldwide

    Directory of Open Access Journals (Sweden)

    Giuseppe Castellana

    2015-12-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a rare disease characterised by the widespread intra-alveolar accumulation of minute calculi called microliths. It is caused by mutation of the SLC34A2 gene encoding the type IIb sodium phosphate cotransporter in alveolar type II cells. The present study explores the epidemiological, familial, genetic, clinical, diagnostic, radiological and therapeutic aspects with the aim of contributing to a better understanding of this uncommon disease. We searched articles on PAM published up to December 2014 and 544 papers were found, accounting for 1022 cases. PAM is present in all continents and in many nations, in particular in Turkey, China, Japan, India, Italy and the USA. Familiality is frequent. The clinical course is not uniform and the causes of this clinical variability seem to be largely nongenetic. The optimal diagnostic procedure is the association of chest high-resolution computed tomography (HRCT with bronchoalveolar lavage, but a chest radiograph may suffice in families in which a case has already been diagnosed. Moreover, chest radiography and HRCT allow the classification of the evolutionary phase of the disease and its severity. At present lung transplantation is the only effective therapy. However, better knowledge of the gene responsible offers hope for new therapies.

  2. Alveolar echinococcosis of the liver. Findings of magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Hayasaka, Kazumasa; Tanaka, Yoshiaki; Okuhata, Yoshitaka; Yoshinobu, Takashi; Takemoto, Akiko; Himi, Kazuhisa; Mutoh, Haruomi [Nihon Univ., Tokyo (Japan). School of Medicine; Shuke, Noriyuki; Aburano, Tamio

    1995-06-01

    The purpose of the present study was to evaluate the findings of MR imaging obtained in patients with Echinococcus multilocularis involving the liver. For 10 patients with alveolar echinococcosis of the liver, the MR findings were compared with the histopathologic findings after biopsy or surgery. Conventional T1-weighted spin echo, T2-weighted spin echo and T1-weighted spin echo after Gd-DTPA were employed. The signal from the lesions of alveolar liver echinococcosis on T1-weighted images was hypointense in 16 of 23 lesions (69.6%), hyperintense in 4 (17.4%), and isointense in 3 (13.0%). The signal from the lesions on T2-weighted images was hyperintense in 20 lesions (87.0%), hypointense in 2 (8.7%), and isointense in one (4.3%). On using Gd-DTPA, 7 of 21 lesions (33.3%) were observed with rim enhancement, and 14 lesions (66.7%) were non-enhanced. We describe our clinical experience together with the various findings of MR imaging as observed in the patients with alveolar echinococcosis of the liver. MR imaging excels in visualizing a low-intensity rim and small cystic foci, with liquefaction necrotic foci displaying a variety of signal intensities. After Gd-DTPA administration, the surrounding inflammatory granulomatous foci could be more clearly visualized. (author).

  3. Requirement of alveolar bone formation for eruption of rat molars.

    Science.gov (United States)

    Wise, Gary E; He, Hongzhi; Gutierrez, Dina L; Ring, Sherry; Yao, Shaomian

    2011-10-01

    Tooth eruption is a localized event that requires a dental follicle (DF) to regulate the resorption of alveolar bone to form an eruption pathway. During the intra-osseous phase of eruption, the tooth moves through this pathway. The mechanism or motive force that propels the tooth through this pathway is controversial but many studies have shown that alveolar bone growth at the base of the crypt occurs during eruption. To determine if this bone growth (osteogenesis) was causal, experiments were designed in which the expression of an osteogenic gene in the DF, bone morphogenetic protein-6 (Bmp6), was inhibited by injection of the first mandibular molar of the rat with a small interfering RNA (siRNA) targeted against Bmp6. The injection was followed by electroporation to promote uptake of the siRNA. In 45 first molars injected, eruption was either delayed or completely inhibited (seven molars). In the impacted molars, an eruption pathway formed but bone growth at the base of the crypt was greatly reduced compared with the erupted first-molar controls. These studies show that alveolar bone growth at the base of the crypt is required for tooth eruption and that Bmp6 may be essential for promoting this growth. © 2011 Eur J Oral Sci.

  4. Massive Alveolar Hemorrhage During Wegener Granulomatosis: a Case Report

    Directory of Open Access Journals (Sweden)

    Gökhan Perincek

    2011-11-01

    Full Text Available This is a presentation of Wegener Granulomatosis (WG disease. Even though the lungs are rarely affected. massive alveolar hemorrhage is seen which leads to mortality. The patient was a 28 year old man. His illness was diagnosed as WG and glomerulonephritis a year previously and he was treated by administration of methylprednisolone orally. He had been treated irregularly. He applied to the emergency service with hemoptysis and asthma complaints two days earlier. After the results of his examination Hb: 3.6 gr/dl, Htc:10.3%, Üre:131 mg /dl, kreatini: 7.7 mg/dl, pH: 7.41, pO2: 55 mmHg, pCO2:33 mmHg, and being diagnosed as alveolar consolidation on lung X-ray, he was taken to the intensive care unit with a diagnosis of a massive alveolar hemorrhagei. He was intubated and attached to mechanical ventilation. He was treated with parenteral 1 mg/kg/day methylprednisolone and, siklofosfamid 2 mg/kg/day. He was extubated on the 21st day. He was taken to the chest service department on 24th day. He is still being treated.

  5. Alveolar osteitis following surgical removal of mandibular third molars.

    Science.gov (United States)

    Fridrich, K L; Olson, R A

    1990-01-01

    The purpose of this study was to evaluate 2 methods that could be used universally to reduce the incidence of alveolar osteitis. In addition, other variables including age and sex of patient, preoperative aspirin use and discomfort, and the use of oral contraceptives (OCs) were studied. A large controlled prospective study was completed with 952 surgical extraction sites in 476 patients. Postoperative dressings included lincomycin hydrochloride (Lincocin)/absorbable gelatin sponge (Gelfoam), oxytetracycline HCL-hydrocortisone acetate (Terra-Cortril)/absorbable gelatin sponge, and absorbable gelatin sponge/saline. Bilaterally impacted mandibular 3rd molars of similar surgical difficulty were selected. Standard accepted surgical technique was used. Patients were seen 1 and 7 days after surgery or as needed. Lincomycin hydrochloride/absorbable gelatin sponge and oxytetracycline HC1-hydrocortisone acetate/absorbable gelatin sponge were effective in reducing the incidence of alveolar osteitis. Lincomycin hydrochloride/absorbable gelatin sponge is preferred because of the increased morbidity associated with dressings containing petrolatum products. Absorbable gelatin sponge alone is not effective in reducing the incidence of alveolar osteitis. Age and OC use were found to be significant factors in the incidence of this problem.

  6. Flexidrive: a soft artificial muscle motor

    Science.gov (United States)

    Anderson, Iain A.; Tse, Tony C. H.; Inamura, Tokushu; O'Brien, Benjamin; McKay, Thomas; Gisby, Todd

    2011-04-01

    We use our thumbs and forefingers to rotate an object such as a control knob on a stereo system by moving our finger relative to our thumb. Motion is imparted without sliding and in a precise manner. In this paper we demonstrate how an artificial muscle membrane can be used to mimic this action. This is achieved by embedding a soft gear within the membrane. Deformation of the membrane results in deformation of the polymer gear and this can be used for motor actuation by rotating the shaft. The soft motors were fabricated from 3M VHB4905 membranes 0.5mm thick that were pre-stretched equibiaxially to a final thickness of 31 μm. Each membrane had polymer acrylic soft gears inserted at the center. Sectors of each membrane (60° sector) were painted on both sides with conducting carbon grease leaving gaps between adjoining sectors to avoid arcing between them. Each sector was electrically connected to a power supply electrode on the rigid acrylic frame via narrow avenues of carbon-grease. The motors were supported in rigid acrylic frames aligned concentrically. A flexible shaft was inserted through both gears. Membranes were charged using a step wave PWM voltage signal delivered using a Biomimetics Lab EAP Control unit. Both membrane viscoelasticity and the resisting torque on the shaft influence motor speed by changing the effective circumference of the flexible gear. This new soft motor opens the door to artificial muscle machines molded as a single part.

  7. Soft Condensed Matter

    International Nuclear Information System (INIS)

    Jones, Richard A L

    2002-01-01

    The author states in the preface of the book that the aim is '...to give a unified overview of the various aspects of the physics of soft condensed matter'. The book succeeds in fulfilling this aim in many respects. The style is fluent and concise and gives the necessary explanations to make its content understandable to people with some knowledge of the basic principles of physics. The content of the book is complete enough to give a panoramic view of the landscape of soft condensed matter. The first two chapters give, respectively, a short introduction and a presentation of forces, energies and timescales, giving a general overview and pointing out the particular importance of different aspects such as timescales, which are much more important in soft condensed matter than in traditional or 'hard' condensed matter. The next chapter, devoted to phase transition, recalls that the equilibrium between two phases is controlled by free energy considerations. Spinodal decomposition is presented as a counterpart of nucleation and growth. Again, characteristic length scales are considered and applied to a phase separation mixture of polymers in a common solvent. The following three chapters are devoted respectively to specific topics: colloidal dispersion, polymers and gelation. The stability and phase behaviour of colloids are related to the interaction between colloidal particles. Properties of colloidal crystals as well as colloidal dispersion are depicted in terms of stabilization of crystalline colloids. The flow properties of colloidal dispersion are presented in terms of free energy minimization and the structure of the dispersion. After a brief introduction to polymer chemistry and architecture, the coil-globule transition is discussed. Viscoelasticity of polymers is described and discussed by introducing the notion of entanglement. This leads to the introduction of the tube model and the theory of reptation. The sol-gel transition is presented phenomenologically

  8. Topological Structure of Vague Soft Sets

    Directory of Open Access Journals (Sweden)

    Chang Wang

    2014-01-01

    Full Text Available We introduce vague soft topological spaces which are defined over an initial universe with a fixed set of parameters. The notions of vague soft open sets, vague soft closed sets, vague soft interior, vague soft closure, and vague soft boundary are introduced and their basic properties and relations are investigated. Furthermore, with the help of examples they established that some properties of topological spaces and soft topological spaces do not hold in vague soft topological spaces. Vague soft connectedness and vague soft compactness are also studied.

  9. Remarks on soft omega-closed sets in soft topological spaces

    Directory of Open Access Journals (Sweden)

    Nirmala Rebecca Paul

    2015-05-01

    Full Text Available The paper introduces soft omega-closed sets in soft topological spaces and establishes the relationship between other existing generlised closed sets in soft topological spaces. It derives the basic properties of soft omega-closed sets. As an application it proves that a soft omega-closed set in a soft compact space is soft compact.

  10. Dressed Hard States and Black Hole Soft Hair.

    Science.gov (United States)

    Mirbabayi, Mehrdad; Porrati, Massimo

    2016-11-18

    A recent, intriguing Letter by Hawking, Perry, and Strominger suggests that soft photons and gravitons can be regarded as black hole hair and may be relevant to the black hole information paradox. In this Letter we make use of factorization theorems for infrared divergences of the S matrix to argue that by appropriately dressing in and out hard states, the soft-quanta-dependent part of the S matrix becomes essentially trivial. The information paradox can be fully formulated in terms of dressed hard states, which do not depend on soft quanta.

  11. Necrotizing Soft Tissue Infection

    Directory of Open Access Journals (Sweden)

    Sahil Aggarwal, BS

    2018-04-01

    Full Text Available History of present illness: A 71-year-old woman with a history of metastatic ovarian cancer presented with sudden onset, rapidly progressing painful rash in the genital region and lower abdominal wall. She was febrile to 103°F, heart rate was 114 beats per minute, and respiratory rate was 24 per minute. Her exam was notable for a toxic-appearing female with extensive areas of erythema, tenderness, and induration to her lower abdomen, intertriginous areas, and perineum with intermittent segments of crepitus without hemorrhagic bullae or skin breakdown. Significant findings: Computed tomography (CT of the abdominal and pelvis with intravenous (IV contrast revealed inflammatory changes, including gas and fluid collections within the ventral abdominal wall extending to the vulva, consistent with a necrotizing soft tissue infection. Discussion: Necrotizing fasciitis is a serious infection of the skin and soft tissues that requires an early diagnosis to reduce morbidity and mortality. Classified into several subtypes based on the type of microbial infection, necrotizing fasciitis can rapidly progress to septic shock or death if left untreated.1 Diagnosing necrotizing fasciitis requires a high index of suspicion based on patient risk factors, presentation, and exam findings. Definitive treatment involves prompt surgical exploration and debridement coupled with IV antibiotics.2,3 Clinical characteristics such as swelling, disproportionate pain, erythema, crepitus, and necrotic tissue should be a guide to further diagnostic tests.4 Unfortunately, lab values such as white blood cell count and lactate imaging studies have high sensitivity but low specificity, making the diagnosis of necrotizing fasciitis still largely a clinical one.4,5 CT is a reliable method to exclude the diagnosis of necrotizing soft tissue infections (sensitivity of 100%, but is only moderately reliable in correctly identifying such infections (specificity of 81%.5 Given the emergent

  12. The Milieu of Damaged Alveolar Epithelial Type 2 Cells Stimulates Alveolar Wound Repair by Endogenous and Exogenous Progenitors

    Science.gov (United States)

    Buckley, Susan; Shi, Wei; Carraro, Gianni; Sedrakyan, Sargis; Da Sacco, Stefano; Driscoll, Barbara A.; Perin, Laura; De Filippo, Roger E.

    2011-01-01

    Alveolar epithelial integrity is dependent upon the alveolar milieu, yet the milieu of the damaged alveolar epithelial cell type 2 (AEC2) has been little studied. Characterization of its components may offer the potential for ex vivo manipulation of stem cells to optimize their therapeutic potential. We examined the cytokine profile of AEC2 damage milieu, hypothesizing that it would promote endogenous epithelial repair while recruiting cells from other locations and instructing their engraftment and differentiation. Bronchoalveolar lavage and lung extract from hyperoxic rats represented AEC2 in vivo damage milieu, and medium from a scratch-damaged AEC2 monolayer represented in vitro damage. CINC-2 and ICAM, the major cytokines detected by proteomic cytokine array in AEC2 damage milieu, were chemoattractive to normoxic AECs and expedited in vitro wound healing, which was blocked by their respective neutralizing antibodies. The AEC2 damage milieu was also chemotactic for exogenous uncommitted human amniotic fluid stem cells (hAFSCs), increasing migration greater than 20-fold. hAFSCs attached within an in vitro AEC2 wound and expedited wound repair by contributing cytokines migration inhibitory factor and plasminogen activator inhibitor 1 to the AEC2 damage milieu, which promoted wound healing. The AEC2 damage milieu also promoted differentiation of a subpopulation of hAFSCs to express SPC, TTF-1, and ABCA3, phenotypic markers of distal alveolar epithelium. Thus, the microenvironment created by AEC2 damage not only promotes autocrine repair but also can attract uncommitted stem cells, which further augment healing through cytokine secretion and differentiation. PMID:21700959

  13. Mechanism of action and morphologic changes in the alveolar bone in response to selective alveolar decortication-facilitated tooth movement.

    Science.gov (United States)

    Baloul, S Susan; Gerstenfeld, Louis C; Morgan, Elise F; Carvalho, Roberto S; Van Dyke, Thomas E; Kantarci, Alpdogan

    2011-04-01

    The aim of this study was to test if corticotomy-induced osteoclastogenesis and bone remodeling underlie orthodontic tooth movement and how selective alveolar decortication enhances the rate of tooth movement. A total of 114 Sprague-Dawley rats were included in 3 treatment groups: selective alveolar decortication alone (SADc); tooth movement alone (TM); and "combined" therapy (SADc + TM). Surgery was performed around the buccal and palatal aspects of the left maxillary first molar tooth and included 5 decortication dots on each side. Tooth movement was performed on the first molar using a 25-g Sentalloy spring. Measurements were done at baseline (day 0: no treatment rendered) and on days 3, 7, 14, 21, 28 and 42. Microcomputed tomography, Faxitron analyses, and quantitative real-time polymerase chain reaction (q-PCR) of expressed mRNAs were used to assess changes. The combined group showed increased tooth movement (P = 0.04) at 7 days compared with the tooth movement group with significantly decreased bone volume (62%; P = 0.016) and bone mineral content (63%; P = 0.015). RNA markers of osteoclastic cells and key osteoclastic regulators (M-CSF [macrophage colony-stimulating factor], RANKL [receptor activator of nuclear factor kappa-B ligand], OPG [osteoprotegerin], calcitonin receptor [CTR], TRACP-5b [tartrate-resistant acid phosphatase 5b], cathepsin K [Ctsk]) all showed expression indicating increased osteoclastogenesis in the combined group. RNA markers of osteoblastic cells (OPN [osteopontin], BSP [bone sialoprotein], OCN [osteocalcin]) also showed increased anabolic activity in response to the combination of alveolar decortication and tooth movement. The data suggest that the alveolar decortication enhances the rate of tooth movement during the initial tooth displacement phase; this results in a coupled mechanism of bone resorption and bone formation during the earlier stages of treatment, and this mechanism underlies the rapid orthodontic tooth movement

  14. Influence of the Alveolar Cleft Type on Preoperative Estimation Using 3D CT Assessment for Alveolar Cleft

    Directory of Open Access Journals (Sweden)

    Hang Suk Choi

    2012-09-01

    Full Text Available Background The bone graft for the alveolar cleft has been accepted as one of the essentialtreatments for cleft lip patients. Precise preoperative measurement of the architecture andsize of the bone defect in alveolar cleft has been considered helpful for increasing the successrate of bone grafting because those features may vary with the cleft type. Recently, somestudies have reported on the usefulness of three-dimensional (3D computed tomography(CT assessment of alveolar bone defect; however, no study on the possible implication of thecleft type on the difference between the presumed and actual value has been conducted yet.We aimed to evaluate the clinical predictability of such measurement using 3D CT assessmentaccording to the cleft type.Methods The study consisted of 47 pediatric patients. The subjects were divided according tothe cleft type. CT was performed before the graft operation and assessed using image analysissoftware. The statistical significance of the difference between the preoperative estimationand intraoperative measurement was analyzed.Results The difference between the preoperative and intraoperative values were -0.1±0.3cm3 (P=0.084. There was no significant intergroup difference, but the groups with a cleftpalate showed a significant difference of -0.2±0.3 cm3 (P<0.05.Conclusions Assessment of the alveolar cleft volume using 3D CT scan data and image analysissoftware can help in selecting the optimal graft procedure and extracting the correct volumeof cancellous bone for grafting. Considering the cleft type, it would be helpful to extract anadditional volume of 0.2 cm3 in the presence of a cleft palate.

  15. Soft skills and dental education.

    Science.gov (United States)

    Gonzalez, M A G; Abu Kasim, N H; Naimie, Z

    2013-05-01

    Soft skills and hard skills are essential in the practice of dentistry. While hard skills deal with technical proficiency, soft skills relate to a personal values and interpersonal skills that determine a person's ability to fit in a particular situation. These skills contribute to the success of organisations that deal face-to-face with clients. Effective soft skills benefit the dental practice. However, the teaching of soft skills remains a challenge to dental schools. This paper discusses the different soft skills, how they are taught and assessed and the issues that need to be addressed in their teaching and assessment. The use of the module by the Faculty of Dentistry, University of Malaya for development of soft skills for institutions of higher learning introduced by the Ministry of Higher Education, Malaysia. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  16. Fundamentals of soft robot locomotion.

    Science.gov (United States)

    Calisti, M; Picardi, G; Laschi, C

    2017-05-01

    Soft robotics and its related technologies enable robot abilities in several robotics domains including, but not exclusively related to, manipulation, manufacturing, human-robot interaction and locomotion. Although field applications have emerged for soft manipulation and human-robot interaction, mobile soft robots appear to remain in the research stage, involving the somehow conflictual goals of having a deformable body and exerting forces on the environment to achieve locomotion. This paper aims to provide a reference guide for researchers approaching mobile soft robotics, to describe the underlying principles of soft robot locomotion with its pros and cons, and to envisage applications and further developments for mobile soft robotics. © 2017 The Author(s).

  17. Regeneración ósea guiada para el aumento vertical del reborde alveolar

    OpenAIRE

    Nappe, C.E.; Baltodano, C.E.

    2013-01-01

    Se considera como aumento óseo vertical, cualquier técnica que apunte a crear una mayor altura del reborde alveolar. A inicios de la década de los 90’s se empezó a utilizar la regeneración ósea guiada (ROG) en mandíbulas atróficas, con el fin de permitir la instalación de implantes óseointegrados. Con el fin de evaluar y exponer parte de la evidencia disponible en la actualidad, con respecto a la ROG para aumento óseo vertical, se realizó la siguiente revisión bibliográfica.

  18. Fundamentals of soft robot locomotion

    OpenAIRE

    Calisti, M.; Picardi, G.; Laschi, C.

    2017-01-01

    Soft robotics and its related technologies enable robot abilities in several robotics domains including, but not exclusively related to, manipulation, manufacturing, human���robot interaction and locomotion. Although field applications have emerged for soft manipulation and human���robot interaction, mobile soft robots appear to remain in the research stage, involving the somehow conflictual goals of having a deformable body and exerting forces on the environment to achieve locomotion. This p...

  19. The Countabilities of Soft Topological Spaces

    OpenAIRE

    Weijian Rong

    2012-01-01

    Soft topological spaces are considered as mathematical tools for dealing with uncertainties, and a fuzzy topological space is a special case of the soft topological space. The purpose of this paper is to study soft topological spaces. We introduce some new concepts in soft topological spaces such as soft first-countable spaces, soft second-countable spaces and soft separable spaces, and some basic properties of these concepts are explored.

  20. Soft Robotic Actuators

    Science.gov (United States)

    Godfrey, Juleon Taylor

    In this thesis a survey on soft robotic actuators is conducted. The actuators are classified into three main categories: Pneumatic Artificial Muscles (PAM), Electronic Electroactive Polymers (Electric EAP), and Ionic Electroactive Polymers (Ionic EAP). Soft robots can have many degrees and are more compliant than hard robots. This makes them suitable for applications that are difficult for hard robots. For each actuator background history, build materials, how they operate, and modeling are presented. Multiple actuators in each class are reviewed highlighting both their use and their mathematical formulation. In addition to the survey the McKibben actuator was chosen for fabrication and in-depth experimental analysis. Four McKibben actuators were fabricated using mesh sleeve, barbed hose fittings, and different elastic bladders. All were actuated using compressed air. Tensile tests were performed for each actuator to measure the tension force as air pressure increased from 20 to 100 psi in 10 psi increments. To account for material relaxation properties eleven trials for each actuator were run for 2-3 days. In conclusion, the smallest outer diameter elastic bladder was capable of producing the highest force due to the larger gap between the bladder and the sleeve.

  1. Soft skills and Moodle

    Directory of Open Access Journals (Sweden)

    Ivanova Veronica

    2017-01-01

    Full Text Available At present, technical university graduates are expected to acquire a set of not only hard skills but soft ones as well, which are in the first instance communication skills that can be developed through active and interactive methods during in-class learning. The issue related to communicative skills development is being discussed in different countries throughout the world. This problem is faced by university graduates from Europe, the US and Russia, and in the East. The learning process exploits a variety of electronic platforms, which, on the one hand, significantly increase the pool of students, but, on the other hand, hinder the development of communicative skills. This poses the question about blended learning which combines active and interactive teaching methods with e-learning. Consider a good example of these two types of combined student activity obtained using interactive methods in the Moodle course “Professional training in English” designed for the Bachelor's Degree Programs, Tomsk Polytechnic University (Tomsk, Russia. This paper considers the main types of tasks used in the e-course. It is shown that the teacher’s first aim is to be not a scientific knowledge translator, but to foster a creative educational environment by selecting an optimal teaching strategy through modern educational technology; an e-course is a good teaching aid to build hard and soft skills.

  2. Deployable Soft Composite Structures

    Science.gov (United States)

    Wang, Wei; Rodrigue, Hugo; Ahn, Sung-Hoon

    2016-02-01

    Deployable structure composed of smart materials based actuators can reconcile its inherently conflicting requirements of low mass, good shape adaptability, and high load-bearing capability. This work describes the fabrication of deployable structures using smart soft composite actuators combining a soft matrix with variable stiffness properties and hinge-like movement through a rigid skeleton. The hinge actuator has the advantage of being simple to fabricate, inexpensive, lightweight and simple to actuate. This basic actuator can then be used to form modules capable of different types of deformations, which can then be assembled into deployable structures. The design of deployable structures is based on three principles: design of basic hinge actuators, assembly of modules and assembly of modules into large-scale deployable structures. Various deployable structures such as a segmented triangular mast, a planar structure comprised of single-loop hexagonal modules and a ring structure comprised of single-loop quadrilateral modules were designed and fabricated to verify this approach. Finally, a prototype for a deployable mirror was developed by attaching a foldable reflective membrane to the designed ring structure and its functionality was tested by using it to reflect sunlight onto to a small-scale solar panel.

  3. Horizontal alveolar ridge augmentation using autologous press fit bone cylinders and micro-lag-screw fixation: technical note and initial experience.

    Science.gov (United States)

    Streckbein, Philipp; Kähling, Christopher; Wilbrand, Jan-Falco; Malik, Christoph-Yves; Schaaf, Heidrun; Howaldt, Hans-Peter; Streckbein, Roland

    2014-07-01

    The use of autologous block bone grafts for horizontal alveolar ridge augmentation in dental implantology is a common surgical procedure. Typically, bone grafts are individually moulded. The aim of this paper is to introduce an innovative procedure in lateral bone augmentation, where the recipient side is adjusted to the graft, not vice versa as in common procedures. Our initial clinical experience of twenty-five consecutive cases is presented. Adjusted trephine drills were used to harvest partly cylindrical grafts from the retromolar region of the mandible. After preparing the recipient site with accurately fitting grinding drills, the bone grafts were transplanted. The horizontally compromised alveolar ridges were successfully augmented and treated with dental implants. No major complication occurred during transplantation, the healing period, and subsequent implant therapy in our experimental setting with 25 patients and 38 augmentation procedures. One out of twenty-five patients presented with temporary dysaesthesia of the inferior alveolar nerve. The new method presented is an effective treatment option for horizontal alveolar ridge augmentation prior to single implant installation. Further studies should evaluate the donor site morbidity and long-term outcome on a larger population. Copyright © 2014 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  4. Coronectomy versus surgical removal of the lower third molars with a high risk of injury to the inferior alveolar nerve. A bibliographical review

    Science.gov (United States)

    Moreno-Vicente, Javier; Schiavone-Mussano, Rocío; Clemente-Salas, Enrique; Marí-Roig, Antoni; Jané-Salas, Enric

    2015-01-01

    Background Coronectomy is the surgical removal of the crown of the tooth deliberately leaving part of its roots. This is done with the hope of eliminating the pathology caused, and since the roots are still intact, the integrity of the inferior alveolar nerve is preserved. Objectives The aim is to carry out a systematic review in order to be able to provide results and conclusions with the greatest scientific evidence possible. Material and Methods A literature review is carried out through the following search engines: Pubmed MEDLINE, Scielo, Cochrane library and EMI. The level of evidence criteria from the Agency for Healthcare Research and Quality was applied, and the clinical trials’ level of quality was analyzed by means of the JADAD criteria. Results The following articles were obtained which represents a total of 17: 1 systematic review, 2 randomized clinical trials and 2 non-randomized clinical trials, 3 cohort studies, 2 retrospective studies, 3 case studies and 4 literature reviews. Conclusions Coronectomy is an adequate preventative technique in protecting the inferior alveolar nerve, which is an alternative to the conventional extraction of third molars, which unlike the former technique, presents a high risk of injury to the inferior alveolar nerve. However, there is a need for new clinical studies, with a greater number of samples and with a longer follow-up period in order to detect potential adverse effects of the retained roots. Key words: Coronectomy, inferior alveolar nerve, nerve injury, wisdom tooth removal, paresthesia, and systematic review. PMID:25858081

  5. Interim endodontic therapy for alveolar socket bone regeneration of infected hopeless teeth prior to implant therapy.

    Science.gov (United States)

    Rass, Marwan Abou

    2010-01-01

    The immediate placement of implants in the fresh extraction sockets of infected teeth with periradicular and periapical lesions is contraindicated because of both the infection and the loss of architecture required for proper implant placement. There are 4 approaches for implant replacement of a hopeless tooth with lesions: (1) extraction and delayed implant placement; (2) extraction, debridement, guided bone regeneration (GBR), guided tissue regeneration (GTR), and delayed implant placement; (3) extraction, intrasocket debridement, and immediate implant placement; or (4) extraction, debridement, GBR, GTR, and simultaneous implant placement. The extraction of such hopeless teeth often results in large bone and soft tissue defects that are difficult to repair. This article introduces an alternative approach: interim endodontic implant site preparation, defined as a transitional, surgical, or nonsurgical endodontic treatment to regenerate the hopeless tooth bone defects and prepare the site for proper implant placement. This article describes 3 distinct interim endodontic protocols used to manage 5 patients, all of whom had severely infected hopeless teeth with large lesions and were treatment planned for implant replacement: the first, interim nonsurgical endodontic treatment to restore the normal anatomy of the infected hopeless tooth; the second, interim surgical endodontics on the hopeless tooth with preexisting endodontic treatment to regenerate apical bone for primary implant stability, thus avoiding the involvement of the maxillary sinus and other critical anatomic structures; and the third, interim surgical endodontics on the hopeless tooth with preexisting endodontic treatment to confine the size of the osseous defect and simplify the GBR and GTR procedures. The outcome of interim endodontic treatment on these 5 patients demonstrated that tooth extraction would have been a less predictable approach. The interim treatment changed the overall direction of the

  6. Correction of Large Oro-antral Communications From Previously Failed Implant Treatment: Reconstruction of Hard and Soft Tissues.

    Science.gov (United States)

    Petrungaro, Paul S; Gonzalez, Santiago; Villegas, Carlos

    2018-02-01

    As dental implants become more popular for the treatment of partial and total edentulism and treatment of "terminal dentitions," techniques for the management of the atrophic posterior maxillae continue to evolve. Although dental implants carry a high success rate long term, attention must be given to the growing numbers of revisions or retreatment of cases that have had previous dental implant treatment and/or advanced bone replacement procedures that, due to either poor patient compliance, iatrogenic error, or poor quality of the pre-existing alveolar and/or soft tissues, have led to large osseous defects, possibly with deficient soft-tissue volume. In the posterior maxillae, where the poorest quality of bone in the oral cavity exists, achieving regeneration of the alveolar bone and adequate volume of soft tissue remains a complex procedure. This is made even more difficult when dealing with loss of dental implants previously placed, aggressive bone reduction required in various implant procedures, and/or residual sinus infections precluding proper closure of the oral wound margins. The purpose of this article is to outline a technique for the total closure of large oro-antral communications, with underlying osseous defects greater than 15 mm in width and 30 mm in length, for which multiple previous attempts at closure had failed, to achieve not only the reconstruction of adequate volume and quality of soft tissues in the area of the previous fistula, but also total regeneration of the osseous structures in the area of the large void.

  7. Effects of fibrin adhesive material (Tissucol) on alveolar healing in rats under stress.

    OpenAIRE

    Alves-Rezende, Maria C. R. [UNESP; Okamoto, Tetuo [UNESP

    1997-01-01

    The effects of Tissucol on alveolar healing following stress were evaluated histologically, comparing three groups of 28 male albino rats each. Stress was applied and their right upper incisors were extracted. Group A served as an empty control site. In Group B, Tissucol was applied into the alveolar cavity. Group C received local antifibrinolytic treatment (alveolar irrigation with epsilon-aminocaproic acid solution) before implant of Tissucol into the tooth socket. Four animals in each grou...

  8. Differentiated bronchiolar epithelium in alveolar ducts of rats exposed to ozone for 20 months

    Energy Technology Data Exchange (ETDEWEB)

    Pinkerton, K.E.; Dodge, D.E.; Cederdahl-Demmler, J.; Wong, V.J.; Peake, J.; Haselton, C.J.; Mellick, P.W.; Singh, G.; Plopper, C.G. (Univ. of California, Davis (United States))

    1993-03-01

    The effects of exposure to 1.0 ppm of ozone for twenty months were studied in male Fischer 344 rats. Light microscopic, morphometric, and immunohistological approaches were used to determine the distribution and degree of differentiation of ciliated and nonciliated bronchiolar epithelial (Clara) cells lining alveolar ducts of the central acinus, a primary target of ozone-induced lung injury. Alveolar duct pathways extending beyond the level of the most proximal alveolar outpocketing of terminal bronchioles were isolated in longitudinal profile. The distance that ciliated and nonciliated bronchiolar epithelial (Clara) cells projected down each alveolar duct pathway was determined by placing concentric arcs radiating outward from a single reference point at the level of the first alveolar outpocketing. A high degree of heterogeneity in the magnitude of bronchiolar epithelial cell extension into alveolar ducts was noted for each isolation and animal. Age-matched control animals also demonstrated variation in the degree of bronchiolar epithelial cell extension down alveolar ducts. In animals exposed to ozone, a striking similarity was noted by scanning electron microscopy in the surface characteristics of cells lining both terminal bronchioles and alveolar ducts. The presence of Clara cell secretory protein in cells of bronchioles and alveolar ducts was also detected immunohistochemically and visualized using confocal laser scanning microscopy in the reflectance mode. Well-differentiated ciliated and nonciliated bronchiolar epithelial cells were found lining alveolar septal tips and alveoli up to a depth of 1,000 mu into the pulmonary acinus after 20 months of exposure to ozone. No evidence of inflammation was present in alveolar ducts, suggesting that epithelial cell transformations in alveolar ducts is a natural consequence of lifetime exposures to oxidant gases.

  9. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation

    OpenAIRE

    Schwartz, João Paulo; Raveli, Taisa Boamorte; Schwartz-Filho, Humberto Osvaldo; Raveli, Dirceu Barnabé

    2016-01-01

    ABSTRACT Objective: This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. Methods: The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years), Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0) and after Herbst treatment (T1). Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B), lingual (L) and to...

  10. A digital evaluation of alveolar ridge preservation at implants placed immediately into extraction sockets: an experimental study in the dog.

    Science.gov (United States)

    Favero, Giacomo; Lang, Niklaus P; Romanelli, Piero; Pantani, Fabio; Caneva, Marco; Botticelli, Daniele

    2015-01-01

    To compare with pristine sites bone resorption and soft tissue adaptation at implants placed immediately into extraction sockets (IPIES) in conjunction with deproteinized bovine bone mineral (DBBM) particles and a collagen membrane. The mesial root of the third premolar in the left side of the mandible was endodontically treated (Test). Flaps were elevated, the tooth hemi-sectioned, and the distal root removed to allow the immediate installation of an implant into the extraction socket in a lingual position. DBBM particles were placed into the defect and on the outer contour of the buccal bony ridge, concomitantly with the placement of a collagen membrane. A non-submerged healing was allowed. The premolar on the right side of the mandible was left in situ (control). Ground sections from the center of the implant as well as from the center of the distal root of the third premolar of the opposite side of the mandible were obtained. The histological image from the implant site was superimposed to that of the contralateral pristine distal alveolus, and dimensional variation evaluated for the hard tissue and the alveolar ridge. After 3 months of healing, both histological and photographic evaluation revealed a reduction of hard and soft tissue dimensions. The contour augmentation performed with DBBM particles and a collagen membrane at the buccal aspects of implants placed IPIES was not able to maintain the tissue volume. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Prosthetic soft contact lenses in Japan.

    Science.gov (United States)

    Kanemoto, Masumi; Toshida, Hiroshi; Takahiro, Itagaki; Murakami, Akira

    2007-11-01

    To investigate the use of the prosthetic iris-tinted soft contact lens, the SEED Opaque, during the past 5 years. The records of 42 outpatients (48 eyes) for whom the prosthetic soft contact lens was prescribed in the contact lens clinic of Juntendo University Hospital from July 2001 to June 2005 were investigated. An investigation was conducted in regard to the tint patterns of the prosthetic soft contact lens and the presence or absence of a transparent part in the middle, as a brown iris with a clear pupil or a solid pupil. The diagnosis, purpose of prescription, age when that lens was prescribed, complications, and changes in corrected visual acuities were analyzed retrospectively from the medical records. The mean age at the first prescription, total number of years of wearing prosthetic contact lenses, total number of prescriptions, and mean period to use each SEED Opaque lens were compared. The mean age at the first prescription of solid-pupil lens wearers was significantly younger than that for clear-pupil lens wearers (Ppossible to adjust the color and size of the cosmetic part and the pupil diameter. Further, corrected visual acuities could improve with the clear-pupil type for patients who had prescribed for improvement of visual function.

  12. Augmentation of residual alveolar bone height with tissue engineering for dental implant placement

    Directory of Open Access Journals (Sweden)

    S M Balaji

    2014-01-01

    Full Text Available The challenge of correcting deficient vertical alveolar height for dental implant placement has been there since dental implants came in to regular clinical placement. The ability of various methods to increase the residual alveolar height has met with varying results. The primary reason is that the techniques were not quite successful in maintaining the required residual alveolar height. Use of Bone Morphogentic Protein, especially rhBMP-2 has been met with high degree of success in deficient vertical alveolar height in a mandibular ridge. The demonstration of this using a case has been presented here.

  13. Alveolar nitric oxide in adults with asthma: evidence of distal lung inflammation in refractory asthma.

    Science.gov (United States)

    Berry, M; Hargadon, B; Morgan, A; Shelley, M; Richter, J; Shaw, D; Green, R H; Brightling, C; Wardlaw, A J; Pavord, I D

    2005-06-01

    Recent studies have suggested that alveolar nitric oxide (NO) concentration is a noninvasive test of distal lung inflammation. The current study determined whether alveolar NO concentration can be measured in patients with asthma of varying severity, tested the hypothesis that there is an association between alveolar NO and bronchoalveolar lavage (BAL) eosinophil count and determined whether refractory asthma is characterised by a raised alveolar NO concentration. Finally, the present authors assessed the effect of 2 weeks of prednisolone (30 mg q.d.) on alveolar NO concentration. Alveolar NO concentration was both measurable and repeatable in patients with refractory asthma. A positive correlation was found between alveolar NO concentration and BAL eosinophil count but not with bronchial wash or sputum eosinophil count. Alveolar NO concentration was increased in patients with refractory asthma (7.1 ppb) compared with mild-to-moderate asthma (3.4 ppb) and normal controls (3.4 ppb) and reduced by treatment with prednisolone. In conclusion, these findings support the hypothesis that alveolar nitric oxide is a measure of distal airway inflammation and suggest that distal lung inflammation is present in refractory asthma.

  14. Some Results on Soft Multi Topology

    Directory of Open Access Journals (Sweden)

    Deniz Tokat

    2013-06-01

    Full Text Available In this article, at first we recall the concept of soft multiset. Then some results which we obtained on soft multisets were given. Moreover, in this paper, the notion of soft multi topology was introduced and some results on soft multi topology and the concept of the soft multi base were presented.

  15. Embodying Soft Wearables Research

    DEFF Research Database (Denmark)

    Tomico, Oscar; Wilde, Danielle

    2016-01-01

    The value of engaging sensory motor skills in the design and use of smart systems is increasingly recognized. Yet robust and reliable methods for development, reporting and transfer are not fully understood. This workshop investigates the role of embodied design research techniques in the context...... of soft wearables. Throughout, we will experiment with how embodied design research techniques might be shared, developed, and used as direct and unmediated vehicles for their own reporting. Rather than engage in oral presentations, participants will lead each other through a proven embodied method...... or approach. Then small groups will create mash-ups of techniques, exploring ways that the new approaches might be coherently reported. By applying such methods to the problem of their reporting, we hope to deepen understanding of how to move towards nuanced and repeatable methods for embodied design...

  16. Soft Costs Fact Sheet

    Energy Technology Data Exchange (ETDEWEB)

    None

    2016-05-01

    This fact sheet is an overview of the systems integration subprogram at the U.S. Department of Energy SunShot Initiative. Soft costs can vary significantly as a result of a fragmented energy marketplace. In the U.S., there are 18,000 jurisdictions and 3,000 utilities with different rules and regulations for how to go solar. The same solar equipment may vary widely in its final installation price due to process and market variations across jurisdictions, creating barriers to rapid industry growth. SunShot supports the development of innovative solutions that enable communities to build their local economies and establish clean energy initiatives that meet their needs, while at the same time creating sustainable solar market conditions.

  17. Soft matter physics

    CERN Document Server

    Williams, Claudine

    1999-01-01

    What do colloids, fractals, liquid crystals, and polymers have in common? Nothing at first sight. Yet the distance scales, the energy transfers, the way these objects react to an external field are very similar. For the first time, this book offers an introduction to the physics of these soft materials in one single volume. A variety of experiments and concepts are presented, including the phenomena of capillarity and wetting, fractals, small volumes and large surfaces, colloids, surfactants, giant micelles and fluid membranes, polymers, and liquid crystals. Each chapter is written by experts in the field with the aim of making the book accessible to the widest possible scientific audience: graduate students, lecturers, and research scientists in physics, chemistry, and other disciplines. Nobel Prize winner Pierre-Gilles de Gennes inspired this book and has written a foreword.

  18. Soft Computing Applications in Optimization, Control, and Recognition

    CERN Document Server

    Castillo, Oscar

    2013-01-01

    Soft computing includes several intelligent computing paradigms, like fuzzy logic, neural networks, and bio-inspired optimization algorithms. This book describes the application of soft computing techniques to intelligent control, pattern recognition, and optimization problems. The book is organized in four main parts. The first part deals with nature-inspired optimization methods and their applications. Papers included in this part propose new models for achieving intelligent optimization in different application areas. The second part discusses hybrid intelligent systems for achieving control. Papers included in this part make use of nature-inspired techniques, like evolutionary algorithms, fuzzy logic and neural networks, for the optimal design of intelligent controllers for different kind of applications. Papers in the third part focus on intelligent techniques for pattern recognition and propose new methods to solve complex pattern recognition problems. The fourth part discusses new theoretical concepts ...

  19. Soft-collinear supersymmetry

    Science.gov (United States)

    Cohen, Timothy; Elor, Gilly; Larkoski, Andrew J.

    2017-03-01

    Soft-Collinear Effective Theory (SCET) is a framework for modeling the infrared structure of theories whose long distance behavior is dominated by soft and collinear divergences. This paper demonstrates that SCET can be made compatible with super-symmetry (SUSY). Explicitly, the effective Lagrangian for N=1 SUSY Yang-Mills is cconstructed and shown to be a complete description for the infrared of this model. For contrast, we also construct the effective Lagrangian for chiral SUSY theories with Yukawa couplings, specifically the single flavor Wess-Zumino model. Only a subset of the infrared divergences are reproduced by the Lagrangian — to account for the complete low energy description requires the inclusion of local operators. SCET is formulated by expanding fields along a light-like direction and then subsequently integrating out degrees-of-freedom that are away from the light-cone. Defining the theory with respect to a specific frame obfuscates Lorentz invariance — given that SUSY is a space-time symmetry, this presents a possible obstruction. The cleanest language with which to expose the congruence be-tween SUSY and SCET requires exploring two novel formalisms: collinear fermions as two-component Weyl spinors, and SCET in light-cone gauge. By expressing SUSY Yang-Mills in "collinear superspace", a slice of superspace derived by integrating out half the fermionic coordinates, the light-cone gauge SUSY SCET theory can be written in terms of superfields. As a byproduct, bootstrapping up to the full theory yields the first algorithmic approach for determining the SUSY Yang-Mills on-shell superspace action. This work paves the way toward discovering the effective theory for the collinear limit of N=4 SUSY Yang-Mills.

  20. Soft-collinear supersymmetry

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, Timothy [Institute of Theoretical Science, University of Oregon,Eugene, OR 97403 (United States); Elor, Gilly [Institute of Theoretical Science, University of Oregon,Eugene, OR 97403 (United States); Center for Theoretical Physics, Massachusetts Institute of Technology,Cambridge, MA 02139 (United States); Larkoski, Andrew J. [Physics Department, Reed College,Portland, OR 97202 (United States); Center for Fundamental Laws of Nature, Harvard University,Cambridge, MA 02138 (United States)

    2017-03-03

    Soft-Collinear Effective Theory (SCET) is a framework for modeling the infrared structure of theories whose long distance behavior is dominated by soft and collinear divergences. This paper demonstrates that SCET can be made compatible with supersymmetry (SUSY). Explicitly, the effective Lagrangian for N=1 SUSY Yang-Mills is constructed and shown to be a complete description for the infrared of this model. For contrast, we also construct the effective Lagrangian for chiral SUSY theories with Yukawa couplings, specifically the single flavor Wess-Zumino model. Only a subset of the infrared divergences are reproduced by the Lagrangian — to account for the complete low energy description requires the inclusion of local operators. SCET is formulated by expanding fields along a light-like direction and then subsequently integrating out degrees-of-freedom that are away from the light-cone. Defining the theory with respect to a specific frame obfuscates Lorentz invariance — given that SUSY is a space-time symmetry, this presents a possible obstruction. The cleanest language with which to expose the congruence between SUSY and SCET requires exploring two novel formalisms: collinear fermions as two-component Weyl spinors, and SCET in light-cone gauge. By expressing SUSY Yang-Mills in “collinear superspace', a slice of superspace derived by integrating out half the fermionic coordinates, the light-cone gauge SUSY SCET theory can be written in terms of superfields. As a byproduct, bootstrapping up to the full theory yields the first algorithmic approach for determining the SUSY Yang-Mills on-shell superspace action. This work paves the way toward discovering the effective theory for the collinear limit of N=4 SUSY Yang-Mills.

  1. Progress and Opportunities in Soft Photonics and Biologically Inspired Optics.

    Science.gov (United States)

    Kolle, Mathias; Lee, Seungwoo

    2018-01-01

    Optical components made fully or partially from reconfigurable, stimuli-responsive, soft solids or fluids-collectively referred to as soft photonics-are poised to form the platform for tunable optical devices with unprecedented functionality and performance characteristics. Currently, however, soft solid and fluid material systems still represent an underutilized class of materials in the optical engineers' toolbox. This is in part due to challenges in fabrication, integration, and structural control on the nano- and microscale associated with the application of soft components in optics. These challenges might be addressed with the help of a resourceful ally: nature. Organisms from many different phyla have evolved an impressive arsenal of light manipulation strategies that rely on the ability to generate and dynamically reconfigure hierarchically structured, complex optical material designs, often involving soft or fluid components. A comprehensive understanding of design concepts, structure formation principles, material integration, and control mechanisms employed in biological photonic systems will allow this study to challenge current paradigms in optical technology. This review provides an overview of recent developments in the fields of soft photonics and biologically inspired optics, emphasizes the ties between the two fields, and outlines future opportunities that result from advancements in soft and bioinspired photonics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Nursing students' perceptions of soft skills training in Ghana.

    Science.gov (United States)

    Laari, Luke; Dube, Barbara M

    2017-09-22

    The quality of nursing care rendered today is markedly reducing and the amount of time spent with patients listening to and explaining issues concerning their conditions is gradually diminishing. The therapeutic touch and the listening ear of the nurse are no longer accessible to the patient. Understanding what non-technical skills are and their relevance for healthcare practitioners has become a new area of consideration. Although recent literature has highlighted the necessity of introducing soft skills training and assessment within medical education, nursing education is yet to fully embrace this skills training. The aim of this study was to explore nursing students' understanding of the concept of soft skills and to acquire their perception on the need for soft skills training to promote quality nursing care. A quantitative research design with descriptive and explorative strategies was used. One hundred and ten nursing students were sampled after permission to conduct the study was requested and obtained from the University of KwaZulu-Natal Ethics Committee. The results indicated that a majority (68.8%) of respondents understood the concept of soft skills and agreed with the definition of 'soft skills'. They furthermore agreed that soft skills should be part of the training that student nurses receive during their professional training. The study revealed that there is a need for nursing students to be educated in soft skills and that this will enhance their job performances in the clinical environment and improve the way in which they communicate with their clients.

  3. Soft tissue expansion before vertical ridge augmentation: Inflatable silicone balloons or self-filling osmotic tissue expanders?

    Directory of Open Access Journals (Sweden)

    Prasad Vijayrao Dhadse

    2014-01-01

    Full Text Available Recent advances in periodontal plastic surgical procedures allow the clinician to reconstruct deficient alveolar ridges in more predictable ways than previously possible. Placement of implant/s in resorbed ridges poses numerous challenges to the clinician for successful esthetic and functional rehabilitation. The reconstruction frequently utilizes one or combination of periodontal plastic surgical procedures in conjunction with autogenous bone grafting, allogenic bone block grafting, ridge split techniques, distraction osteogenesis, or guided bone regeneration (GBR for most predictable outcomes. Current surgical modalities used in reconstruction of alveolar ridge (horizontal and/or vertical component often involve the need of flap transfer. Moreover, there is compromise in tissue integrity and color match owing to different surgical site and the tissue utilized is insufficient in quantity leading to post surgical graft exposition and/or loss of grafted bone. Soft tissue expansion (STE by implantation of inflatable silicone balloon or self filling osmotic tissue expanders before reconstructive surgery can overcome these disadvantages and certainly holds a promise for effective method for generation of soft tissue thereby achieving predictable augmentation of deficient alveolar ridges for the implant success. This article focuses and compares these distinct tissue expanders for their clinical efficacy of achieving excess tissue that predominantly seems to be prerequisite for ridge augmentation which can be reasonably followed by successful placement of endosseous fixtures.

  4. Alveolar corticotomies for accelerated orthodontics: A systematic review.

    Science.gov (United States)

    Gil, A P S; Haas, O L; Méndez-Manjón, I; Masiá-Gridilla, J; Valls-Ontañón, A; Hernández-Alfaro, F; Guijarro-Martínez, R

    2018-03-01

    It has been suggested that alveolar corticotomies may accelerate tooth movement, broaden the scope of malocclusion types that can be treated orthodontically, decrease the need for extractions, and support long-term stability. Several techniques have been proposed, although the indications, ideal design and technical characteristics, potential complications, and objective clinician and patient satisfaction remain unclear. This systematic review aimed to provide scientific support to validate alveolar corticotomies as a reliable approach to accelerated orthodontics. A literature search was conducted using MEDLINE (via PubMed), Cochrane, and EMBASE electronic databases until December, 2016. Articles written in any language other than English, Spanish, French, German, and Portuguese were excluded. Randomized controlled trials, controlled clinical trials, and case series involving healthy adult patients, with a sample size of at least 5 patients, and using alveolar corticotomy techniques were included. Two reviewers extracted the data independently. Three randomized clinical trials, 2 prospective randomized clinical trials, 6 case series and 1 randomized controlled split-mouth study were included. No clinical trials were retrieved. Mean total treatment time in corticotomy-facilitated orthodontic cases was 8.85 months (range, 4-20 months); control groups treatment duration was 16.4 months (range, 7.8-28.3 months). Complications such as pain, swelling, and dentin hypersensitivity were reported. Few studies mentioned patient/clinician satisfaction. The faster and less invasive procedures appeared to be well tolerated. However, the methodological quality of the selected studies was low, with only low to moderate scientific evidence. Corticotomy-facilitated orthodontics resulted in decreased treatment time. Few complications and low morbidity were found. More solid evidence-based research is required to support these results. Copyright © 2018 European Association for Cranio

  5. Metabolic shift in lung alveolar cell mitochondria following acrolein exposure.

    Science.gov (United States)

    Agarwal, Amit R; Yin, Fei; Cadenas, Enrique

    2013-11-15

    Acrolein, an α,β unsaturated electrophile, is an environmental pollutant released in ambient air from diesel exhausts and cooking oils. This study examines the role of acrolein in altering mitochondrial function and metabolism in lung-specific cells. RLE-6TN, H441, and primary alveolar type II (pAT2) cells were exposed to acrolein for 4 h, and its effect on mitochondrial oxygen consumption rates was studied by XF Extracellular Flux analysis. Low-dose acrolein exposure decreased mitochondrial respiration in a dose-dependent manner because of alteration in the metabolism of glucose in all the three cell types. Acrolein inhibited glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity, leading to decreased substrate availability for mitochondrial respiration in RLE-6TN, H441, and pAT2 cells; the reduced GAPDH activity was compensated in pAT2 cells by an increase in the activity of glucose-6-phosphate dehydrogenase, the regulatory control of the pentose phosphate pathway. The decrease in pyruvate from glucose metabolism resulted in utilization of alternative sources to support mitochondrial energy production: palmitate-BSA complex increased mitochondrial respiration in RLE-6TN and pAT2 cells. The presence of palmitate in alveolar cells for surfactant biosynthesis may prove to be the alternative fuel source for mitochondrial respiration. Accordingly, a decrease in phosphatidylcholine levels and an increase in phospholipase A2 activity were found in the alveolar cells after acrolein exposure. These findings have implications for understanding the decrease in surfactant levels frequently observed in pathophysiological situations with altered lung function following exposure to environmental toxicants.

  6. Alveolar hemorrhage and kidney disease: characteristics and therapy.

    Science.gov (United States)

    Fatma, Lilia Ben; El Ati, Zohra; Lamia, Rais; Aich, Dorra Ben; Madiha, Krid; Wided, Smaoui; Maiz, Hedi Ben; Beji, Somaya; Karim, Zouaghi; Moussa, Fatma Ben

    2013-07-01

    Anti-neutrophil cytoplasmic antibody-associated vasculitis and Goodpasture's glomerular basement membrane disease are the most common causes of diffuse alveolar hemorrhage, a life-threatening disease. Systemic lupus erythematosus and the antiphospholipid syndrome are also causes of alveolar hemorrhage. We retrospectively reviewed 15 cases of diffuse alveolar hemorrhage (DAH) associated with renal diseases. Diagnosis of DAH was based on the presence of bloody bronchoalveolar lavage fluid. There were three men and 12 women, with a mean age of 50.5 years (extremes: 24-74 years). Proteinuria and hematuria were observed, respectively, in 15 and 14 cases. Six patients revealed arterial hypertension. Crescentic glomerulonephritis was diagnosed with kidney biopsies in ten cases. The etiology of renal disease was microscopic polyangiitis (MPA) in seven cases, Wegener disease in four cases, systemic lupus erythematous in one case, cryoglobulinemia in one case, myeloma in one case and propyl-thiouracil-induced MPA in one case. Hemoptysis occurred in 14 cases. The mean serum level of hemoglobin was 7.1 g/dL (5.1-10 g/dL). The mean serum creatinine concentration was 7.07 mg/dL (2.4-13.7 mg/dL). Gas exchange was severely compromised, with an oxygenation index <80 mmHg in 14 patients and <60 mmHg in seven patients. Bronchoalveolar lavage was performed in 11 cases, and had positive findings for hemorrhage in all. Methylprednisolone pulses and cyclophosphamide were used in 14 patients. Plasmapheresis was performed in three cases. One patient received cycles of Dexamethasome-Melphalan. Three patients died as a result of DAH. The mortality rate in our study was 20%.

  7. Enhanced rifampicin delivery to alveolar macrophages by solid lipid nanoparticles

    International Nuclear Information System (INIS)

    Chuan Junlan; Li Yanzhen; Yang Likai; Sun Xun; Zhang Qiang; Gong Tao; Zhang Zhirong

    2013-01-01

    The present study aimed at developing a drug delivery system targeting the densest site of tuberculosis infection, the alveolar macrophages (AMs). Rifampicin (RFP)-loaded solid lipid nanoparticles (RFP-SLNs) with an average size of 829.6 ± 16.1 nm were prepared by a modified lipid film hydration method. The cytotoxicity of RFP-SLNs to AMs and alveolar epithelial type II cells (AECs) was examined using MTT assays. The viability of AMs and AECs was above 80 % after treatment with RFP-SLNs, which showed low toxicity to both AMs and AECs. Confocal Laser Scanning Microscopy was employed to observe the interaction between RFP-SLNs and both AMs and AECs. After incubating the cells with RFP-SLNs for 2 h, the fluorescent intensity in AMs was more and remained longer (from 0.5 to 12 h) when compared with that in AECs (from 0.5 to 8 h). In vitro uptake characteristics of RFP-SLNs in AMs and AECs were also investigated by detection of intracellular RFP by High performance liquid chromatography. Results showed that RFP-SLNs delivered markedly higher RFP into AMs (691.7 ng/mg in cultured AMs, 662.6 ng/mg in primary AMs) than that into AECs (319.2 ng/mg in cultured AECs, 287.2 ng/mg in primary AECs). Subsequently, in vivo delivery efficiency and the selectivity of RFP-SLNs were further verified in Sprague–Dawley rats. Under pulmonary administration of RFP-SLNs, the amount of RFP in AMs was significantly higher than that in AECs at each time point. Our results demonstrated that solid lipid nanoparticles are a promising strategy for the delivery of rifampicin to alveolar macrophages selectively.

  8. Diffuse alveolar hemorrhage as initial manifestation of microscopic polyangiitis

    OpenAIRE

    Campanholo, Cristiano Barbosa; Cavalcante, Leonardo de Oliveira; Torigoe, Dawton Yukito; Souza, Branca Dias Batista de

    2007-01-01

    Hemorragia alveolar (HA) é uma manifestação clínica com alta taxa de mortalidade que deve ser investigada, reconhecida e estabilizada. Causas possíveis para a HA incluem infecções respiratórias ou sistêmicas, malformações arteriovenosas, estenose mitral, discrasias sangüíneas e doenças auto-imunes, como o lúpus eritematoso sistêmico (LES), a síndrome de Goodpasture e as vasculites sistêmicas primárias, principalmente aquelas associadas aos anticorpos anticitoplasma de neutrófilos (Anca), como...

  9. A review on alveolar ridge preservation following tooth extraction.

    Science.gov (United States)

    Horowitz, Robert; Holtzclaw, Danny; Rosen, Paul S

    2012-09-01

    The question that clinicians face is whether the use of bone replacement grafts and/or barrier membranes enhance their ability to provide for the future placement of a dental implant or to maximize ridge dimensions following the extraction of a tooth versus no additional treatments. The evidence was obtained by search of Entrez PubMed and manual search of The International Journal of Oral and Maxillofacial Implants, The International Journal of Periodontics & Restorative Dentistry, Clinical Oral Implant Research, The Journal of Periodontology, The Journal of Clinical Periodontology, and The Compendium of Continuing Education in Dentistry. Key search words included Guided Bone Regeneration, Dental Extraction, Tooth Extraction, Bone Replacement Graft, Alveolar Ridge. The years of search included from January 2011 through February 2012. The recurring theme was that there was considerable heterogeneity to study designs, time periods, and methods of evaluation. This created great difficulty in trying to answer with good high-quality evidence questions about the techniques and materials to be used for maximizing regeneration at the time of tooth extraction or in which situations this ought to be used. There appears to be consensus from the reviewed literature supporting ridge preservation techniques as a whole. Multiple studies demonstrated less ridge resorption occurring when alveolar ridge preservation procedures were used versus the placement of no graft material in fresh alveolar sockets. The analysis did not show any grafting materials demonstrating a clear benefit over any others or that a barrier membrane is necessary. The evidence is also too premature about whether socket preservation efforts require primary closure. In the emerging area of growth factors, there is no high-quality evidence to either support or refute their use. Tooth extraction is one of the most widely performed procedures in dentistry today and it has been historically well documented that

  10. Is acute alveolar dilation an indicator of strangulation homicide?

    DEFF Research Database (Denmark)

    Klysner, Anne; Lynnerup, Niels; Hougen, Hans Petter

    2011-01-01

    Some cases of suspected homicidal strangulation are difficult to diagnose if the classical injuries of strangulation are few or lacking. The main purpose of this study was to determine if abnormal distension of alveolar airspaces is present in strangulation deaths and whether or not it can be used...... to support this diagnosis. Another purpose was to see how often the gross examination of the lungs was in agreement with the microscopic examination. The material comprised 33 victims of homicidal strangulation above the age of 15 years, autopsied at the Department of Forensic Medicine in Copenhagen between...

  11. Alveolar hemorrhage after scuba diving: a case report.

    Science.gov (United States)

    Tsai, Ming-Ju; Tsai, Mee-Sun; Tsai, Ying-Ming; Lien, Chi-Tun; Hwang, Jhi-Jhu; Huang, Ming-Shyan

    2010-07-01

    Self-contained underwater breathing apparatus (scuba) diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving. Copyright 2010 Elsevier. Published by Elsevier B.V. All rights reserved.

  12. Alveolar Hemorrhage After Scuba Diving: A Case Report

    Directory of Open Access Journals (Sweden)

    Ming-Ju Tsai

    2010-07-01

    Full Text Available Self-contained underwater breathing apparatus (scuba diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving.

  13. Demineralized dentin matrix scaffolds for alveolar bone engineering

    Directory of Open Access Journals (Sweden)

    In-Woong Um

    2017-01-01

    Full Text Available From the point of view of implant dentistry, this review discusses the development and clinical use of demineralized dentin matrix (DDM scaffolds, produced from the patient's own extracted teeth, to repair alveolar bone defects. The structure and the organic and inorganic components of DDM are presented to emphasize the similarities with autogenous bone. Studies of DDM properties, such as osteoinductive and osteoconductive functions as well as efficacy and safety, which are mandatory for its use as a bone graft substitute, are also presented. The clinical applications of powder, block, and moldable DDM are discussed, along with future developments that can support growth factor and stem cell delivery.

  14. Soft Tissue Biomechanical Modeling for Computer Assisted Surgery

    CERN Document Server

    2012-01-01

      This volume focuses on the biomechanical modeling of biological tissues in the context of Computer Assisted Surgery (CAS). More specifically, deformable soft tissues are addressed since they are the subject of the most recent developments in this field. The pioneering works on this CAS topic date from the 1980's, with applications in orthopaedics and biomechanical models of bones. More recently, however, biomechanical models of soft tissues have been proposed since most of the human body is made of soft organs that can be deformed by the surgical gesture. Such models are much more complicated to handle since the tissues can be subject to large deformations (non-linear geometrical framework) as well as complex stress/strain relationships (non-linear mechanical framework). Part 1 of the volume presents biomechanical models that have been developed in a CAS context and used during surgery. This is particularly new since most of the soft tissues models already proposed concern Computer Assisted Planning, with ...

  15. The axonal guidance cue semaphorin 3C contributes to alveolar growth and repair.

    Directory of Open Access Journals (Sweden)

    Arul Vadivel

    Full Text Available Lung diseases characterized by alveolar damage such as bronchopulmonary dysplasia (BPD in premature infants and emphysema lack efficient treatments. Understanding the mechanisms contributing to normal and impaired alveolar growth and repair may identify new therapeutic targets for these lung diseases. Axonal guidance cues are molecules that guide the outgrowth of axons. Amongst these axonal guidance cues, members of the Semaphorin family, in particular Semaphorin 3C (Sema3C, contribute to early lung branching morphogenesis. The role of Sema3C during alveolar growth and repair is unknown. We hypothesized that Sema3C promotes alveolar development and repair. In vivo Sema3C knock down using intranasal siRNA during the postnatal stage of alveolar development in rats caused significant air space enlargement reminiscent of BPD. Sema3C knock down was associated with increased TLR3 expression and lung inflammatory cells influx. In a model of O2-induced arrested alveolar growth in newborn rats mimicking BPD, air space enlargement was associated with decreased lung Sema3C mRNA expression. In vitro, Sema3C treatment preserved alveolar epithelial cell viability in hyperoxia and accelerated alveolar epithelial cell wound healing. Sema3C preserved lung microvascular endothelial cell vascular network formation in vitro under hyperoxic conditions. In vivo, Sema3C treatment of hyperoxic rats decreased lung neutrophil influx and preserved alveolar and lung vascular growth. Sema3C also preserved lung plexinA2 and Sema3C expression, alveolar epithelial cell proliferation and decreased lung apoptosis. In conclusion, the axonal guidance cue Sema3C promotes normal alveolar growth and may be worthwhile further investigating as a potential therapeutic target for lung repair.

  16. Soft α-Open Sets and Soft α-Continuous Functions

    Directory of Open Access Journals (Sweden)

    Metin Akdag

    2014-01-01

    Full Text Available We introduce soft α-sets on soft topological spaces and study some of their properties. We also investigate the concepts of soft α-continuous and soft α-open functions and discuss their relationships with soft continuous and other weaker forms of soft continuous functions. Also counterexamples are given to show the noncoincidence of these functions.

  17. Decreased IGF Type 1 Receptor Signaling in Mammary Epithelium during Pregnancy Leads to Reduced Proliferation, Alveolar Differentiation, and Expression of Insulin Receptor Substrate (IRS)-1 and IRS-2

    Science.gov (United States)

    Sun, Zhaoyu; Shushanov, Sain; LeRoith, Derek

    2011-01-01

    The IGFs and the IGF type 1 receptor (IGF-1R) are essential mediators of normal mammary gland development in mice. IGF-I and the IGF-1R have demonstrated functions in formation and proliferation of terminal end buds and in ductal outgrowth and branching during puberty. To study the functions of IGF-1R during pregnancy and lactation, we established transgenic mouse lines expressing a human dominant-negative kinase dead IGF-1R (dnhIGF-1R) under the control of the whey acidic protein promoter. We provide evidence that the IGF-1R pathway is necessary for normal epithelial proliferation and alveolar formation during pregnancy. Furthermore, we demonstrate that the whey acidic protein-dnhIGF-1R transgene causes a delay in alveolar differentiation including lipid droplet formation, lumen expansion, and β-casein protein expression. Analysis of IGF-1R signaling pathways showed a decrease in P-IGF-1R and P-Akt resulting from expression of the dnhIGF-1R. We further demonstrate that disruption of the IGF-1R decreases mammary epithelial cell expression of the signaling intermediates insulin receptor substrate (IRS)-1 and IRS-2. No alterations were observed in downstream signaling targets of prolactin and progesterone, suggesting that activation of the IGF-1R may directly regulate expression of IRS-1/2 during alveolar development and differentiation. These data show that IGF-1R signaling is necessary for normal alveolar proliferation and differentiation, in part, through induction of signaling intermediates that mediate alveolar development. PMID:21628386

  18. Cirurgia conservadora, radioterapia externa e reforço de dose com braquiterapia de alta taxa de dose: uma nova perspectiva no tratamento de sarcomas de partes moles do adulto Limb-sparing surgery, external beam radiotherapy and boost with high-dose rate brachytherapy: a new perspective for the treatment of soft tissue sarcomas in adults

    Directory of Open Access Journals (Sweden)

    Antonio Cássio Assis Pellizzon

    2002-03-01

    Full Text Available OBJETIVO: Avaliar a influência no controle local de pacientes adultos e portadores de sarcoma de partes moles em extremidades e submetidos a cirurgia conservadora do membro, com braquiterapia de alta taxa de dose (BATD como reforço para a radioterapia externa (RT. MATERIAL E MÉTODOS: Foram avaliados 16 pacientes tratados, de 1993 até 1999. A RT foi utilizada com finalidade pré ou pós-operatória (30--55 Gy e BATD com dose de 18--36 Gy (fx 3--6 Gy BID. Com base no modelo linear quadrático calculou-se a dose efetiva biológica ("biological effective dose" - BED para o tumor e comparou-se seu valor a dados da literatura internacional, que utiliza tratamentos com RT e braquiterapia de baixa taxa de dose (BBTD. RESULTADOS: Os valores médios e medianos da BED para os sarcomas de partes moles foram de 78,5 Gy7 e 80 Gy7. A análise univariada mostrou que a BED para o tumor, quando utilizada BATD, era semelhante ao valor de 83 Gy7 quando utilizada BBTD (p = 0,008. As taxas de controle local, sobrevida livre de doença e sobrevida global atuarial em cinco anos foram de 83,2%, 75% e 93,7%, respectivamente. CONCLUSÕES: A BATD, quando utilizada como método complementar no reforço de dose da RT no tratamento conservador dos sarcomas de partes moles, apresenta taxas de controle local equiparáveis às da literatura internacional; no entanto, estudos com número maior de pacientes e período maior de seguimento são ainda necessários para determinar o verdadeiro potencial da BATD em substituir a BBTD.PURPOSE: To evaluate the influence on local control in adult patients with soft tissue sarcomas of the limbs that underwent limb-sparing surgery and high-dose rate brachytherapy (HDRB in association with teletherapy. MATERIAL AND METHODS: Sixteen patients treated from 1993 to 1999 were reviewed. Teletherapy was used pre- or postoperatively (30--55 Gy in association with HDRB in a dose range of 18--36 Gy (fx 3--6 Gy BID. The linear quadratic model was

  19. Gravidez em paciente com microlitíase alveolar pulmonar grave Pregnancy in a patient with severe pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    José Osmar Bezerra de Souza Filho

    2008-10-01

    Full Text Available A microlitíase alveolar pulmonar (MAP é uma doença rara que atinge ambos os pulmões, caracterizada pela presença de pequenos cálculos (fosfato de cálcio nos espaços alveolares. Relatamos o caso de uma paciente do sexo feminino, de 26 anos, cujo diagnóstico foi confirmado com base nos achados marcantes na radiografia de tórax e tomografia computadorizada de alta resolução. A paciente, gestante de 28 semanas, retornou ao hospital 10 meses após o diagnóstico apresentando insuficiência respiratória hipoxêmica e com distúrbio ventilatório restritivo grave à espirometria. Após completadas 32 semanas e 4 dias de gestação, foi submetida aparto cesariano, com sucesso para mãe e filha. A MAP tem evolução clínica variável. Tem provável caráter autossômico recessivo e associação com história familiar positiva. A etiologia é incerta, e muitos autores especulam que haja um defeito enzimático local responsável pelo acúmulo intra-alveolar de cálcio. Relatos de pacientes com MAP que engravidaram são excepcionais, sendo o presente caso o primeiro descrito no Brasil. O curso dessa doença costuma ser lentamente progressivo, e os pacientes geralmente falecem devido à insuficiência cardiorrespiratória. O presente caso ilustra a necessidade de se oferecer aconselhamento genético e orientações sobre o risco de gravidez às pacientes, especialmente em casos de doença avançada. Atualmente, a única terapia efetiva é o transplante pulmonar.Pulmonary alveolar microlithiasis (PAM is a rare disease that affects both lungs. It is characterized by the presence of small calculi (calcium phosphate within the alveolar spaces. We report the case of a 26-year-old female whose diagnosis was based on characteristic findings on chest X-rays and high-resolution computed tomography scans. The patient, 28 weeks pregnant, was rehospitalized 10 months after the diagnosis, presenting hypoxemic acute respiratory failure and severe restrictive

  20. Soft Decision Analyzer

    Science.gov (United States)

    Steele, Glen; Lansdowne, Chatwin; Zucha, Joan; Schlensinger, Adam

    2013-01-01

    The Soft Decision Analyzer (SDA) is an instrument that combines hardware, firmware, and software to perform realtime closed-loop end-to-end statistical analysis of single- or dual- channel serial digital RF communications systems operating in very low signal-to-noise conditions. As an innovation, the unique SDA capabilities allow it to perform analysis of situations where the receiving communication system slips bits due to low signal-to-noise conditions or experiences constellation rotations resulting in channel polarity in versions or channel assignment swaps. SDA s closed-loop detection allows it to instrument a live system and correlate observations with frame, codeword, and packet losses, as well as Quality of Service (QoS) and Quality of Experience (QoE) events. The SDA s abilities are not confined to performing analysis in low signal-to-noise conditions. Its analysis provides in-depth insight of a communication system s receiver performance in a variety of operating conditions. The SDA incorporates two techniques for identifying slips. The first is an examination of content of the received data stream s relation to the transmitted data content and the second is a direct examination of the receiver s recovered clock signals relative to a reference. Both techniques provide benefits in different ways and allow the communication engineer evaluating test results increased confidence and understanding of receiver performance. Direct examination of data contents is performed by two different data techniques, power correlation or a modified Massey correlation, and can be applied to soft decision data widths 1 to 12 bits wide over a correlation depth ranging from 16 to 512 samples. The SDA detects receiver bit slips within a 4 bits window and can handle systems with up to four quadrants (QPSK, SQPSK, and BPSK systems). The SDA continuously monitors correlation results to characterize slips and quadrant change and is capable of performing analysis even when the

  1. Soft Hair on Black Holes.

    Science.gov (United States)

    Hawking, Stephen W; Perry, Malcolm J; Strominger, Andrew

    2016-06-10

    It has recently been shown that Bondi-van der Burg-Metzner-Sachs supertranslation symmetries imply an infinite number of conservation laws for all gravitational theories in asymptotically Minkowskian spacetimes. These laws require black holes to carry a large amount of soft (i.e., zero-energy) supertranslation hair. The presence of a Maxwell field similarly implies soft electric hair. This Letter gives an explicit description of soft hair in terms of soft gravitons or photons on the black hole horizon, and shows that complete information about their quantum state is stored on a holographic plate at the future boundary of the horizon. Charge conservation is used to give an infinite number of exact relations between the evaporation products of black holes which have different soft hair but are otherwise identical. It is further argued that soft hair which is spatially localized to much less than a Planck length cannot be excited in a physically realizable process, giving an effective number of soft degrees of freedom proportional to the horizon area in Planck units.

  2. Ovariectomy delays alveolar wound healing after molar extractions in rats.

    Science.gov (United States)

    Pereira, Michele Conceição; Zecchin, Karina Gottardello; Campagnoli, Eduardo Bauml; Jorge, Jacks

    2007-11-01

    This study was conducted to investigate the morphological effects of the absence of estrogen on alveolar wound healing of young female rats after tooth extraction. A total of 60 4- to 6-week-old female rats underwent bilateral ovariectomy (OVX) or sham operations. Three weeks later, the first mandibular molars were extracted. Subsequently, the animals were killed by cervical dislocation 3, 5, 7, 14, 21, or 28 days after tooth extraction. The mandibles were removed, and serial transversal sections of mesial alveolus of the first mandibular molars were obtained for histometric analysis. OVX sockets showed significant increases in fibroblasts and collagen content 3 and 5 days after the extractions, followed by significant decreases in these parameters in the subsequent periods. In accordance with the decreased collagen content in the latest period of healing, new bone formation was significantly reduced in the OVX animals. These findings suggest that the initial molecular changes observed in the absence of estrogen lead to delayed alveolar wound healing.

  3. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings.

    Science.gov (United States)

    Eguía-Aguilar, Pilar; López-Martínez, Briceida; Retana-Contreras, Carmen; Perezpeña-Diazconti, Mario

    We present the case of a 2-year-old male patient with a facial tumor partially treated with chemotherapy before his admission to our institution. The tumor involved from the frontal region to the maxillary floor, the orbit, and the maxillary and sphenoid sinuses. The histopathological diagnosis revealed a stage IV alveolar rhabdomyosarcoma with infiltration to bone marrow and cerebrospinal fluid. He was managed with four cycles of adriamycin, actinomycin, cyclophosphamide and vincristine; cisplatin and irinotecan were added to the last cycle. The tumor had a 50% size reduction, but the patient died after a neutropenia and fever episode. The aggressive behavior of alveolar rhabdomyosarcoma has been associated with the expression of oncogenic fusion proteins resulting from chromosomal translocations, particularly t(2;13) (q35;q14) PAX3/FOXO1, and t(1;13) (p36;q14) PAX7/FOXO1 which were present in this patient. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  4. Primary pulmonary alveolar proteinosis: computed tomography features at diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Berteloot, Laureline; Emond-Gonsard, Sophie; Mamou-Mani, Tania; Lambot, Karen; Grevent, David [Hopital Necker Enfants-Malades, Department of Pediatric Radiology, Paris (France); Taam, Rola Abou; Le Bourgeois, Muriel [Hopital Necker Enfants-Malades, Department of Pediatric Pneumology and Allergology, Paris (France); Elie, Caroline [Hopital Necker Enfants-Malades, Department of Biostatistics, Paris (France); Paris Descartes University, Paris (France); Delacourt, Christophe; Blic, Jacques de [Hopital Necker Enfants-Malades, Department of Pediatric Pneumology and Allergology, Paris (France); Paris Descartes University, Paris (France); Brunelle, Francis [Hopital Necker Enfants-Malades, Department of Pediatric Radiology, Paris (France); Paris Descartes University, Paris (France)

    2014-07-15

    Pulmonary alveolar proteinosis (PAP) is characterized by an abnormal accumulation of periodic acid-schiff-positive lipoproteinaceous material in the alveoli. Early diagnosis allows setting up of therapeutic lung lavages, which reduces the need for oxygen supplementation and weight gain. To provide a description of radiological features by CT at the onset of primary PAP in children. The clinical and radiological data of 24 patients, including 16 boys and 8 girls (median age: 12 months), diagnosed with a primary form of PAP between April 1992 and May 2012 in a tertiary referral hospital, were retrospectively reviewed. CT images were examined for the presence of alveolar and interstitial elementary lesions. Correlation between clinical and radiological findings was assessed. The types of elementary lesions detected were: ground-glass opacities (n = 24), intralobular lines (n = 24), thickened interlobular septa (n = 22), thickened fissures (n = 21), airspace consolidation (n = 16), hyperinflation (n = 16), cystic lesions (n = 2) and micronodules (n = 1). A crazy-paving pattern was found in 92% of cases. Consolidation and hyperinflation were especially detected in younger children (median age, 8 months, P < 0.01). A density dependent gradient was found. The distribution of the lesions was symmetrical. There was no correlation between radiological and clinical data of severity of the disease. CT findings are suggestive of diagnosis of PAP in immunocompetent children with chronic respiratory failure. (orig.)

  5. Alveolar macrophage dysregulation in Hermansky-Pudlak syndrome type 1.

    Science.gov (United States)

    Rouhani, Farshid N; Brantly, Mark L; Markello, Thomas C; Helip-Wooley, Amanda; O'Brien, Kevin; Hess, Richard; Huizing, Marjan; Gahl, William A; Gochuico, Bernadette R

    2009-12-01

    Individuals with Hermansky-Pudlak syndrome type 1 (HPS-1), an autosomal recessive disorder characterized by defective biogenesis of lysosome-related organelles, develop an accelerated form of progressive fibrotic lung disease. The etiology of pulmonary fibrosis associated with HPS-1 is unknown. To investigate the potential pathogenesis of pulmonary fibrosis in HPS-1, lung cells and proteins from individuals with HPS-1 were studied. Forty-one subjects with HPS-1 with and without pulmonary fibrosis were evaluated with pulmonary function tests, high-resolution computed tomography scan, and bronchoscopy. Bronchoalveolar lavage cells and analytes were analyzed. Concentrations of total bronchoalveolar lavage cells and alveolar macrophages were significantly higher in epithelial lining fluid from subjects with HPS-1 with and without pulmonary fibrosis compared with healthy research volunteers. Concentrations of cytokines and chemokines (i.e., monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha, and granulocyte-macrophage colony-stimulating factor) in alveolar epithelial lining fluid were significantly higher in subjects with HPS-1 with and without pulmonary fibrosis compared with healthy research volunteers (P system in which to study the pathogenesis and treatment of HPS pulmonary fibrosis.

  6. Alveolar Bone Housing- A Modified Wilkodontics Approach- A Case Report

    Science.gov (United States)

    Sanjay, Kothamachu; Bhongade, ML; Shrivastav, Sunita

    2016-01-01

    Accelerated orthodontic treatment is the need of the hour in current scenario as the conventional orthodontics is time taking. Corticotomy assisted orthodontics have been used for years to reduce the treatment duration by reducing the resistance provided by alveolar bone housing. This case report describes the orthodontic treatment combined with the modification in conventional wilkodontic technique in a patient to accelerate tooth movement and shorten the treatment time with an anterior open bite and flared and spaced upper and lower incisors. Firstly plaque control was achieved with supra and subgingival scaling. A modified approach using periodontal access flap followed by vertical bone cuts in the cortical bone from the crest of the alveolar bone margin to 2mm-3mm below the apices of all the anterior teeth extending from upper left canine to upper right canine were performed. These vertical cuts were joined by horizontal cuts apically and flap repositioned. An MBT 0.018 inch appliance was bonded. Orthodontic therapy proceeded with frequent activation of the appliances to retract the incisors every two weeks. The total treatment time was four and half months with active period of two months and no adverse effects were observed at the end of active treatment. The modified decortication technique reduced the treatment time to a considerable extent. The interdental spacing closed and optimum overjet and overbite was achieved. PMID:27656577

  7. Advances in multidisciplinary individualized treatment of refractory hepatic alveolar echinococcosis

    Directory of Open Access Journals (Sweden)

    ABUDUAINI Abulizi

    2015-04-01

    Full Text Available Hepatic alveolar echinococcosis (HAE is a zoonotic parasitic disease that seriously threatens the population in western China and compromises patients′ quality of life. With the continuous improvement in radical resection rate in recent years, late-stage HAE patients that were incurable in the past now have the opportunity for radical resection. However, patients who are not suitable candidates for radical resection still suffer from various complications and poor quality of life. Therefore, HAE is still considered a refractory and complex disease. The simple empirical treatment model provided by traditional professional discussion is unable to satisfy the treatment of advanced refractory HAE as it is unable to integrate specialized, standardized clinical skills for diagnosis and treatment. Multidisciplinary individualized treatment (MDT organically integrates the advantages of the available treatment into a reasonable individualized comprehensive treatment regimen. This review summarizes the advances in MDT for HAE as the best option to increase long-term survival, and suggests MDT as the first-line treatment for late-stage refractory hepatic alveolar echinococcosis.

  8. Peptide secreted by human alveolar macrophages releases neutrophil granule contents

    International Nuclear Information System (INIS)

    MacArthur, C.K.; Miller, E.J.; Cohen, A.B.

    1987-01-01

    A monoclonal antibody was developed against an 8000-kDa enzyme-releasing peptide (ERP) released from human alveolar macrophages. ERP was isolated on an immunoaffinity column containing the antibody bound to staphylococcal protein A-Sepharose, and by autoradiography. Release of ERP from the macrophages is not changed by plastic adherence, phagocytosis, calcium ionophore, or phorbol esters. The peptide was not antigenically similar to interferon-γ, tumor necrosis factor, or interleukin lα or 1β. The release of constituents from azurophilic and specific granules was the main identified biologic function of ERP. ERP was a more effective secretagogue in the untreated neutrophils and f-met-leu-phe was more effective in the cytochalasin B-treated neutrophils. Absorption of ERP from macrophage-conditioned medium removed a small amount of the chemotactic activity; however, the immunopurified peptide was not chemotactic or chemokinetic for neutrophils, and at high concentrations, it suppressed base line chemokinesis. Treatment of washed macrophages with trypsin released active ERP of approximately the same m.w. of spontaneously secreted ERP. These studies showed that human alveolar macrophages release a peptide which is a secretagogue for human neutrophils under conditions which may be encountered in the lungs during certain disease states. Proteolytic enzymes which are free in the lungs may release the peptide and lead to the secretion of neutrophil enzymes

  9. Primary pulmonary alveolar proteinosis: computed tomography features at diagnosis

    International Nuclear Information System (INIS)

    Berteloot, Laureline; Emond-Gonsard, Sophie; Mamou-Mani, Tania; Lambot, Karen; Grevent, David; Taam, Rola Abou; Le Bourgeois, Muriel; Elie, Caroline; Delacourt, Christophe; Blic, Jacques de; Brunelle, Francis

    2014-01-01

    Pulmonary alveolar proteinosis (PAP) is characterized by an abnormal accumulation of periodic acid-schiff-positive lipoproteinaceous material in the alveoli. Early diagnosis allows setting up of therapeutic lung lavages, which reduces the need for oxygen supplementation and weight gain. To provide a description of radiological features by CT at the onset of primary PAP in children. The clinical and radiological data of 24 patients, including 16 boys and 8 girls (median age: 12 months), diagnosed with a primary form of PAP between April 1992 and May 2012 in a tertiary referral hospital, were retrospectively reviewed. CT images were examined for the presence of alveolar and interstitial elementary lesions. Correlation between clinical and radiological findings was assessed. The types of elementary lesions detected were: ground-glass opacities (n = 24), intralobular lines (n = 24), thickened interlobular septa (n = 22), thickened fissures (n = 21), airspace consolidation (n = 16), hyperinflation (n = 16), cystic lesions (n = 2) and micronodules (n = 1). A crazy-paving pattern was found in 92% of cases. Consolidation and hyperinflation were especially detected in younger children (median age, 8 months, P < 0.01). A density dependent gradient was found. The distribution of the lesions was symmetrical. There was no correlation between radiological and clinical data of severity of the disease. CT findings are suggestive of diagnosis of PAP in immunocompetent children with chronic respiratory failure. (orig.)

  10. A 55 years old man with pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    Rebeen R Saeed

    2014-01-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a very rare diffuse chronic lung disease characterized by deposition of small spherules of calcium phosphate within the alveolar cavity. The disease is usually seen from birth up to 40 years of age and is usually diagnosed incidentally during radiography of the chest for other reasons. Most of patients are asymptomatic or having very mild symptoms and the majority of patients either have normal or restrictive pulmonary function test. Clinically, the course of the disease is different; it remains static in few patients or it may progress to pulmonary fibrosis, respiratory failure and cor pulmonale in others. In this case report, we present a 55-year-old man who presented with moderate shortness of breath which has progressed from mild symptoms with in the previous years. His chest high-resolution CT scan showed diffusely scattered, ill-defined little shadowy micronodules which involve the left lung; lingula and left lower lobe in particular. A lung biopsy confirmed the diagnosis of PAM. He was followed up for 1 year with treatment by steroid and alendronate, and no progression was noticed in fact improvement in pulmonary function test noticed. This is the first case report of PAM in Kurdistan.

  11. Dimensional changes of the post extraction alveolar ridge, preserved with Leukocyte- and Platelet Rich Fibrin: A clinical pilot study.

    Science.gov (United States)

    Anwandter, Andreas; Bohmann, Stephanie; Nally, Mauricio; Castro, Ana B; Quirynen, Marc; Pinto, Nelson

    2016-09-01

    This clinical trial explored the clinical and radiographic dimensional changes of the alveolar ridge in the first 4 months after tooth extraction in combination with the application of Leukocyte- and Platelet Rich Fibrin (L-PRF). Eighteen single rooted maxillary and mandibular sockets were filled with L-PRF without soft tissue closure. Clinical measurements (bone sounding) were performed using a customized acrylic stent and radiographic measurements were accomplished using Cone Beam Computed Tomography (CBCT), immediately after tooth extraction and after 4 months. The clinical observations indicated a mean horizontal resorption of 1.18±2.4mm (p=0.8) at the crest, 1.25±2.0mm (p=0.57) and 0.83±2.0mm (p=0.78) at 2mm and 4mm apical to the crest, respectively. The buccal plate demonstrated a mean vertical loss of 0.44±3.5mm (p=0.9), the centre of the socket had a significant filling of 5.72±3.6mm (p=0.0001) and the oral cortical plate had a mean vertical gain of 0.09mm±1.57mm (p=0.9). The radiographic analysis demonstrated a mean vertical bone loss of 0.27±2.5mm (p=0.9) on the buccal and of 0.03±1.6mm (p=0.9) at the oral crest. The width of the alveolar ridge had a mean loss of 1.33mm±1.43mm. Within the limitations of this pilot study, it can be concluded that L-PRF might show clinical benefits for ridge preservation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Combination of interval set and soft set

    Directory of Open Access Journals (Sweden)

    Keyun Qin

    2013-04-01

    Full Text Available Soft set theory and interval set theory are all mathematical tools for dealing with uncertainties. This paper is devoted to the discussion of soft interval set and its application. The notion of soft interval sets is introduced by combining soft set and interval set. Several operations on soft interval sets are presented in a manner parallel to that used in defining operations on soft sets and the lattice structures of soft interval sets are established. In addition, a soft interval set based decision making problem is analyzed.

  13. Evaluation of the Effect of Platelet-Rich Fibrin on the Alveolar ...

    African Journals Online (AJOL)

    2018-02-23

    Feb 23, 2018 ... nonsmokers or positively affect periodontal healing, but it positively affected postoperative pain levels. Keywords: Alveolar osteitis, mandibular third molar, platelet-rich fibrin, probing depth. Evaluation of the Effect of Platelet-Rich Fibrin on the Alveolar Osteitis. Incidence and Periodontal Probing Depth after ...

  14. Is 2 mm a safe distance from the inferior alveolar canal to avoid ...

    African Journals Online (AJOL)

    2015-10-30

    Oct 30, 2015 ... related to implants inserted closer than 2 mm to the inferior alveolar canal (IAC) with those inserted further than 2 ... KEYWORDS: Dental implants, inferior alveolar nerve injury, neurosensory complication. Department of .... such injury occurs, a complete healing is difficult if the extent of the injury is not minor ...

  15. Alveolar index as a means of skull classification: a radiological study ...

    African Journals Online (AJOL)

    Alveolar index is an important parameter in intra and inter-ethnic classification of skull and in defining the positional relation of the maxilla to the mandible. The objective of the study was to evaluate the alveolar index of Nigerians using radiographs. 130 (90 males and 40 females) normal lateral view skull radiographs of ...

  16. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation

    Directory of Open Access Journals (Sweden)

    João Paulo Schwartz

    2016-04-01

    Full Text Available ABSTRACT Objective: This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. Methods: The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years, Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0 and after Herbst treatment (T1. Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B, lingual (L and total (T bone thicknesses were assessed at crestal (1, midroot (2 and apical (3 levels of mandibular incisors. Student's t-test and Wilcoxon t-test were used to compare dependent samples in parametric and nonparametric cases, respectively. Pearson's and Spearman's rank correlation analyses were performed to determine the relationship of changes in alveolar bone thickness. Results were considered at a significance level of 5%. Results: Mandibular incisors showed no statistical significance for vertical alveolar bone level. Alveolar bone thickness of mandibular incisors significantly reduced after treatment at B1, B2, B3, T1 and significantly increased at L2. The magnitude of the statistically significant changes was less than 0.2 mm. The changes in alveolar bone thickness showed no statistical significance with incisor inclination degree. Conclusions: CBCT scans showed an association between the Herbst appliance and alveolar bone loss on the buccal surface of mandibular incisors; however, without clinical significance.

  17. Popliteal pterygium syndrome (PPS) with intra-alveolar syngnathia: a discussion of anesthetic and surgical considerations.

    Science.gov (United States)

    Gahm, Caroline; Kuylenstierna, Richard; Papatziamos, Georgios

    2007-10-01

    Popliteal pterygium syndrome (PPS) is a rare genetic disorder that involves the association of a popliteal web with a combination of craniofacial, genitourinary and extremity malformations. In this article, we describe a patient with PPS complicated with multiple intra-alveolar syngnathia. We discuss the anesthetic and the surgical management of this case and review the literature regarding PPS and intra-alveolar syngnathia.

  18. Morbidity of chin bone transplants used for reconstructing alveolar defects in cleft patients

    NARCIS (Netherlands)

    Booij, A; Raghoebar, GM; Jansma, J; Kalk, WWI; Vissink, A

    Objective: The aim of this study was to evaluate the objective and subjective morbidity of symphyseal chin bone harvesting used for reconstruction of alveolar defects in young cleft patients. Design: All patients who had undergone chin bone harvesting for alveolar cleft reconstruction in the period

  19. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation.

    Science.gov (United States)

    Schwartz, João Paulo; Raveli, Taisa Boamorte; Schwartz-Filho, Humberto Osvaldo; Raveli, Dirceu Barnabé

    2016-01-01

    This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years), Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0) and after Herbst treatment (T1). Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B), lingual (L) and total (T) bone thicknesses were assessed at crestal (1), midroot (2) and apical (3) levels of mandibular incisors. Student's t-test and Wilcoxon t-test were used to compare dependent samples in parametric and nonparametric cases, respectively. Pearson's and Spearman's rank correlation analyses were performed to determine the relationship of changes in alveolar bone thickness. Results were considered at a significance level of 5%. Mandibular incisors showed no statistical significance for vertical alveolar bone level. Alveolar bone thickness of mandibular incisors significantly reduced after treatment at B1, B2, B3, T1 and significantly increased at L2. The magnitude of the statistically significant changes was less than 0.2 mm. The changes in alveolar bone thickness showed no statistical significance with incisor inclination degree. CBCT scans showed an association between the Herbst appliance and alveolar bone loss on the buccal surface of mandibular incisors; however, without clinical significance.

  20. Comparison of two local anesthesia techniques (conventional & akinosi for inferior alveolar dental nerve

    Directory of Open Access Journals (Sweden)

    Refua Y

    2001-09-01

    Full Text Available Different techniques for local anesthesia are used in the mandible. The purpose of this study"nwas to determine the effects of inferior alveolar dental nerve blocks by comparing the two akinosi and"nconventional techniques. 80 patients (aged 15-60 years old were randomly divided into tow groups for"nextracting the mandibuler posterior teeth by akinosi and conventional techniques. Patients were all"ninjected with 1.8 ml of Lidocaine 2% plus Adernaline j^nnnn .Then the Pain Sensation during injection,"npositive aspiration, beginning time of anesthesia, duration of anesthesia depth of anesthesia, and the anesthesia of soft tissue related to sensory nerves were evaluated. The results showed that the pain sensation in conventional technique was significantly higher than that of akinosi technique. The number of positive aspirations in conventional technique (12,5% was higher than that of akinosi (5% but not significantly different. The long buccal nerve anesthesia in akinosi technique (75% was significantly higher than that of conventional technique. There was no significant difference between the two techniques for the depth of anesthesia. The success rate was 87.5% in conventional technique and 80% in akinosi technique. The average time of lips anesthesia in conventional technique was 3 minutes compared with 4 minutes in akinosi technique, which was not significantly different from each other. However, the beginning time of aneshtesia in tongue was significantly lower in conventional technique. No significant difference in the duration of anesthesia in lips and tonques between the two techniques was observed.

  1. Palatal approach of anterior superior alveolar injection technique may not be potentially useful in periodontal procedures

    Directory of Open Access Journals (Sweden)

    Pragathi Raghavendra Bhat

    2016-01-01

    Full Text Available Background: The palatal approach of anterior superior alveolar (P-ASA using WAND injection was reported to effectively provide a profound bilateral maxillary anesthesia of the soft tissue of anterior one-third of the palate and facial gingivae extending from canine to canine which lasted for more than an hour thus making it ideal for scaling root planing and minor periodontal procedures in the anterior maxilla. Our study suggests that the conventional P-ASA injection is of very short duration and the extent of anesthesia was not profound and consistent. This has not been reported earlier in the literature. Materials and Methods: Thirty-five cases (20 males and 15 females, who underwent scaling, root planing and minor periodontal surgical procedures such as abscess drainage, gingivectomy, and frenectomy in the maxillary anterior region in the age range of 19–45 years was assessed for the efficacy of the P-ASA injection. After the administration of the P-ASA injection, the subjective and the objective symptoms were used to evaluate the extent and duration of the anesthesia at 10, 15, and 20 min. Results: This study suggests that the conventional P-ASA injection technique does not provide anesthesia for more than 20 min. Wilcoxon matched pairs test was used to compare the effect of anesthesia at the different time intervals and the results were found to be statistically significant (P < 0.05. Conclusions: The conventional P-ASA injection technique is of very short duration and does not demonstrate effectiveness in periodontal surgery of the anterior maxilla.

  2. Heparanase activity in alveolar and embryonal rhabdomyosarcoma: implications for tumor invasion

    Directory of Open Access Journals (Sweden)

    Rosolen Angelo

    2009-08-01

    Full Text Available Abstract Background Rhabdomyosarcoma (RMS is a malignant soft tissue sarcoma of childhood including two major histological subtypes, alveolar (ARMS and embryonal (ERMS RMS. Like other human malignancies RMS possesses high metastatic potential, more pronounced in ARMS than in ERMS. This feature is influenced by several biological molecules, including soluble factors secreted by tumor cells, such as heparanase (HPSE. HPSE is an endo-β-D-glucuronidase that cleaves heparan sulphate proteoglycans. Methods We determined HPSE expression by Western blot analysis in ARMS and ERMS cells lines and activity in supernatants by an ELISA assay. Stable HPSE silencing has been performed by shRNA technique in RH30 and RD cell lines and their invasiveness has been evaluated by Matrigel-invasion assay. HPSE activity and mRNA expression have also been quantified in plasma and biopsies from RMS patients. Results HPSE expression and activity have been detected in all RMS cell lines. Stable HPSE silencing by shRNA technique determined a significant knockdown of gene expression equal to 76% and 58% in RH30 and RD cell lines respectively and induced a less invasive behaviour compared to untreated cells. Finally, we observed that HPSE mRNA expression in biopsies was higher than in foetal skeletal muscle and that plasma from RMS patients displayed significantly more elevated HPSE levels than healthy subjects with a trend to higher levels in ARMS. Conclusion In conclusion, our data demonstrate for the first time HPSE expression and activity in RMS and highlight its involvement in tumor cell invasion as revealed by shRNA silencing. Moreover, HPSE expression in RMS patients is significantly higher with respect to healthy subjects. Further studies are warranted to assess possible relationships between HPSE and clinical behaviour in RMS.

  3. Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients

    DEFF Research Database (Denmark)

    Andersen, Kristian; Nørholt, Sven Erik; Knudsen, Johan

    Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients......Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients...

  4. Is there a relation between local bone quality as assessed on panoramic radiographs and alveolar bone level?

    Science.gov (United States)

    Nackaerts, Olivia; Gijbels, Frieda; Sanna, Anna-Maria; Jacobs, Reinhilde

    2008-03-01

    The aim was to explore the relation between radiographic bone quality on panoramic radiographs and relative alveolar bone level. Digital panoramic radiographs of 94 female patients were analysed (mean age, 44.5; range, 35-74). Radiographic density of the alveolar bone in the premolar region was determined using Agfa Musica software. Alveolar bone level and bone quality index (BQI) were also assessed. Relationships between bone density and BQI on one hand and the relative loss of alveolar bone level on the other were assessed. Mandibular bone density and loss of alveolar bone level were weakly but significantly negatively correlated for the lower premolar area (r = -.27). The BQI did not show a statistically significant relation to alveolar bone level. Radiographic mandibular bone density on panoramic radiographs shows a weak but significant relation to alveolar bone level, with more periodontal breakdown for less dense alveolar bone.

  5. Soft tissue angiosarcomas

    Energy Technology Data Exchange (ETDEWEB)

    Morales, P.H.; Lindberg, R.D.; Barkley, H.T.

    1981-12-01

    From 1949 to 1979, 12 patients with soft tissue angiosarcoma received radiotherapy (alone or in combination with other modalities of treatment) with curative intent at The University of Texas M.D. Anderson Hospital and Tumor Institute. The primary site was the head and neck in six patients (scalp, four; maxillary antrum, one; and oral tongue, one), the breast in four patients, and the thigh in two patients. All four patients with angiosarcoma of the scalp had advanced multifocal tumors, and two of them had clinically positive neck nodes. None of these tumors were controlled locally, and local recurrences occurred within and/or at a distance from the generous fields of irradiation. The remaining two patients with head and neck lesions had their disease controlled by surgery and postoperative irradiation. Three of the four angiosarcomas of the breast were primary cases which were treated by a combination of surgery (excisional biopsy, simple mastectomy, radical mastectomy) and postoperative irradiation. One patient also received adjuvant chemotherapy. The fourth patient was treated for scar recurrence after radical mastectomy. All four patients had their disease locally controlled, and two of them have survived over 5 years. The two patients with angiosarcoma of the thigh were treated by conservative surgical excision and postoperative irradiation. One patient had her disease controlled; the other had a local recurrence requiring hip disarticulation and subsequent hemipelvectomy for salvage.

  6. Softly Massive Gravity

    CERN Document Server

    Gabadadze, Gregory T

    2004-01-01

    Large-distance modification of gravity may be the mechanism for solving the cosmological constant problem. A simple model of the large-distance modification -- four-dimensional (4D) gravity with the hard mass term-- is problematic from the theoretical standpoint. Here we discuss a different model, the brane-induced gravity, that effectively introduces a soft graviton mass. We study the issues of unitarity, analyticity and causality in this model in more than five dimensions. We show that a consistent prescription for the poles of the Green's function can be specified so that 4D unitarity is preserved. However, in certain instances 4D analyticity cannot be maintained when theory becomes higher dimensional. As a result, one has to sacrifice 4D causality at distances of the order of the present-day Hubble scale. This is a welcome feature for solving the cosmological constant problem, as was recently argued in the literature. We also show that, unlike the 4D massive gravity, the model has no strong-coupling probl...

  7. Neutrons in soft matter

    CERN Document Server

    Imae, Toyoko; Furusaka, Michihiro; Torikai, Naoya

    2011-01-01

    Neutron and synchrotron facilities, which are beyond the scale of the laboratory, and supported on a national level in countries throughout the world.  These tools for probing micro- and nano-structure research and on fast dynamics research of atomic location in materials have been key in the development of new polymer-based materials. Different from several existing professional books on neutron science, this book focuses on theory, instrumentation, an applications. The book is divided into five parts: Part 1 describes the underlying theory of neutron scattering. Part 2 desc

  8. Histological analysis of the Ankylos peri-implant soft tissues in a dog model.

    Science.gov (United States)

    Tenenbaum, Henri; Schaaf, Jean-François; Cuisinier, Frédéric J

    2003-01-01

    The importance of the soft tissue-implant interface is enhanced by the presence of a microgap between the implant and the abutment, which represents a contamination site for bacteria. The aim of this study was to investigate the interface between the Ankylos gap-free implant system and the surrounding soft tissues in a dog model. Six Labrador dogs were included in the study and two Ankylos implants were inserted per dog. The dogs were killed 6 months after abutment placement without functional loading and without plaque control. The implants were analysed histologically by scanning electron microscopy, light microscopy, and histomorphometry. Some sections exhibited histologic signs of a mild inflammation. The connective tissue between the most apical epithelial cells of the junctional epithelium and the alveolar crest was characterized by collagen fibers running from the periosteum and the alveolar crest toward the oral epithelium and, in front of the cone-shaped abutment, by a narrow zone of extracellular matrix with a few collagen fibers. Compared with results obtained in other studies using different types of implant (Astra, Bränemark, ITI), the Ankylos implant showed a higher length and a larger width of connective tissue contact as well as a shorter epithelial downgrowth. The absence of a microgap in the Ankylos system could explain the histologic mild inflammation in the connective tissue.

  9. Hard evidence on soft skills.

    Science.gov (United States)

    Heckman, James J; Kautz, Tim

    2012-08-01

    This paper summarizes recent evidence on what achievement tests measure; how achievement tests relate to other measures of "cognitive ability" like IQ and grades; the important skills that achievement tests miss or mismeasure, and how much these skills matter in life. Achievement tests miss, or perhaps more accurately, do not adequately capture, soft skills -personality traits, goals, motivations, and preferences that are valued in the labor market, in school, and in many other domains. The larger message of this paper is that soft skills predict success in life, that they causally produce that success, and that programs that enhance soft skills have an important place in an effective portfolio of public policies.

  10. Soft tissue tumors - imaging methods

    International Nuclear Information System (INIS)

    Arlart, I.P.

    1985-01-01

    Soft Tissue Tumors - Imaging Methods: Imaging methods play an important diagnostic role in soft tissue tumors concerning a preoperative evaluation of localization, size, topographic relationship, dignity, and metastatic disease. The present paper gives an overview about diagnostic methods available today such as ultrasound, thermography, roentgenographic plain films and xeroradiography, radionuclide methods, computed tomography, lymphography, angiography, and magnetic resonance imaging. Besides sonography particularly computed tomography has the most important diagnostic value in soft tissue tumors. The application of a recently developed method, the magnetic resonance imaging, cannot yet be assessed in its significance. (orig.) [de

  11. New operational techniques of implantation of biomaterials and titanium implants in the jaw with the atrophy of the bone and soft tissues

    Science.gov (United States)

    Nikityuk, D. B.; Urakov, A. L.; Reshetnikov, A. P.; Kopylov, M. V.; Baimurzin, D. Yu.

    2015-11-01

    The research into dynamics of quality of clinical use in 2003 - 2012 of autologous and xenogeneic biomaterials at dental transplantation and implantation among 1,100 of adult patients was made. The analysis results show that at autologous bone transplantation implant survival is observed only in 72% of cases, and the "necessary" result of bone repair occurred only in 6 - 9 months. Transplantation of biomaterials of OsteoBiol® (materials "mp3", "Genos" and "Evolution") provided engraftment and bone regeneration in 100 % of cases and allowed the use of dental implantation immediately after transplantation even in case of reduction in the patient's alveolar crest down to 2.0 mm. Replace Select implants of Nobel Biocare® were used at plantation. In order to exclude Schneiderian membrane's perforation lighting of Highmore's sinus with the cold blue-violet light from inside at sinus elevation is recommended as well as deepening of dental instruments into the bone only until the blue-violet light appears under them. To exclude deficiency of soft tissue under the cervical part of the ceramic crown application of special anti-fissure technology involving biomaterial flap dissection and its laying around the implant is suggested.

  12. Some Local Properties of Soft Semi-Open Sets

    Directory of Open Access Journals (Sweden)

    Bin Chen

    2013-01-01

    Full Text Available We introduce some local properties by soft semi-open sets. For example, soft semi-neighborhoods of the soft point, soft semi-first-countable spaces and soft semi-pu-continuous at the soft point are given. Furthermore, we define soft semi-connectedness and prove that a soft topological space is soft semiconnected if and only if both soft semi-open and soft semi-closed sets are only ∅ and X~.

  13. A contemporary perspective on techniques for the clinical assessment of alveolar bone

    Energy Technology Data Exchange (ETDEWEB)

    Hausmann, E. (State Univ. of New York, Buffalo (USA))

    1990-03-01

    Radiographic techniques, traditional ones as well as newer ones under development, for clinically assessing alveolar bone are critically assessed. Traditional intraoral radiography is reexamined, in particular with regard to the accuracy with which the alveolar crest is seen. Evidence is presented for a more accurate representation of the alveolar crest on bitewings rather than periapical films. Application in periodontics of newer radiographic techniques, subtraction radiography, and single and dual photon aborptiometry presently under clinical development are discussed in regard to their potential and limitations. Similarly, radiopharmaceuticals to evaluate the metabolic status of alveolar bone are discussed as well as the potential for using analyses of gingival crevice fluid as a window for assessment of alveolar crest metabolism. 46 references.

  14. A contemporary perspective on techniques for the clinical assessment of alveolar bone

    International Nuclear Information System (INIS)

    Hausmann, E.

    1990-01-01

    Radiographic techniques, traditional ones as well as newer ones under development, for clinically assessing alveolar bone are critically assessed. Traditional intraoral radiography is reexamined, in particular with regard to the accuracy with which the alveolar crest is seen. Evidence is presented for a more accurate representation of the alveolar crest on bitewings rather than periapical films. Application in periodontics of newer radiographic techniques, subtraction radiography, and single and dual photon aborptiometry presently under clinical development are discussed in regard to their potential and limitations. Similarly, radiopharmaceuticals to evaluate the metabolic status of alveolar bone are discussed as well as the potential for using analyses of gingival crevice fluid as a window for assessment of alveolar crest metabolism. 46 references

  15. Factors Influencing the Soft Tissue Changes Around Single Laser Microtextured Implants-Abutments in the Anterior Maxilla: A 5-Year Retrospective Study.

    Science.gov (United States)

    Guarnieri, Renzo; Savio, Luca; Bermonds des Ambrois, Alessandro; Ippoliti, Stefano; Zuffetti, Francesco; Stefanelli, Luigi Vito; Di Carlo, Stefano; Pompa, Giorgio

    2016-12-01

    The aim of this study was to evaluate the possible factors that influenced the periimplant soft tissue changes around single implants-abutments with laser-microtextured surface (LMS) in the esthetic zone. Thirty-nine units, formed by implant-abutment with LMS were studied. Variables possibly associated with the periimplant soft tissue changes were obtained from clinical measurements (plaque [present/absent], periimplant biotype [thin/thick], and probing depth); intrasurgical measurements (vertical height in millimeters of the keratinized gingiva in the vestibular part of the implant site vestibular keratinized gingiva [VKG], implant vestibular crestal exposition, vestibular crestal level, and vestibular bone width); cast models (implant position [buccal/palatal], implant abutments angle); periapical radiographs (distance from the contact point to the interproximal bone crest of the adjacent tooth [CP-BC], distance from the contact point to the implant platform [CP-P], distance from the contact point to the first bone to implant contact [CP-IB]); and digital clinical photographs. Fisher exact test was used to determine the influence of each factor on the papilla level and on the facial marginal mucosal level. The papillae level at the implant sites was significantly associated with the distance from the contact point to the alveolar bone crest, whereas no association was found with other variables. Periimplant biotype, differences in the VKG, CP-BC, and CP-IB were found associated with the different facial marginal mucosal level groups. This study showed that the papilla level at single-tooth implants-abutments with LMS in the anterior maxilla was mainly influenced by the interproximal bone crest level of the adjacent tooth, whereas the marginal mucosal level was affected by periimplant biotype, facial bone crest level, and crestal implant exposition.

  16. Clinical study of the alveolar bone height for the dental implant using preoperative computed tomographic examination

    International Nuclear Information System (INIS)

    Sekiya, Keiko; Mori, Shintaro; Sekiya, Kotaro

    2008-01-01

    CT examination is useful for preoperative dental implant, and many studies of concerning clinical studies using CT images have been reported. However, there are few reports comparing alveolar bone heights among age groups of many cases. The purpose of this study was to evaluate the clinical studies of preoperative CT examinations for alveolar bone heights and patient ages at our department of radiology using 64 multi-detector row CT. The subjects consisted of 5174 regions in 1312 (425 males and 887 females, mean age 55.5 yrs, 16-86 yrs) cases of preoperative CT examinations, between April 2006 and December 2007. CT machine used was the Aquilion TM 64 (Toshiba Medical Systems, Japan), and the workstation used was the ZIOSTATION (ZIOSOFT, Japan). All of CT examinations were performed the position of implant placement and disease examined from CT findings. Alveolar bone heights for dental implants were examined from the CT images. For the maxilla, the alveolar bone height was the distance from the alveolar crest to the base of the nasal cavity, or the base of the maxillary sinus. For the mandible, the alveolar bone height is the distance from the alveolar crest and the upper wall of the mandibular canal, or the distance between the alveolar crest and inferior border of mandible. The numbers of the implant position were 955 site for the first molar of the mandible (the average alveolar bone height is 13.9 mm), 652 site for the second molar of the mandible (12.8 mm), and 567 site for the first molar of the maxilla (6.8 mm). In conclusion, the position where implant were to placed the most was the first molar of the mandible, and it's alveolar bone height got lower with age for women. It is over 60% of the maxillary molar area were lower 8 mm, so some kind of osteogenetic treatment was required in many cases, and hence we reassured the importance of CT. (author)

  17. The use of digital periapical radiographs to study the prevalence of alveolar domes

    Energy Technology Data Exchange (ETDEWEB)

    Xambre, Pedro Augusto Oliveira Santos; Valerio, Claudia Scigliano; Alves Cardoso, Claudia Assuncoe; Custodio, Antonio Luis Neto; Manzi, Flavio Ricardo [Dept. of Oral Radiology, School of Dentistry, Pontifical Catholic University of Minas Gerais, Belo Horizonte (Brazil)

    2016-09-15

    In the present study, we coined the term 'alveolar dome' and aimed to demonstrate the prevalence of alveolar domes through digital periapical radiographs. This study examined 800 digital periapical radiographs in regard to the presence of alveolar domes. The periapical radiographs were acquired by a digital system using a photostimulable phosphor (PSP) plate. The χ2 test, with a significance level of 5%, was used to compare the prevalence of alveolar domes in the maxillary posterior teeth and, considering the same teeth, to verify the difference in the prevalence of dome-shaped phenomena between the roots. The prevalence of alveolar domes present in the first pre-molars was statistically lower as compared to the other maxillary posterior teeth (p<0.05). No statistically significant difference was observed in the prevalence of alveolar domes between the maxillary first and second molars. Considering the maxillary first and second molars, it was observed that the palatal root presented a lower prevalence of alveolar domes when compared to the distobuccal and mesiobuccal roots (p<0.05). The present study coined the term 'alveolar dome', referring to the anatomical projection of the root into the floor of the maxillary sinus. The maxillary first and second molars presented a greater prevalence of alveolar domes, especially in the buccal roots, followed by the third molars and second pre-molars. Although the periapical radiograph is a two-dimensional method, it can provide dentists with the auxiliary information necessary to identify alveolar domes, thus improving diagnosis, planning, and treatment.

  18. Towards tooth friendly soft drinks.

    Science.gov (United States)

    Kolahi, Jafar; Fazilati, Mohamad; Kadivar, Mahdi

    2009-10-01

    Most soft drinks contain high concentration of simple carbohydrates and have a pH of 3 or even lower. Therefore, they are harmful for tooth structure. A tooth friendly soft drink (T.F.S.D) should have the following characteristics and elements; fluoride (approximately 1 ppm), casein phosphopeptide-amorphous calcium phosphate (2%), xylitol (4-6g/serving), tea polyphenols (2-4 mg/ml), cranberry extract (250 mg/ml of the flavonoids quercetin and myricetin), sugar free, pH close to 5.5 and super oxygenation (240,000 ppm) vs. carbonation. T.F.S.D can be packaged in a container which gaseous oxygen is dissolved in a liquid in the form of bubbles. However, looking at opportunities for so-called sophisticated soft drinks, T.F.S.D will be an example for a functional and health oriented soft drink.

  19. Recursion relations from soft theorems

    Energy Technology Data Exchange (ETDEWEB)

    Luo, Hui [II. Institut für Theoretische Physik, Universität Hamburg, Luruper Chaussee 149, Hamburg, D-22761 (Germany); Wen, Congkao [I.N.F.N. Sezione di Roma “Tor Vergata”,Via della Ricerca Scientifica, Roma, 00133 (Italy)

    2016-03-14

    We establish a set of new on-shell recursion relations for amplitudes satisfying soft theorems. The recursion relations can apply to those amplitudes whose additional physical inputs from soft theorems are enough to overcome the bad large-z behaviour. This work is a generalization of the recursion relations recently obtained by Cheung et al. for amplitudes in scalar effective field theories with enhanced vanishing soft behaviours, which can be regarded as a special case of those with non-vanishing soft limits. We apply the recursion relations to tree-level amplitudes in various theories, including amplitudes in the Akulov-Volkov theory and amplitudes containing dilatons of spontaneously-broken conformal symmetry.

  20. Modular Joints for Soft Robots

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to design, optimize, and build several modular soft robotic joints which have between 3 and 6 degrees of freedom (DOF). These designs will be lighter,...

  1. Engineering applications of soft computing

    CERN Document Server

    Díaz-Cortés, Margarita-Arimatea; Rojas, Raúl

    2017-01-01

    This book bridges the gap between Soft Computing techniques and their applications to complex engineering problems. In each chapter we endeavor to explain the basic ideas behind the proposed applications in an accessible format for readers who may not possess a background in some of the fields. Therefore, engineers or practitioners who are not familiar with Soft Computing methods will appreciate that the techniques discussed go beyond simple theoretical tools, since they have been adapted to solve significant problems that commonly arise in such areas. At the same time, the book will show members of the Soft Computing community how engineering problems are now being solved and handled with the help of intelligent approaches. Highlighting new applications and implementations of Soft Computing approaches in various engineering contexts, the book is divided into 12 chapters. Further, it has been structured so that each chapter can be read independently of the others.

  2. Necrotizing soft-tissue infections.

    Science.gov (United States)

    Ahrenholz, D H

    1988-02-01

    A variety of infections are encountered by the practicing surgeon. Uncommonly, a patient presents with minimal external manifestations of a deep surgical soft-tissue infection. Early aggressive intervention is required to minimize the morbidity in these often debilitated patients.

  3. Soft tissue molding technique in cleft lip and palate patient using laser surgery in combination with orthodontic appliance: A case report.

    Science.gov (United States)

    Theerasopon, Pornpat; Wangsrimongkol, Tasanee; Sattayut, Sajee

    2017-03-31

    Although surgical treatment protocols for cleft lip and palate patients have been established, many patients still have some soft tissue defects after complete healing from surgical interventions. These are excess soft tissue, high attached fraena and firmed tethering scares. These soft tissue defects resulted shallowing of vestibule, restricted tooth movement, compromised periodontal health and trended to limit the maxillary growth. The aim of this case report was to present a method of correcting soft tissue defects after conventional surgery in cleft lip and palate patient by using combined laser surgery and orthodontic appliance. A bilateral cleft lip and palate patient with a clinical problem of shallow upper anterior vestibule after alveolar bone graft received a vestibular extension by using CO 2 laser with ablation and vaporization techniques at 4 W and continuous wave. A customized orthodontic appliance, called a buccal shield, was placed immediately after surgery and retained for 1 month to 3 months until complete soft tissue healing. The procedures were performed 2 episodes. Both interventions used the same CO 2 laser procedure. The first treatment resulted in partial re-attachment of soft tissue at surgical area. The second laser operation with the proper design of buccal shield providing passive contact with more extended flange resulting in a favorable outcome from 1 year follow up. Then the corrective orthodontic treatment could be continued effectively. The CO 2 laser surgery was a proper treatment for correcting soft tissue defects and the design of buccal shield was a key for success in molding surgical soft tissue.

  4. Lubrication of soft viscoelastic solids

    OpenAIRE

    Pandey, Anupam; Karpitschka, Stefan; Venner, Cornelis H.; Snoeijer, Jacobus Hendrikus

    2015-01-01

    Lubrication flows appear in many applications in engineering, biophysics, and in nature. Separation of surfaces and minimisation of friction and wear is achieved when the lubrication fluid builds up a lift force. In this paper we analyse soft lubricated contacts by treating the solid walls as viscoelastic: soft materials are typically not purely elastic, but dissipate energy under dynamical loading conditions. We present a method for viscoelastic lubrication and focus on three canonical examp...

  5. Soft ideal topological space and mixed fuzzy soft ideal topological space

    Directory of Open Access Journals (Sweden)

    Manash Borah

    2019-01-01

    Full Text Available In this paper we introduce fuzzy soft ideal and mixed fuzzy soft ideal topological spaces and some properties of this space. Also we introduce fuzzy soft $I$-open set, fuzzy soft $\\alpha$-$I$-open set, fuzzy soft pre-$I$-open set, fuzzy soft semi-$I$-open set and fuzzy soft $\\beta$-$I$-open set and discuss some of their properties.

  6. Alveolar Molding Effect in Infants With Unilateral Cleft Lip and Palate: Comparison of Two- and Three-Dimensional Measurements.

    Science.gov (United States)

    Lim, Won Hee; Park, Eun Woo; Chae, Hwa Sung; Kwon, Soon Man; Jung, Hoi-In; Baek, Seung-Hak

    2017-06-01

    The purpose of this study was to compare the results of two- (2D) and three-dimensional (3D) measurements for the alveolar molding effect in patients with unilateral cleft lip and palate. The sample consisted of 23 unilateral cleft lip and palate infants treated with nasoalveolar molding (NAM) appliance. Dental models were fabricated at initial visit (T0; mean age, 23.5 days after birth) and after alveolar molding therapy (T1; mean duration, 83 days). For 3D measurement, virtual models were constructed using a laser scanner and 3D software. For 2D measurement, 1:1 ratio photograph images of dental models were scanned by a scanner. After setting of common reference points and lines for 2D and 3D measurements, 7 linear and 5 angular variables were measured at the T0 and T1 stages, respectively. Wilcoxon signed rank test and Bland-Altman analysis were performed for statistical analysis. The alveolar molding effect of the maxilla following NAM treatment was inward bending of the anterior part of greater segment, forward growth of the lesser segment, and decrease in the cleft gap in the greater segment and lesser segment. Two angular variables showed difference in statistical interpretation of the change by NAM treatment between 2D and 3D measurements (ΔACG-BG-PG and ΔACL-BL-PL). However, Bland-Altman analysis did not exhibit significant difference in the amounts of change in these variables between the 2 measurements. These results suggest that the data from 2D measurement could be reliably used in conjunction with that from 3D measurement.

  7. An Optimised Human Cell Culture Model for Alveolar Epithelial Transport

    Science.gov (United States)

    Birch, Nigel P.; Suresh, Vinod

    2016-01-01

    Robust and reproducible in vitro models are required for investigating the pathways involved in fluid homeostasis in the human alveolar epithelium. We performed functional and phenotypic characterisation of ion transport in the human pulmonary epithelial cell lines NCI-H441 and A549 to determine their similarity to primary human alveolar type II cells. NCI-H441 cells exhibited high expression of junctional proteins ZO-1, and E-cadherin, seal-forming claudin-3, -4, -5 and Na+-K+-ATPase while A549 cells exhibited high expression of pore-forming claudin-2. Consistent with this phenotype NCI-H441, but not A549, cells formed a functional barrier with active ion transport characterised by higher electrical resistance (529 ± 178 Ω cm2 vs 28 ± 4 Ω cm2), lower paracellular permeability ((176 ± 42) ×10−8 cm/s vs (738 ± 190) ×10−8 cm/s) and higher transepithelial potential difference (11.9 ± 4 mV vs 0 mV). Phenotypic and functional properties of NCI-H441 cells were tuned by varying cell seeding density and supplement concentrations. The cells formed a polarised monolayer typical of in vivo epithelium at seeding densities of 100,000 cells per 12-well insert while higher densities resulted in multiple cell layers. Dexamethasone and insulin-transferrin-selenium supplements were required for the development of high levels of electrical resistance, potential difference and expression of claudin-3 and Na+-K+-ATPase. Treatment of NCI-H441 cells with inhibitors and agonists of sodium and chloride channels indicated sodium absorption through ENaC under baseline and forskolin-stimulated conditions. Chloride transport was not sensitive to inhibitors of the cystic fibrosis transmembrane conductance regulator (CFTR) under either condition. Channels inhibited by 5-nitro-1-(3-phenylpropylamino) benzoic acid (NPPB) contributed to chloride secretion following forskolin stimulation, but not at baseline. These data precisely define experimental conditions for the application of NCI

  8. Interaction of rat alveolar macrophages with dental composite dust.

    Science.gov (United States)

    Van Landuyt, K L; Cokic, S M; Asbach, C; Hoet, P; Godderis, L; Reichl, F X; Van Meerbeek, B; Vennemann, A; Wiemann, M

    2016-11-26

    Dental composites have become the standard filling material to restore teeth, but during the placement of these restorations, high amounts of respirable composite dust (nano-sized particles may be released in the breathing zone of the patient and dental operator. Here we tested the respirable fraction of several composite particles for their cytotoxic effect using an alveolar macrophage model system. ​METHODS: Composite dust was generated following a clinical protocol, and the dust particles were collected under sterile circumstances. Dust was dispersed in fluid, and 5-μm-filtered to enrich the respirable fractions. Quartz DQ12 and corundum were used as positive and negative control, respectively. Four concentrations (22.5 μg/ml, 45 μg/ml, 90 μg/ml and 180 μg/ml) were applied to NR8383 alveolar macrophages. Light and electron microscopy were used for subcellular localization of particles. Culture supernatants were tested for release of lactate dehydrogenase, glucuronidase, TNF-α, and H 2 O 2 . Characterization of the suspended particles revealed numerous nano-sized particles but also many high volume particles, most of which could be removed by filtering. Even at the highest concentration (180 μg/ml), cells completely cleared settled particles from the bottom of the culture vessel. Accordingly, a mixture of nano- and micron-scaled particles was observed inside cells where they were confined to phagolysosomes. The filtered particle fractions elicited largely uniform dose-dependent responses, which were elevated compared to the control only at the highest concentration, which equaled a mean cellular dose of 120 pg/cell. A low inflammatory potential was identified due to dose-dependent release of H 2 O 2 and TNF-α. However, compared to the positive control, the released levels of H 2 O 2 and TNF-α were still moderate, but their release profiles depended on the type of composite. Alveolar macrophages are able to phagocytize respirable composite dust

  9. Hormonal regulation of alveolarization: structure-function correlation

    Directory of Open Access Journals (Sweden)

    Godinez Marye H

    2006-03-01

    Full Text Available Abstract Background Dexamethasone (Dex limits and all-trans-retinoic acid (RA promotes alveolarization. While structural changes resulting from such hormonal exposures are known, their functional consequences are unclear. Methods Neonatal rats were treated with Dex and/or RA during the first two weeks of life or were given RA after previous exposure to Dex. Morphology was assessed by light microscopy and radial alveolar counts. Function was evaluated by plethysmography at d13, pressure volume curves at d30, and exercise swim testing and arterial blood gases at both d15 and d30. Results Dex-treated animals had simplified lung architecture without secondary septation. Animals given RA alone had smaller, more numerous alveoli. Concomitant treatment with Dex + RA prevented the Dex-induced changes in septation. While the results of exposure to Dex + RA were sustained, the effects of RA alone were reversed two weeks after treatment was stopped. At d13, Dex-treated animals had increased lung volume, respiratory rate, tidal volume, and minute ventilation. On d15, both RA- and Dex-treated animals had hypercarbia and low arterial pH. By d30, the RA-treated animals resolved this respiratory acidosis, but Dex-treated animals continued to demonstrate blood gas and lung volume abnormalities. Concomitant RA treatment improved respiratory acidosis, but failed to normalize Dex-induced changes in pulmonary function and lung volumes. No differences in exercise tolerance were noted at either d15 or d30. RA treatment after the period of alveolarization also corrected the effects of earlier Dex exposure, but the structural changes due to RA alone were again lost two weeks after treatment. Conclusion We conclude that both RA- and corticosteroid-treatments are associated with respiratory acidosis at d15. While RA alone-induced changes in structure andrespiratory function are reversed, Dex-treated animals continue to demonstrate increased respiratory rate, minute

  10. Soft Skill: Its Urgency and Development at Islamic Higher Education

    Directory of Open Access Journals (Sweden)

    Ahmad Sabri

    2014-11-01

    Full Text Available The success of a person in a career work is not only determined by his or her technical capability, but also the non-technical skills which is so called ‘soft-skills’.  It is an attitude which is exemplified among the cognitive and values in the interaction with people around. Several identified falures in the community’s life indicate that many Islamic university graduates suffered from lack of ability to build  harmonious relationship with the environment.  Therefore, it is a high time for this institution to consistently instil some types of soft-skills on the parts of the students.  The current study shares the urgent needs for developing students’ soft-skills for Islamic colleges and universities. The paper ends up with several conclusions while promoting some commitments to be held by the faculty development including: the identification of soft-skills that have already existed in the students’ minds and which need to be developed, the exploration of soft skills attributes for the next 5 years based on the inspiration or opinion of the stake holders and alumnaes, the setting of action plan for academic and non-cademic agendas, acting out the planned activities, as well as the sustainable blue-print of valid soft-skills. Copyright © 2014 by Al-Ta'lim All right reserved

  11. [Soft tissue rheumatism in erderly].

    Science.gov (United States)

    Szczepański, Leszek

    2008-01-01

    Disorders of soft, peri-articular tissues are a common cause of musculoskeletal pain in elderly patients. Nevertheless, most physicians underestimate the role of soft tissue rheumatism in the pathomechanism of the pain. The impairments of soft tissue can not be diagnosed by X-rays examinations, whereas degenerative lesions of joints are easy diagnosed using this method even despite of their uncertain role in producing the symptoms. The incidence of pain syndromes originated from soft tissues differ regarding to the age of patients. In young subjects the incidence of all of them is generally low. Syndromes provoked by overloading during work: repetitive strain syndrome, canal tunnel syndrome, tennis elbow, golfers elbow, shoulder tendon coin disorders and myofascial pain syndrome are common in middle-aged patients. The morbidity of fibromialgia syndrome is also lower in old people probably as the result of diminished numbers and degenerative changes in nociceptive fibers. The syndromes prevailing in elderly patients include trochanteric syndrome and the pain syndromes provoked by muscle spasm depended on posture abnormalities. In the soft tissue pain syndrome prevention adapted to old age kinesitherapy and avoiding muscle overloading are recommended. Soft tissue pain syndromes are usually treated with non steroidal anti inflammatory drugs. In local pain syndromes better results can be obtained by local treatment. Local injections of glikocorticosteroids are usually very effective and safe.

  12. Clinical outcomes of the KYOCERA Physio Hinge Total Knee System Type III after the resection of a bone and soft tissue tumor of the distal part of the femur.

    Science.gov (United States)

    Matsumine, Akihiko; Ueda, Takafumi; Sugita, Takashi; Yazawa, Yasuo; Isu, Kazuo; Kawai, Akira; Abe, Satoshi; Yakushiji, Toshitake; Hiraga, Hiroaki; Sudo, Akihiro; Uchida, Atsumasa

    2011-03-01

    The KYOCERA Physio Hinge Total Knee System Type III (PHKIII) was developed to reconstruct bony defects of the distal femur. The PHKIII is originative in that the metallic parts are fully made of titanium alloy, and this prosthesis has a unique semi-rotating hinge joint and was designed especially for people with the Asian physical body-type. The clinical outcomes of the PHKIII after the resection of musculoskeletal tumors of the distal femur were evaluated. There were 41 males and 28 females with a median age of 48-years. The median duration of follow-up was 57 months. Eleven early complications and 37 late complications were observed, including 10 recurrences, 7 deep infections, 7 aseptic loosenings, 4 stem breakages, 4 displacements of shaft cap, and one wear of rotation sleeve. Twenty four prosthesis (35%) required a secondary operation because of complications. The five-year overall prosthetic survival rates, -prosthetic survival rate without aseptic loosening, and -limbs preservation rate were 85%, 90%, and 86%, respectively. The mean functional score according to the classification system of the Musculoskeletal Tumor Society was 20.5 points (68%). Although continuous follow-up is required, reconstructions using PHKIII are considered to achieve more acceptable functional results. Copyright © 2010 Wiley-Liss, Inc.

  13. Temporal sequence of hard and soft tissue healing around titanium dental implants.

    Science.gov (United States)

    Salvi, Giovanni E; Bosshardt, Dieter D; Lang, Niklaus P; Abrahamsson, Ingemar; Berglundh, Tord; Lindhe, Jan; Ivanovski, Saso; Donos, Nikos

    2015-06-01

    The objective of the present review was to summarize the evidence available on the temporal sequence of hard and soft tissue healing around titanium dental implants in animal models and in humans. A search was undertaken to find animal and human studies reporting on the temporal dynamics of hard and soft tissue integration of titanium dental implants. Moreover, the influence of implant surface roughness and chemistry on the molecular mechanisms associated with osseointegration was also investigated. The findings indicated that the integration of titanium dental implants into hard and soft tissue represents the result of a complex cascade of biological events initiated by the surgical intervention. Implant placement into alveolar bone induces a cascade of healing events starting with clot formation and continuing with the maturation of bone in contact with the implant surface. From a genetic point of view, osseointegration is associated with a decrease in inflammation and an increase in osteogenesis-, angiogenesis- and neurogenesis-associated gene expression during the early stages of wound healing. The attachment and maturation of the soft tissue complex (i.e. epithelium and connective tissue) to implants becomes established 6-8 weeks following surgery. Based on the findings of the present review it can be concluded that improved understanding of the mechanisms associated with osseointegration will provide leads and targets for strategies aimed at enhancing the clinical performance of titanium dental implants. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. [Evaluation with different measuring methods for the alveolar bone change of ridge preservation in molar sites].

    Science.gov (United States)

    Zhao, Li-ping; Zhan, Ya-lin; Hu, Wen-jie; Xu, Tao; Wei, Yi-ping; Zhen, Min; Wang, Cui

    2016-02-18

    To investigate the changes of the vertical height and width of the alveolar bone six months after the alveolar ridge preservation in periodontal compromised molar sites of severe alveolar bone defects with clinical direct measurement, parallel periapical radiographs, and cone-beam computed tomography (CBCT), and to analyze the effect of the three different methods of measurement. In this study, 20 subjects requiring tooth extraction on account of periodontal disease with a total of 23 extracted molars were enrolled. Extractions were performed atraumatically and patients were received alveolar ridge preservation procedure with Bio-Oss and Bio-Gide. Clinical direct measurements were taken after tooth extraction and during the implant surgery 6 months later, CBCT scans and parallel periapical radiographs were taken immediately after ridge preservation and 6 months later. The changes of alveolar ridge width and vertical height after six months were measured and analyzed through the above-mentioned three methods and the similarities and differences of the measured effect were compared. There were no significant difference of alveolar vertical height in the center of the extraction sites, the center of distal aspect, and distobuccal aspect between the clinical direct measurements and the CBCT measurements (P>0.05), alveolar vertical height in other points and alveolar width measurements were statically significant (Palveolar increased significantly and the changes of alveolar vertical height of clinical direct and CBCT measurement were (6.15 ± 1.73) mm and (6.59 ± 2.53) mm, respectively. The measurements of the width of the alveolar bone were (8.45 ± 1.18) mm and (8.52 ± 1.27) mm, respectively. The measurements of the two methods were not statistically significant (P>0.05). The change of the alveolar height in the center of the extraction socket after six months measured by parallel periapical was (5.84 ± 4.28) mm, which was closed to the clinical direct measurement

  15. Modified technique for preservation of inferior alveolar nerve during mandibulectomy.

    Science.gov (United States)

    Chen, Min-Jie; Yang, Chi; Huang, Dong; He, Dong-Mei; Wang, Yi-Wen; Zhang, Wen-Hao

    2017-12-01

    The purpose of this article is to introduce the modified technique of preservation of the inferior alveolar nerve (IAN) during mandibulectomy for a benign lesion. Five cases of osteofibrous hyperplasia and 3 cases of centricity osteomyelitis were included. During surgery, the IAN was marked using a planned cutting guide. Using an oscillating saw, the depth of the osteotomy along the IAN was controlled until the bone cortex was cut through. After splitting, the bony section was removed, leaving the neurovascular bundle intact. The sensation of the lower lip was evaluated using current perceptive threshold testing during follow-up. After follow-up for 6-27 months, no recurrence or secondary deformity was found. One patient had severe sensory disturbance. With the use of a cutting guide and osteotomy tricks, mandibulectomy with preservation of the IAN can be accurately performed. © 2017 Wiley Periodicals, Inc.

  16. Hepatic alveolar echinococcosis: correlative US and CT study

    Energy Technology Data Exchange (ETDEWEB)

    Didier, D.; Weiler, S.; Rohmer, P.; Lasseque, A.; Deschamps, J.P.; Vuitton, D.; Miguet, J.P.; Weill, F.

    1985-01-01

    A total of 24 cases of hepatic alveolar echinococcosis (HAE) due to Echinococcus multilocularis was assessed by US and CT. The diagnosis was confirmed in all cases by immunologic and histologic study. Both US and CT patterns of HAE showed changes of liver morphology in both contour and size. Abnormal areas of parenchyma were nodular or in fields, irregular, heterogeneous, and basically echogenic. Clustered microcalcifications were encountered within the abnormal parenchymal fields in 50% of cases, and necrotized zones occurred in 40% of cases. Dilatation of intrahepatic bile ducts was commonly seen, especially on US; hilar involvement was frequent. Follow-up by both techniques can display increases of primary lesions, occurrence of new foci, and local or regional extensions. Precise evaluations of the lesions arising from correlative use of US and CT permits adequate therapeutic management.

  17. Alveolar bone tissue engineering using composite scaffolds for drug delivery

    Directory of Open Access Journals (Sweden)

    Tomonori Matsuno

    2010-08-01

    Full Text Available For many years, bone graft substitutes have been used to reconstruct bone defects in orthopedic and dental fields. However, synthetic bone substitutes such as hydroxyapatite or β-tricalcium phosphate have no osteoinductive or osteogenic abilities. Bone tissue engineering has also been promoted as an alternative approach to regenerating bone tissue. To succeed in bone tissue engineering, osteoconductive scaffolding biomaterials should provide a suitable environment for osteogenic cells and provide local controlled release of osteogenic growth factors. In addition, the scaffold for the bone graft substitute should biodegrade to replace the newly formed bone. Recent advances in bone tissue engineering have allowed the creation of composite scaffolds with tailored functional properties. This review focuses on composite scaffolds that consist of synthetic ceramics and natural polymers as drug delivery carriers for alveolar bone tissue engineering.

  18. A case of pulmonary alveolar microlithiasis with Cor Pulmonale.

    Science.gov (United States)

    Chen, Wen; Gu, Tao

    2012-03-01

    Pulmonary alveolar microlithiasis (PAM) is a rare disease characterized by the formation and deposition of microliths within the alveoli and a paucity of symptoms in contrast to the imaging findings. It has familial tendency and is thought to be an autosomal recessive disorder with the mutation in the SLC34A2 gene. We describe a case of PAM with Cor Pulmonale. Ultrasonic cardiogram showed pulmonary hypertension (82 mmHg). Chest radiography revealed diffuse, bilateral sandstorm-like micronodules with greater density in the lower lung fields. HRCT scans demonstrated diffuse ground-grass opacities, thickening and calcification of interlobular septa and confluent calcified nodules. A diagnosis of PAM was suggested and confirmed by transbronchial lung biopsy (TBLB).

  19. Soft Mobility and Urban Transformation

    Directory of Open Access Journals (Sweden)

    Rosa Anna La Rocca

    2010-04-01

    Full Text Available This paper examines some European cases referred to promotion of soft mobility as a new lifestyle aimed to improve benefits on environment and urban liveability. Soft mobility includes any non-motorized transport (human powered mobility. According to this, soft mobility refers to pedestrian, bicycle, roller skate and skateboard transfers. It could be indented as “zeroimpact” mobility too. As a matter of fact, the words to define this way of moving have not been codified yet, therefore mobilitè douce, soft mobility, slow traffic are synonymous in referring mainly to pedestrians and cyclists to indicate alternative to car use. Soft mobility, indeed, can be defined as a special form of sustainable mobility able to optimize urban liveability, by keeping the individual right to move. At present, cities are engaged in defining policies, procedures and interventions to further “slow traffic”, both to relieve the traffic congestion, and to work for regeneration and environmental improvements. This asks for an in-depth cooperation between different political and administrative levels to achieve common objectives of development more attentive to environmental concerns. Despite this increasing attention, the idea of a “network” for soft mobility has not been yet achieved and the supply of integrated facilities and services as an alternative to the car use seems to be still difficult of accomplishment. High disparity characterizes European countries in promoting soft mobility: despite a prolific production of laws and roles referred to emergency of adopting alternative ways of moving to minimize negatives impacts (especially air and noise pollution as very threat to health due to car dependence for urban short distance too. And yet, soft mobility could represent a real occasion of urban and territorial regeneration aimed to rehabilitate some disused paths and routes (greenways. Some successful European cases show how it is possible to

  20. Alveolar wound healing in rats fed on high sucrose diet.

    Science.gov (United States)

    Baró, María A; Rocamundi, Marina R; Viotto, Javier O; Ferreyra, Ruth S

    2013-01-01

    The potential for bone repair is influenced by various biochemical, biomechanical, hormonal, and pathological mechanisms and factors such as diet and its components, all of which govern the behavior and function of the cells responsible for forming new bone. Several authors suggest that a high sucrose diet could change the calcium balance and bone composition in animals, altering hard tissue mineralization. The mechanism by which it occurs is unclear. Alveolar healing following tooth extraction has certain characteristics making this type of wound unique, in both animals and humans. The general aim of this study was to evaluate and quantify the biological response during alveolar healing following tooth extraction in rats fed on high sucrose diets, by means of osteocyte lacunae histomorphometry, counting empty lacunae and measuring areas of bone quiescence, formation and resorption. Forty-two Wistar rats of both sexes were divided into two groups: an experimental group fed on modified Stephan Harris diet (43% sucrose) and a control group fed on standard balanced diet. The animals were anesthetized and their left and right lower molars extracted. They were killed at 0 hours, 14, 28, 60 and 120 days. Samples were fixed, decalcified in EDTA and embedded in paraffin to prepare sections for optical microscopy which were stained with hematoxylin/eosin. Histomorphometric analysis showed significant differences in the size of osteocyte lacunae between groups at 28 and 60 days, with the experimental group having larger lacunae. There were more empty lacunae in the experimental group at 14 days, and no significant difference in the areas of bone activity. A high sucrose diet could modify the morphology and quality of bone tissue formed in the alveolus following tooth extraction.

  1. Ontogeny of pulmonary alveolar epithelial markers of differentiation.

    Science.gov (United States)

    Joyce-Brady, M F; Brody, J S

    1990-02-01

    We studied differentiation of the pulmonary epithelium in the periphery of fetal rat lung in vivo and in vitro by comparing the ontogeny of cell-surface glycoconjugates with that of surfactant phospholipids. Apical surface binding of the lectin Maclura pomifera agglutinin (MPA) and expression of a 200-kDa MPA-binding glycoprotein (MPA-gp200) was evident at 20 days gestation in type 2 cells, but did not correlate with ultrastructural features of type 2 cell differentiation. Epithelial cells isolated from peripheral lung of 18-day gestation fetal rats displayed hormone-sensitive surfactant synthesis prior to the hormone-insensitive expression of MPA-gp200. Expression of MPA-gp200 occurred in association with the appearance of many new apical surface proteins suggesting a hormone-independent process of polar membrane differentiation. Thus membrane and secretory differentiation are discordant and can be dissociated. In vivo binding of Ricinus communis 1 agglutinin (RCA1), an apical marker of the differentiated alveolar type 1 cell occurred in undifferentiated peripheral lung epithelial cells as early as 18 days gestation, disappeared from differentiating type 2 cells and appeared in differentiated type 1 cells. Both undifferentiated fetal epithelial cells at 18 days gestation and fully differentiated type 1 cells express multiple glycoproteins with terminal beta-linked galactose residues which bind RCA1. Some of these RCA1-binding glycoproteins appear to be similar. These observations suggest that alveolar epithelial type 1 cells may derive directly from undifferentiated peripheral lung epithelial cells as well as from fully differentiated type 2 cells. In addition, terminal differentiation of fetal lung peripheral epithelium into type 1 and type 2 cells may involve repression as well as induction of differentiation-related genes.

  2. The Effects of Alveolar Ridge Preservation: A Meta-Analysis.

    Science.gov (United States)

    Willenbacher, Maximillian; Al-Nawas, Bilal; Berres, Manfred; Kämmerer, Peer W; Schiegnitz, Eik

    2016-12-01

    The aim of this article was to analyze the horizontal, vertical, and histological effects of alveolar ridge preservation (ARP) versus the ones of unassisted socket healing, in the format of an up-to-date review and meta-analysis. An extensive electronic search in the electronic databases of the National Library of Medicine was conducted for articles published up to June 2014 to identify literature presenting data on the topic of ARP. Only randomized controlled trials, controlled clinical trials, and prospective trials were included for meta-analysis. After screening 903 abstracts from the electronic database, we included 64 studies in qualitative and 18 in quantitative synthesis. Quality assessment characterized a medium risk of bias for the included literature. The meta-analysis showed a mean difference between test and control groups of approximately 1.31 to 1.54 mm in bucco-oral bone width and 0.91 to 1.12 mm in bone height. Additionally, the intergroup difference in percentage of vital bone was assessed to be inconclusive across the included studies. Implants could be inserted into the determined position without further augmentation in 90.1% of the experimental sites, while this was the case in only 79.2% of the control sockets. Resorption of the alveolar ridge cannot be totally stopped by ARP, while it still can be prevented compared with unassisted healing. No reliable predictions on the histological effects could be made due to limited data. Further on, no recommendation for a specific technique of ARP could be made. In conclusion, there is still need for ongoing research on the topic, even though the lower percentage of implant sites that needed additional augmentation in test sockets seemed to bring a patient benefit. © 2015 Wiley Periodicals, Inc.

  3. Fractionated breath condensate sampling: H2O2 concentrations of the alveolar fraction may be related to asthma control in children

    Directory of Open Access Journals (Sweden)

    Trischler Jordis

    2012-02-01

    Full Text Available Abstract Background Asthma is a chronic inflammatory disease of the airways but recent studies have shown that alveoli are also subject to pathophysiological changes. This study was undertaken to compare hydrogen peroxide (H2O2 concentrations in different parts of the lung using a new technique of fractioned breath condensate sampling. Methods In 52 children (9-17 years, 32 asthmatic patients, 20 controls measurements of exhaled nitric oxide (FENO, lung function, H2O2 in exhaled breath condensate (EBC and the asthma control test (ACT were performed. Exhaled breath condensate was collected in two different fractions, representing mainly either the airways or the alveoli. H2O2 was analysed in the airway and alveolar fractions and compared to clinical parameters. Results The exhaled H2O2 concentration was significantly higher in the airway fraction than in the alveolar fraction comparing each single pair (p = 0.003, 0.032 and 0.040 for the whole study group, the asthmatic group and the control group, respectively. Asthma control, measured by the asthma control test (ACT, correlated significantly with the H2O2 concentrations in the alveolar fraction (r = 0.606, p = 0.004 but not with those in the airway fraction in the group of children above 12 years. FENO values and lung function parameters did not correlate to the H2O2 concentrations of each fraction. Conclusion The new technique of fractionated H2O2 measurement may differentiate H2O2 concentrations in different parts of the lung in asthmatic and control children. H2O2 concentrations of the alveolar fraction may be related to the asthma control test in children.

  4. SOFT SKILLS COMPETENCE DEVELOPMENT OF VOCATIONAL TEACHER CANDIDATES

    Directory of Open Access Journals (Sweden)

    I Made Sudana

    2015-02-01

    talent themselves, (2 environmental adaptation, (3 involvement in the organization and (4 development of social life and soul of educational. There needs to be a policy of the leaders of institutions to incorporate soft skills as part of the curriculum and study for the development of the model and test to kwoning the effectiveness of the model.

  5. Laser microdissection of the alveolar duct enables single-cell genomic analysis

    Directory of Open Access Journals (Sweden)

    Robert eBennett

    2014-09-01

    Full Text Available Complex tissues such as the lung are composed of structural hierarchies such as alveoli, alveolar ducts and lobules. Some structural units, such as the alveolar duct, appear to selectively participate in tissue regeneration. Here, we demonstrate an approach to conduct laser microdissection of the lung alveolar duct for single-cell PCR analysis. Our approach involved three steps. 1 The initial preparation used mechanical sectioning of the lung tissue with sufficient thickness to encompass the structure of interest. In the case of the alveolar duct, the precision-cut lung slices were 200um thick; the slices were processed using near-physiologic conditions to preserve the state of viable cells. 2 The lung slices were examined by transmission light microscopy to target the alveolar duct. The air-filled lung was sufficiently accessible by light microscopy that counterstains or fluorescent labels were unnecessary to identify the alveolar duct. 3 The enzymatic and microfluidic isolation of single cells allowed for the harvest of as few as several thousand cells for PCR analysis. Microfluidics based arrays were used to measure the expression of selected marker genes in individual cells to characterize different cell populations. Preliminary work suggests the unique value of this approach to understanding the intra- and intercellular interactions within the regenerating alveolar duct.

  6. Mean alveolar bone crest height decrement in subjects with an osteoporosis risk

    Science.gov (United States)

    Effrianto, H. P. S.; Priminiarti, M.; Makes, B. N.

    2017-08-01

    People 40-75 years of age have an osteoporosis risk that may be signaled by a decrease in alveolar bone crest height. Thus, this measure can be used as an indicator of osteoporosis risk. This study was conducted to provide a database of decreased alveolar bone crest heights in ages at risk of osteoporosis by using intraoral radiographs. Forty periapical radiographs of the posterior region of tooth 36 (or 46) were measured twice at different times by two different observers. The interproximal decrease in alveolar bone crest height was measured from the alveolar bone crest to the cementoenamel junction (CEJ) for each tooth on the mesial and distal sides using a ruler (mm). The mean decrease in alveolar bone crest height in at-risk ages for osteoporosis was 3.50±1.085 mm, with a mean of 3.15±0.864 mm for those 45-59 years of age, and 3.90±1.156 mm for those aged 60-75 years. The mean decrease in alveolar bone crest height in people 60-75 years of age was larger than in people 45-59 years of age. There was a medium correlation between age and decreased alveolar bone crest height.

  7. How Volunteering Helps Students to Develop Soft Skills

    Science.gov (United States)

    Khasanzyanova, Albina

    2017-01-01

    It is widely recognised that tertiary education does not provide all of the knowledge and skills required to succeed in modern societies. Personal and interpersonal skills--so-called "soft skills"--are also needed to complement professional skills and expertise, and become an essential part of an individual's personality. One way of…

  8. The conceptualisation of "soft skills" among medical students before ...

    African Journals Online (AJOL)

    Objective: This paper reports on the conceptualisation of "soft skills" as part of a study carried out among two groups of undergraduate medical students before and after curriculum reform at the School of Medicine of the University of Pretoria. Congruent with a call from the World Psychiatric Association, the curriculum reform ...

  9. Necrotizing soft tissue infections - a multicentre, prospective observational study (INFECT)

    NARCIS (Netherlands)

    Madsen, M.B.; Skrede, S.; Bruun, T.; Arnell, P.; Rosén, A.; Nekludov, M.; Karlsson, Y.; Bergey, F.; Saccenti, E.; Martins dos Santos, V.A.P.; Perner, A.; Norrby-Teglund, A.; Hyldegaard, O.

    2018-01-01

    Background: The INFECT project aims to advance our understanding of the pathophysiological mechanisms in necrotizing soft tissue infections (NSTIs). The INFECT observational study is part of the INFECT project with the aim of studying the clinical profile of patients with NSTIs and correlating

  10. Neutrosophic Parameterized Soft Relations and Their Applications

    Directory of Open Access Journals (Sweden)

    Irfan Deli

    2014-06-01

    Full Text Available The aim of this paper is to introduce the concept of relation on neutrosophic parameterized soft set (NP- soft sets theory. We have studied some related properties and also put forward some propositions on neutrosophic parameterized soft relation with proofs and examples. Finally the notions of symmetric, transitive, reflexive, and equivalence neutrosophic parameterized soft set relations have been established in our work. Finally a decision making method on NP-soft sets is presented.

  11. Mechanics and Physics of Soft Materials

    OpenAIRE

    Liu, Qihan

    2016-01-01

    Materials where thermal energy is comparable to the interaction energy between molecules are called soft materials. Soft materials are everywhere in our life: food, rubber, polymer diaper, our own body, etc. The thermal fluctuation endows soft materials with fundamentally different behavior comparing to hard materials like metals and ceramics. This dissertation studies three aspects of the mechanics and physics of soft materials, as is reviewed below. First, soft materials are generally s...

  12. Oral administration of 5-hydroxytryptophan aggravated periodontitis-induced alveolar bone loss in rats.

    Science.gov (United States)

    Li, Xianxian; Wu, Xiangnan; Ma, Yuanyuan; Hao, Zhichao; Chen, Shenyuan; Fu, Taozi; Chen, Helin; Wang, Hang

    2015-05-01

    5-Hydroxytryptophan (5-HTP) is the precursor of serotonin and 5-HTP has been widely used as a dietary supplement to raise serotonin level. Serotonin has recently been discovered to be a novel and important player in bone metabolism. As peripheral serotonin negatively regulates bone, the regular take of 5-HTP may affect the alveolar bone metabolism and therefore influence the alveolar bone loss induced by periodontitis. The aim of this study was to investigate the effect of 5-HTP on alveolar bone destruction in periodontitis. Male Sprague-Dawley rats were randomly divided into the following four groups: (1) the control group (without ligature); (2) the 5-HTP group (5-HTP at 25 mg/kg/day without ligature); (3) the L group (ligature+saline placebo); and (4) the L+5-HTP group (ligature+5-HTP at 25 mg/kg/day). Serum serotonin levels were determined by ELISA. The alveolar bones were evaluated with micro-computed tomography and histology. Tartrate-resistant acid phosphatase staining was used to assess osteoclastogenesis. The receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) expression in the periodontium as well as the interleukin-6 positive osteocytes were analysed immunohistochemically. 5-HTP significantly increased serum serotonin levels. In rats with experimental periodontitis, 5-HTP increased alveolar bone resorption and worsened the micro-structural destruction of the alveolar bone. 5-HTP also stimulated osteoclastogenesis and increased RANKL/OPG ratio and the number of IL-6 positive osteocytes. However, 5-HTP treatment alone did not cause alveolar bone loss in healthy rats. The present study showed that 5-HTP aggravated alveolar bone loss, deteriorated alveolar bone micro-structure in the presence of periodontitis, which suggests 5-HTP administration may increase the severity of periodontitis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Alveolar bone loss and mineralization in the pig with experimental periodontal disease

    Directory of Open Access Journals (Sweden)

    Mandee Yang

    2018-03-01

    Full Text Available Objective: To address how experimental periodontal disease affects alveolar bone mass and mineral apposition in a young pig model. Materials and methods: Seven three-month-old pigs were periodically inoculated with 4 types of periodontal bacteria, along with a ligature around the last maxillary deciduous molar for 8 weeks to induce periodontal disease (PG. Eight same-aged pigs served as the control (CG. Segmentations of 3D cone-beam CT images were performed to quantify volumes of the total alveolar bone, alveolar ridge, and all roots of the target molar. Calcein and alizarin were administered for labeling mineral apposition before euthanasia. The harvested molar blocks were sectioned and examined under epifluorescence. The inter-label distance between the two vital markers at regional bone surfaces were measured and mineral apposition rate (MAR was calculated. Results: A significant reduction of total alveolar bone volume was seen in PG with the major loss at the alveolar ridge. MAR was significantly higher at the root furcation region than those at both buccal and palatal ridges in CG. Compared with CG, PG animals showed more interrupted labeled bands with significantly lower MAR at the furcation region. MARs were positively associated with both the volumes of total alveolar bone and ridge in CG, but only with the total alveolar bone in PG. Conclusions: In young growing pigs, mineral apposition is region specific. The experimental periodontal disease not only leads to alveolar bone loss, but also perturbs mineral apposition for new bone formation, thus impairing the homeostasis of alveolar bone remodeling. Keyword: Dentistry

  14. HIV-1 transgene expression in rats causes oxidant stress and alveolar epithelial barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Jacob Barbara A

    2009-02-01

    Full Text Available Abstract Background HIV-infected individuals are at increased risk for acute and chronic airway disease even though there is no evidence that the virus can infect the lung epithelium. Although HIV-related proteins including gp120 and Tat can directly cause oxidant stress and cellular dysfunction, their effects in the lung are unknown. The goal of this study was to determine the effects of HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining lung liquid clearance in vivo and alveolar epithelial monolayer permeability in vitro. Oxidant stress in the alveolar space was determined by measuring the glutathione redox couple by high performance liquid chromatography, and the expression and membrane localization of key tight junction proteins were assessed. Finally, the direct effects of the HIV-related proteins gp120 and Tat on alveolar epithelial barrier formation and tight junction protein expression were determined. Results HIV-1 transgene expression caused oxidant stress within the alveolar space and impaired epithelial barrier function even though there was no evidence of overt inflammation within the airways. The expression and membrane localization of the tight junction proteins zonula occludens-1 and occludin were decreased in alveolar epithelial cells from HIV-1 transgenic rats. Further, treating alveolar epithelial monolayers from wild type rats in vitro with recombinant gp120 or Tat for 24 hours reproduced many of the effects on zonula occludens-1 and occludin expression and membrane localization. Conclusion Taken together, these data indicate that HIV-related proteins cause oxidant stress and alter the expression of critical tight junction proteins in the alveolar epithelium, resulting in barrier dysfunction.

  15. Diagnosis of alveolar and root fractures: an in vitro study comparing CBCT imaging with periapical radiographs

    Directory of Open Access Journals (Sweden)

    Solange KOBAYASHI-VELASCO

    Full Text Available Abstract Objective To compare periapical radiograph (PR and cone-beam computed tomography (CBCT in the diagnosis of alveolar and root fractures. Material and Methods Sixty incisor teeth (20 higid and 40 with root fracture from dogs were inserted in 60 anterior alveolar sockets (40 higid and 20 with alveolar fracture of 15 macerated canine maxillae. Each fractured socket had a root fractured tooth inserted in it. Afterwards, each maxilla was submitted to PR in two different vertical angulation incidences, and to CBCT imaging with a small field of view (FOV and high-definition protocol. Images were randomized and posteriorly analyzed by two oral and maxillofacial radiologists two times, with a two-week interval between observations. Results Sensitivity and specificity values were good for root fractures for PR and CBCT. For alveolar fractures, sensitivity ranged from 0.10 to 0.90 for PR and from 0.50 to 0.65 for CBCT. Specificity for alveolar fractures showed lower results than for root fractures for PR and CBCT. Areas under the ROC curve showed good results for both PR and CBCT for root fractures. However, results were fair for both PR and CBCT for alveolar fractures. When submitted to repeated measures ANOVA tests, there was a statistically significant difference between PR and CBCT for root fractures. Root fracture intraobserver agreement ranged from 0.90 to 0.93, and alveolar fracture intraobserver agreement ranged from 0.30 to 0.57. Interobserver agreement results were substantial for root fractures and poor/fair for alveolar fractures (0.11 for PR and 0.30 for CBCT. Conclusion Periapical radiograph with two different vertical angulations may be considered an accurate method to detect root fractures. However, PR showed poorer results than CBCT for the diagnosis of alveolar fractures. When no fractures are diagnosed in PR and the patient describes pain symptoms, the subsequent exam of choice is CBCT.

  16. Diagnosis of alveolar and root fractures: an in vitro study comparing CBCT imaging with periapical radiographs

    Science.gov (United States)

    KOBAYASHI-VELASCO, Solange; SALINEIRO, Fernanda Cristina Sales; GIALAIN, Ivan Onone; CAVALCANTI, Marcelo Gusmão Paraiso

    2017-01-01

    Abstract Objective To compare periapical radiograph (PR) and cone-beam computed tomography (CBCT) in the diagnosis of alveolar and root fractures. Material and Methods Sixty incisor teeth (20 higid and 40 with root fracture) from dogs were inserted in 60 anterior alveolar sockets (40 higid and 20 with alveolar fracture) of 15 macerated canine maxillae. Each fractured socket had a root fractured tooth inserted in it. Afterwards, each maxilla was submitted to PR in two different vertical angulation incidences, and to CBCT imaging with a small field of view (FOV) and high-definition protocol. Images were randomized and posteriorly analyzed by two oral and maxillofacial radiologists two times, with a two-week interval between observations. Results Sensitivity and specificity values were good for root fractures for PR and CBCT. For alveolar fractures, sensitivity ranged from 0.10 to 0.90 for PR and from 0.50 to 0.65 for CBCT. Specificity for alveolar fractures showed lower results than for root fractures for PR and CBCT. Areas under the ROC curve showed good results for both PR and CBCT for root fractures. However, results were fair for both PR and CBCT for alveolar fractures. When submitted to repeated measures ANOVA tests, there was a statistically significant difference between PR and CBCT for root fractures. Root fracture intraobserver agreement ranged from 0.90 to 0.93, and alveolar fracture intraobserver agreement ranged from 0.30 to 0.57. Interobserver agreement results were substantial for root fractures and poor/fair for alveolar fractures (0.11 for PR and 0.30 for CBCT). Conclusion Periapical radiograph with two different vertical angulations may be considered an accurate method to detect root fractures. However, PR showed poorer results than CBCT for the diagnosis of alveolar fractures. When no fractures are diagnosed in PR and the patient describes pain symptoms, the subsequent exam of choice is CBCT. PMID:28403364

  17. The effect of peri-implant bone exposure on soft tissue healing and bone loss in two adjacent implants

    OpenAIRE

    Shin, Seung-Yun; Kye, Seung-Boem; Hong, Jongrak; Paeng, Jun-Young; Yang, Seung-Min

    2012-01-01

    Purpose The purpose of this study was to evaluate the soft tissue and bone change around two adjacent implants in one-stage implant surgery. Methods Eleven subjects (7 males, 4 females) who were needed placement of 2 adjacent implants in the molar area were included. The two implants were placed with the platform at the level of the alveolar crest. The interproximal bone between the 2 implants was not covered with gingiva. After surgery, an alginate impression was taken to record the gingival...

  18. Ozone Treatment of Alveolar Bone in the Cape Chacma Baboon Does Not Enhance Healing Following Trauma

    OpenAIRE

    Kotze, Marthinus; Bütow, Kürt-W; Olorunju, Steve A.; Kotze, Harry F.

    2013-01-01

    In the international literature, the role of Ozone (O3) in the advancement in alveolar bone healing in the absence of bone pathology was not tested before. The purpose of this study was to evaluate alveolar bone regeneration after a bone defect was created and treated with a single topical administration of O3. Alveolar bone defects were created on five healthy chacma baboons. One side of the maxilla and mandible was topically treated with a single treatment of an O3/O2 mixture (3,5–4 % O3), ...

  19. A preliminary study of the pathogenesis of malnutrition in patients with hepatic alveolar echinococcosis

    Directory of Open Access Journals (Sweden)

    MA Bao

    2018-01-01

    Full Text Available Hepatic echinococcosis has become a major threat to human health. Hepatic alveolar echinococcosis caused by Echinococcus multilocularis infection has the features of slow and insidious onset, a high probability of surgery, slow postoperative recovery, and many complications and thus does great harm to humans. Most of the patients with hepatic alveolar echinococcosis also have varying degrees of malnutrition on admission, which is closely associated with surgical tolerance, postoperative rehabilitation, and the development of complications. However, the pathogenesis of malnutrition in patients with hepatic alveolar echinococcosis remains unknown. This article elaborates on possible mechanisms and points out that malnutrition in such patients is a result of various factors and complex mechanisms.

  20. Evolución en el tratamiento de la atrofia alveolar

    OpenAIRE

    Oscar García-Roco Pérez; Miguel Arredondo López

    2002-01-01

    Con el objetivo de describir la evolución del tratamiento de la atrofia alveolar se realiza una revisión bibliográfica actualizada de 25 referencias, se destacan las vestibuloplastias, injertos óseos, biomateriales, implantes endóseos, regeneración ósea guiada y la distracción ósea, que corrigen o compensan la atrofia alveolar con sus indicaciones, ventajas y desventajas.An updated literature review of 25 references was made to describe the development in the treatment of dental alveolar atro...