WorldWideScience

Sample records for alveolar process

  1. Bone graft healing in alveolar osteoplasty in patients with unilateral lip, alveolar process, and palate clefts.

    Science.gov (United States)

    Rychlik, Dariusz; Wójcicki, Piotr

    2012-01-01

    Secondary osteoplasty by means of autogenic spongy bone grafting is the most common procedure used in the reconstruction of the continuity of the maxillary alveolar process. The aim of the study was to analyze retrospectively the effect of certain factors on the course of the bone graft healing process in patients with unilateral complete clefts of the lip, alveolar process, and palate. The investigations involved 62 children aged 8 to 14 years (mean age, 11 years) with unilateral complete cleft of the lip, alveolar process, and palate operated on at the Clinic of Plastic Surgery in Polanica Zdrój from November 2007 to April 2009. All the procedures consisted in the reconstruction of the maxillary alveolar process by means of autogenic spongy bone grafting from the iliac bone. The analysis was performed on the basis of computed tomography scans presenting maxillary alveolar processes in the horizontal cross-sectional planes performed on the second or third postoperative day and after 6 months. They were used as the basis for the measurement of the volume and density (condensation) of the bone graft, the surface of its adhesion to the maxillary alveolar bone, and the volume and density of the healed bone. The following correlation coefficients were determined: between the adhesion surface of the bone to the alveolar bone and the volume of the healed bone, between the adhesion surface of the bone to the alveolar bone and the density of the healed bone, and between the density of the graft and the volume of the healed bone. Increasing the surface of the graft adhesion to the bone ridges of the alveolar cleft contributes to increased volume of the healed bone and slows down the increase in its density (on 6-month follow-up). Crushing of the bone graft increases its resorption and reduces volume of the healed bone.

  2. Treatment of sharp mandibular alveolar process with hybrid prosthesis

    Directory of Open Access Journals (Sweden)

    Sukaedi Sukaedi

    2010-09-01

    Full Text Available Background: Losing posterior teeth for a long time would occasionally lead to the sharpening of alveolar process. The removable partial denture usually have problems when used during mastication, because of the pressure on the mucosa under the alveolar ridge. Purpose: The purpose of this case report was to manage patients with sharp mandibular alveolar process by wearing hybrid prosthesis with extra coronal precision attachment retention and soft liner on the surface base beneath the removable partial denture. Case: A 76 years old woman visited the Prosthodontic Clinic Faculty of Dentistry Airlangga University. The patient had a long span bridge on the upper jaw and a free end acrylic removable partial denture on the lower jaw. She was having problems with mastication. The patient did not wear her lower denture because of the discomfort with it during mastication. Hence, she would like to replace it with a new removable partial denture. Case management: The patient was treated by wearing a hybrid prosthesis with extra coronal precision attachment on the lower jaw. Soft liner was applied on the surface of the removable partial denture. Hybrid prosthesis is a complex denture consisting of removable partial denture and fixed bridge. Conclusion: It concluded that after restoration, the patient had no problems with sharp alveolar process with her new denture, and she was able to masticate well.Latar belakang: Kehilangan geligi posterior dapat menimbulkan processus alveolaris tajam. Gigi tiruan sebagian lepasan mempunyai masalah selama pengunyahan karena adanya tekanan di mukosa di bawah alveolar ridge. Tujuan: Tujuan laporan kasus ini adalah untuk menjelaskan cara menangani pasien yang mempunyai prosesus alveolaris yang tajam di rahang bawah dengan dibuatkan protesis hybrid dengan daya tahan extra coronal precision attachment dan soft liner di permukaan bawah basis gigi tiruan sebagian lepasan. Kasus: Pasien wanita berumur 76 tahun datang di klinik

  3. Alveolar process fractures in the permanent dentition. Part 2. The risk of healing complications in teeth involved in an alveolar process fracture

    DEFF Research Database (Denmark)

    Lauridsen, Eva; Gerds, Thomas; Andreasen, Jens Ove

    2016-01-01

    AIM: To analyze the risk of pulp canal obliteration (PCO), pulp necrosis (PN), repair-related resorption (RRR), infection-related resorption (IRR), ankylosis-related resorption (ARR), marginal bone loss (MBL), and tooth loss (TL) for teeth involved in an alveolar process fracture and to identify.......3-3.5), P = 0.003), and age >30 years (HR: 2.3 (95% CI: 1.1-4.6), P = 0.02). The type of splint (rigid or flexible), the duration of splinting (more or less than 4 weeks), and the administration of antibiotics did not affect the risk of PN. CONCLUSION: Teeth involved in alveolar process fractures appear...

  4. Predictors of Alveolar Process Remodeling Following Ridge Preservation in High-Risk Patients.

    Science.gov (United States)

    Cosyn, Jan; Cleymaet, Roberto; De Bruyn, Hugo

    2016-04-01

    (1) To clinically evaluate horizontal remodeling of the alveolar process (hard and soft tissues) following ridge preservation in high-risk patients and (2) to identify predictors of such remodeling. Periodontally healthy nonsmoking patients with a failing tooth in the anterior maxilla (15-25) were selected for a prospective case series. All were in need of a single implant and demonstrated high risk for aesthetic complications given an incomplete buccal bone wall and/or thin-scalloped gingival biotype. Following flapless tooth extraction, ridge preservation was performed using one or more collagen-enriched, bovine-derived block grafts (Geistlich Bio-Oss® Collagen® 100 mg, Geistlich Pharma AG, Wolhusen, Switzerland) without the additional use of membranes or soft tissue grafts. The change in buccopalatal dimension of the alveolar process between baseline (prior to tooth extraction) and 4 months was assessed on the basis of superimposed occlusal slides. Regression analysis was performed to identify predictors of alveolar process remodeling. Forty-two patients (21 females, 21 males; mean age 38) met the selection criteria and consented to the treatment. Mean alveolar process remodeling was 14% (SD 7, range 4-30) with minimal remodeling (≤ 10%) in 16 patients (38%) and advanced remodeling (>20%) in 10 patients (24%). A single implant could be installed in all subjects without additional guided bone regeneration. Connective tissue grafting was performed later on in the treatment for aesthetic purposes, hereby compensating for tissue loss at the buccal aspect. Predictors of alveolar process remodeling were tooth location (central incisors and cuspids > laterals incisors and premolars), tooth abscess (p = .025), and buccal bone loss (p = .035). Alveolar process remodeling seems inevitable yet acceptable following ridge preservation in high-risk patients. Proper case selection may reduce the incidence of advanced remodeling. © 2014 Wiley Periodicals, Inc.

  5. Oxytocin promotes bone formation during the alveolar healing process in old acyclic female rats.

    Science.gov (United States)

    Colli, Vilma Clemi; Okamoto, Roberta; Spritzer, Poli Mara; Dornelles, Rita Cássia Menegati

    2012-09-01

    OT was reported to be a direct regulator of bone mass in young rodents, and this anabolic effect on bone is a peripheral action of OT. The goal of this study was to investigate the peripheral action of oxytocin (OT) in the alveolar healing process in old female rats. Females Wistar rats (24-month-old) in permanent diestrus phase, received two ip (12h apart) injections of saline (NaCl 0.15M - control group) or OT (45μg/rat - treated group). Seven days later, the right maxillary incisor was extracted and analyses were performed up to 28 days of the alveolar healing process (35 days after saline or OT administration). Calcium and phosphorus plasma concentrations did not differ between the groups. The plasma biochemical bone formations markers, alkaline phosphatase (ALP) and osteocalcin were significantly higher in the treated group. Histomorphometric analyses confirmed bone formation as the treated group presented the highest mean value of post-extraction bone formation. Tartrate-resistant acid phosphatase (TRAP) was significantly reduced in the treated group indicating an anti-resorptive effect of OT. Immunohistochemistry reactions performed in order to identify the presence of osteocalcin and TRAP in the bone cells of the dental socket confirmed these outcomes. OT was found to promote bone formation and to inhibit bone resorption in old acyclic female rats during the alveolar healing process. Published by Elsevier Ltd.

  6. Automated method for measuring alveolar bone resorption by three-dimensional image processing

    International Nuclear Information System (INIS)

    Nagao, Jiro; Kitasaka, Takayuki; Mori, Kensaku; Suenaga, Yasuhito; Yamada, Shohzoh; Naitoh, Munetaka

    2007-01-01

    This report describes a method for estimating regions of alveolar bone resorption and automatically measuring resorption depth using dental 3-D CT images by applying 3-D image processing techniques. The depth of alveolar bone resorption is an important index of the severity of periodontitis. Conventional methods for evaluating alveolar bone resorption have suffered from the limitations of not permitting inspection on the interproximal sides and not providing a 3-D description of resorption. In our proposed method, dental 3-D X-ray CT images are used to estimate the region of resorption and to automatically measure the resorption depth around the tooth of interest. Detailed information concerning the distribution of resorption can be obtained using this method. Regions of resorption are estimated using morphological operations and labeling. Limits are established by fitting convex hulls to the region of the target tooth before searching for the lowest points of resorption. The resorption depth is calculated as the distance between the cement-enamel junction and the lowest point of resorption. The experimental results and comparison of these results against measurements obtained by experts using cross-sectional CT images and the findings of clinical examination showed that the proposed method can be used to measure the resorption depth around the entire tooth automatically. (author)

  7. Alveolar process fractures in the permanent dentition. Part 2. The risk of healing complications in teeth involved in an alveolar process fracture.

    Science.gov (United States)

    Lauridsen, Eva; Gerds, Thomas; Andreasen, Jens Ove

    2016-04-01

    To analyze the risk of pulp canal obliteration (PCO), pulp necrosis (PN), repair-related resorption (RRR), infection-related resorption (IRR), ankylosis-related resorption (ARR), marginal bone loss (MBL), and tooth loss (TL) for teeth involved in an alveolar process fracture and to identify possible risk factors. A total of 91 patients with 223 traumatized teeth. The risks of PCO, PN, RRR, IRR, ARR, MBL, and TL were analyzed separately for teeth with immature and mature root development using Kaplan-Meier and Aalen-Johansen methods. Possible risk factors for PN (age, fracture in relation to apex, displacement, gingival injury, degree of repositioning, type of splint, duration of splinting, treatment delay, and antibiotics) were analyzed for mature teeth using Cox regression. The level of significance was 5%. Immature: No severe complications (PN, IRR, ARR, MBL, or TL) were diagnosed during follow up. Mature: Estimated risk after a 10-year follow up: PN: 56% (95% confidence interval (CI): 48.1-63.9), IRR: 2.5% (95% CI: 0-5.1), ARR: 2.1% (95% CI: 0.1-4.1), MBL: 2.4% (95% CI: 0.3-4.4), and TL: 7.8% (95% CI: 0-15.7). The following factors significantly increased the risk of PN in teeth with mature root development: fracture in relation to apex (hazard ratio (HR): 2.6 (95% CI: 0.2 - 5.7), P = 0.01), displacement in the horizontal part of the fracture >2 mm (HR: 1.8; 95% CI: 1.1-3.2, P = 0.03), incomplete repositioning (HR: 2.1 (95% CI: 1.3-3.5), P = 0.003), and age >30 years (HR: 2.3 (95% CI: 1.1-4.6), P = 0.02). The type of splint (rigid or flexible), the duration of splinting (more or less than 4 weeks), and the administration of antibiotics did not affect the risk of PN. Teeth involved in alveolar process fractures appear, apart from PN, to have a good prognosis. A conservative treatment approach is recommended. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Alveolar bone healing process in spontaneously hypertensive rats (SHR). A radiographic densitometry study.

    Science.gov (United States)

    Manrique, Natalia; Pereira, Cassiano Costa Silva; Garcia, Lourdes Maria Gonzáles; Micaroni, Samuel; Carvalho, Antonio Augusto Ferreira de; Perri, Sílvia Helena Venturoli; Okamoto, Roberta; Sumida, Doris Hissako; Antoniali, Cristina

    2012-01-01

    Hypertension is one of the most important public health problems worldwide. If undiagnosed or untreated, this pathology represents a systemic risk factor and offers unfavorable conditions for dental treatments, especially those requiring bone healing. The purpose of this study was to demonstrate, by analysis of bone mineral density (BMD), that the alveolar bone healing process is altered in spontaneously hypertensive rats (SHRs). Wistar rats and SHRs were submitted to extraction of the upper right incisor and were euthanized 7, 14, 21, 28 and 42 days after surgery. Right maxillae were collected, radiographed and analyzed using Digora software. BMD was expressed as minimum (min), middle (med) and maximum (max) in the medium (MT) and apical (AT) thirds of the dental alveolus. The results were compared across days and groups. Wistar showed difference in med and max BMD in the MT between 7 and 28 and also between 14 and 28 days. The AT exhibited significant difference in med and min BMD between 7 and 28 days, as well as difference in min BMD between 28 and 42 days. SHRs showed lower med BMD in the MT at 28 days when compared to 21 and 42 days. Differences were observed across groups in med and min BMD at day 28 in the MT and AT; and in max BMD at 14, 21 and 42 days in the MT. These results suggest that the alveolar bone healing process is delayed in SHRs comparing with Wistar rats.

  9. A retrospective study of isolated fractures of the alveolar process in the permanent dentition.

    Science.gov (United States)

    Marotti, Maja; Ebeleseder, Kurt Alois; Schwantzer, Gerold; Jauk, Stefanie

    2017-06-01

    There is a lack of studies of fractures of the alveolar process (FAP). Only five were published in the last 50 years. The aim of this study was to analyze the risk of pulp necrosis and infection (PN), pulp canal obliteration (PCO), infection-related root resorption (IRR), ankylosis-related resorption (ARR), marginal bone loss (MBL), and tooth loss (TL) as well as to identify the possible risk factors for teeth involved in an isolated alveolar process fracture. In the second part, any late complications of the involved teeth were reported in patients who responded to a follow-up examination. This study was a retrospective analysis of 126 patients with 329 traumatized permanent teeth treated in a regional dental trauma clinic. Follow-up examination was performed on 31 (24.6%) patients with 75 (22.8%) teeth. The risks of PN, PCO, RR, MBL, and TL were analyzed using the Kaplan-Meier method. Possible risk factors for PN (stage of root development, fracture position in relation to the root apex, concomitant injury, treatment delay, and antibiotics) were analyzed using univariate and multivariate Cox regression and generalized estimating equation. The level of significance was 5%. Pulp necrosis was observed in 43% of the teeth, and it was significantly associated with the presence of a concomitant injury and complete root formation. PCO was recorded in 2.8%, root resorption (RR, IRR, and ARR) in 4%, MBL in 8%, and TL in 0.6% of the teeth. Thirty-four percent of the teeth were assumed to have normal pulps, but they did not respond to pulp sensibility testing. At the follow-up examination, PN was found in 49%, PCO in 28%, RR (IRR and ARR) in 4%, MBL in 17%, and TL in 5%. Estimated risk after a 5-years follow up was as follows: PN: 48.2% (95% confidence interval (CI): 42.0-54.5), IRR: 7.2 (95% CI: 3.5-10.9), ARR: 33.0% (95% CI: 22.4-43.6), BL: 16.7% (95% CI: 9.6-23.8), TL: 4.0% (95% CI: 0.0-8.5). The following factors significantly increased the risk of PN: mature root

  10. A novel image processing technique for 3D volumetric analysis of severely resorbed alveolar sockets with CBCT.

    Science.gov (United States)

    Manavella, Valeria; Romano, Federica; Garrone, Federica; Terzini, Mara; Bignardi, Cristina; Aimetti, Mario

    2017-06-01

    The aim of this study was to present and validate a novel procedure for the quantitative volumetric assessment of extraction sockets that combines cone-beam computed tomography (CBCT) and image processing techniques. The CBCT dataset of 9 severely resorbed extraction sockets was analyzed by means of two image processing software, Image J and Mimics, using manual and automated segmentation techniques. They were also applied on 5-mm spherical aluminum markers of known volume and on a polyvinyl chloride model of one alveolar socket scanned with Micro-CT to test the accuracy. Statistical differences in alveolar socket volume were found between the different methods of volumetric analysis (P<0.0001). The automated segmentation using Mimics was the most reliable and accurate method with a relative error of 1.5%, considerably smaller than the error of 7% and of 10% introduced by the manual method using Mimics and by the automated method using ImageJ. The currently proposed automated segmentation protocol for the three-dimensional rendering of alveolar sockets showed more accurate results, excellent inter-observer similarity and increased user friendliness. The clinical application of this method enables a three-dimensional evaluation of extraction socket healing after the reconstructive procedures and during the follow-up visits.

  11. Alveolar process fractures in the permanent dentition. Part 1. Etiology and clinical characteristics. A retrospective analysis of 299 cases involving 815 teeth

    DEFF Research Database (Denmark)

    Andreasen, Jens Ove; Lauridsen, Eva

    2015-01-01

    AIM: To describe the etiology and clinical characteristics of alveolar process fractures treated in a regional trauma clinic. MATERIAL AND METHOD: The study is a retrospective descriptive analysis of 299 patients (180 males, 119 females; 815 permanent teeth) diagnosed with fractures of the alveolar...... process. RESULTS: Violence was the overall most frequent cause of injury in men (44%), whereas the three most common causes of this type of injury in women were violence (33%), falls (32%), or traffic injuries (26%). Fracture of the alveolar process occurred most frequently in the maxilla (74%) and less...... frequently in the mandible (26%). The majority of the fractures involved only two teeth (57%) but occasionally involved up to seven teeth. The age at fracture ranged from 5 to 90 years; alveolar process fractures occurred most frequently between 15 and 25 years of age (43%). Concomitant soft tissue injuries...

  12. Reconstrucción del maxilar superior mediante transporte del proceso alveolar: Presentación de un caso Reconstruction of the maxilla by means of transport of the alveolar process: A case report

    Directory of Open Access Journals (Sweden)

    A. Bilbao

    2006-02-01

    Full Text Available La osteogénesis mediante distracción aplicada a la reconstrucción del proceso alveolar es una técnica sobradamente contrastada en la literatura, al igual que la utilización del transporte óseo en la reconstrucción de defectos segmentarios mandibulares. Presentamos en este artículo un caso de reconstrucción de un defecto segmentario del maxilar superior mediante transporte de proceso alveolar y su posterior rehabilitación protésica implantosoportada. Mostramos tanto la técnica quirúrgica como el manejo de del vector de distracción utilizando elásticos de ortodoncia y tornillos de bloqueo intermaxilar.Osteogenesis by means of distraction applied to the reconstruction of the alveolar process is a well-documented technique in the literature, as is the use of bone transport in the reconstruction of mandibular segment defects. In the present article we report on a case of reconstruction of a segment defect in the maxilla using the alveolar transport process, and on the subsequent rehabilitation by means of an implant-supported prosthesis. Both the surgical technique and the handling of the distraction vector using orthodontic bands and inter-maxillary fixation screws are shown.

  13. Pulmonary alveolar proteinosis

    Science.gov (United States)

    PAP; Alveolar proteinosis; Pulmonary alveolar phospholipoproteinosis; Alveolar lipoproteinosis phospholipidosis ... PAP is unknown. In others, it occurs with lung infection or an immune problem. It also can ...

  14. Alveolar process preservation at implants installed immediately into extraction sockets using deproteinized bovine bone mineral - an experimental study in dogs.

    Science.gov (United States)

    Caneva, Marco; Botticelli, Daniele; Morelli, Fabrizio; Cesaretti, Gianfranco; Beolchini, Marco; Lang, Niklaus P

    2012-07-01

    To evaluate the soft tissue and the dimensional changes of the alveolar bony crest at sites where deproteinized bovine bone mineral (DBBM) particles, concomitantly with the placement of a collagen membrane, were used at implants installed into sockets immediately after tooth extraction. The pulp tissue of the mesial roots of (3) P(3) was removed in six Labrador dogs, and the root canals were filled. Flaps were elevated bilaterally, the premolars hemi-sectioned, and the distal roots removed. Recipient sites were prepared in the distal alveolus, and implants were placed. At the test sites, DBBM particles were placed in the residual marginal defects concomitantly with the placement of a collagen membrane. No treatment augmentation was performed at the control sites. A non-submerged healing was allowed. Impressions were obtained at baseline and at the time of sacrifice performed 4 months after surgery. The cast models obtained were analyzed using an optical system to evaluate dimensional variations. Block sections of the implant sites were obtained for histological processing and soft tissue assessments. After 4 months of healing, no differences in soft tissue dimensions were found between the test and control sites based on the histological assessments. The location of the soft tissue at the buccal aspect was, however, more coronal at the test compared with the control sites (1.8 ± 0.8 and 0.9 ± 0.8 mm, respectively). At the three-dimensional evaluation, the margin of the soft tissues at the buccal aspect appeared to be located more apically and lingually. The vertical dislocation was 1 ± 0.6 and 2.7 ± 0.5 mm at the test and control sites, respectively. The area of the buccal shrinkage of the alveolar crest was significantly smaller at the test sites (5.9 ± 2.4 mm(2) ) compared with the control sites (11.5 ± 1.7 mm(2) ). The use of DBBM particles concomitantly with the application of a collagen membrane used at implants placed into sockets immediately after

  15. Early healing of the alveolar process after tooth extraction: an experimental study in the beagle dog.

    Science.gov (United States)

    Discepoli, Nicola; Vignoletti, Fabio; Laino, Luigi; de Sanctis, Massimo; Muñoz, Fernando; Sanz, Mariano

    2013-06-01

    To describe the early healing events in the alveolar socket during the first 8 weeks of spontaneous healing after tooth extraction. 16 adult beagle dogs were selected and five healing periods were analysed (4 h, 1 week, 2 weeks, 4 weeks, 8 weeks). Mandibular premolars were extracted and each socket corresponding to the mesial root was left to heal undisturbed. In each healing period, three animals were euthanatized, each providing four study sites. Healing was assessed by descriptive histology and by histometric analysis using as landmarks: the vertical distance between buccal and lingual crest (B'L') and the width of buccal and lingual walls at three different levels. Differences between means for each variable for each healing period were compared (ANOVA; p healing period to a final value of 0.18 (0.08) mm. The lingual width (Lw) remains almost unchanged while the buccal width (Bw) at 1 (Bw1) and 2 (Bw2) mm was reduced in about 40% of its initial value. Minor vertical bone reduction in both the buccal and lingual socket walls were observed. A marked horizontal reduction of the buccal bone wall was observed mostly in its coronal aspect. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. The alveolar process following single-tooth extraction: a study of maxillary incisor and premolar sites in man.

    Science.gov (United States)

    Misawa, Mônica; Lindhe, Jan; Araújo, Mauricio G

    2016-07-01

    The present investigation was performed to determine some dimensional alterations that occur in the alveolar process of the incisor and premolar sites of the maxilla following tooth removal. Computer-assisted cone-beam computed tomography (CBCT) scans were obtained from the maxilla using an iCAT unit, and involved edentulous and contralateral tooth sites. For each site included in the study, parasagittal and axial reconstructions, 1 mm apart, were made and measurements of different variables (cross-sectional area, height, and width) performed. The study involved 69 subjects and disclosed that the cross-sectional area and the height and width of the alveolar process of the lateral incisor site were the smallest and those of the second premolar the largest. All parameters had been significantly reduced after the completion of the ≥1 year of healing. Thus, the overall (i) cross-sectional area was reduced from 99.1 to 65.0 mm(2) , (ii) the height from 11.5 to 9.5 mm, and (iii) the width from 8.5 to 3.2 mm (marginal 1/3(rd) ), 8.9 to 4.8 mm (middle portion), and 9.0 to 5.7 mm (apical portion). The removal of single tooth caused marked hard tissue diminution. The loss of hard tissue was most pronounced in the buccal and marginal portions of the edentulous ridge that in most sites had acquired a triangular shape. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. The alveolar process of the edentulous maxilla in periodontitis and non-periodontitis subjects.

    Science.gov (United States)

    Lindhe, Jan; Cecchinato, Denis; Bressan, Eriberto A; Toia, Marco; Araújo, Mauricio G; Liljenberg, Birgitta

    2012-01-01

    Early implant failures may document that the bone tissue or the wound-healing process following installation surgery was compromised. Subjects who have lost teeth for periodontal reasons exhibit more earlier implant failures than subjects who had experienced tooth loss for other reasons. To describe the tissue of the fully healed extraction sites in subjects who had lost teeth as a result of periodontitis or for other reasons. Thirty-six otherwise healthy, partially dentate subjects with fully healed edentulous portions in the posterior maxilla were included. Nineteen of these subjects had lost teeth because of advanced periodontitis (group P) and 17 for other reasons (group NP). Using a trephine drill, a 4-6 mm long hard tissue specimen was harvested. The biopsies were decalcified, embedded in paraffin, sectioned, stained and examined. The edentulous posterior maxilla was comprised of 47.1 ± 11% lamellar bone, 8.1 ± 7.1% woven bone, 4.3 ± 3.1% osteoid and 16.5 ± 10.4% bone marrow. There were no significant differences in the tissue composition of post-extraction sites of (i) P and NP subjects and (ii) premolar and molar sites. More than 50% of the edentulous maxilla was comprised of mineralized bone (lamellar and woven bone). The bone trabeculae frequently appeared to have a random orientation. The direction of the trabeculae rather than the lack of mineralized bone tissue may explain the clinical impression that the bone in the posterior maxilla provides limited resistance to mechanical instrumentation. © 2011 John Wiley & Sons A/S.

  18. Alveolar development and disease.

    Science.gov (United States)

    Whitsett, Jeffrey A; Weaver, Timothy E

    2015-07-01

    Gas exchange after birth is entirely dependent on the remarkable architecture of the alveolus, its formation and function being mediated by the interactions of numerous cell types whose precise positions and activities are controlled by a diversity of signaling and transcriptional networks. In the later stages of gestation, alveolar epithelial cells lining the peripheral lung saccules produce increasing amounts of surfactant lipids and proteins that are secreted into the airspaces at birth. The lack of lung maturation and the associated lack of pulmonary surfactant in preterm infants causes respiratory distress syndrome, a common cause of morbidity and mortality associated with premature birth. At the time of birth, surfactant homeostasis begins to be established by balanced processes involved in surfactant production, storage, secretion, recycling, and catabolism. Insights from physiology and engineering made in the 20th century enabled survival of newborn infants requiring mechanical ventilation for the first time. Thereafter, advances in biochemistry, biophysics, and molecular biology led to an understanding of the pulmonary surfactant system that made possible exogenous surfactant replacement for the treatment of preterm infants. Identification of surfactant proteins, cloning of the genes encoding them, and elucidation of their roles in the regulation of surfactant synthesis, structure, and function have provided increasing understanding of alveolar homeostasis in health and disease. This Perspective seeks to consider developmental aspects of the pulmonary surfactant system and its importance in the pathogenesis of acute and chronic lung diseases related to alveolar homeostasis.

  19. Studies on the binding and transport processes of americium-241 hydroxide polymers in rat lung and bovine alveolar macrophages

    International Nuclear Information System (INIS)

    Taya, A.

    1986-03-01

    The binding of Am-241 hydroxide polymers to the cell components of rat lung was investigated using differential centrifugation, density gradient centrifugation with different media, gel chromatography, free flow electrophoresis and electron microscopic autoradiography with Pu-241. The bovine alveolar macrophage cultures were introduced as an in vitro test system for Am-241 uptake. Form the biochemical and electron microscopic studies it can be concluded that Am-241 is taken up by pulmonary macrophages, where its first storage site is probably the lysosome. Then the Am-241 seems to be solubilized in the lysosomes and to be bound to the cytosolic ferritin of macrophages. Am-241 might be released from the cells and crosses the alveolar membranes as bound to transferrin or as low molecular weight form. (orig.) [de

  20. Histomorphometric analysis and immunolocalization of RANKL and OPG during the alveolar healing process in female ovariectomized rats treated with oestrogen or raloxifene.

    Science.gov (United States)

    Luvizuto, Eloá Rodrigues; Queiroz, Thallita Pereira; Dias, Sheila Mônica Damásio; Okamoto, Tetuo; Dornelles, Rita Cássia Menegati; Garcia, Idelmo Rangel; Okamoto, Roberta

    2010-01-01

    To investigate the effects of bone-resorption inhibitors (oestrogen and raloxifene) on the RANKL/OPG balance during the chronology of the alveolar healing process in ovariectomized (OVX) rats by means of immunocolocalization and histomorphometric analysis. One hundred sixty female Wistar rats at 70 days of age were either OVX or sham-operated and divided into four groups: sham, OVX/Oil, OVX with E(2) replacement (17beta-estradiol, 400 microg/month), OVX with RLX treatment (1mg/kg bw/day). The 60-day treatment started 8 days after ovariectomy. The incisors were extracted to allow analysis of 7, 14, 21, 28 and 42 days of wound healing. After obtaining the histological samples, slides were stained with hematoxylin and eosin or subjected to immunocolocalization reaction for RANKL and OPG. Results were quantitatively evaluated. Histomorphometric analysis showed that the sham group presented the highest and OVX/Oil group the lowest mean bone formation value in the post-extraction period. The immunocolocalization analysis showed a larger increase in bone turnover at 7 postoperative days in OVX/Oil and sham groups and decreasing bone turnover in the other periods. The OVX/Oil group showed a large decrease in bone turnover at 14 postoperative days, a period demonstrated by mild cellular activity. OVX/E(2) and sham groups showed a decreased bone turnover at 28 postoperative days while OVX/RLX group showed a decreased bone turnover at 21 postoperative days. On the 42nd postoperative day, sham and OVX/RLX groups showed an established alveolar bone healing process. Ovariectomy delays the alveolar healing process and interferes with bone turnover through the balance between RANKL and OPG. Oestrogen replacement or raloxifene treatment did not totally recover the oestrogen-deficient state. However raloxifene treatment showed more satisfactory results than oestrogen replacement. Copyright 2009 Elsevier Ltd. All rights reserved.

  1. Reconstrucción del maxilar superior mediante transporte del proceso alveolar: Presentación de un caso Reconstruction of the maxilla by means of transport of the alveolar process: A case report

    OpenAIRE

    A. Bilbao; R. Cobo; M. Hernández; R. Rocha; J.M. Albertos

    2006-01-01

    La osteogénesis mediante distracción aplicada a la reconstrucción del proceso alveolar es una técnica sobradamente contrastada en la literatura, al igual que la utilización del transporte óseo en la reconstrucción de defectos segmentarios mandibulares. Presentamos en este artículo un caso de reconstrucción de un defecto segmentario del maxilar superior mediante transporte de proceso alveolar y su posterior rehabilitación protésica implantosoportada. Mostramos tanto la técnica quirúrgica como ...

  2. Proteinosis alveolar pulmonar Pulmonary alveolar proteinosis

    Directory of Open Access Journals (Sweden)

    Concepción Sánchez Infante

    2011-12-01

    Full Text Available La proteinosis alveolar pulmonar es una enfermedad respiratoria crónica, caracterizada por alteración en el metabolismo del surfactante, lo que determina su acumulación anormal en el espacio alveolar. Es una enfermedad extremadamente rara. Se han reportado solamente 500 casos en la literatura. Se describió por primera vez en 1958. Se presenta un caso de proteinosis alveolar pulmonar en un lactante de 2 meses, con desnutrición proteico energética, que ingresa por dificultad respiratoria e hipoxemia, y, con imágenes radiológicas de tipo retículo-nodulillar, en vidrio deslustrado, en el cual se plantea inicialmente el diagnóstico de bronconeumonía. Ante la evolución desfavorable y no respuesta al tratamiento, se realizó un estudio para descartar enfermedades pulmonares crónicas. El paciente fallece y se confirma el diagnóstico por anatomía patológica. Se realiza una revisión del tema.The pulmonary alveolar proteinosis is a chronic respiratory disease characterized by surfactant metabolism alteration determining its abnormal accumulation in the alveolar space. It is a disease very rare and in literature only 500 cases have been reported; it was described for the first time in 1958. This is a case presentation of pulmonary alveolar proteinosis in an infant aged 2 months with energetic protein malnutrition admitted due to respiratory difficulty and hypoxemia and with radiologic images of the reticulonodulillary, in frosting glass, where initially is made the diagnosis of bronchopneumonia. In the face of unfavorable evolution and no response to treatment, a study was conducted to rule out chronic pulmonary diseases. Patient died confirming the diagnosis according to the pathologic anatomy. A review on subject is carried out.

  3. Osteointegração da hidroxiapatita sintética no processo alveolar da mandíbula de cães: aspectos histológicos Osteointegration of synthetic hydroxyapatite in alveolar process of mandible in dogs: histological aspects

    Directory of Open Access Journals (Sweden)

    T.S. Duarte

    2006-10-01

    Full Text Available Avaliou-se a hidroxiapatita sintética como substituto ósseo na regeneração do processo alveolar, utilizando-se 28 cães adultos hígidos, pesando entre 10 e 15kg, divididos em dois grupos. Foram criados defeitos de aproximadamente 6 x 5mm na superfície vestibular do processo alveolar até atingir a raiz do quarto pré-molar mandibular direito. Em um grupo, o defeito foi totalmente preenchido com hidroxiapatita sintética; o outro, sem tratamento, foi usado como controle. Aos 8, 15, 21, 42, 60, 90 e 120 dias, foram coletados fragmentos ósseos para a análise histológica sob microscopia óptica. Observou-se crescimento ósseo e vascular no interior dos poros de hidroxiapatita, intensa proliferação de osteoblastos e neovascularização na presença do implante. A biocompatibilidade da hidroxiapatita permitiu a sua integração com o processo alveolar por meio da formação direta de um osso lamelar. Ocorreu neoformação óssea à medida que a hidroxiapatita foi degradada.The synthetic hydroxyapatite was evaluated as bone substitute in the regeneration of the alveolar process. Twenty-eight healthy adult dogs weighing from 10 to 15kg were divided into two groups. Defects around 6 x 5mm were provoked on the vestibular surface of the alveolar process until reaching the root of the fourth right mandibular premolar tooth. In one group the defect was totally infilled with synthetic hydroxyapatite, whereas the other untreated one was used as control. On days 8, 15, 21, 42, 60, 90 and 120, bone fragments were collected for the histological analysis under optical microscopy. The following results were observed: both bone and vascular growth inside the hydroxyapatite pores, intense osteoblast proliferations and neovascularization at the presence of the implant. The biocompatibility of the hydroxyapatite allowed its integration with the alveolar process by direct formation of a lamellar bone. The bone neoformation occurred as the hydroxyapatite was

  4. Espessura do processo alveolar da região anterior da maxila e mandíbula em pacientes com discrepância óssea ântero-posterior Thickness of the alveolar process in the anterior region of the maxilla and mandible of patients with antero-posterior discrepancy

    Directory of Open Access Journals (Sweden)

    Rachel de Mattos Garcia

    2005-10-01

    Full Text Available O presente estudo teve como objetivo avaliar a espessura do processo alveolar da região anterior da maxila e mandíbula em pacientes portadores de discrepâncias ântero-posteriores. Após a seleção de telerradiografias laterais de cinqüenta e dois pacientes entre idades de sete e 13 anos, mediu-se a espessura do processo alveolar da região anterior da maxila e mandíbula. Todos os pacientes apresentavam o ângulo do plano mandibular entre vinte e trinta graus e discrepância óssea ântero-posterior entre maxila e mandíbula. Após a análise estatística (teste qui-quadrado observou-se que não houve dependência entre a espessura do processo alveolar da maxila e mandíbula e a idade do paciente. Todavia houve dependência entre o tipo de má oclusão e a espessura de osso vestibular na região anterior da maxila. Os pacientes portadores de má oclusão de Classe III apresentaram maior porcentagem de redução de osso vestibular da região anterior da maxila quando comparados aos pacientes Classe II. Os pacientes com tendência ao crescimento vertical apresentaram a dimensão reduzida de osso lingual da maxila e osso vestibular da mandíbula.The purpose of the present study was to assess the thickness of the alveolar process on the anterior region of maxilla and mandible of patients with antero-posterior discrepancy. The thickness of the alveolar process on the anterior regions of maxilla and mandible was measured by lateral cephalograms from fifty two patients with ages between seven to thirteen years. All the patients included on this study had the mandibular plan angle between 20 and 30 degrees and antero-posterior bone discrepancy between maxilla and mandible. The statistical analysis (Chi-square test revealed independence between the thickness of the maxilla and mandible alveolar process and the patient age. However, a statistical dependence was found between the type of the malocclusion and the thickness of the buccal bone on

  5. Pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    Surender Kashyap

    2013-01-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a rare, chronic lung disease with bilateral intra-alveolar calcium and phosphate deposition throughout the lung parenchyma with predominance to lower and midzone. Although, etiology and pathogenesis of PAM is not fully understood, the mutation in SLC34A2 gene that encodes a sodium-phosphate co-transporter in alveolar type II cells resulting in the accumulation and forming of microliths rich in calcium phosphate (due to impaired clearance are considered to be the cause of the disease. Chest radiograph and high-resolution CT of thorax are nearly pathognomonic for diagnosing PAM. HRCT demonstrates diffuse micronodules showing slight perilobular predominance resulting in calcification of interlobular septa. Patients with PAM are asymptomatic till development of hypoxemia and cor-pulmonale. No therapy has been proven to be beneficial except lung transplantation.

  6. Alveolar ridge augmentation by osteoinductive materials in goats

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Roervik, M

    1992-01-01

    The purpose of the present study was to determine whether alveolar ridge augmentation could be induced in goats. In 12 male goats allogenic, demineralized, and lyophilized dentin or bone was implanted subperiosteally on the buccal sides of the natural edentulous regions of the alveolar process...

  7. Alveolar ridge preservation and biologic width management for ...

    African Journals Online (AJOL)

    Alveolar bone atrophy is a chronically progressive, irreversible process which results in bone loss in both the buccal, lingual and apico-coronal region. Without bone preservation measures, bone resorption is experienced and continues for life. Preservation of alveolar ridge is indicated when a tooth-supported fixed partial ...

  8. Nostril Base Augmentation Effect of Alveolar Bone Graft

    Directory of Open Access Journals (Sweden)

    Woojin Lee

    2013-09-01

    Full Text Available Background The aims of alveolar bone grafting are closure of the fistula, stabilization ofthe maxillary arch, support for the roots of the teeth adjacent to the cleft on each side.We observed nostril base augmentation in patients with alveolar clefts after alveolar bonegrafting. The purpose of this study was to evaluate the nostril base augmentation effect ofsecondary alveolar bone grafting in patients with unilateral alveolar cleft.Methods Records of 15 children with alveolar clefts who underwent secondary alveolar bonegrafting with autogenous iliac cancellous bone between March of 2011 and May of 2012 werereviewed. Preoperative and postoperative worm’s-eye view photographs and reconstructedthree-dimensional computed tomography (CT scans were used for photogrammetry. Thedepression of the nostril base and thickness of the philtrum on the cleft side were measuredin comparison to the normal side. The depression of the cleft side pyriform aperture wasmeasured in comparison to the normal side on reconstructed three-dimensional CT.Results Significant changes were seen in the nostril base (P=0.005, the philtrum length(P=0.013, and the angle (P=0.006. The CT measurements showed significant changes in thepyriform aperture (P<0.001 and the angle (P<0.001.Conclusions An alveolar bone graft not only fills the gap in the alveolar process but alsoaugments the nostril base after surgery. In this study, only an alveolar bone graft was performedto prevent bias from other procedures. Nostril base augmentation can be achieved byperforming alveolar bone grafts in children, in whom invasive methods are not advised.

  9. Proteinosis alveolar pulmonar

    Directory of Open Access Journals (Sweden)

    Concepción Sánchez Infante

    2011-12-01

    Full Text Available La proteinosis alveolar pulmonar es una enfermedad respiratoria crónica, caracterizada por alteración en el metabolismo del surfactante, lo que determina su acumulación anormal en el espacio alveolar. Es una enfermedad extremadamente rara. Se han reportado solamente 500 casos en la literatura. Se describió por primera vez en 1958. Se presenta un caso de proteinosis alveolar pulmonar en un lactante de 2 meses, con desnutrición proteico energética, que ingresa por dificultad respiratoria e hipoxemia, y, con imágenes radiológicas de tipo retículo-nodulillar, en vidrio deslustrado, en el cual se plantea inicialmente el diagnóstico de bronconeumonía. Ante la evolución desfavorable y no respuesta al tratamiento, se realizó un estudio para descartar enfermedades pulmonares crónicas. El paciente fallece y se confirma el diagnóstico por anatomía patológica. Se realiza una revisión del tema.

  10. Alveolar proteinosis associated with aluminium dust inhalation.

    Science.gov (United States)

    Chew, R; Nigam, S; Sivakumaran, P

    2016-08-01

    Secondary alveolar proteinosis is a rare lung disease which may be triggered by a variety of inhaled particles. The diagnosis is made by detection of anti-granulocyte-macrophage colony-stimulating factor antibodies in bronchoalveolar lavage fluid, which appears milky white and contains lamellar bodies. Aluminium has been suggested as a possible cause, but there is little evidence in the literature to support this assertion. We report the case of a 46-year-old former boilermaker and boat builder who developed secondary alveolar proteinosis following sustained heavy aluminium exposure. The presence of aluminium was confirmed both by histological examination and metallurgical analysis of a mediastinal lymph node. Despite cessation of exposure to aluminium and treatment with whole-lung lavage which normally results in improvements in both symptoms and lung function, the outcome was poor and novel therapies are now being used for this patient. It may be that the natural history in aluminium-related alveolar proteinosis is different, with the metal playing a mediating role in the disease process. Our case further supports the link between aluminium and secondary alveolar proteinosis and highlights the need for measures to prevent excessive aluminium inhalation in relevant industries. © The Author 2016. Published by Oxford University Press on behalf of the Society of Occupational Medicine. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  11. Soft tissue healing in alveolar socket preservation technique: histologic evaluations.

    Science.gov (United States)

    Pellegrini, Gaia; Rasperini, Giulio; Obot, Gregory; Farronato, Davide; Dellavia, Claudia

    2014-01-01

    After tooth extraction, 14 alveolar sockets were grafted with porous bovine bone mineral particles and covered with non-cross-linked collagen membrane (test group), and 14 alveolar sockets were left uncovered. At 5 and 12 weeks, microvascular density (MVD), collagen content, and amount of lymphocytes (Lym) T and B were analyzed in soft tissue. At 5 weeks, MVD was significantly lower and Lym T was significantly higher in tests than in controls (P healing process of the soft tissue.

  12. Alveolar ridge augmentation by osteoinductive materials in goats

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Roervik, M

    1992-01-01

    The purpose of the present study was to determine whether alveolar ridge augmentation could be induced in goats. In 12 male goats allogenic, demineralized, and lyophilized dentin or bone was implanted subperiosteally on the buccal sides of the natural edentulous regions of the alveolar process of...... of the mandible. Light microscopic evaluation revealed fibrous encapsulation, a few multinuclear giant cells, little inflammatory reaction, and no osteoinduction. It was concluded that no osteoinduction took place in goats....

  13. Postextraction Alveolar Ridge Preservation: Biological Basis and Treatments

    OpenAIRE

    Pagni, Giorgio; Pellegrini, Gaia; Giannobile, William V.; Rasperini, Giulio

    2012-01-01

    Following tooth extraction, the alveolar ridge undergoes an inevitable remodeling process that influences implant therapy of the edentulous area. Socket grafting is a commonly adopted therapy for the preservation of alveolar bone structures in combination or not with immediate implant placement although the biological bases lying behind this treatment modality are not fully understood and often misinterpreted. This review is intended to clarify the literature support to socket grafting in ord...

  14. Alveolar ridge preservation in the esthetic zone.

    Science.gov (United States)

    Jung, Ronald E; Ioannidis, Alexis; Hämmerle, Christoph H F; Thoma, Daniel S

    2018-02-27

    In the esthetic zone, in the case of tooth extraction, the clinician is often confronted with a challenge regarding the optimal decision-making process for providing a solution using dental implants. This is because, after tooth extraction, alveolar bone loss and structural and compositional changes of the covering soft tissues, as well as morphological alterations, can be expected. Ideally, the therapeutic plan starts before tooth extraction and it offers three options: spontaneous healing of the extraction socket; immediate implant placement; and techniques for preserving the alveolar ridge at the site of tooth removal. The decision-making process mainly depends on: (i) the chosen time-point for implant placement and the ability to place a dental implant; (ii) the quality and quantity of soft tissue in the region of the extraction socket; (iii) the remaining height of the buccal bone plate; and (iv) the expected rates of implant survival and success. Based on scientific evidence, three time-periods for alveolar ridge preservation are described in the literature: (i) soft-tissue preservation with 6-8 weeks of healing after tooth extraction (for optimization of the soft tissues); (ii) hard- and soft-tissue preservation with 4-6 months of healing after tooth extraction (for optimization of the hard and soft tissues); and (iii) hard-tissue preservation with > 6 months of healing after tooth extraction (for optimization of the hard tissues). © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Alveolar ridge sockets preservation with bone grafting--review.

    Science.gov (United States)

    Allegrini, Sergio; Koening, Bruno; Allegrini, Marcia Rivellino Facci; Yoshimoto, Marcelo; Gedrange, Tomasz; Fanghaenel, Jochen; Lipski, Mariusz

    2008-01-01

    Alveolar bone seems to play a key role in providing support to the teeth, which are anchored to the bone by desmodontal fibers. The progressive alveolar bone resorption process occurs due to a loss of anatomic, biologic and mechanical factors. Mechanical stimulation of alveolar bone during mastication is crucial in keeping the teeth and underlying bone healthy. Tooth extraction leads to typical bone deficiency of ridge width and height of alveolar crest and reduces the possibility of placing screw titanium implants. When tooth extraction is necessary, trauma should be minimized during the procedure and bone preservation should receive careful attention. The literature has shown that early bone loss can be significantly reduced by socket grafting. The process of socket grafting requires an understanding of wound healing and an appreciation of the biological properties of the products available for socket grafting. Augmentative measures may, thus, be required to guarantee optimal prosthetic replacement of the lost tissue. Success or failure of augmentation procedures is dependent on revascularization and remodelling of the grafted bone into a vital, load bearing bone. In contrast to a visible three-dimensional change, the concept of remodelling refers to the internal turnover of bone, which is a coupled process where osteoclastic resorption and osteoblastic formation are more or less balanced. To restore alveolar bone loss and support efficient placement of dental implants, many different bone substitute such as autografts, allografts, xenografts, synthetic biomaterials and osteoactive agents have been proposed. In order to avoid harvesting an autograft, and thereby eliminating additional surgical procedures and risks, bone grafting materials and substitutes are alternative filler materials to be used for ridge augmentation. To present a literature review about biomaterials applicable in alveolar ridge sockets preservation to future implants insertion. The

  16. Alveolar bone resorption after tooth extraction

    OpenAIRE

    Dimova, Cena; Popovski, Stipica

    2012-01-01

    Alveolar ridge resorption has long been considered an unavoidable consequence of tooth extraction. Atrophy of the alveolar bone may cause significant esthetic and surgical problems in implantation, as well as at prosthetic and restorative dentistry. Alveolar ridge prophylaxis immediately upon tooth extraction may reduce such sequelae for both, the treating dentist and the patient. Attempts to reduce alveolar bone resorption have included the placement of natural roots, root analogues, and...

  17. Distracción osteogénica alveolar como método de aumento del reborde alveolar Alveolar osteogenic distraction as method to increase the alveolar ridge

    Directory of Open Access Journals (Sweden)

    Denia Morales Navarro

    2011-03-01

    Full Text Available La distracción osteogénica alveolar, como proceso biológico de neoformación de hueso alveolar, nos motivó a la realización de la presente revisión bibliográfica, con el objetivo enfatizar en el análisis de las variables: antecedentes históricos en Cuba, clasificación de los distractores, fases de la distracción (latencia, distracción y consolidación, indicaciones, contraindicaciones, ventajas, desventajas y complicaciones. Se realizó una revisión bibliográfica mediante la consulta de bases de datos de los sistemas referativos, como MEDLINE y PubMed con la utilización de descriptores "alveolar distraction" y "osteogenic distraction". Se consultaron las fuentes bibliográficas publicadas fundamentalmente en los últimos 5 años, lo que reveló que esta técnica es una excelente alternativa para la formación de huesos y tejidos blandos en zonas de atrofia alveolar, que consta de tres etapas: latencia, distracción y consolidación; un método previsible y con bajas tasas de reabsorción ósea en comparación con otras técnicas de aumento del reborde alveolar. Tiene su principal indicación en la terapia de implantes al proveer volumen óseo. Debemos individualizar cada caso y usar el método más adecuado según las características clínicas y personales del paciente. Una adecuada selección de los casos y una mejor comprensión de la técnica son los puntales para lograr exitosos resultados mediante la distracción osteogénica alveolar. En Cuba se ha aplicado poco la distracción alveolar, por lo que ha sido necesario ampliar los estudios sobre esta temática.The alveolar osteogenic distraction, as a biological process of alveolar bone neoformation, motivates us to make the bibliographic review whose objective was to emphasize in analysis the following variables: historical backgrounds in Cuba, distraction classification, distraction phases (latency, distraction and consolidation, indications, contraindications, advantages

  18. Intravascular bronchio-alveolar tumor

    International Nuclear Information System (INIS)

    Mata, J.M.; Caceres, J.; Prat, J.; Lopez, J.I.; Velilla, O.

    1991-01-01

    In 1975 Dail and Liebow described the clinical and pathological characteristics of a pulmonary tumor which they dominated intravascular bronchio-alveolar tumor (IVBAT). Our aim is to acquaint radiologists with the existence of this tumor by describing the radiologic findings in 2 patients with IVBAT, 1 with hepatic involvement ant the other with pulmonary osteoarthropathy. (author). 7 refs.; 2 figs

  19. Human alveolar echinococcosis in Kyrgyzstan.

    Science.gov (United States)

    Usubalieva, Jumagul; Minbaeva, Gulnara; Ziadinov, Iskender; Deplazes, Peter; Torgerson, Paul R

    2013-07-01

    Human echinococcosis is a reportable disease in Kyrgyzstan. Between 1995 and 2011, human alveolar echinococcosis increased from 60 cases per year. The origins of this epidemic, which started in 2004, may be linked to the socioeconomic changes that followed the dissolution of the former Soviet Union.

  20. True Fibroma of Alveolar Mucosa

    Directory of Open Access Journals (Sweden)

    Shankargouda Patil

    2014-01-01

    Full Text Available Benign fibrous overgrowths are often found in the oral cavity, almost always being reactive/irritational in nature. However, benign mesenchymal neoplasms of the fibroblasts are extremely uncommon. Here we report a case of “True Fibroma of Alveolar Mucosa” for its rarity.

  1. Hypocapnic but Not Metabolic Alkalosis Impairs Alveolar Fluid Reabsorption

    Science.gov (United States)

    Myrianthefs, Pavlos M.; Briva, Arturo; Lecuona, Emilia; Dumasius, Vidas; Rutschman, David H.; Ridge, Karen M.; Baltopoulos, George J.; Sznajder, Jacob Iasha

    2005-01-01

    Acid-base disturbances, such as metabolic or respiratory alkalosis, are relatively common in critically ill patients. We examined the effects of alkalosis (hypocapnic or metabolic alkalosis) on alveolar fluid reabsorption in the isolated and continuously perfused rat lung model. We found that alveolar fluid reabsorption after 1 hour was impaired by low levels of CO2 partial pressure (PCO2; 10 and 20 mm Hg) independent of pH levels (7.7 or 7.4). In addition, PCO2 higher than 30 mm Hg or metabolic alkalosis did not have an effect on this process. The hypocapnia-mediated decrease of alveolar fluid reabsorption was associated with decreased Na,K-ATPase activity and protein abundance at the basolateral membranes of distal airspaces. The effect of low PCO2 on alveolar fluid reabsorption was reversible because clearance normalized after correcting the PCO2 back to normal levels. These data suggest that hypocapnic but not metabolic alkalosis impairs alveolar fluid reabsorption. Conceivably, correction of hypocapnic alkalosis in critically ill patients may contribute to the normalization of lung ability to clear edema. PMID:15764729

  2. Postextraction alveolar ridge preservation: biological basis and treatments.

    Science.gov (United States)

    Pagni, Giorgio; Pellegrini, Gaia; Giannobile, William V; Rasperini, Giulio

    2012-01-01

    Following tooth extraction, the alveolar ridge undergoes an inevitable remodeling process that influences implant therapy of the edentulous area. Socket grafting is a commonly adopted therapy for the preservation of alveolar bone structures in combination or not with immediate implant placement although the biological bases lying behind this treatment modality are not fully understood and often misinterpreted. This review is intended to clarify the literature support to socket grafting in order to provide practitioners with valid tools to make a conscious decision of when and why to recommend this therapy.

  3. Alveolar ridge atrophy related to facial morphology in edentulous patients

    Directory of Open Access Journals (Sweden)

    Kuć J

    2017-09-01

    Full Text Available Joanna Kuć,1 Teresa Sierpińska,2 Maria Gołębiewska1 1Department of Prosthodontics, 2Department of Dental Technology, Medical University of Bialystok, Bialystok, Poland Objectives: The morphology of the alveolar process determines the retention and stability of prosthetic restorations, thereby determining the result of the therapy. Considering that the edentulous jaws may be affected by the atrophy process, it was hypothesized that the morphology of the alveolar process of the maxilla may be dependent on the anterior facial height and anatomy of the mandible. Subjects and methods: Twenty-five healthy edentulous Caucasian individuals were randomly chosen. Each subject underwent a lateral cephalogram before and after prosthetic rehabilitation. During exposition, newly made prostheses were placed in the patient’s mouth. Teeth remained in maximal intercuspidation. Morphological parameters were evaluated according to the Ricketts, McNamara, and Tallgren’s method. Results: An inversely proportional association was observed between patient age and the distal part of the maxilla. A statistically significant connection was noted between the vertical dimension of alveolar ridge and anterior total and lower facial height conditioned by prosthetic rehabilitation. Conclusion: The height of the lateral part of the alveolar ridge of the maxilla remains in connection with the anterior total and lower facial height obtained in the course of prosthetic rehabilitation. The vertical dimension of the alveolar ridge of the maxilla seems to be in close relationship with the morphology of the lower jaw. Keywords: anterior facial height, cephalometric analysis, complete dentures, vertical occlusal dimension

  4. The development and plasticity of alveolar type 1 cells

    Science.gov (United States)

    Yang, Jun; Hernandez, Belinda J.; Martinez Alanis, Denise; Narvaez del Pilar, Odemaris; Vila-Ellis, Lisandra; Akiyama, Haruhiko; Evans, Scott E.; Ostrin, Edwin J.; Chen, Jichao

    2016-01-01

    Alveolar type 1 (AT1) cells cover >95% of the gas exchange surface and are extremely thin to facilitate passive gas diffusion. The development of these highly specialized cells and its coordination with the formation of the honeycomb-like alveolar structure are poorly understood. Using new marker-based stereology and single-cell imaging methods, we show that AT1 cells in the mouse lung form expansive thin cellular extensions via a non-proliferative two-step process while retaining cellular plasticity. In the flattening step, AT1 cells undergo molecular specification and remodel cell junctions while remaining connected to their epithelial neighbors. In the folding step, AT1 cells increase in size by more than 10-fold and undergo cellular morphogenesis that matches capillary and secondary septa formation, resulting in a single AT1 cell spanning multiple alveoli. Furthermore, AT1 cells are an unexpected source of VEGFA and their normal development is required for alveolar angiogenesis. Notably, a majority of AT1 cells proliferate upon ectopic SOX2 expression and undergo stage-dependent cell fate reprogramming. These results provide evidence that AT1 cells have both structural and signaling roles in alveolar maturation and can exit their terminally differentiated non-proliferative state. Our findings suggest that AT1 cells might be a new target in the pathogenesis and treatment of lung diseases associated with premature birth. PMID:26586225

  5. Pulmonary alveolar microlithiasis in children

    International Nuclear Information System (INIS)

    Schmidt, H.; Loercher, U.; Kitz, R.; Zielen, S.; Ahrens, P.; Koenig, R.

    1996-01-01

    Two asymptomatic Turkish sibs are presented, a 4-year-old boy and his 7-year-old sister, with pulmonary alveolar microlithiasis (PAM) confirmed by transbronchial lung biopsy and bronchoalveolar lavage. Chest radiographs and high resolution CT demonstrated wide-spread intra-alveolar calcifications in both lungs. The lesions were sharply defined and less than 1 mm in diameter. CT documented a high concentration of microliths along the bronchovascular bundles, the intralobular fissue and the (sub)pleural lung parenchyma. The combination of bronchoalveolar lavage and roentgenographic appearance in high resolution CT are characteristic and pathognomonic, and can confirm the diagnosis. The more severe changes in the elder sib and the radiographic controls suggest that the pulmonary disease may be progressive in our patients. The described family of consanguineous, unaffected parents with two affected and one healthy child confirmed the autosomal recessive inheritance of PAM (McKusick 265100). In addition, the affected girl had autosomal recessive Waardenburg-anophthalmia syndrome (McKusick 206920), raising the question of whether this is a chance occurrence or possibly a contiguous gene syndrome. (orig.)

  6. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy

    OpenAIRE

    Kaya, Bülent; Yildiz, Ibrahim; Baha, Reshat Mehmet; Zeytun, Neslihan Ebru Eryaşar; Yetisgen, Azize

    2015-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  7. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy.

    Science.gov (United States)

    Kaya, Bülent; Yildiz, Ibrahim; Baha, Reshat Mehmet; Zeytun, Neslihan Ebru Eryaşar; Yetisgen, Azize

    2015-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  8. Diffuse Alveolar Hemorrhage Associated with Warfarin Therapy

    Directory of Open Access Journals (Sweden)

    Bülent Kaya

    2015-01-01

    Full Text Available Diffuse alveolar hemorrhage (DAH is a life-threatening clinical pathologic syndrome caused by a variety of diseases. We report a case of DAH related to therapy of warfarin use. In this case report, we present the diffuse alveolar hemorrhage case as a rare and life-threatening complication of warfarin.

  9. CT quantification of pulmonary alveolar microlithiasis

    International Nuclear Information System (INIS)

    Wurche, K.D.; Kubale, R.; Vallee, D.; Ostertag, H.

    1987-01-01

    Pulmonary alveolar microlithiasis is a rare, familial disease with massive symmetrical intra-alveolar calcium deposition. Conventional CT findings and CT measurements with a dual energy technique were carried out in a 26-year-old patient suffering from this disease. The importance of the findings in the differential diagnosis and for estimating the progression and prognosis of the disease is discussed. (orig.) [de

  10. Laser microdissection of the alveolar duct enables single-cell genomic analysis

    Directory of Open Access Journals (Sweden)

    Robert eBennett

    2014-09-01

    Full Text Available Complex tissues such as the lung are composed of structural hierarchies such as alveoli, alveolar ducts and lobules. Some structural units, such as the alveolar duct, appear to selectively participate in tissue regeneration. Here, we demonstrate an approach to conduct laser microdissection of the lung alveolar duct for single-cell PCR analysis. Our approach involved three steps. 1 The initial preparation used mechanical sectioning of the lung tissue with sufficient thickness to encompass the structure of interest. In the case of the alveolar duct, the precision-cut lung slices were 200um thick; the slices were processed using near-physiologic conditions to preserve the state of viable cells. 2 The lung slices were examined by transmission light microscopy to target the alveolar duct. The air-filled lung was sufficiently accessible by light microscopy that counterstains or fluorescent labels were unnecessary to identify the alveolar duct. 3 The enzymatic and microfluidic isolation of single cells allowed for the harvest of as few as several thousand cells for PCR analysis. Microfluidics based arrays were used to measure the expression of selected marker genes in individual cells to characterize different cell populations. Preliminary work suggests the unique value of this approach to understanding the intra- and intercellular interactions within the regenerating alveolar duct.

  11. Estudio histológico comparativo de la reparación ósea entre hueso alveolar y extra-alveolar en los cerdos sometidos a osteotomía con alta y baja velocidad, con refrigeración líquida Comparative study of bone repair between alveolar and extra-alveolar bone in pigs subjected to osteotomy at low speed and high speed with liquid refrigeration

    Directory of Open Access Journals (Sweden)

    Henrique José Baldo de Toledo

    2012-03-01

    Full Text Available Introducción: Teniendo en cuenta que el proceso de reparación ósea en los cerdos se muestra en una mayor proximidad entre las variables histológicas estudiadas en comparación con otros modelos biológicos, el presente estudio tenía como objetivo evaluar el proceso histológico de la reparación ósea de osteotomías realizadas en huesos alveolares y extra-alveolar, utilizando instrumentos rotatorios con refrigeración líquida. Material y método: Dieciocho cerdos Large White con peso comprendido entre 20 y 25Kg fueron divididos en tres grupos de seis animales cada uno, con cada grupo formado por tres animales para evaluar la reparación de osteotomías con baja y alta velocidades en el hueso alveolar y tres en área extra-alveolar en los períodos de estudio de 7, 14 y 28 días. Resultados: Se observó que en el hueso alveolar en los tiempos post-operatorio de 14 y 28 días, los mejores resultados de reparación fueron en las osteotomías realizadas con baja velocidad, mientras que en el período post-operatorio de siete días, los resultados con alta velocidad fueron ligeramente mejores tanto en áreas alveolares como extra-alveolares. Para la metodología utilizada, no se encontraron diferencias estadísticamente significativas en el proceso de reparación ósea alveolar y extra-alveolar. Conclusiones: El proceso de reparación, por medio de análisis microscópico en la región alveolar y extra-alveolar, son similares con mejores resultados observados en osteotomías hechas con taladros en baja velocidad en los tiempos de catorce y veintiocho días y en el post-operatorio de siete días, los resultados con taladros de alta velocidad y la refrigeración fueron ligeramente mejores. Los trabajos de investigación utilizando cerdos como modelo animal son perfectamente viables.Introduction: Taking into account the bone repair process in pigs has shown a greater similarity among the histological variables studied compared to other biological

  12. [Treatment of dental accidents and associated alveolar fractures].

    Science.gov (United States)

    Teerijoki-Oksa, Tuija; Karjalainen, Sára; Soukka, Tero

    2010-01-01

    Diagnosis of dental accidents is based on patient history, clinical examination and imaging. A completely avulsed tooth should immediately be reimplanted, and a dislodged tooth urgently repositioned to the original position. Avulsed primary teeth will never be reimplanted, and primary teeth of children under three years are not repositioned. Furthermore, fractures of the alveolar process and various soft tissue injuries but not dental fractures require urgent treatment. All dental accident patients should be referred to dental consultation for further examinations and treatment.

  13. Alveolar socket healing: what can we learn?

    Science.gov (United States)

    Araújo, Mauricio G; Silva, Cléverson O; Misawa, Mônica; Sukekava, Flavia

    2015-06-01

    Tooth extraction induces a series of complex and integrated local changes within the investing hard and soft tissues. These local alterations arise in order to close the socket wound and to restore tissue homeostasis, and are referred to as '"socket healing". The aims of the present report were twofold: first, to describe the socket-healing process; and, second, to discuss what can be learned from the temporal sequence of healing events, in order to improve treatment outcomes. The socket-healing process may be divided into three sequential, and frequently overlapping, phases: inflammatory; proliferative; and modeling/remodeling. Several clinical and experimental studies have demonstrated that the socket-healing process promotes up to 50% reduction of the original ridge width, greater bone resorption at the buccal aspect than at the lingual/palatal counterpart and a larger amount of alveolar bone reduction in the molar region. In conclusion, tooth extraction, once a simple and straightforward surgical procedure, should be performed in the knowledge that ridge reduction will follow and that further clinical steps should be considered to compensate for this, when considering future options for tooth replacement. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Pulmonary Alveolar Proteinosis in Setting of Inhaled Toxin Exposure and Chronic Substance Abuse

    Directory of Open Access Journals (Sweden)

    Meirui Li

    2018-01-01

    Full Text Available Pulmonary alveolar proteinosis (PAP is a rare lung disorder in which defects in alveolar macrophage maturation or function lead to the accumulation of proteinaceous surfactant in alveolar space, resulting in impaired gas exchange and hypoxemia. PAP is categorized into three types: hereditary, autoimmune, and secondary. We report a case of secondary PAP in a 47-year-old man, whose risk factors include occupational exposure to inhaled toxins, especially aluminum dust, the use of anabolic steroids, and alcohol abuse, which in mice leads to alveolar macrophage dysfunction through a zinc-dependent mechanism that inhibits granulocyte macrophage-colony stimulating factor (GM-CSF receptor signalling. Although the rarity and vague clinical presentation of PAP can pose diagnostic challenges, clinician awareness of PAP risk factors may facilitate the diagnostic process and lead to more prompt treatment.

  15. Effect of Alveolar Segmental Sandwich Osteotomy on Alveolar Height: A Preliminary Study.

    Science.gov (United States)

    Mehta, Karan S; Prasad, Kavitha; Shetty, Vibha; Ranganath, Krishnappa; Lalitha, R M; Dexith, Jayashree; Munoyath, Sejal K; Kumar, Vineeth

    2017-12-01

    Bone loss following extraction is maximum in horizontal dimension. Height is also reduced which is pronounced on the buccal aspect. Various surgical procedures are available to correct the bone volume viz. GBR, onlay bone grafting, alveolar distraction and sandwich osteotomy. Sandwich osteotomy has been found to increase the vertical alveolar bone height successfully. The objective of the study was to assess the effect of alveolar segmental sandwich osteotomy on alveolar height and crestal width. A prospective study was undertaken from December 2012 to August 2014. Seven patients with 12 implant sites with a mean age of 36 years were recruited. All seven patients with 12 implant sites underwent alveolar segmental sandwich osteotomy and interpositional bone grafting. Alveolar bone height was assessed radiographically preoperatively, immediate post-op, and at 3 months post-op. Alveolar bone width was assessed radiographically preoperatively and at 3 months post-op. Statistical significance was inferred at p  Sandwich osteotomy can be used as an alternative technique to increase alveolar bone height prior to implant placement. Moderate alveolar deficiency can be predictably corrected by this technique.

  16. Proteinose alveolar pulmonar: série de quatro casos Pulmonary alveolar proteinosis: four cases

    Directory of Open Access Journals (Sweden)

    João Carlos Thompson

    2006-06-01

    without the need for whole-lung lavage. In the other three cases, the number of lavages varied: in one patient, a single unilateral lavage resulted in complete remission of the bilateral process; in another patient, three lavages yielded no significant improvement; in the remaining patient, four lavages provided intervening periods of transient improvement. CONCLUSION: In the cases evaluated, whole-lung lavage proved an efficient treatment for pulmonary alveolar proteinosis. Although some patients presented a certain resistance to the procedure, it might lead to complete remission of the disease in others.

  17. Alveolar ridge augmentation by osteoinduction in rats

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1990-01-01

    The purpose of this study was to evaluate bone substitutes for alveolar ridge augmentation by osteoinduction. Allogenic, demineralized, and lyophilized dentin and bone was tested for osteoinductive properties in order to establish an experimental model for further studies. Implantations were...

  18. Development of a lung slice preparation for recording ion channel activity in alveolar epithelial type I cells

    Directory of Open Access Journals (Sweden)

    Crandall Edward D

    2005-04-01

    Full Text Available Abstract Background Lung fluid balance in the healthy lung is dependent upon finely regulated vectorial transport of ions across the alveolar epithelium. Classically, the cellular locus of the major ion transport processes has been widely accepted to be the alveolar type II cell. Although evidence is now emerging to suggest that the alveolar type I cell might significantly contribute to the overall ion and fluid homeostasis of the lung, direct assessment of functional ion channels in type I cells has remained elusive. Methods Here we describe a development of a lung slice preparation that has allowed positive identification of alveolar type I cells within an intact and viable alveolar epithelium using living cell immunohistochemistry. Results This technique has allowed, for the first time, single ion channels of identified alveolar type I cells to be recorded using the cell-attached configuration of the patch-clamp technique. Conclusion This exciting new development should facilitate the ascription of function to alveolar type I cells and allow us to integrate this cell type into the general model of alveolar ion and fluid balance in health and disease.

  19. Ultrastructural types of alveolar macrophages in bronchoalveolar lavages from patients with pulmonary sarcoidosis.

    Science.gov (United States)

    Burkhardt, Olaf; Lode, Hartmut; Welte, Tobias; Merker, Hans-Joachim

    2007-01-01

    By routine applied quantitative BAL methods are particularly helpful for the diagnosis of pulmonary sarcoidosis. Here the morphology of the alveolar cells does not play a role. However, morphological and especially electron microscopic investigations might contribute to the clarification of the aetiology of this disease. In a prospective study we investigated the bronchoalveolar lavages (BALs) from 10 patients with recently histologically diagnosed, untreated pulmonary sarcoidosis. Commonly applied cytological and immunological BAL diagnostic techniques were accompanied by morphological investigations of alveolar cells, especially alveolar macrophages, using light and electron microscopy. All patients showed lymphocytic alveolitis with an increased number of CD4 positive lymphocytes as well as an increased CD4/CD8 ratio. A striking light microscopic finding was the great morphological variety of the alveolar macrophages. Electron microscopy revealed typical lymphocytes, neutrophils, and eosinophils as well as three different types of alveolar macrophages in all 10 patients: type I (approx. 30%) with a normal macrophage morphology, a vacuole-rich type II (approx. 30%) with myelin-like structures and type III (approx. 40%) with electron-dense inclusions. The occurrence of intracellular myelin figures in type II macrophages is a hint for increased phagocytotic processes of surfactant with or without its overproduction in the sense of a secondary alveolar proteinosis. Numerous electron-dense inclusions in type III also indicate an increased macrophage activity that leads to an increased release of cytokines, which in turn can trigger an inflammatory reaction.

  20. Quality assessment of systematic reviews on alveolar socket preservation.

    Science.gov (United States)

    Moraschini, V; Barboza, E Dos S P

    2016-09-01

    The aim of this overview was to evaluate and compare the quality of systematic reviews, with or without meta-analysis, that have evaluated studies on techniques or biomaterials used for the preservation of alveolar sockets post tooth extraction in humans. An electronic search was conducted without date restrictions using the Medline/PubMed, Cochrane Library, and Web of Science databases up to April 2015. Eligibility criteria included systematic reviews, with or without meta-analysis, focused on the preservation of post-extraction alveolar sockets in humans. Two independent authors assessed the quality of the included reviews using AMSTAR and the checklist proposed by Glenny et al. in 2003. After the selection process, 12 systematic reviews were included. None of these reviews obtained the maximum score using the quality assessment tools implemented, and the results of the analyses were highly variable. A significant statistical correlation was observed between the scores of the two checklists. A wide structural and methodological variability was observed between the systematic reviews published on the preservation of alveolar sockets post tooth extraction. None of the reviews evaluated obtained the maximum score using the two quality assessment tools implemented. Copyright © 2016 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  1. [Cleft lip, alveolar and palate sequelae. Proposal of new alveolar score by the Alveolar Cleft Score (ACS) classification].

    Science.gov (United States)

    Molé, C; Simon, E

    2015-06-01

    The management of cleft lip, alveolar and palate sequelae remains problematic today. To optimize it, we tried to establish a new clinical index for diagnostic and prognostic purposes. Seven tissue indicators, that we consider to be important in the management of alveolar sequelae, are listed by assigning them individual scores. The final score, obtained by adding together the individual scores, can take a low, high or maximum value. We propose a new classification (ACS: Alveolar Cleft Score) that guides the therapeutic team to a prognosis approach, in terms of the recommended surgical and prosthetic reconstruction, the type of medical care required, and the preventive and supportive therapy to establish. Current studies are often only based on a standard radiological evaluation of the alveolar bone height at the cleft site. However, the gingival, the osseous and the cellular areas bordering the alveolar cleft sequelae induce many clinical parameters, which should be reflected in the morphological diagnosis, to better direct the surgical indications and the future prosthetic requirements, and to best maintain successful long term aesthetic and functional results. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  2. Perawatan Ortodontik Gigi Anterior Berjejal dengan Tulang Alveolar yang Tipis

    Directory of Open Access Journals (Sweden)

    Miesje K. Purwanegara

    2015-09-01

    Full Text Available Anterior teeth movement in orthodontic treatment is limited to labiolingual direction by very thin alveolar bone. An uncontrolled anterior tooth movement to labiolingual direction can cause alveolar bone perforation at its root segment. This case report is to remind us that alveolar bone thickness limits orthodontc tooth movement. A case of crowded anterior teeth with thin alveolar bone in malocclusion I is reported. This case is treated using adgewise orthodontic appliance. Protraction of anterior teeth is anticipated due to thin alveolar bone on the anterior surface. The conclusion is although the alveolar bone surrounding the crowded anterior teeth is thin, by controlling the movement the teeth reposition is allowed.

  3. Lateralization Technique and Inferior Alveolar Nerve Transposition

    Directory of Open Access Journals (Sweden)

    Angélica Castro Pimentel

    2016-01-01

    Full Text Available Bone resorption of the posterior mandible can result in diminished bone edge and, therefore, the installation of implants in these regions becomes a challenge, especially in the presence of the mandibular canal and its contents, the inferior alveolar nerve. Several treatment alternatives are suggested: the use of short implants, guided bone regeneration, appositional bone grafting, distraction osteogenesis, inclined implants tangential to the mandibular canal, and the lateralization of the inferior alveolar nerve. The aim was to elucidate the success rate of implants in the lateralization technique and in inferior alveolar nerve transposition and to determine the most effective sensory test. We conclude that the success rate is linked to the possibility of installing implants with long bicortical anchor which favors primary stability and biomechanics.

  4. Alveolar Ridge Carcinoma. Two Cases Report

    International Nuclear Information System (INIS)

    Pupo Triguero, Raul J; Vivar Bauza, Miriam; Alvarez Infante, Elisa

    2008-01-01

    Two cases with alveolar ridge carcinoma due to prosthetist traumatism are discussed in this paper, after 9 and 10 years of using dental prosthesis. Both patients began with disturbance in the alveolar ridge. The clinical examination and biopsy showed a well differenced carcinoma. The treatment was radical surgery and radiotherapy in the first patient, and conservative surgery with radiotherapy in the second case .The patients had xerostomia after radiotherapy and the woman had difficulties with mastication. The advantages and disadvantages of the treatment were discussed, focused on the prevention and treatment for oral

  5. Alveolar Bone Fracture: Pathognomonic Sign for Clinical Diagnosis

    OpenAIRE

    Gutmacher, Zvi; Peled, Eli; Norman, Doron; Lin, Shaul

    2017-01-01

    Aim: Dental injuries, especially luxation and avulsion, are common. Dental trauma can cause alveolar bone fracture that can lead to tooth loss and malocclusion. Single tooth alveolar bone fractures are difficult to identify unless it protrudes through the overlying mucosa and can be visualized. Pain, malocclusion, and tooth mobility provide signs of suspected alveolar bone fractures. Integrity of the proximate alveolar bone should be examined for fractures where avulsion, luxation, or other t...

  6. Teaching Alveolar Ventilation with Simple, Inexpensive Models

    Science.gov (United States)

    DiCarlo, Stephen E.

    2008-01-01

    When teaching and learning about alveolar ventilation with our class of 300 first-year medical students, we use four simple, inexpensive "models." The models, which encourage research-oriented learning and help our students to understand complex ideas, are distributed to the students before class. The students anticipate something new every day,…

  7. Alveolar ridge augmentation by osteoinduction in rats

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1990-01-01

    The purpose of this study was to evaluate bone substitutes for alveolar ridge augmentation by osteoinduction. Allogenic, demineralized, and lyophilized dentin and bone was tested for osteoinductive properties in order to establish an experimental model for further studies. Implantations were perf...

  8. Menopause-related oral alveolar bone resorption: a review of relatively unexplored consequences of estrogen deficiency.

    Science.gov (United States)

    Birkenfeld, L; Yemini, M; Kase, N G; Birkenfeld, A

    1999-01-01

    The alveolar processes of the maxilla and mandible provide the bony framework for tooth support. Osteoporotic changes of these bones may directly affect tooth stability and retention. This report reviews studies that have evaluated the relationship between systemic osteoporosis and oral alveolar bone mass as well as the effect of estrogen use on oral alveolar bone and tooth retention. Ten years (1989-1998) literature review. Studies reviewed demonstrate a positive correlation between systemic bone mass and systemic osteoporosis to oral bone resorption. Estrogen replacement therapy affects oral bone in a manner similar to the way it affects other sites. It is evident that postmenopausal estrogen users may retain more teeth after menopause. Sustained oral health and better tooth retention are potentially additional benefits for hormone replacement therapy users after menopause.

  9. Alveolar bone preservation subsequent to miniscrew implant placement in a canine model

    DEFF Research Database (Denmark)

    Melsen, Birte; Huja, Sarandeep; Chien, Hua-Hong

    2015-01-01

    -implant across the healing alveolar process results in increased density not only adjacent to the screws, but also in the region where a potential dental implant would be inserted. In humans, the insertion of transcortical screws may maintain bone when for various reasons insertion of a permanent dental implant......Abstract OBJECTIVE: To assess the effects of transcortical screws on alveolar (bone) ridge preservation following extraction. DESIGN: Four adult beagle dogs had mandibular premolars extracted bilaterally. After 6 weeks, using a split-mouth design, two transcortical screws were inserted unilaterally...... below the alveolar crest on the experimental side in the region of the extraction. The dogs were killed after 12 weeks. The bone at the extraction sites was analyzed using μCT and 3D analysis. A cylindrical core was placed around the actual and a virtual screw placed in the identical location...

  10. Alveolar Bone Fracture: Pathognomonic Sign for Clinical Diagnosis.

    Science.gov (United States)

    Gutmacher, Zvi; Peled, Eli; Norman, Doron; Lin, Shaul

    2017-01-01

    Dental injuries, especially luxation and avulsion, are common. Dental trauma can cause alveolar bone fracture that can lead to tooth loss and malocclusion. Single tooth alveolar bone fractures are difficult to identify unless it protrudes through the overlying mucosa and can be visualized. Pain, malocclusion, and tooth mobility provide signs of suspected alveolar bone fractures. Integrity of the proximate alveolar bone should be examined for fractures where avulsion, luxation, or other tooth trauma is detected. Any suggestion of alveolar fractures should be further investigated with an appropriate radiograph. This case report shows a pathognomonic sign that detects and diagnosis single tooth alveolar bone fractures, i.e. , a localized hematoma crossing the attached gingiva from the free gingival margin to the vestibular mucosa. This should serve as a warning for localized alveolar bone fracture. A visualized hematoma and gentle, careful palpation may help detect covered fractures when the overlying mucosa is not perforated.

  11. Rare Lung Diseases II: Pulmonary Alveolar Proteinosis

    Directory of Open Access Journals (Sweden)

    Stephen C Juvet

    2008-01-01

    Full Text Available The present article is the second in a series on rare lung diseases. It focuses on pulmonary alveolar proteinosis (PAP, a disorder in which lipoproteinaceous material accumulates in the alveolar space. PAP was first described in 1958, and for many years the nature of the material accumulating in the lungs was unknown. Major insights into PAP have been made in the past decade, and these have led to the notion that PAP is an autoimmume disorder in which autoantibodies interfere with signalling through the granulocyte-macrophage colony-stimulating factor receptor, leading to macrophage and neutrophil dysfunction. This has spurred new therapeutic approaches to this disorder. The discussion of PAP will begin with a case report, then will highlight the classification of PAP and review recent insights into the pathogenesis of PAP. The approach to therapy and the prognosis of PAP will also be discussed.

  12. Silver Nanoparticles in Alveolar Bone Surgery Devices

    Directory of Open Access Journals (Sweden)

    Stefano Sivolella

    2012-01-01

    Full Text Available Silver (Ag ions have well-known antimicrobial properties and have been applied as nanostrategies in many medical and surgical fields, including dentistry. The use of silver nanoparticles (Ag NPs may be an option for reducing bacterial adhesion to dental implant surfaces and preventing biofilm formation, containing the risk of peri-implant infections. Modifying the structure or surface of bone grafts and membranes with Ag NPs may also prevent the risk of contamination and infection that are common when alveolar bone augmentation techniques are used. On the other hand, Ag NPs have revealed some toxic effects on cells in vitro and in vivo in animal studies. In this setting, the aim of the present paper is to summarize the principle behind Ag NP-based devices and their clinical applications in alveolar bone and dental implant surgery.

  13. Alveolar ridge preservation immediately after tooth extraction.

    Science.gov (United States)

    Feller, L; Khammissa, R A G; Bouckaert, M; Lemmer, J

    2013-10-01

    Ridge preservation procedures immediately after tooth extraction, are commonly used with a view to minimising remodelling and shrinkage of the alveolar ridge, associated with socket healing. These procedures may sometimes be effective, but they cannot completely prevent reduction in dimension of the ridge. Certain biomater als used may actually hamper normal deposition of bone within the healing socket, reducing bone trabeculae that can integrate with the implant surface. However, in extraction sockets in alveolar ridges of low bone density, particles of implanted bone substitute incorporated in the healing bone, may enhance the mechanical support for the implant, provided by normal healed bone of low trabecular density alone. This paper reviews biological rationales and procedures for ridge preservation immediately after extraction and comments on their clinical use.

  14. [Clinical research on repairing alveolar cleft with osteoinduction active material].

    Science.gov (United States)

    She, Xiao-ming; Zhang, Qian; Tian, Kun; Yang, Li; Xiong, Gui-fa

    2010-08-01

    To study the feasibility and authenticity of repairing alveolar defects in alveolar cleft patients with osteoinduction active material (OAM) in clinic. Twenty-seven cases of alveolar defect chosen from clinic were divided into two groups (test group and control group). For test group (12 cases), OAM was transplanted to repair the alveolar cleft. For control group (15 cases), autogenous ilium cancellous bone were transplanted into the defect region to repair alveolar cleft. At 6 months after operation, CT and three-dimensional reconstruction were used to observe alveolar appearance, and the effect and clinical success rate of recover alveolar cleft by using different repair material were compared. In the 27 cases, all the maxillary continuity was restored except two of test group and two of control group. There was no significant difference between test group and control group regarding the clinical success rate of the alveolar cleft repair (P = 1.000). OAM was used to repair the alveolar cleft that can result in new bone formations and the burgeon of canines from the bone grafted areas. There is no significant difference between OAM and autogenous ilium cancellous bone regarding the effect of the alveolar cleft repair.

  15. Post traumatic immediate GBR: alveolar ridge preservation after a comminuted fracture of the anterior maxilla.

    Science.gov (United States)

    Kim, Yongsoo; Leem, Dae Ho

    2015-04-01

    Without a proper intervention, a crushed alveolar process fracture can cause significant dimensional changes on affected hard and soft tissue that lead to difficult circumstances for post traumatic bone augmentation and dental implant placement. We present herein the cases of immediate guided bone regeneration (GBR) for the maxillary anterior alveolar process with comminuted fracture. Shortly after the hospital visit, guided bone regeneration was conducted for three patients using only xenograft material and bone fragments from traumatic site, without an additional donor site. Resorbable collagen membrane was used on the bone graft site, and titanium mesh was also used if significant bone loss were expected. Radiographic evaluation 6 months after GBR confirmed that all three cases had sufficiently preserved alveolar bone which is clinically required for implant placement. Dental implant installation was carried out for two patients and no specific findings were noted in follow-up after the placement. In this method, additional operation sites for bone collection are not necessary and the number of surgical steps before implant placement can be reduced. Furthermore, this immediate intervention can effectively minimize the alveolar ridge shrinkage of anterior maxilla after injury. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Intranasal Fentanyl Intoxication Leading to Diffuse Alveolar Hemorrhage.

    Science.gov (United States)

    Ruzycki, Shannon; Yarema, Mark; Dunham, Michael; Sadrzadeh, Hossein; Tremblay, Alain

    2016-06-01

    Increasing rates of opioid abuse, particularly fentanyl, may lead to more presentations of unusual effects of opioid toxicity. Diffuse alveolar hemorrhage is a rare complication of fentanyl overdose. A 45-year-old male presented in hypoxic respiratory failure secondary to diffuse alveolar hemorrhage requiring intubation. Comprehensive drug screening detected fentanyl without exposure to cocaine. Further history upon the patient's recovery revealed exposure to snorted fentanyl powder immediately prior to presentation. Diffuse alveolar hemorrhage is a potential, though rare, presentation of opioid intoxication. Recognition of less common complications of opioid abuse such as diffuse alveolar hemorrhage is important in proper management of overdoses.

  17. RAGE-induced changes in the proteome of alveolar epithelial cells.

    Science.gov (United States)

    Downs, Charles A; Johnson, Nicholle M; Tsaprailis, George; Helms, My N

    2018-02-12

    The receptor for advanced glycation end-products (RAGE) is a pattern recognition receptor and member of the immunoglobulin superfamily. RAGE is constitutively expressed in the distal lung where it co-localizes with the alveolar epithelium; RAGE expression is otherwise minimal or absent, except with disease. This suggests RAGE plays a role in lung physiology and pathology. We used proteomics to identify and characterize the effects of RAGE on rat alveolar epithelial (R3/1) cells. LC-MS/MS identified 177 differentially expressed proteins and the PANTHER Classification System further segregated proteins. Proteins involved in gene transcription (RNA and mRNA splicing, mRNA processing) and transport (protein, intracellular protein) were overrepresented; genes involved in a response to stimulus were underrepresented. Immune system processes and response to stimuli were downregulated with RAGE knockdown. Western blot confirmed RAGE-dependent changes in protein expression for NFκB and NLRP3 that was functionally supported by a reduction in IL-1β and phosphorylated p65. We also assessed RAGE's effect on redox regulation and report that RAGE knockdown attenuated oxidant production, decreased protein oxidation, and increased reduced thiol pools. Collectively the data suggest that RAGE is a critical regulator of epithelial cell response and has implications for our understanding of lung disease, specifically acute lung injury. In the present study, we undertook the first proteomic evaluation of RAGE-dependent processes in alveolar epithelial cells. The alveolar epithelium is a primary target during acute lung injury, and our data support a role for RAGE in gene transcription, protein transport, and response to stimuli. More over our data suggest that RAGE is a critical driver of redox regulation in the alveolar epithelium. The conclusions of the present work assist to unravel the molecular events that underlie the function of RAGE in alveolar epithelial cells and have

  18. PERFORATION OF INFERIOR ALVEOLAR NERVE BY MAXILLARY ARTERY. LA PERFORACION DEL NERVIO ALVEOLAR INFERIOR POR LA ARTERIA MAXILAR

    OpenAIRE

    Vanishree S Nayak; Ramachandra Bhat K; Prakash Billakanti Babu

    2011-01-01

    Infratemporal fossa is clinically important anatomical area for the delivery of local anesthetic agents in dentistry and maxillofacial surgery. Variations in the anatomy of the inferior alveolar nerve and maxillary artery were studied in infratemporal dissection. During routine dissection of the head in an adult male cadaver an unusual variation in the origin of the inferior alveolar nerve and its relationship with the surrounding structures was observed. The inferior alveolar nerve originate...

  19. Segment distraction to reduce a wide alveolar cleft before alveolar bone grafting.

    NARCIS (Netherlands)

    Binger, T.; Katsaros, C.; Rucker, M.; Spitzer, W.J.

    2003-01-01

    OBJECTIVE: To demonstrate a method for reduction of wide alveolar clefts prior to bone grafting. This method aims to facilitate bone grafting and achieve adequate soft tissue coverage of the graft with attached gingiva. CASE REPORT: Treatment of a patient with bilateral cleft lip and palate with a

  20. Alveolar soft part sarcoma: A rare diagnosis

    Directory of Open Access Journals (Sweden)

    Priyanka Sarkar

    2013-01-01

    Full Text Available Alveolar soft-part sarcoma (ASPS is an extremely rare disease arising from connective tissues with a propensity for recurrence and metastasis. Clinically, it can be confused with hemangioma or arterio-venous malformations. Thus, a high index of suspicion and histopathological examination are required to make a definitive diagnosis. We report a case of recurrent ASPS in a young female with multiple sites involvement without any features of metastasis who has been treated with excision of the symptomatic lesions followed by chemotherapy.

  1. Post-extraction application of beta-tricalcium phosphate in alveolar socket

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Corcuera

    2015-03-01

    Full Text Available Aim The objective of this study was to assess the capacity of beta-tricalcium phosphate to facilitate bone formation in the socket and prevent post-extraction alveolar resorption. Materials and methods After premolar extraction in 16 patients, the sockets were filled with beta-tricalcium phosphate. Six months later, during the implant placement surgery, a trephine was used to harvest the bone samples which were processed for histological and histomorphometrical analyses. Data were gathered on patient, clinical, histological and histomorphometric variables at the extraction and implant placement sessions, using data collection forms and pathological reports. Results Clinical outcomes were satisfactory, the biomaterial was radio-opaque on X-ray. Histological study showed: partial filling with alveolar bone of appropriate maturation and mineralization for the healing time, osteoblastic activity and bone lacunae containing osteocytes. The biomaterial was not completely resorbed at six months. Conclusion Beta-tricalcium phosphate is a material capable of achieving preservation of the alveolar bone when it is positioned in the immediate post-extraction socket followed by suture; it also helps the formation of new bone in the socket. Further studies are needed comparing this technique with other available biomaterials, with growth factors and with sites where no alveolar preservation techniques are performed.

  2. 3D computed tomographic evaluation of secondary alveolar bone grafts in cleft lip and palate patients

    International Nuclear Information System (INIS)

    Ohkubo, Fumio; Akai, Hidemi; Hosaka, Yoshiaki

    2001-01-01

    Alveolar bone grafting in patients with cleft lip and palate has becomes a routine part of most treatment regimes. This study was undertaken to estimate how much bone needs to be grafted into the cleft cavity and to evaluate the grafted bone using 3-DCT over a period from the early postoperative stage to after one year. Seventy-five patients divided into four groups according to the type of cleft were studied. All patients underwent secondary alveolar bone grafting using particulate cancellous bone from the anterior iliac crest. The bone graft areas were divided into two regions: the extra-cleft region and the intra-cleft region. The weight and the volume of the grafted bone were correlated and the average density was 1.5 g/ml regardless of the cleft type. The bone in the extra-cleft region could be seen in almost all slices of the CT scans, from the lower alveolar process to the piriform aperture. The extra-cleft graft ratio of unilateral and bilateral cleft lip and palate is higher than that of cleft lip and alveolus. The extra-cleft grafting is necessary to restore facial symmetry. The grafted bone was decreased in both height and volume following three months and adequate bone bridging was maintained for one year. We concluded that 3-DCT findings are one of the most valuable methods to evaluate postoperative conditions after alveolar bone grafting. (author)

  3. 3D computed tomographic evaluation of secondary alveolar bone grafts in cleft lip and palate patients

    Energy Technology Data Exchange (ETDEWEB)

    Ohkubo, Fumio; Akai, Hidemi; Hosaka, Yoshiaki [Showa Univ., Tokyo (Japan). School of Medicine

    2001-04-01

    Alveolar bone grafting in patients with cleft lip and palate has becomes a routine part of most treatment regimes. This study was undertaken to estimate how much bone needs to be grafted into the cleft cavity and to evaluate the grafted bone using 3-DCT over a period from the early postoperative stage to after one year. Seventy-five patients divided into four groups according to the type of cleft were studied. All patients underwent secondary alveolar bone grafting using particulate cancellous bone from the anterior iliac crest. The bone graft areas were divided into two regions: the extra-cleft region and the intra-cleft region. The weight and the volume of the grafted bone were correlated and the average density was 1.5 g/ml regardless of the cleft type. The bone in the extra-cleft region could be seen in almost all slices of the CT scans, from the lower alveolar process to the piriform aperture. The extra-cleft graft ratio of unilateral and bilateral cleft lip and palate is higher than that of cleft lip and alveolus. The extra-cleft grafting is necessary to restore facial symmetry. The grafted bone was decreased in both height and volume following three months and adequate bone bridging was maintained for one year. We concluded that 3-DCT findings are one of the most valuable methods to evaluate postoperative conditions after alveolar bone grafting. (author)

  4. Endogenous opioids regulate alveolar bone loss in a periodontal disease model.

    Science.gov (United States)

    Queiroz-Junior, Celso M; Maltos, Kátia L M; Pacheco, Daniela F; Silva, Tarcília Aparecida; Albergaria, Juliano D S; Pacheco, Cinthia M F

    2013-10-06

    The anti-inflammatory effects of exogenous opioid compounds have been demonstrated in several conditions. Nevertheless, the function of endogenous opioid peptides released by the host during inflammatory processes deserves further characterization. The aim of this study was to verify whether endogenous opioids are involved in the progression of the inflammatory alveolar bone loss induced by ligature in rats. The experimental model of periodontal disease (PD) induced by ligature in rats was used throughout the study. A silk ligature was placed around the 2nd upper molar of male Holtzman rats, for 7 days. Rats received different doses of either the non-selective opioid antagonist naloxone or vehicle, locally into the afflicted gingival tissue, from the 3rd to the 5th day after ligature placement. In the 7th experimental day, rats were euthanized and their maxillae were collected for evaluation of alveolar bone and fiber attachment loss, presence of neutrophils (myeloperoxidase assay), osteoclast amount, and levels of cytokines IL-6, TNF-α, IL-8 and IL-10 in periodontal tissues. Naloxone increased alveolar bone loss significantly, in a dose-dependent manner, in relation to vehicle-treated rats. In contrast, the opioid antagonist did not affect the loss of fiber attachment. The treatment with naloxone also induced a significant increase in myeloperoxidase levels, osteoclast number and cytokines in periodontal tissues of rats with ligature-induced PD. Endogenous opioids protect the host from the progression of inflammatory alveolar bone loss that occurs in chronic periodontitis. © 2013.

  5. Complementary roles of KCa3.1 channels and β1-integrin during alveolar epithelial repair.

    Science.gov (United States)

    Girault, Alban; Chebli, Jasmine; Privé, Anik; Trinh, Nguyen Thu Ngan; Maillé, Emilie; Grygorczyk, Ryszard; Brochiero, Emmanuelle

    2015-09-04

    Extensive alveolar epithelial injury and remodelling is a common feature of acute lung injury and acute respiratory distress syndrome (ARDS) and it has been established that epithelial regeneration, and secondary lung oedema resorption, is crucial for ARDS resolution. Much evidence indicates that K(+) channels are regulating epithelial repair processes; however, involvement of the KCa3.1 channels in alveolar repair has never been investigated before. Wound-healing assays demonstrated that the repair rates were increased in primary rat alveolar cell monolayers grown on a fibronectin matrix compared to non-coated supports, whereas an anti-β1-integrin antibody reduced it. KCa3.1 inhibition/silencing impaired the fibronectin-stimulated wound-healing rates, as well as cell migration and proliferation, but had no effect in the absence of coating. We then evaluated a putative relationship between KCa3.1 channel and the migratory machinery protein β1-integrin, which is activated by fibronectin. Co-immunoprecipitation and immunofluorescence experiments indicated a link between the two proteins and revealed their cellular co-distribution. In addition, we demonstrated that KCa3.1 channel and β1-integrin membrane expressions were increased on a fibronectin matrix. We also showed increased intracellular calcium concentrations as well as enhanced expression of TRPC4, a voltage-independent calcium channel belonging to the large TRP channel family, on a fibronectin matrix. Finally, wound-healing assays showed additive effects of KCa3.1 and TRPC4 inhibitors on alveolar epithelial repair. Taken together, our data demonstrate for the first time complementary roles of KCa3.1 and TRPC4 channels with extracellular matrix and β1-integrin in the regulation of alveolar repair processes.

  6. Alveolar bone loss in obese subjects.

    Science.gov (United States)

    Alabdulkarim, Maher; Bissada, Nabil; Al-Zahrani, Mohammad; Ficara, Anthony; Siegel, Burton

    2005-04-01

    Obesity was found to be significantly associated with periodontal disease prevalence as measured by probing depth and clinical attachment loss. The aim of this study was to examine if obesity correlates with chronic periodontitis as diagnosed by radiographic alveolar bone loss. Four hundred subjects > or =18 years old were included; 200 with body mass index (BMI) > or =30 kg/m2 (obese) and 200 with BMI periodontitis. Obesity was found to be significantly associated with periodontitis in the uni-variate regression analysis (OR = 2.37, 95% CI, 1.55-3.63). After adjusting for age, gender, smoking, employment, diabetes, marital status, and number of teeth present, obese subjects were found to be 1.86 times more likely to have periodontitis (95% CI, 0.99-3.51) than non-obese ones. When the sample was stratified based on age, the multivariate association was statistically significant among individuals or = 40 years of age the association was statistically insignificant (OR = 1.06, 95% CI, 0.57-1.95). Stratifying the sample based on gender and smoking status revealed a stronger association among females than males (OR = 3.14 vs. 1.95) and among non-smokers than smokers (OR = 3.36 vs. 2.22). Obesity is associated with increased prevalence of periodontitis as measured by radiographic alveolar bone loss, especially among younger individuals. Prevention and management of obesity may be considered to promote better systemic and periodontal health.

  7. Prevention of Alveolar Osteitis After Third Molar Surgery ...

    African Journals Online (AJOL)

    2017-05-16

    May 16, 2017 ... development of alveolar osteitis were obtained and analyzed. Comparative statistics were done using ... KEY WORDS: Alveolar osteitis, chlorhexidine, prevention, warm saline. Department of Dental. Surgery .... healing by inducing vasodilatation of the vasculature of oral cavity, and thus enhances migration ...

  8. Increased alveolar soluble Annexin V promotes lung inflammation and fibrosis

    OpenAIRE

    Buckley, S.; Shi, W.; Xu, W.; Frey, M.R.; Moats, R.; Pardo, A.; Selman, M.; Warburton, D.

    2015-01-01

    The causes underlying the self-perpetuating nature of idiopathic pulmonary fibrosis (IPF), a progressive and usually lethal disease, remain unknown. We hypothesized that alveolar soluble Annexin V contributes to lung fibrosis, based on the observation that human IPF BALF containing high Annexin V levels promoted fibroblast involvement in alveolar epithelial wound healing that was reduced when Annexin V was depleted from the BALF.

  9. Tongue-Palate Contact of Perceptually Acceptable Alveolar Stops

    Science.gov (United States)

    Lee, Alice; Gibbon, Fiona E.; O'Donovan, Cliona

    2013-01-01

    Increased tongue-palate contact for perceptually acceptable alveolar stops has been observed in children with speech sound disorders (SSD). This is a retrospective study that further investigated this issue by using quantitative measures to compare the target alveolar stops /t/, /d/ and /n/ produced in words by nine children with SSD (20 tokens of…

  10. Classification of alveolar bone destruction patterns on maxillary ...

    African Journals Online (AJOL)

    Objective: The defective diagnosis of alveolar structures is one of most serious handicaps when assessing available periodontal treatment options for the prevention of tooth loss. The aim of this research was to classify alveolar bone defects in the maxillary molar region which is a challenging area for dental implant ...

  11. Pulmonary alveolar proteinosis in a child from an informal settlement

    African Journals Online (AJOL)

    clinical, histopathological, biochemical and genetic data.[3]. Surfactant homeostasis is critical for lung function and is tightly regulated, in part by pulmonary granulocyte-macrophage colony- stimulating factor (GM-CSF), which is required for surfactant clearance by alveolar macrophages and alveolar macrophage maturation.

  12. Diffuse alveolar hemorrhage in a young woman with systemic lupus ...

    African Journals Online (AJOL)

    Diffuse Alveolar Hemorrhage (DAH) is rarely reported complication of Systemic Lupus Erythematosus (SLE). A young woman diagnosed SLE, with a previously normal plain chest radiograph, developed acute onset cough, dyspnoea and hemoptysis. The repeat urgent chest radiograph revealed alveolar opacities. The triad ...

  13. Contemporary Approaches in the Repair of Alveolar Clefts

    Directory of Open Access Journals (Sweden)

    Ufuk Tatli

    2014-08-01

    Full Text Available Cleft lip and palate is one of the most common craniofacial anomalies. The repair of the alveolar clefts is an important part of the treatment for patients with cleft lip and palate. The treatment concepts of alveolar bone grafting are still controversial. The corresponding controversial issues are; timing of alveolar bone grafting, graft materials, and timing of the orthodontic expansion. In the present article, aforementioned controversial issues and contemporary treatment modalities of the maxillary alveolar clefts were reviewed in the light of current literature. In conclusion, the most suitable time for alveolar bone grafting is mixed dentition period. Grafting procedure may be performed in the early or late phases of this period depending on some clinical features. Adjunct orthodontic expansion procedures should be performed before and/or after grafting depending on the patient's current features. [Archives Medical Review Journal 2014; 23(4.000: 563-574

  14. Modeling of Trabecular Bone and Lamina Dura Following Selective Alveolar Decortication in Rats

    Science.gov (United States)

    Sebaoun, Jean-David; Kantarci, Alpdogan; Turner, John W.; Carvalho, Roberto S.; Van Dyke, Thomas E.; Ferguson, Donald J.

    2008-01-01

    Background: Modifying the balance between resorption and apposition through selectively injuring the cortical plate of the alveolus has been an approach to speed tooth movement and is referred to as periodontally accelerated osteogenic orthodontics. The aim of this study was to investigate the alveolar response to corticotomy as a function of time and proximity to the surgical injury in a rat model. Methods: Maxillary buccal and lingual cortical plates were injured in 36 healthy adult rats adjacent to the upper left first molars. Twenty-four animals were euthanized at 3, 7, or 11 weeks. In one group, the maxillae were removed and stripped of soft tissues, and histomorphometric analysis was performed to study alveolar spongiosa and periodontal ligament (PDL) modeling dynamics. Catabolic activity was analyzed with tartrate-resistant acid phosphatase–positive osteoclasts and preosteoclasts. Anabolic actions were measured using a fluorescent vital bone stain series followed by sacrifice at 30 and 51 days. To further analyze the new bone formation, a separate group of animals were fed with calcein fluorescent stain and processed for non-decalcified fluorescent stain histology. Results: At 3 weeks, the surgery group had significantly (P <0.05) less calcified spongiosa bone surface, greater periodontal ligament surface, higher osteoclast number, and greater lamina dura apposition width. The catabolic activity (osteoclast count) and anabolic activity (apposition rate) were three-fold greater, calcified spongiosa decreased by two-fold, and PDL surface increased by two-fold. Surgical injury to the alveolus that induced a significant increase in tissue turnover by week 3 dissipated to a steady state by postoperative week 11. The impact of the injury was localized to the area immediately adjacent to the decortication injury. Conclusion: Selective alveolar decortication induced increased turnover of alveolar spongiosa, and the activity was localized; dramatic escalation of

  15. Distribution of BMP6 in the alveolar bone during mouse mandibular molar eruption.

    Science.gov (United States)

    Oralová, Veronika; Chlastáková, Ivana; Radlanski, Ralf Johannes; Matalová, Eva

    2014-01-01

    Eruption requires synchrony of the tooth with the surrounding tissues, particularly the bone. One important step during eruption is remodelling of the alveolar bone at the base of the tooth and along the roots. Expression of BMP6 was reported to be increased in the basal half of the dental follicle prior to eruption and inhibition of BMP6 affected bone formation at the base of the alveolar crypt. The aim of this study was to further investigate BMP6 protein in relation to tooth eruption and the corresponding bone remodelling using temporospatial correlations of BMP6 localization with morphogenetic events (proliferation, differentiation, apoptosis and bone apposition/resorption), other BMPs (BMP2 and BMP7) and three-dimensional images of tooth-bone development. BMP6 expression pattern was mapped in the mandibular molar teeth and related structures around eruption. Localization of BMP6 dominated in osteoblasts, in regions of bone formation within the alveolar crypt. These findings positively correlated with proliferation at the tooth base region, osteocalcin expression in the osteoblasts/osteocytes and BMP2 and BMP7 presence in the alveolar bone surrounding the tooth. Osteoclast activity and apoptotic elimination in the root region gradually decreased before eruption and totally ceased at eruption stages. Generally, BMP6 positively correlated with BMP2, BMP7 and osteocalcin-positive osteoblasts, and areas of bone remodelling. Moreover, BMP6 was found in the periodontium and cementoblasts. BMP6 expression in the alveolar bone accompanied tooth eruption. Notably, the expression pattern of BMP6 in the bone did not differ around individual molar teeth at the same stage of development. The expression of BMP6 in periodontal ligaments may contribute to interaction between the tooth and bone during the eruption and anchoring process.

  16. P2X7R-dependent regulation of glycogen synthase kinase 3β and claudin-18 in alveolar epithelial type I cells of mice lung.

    Science.gov (United States)

    Barth, K; Bläsche, R; Neißer, A; Bramke, S; Frank, J A; Kasper, M

    2016-12-01

    The purinergic receptor P2X7 represents an ATP-gated ionotropic receptor with a selective localization in alveolar epithelial type I cells of the lung. Despite the involvement of the receptor in inflammatory processes of the lung, it is not established whether this receptor plays a specific role in the alveolar epithelial cell biology. There is evidence that P2X7 receptor influences Wnt/β-catenin signalling pathways in alveolar epithelial cells under conditions of injury. Here, we investigated the expression of GSK-3β, a potent protein kinase involved in alveolar epithelial barrier functions, and of tight junction molecules occludin, claudin-4 and claudin-18 in wild-type and P2X7 -/- mice. Western blot analysis, immunohistochemistry and quantitative real-time RT-PCR revealed a remarkable increase in claudin-18 mRNA and protein in lungs of P2X7 -/- mice animals. Furthermore, alveolar epithelial cells from P2X7 -/- animals showed decreased levels of GSK-3β protein and its inactive form GSK-3β (pS9). Conversely, claudin-18 knockout mice exhibited decreased P2X7 mRNA transcript abundance as measured by mRNA expression microarray and quantitative PCR. Our data are consistent with the hypothesis that P2X7R contributes to alveolar epithelial barrier function through effects on GSK-3β. Furthermore, these data suggest a potential reciprocal regulation of claudin-18 and P2X7R in the alveolar epithelium.

  17. Ontogeny of pulmonary alveolar epithelial markers of differentiation.

    Science.gov (United States)

    Joyce-Brady, M F; Brody, J S

    1990-02-01

    We studied differentiation of the pulmonary epithelium in the periphery of fetal rat lung in vivo and in vitro by comparing the ontogeny of cell-surface glycoconjugates with that of surfactant phospholipids. Apical surface binding of the lectin Maclura pomifera agglutinin (MPA) and expression of a 200-kDa MPA-binding glycoprotein (MPA-gp200) was evident at 20 days gestation in type 2 cells, but did not correlate with ultrastructural features of type 2 cell differentiation. Epithelial cells isolated from peripheral lung of 18-day gestation fetal rats displayed hormone-sensitive surfactant synthesis prior to the hormone-insensitive expression of MPA-gp200. Expression of MPA-gp200 occurred in association with the appearance of many new apical surface proteins suggesting a hormone-independent process of polar membrane differentiation. Thus membrane and secretory differentiation are discordant and can be dissociated. In vivo binding of Ricinus communis 1 agglutinin (RCA1), an apical marker of the differentiated alveolar type 1 cell occurred in undifferentiated peripheral lung epithelial cells as early as 18 days gestation, disappeared from differentiating type 2 cells and appeared in differentiated type 1 cells. Both undifferentiated fetal epithelial cells at 18 days gestation and fully differentiated type 1 cells express multiple glycoproteins with terminal beta-linked galactose residues which bind RCA1. Some of these RCA1-binding glycoproteins appear to be similar. These observations suggest that alveolar epithelial type 1 cells may derive directly from undifferentiated peripheral lung epithelial cells as well as from fully differentiated type 2 cells. In addition, terminal differentiation of fetal lung peripheral epithelium into type 1 and type 2 cells may involve repression as well as induction of differentiation-related genes.

  18. PERFORATION OF INFERIOR ALVEOLAR NERVE BY MAXILLARY ARTERY. Perforation of inferior alveolar nerve by maxillary artery

    OpenAIRE

    Prakash B Billakanti

    2016-01-01

    La fosa infratemporal es un área anatómica clínicamente importante para la administración de agentes anestésicos locales en odontología y cirugía maxilofacial. Fueron estudiadas variaciones en la anatomía del nervio alveolar inferior y la arteria maxilar en la disección infratemporal. Durante la disección rutinaria de la cabeza en el cadáver de un varón adulto, fue observada una variación excepcional en el origen del nervio alveolar inferior y su relación con las estructuras circundantes. El ...

  19. Proteomic Analysis of Gingival Tissue and Alveolar Bone during Alveolar Bone Healing*

    OpenAIRE

    Yang, Hee-Young; Kwon, Joseph; Kook, Min-Suk; Kang, Seong Soo; Kim, Se Eun; Sohn, Sungoh; Jung, Seunggon; Kwon, Sang-Oh; Kim, Hyung-Seok; Lee, Jae Hyuk; Lee, Tae-Hoon

    2013-01-01

    Bone tissue regeneration is orchestrated by the surrounding supporting tissues and involves the build-up of osteogenic cells, which orchestrate remodeling/healing through the expression of numerous mediators and signaling molecules. Periodontal regeneration models have proven useful for studying the interaction and communication between alveolar bone and supporting soft tissue. We applied a quantitative proteomic approach to analyze and compare proteins with altered expression in gingival sof...

  20. Hemorragia alveolar associada a nefrite lúpica Alveolar hemorrhage associated with lupus nephritis

    Directory of Open Access Journals (Sweden)

    Ricardo Henrique de Oliveira Braga Teixeira

    2003-12-01

    Full Text Available Hemorragia alveolar, como causa de insuficiência respiratória, é pouco freqüente, com diversas etiologias possíveis. Entre elas, o lúpus eritematoso sistêmico, que se apresenta geralmente como síndrome pulmão-rim, possui alta morbimortalidade. Acredita-se que a patogênese da microangiopatia, tanto renal como pulmonar, esteja associada ao depósito de imunocomplexos, que ativariam as vias de apoptose celular. Relatam-se dois casos de pacientes com nefrite lúpica que evoluíram com hemorragia alveolar associada à insuficiência respiratória necessitando de ventilação mecânica com evoluções totalmente distintas frente às terapias farmacológicas. O achado de anticorpos antimembrana basal em um dos casos evidencia a multiplicidade de mecanismos fisiopatológicos possivelmente envolvidos, que poderiam justificar as respostas heterogêneas frente aos tratamentos disponíveis.Alveolar hemorrhage leading to respiratory failure is uncommon. Various etiologies have been reported, including systemic lupus erythematosus, which generally presents as pulmonary-renal syndrome. It is believed that the pathogenesis of microangiopathy is related to deposits of immune complexes that lead to activation of cellular apoptosis. The authors report two cases of alveolar hemorrhage and respiratory failure, both requiring mechanical ventilation. The two cases had opposite outcomes after pharmacological therapy. The presence of anti-glomerular basement membrane antibodies in one of the cases demonstrates the multiplicity of physiopathological mechanisms that may be involved. This multiplicity of mechanisms provides a possible explanation for the heterogeneous responses to the available treatments.

  1. [Massive alveolar haemorrhage in Wegener's granulomatosis].

    Science.gov (United States)

    Valero-Roldán, J; Nuñez-Castillo, D; Fernández-Fígares, C; López-Leiva, I

    2014-01-01

    Wegener's granulomatosis is a systemic vasculitis with involvement of primary granulomatous upper and lower respiratory tract, glomerulonephritis and vasculitis of small vessels. The lung disease ranges from asymptomatic pulmonary nodules to pulmonary infiltrates and fulminant alveolar haemorrhage. The prognosis is poor due to kidney and respiratory failure, although the data are changing due to new treatments with glucocorticoids and cyclophosphamide. We report a case with severe lung disease, which after appropriate anamnesis, multiple tests, and optimal sequential action, the patient was diagnosed with Wegener's granulomatosis. This disease has a low incidence in the Emergency Department, where the patient history supported by the appropriate additional provides a diagnostic suspicion. It is important that the Emergency Department has the skills to manage the stability in these patients in order to resolve their symptoms. Copyright © 2013 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

  2. The influence of topic and systemic administration of copaiba oil on the alveolar wound healing after tooth extraction in rats.

    Science.gov (United States)

    Dias-da-Silva, Marco A; Pereira, Andresa C; Marin, Miguel Cc; Salgado, Miguel Ac

    2013-10-01

    The Copaiba oil has been used as an auxiliary treatment of inflammations, skin disorders and stomach ulcers, however, in dentistry, this "alternative" medicine has not been investigated yet. The purpose of this study was to evaluate the influence of topic and systemic administration of copaiba oil on the alveolar wound healing after tooth extraction. Twenty-eight wistar male rats had their lower first molar teeth extracted. Subsequently, they were divided in four groups, according to the treatment performed: (a) alveolar socket irrigation with copaiba oil; (b) alveolar socket irrigation with physiological serum; (c) daily gavage with copaiba oil or (d) daily gavage with physiological serum. After the sacrifice, the mandibles were removed and processed in order to obtain decalcified histological sections. The results demonstrated high level of epithelial migration, small number of inflammatory cells and vascular enhancement in the animals which received systemic administration of copaiba oil. The rats treated with topic administration of copaiba oil presented ulcerations and large number of inflammatory cells. An increased bone neoformation was observed in both groups treated with copaiba oil when compared with placebo group. It could be concluded that topic or systemic administration of copaiba oil leads to a better alveolar bone healing, however the topic application on connective tissue should be carefully considered, regarding the whole socket wound healing. Key words:Alveolar wound healing, oil-resin, copaiba.

  3. Accelerated orthodontics with alveolar decortication and augmentation: a case report.

    Science.gov (United States)

    Yezdani, A Arif

    2012-01-01

    This case report reiterates the fact that selective alveolar decortication in conjunction with periodontal alveolar augmentation with a bone graft indubitably and efficaciously produces rapid orthodontic tooth movement. A 29-year-old woman presented with a Class I malocclusion and increased bidentoalveolar protrusion with increased spacing between the maxillary and mandibular incisors. She readily agreed to selective alveolar decortication in conjunction with periodontal alveolar augmentation with a bone graft when presented with the proposal that her malocclusion could be corrected in one-third the treatment time required for conventional orthodontics. A preadjusted edgewise appliance (Roth prescription, 0.022 x 0.028-inch slot) was placed prior to the surgical procedure. One week later, full-thickness labial and lingual flaps were reflected in the maxillary and mandibular arches. The alveolar bone was selectively decorticated and periodontally augmented with a bone graft. Starting 1 week postsurgically, orthodontic adjustments were carried out every 2 weeks. From bracketing to debracketing, the entire orthodontic treatment took 7 months. The rapid orthodontic tooth movement was attributed to the regional acceleratory phenomenon, triggered by selective alveolar decortication. The subsequent periodontal alveolar augmentation with the bone graft repaired the bony dehiscences and enhanced the bone volume and dramatically improved the patient's soft tissue profile.

  4. Assessment of the effectiveness of low level laser in the treatment of alveolar osteitis

    Directory of Open Access Journals (Sweden)

    Jovanović Goran

    2011-01-01

    Full Text Available Background/Aim. Alveolar osteitis (AO is the extraction wound healing disorder with a presence of severe pain. Low level laser therapy stimulates cell metabolism and microcirculation, have has pronounced analgesic, antiedematous and anti-inflammatory effect and speeds up wound healing process. The aim of this study was to present results of clinical research that examined the effectiveness of low level laser in pain relief and healing of extraction wounds with alveolar osteitis in the lower jaw which was formed on the second day after tooth extraction. Methods. The study was conducted on 60 subjects divided into the study and the control group. In both groups extraction wounds were processed in similar way, except that in the study group was applied daily treatment of low level laser with a total of eight sessions of radiation, while in the control group extraction wounds were dressed with zinc oxide eugenol paste, which was changed every 48 hours up to the pain cessation. Measurement of pain intensity was done with a visual analogue scale (VAS 10 min prior to processing of extraction wounds and daily for the next eight days. Assessment of the effectiveness of low level laser on healing of extraction wounds was performed on the day eight of the treatment. Results. On the day five after beginning of the treatment of extraction wounds with alveolar osteitis in the patients of the study group a lower average value of pain as compared to the control group was registered. This difference was increased within the following days. Extraction wounds healing in the study group was more successful and faster than in the control group. Conclusion. This study suggested that the reduction of pain was more pronounced in the patients with alveolar osteitis whose extraction wounds were subjected to low level laser radiation in comparison to those in which extraction wounds were treated with zinc oxide eugenol paste.

  5. Alveolar cleft closure with iliac bone graft: A case report.

    Directory of Open Access Journals (Sweden)

    Tichvy Tammama

    2017-04-01

    Conclusion: The timing of alveolar bone grafting usually associated with the state of the developing of dentition. Post operative management is important to get a good result, and to prevent any complications.

  6. Radionuclide study of the action of cadmium on alveolar macrophages

    International Nuclear Information System (INIS)

    Reulet, Maryse.

    1976-01-01

    The experimental toxicity of cadmium was studied on the lung, using cadmium sulfate, cadmium acetate and the radioactive isotope cadmium 109 in chloride or acetate form. The results are given in the following order: part one is devoted to the results of investigations on chronic cadmium poisoning and the role of alveolar macrophages in this poisoning; in part two the uptake of cadmium on alveolar macrophages is studied with cadmium 109, administered intraperitoneally; in part three the action of cadmium on the phospholipid metabolism of alveolar macrophages is examined. The cadmium, as sulfate or acetate, is administered in several ways: by intraperitoneal injection; or by inhalation of cadmium dusts or aerosols. The effect of cadmium on the oxidative metabolism of alveolar macrophages is studied in part four. This work is carried out 'in vitro' and 'in vivo' after cadmium oxide dusting of the air [fr

  7. Horizontal alveolar bone loss: A periodontal orphan

    Directory of Open Access Journals (Sweden)

    Jayakumar A

    2010-01-01

    Full Text Available Background: Attempts to successfully regenerate lost alveolar bone have always been a clinician′s dream. Angular defects, at least, have a fairer chance, but the same cannot be said about horizontal bone loss. The purpose of the present study was to evaluate the prevalence of horizontal alveolar bone loss and vertical bone defects in periodontal patients; and later, to correlate it with the treatment modalities available in the literature for horizontal and vertical bone defects. Materials and Methods: The study was conducted in two parts. Part I was the radiographic evaluation of 150 orthopantomographs (OPGs (of patients diagnosed with chronic periodontitis and seeking periodontal care, which were digitized and read using the AutoCAD 2006 software. All the periodontitis-affected teeth were categorized as teeth with vertical defects (if the defect angle was ≤45° and defect depth was ≥3 mm or as having horizontal bone loss. Part II of the study comprised search of the literature on treatment modalities for horizontal and vertical bone loss in four selected periodontal journals. Results: Out of the 150 OPGs studied, 54 (36% OPGs showed one or more vertical defects. Totally, 3,371 teeth were studied, out of which horizontal bone loss was found in 3,107 (92.2% teeth, and vertical defects were found only in 264 (7.8% of the teeth, which was statistically significant (P<.001. Search of the selected journals revealed 477 papers have addressed the treatment modalities for vertical and horizontal types of bone loss specifically. Out of the 477 papers, 461 (96.3% have addressed vertical bone loss, and 18 (3.7% have addressed treatment options for horizontal bone loss. Two papers have addressed both types of bone loss and are included in both categories. Conclusion: Horizontal bone loss is more prevalent than vertical bone loss but has been sidelined by researchers as very few papers have been published on the subject of regenerative treatment

  8. Alveolar lymphangioma in infants: report of two cases.

    LENUS (Irish Health Repository)

    FitzGerald, Kirsten

    2012-02-01

    The alveolar lymphangioma is a benign but relatively rare condition found only in the oral cavities of black infants. Dentists practising in Ireland may be unaware of this condition due to its racial specificity. This paper presents two case reports of multiple alveolar lymphangiomas found in black infants in a children\\'s hospital in Ireland. The epidemiology, aetiology, clinical presentation, histology, and management options are discussed. The photographs should aid the practitioner in recognising these lesions.

  9. Dynamic thermal performance of alveolar brick construction system

    International Nuclear Information System (INIS)

    Gracia, A. de; Castell, A.; Medrano, M.; Cabeza, L.F.

    2011-01-01

    Highlights: → Even though U-value does not measure thermal inertia, it is the commonly used parameter. → The thermal performance analysis of buildings must include the evaluation of transient parameters. → Transient parameters of alveolar brick constructive system show good agreement with its low energy consumption. -- Abstract: Alveolar bricks are being introduced in building sector due to the simplicity of their construction system and to the elimination of the insulation material. Nevertheless, it is not clear if this new system is energetically efficient and which is its thermal behaviour. This paper presents an experimental and theoretical study to evaluate the thermal behaviour of the alveolar brick construction system, compared with a traditional Mediterranean brick system with insulation. The experimental study consists of measuring the thermal performance of four real house-like cubicles. The thermal transmittance in steady-state, also known as U-value, is calculated theoretically and experimentally for each cubicle, presenting the insulated cubicles as the best construction system, with differences around 45% in comparison to the alveolar one. On the other hand, experimental results show significantly smaller differences on the energy consumption between the alveolar and insulated construction systems during summer period (around 13% higher for the alveolar cubicle). These values demonstrate the high thermal efficiency of the alveolar system. In addition, the lack of agreement between the measured energy consumption and the calculated U-values, guides the authors to analyze the thermal inertia of the different building components. Therefore, several transient parameters, extracted from the heat transfer matrix and from experimental data, are also evaluated. It can be concluded that the alveolar brick construction system presents higher thermal inertia than the insulated one, justifying the low measured energy consumption.

  10. Alveolar lymphangioma in infants: report of two cases.

    LENUS (Irish Health Repository)

    FitzGerald, Kirsten

    2009-06-01

    The alveolar lymphangioma is a benign but relatively rare condition found only in the oral cavities of black infants. Dentists practising in Ireland may be unaware of this condition due to its racial specificity. This paper presents two case reports of multiple alveolar lymphangiomas found in black infants in a children\\'s hospital in Ireland. The epidemiology, aetiology, clinical presentation, histology, and management options are discussed. The photographs should aid the practitioner in recognising these lesions.

  11. Surgical techniques for alveolar socket preservation: a systematic review.

    Science.gov (United States)

    Vittorini Orgeas, Gianluca; Clementini, Marco; De Risi, Valeria; de Sanctis, Massimo

    2013-01-01

    To evaluate, through a systematic review of the literature, the efficacy of different surgical techniques in maintaining residual bone in the alveolar process following tooth extractions. MEDLINE/PubMed was searched through January 2010 and papers were selected according to the CONSORT statement and an independent three-stage screening process. The selected outcome variables were clinical width and height changes of the socket, and means and standard deviations were calculated from the included studies. For those studies that were randomized controlled trials, six meta-analyses were performed by dividing studies into three groups with regard to the use of barriers and grafting (barriers alone, graft alone, or both). Thirteen papers met the eligibility criteria and were included in the analyses. Statistically significant ridge preservation was found for studies that used barriers alone; the pooled weighted mean was 0.909 mm (95% confidence interval, 0.497554 to 1.320732 mm) for bone height, while the mean for bone width was 2.966 mm (95% confidence interval, 2.334770 to 3.598300 mm). Socket preservation procedures are effective in limiting horizontal and vertical ridge alterations in postextraction sites. The meta-analysis indicates that the use of barrier membranes alone might improve normal wound healing in extraction sites.

  12. [Fatal alveolar haemorrhage following a "bang" of cannabis].

    Science.gov (United States)

    Grassin, F; André, M; Rallec, B; Combes, E; Vinsonneau, U; Paleiron, N

    2011-09-01

    The new methods of cannabis consumption (home made water pipe or "bang") may be responsible for fatal respiratory complications. We present a case, with fatal outcome, of a man of 19 years with no previous history other than an addiction to cannabis using "bang". He was admitted to intensive care with acute dyspnoea. A CT scan showed bilateral, diffuse alveolar shadowing. He was anaemic with an Hb of 9.3g/l. Bronchoalveolar lavage revealed massive alveolar haemorrhage. Investigations for infection and immunological disorder were negative and toxicology was negative except for cannabis. Antibiotic treatment was given and favourable progress allowed early discharge. Death occurred 15 days later due to alveolar haemorrhage following a further "bang" of cannabis. Autopsy showed toxic alveolar haemorrhage. The probable mechanism is pulmonary damage due to acid anhydrides released by the incomplete combustion of cannabis in contact with plastic. These acids have a double effect on the lungs: a direct toxicity with severe inflammation of the mucosa leading to alveolar haemorrhage and subsequently the acid anhydrides may lead to the syndrome of intra-alveolar haemorrhage and anaemia described in occupational lung diseases by Herbert in Oxford in 1979. It manifests itself by haemoptysis and intravascular haemolysis. We draw attention to the extremely serious potential consequences of new methods of using cannabis, particularly the use of "bang" in homemade plastic materials. Copyright © 2011 SPLF. Published by Elsevier Masson SAS. All rights reserved.

  13. Lung fibroblasts accelerate wound closure in human alveolar epithelial cells through hepatocyte growth factor/c-Met signaling.

    Science.gov (United States)

    Ito, Yoko; Correll, Kelly; Schiel, John A; Finigan, Jay H; Prekeris, Rytis; Mason, Robert J

    2014-07-01

    There are 190,600 cases of acute lung injury/acute respiratory distress syndrome (ALI/ARDS) each year in the United States, and the incidence and mortality of ALI/ARDS increase dramatically with age. Patients with ALI/ARDS have alveolar epithelial injury, which may be worsened by high-pressure mechanical ventilation. Alveolar type II (ATII) cells are the progenitor cells for the alveolar epithelium and are required to reestablish the alveolar epithelium during the recovery process from ALI/ARDS. Lung fibroblasts (FBs) migrate and proliferate early after lung injury and likely are an important source of growth factors for epithelial repair. However, how lung FBs affect epithelial wound healing in the human adult lung has not been investigated in detail. Hepatocyte growth factor (HGF) is known to be released mainly from FBs and to stimulate both migration and proliferation of primary rat ATII cells. HGF is also increased in lung tissue, bronchoalveolar lavage fluid, and serum in patients with ALI/ARDS. Therefore, we hypothesized that HGF secreted by FBs would enhance wound closure in alveolar epithelial cells (AECs). Wound closure was measured using a scratch wound-healing assay in primary human AEC monolayers and in a coculture system with FBs. We found that wound closure was accelerated by FBs mainly through HGF/c-Met signaling. HGF also restored impaired wound healing in AECs from the elderly subjects and after exposure to cyclic stretch. We conclude that HGF is the critical factor released from FBs to close wounds in human AEC monolayers and suggest that HGF is a potential strategy for hastening alveolar repair in patients with ALI/ARDS. Copyright © 2014 the American Physiological Society.

  14. Inferior alveolar canal course: a radiographic study.

    Science.gov (United States)

    Liu, Tie; Xia, Bing; Gu, Zhiyuan

    2009-11-01

    To describe the morphology and course of the inferior alveolar canal (IAC) as it appears in digital panoramic radiographs. Three hundred and eighty-six digital rotational panoramic radiographs (OPG) were studied using the Clinview Software (6.1.3.7 version, Instrumentarium). Among the 386 radiographs, 86 radiographs with 5-mm steel balls were used to calculate the magnification. The average magnification of radiographs in this study was 7.24+/-7.55%. The course of IAC as seen in the panoramic radiograph may be classified into four types: (1) linear curve, 12.75%, (2) spoon-shaped curve, 29.25%, (3) elliptic-arc curve, 48.5%, and (4) turning curve, 9.5%. On panoramic radiographs, the IAC appeared closest to the inferior border of the mandible in the region of the first molar. In relation to the teeth, on panoramic radiographs, the IAC appeared closest to the distal root tip of the third molar and furthest from the mesial root tip of the first molar. In the OPG, there are four types of IAC: linear, spoon shape, elliptic-arc, and turning curve. The data found in the study may be useful for dental implant, mandibule surgery, and dental anesthesia. The limitations of the panoramic radiograph in depicting the true three-dimensional (3D) morphology of the IAC are recognized, computed tomography (CT) and cone beam (CB)3D imaging being more precise.

  15. Populations at Risk for Alveolar Echinococcosis, France

    Science.gov (United States)

    Piarroux, Martine; Piarroux, Renaud; Knapp, Jenny; Bardonnet, Karine; Dumortier, Jérôme; Watelet, Jérôme; Gerard, Alain; Beytout, Jean; Abergel, Armand; Bresson-Hadni, Solange

    2013-01-01

    During 1982–2007, alveolar echinococcosis (AE) was diagnosed in 407 patients in France, a country previously known to register half of all European patients. To better define high-risk groups in France, we conducted a national registry-based study to identify areas where persons were at risk and spatial clusters of cases. We interviewed 180 AE patients about their way of life and compared responses to those of 517 controls. We found that almost all AE patients lived in 22 départements in eastern and central France (relative risk 78.63, 95% CI 52.84–117.02). Classification and regression tree analysis showed that the main risk factor was living in AE-endemic areas. There, most at-risk populations lived in rural settings (odds ratio [OR] 66.67, 95% CI 6.21–464.51 for farmers and OR 6.98, 95% CI 2.88–18.25 for other persons) or gardened in nonrural settings (OR 4.30, 95% CI 1.82–10.91). These findings can help sensitization campaigns focus on specific groups. PMID:23647623

  16. Computed tomography of the alveolar bone

    International Nuclear Information System (INIS)

    Schueller, H.

    1996-01-01

    In addition to the conventional radiological methods used in odontology, computed tomography (CT) provides superposition-free images of the mandible and maxilla. Its value has been proved not only in cases of malignancy but also in many other problems. If an examination is performed with a slice thickness of less than 1.5 mm, the form and position of retained teeth in the alveolar bone, as well as subsequent lesions of neighboring permanent teeth, can be visualized so that early treatment can be planned. If the parodontal space of a retained tooth is visible, orthodontic intervention is possible. Precise assessment of horizontal or vertical bone loss is essential in inflammatory dental diseases. The morphology and extent of benign cystic lesions are also shown by CT. With CT surgical strategy of an intended implant therapy can take into account the remaining bone substance and the exact position of nerves and foramina. If such therapy is possible, the location, form and number of implants are easily defined. (orig.) [de

  17. Modeling Alveolar Epithelial Cell Behavior In Spatially Designed Hydrogel Microenvironments

    Science.gov (United States)

    Lewis, Katherine Jean Reeder

    The alveolar epithelium consists of two cell phenotypes, elongated alveolar type I cells (AT1) and rounded alveolar type II cells (ATII), and exists in a complex three-dimensional environment as a polarized cell layer attached to a thin basement membrane and enclosing a roughly spherical lumen. Closely surrounding the alveolar cysts are capillary endothelial cells as well as interstitial pulmonary fibroblasts. Many factors are thought to influence alveolar epithelial cell differentiation during lung development and wound repair, including physical and biochemical signals from the extracellular matrix (ECM), and paracrine signals from the surrounding mesenchyme. In particular, disrupted signaling between the alveolar epithelium and local fibroblasts has been implicated in the progression of several pulmonary diseases. However, given the complexity of alveolar tissue architecture and the multitude of signaling pathways involved, designing appropriate experimental platforms for this biological system has been difficult. In order to isolate key factors regulating cellular behavior, the researcher ideally should have control over biophysical properties of the ECM, as well as the ability to organize multiple cell types within the scaffold. This thesis aimed to develop a 3D synthetic hydrogel platform to control alveolar epithelial cyst formation, which could then be used to explore how extracellular cues influence cell behavior in a tissue-relevant cellular arrangement. To accomplish this, a poly(ethylene glycol) (PEG) hydrogel network containing enzymatically-degradable crosslinks and bioadhesive pendant peptides was employed as a base material for encapsulating primary alveolar epithelial cells. First, an array of microwells of various cross-sectional shapes was photopatterned into a PEG gel containing photo-labile crosslinks, and primary ATII cells were seeded into the wells to examine the role of geometric confinement on differentiation and multicellular arrangement

  18. Accelerated osteogenic orthodontics technique: a 1-stage surgically facilitated rapid orthodontic technique with alveolar augmentation.

    Science.gov (United States)

    Wilcko, M Thomas; Wilcko, William M; Pulver, Jeffrey J; Bissada, Nabil F; Bouquot, Jerry E

    2009-10-01

    Demineralization of a thin layer of bone over a root prominence after corticotomy surgery can optimize the response to applied orthodontic forces. This physiologic response is consistent with the regional acceleratory phenomenon process. When combined with alveolar augmentation, one is no longer strictly at the mercy of the original alveolar volume and osseous dehiscences, and fenestrations can be corrected over vital root surfaces. This is substantiated with computerized tomographic and histologic evaluations. Two case reports are presented that demonstrate the usefulness of the accelerated osteogenic orthodontics technique in de-crowding and space closing for the correction of dental malocclusions. Orthodontics is combined with full-thickness flap reflection, selective alveolar decortication, ostectomy, and bone grafting to accomplish complete orthodontic treatment. Rapid tooth movement was demonstrated in both cases and stability up to 8 years of retention. The accelerated osteogenic orthodontics technique provides for efficient and stable orthodontic tooth movement. Frequently, the teeth can be moved further in one third to one fourth the time required for traditional orthodontics alone. This is a physiologically based treatment consistent with a regional acceleratory phenomenon and maintaining an adequate blood supply is essential.

  19. Lung tissue engineering and preservation of alveolar microstructure using a novel casting method.

    Science.gov (United States)

    Kajbafzadeh, A-M; Sabetkish, N; Sabetkish, S; Tavangar, S M; Hossein Beigi, R S; Talebi, M A; Akbarzadeh, A; Nikfarjam, L

    2015-02-01

    We used a rat model to decellularize and seed alveolar cells on a three-dimensional lung scaffold to preserve alveolar microarchitecture. We verified the preservation of terminal respiratory structure by casting and by scanning electron microscopy (SEM) of the casts after decellularization. Whole lungs were obtained from 12 healthy Sprague-Dawley rats, cannulated through the trachea under sterile conditions, and decellularized using a detergent-based method. Casting of both natural and decellularized lungs was performed to verify preservation of the inner microstructure of scaffolds for further cell seeding. Alveolar cell seeding was performed using green fluorescent protein (GFP) lung cells and non-GFP lung cells, and a peristaltic pump. We assessed cell seeding using histological and immunohistochemical staining, and enzymatic evaluation. All cellular components were removed completely from the scaffolds, and histological staining and SEM of casts were used to verify the preservation of tissue structure. Tensile tests verified conservation of biomechanical properties. The hydroxyproline content of decellularized lungs was similar to native lung. Histological and immunohistochemical evaluations showed effective cell seeding on decellularized matrices. Enzymatic measurement of trypsin and alpha 1 antitrypsin suggested the potential functional properties of the regenerated lungs. Casts produced by our method have satisfactory geometrical properties for further cell seeding of lung scaffolds. Preservation of micro-architecture and terminal alveoli that was confirmed by SEM of lung casts increases the probability of an effective cell seeding process.

  20. Expression of functional toll-like receptor-2 and -4 on alveolar epithelial cells.

    Science.gov (United States)

    Armstrong, Lynne; Medford, Andrew R L; Uppington, Kay M; Robertson, John; Witherden, Ian R; Tetley, Teresa D; Millar, Ann B

    2004-08-01

    The recognition of potentially harmful microorganisms involves the specific recognition of pathogen-associated molecular patterns (PAMPs) and the family of Toll-like receptors (TLRs) is known to play a central role in this process. TLR-4 is the major recognition receptor for lipopolysaccharide (LPS), a component of gram-negative bacterial cell walls, whereas TLR-2 responds to bacterial products from gram-positive organisms. Although resident alveolar macrophages are the first line of defense against microbial attack, it is now understood that the alveolar epithelium also plays a pivotal role in the innate immunity of the lung. The purpose of the current study was to determine whether human primary type II alveolar epithelial cells (ATII) express functional TLR-2 and TLR-4 and how they may be regulated by inflammatory mediators. We have used reverse transcriptase-polymerase chain reaction and flow cytometry to determine basal and inducible expression on ATII. We have used highly purified preparations of the gram-positive bacterial product lipoteichoic acid (LTA) and LPS to look at the functional consequences of TLR-2 and TLR-4 ligation, respectively, in terms of interleukin-8 release. We have shown that human primary ATII cells express mRNA and protein for both TLR-2 and TLR-4, which can be modulated by incubation with LPS and tumor necrosis factor. Furthermore, we have demonstrated that these receptors are functional. This suggests that ATII have the potential to contribute significantly to the host defense of the human alveolus against bacteria.

  1. PDGF-metronidazole-encapsulated nanofibrous functional layers on collagen membrane promote alveolar ridge regeneration

    Directory of Open Access Journals (Sweden)

    Ho MH

    2017-08-01

    Full Text Available Ming-Hua Ho,1 Hao-Chieh Chang,2,3 Yu-Chia Chang,3 Jeiannete Claudia,1 Tzu-Chiao Lin,2 Po-Chun Chang2,3 1Department of Chemical Engineering, College of Engineering, National Taiwan University of Science and Technology, Taipei, Taiwan; 2Graduate Institute of Clinical Dentistry, School of Dentistry, National Taiwan University, Taipei, Taiwan; 3Department of Dentistry, National Taiwan University Hospital, Taipei, Taiwan Abstract: This study aimed to develop a functionally graded membrane (FGM to prevent infection and promote tissue regeneration. Poly(L-lactide-co-D,L-lactide encapsulating platelet-derived growth factor (PDLLA-PDGF or metronidazole (PDLLA-MTZ was electrospun to form a nanofibrous layer on the inner or outer surface of a clinically available collagen membrane, respectively. The membrane was characterized for the morphology, molecule release profile, in vitro and in vivo biocompatibility, and preclinical efficiency for alveolar ridge regeneration. The PDLLA-MTZ and PDLLA-PDGF nanofibers were 800–900 nm in diameter, and the thicknesses of the functional layers were 20–30 µm, with sustained molecule release over 28 days. All of the membranes tested were compatible with cell survival in vitro and showed good tissue integration with minimal fibrous capsule formation or inflammation. Cell proliferation was especially prominent on the PDLLA-PDGF layer in vivo. On the alveolar ridge, all FGMs reduced wound dehiscence compared with the control collagen membrane, and the FGM with PDLLA-PDGF promoted osteogenesis significantly. In conclusion, the FGMs with PDLLA-PDGF and PDLLA-MTZ showed high biocompatibility and facilitated wound healing compared with conventional membrane, and the FGM with PDLLA-PDGF enhanced alveolar ridge regeneration in vivo. The design represents a beneficial modification, which may be easily adapted for future clinical use. Keywords: tissue engineering, platelet-derived growth factor, metronidazole, alveolar process

  2. Evaluation of the alveolar macrophage role in the pulmonary distribution of actinide oxides

    International Nuclear Information System (INIS)

    Guezingar-Liebard, Florence

    1999-01-01

    Actinide oxide inhalation is potentially a risk during the fuel fabrication process in the electronuclear industry. These particles can induce pulmonary lesions. The alveolar macrophage play an important role in the particle sequestration and transport but the actinide toxicity towards these cells is not well known. The aim of this work was to characterize the evolution of particle localisation in lungs after inhalation and to evaluate the role of macrophages in the lesion histo-genesis. We have used of a solid track detector to visualise alpha dose distribution within lung tissue. After 237 NpO 2 , MOX or PuO 2 inhalation by rats, different kinetics of clearance were observed for the sub-pleural and peri-bronchial areas compared to the others alveolar areas. For initial lung burdens that alter the lung clearance, particle aggregates were observed. Their kinetic and localisation vary depending on the aerosol, for a same global dose delivered to the lungs. This could be due to the different specific alpha activities of the particles and to the particle number deposited in the lung to obtain a similar burden but it could be also due to a chemical toxicity of neptunium higher than that of the others actinides. The flow cytometry methods developed allow us to measure apoptosis, phagocytosis and free radicals generation. After addition of soluble uranium to the culture medium, similar results were obtained using either alveolar macrophages extracted from rats or a macrophage cell line. This work confirms that alveolar macrophages are involved in the aggregate formation which induces heterogeneous dose distribution within the different lung tissues. (author) [fr

  3. Alveolar bone preservation subsequent to miniscrew implant placement in a canine model.

    Science.gov (United States)

    Melsen, B; Huja, S S; Chien, H-H; Dalstra, M

    2015-05-01

    To assess the effects of transcortical screws on alveolar (bone) ridge preservation following extraction. Four adult beagle dogs had mandibular premolars extracted bilaterally. After 6 weeks, using a split-mouth design, two transcortical screws were inserted unilaterally below the alveolar crest on the experimental side in the region of the extraction. The dogs were killed after 12 weeks. The bone at the extraction sites was analyzed using μCT and 3D analysis. A cylindrical core was placed around the actual and a virtual screw placed in the identical location on the control side. The bone volume within the cylinders was quantified. An insertion of a dental implant was simulated bilaterally at the insertion site. The height of the clinical crown and the alveolar crest were determined on both sides. The bone turnover was assessed histomorphometrically on un-decalcified bucco-lingual sections stained with basic fuchsine and toluidine blue. Comparison of the two sides revealed a significant difference both with regard to the bone volume and morphology. The transcortical screw caused an increase in bone density and less ridge atrophy. When simulating a dental implant placement on both sides, the bone preservation on the experimental side led to a need for a shorter clinical crown compared to the control side. A higher activity level of the bone in the experimental side was demonstrated histologically. In this dog model the insertion of a mini-implant across the healing alveolar process results in increased density not only adjacent to the screws, but also in the region where a potential dental implant would be inserted. In humans, the insertion of transcortical screws may maintain bone when for various reasons insertion of a permanent dental implant has to be postponed. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Partial pulmonary embolization disrupts alveolarization in fetal sheep

    Directory of Open Access Journals (Sweden)

    Hooper Stuart B

    2010-04-01

    Full Text Available Abstract Background Although bronchopulmonary dysplasia is closely associated with an arrest of alveolar development and pulmonary capillary dysplasia, it is unknown whether these two features are causally related. To investigate the relationship between pulmonary capillaries and alveolar formation, we partially embolized the pulmonary capillary bed. Methods Partial pulmonary embolization (PPE was induced in chronically catheterized fetal sheep by injection of microspheres into the left pulmonary artery for 1 day (1d PPE; 115d gestational age; GA or 5 days (5d PPE; 110-115d GA. Control fetuses received vehicle injections. Lung morphology, secondary septal crests, elastin, collagen, myofibroblast, PECAM1 and HIF1α abundance and localization were determined histologically. VEGF-A, Flk-1, PDGF-A and PDGF-Rα mRNA levels were measured using real-time PCR. Results At 130d GA (term ~147d, in embolized regions of the lung the percentage of lung occupied by tissue was increased from 29 ± 1% in controls to 35 ± 1% in 1d PPE and 44 ± 1% in 5d PPE fetuses (p VEGF and Flk-1, although a small increase in PDGF-Rα expression at 116d GA, from 1.00 ± 0.12 in control fetuses to 1.61 ± 0.18 in 5d PPE fetuses may account for impaired differentiation of alveolar myofibroblasts and alveolar development. Conclusions PPE impairs alveolarization without adverse systemic effects and is a novel model for investigating the role of pulmonary capillaries and alveolar myofibroblasts in alveolar formation.

  5. Asymmetric [14C]albumin transport across bullfrog alveolar epithelium

    International Nuclear Information System (INIS)

    Kim, K.J.; LeBon, T.R.; Shinbane, J.S.; Crandall, E.D.

    1985-01-01

    Bullfrog lungs were prepared as planar sheets and bathed with Ringer solution in Ussing chambers. In the presence of a constant electrical gradient (20, 0, or -20 mV) across the tissue, 14 C-labeled bovine serum albumin or inulin was instilled into the upstream reservoir and the rate of appearance of the tracer in the downstream reservoir was monitored. Two lungs from the same animal were used to determine any directional difference in tracer fluxes. An apparent permeability coefficient was estimated from a relationship between normalized downstream radioactivities and time. Results showed that the apparent permeability of albumin in the alveolar to pleural direction across the alveolar epithelial barrier is 2.3 X 10(-7) cm/s, significantly greater (P less than 0.0005) than that in the pleural to alveolar direction (5.3 X 10(-8) cm/s) when the tissue was short circuited. Permeability of inulin, on the other hand, did not show any directional dependence and averaged 3.1 X 10(-8) cm/s in both directions. There was no effect on radiotracer fluxes permeabilities of different electrical gradients across the tissue. Gel electrophoretograms and corresponding radiochromatograms suggest that the large and asymmetric isotope fluxes are not primarily due to digestion or degradation of labeled molecules. Inulin appears to traverse the alveolar epithelial barrier by simple diffusion through hydrated paracellular pathways. On the other hand, [ 14 C]albumin crosses the alveolar epithelium more rapidly than would be expected by simple diffusion. These asymmetric and large tracer fluxes suggest that a specialized mechanism is present in alveolar epithelium that may be capable of helping to remove albumin from the alveolar space

  6. NFκB signaling in alveolar rhabdomyosarcoma

    Directory of Open Access Journals (Sweden)

    Megan M. Cleary

    2017-09-01

    Full Text Available Alveolar rhabdomyosarcoma (aRMS is a pediatric soft tissue cancer commonly associated with a chromosomal translocation that leads to the expression of a Pax3:Foxo1 or Pax7:Foxo1 fusion protein, the developmental underpinnings of which may give clues to its therapeutic approaches. In aRMS, the NFκB–YY1–miR-29 regulatory circuit is dysregulated, resulting in repression of miR-29 and loss of the associated tumor suppressor activity. To further elucidate the role of NFκB in aRMS, we first tested 55 unique sarcoma cell lines and primary cell cultures in a large-scale chemical screen targeting diverse molecular pathways. We found that pharmacological inhibition of NFκB activity resulted in decreased cell proliferation of many of the aRMS tumor cultures. Surprisingly, mice that were orthotopically allografted with aRMS tumor cells exhibited no difference in tumor growth when administered an NFκB inhibitor, compared to control. Furthermore, inhibition of NFκB by genetically ablating its activating kinase inhibitor, IKKβ, by conditional deletion in a mouse model harboring the Pax3:Foxo1 chimeric oncogene failed to abrogate spontaneous tumor growth. Genetically engineered mice with conditionally deleted IKKβ exhibited a paradoxical decrease in tumor latency compared with those with active NFκB. However, using a synthetic-lethal approach, primary cell cultures derived from tumors with inactivated NFκB showed sensitivity to the BCL-2 inhibitor navitoclax. When used in combination with an NFκB inhibitor, navitoclax was synergistic in decreasing the growth of both human and IKKβ wild-type mouse aRMS cells, indicating that inactivation of NFκB alone may not be sufficient for reducing tumor growth, but, when combined with another targeted therapeutic, may be clinically beneficial.

  7. Alveolar targeting of aerosol pentamidine. Toward a rational delivery system

    Energy Technology Data Exchange (ETDEWEB)

    Simonds, A.K.; Newman, S.P.; Johnson, M.A.; Talaee, N.; Lee, C.A.; Clarke, S.W. (Royal Free Hospital, London (England))

    1990-04-01

    Nebulizer systems that deposit a high proportion of aerosolized pentamidine on large airways are likely to be associated with marked adverse side effects, which may lead to premature cessation of treatment. We have measured alveolar deposition and large airway-related side effects (e.g., cough, breathlessness, and effect on pulmonary function) after aerosolization of 150 mg pentamidine isethionate labeled with {sup 99m}Tc-Sn-colloid. Nine patients with AIDS were studied using three nebulizer systems producing different droplet size profiles: the Acorn System 22, Respirgard II, and Respirgard II with the inspiratory baffle removed. Alveolar deposition was greatest and side effects least with the nebulizer producing the smallest droplet size profile (Respirgard II), whereas large airway-related side effects were prominent and alveolar deposition lowest with the nebulizer producing the largest droplet size (Acorn System 22). Values for alveolar deposition and adverse airway effects were intermediate using the Respirgard with inspiratory baffle removed, thus indicating the importance of the baffle valve in determining droplet size. Addition of a similar baffle valve to the Acorn System 22 produced a marked improvement in droplet size profile. Selection of a nebulizer that produces an optimal droplet size range offers the advantage of enhancing alveolar targeting of aerosolized pentamidine while reducing large airway-related side effects.

  8. Is alveolar cleft reconstruction still controversial? (Review of literature

    Directory of Open Access Journals (Sweden)

    Sameh A. Seifeldin

    2016-01-01

    Full Text Available Cleft lip and palate (CL/P is a frequent congenital malformation that manifests in several varieties including unilateral or bilateral and complete or incomplete. Alveolar cleft reconstruction remains controversial with regard to timing, graft materials, surgical techniques, and methods of evaluation. Many studies have been conducted addressing these points to develop an acceptable universal protocol for managing CL/P. The primary goal of alveolar cleft reconstruction in CL/P patients is to provide a bony bridge at the cleft site that allows maxillary arch continuity, oronasal fistula repair, eruption of the permanent dentition into the newly formed bone, enhances nasal symmetry through providing alar base support, orthodontic movement and placement of osseointegrated implants when indicated. Other goals include improving speech, improvement of periodontal conditions, establishing better oral hygiene, and limiting growth disturbances. In order to rehabilitate oral function in CL/P patients alveolar bone grafting is necessary. Secondary bone grafting is the most widely accepted method for treating alveolar clefts. Autogenous bone graft is the primary source for reconstructing alveolar cleft defects and is currently the preferred grafting material.

  9. Evaluation of Inferior Alveolar Nerve Regeneration by Bifocal Distraction Osteogenesis with Retrograde Transportation of Horseradish Peroxidase in Dogs

    Science.gov (United States)

    Isomura, Emiko Tanaka

    2014-01-01

    Background Bifocal distraction osteogenesis has been shown to be a reliable method for reconstructing segmental mandibular defects. However, there are few reports regarding the occurrence of inferior alveolar nerve regeneration during the process of distraction. Previously, we reported inferior alveolar nerve regeneration after distraction, and evaluated the regenerated nerve using histological and electrophysiological methods. In the present study, we investigated axons regenerated by bifocal distraction osteogenesis using retrograde transportation of horseradish peroxidase in the mandibles of dogs to determine their type and function. Methods and Findings Using a bifocal distraction osteogenesis method, we produced a 10-mm mandibular defect, including a nerve defect, in 11 dogs and distracted using a transport disk at a rate of 1 mm/day. The regenerated inferior alveolar nerve was evaluated by retrograde transportation of HRP in all dogs at 3 and 6 months after the first operation. At 3 and 6 months, HRP-labeled neurons were observed in the trigeminal ganglion. The number of HRP-labeled neurons in each section increased, while the cell body diameter of HRP-labeled neurons was reduced over time. Conclusions We found that the inferior alveolar nerve after bifocal distraction osteogenesis successfully recovered until peripheral tissue began to function. Although our research is still at the stage of animal experiments, it is considered that it will be possible to apply this method in the future to humans who have the mandibular defects. PMID:24732938

  10. Healing of periodontal defects and calcitonin gene related peptide expression following inferior alveolar nerve transection in rats.

    Science.gov (United States)

    Lv, Linlin; Wang, Yanzhi; Zhang, Jing; Zhang, Ting; Li, Shu

    2014-06-01

    The roles of nerve and neuropeptides in the process of bone formation and remolding have been studied previously. However, the effects of nervous system and neuropeptide on periodontal alveolar bone formation remained unknown. The aim of this study was to assess the effect of innervation on regeneration of alveolar bone and expression levels of calcitonin gene related peptide (CGRP) in periodontal tissues of rats, so as to have a better understanding of the effect of nerve and its related neuropeptide on periodontal tissue regeneration. Rats received transection of the left inferior alveolar nerve and a surgery to produce bilateral periodontal defect, then the alveolar tissue was obtained from animals of each group at week 1, 2, 4, 6 and 8 weeks after operation, respectively. Hematoxylin and eosin staining, and Masson staining were performed to evaluate the ability to restore and repair periodontal tissues at 4, 6 and 8 after surgery. Then new bone formation area and mineralized area were quantified using imagepro-plus6.0 software after pictures were taken under the microscope and SPSS17.0 was used for statistical analysis. Immunohistochemical staining was applied to investigate the expression of CGRP at 1, 2, 4, 6 and 8 weeks. Rats received transection of the left inferior alveolar nerve surgery and were then sacrificed at day 1, 3, 7, 14, 21, 28 after the operation. The change of CGRP expression in periodontal tissue was detected using immunohistochemical methods. The results showed that the volume of new bone formation was not significantly difference between the experimental and control groups, but the mineralized new bone area between the two groups was statistically significant. The level of CGRP expression was lower than normal at week 1, and then it began to rise in the next stage. The plateau, at higher than normal level, was reached at 6 weeks post-surgery. Results of transection of the left inferior alveolar nerve demonstrated the expression of CGRP

  11. Three-Dimensional Radiological Assessment of Alveolar Bone Volume Preservation Using Bovine Bone Xenograft.

    Science.gov (United States)

    Al Qabbani, Ali; Al Kawas, Sausan; A Razak, Noor Hayati; Al Bayatti, Saad Wahby; Enezei, Hamid Hammad; Samsudin, A Rani; Sheikh Ab Hamid, Suzina

    2018-03-01

    Alveolar bone is critical in supporting natural teeth, dental implants as well as a removable and fixed prosthesis. Alveolar bone volume diminishes when its associated natural tooth is lost. The aim of this study is to evaluate the effectiveness of bovine bone granules on alveolar bone socket augmentation for ridge preservation following atraumatic tooth extraction. Twenty medically fit patients (12 males and 8 females aged between 18 and 40 years) who needed noncomplicated tooth extraction of 1 mandibular premolar tooth were divided randomly and equally into 2 groups. In control group I, the empty extraction socket was left untreated and allowed to heal in a conventional way. In group II, the empty extraction socket wound was filled with lyophilized bovine bone xenograft granules 0.25 to 1 mm of size, 1 mL/vial. A resorbable pericardium membrane was placed to cover the defect. Clinical and 3-dimensional radiological assessments were performed at day 0, 3 months, and 9 months postoperative. There were no clinical differences in general wound healing between the groups. Comparisons within the groups showed a significant difference of bone resorption of 1.49 mm (95% confidence interval, 0.63-2.35) at 3 months, and further resorption of 1.84 mm (P ≤ 0.05) at 9 months in the control group. No significant changes of bone resorption were observed in group II during the same time interval. Comparison between groups showed a significant difference of bone resorption at 3 and 9 months (2.40 and 2.88 mm, respectively). The use of lyophilized demineralized bovine bone granules in socket preservation to fill in the extraction socket seems essential in preserving the alveolar bone dimension as it showed excellent soft and hard tissue healing. This study concludes that the alveolar bone socket exhibited a dynamic process of resorption from the first day of tooth extraction. Evidence shows the possibility of using bovine bone granules routinely in socket volume

  12. Diffuse bronchiolo-alveolar carcinoma in a dog.

    Science.gov (United States)

    Bertazzolo, W; Zuliani, D; Pogliani, E; Caniatti, M; Bussadori, C

    2002-06-01

    An eight-year-old female German wirehaired pointer was presented with signs of respiratory distress. Clinical examination, laboratory results, thoracic radiography and echocardiography indicated the presence of a diffuse interstitial lung disease with secondary appropriate erythrocytosis, pulmonary hypertension and cor pulmonale. Transthoracic fine needle aspiration biopsy of the lung suggested malignant epithelial neoplasia. A primary lung cancer with an unusually diffuse distribution of miliary/micronodular lesions was found at postmortem examination. Histological diagnosis was bronchiolo-alveolar carcinoma. Bronchiolo-alveolar carcinoma can occasionally occur in a diffuse fashion involving most or all of the lung parenchyma. In man, diffuse bronchiolo-alveolar carcinoma is considered a great imitator of other, more common diffuse interstitial forms of lung disease. This case report indicates that it is also a differential diagnosis to consider in dogs.

  13. Alveolocapillary model system to study alveolar re-epithelialization

    Energy Technology Data Exchange (ETDEWEB)

    Willems, Coen H.M.P.; Zimmermann, Luc J.I.; Sanders, Patricia J.L.T.; Wagendorp, Margot; Kloosterboer, Nico [Department of Paediatrics, School for Oncology and Developmental Biology (GROW), Maastricht University Medical Centre, Maastricht (Netherlands); Cohen Tervaert, Jan Willem [Division of Clinical and Experimental Immunology, Department of Internal Medicine, Maastricht University Medical Centre, Maastricht (Netherlands); Duimel, Hans J.Q.; Verheyen, Fons K.C.P. [Electron Microscopy Unit, Department of Molecular Cell Biology, Maastricht University Medical Centre, Maastricht (Netherlands); Iwaarden, J. Freek van, E-mail: f.vaniwaarden@maastrichtuniversity.nl [Department of Paediatrics, School for Oncology and Developmental Biology (GROW), Maastricht University Medical Centre, Maastricht (Netherlands)

    2013-01-01

    In the present study an in vitro bilayer model system of the pulmonary alveolocapillary barrier was established to investigate the role of the microvascular endothelium on re-epithelialization. The model system, confluent monolayer cultures on opposing sides of a porous membrane, consisted of a human microvascular endothelial cell line (HPMEC-ST1.6R) and an alveolar type II like cell line (A549), stably expressing EGFP and mCherry, respectively. These fluorescent proteins allowed the real time assessment of the integrity of the monolayers and the automated analysis of the wound healing process after a scratch injury. The HPMECs significantly attenuated the speed of re-epithelialization, which was associated with the proximity to the A549 layer. Examination of cross-sectional transmission electron micrographs of the model system revealed protrusions through the membrane pores and close contact between the A549 cells and the HPMECs. Immunohistochemical analysis showed that these close contacts consisted of heterocellular gap-, tight- and adherens-junctions. Additional analysis, using a fluorescent probe to assess gap-junctional communication, revealed that the HPMECs and A549 cells were able to exchange the fluorophore, which could be abrogated by disrupting the gap junctions using connexin mimetic peptides. These data suggest that the pulmonary microvascular endothelium may impact the re-epithelialization process. -- Highlights: ► Model system for vital imaging and high throughput screening. ► Microvascular endothelium influences re-epithelialization. ► A549 cells form protrusions through membrane to contact HPMEC. ► A549 cells and HPMECs form heterocellular tight-, gap- and adherens-junctions.

  14. Bone resorption and complications in alveolar distraction osteogenesis.

    Science.gov (United States)

    Ettl, Tobias; Gerlach, Till; Schüsselbauer, Thomas; Gosau, Martin; Reichert, Torsten E; Driemel, Oliver

    2010-10-01

    Distraction osteogenesis presents an alternative procedure for augmentation of atrophic alveolar bone prior to inserting dental implants. The aim of this retrospective study was to evaluate complications of this method with specific focus on bone resorption during the consolidation period and the follow-up period after dental implant insertion into distracted bone. Thirty partially edentulous patients underwent a total of 36 vertical alveolar distractions with an extraosseous distraction system. Eleven devices were placed in the maxilla and 25 in the mandible. Eighty-two dental implants were inserted after a mean consolidation period of 4.5 months. Treatment results were evaluated by means of panoramic radiographs for distraction follow-up and periapical radiographs for implant follow-up. The mean length of the transport segment was 19 mm. The average alveolar height achieved was 6.4 mm with a mean resorption of 1.8 mm (21.1%) at the time of dental implant insertion. Main problems comprised oral displacement of the transport segment (n = 15) and inadequate soft tissue extension (n = 13). Eighty-two dental implants were inserted with an overall survival rate of 95.1% after 45.8 months. For periimplant marginal bone, an average resorption of 3.5 mm was recorded 50.4 months after implant insertion. Although alveolar distraction osteogenesis seems to be an effective tool to treat vertical defects of the alveolar ridge, it is not an uncomplicated procedure. A combination with vestibular augmentation of autogenous bone grafts should be considered. Overcorrection of 20% may compensate bone relapse during the consolidation period of the distracted alveolar bone. Further bone resorption after dental implantation is common.

  15. Alveolar bone width preservation after decoronation of ankylosed anterior incisors.

    Science.gov (United States)

    Lin, Shaul; Schwarz-Arad, Dvorah; Ashkenazi, Malka

    2013-12-01

    The aim of the study was to assess the alteration of alveolar ridge dimensions after decoronation procedures in children and adolescents at least 1 year after surgery. Twelve children who underwent decoronation of ankylosed maxillary anterior incisors with at least 1 year after surgery follow-up were recalled for reevaluation. All decoronations were performed when the ankylosed teeth were submerged 1-1.5 mm. During the recall appointment, impressions of the upper arch were obtained. The bucco-palatal alveolar dimensions of the decoronated teeth were measured on the cast at the mid-mesiodistal distance from the missing tooth and were compared with the distance from the contralateral healthy incisor. Overall, 12 children (9 male and 3 female) were reevaluated up to 82 months after decoronation (mean, 49.58 ± 24 months). The mean age of the patients at the time of trauma was 9.83 ± 2.8 years. The average bucco-palatal dimension of the alveolar ridge at the mid-decoronation area was 9 ± 1 mm compared with 10.17 ± 0.9 mm at the contralateral homologous tooth (difference of 1.67 ± 1.12, P = .004). The findings show a positive statistical correlation between the duration of the follow-up period and the bucco-palatal dimension of the alveolar ridge (P = .027). Although decoronation of ankylosed young permanent incisors resulted in a decrease in the bucco-palatal dimension with time, it did not prevent additional alveolar growth that occurs with age in a developing child and thus may help maintain the alveolar bone ridge width, height, and continuity and assist in future rehabilitation with less invasive ridge augmentation procedures required for implant placement. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  16. Effects of Tissucol™ and epsilon aminocaproic acid in the healing process following dental extraction in dehydrated rats Efeitos do Tissucol® e do ácido épsilon aminocapróico no processo de reparo alveolar em ratos desidratados

    Directory of Open Access Journals (Sweden)

    Tetuo Okamoto

    2006-03-01

    Full Text Available A histological study was conducted of the alveolar bone healing process following tooth extraction of dehydrated rats after the implantation of fibrin adhesive (TISSUCOL™ associated to previous irrigation of the wound with a 5% epsilon aminocaproic acid solution (EACA. Seventy two rats were used, divided into three groups receiving different treatments after the surgical procedure. In group I, the gingival mucosa was sutured after extraction of the right upper incisor. In groups II and III, chronic dehydration was produced by water deprivation for 9 days (3 days in the preoperative period and 6 days in the postoperative period. In the animals of Group II, after tooth extraction, the gingival mucosa was sutured in the same way as performed in group I. In group III, after extraction, the dental socket was irrigated with 5% EACA, followed by implantation of the fibrin adhesive (TISSUCOL™. The mucosa was sutured in the same way as performed in the other groups. At 3, 7, 15 and 21 postoperative days, the animals were sacrificed in number of 6 for each group. Specimens containing the dental socket were removed and fixed in 10% formalin and decalcified in an equal part formic acid and sodium citrate solution. After routine processing, the specimens were embedded in paraffin for microtomy. We obtained 6 µm semi-serial slices that were stained with hematoxylin and eosin for histological evaluation. The results showed that the water deprivation in the pre- and postoperative periods caused a delay in the alveolar bone healing process. The use of the fibrin adhesive (TISSUCOL™ produced an improvement in the fibrinolytic picture caused by dehydration.Foi estudada histologicamente a reparação do alvéolo dental de ratos desidratados, após o implante de adesivo fibrínico (TISSUCOL® associado à irrigação prévia da ferida com solução a 5% de ácido épsilon-aminocapróico. Foram empregados 72 ratos, divididos em três grupos, que receberam

  17. Proximal alveolar bone loss in a longitudinal radiographic investigation

    International Nuclear Information System (INIS)

    Bolin, A.; Lavstedt, S.; Henrikson, C.O.; Frithiof, L.

    1986-01-01

    The difference in proximal alveolar bone height between 1970 and 1980, the ''ABD index'', has been measured longitudinally in radiographs from an unselected material. The group constitutes 406 individuals born in 1904 - 1952 in the county of Stockholm. 13 of 18 predictors determined in 1970 were significantly related to the ABD index in the simple correlation analyses. The predictor ''the alveolar bone loss 1970'' (ABL index 1970) had the strongest correlation to the ABD index. In the stepwise multiple regression analysis the predictor ABL index 1970 and three other predictors reached significant levels. These were age, number of lost teeth and Russell's Periodontal Index

  18. Repopulation of denuded tracheal grafts with alveolar type II cells

    International Nuclear Information System (INIS)

    Johnson, N.F.

    1988-01-01

    Repopulation of denuded heterotopic tracheal grafts with populations of specific epithelial cell types is one approach to study the differentiation potential of various cell types. This technique has been adopted to delineate the differentiation pathways of alveolar type II cells isolated from rat lungs. Under the conditions of this experiment, the reestablished epithelial lining was alveolar-like, however, ultrastructural analysis of the cells showed them to be like Clara cells. These preliminary results suggest that the secretary cells of the lung parenchyma and terminal airways may share a common ancestry. (author)

  19. Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients

    DEFF Research Database (Denmark)

    Andersen, Kristian

    2012-01-01

    Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients......Reconstruction of alveolar defects in patients with cleft lip and palate - 111 consecutive patients...

  20. Secondary bone grafting for alveolar cleft in children with cleft lip or cleft lip and palate

    NARCIS (Netherlands)

    Guo, J.; Li, C.; Zhang, Q.; Wu, G.; Deacon, S.A.; Chen, J.; Hu, H.; Zou, S.; Ye, Q.

    2011-01-01

    BACKGROUND: Secondary alveolar bone grafting has been widely used to reconstruct alveolar cleft. However, there is still some controversy. OBJECTIVES: To compare the effectiveness and safety of different secondary bone grafting methods. SEARCH STRATEGY: The final electronic and handsearches were

  1. A novel semi-automatic segmentation protocol for volumetric assessment of alveolar cleft grafting procedures

    NARCIS (Netherlands)

    Janssen, Nard G.; Schreurs, Ruud; Bittermann, Gerhard K.P.; Borstlap, Wilfred A.; Koole, Ronald; Meijer, Gert J.; Maal, Thomas J.J.

    2017-01-01

    A novel protocol for volumetric assessment of alveolar cleft grafting procedures is presented. Eleven cone-beam computed tomography (CBCT) datasets of patients who underwent secondary alveolar cleft reconstructive surgery for a unilateral alveolar cleft were evaluated by two investigators. Residual

  2. A novel semi-automatic segmentation protocol for volumetric assessment of alveolar cleft grafting procedures.

    NARCIS (Netherlands)

    Janssen, N.G.; Schreurs, R.; Bittermann, G.K.P.; Borstlap, W.A.; Koole, R.A.; Meijer, G.J.; Maal, T.J.J.

    2017-01-01

    A novel protocol for volumetric assessment of alveolar cleft grafting procedures is presented. Eleven cone-beam computed tomography (CBCT) datasets of patients who underwent secondary alveolar cleft reconstructive surgery for a unilateral alveolar cleft were evaluated by two investigators. Residual

  3. Serial bronchoscopic lung lavage in pulmonary alveolar proteinosis under local anesthesia

    Directory of Open Access Journals (Sweden)

    K Rennis Davis

    2015-01-01

    Full Text Available Pulmonary alveolar proteinosis (PAP is a rare disease, characterized by alveolar accumulation of surfactant composed of proteins and lipids due to defective surfactant clearance by alveolar macrophages. Mainstay of treatment is whole lung lavage, which requires general anesthesia. Herein, we report a case of primary PAP, successfully treated with serial bronchoscopic lung lavages under local anesthesia.

  4. Mitochondrial quality control in alveolar epithelial cells damaged byS. aureuspneumonia in mice.

    Science.gov (United States)

    Suliman, Hagir B; Kraft, Bryan; Bartz, Raquel; Chen, Lingye; Welty-Wolf, Karen E; Piantadosi, Claude A

    2017-10-01

    Mitochondrial damage is often overlooked in acute lung injury (ALI), yet most of the lung's physiological processes, such as airway tone, mucociliary clearance, ventilation-perfusion (Va/Q) matching, and immune surveillance require aerobic energy provision. Because the cell's mitochondrial quality control (QC) process regulates the elimination and replacement of damaged mitochondria to maintain cell survival, we serially evaluated mitochondrial biogenesis and mitophagy in the alveolar regions of mice in a validated Staphylococcus aureus pneumonia model. We report that apart from cell lysis by direct contact with microbes, modest epithelial cell death was detected despite significant mitochondrial damage. Cell death by TdT-mediated dUTP nick-end labeling staining occurred on days 1 and 2 postinoculation: apoptosis shown by caspase-3 cleavage was present on days 1 and 2, while necroptosis shown by increased levels of phospho- mixed lineage kinase domain-like protein (MLKL) and receptor-interacting serine/threonine-protein kinase 1 (RIPK1) was present on day 1 Cell death in alveolar type I (AT 1 ) cells assessed by bronchoalveolar lavage fluid receptor for advanced glycation end points (RAGE) levels was high, yet AT 2 cell death was limited while both mitochondrial biogenesis and mitophagy were induced. These mitochondrial QC mechanisms were evaluated mainly in AT 2 cells by localizing increases in citrate synthase content, increases in nuclear mitochondrial biogenesis regulators nuclear respiratory factor-1 (NRF-1) and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α), and increases in light chain 3B protein (LC3-I)/LC3II ratios. Concomitant changes in p62, Pink 1, and Parkin protein levels indicated activation of mitophagy. By confocal microscopy, mitochondrial biogenesis and mitophagy were often observed on day 1 within the same AT 2 cells. These findings imply that mitochondrial QC activation in pneumonia-damaged AT 2 cells promotes cell

  5. Autochthonous human alveolar echinococcosis in a Hungarian patient.

    Science.gov (United States)

    Dezsényi, Balázs; Strausz, Tamás; Makrai, Zita; Csomor, Judit; Danka, József; Kern, Peter; Rezza, Giovanni; Barth, Thomas F E; Casulli, Adriano

    2017-02-01

    Alveolar echinococcosis is a zoonotic parasitic disease causing a severe clinical condition and is known as the most deadly of all helminth infections. Moreover, this disease is also an increasing concern in Northern and Eastern Europe due to its spread in the wildlife animal host. An asymptomatic 70-year-old woman from south-western Hungary was diagnosed with multiple liver lesions. Imaging techniques (ultrasound, computed tomography and magnetic resonance imaging), serology (ELISA, indirect hemagglutination and Western blot), and conventional staining methods (hematoxylin-eosin and periodic acid-Schiff) were used for the detection of the disease. A histopathological re-evaluation of formalin-fixed paraffin block by immunohistochemical staining with the monoclonal antibody Em2G11 definitively confirmed the diagnosis of alveolar echinococcosis. To our knowledge, this is the first confirmed autochthonous case of human alveolar echinococcosis in Hungary. To what extent diagnostic difficulties may contribute to underestimate this zoonosis in Eastern Europe is unknown. Differential diagnosis with alveolar echinococcosis should be considered for patients with multiple, tumor-like cystic lesions of the liver, in countries where this parasite is emerging.

  6. Three‑dimensional Evaluation of Alveolar Bone Thickness of ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... mandibular anterior teeth are going to be retracted, mechanics for torque control should be preferred not to have uncontrolled tipping. In Class I, light orthodontic forces should be applied using elastic arch wires, and time must be allowed for the remodeling and healing of the alveolar bone in these patient ...

  7. Advanced Alveolar Rhabdomyosarcoma of the Uterus: A Case Report

    African Journals Online (AJOL)

    Alveolar rhabdomyosarcoma is an uncommon malignant soft tissue tumour rarely found in the female genital tract and carries a very poor prognosis especially in adults. A 44 year old premenopausal woman was evaluated for a lower abdominal mass, intermittent unprovoked vaginal bleeding and weight loss. Examination ...

  8. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings

    Directory of Open Access Journals (Sweden)

    Pilar Eguía-Aguilar

    2016-11-01

    The aggressive behavior of alveolar rhabdomyosarcoma has been associated with the expression of oncogenic fusion proteins resulting from chromosomal translocations, particularly t(2;13 (q35;q14 PAX3/FOXO1, and t(1;13 (p36;q14 PAX7/FOXO1 which were present in this patient.

  9. Complications in alveolar distraction osteogenesis of the atrophic mandible.

    NARCIS (Netherlands)

    Perdijk, F.B.T.; Meijer, G.J.; Strijen, P.J. van; Koole, R.A.

    2007-01-01

    To improve the starting point for placement of dental implants, 45 patients suffering from atrophied edentulous mandibles, with a vertical height varying between 7.3 and 15.8mm, were treated by alveolar vertical distraction osteogenesis (VDO). The mean follow-up period was 3 years, ranging from 1 to

  10. Alveolar pulmonary proteinosis: case report and literature review

    International Nuclear Information System (INIS)

    Vergara, Erika; Saenz, Alberto; Ojeda, Paulina

    2009-01-01

    We describe the case of a young women with primary alveolar proteinosis, with a short period of symptoms that are uncommon for this disease, without risk factors for this entity, the clinical evolution of the patient and some complications with the treatment. We review the literature for this entity.

  11. Buccal Infiltration versus Inferior Alveolar Nerve Block in Mandibular ...

    African Journals Online (AJOL)

    2018-04-04

    Apr 4, 2018 ... Purpose: The purpose of this study is to compare the success rates of inferior alveolar nerve block (IANB) and buccal infiltration anesthesia of mandibular second premolar with irreversible pulpitis and to evaluate the level of patient discomfort with these methods. Matherials and Methods: Forty patients, who.

  12. Alveolar Bone Housing- A Modified Wilkodontics Approach- A Case Report

    OpenAIRE

    Awasthi, Eshan; Sanjay, Kothamachu; Bhongade, ML; Shrivastav, Sunita

    2016-01-01

    Accelerated orthodontic treatment is the need of the hour in current scenario as the conventional orthodontics is time taking. Corticotomy assisted orthodontics have been used for years to reduce the treatment duration by reducing the resistance provided by alveolar bone housing.

  13. Three‑dimensional evaluation of alveolar bone thickness of ...

    African Journals Online (AJOL)

    Aim: The aim of this randomized study was to compare the alveolar bone thickness (ABT) of the mandibular incisor teeth of dental and skeletal Class I, II, and III adult patients at labial and lingual aspects of the bone and develop recommendations for the associated movements of teeth in this region, taking vertical facial type ...

  14. Alveolar ridge augmentation in rats by Bio-Oss

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1991-01-01

    The purpose of the study was to examine if Bio-Oss initiated osteoinduction or osteoconduction when implanted into rats. Sintered and unsintered granules of the anorganic bovine bone Bio-Oss was implanted subperiosteally for alveolar ridge augmentation purposes and heterotopically in the abdominal...

  15. The Effect of Astragalus Extractive on Alveolar Bone Rebuilding ...

    African Journals Online (AJOL)

    Background: Postmenopausal osteoporosis (PMO) is an estrogen deficiency condition that causes severe loss of bone mass in the vertebrae and long bones. We explored the effect and the possible underlying mechanism of the extracts of Astragalus (AE) on the tooth alveolar bone rebuilding progress of postmenopausal ...

  16. Contribution of the tooth bud mesenchyme to alveolar bone

    Czech Academy of Sciences Publication Activity Database

    Diep, L.; Matalová, Eva; Mitsiadis, T. A.; Tucker, A. S.

    312B, č. 5 (2009), 510-517 ISSN 1552-5007 R&D Projects: GA ČR GC524/08/J032; GA AV ČR KJB500450802 Institutional research plan: CEZ:AV0Z50450515 Keywords : tooth * alveolar bone * bud Subject RIV: FF - HEENT, Dentistry Impact factor: 2.938, year: 2009

  17. Alveolar occupation infiltrations, eosinophilia in peripheral blood and bronchoalveolar lavage

    International Nuclear Information System (INIS)

    Hincapie Diaz, Gustavo Adolfo; Yama Mosquera, Erica; Guevara, Jairo

    2006-01-01

    A case of a patient of 25 years old is shown with the antecedent of no potable water consumption who entered for having pulmonary symptoms. Fever, presence of alveolar occupation infiltrations and eosinophilia in peripheral blood a treatment with antiparasitary started with a significant improvement of the symptoms, infiltrations and eosinophilia. it is considered eosinophilic pneumonia diagnostic by parasitary infection (Loeffler's syndrome)

  18. Pulmonary alveolar hemorrhage mimicking a pneumopathy: a rare ...

    African Journals Online (AJOL)

    Diffuse alveolar hemorrhage after percutaneous coronary intervention (PCI) is a rare complication. The diagnosis is difficult and can mimic by clinical and radiological features other diagnosis as pneumopathy. We herein report the case of a 63-year-old female admitted to the hospital for ST elevation myocardial infarction.

  19. Alveolar Ridge Split Technique Using Piezosurgery with Specially Designed Tips

    Directory of Open Access Journals (Sweden)

    Alessandro Moro

    2017-01-01

    Full Text Available The treatment of patients with atrophic ridge who need prosthetic rehabilitation is a common problem in oral and maxillofacial surgery. Among the various techniques introduced for the expansion of alveolar ridges with a horizontal bone deficit is the alveolar ridge split technique. The aim of this article is to give a description of some new tips that have been specifically designed for the treatment of atrophic ridges with transversal bone deficit. A two-step piezosurgical split technique is also described, based on specific osteotomies of the vestibular cortex and the use of a mandibular ramus graft as interpositional graft. A total of 15 patients were treated with the proposed new tips by our department. All the expanded areas were successful in providing an adequate width and height to insert implants according to the prosthetic plan and the proposed tips allowed obtaining the most from the alveolar ridge split technique and piezosurgery. These tips have made alveolar ridge split technique simple, safe, and effective for the treatment of horizontal and vertical bone defects. Furthermore the proposed piezosurgical split technique allows obtaining horizontal and vertical bone augmentation.

  20. Modulation of epithelial sodium channel in human alveolar epithelial ...

    African Journals Online (AJOL)

    Modulation of epithelial sodium channel in human alveolar epithelial cells by lipoxin A4 through AhR-cAMP-dependent pathway. Bi-Huan Cheng, Li-Wei Pan, Sheng-Rong Zhang, Bin-Yu Ying, Ben-Ji Wang, Guo-Liang Lin, Shi-Fang Ding ...

  1. Structural changes and effect of denopamine on alveolar fluid ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... sectioning plane, and D = the mean caliper diameter of pulmonary cell nuclei. The frequency of occurrence of nuclear profiles per unit area of a random sectioning plane (NA) was determined using the electron microscope. ..... Chronic pulmonary artery occlusion increases alveolar fluid clearance in rats.

  2. Pulmonary alveolar proteinosis — a case report and review

    African Journals Online (AJOL)

    Enrique

    with granular, eosinophilic, proteina- ceous material (Fig. 2) with preserva- tion of the alveolar architecture. The patient was treated by whole-lung lavage, followed by a 4-week trial of subcutaneous granulocyte-macro- phage colony-stimulating factor. (GM-CSF). The trial of GM-CSF failed, however, and the patient is cur-.

  3. Alveolar occupation infiltrations, eosinophilia in peripheral blood and bronchoalveolar lavage

    International Nuclear Information System (INIS)

    Hincapie Diaz, Gustavo Adolfo; Yama Mosquera, Erica; Guevara, Jairo

    2006-01-01

    A case of a patient of 25 years old is shown with the antecedent of no potable water consumption who entered for having pulmonary symptoms, fever, presence of alveolar occupation infiltrations and eosinophilia in peripheral blood treatment with antiparasitary started with a significant improvement of the symptoms, infiltrations and eosinophilia. It is considered eosinophilic pneumonia diagnostic by parasitary infection (Loefffers Syndrome)

  4. Buccal infiltration versus inferior alveolar nerve block in mandibular ...

    African Journals Online (AJOL)

    Purpose: The purpose of this study is to compare the success rates of inferior alveolar nerve block (IANB) and buccal infiltration anesthesia of mandibular second premolar with irreversible pulpitis and to evaluate the level of patient discomfort with these methods. Materials and Methods: Forty patients, who had irreversible ...

  5. Arterial-alveolar oxygen partial pressure ratio: a theoretical reappraisal.

    Science.gov (United States)

    Viale, J P; Percival, C J; Annat, G; Rousselet, B; Motin, J

    1986-02-01

    The relationship between the arterial-alveolar oxygen partial pressure ratio (PaO2/PAO2) and different fractions of inspired oxygen (FIO2) was studied using a bicompartmental computer model. PaO2/PAO2 was found to be less stable than in previous clinical works probably because the venous admixture varied with changes in the FIO2.

  6. The role of alveolar type II cells in swine leptospirosis

    Directory of Open Access Journals (Sweden)

    Ângela P. Campos

    2015-07-01

    Full Text Available Abstract: This study aimed to investigate a possible relationship between alveolar type II cells and the inflammatory response to infection with Leptospira spp., and thus comprise a further element that can be involved in the pathogenesis of lung injury in naturally infected pigs. The study group consisted of 73 adult pigs that were extensively reared and slaughtered in Teresina, Piauí state, and Timon, Maranhão state, Brazil. The diagnosis of leptospirosis was made using the microscopic agglutination test (MAT aided by immunohistochemistry and polymerase chain reaction. The MAT registered the occurrence of anti-Leptospira antibodies in 10.96% (8/73 of the pigs. Immunohistochemistry allowed for the visualization of the Leptospira spp. antigen in the lungs of 87.67% (64/73 of the pigs. There was hyperplasia of bronchus-associated lymphoid tissue and circulatory changes, such as congestion of alveolar septa, parenchymal hemorrhage and edema within the alveoli. Lung inflammation was more intense (p = 0.0312 in infected animals, which also showed increased thickening of the alveolar septa (p = 0.0006. Evaluation of alveolar type II (ATII cells using an anti-TTF-1 (Thyroid Transcription Factor-1 antibody showed that there were more immunostained cells in the non-infected pigs (53.8% than in the infected animals (46.2% and that there was an inverse correlation between TTF-1 positive cells and the inflammatory infiltrate. There was no amplification of Leptospira DNA in the lung samples, but leptospiral DNA amplification was observed in the kidneys. The results of this study showed that a relationship exists between a decrease in alveolar type II cells and a leptospire infection. Thus, this work points to the importance of studying the ATII cells as a potential marker of the level of lung innate immune response during leptospirosis in pigs.

  7. Hard tissue augmentation for alveolar defects before implant placement

    Directory of Open Access Journals (Sweden)

    Mutia Rochmawati

    2017-08-01

    Full Text Available Background. Often when planning implant therapy, there is a need to augment or  replace  bone  that  has  been  lost. The alveolar defects may occur as a result of tooth loss due to extraction, advanced periodontal diseases or trauma, long term use of removable appliances, dehiscence and fenestration defects, developmental defects/clefts, congenitally missing teeth and odontogenic cysts and tumors. Insufficient bone volume can be brought about by hard tissue augmentation. This techniques have led to increased predictability in reconstruction of alveolar ridge defects and functional implant placement. Purpose. To describe the methods of hard tissue augmentation which can be done with block grafts (autografts and allografts, particulate grafts (cortical and cancellous, xenografts, or synthetic materials. Review. The reconstruction of a normal alveolar housing, in height and width, is imperative to achieve a harmonious balance between biology, function, and aesthetics. Depending on the size and morphology of the defect, horizontal or vertical, various augmentation procedures can be used. Soft tissue management is a critical aspect of hard tissue augmentation procedures. Incisions, reflection, and manipulation should be designed to optimize blood supply and wound closure. The design and management of mucoperiosteal flaps must consider the increased dimensions of the ridge after augmentation as well as esthetics and approximation of the wound margins. The surgical procedure needs to be executed with utmost care to preserve the maximum vascularity to the flap and minimize tissue injury. Conclusion. Alveolar ridge defects can be classified by using Seibert’s classification or HVC System. The treatment of alveolar ridge defect before implant placement can be done with hard tissue augmentation.

  8. Alveolar wound healing after implantation with a pool of commercially available bovine bone morphogenetic proteins (BMPs): a histometric study in rats.

    Science.gov (United States)

    Calixto, Romeu Felipe Elias; Teófilo, Juliana Mazzonetto; Brentegani, Luiz Guilherme; Lamano-Carvalho, Teresa Lúcia

    2007-01-01

    The capacity of a commercially available pool of bovine bone morphogenetic proteins (BMPs) to stimulate osteogenesis in the rat alveolar healing was investigated by histometric analysis. Male rats were anesthetized and had their upper incisor extracted. A pool of purified bovine BMPs adsorbed to microgranular resorbable hydroxyapatite was agglutinated with bovine collagen and saline before implantation into the alveolar socket. The implanted and control rats (n=30 per group) were sacrificed 1 to 9 weeks postoperatively, the hemi-maxillae were decalcified, processed for paraffin embedding and semi-serial longitudinal sections were obtained and stained with hematoxylin and eosin. The volume fraction of alveolar healing components was estimated by a differential point-counting method in histologic images. The results showed that in both, control and implanted rats, the alveolar healing followed the histologic pattern usually described in the literature. Quantitative data confirmed that the BMPs mixture did not stimulate new bone formation in the alveolar socket of implanted rats. These results suggest that the pool of BMPs adsorbed to hydroxyapatite and agglutinated with bovine collagen did not warrant incorporation of the osteoinductive proteins to a slow-absorption system that would allow a BMPs release rate compatible to that of new bone formation, and thus more adequate to osteoinduction.

  9. Alveolar but not intravenous S-ketamine inhibits alveolar sodium transport and lung fluid clearance in rats

    NARCIS (Netherlands)

    Berger, Marc M.; Pitzer, Bernhard; Zügel, Stefanie; Wieland, Catharina W.; Vlaar, Alexander P.; Schultz, Marcus J.; Dahan, Albert; Bärtsch, Peter; Hollmann, Markus W.; Mairbäurl, Heimo

    2010-01-01

    BACKGROUND: S-ketamine is frequently used for analgosedation, especially during sepsis and cardiovascular instability. Because S-ketamine blocks voltage-gated sodium (Na+) channels in neurons and skeletal muscle, it is conceivable that S-ketamine also blocks alveolar epithelial Na+ channels that are

  10. Distracción osteogénica alveolar como método de aumento del reborde alveolar

    Directory of Open Access Journals (Sweden)

    Denia Morales Navarro

    2011-03-01

    Full Text Available La distracción osteogénica alveolar, como proceso biológico de neoformación de hueso alveolar, nos motivó a la realización de la presente revisión bibliográfica, con el objetivo enfatizar en el análisis de las variables: antecedentes históricos en Cuba, clasificación de los distractores, fases de la distracción (latencia, distracción y consolidación, indicaciones, contraindicaciones, ventajas, desventajas y complicaciones. Se realizó una revisión bibliográfica mediante la consulta de bases de datos de los sistemas referativos, como MEDLINE y PubMed con la utilización de descriptores "alveolar distraction" y "osteogenic distraction". Se consultaron las fuentes bibliográficas publicadas fundamentalmente en los últimos 5 años, lo que reveló que esta técnica es una excelente alternativa para la formación de huesos y tejidos blandos en zonas de atrofia alveolar, que consta de tres etapas: latencia, distracción y consolidación; un método previsible y con bajas tasas de reabsorción ósea en comparación con otras técnicas de aumento del reborde alveolar. Tiene su principal indicación en la terapia de implantes al proveer volumen óseo. Debemos individualizar cada caso y usar el método más adecuado según las características clínicas y personales del paciente. Una adecuada selección de los casos y una mejor comprensión de la técnica son los puntales para lograr exitosos resultados mediante la distracción osteogénica alveolar. En Cuba se ha aplicado poco la distracción alveolar, por lo que ha sido necesario ampliar los estudios sobre esta temática.

  11. A method for measuring post-extraction alveolar dimensional changes with volumetric computed tomography.

    Science.gov (United States)

    Bontá, Hernán; Galli, Federico G; Caride, Facundo; Carranza, Nelson

    2012-01-01

    The aim of this study is to present a predictable method for evaluating dimensional changes in the alveolar ridge through cone beam computed tomography (CT). Twenty subjects with single-rooted tooth extraction indication were selected for this preliminary report, which is part of a larger ongoing investigation. After extraction, two CT scans were performed; the first within 24 hours post-extraction (TC1) and the second 6 months (TC2) later. A radiographic guide with a radiopaque element placed along the tooth axis was developed to locate the same plane of reference in two different CT scans. For each patient, backtrack analysis was performed in order to establish the reproducibility error of a predetermined point in space between two CT scans. Briefly, an anatomical landmark was selected and its coordinates to the radiopaque marker were recorded. One week later, the coordinates were followed backwards in the same CT scan to obtain the position where the reference point should be located. A similar process was carried out between two different CT scans taken 6 months apart. The distance between the anatomical reference and the obtained point of position was calculated to establish the accuracy of the method. Additionally, a novel method for evaluating dimensional changes of the alveolus after tooth extraction is presented. The backtrack analysis determined an average within-examiner discrepancy between both measurements from the same CT scan of 0.19 mm. SD +/- 0.05. With the method presented herein, a reference point in a CT scan can be accurately backtracked and located in a second CT scan taken six months later. Taken together they open the possibility of calculating dimensional changes that occur in the alveolar ridge over time, such as post-extraction alveolar resorption, or the bone volume gained after different augmentation procedures.

  12. Activation of Alveolar Macrophages after Plutonium Oxide Inhalation in Rats: Involvement in the Early Inflammatory Response

    Energy Technology Data Exchange (ETDEWEB)

    Van der Meeren, A.; Tourdes, F.; Gremy, O.; Grillon, G.; Abram, M.C.; Poncy, J.L.; Griffiths, N. [CEA, DSV, DRR, SRCA, Centre DAM Ile de France, F-91297 Bruyeres Le Chatel, Arpajon (France)

    2008-07-01

    Alveolar macrophages play an important role in the distribution, clearance and inflammatory reactions after particle inhalation, which may influence long-term events such as fibrosis and tumorigenesis. The objectives of the present study were to investigate the early inflammatory events after plutonium oxide inhalation in rats and involvement of alveolar macrophages. Lung changes were studied from 3 days to 3 months after inhalation of PuO{sub 2} or different isotopic compositions (70% or 97% {sup 239}Pu) and initial lung deposits (range 2.1 to 43.4 kBq/rat). Analyses of bronchoalveolar lavages showed early increases in the numbers of granulocytes, lymphocytes and multi-nucleated macrophages. The activation of macrophages was evaluated ex vivo by measurement of inflammatory mediator levels in culture supernatants. TNF-alpha and chemokine MCP-1, MIP-2 and CINC-1 production was elevated from 7 days after inhalation and remained so up to 3 months. In contrast, IL-1 beta, IL-6 and IL-10 production was unchanged. At 6 weeks, pulmonary macrophage numbers and activation state were increased as observed from an immunohistochemistry study of lung sections with anti-ED1. Similarly, histological analyses of lung sections also showed evidence of inflammatory responses. In conclusion, our results indicate early inflammatory changes in the lungs of PuO{sub 2}-contaminated animals and the involvement of macrophages in this process. A dose-effect relationship was observed between the amount of radionuclide inhaled or retained at the time of analysis and inflammatory mediator production by alveolar macrophages 14 days after exposure. For similar initial lung deposits, the inflammatory manifestation appears higher for 97% {sup 239}Pu than for 70% {sup 239}Pu. (authors)

  13. Characteristic aspects of alveolar proteinosis diagnosis Aspectos característicos do diagnóstico da proteinose alveolar

    Directory of Open Access Journals (Sweden)

    Thiago Prudente Bártholo

    2012-02-01

    Full Text Available Alveolar proteinosis is an uncommon pulmonary disease characterized by an accumulation of surfactant in terminal airway and alveoli, thereby impairing gas exchange and engendering respiratory insufficiency in some cases. Three clinically and etiologically distinct forms of pulmonary alveolar proteinosis are recognized: congenital, secondary and idiopathic, the latter corresponding to 90% of the cases. In this case report we present a young male patient that was diagnosed with alveolar proteinosis. Computed tomography of the thorax, bronchoscopy and transbronchial biopsy were performed. The histopathologic aspect was characteristic. The patient was discharged in good health conditions and remains asymptomatic to date.Proteinose alveolar é uma doença pulmonar incomum caracterizada pelo acúmulo de surfactante nas vias aéreas terminais e nos alvéolos, alterando a troca gasosa e, em alguns casos, promovendo insuficiência respiratória. Três formas clínicas e etiologicamente distintas de proteinose alveolar são reconhecidas: congênitas, secundárias e idiopáticas (mais de 90% dos casos são de etiologia idiopática. Neste relato, apresentamos um homem jovem que foi diagnosticado com proteinose pulmonar. Tomografia computadorizada de tórax, broncoscopia e biópsia transbrônquica foram realizadas. O aspecto histopatológico foi característico. O paciente teve alta, com boas condições de saúde, e encontra-se assintomático nos dias de hoje.

  14. Effect of antiresorptive drugs in the alveolar bone healing. A histometric and immunohistochemical study in ovariectomized rats.

    Science.gov (United States)

    Ramalho-Ferreira, Gabriel; Faverani, Leonardo Perez; Momesso, Gustavo Antonio Correa; Luvizuto, Eloá Rodrigues; de Oliveira Puttini, Igor; Okamoto, Roberta

    2017-06-01

    The aim of this study is to evaluate the alendronate and raloxifene influence in the alveolar healing process of osteoporotic rats. Sixty-four female rats were divided in four groups: sham rats (SHAM), ovariectomized rats and no medical treatment (OVX NT), ovariectomized rats and submitted to alendronate treatment (OVX ALE), and ovariectomized and submitted to raloxifene treatment (OVX RAL). The histomorphometrical and immunohistochemical analysis was performed. The quantitative data were analyzed through Kruskal-Wallis and Dunn tests (α = 0.05). In the longest period, SHAM and OVX RAL groups showed the better bone formation responses (P alveolar healing process in osteoporotic rats, but not enough to achieve the histometrical and protein expression values that were observed in the SHAM group. Alendronate is largely used as a potent antiresorptive agent. Otherwise, considering the undesirable effects in relation to the alveolar healing, other antiosteoporosis medications should be studied. Raloxifene seems to be a good candidate once its action mechanism involves the activation of osteoblasts.

  15. CT findings of extrahepatic alveolar echinococcus (report of 12 cases)

    International Nuclear Information System (INIS)

    Liu Wenya; Shang Ge; Dang Jun

    2000-01-01

    Objective: To analyze the CT findings of extrahepatic alveolar echinococcus (EAE), and assess the value of CT scanning for the diagnosis of such cases. Methods: 12 patients with hepatic alveolar echinococcus (HAE) verified by operation and histology were examined by CT because of new complains. It was found that multiple organs were involved by the same lesions. Results: Brain AE (7 cases) showed single or multiple cerebral nodules, characterized by honeycombed hypodense structures or target sign after enhancement. Lung AE (3 cases) appeared as irregular, peripherally scattered nodules, with small vacuoles or cavities inside. The only 1 case with heart AE demonstrated a multiple calcifications and vacuoles within the mass. Adrenal gland AE (2 cases) presented as plaques containing different sizes of hypodense areas and calcifications. Retroperitoneal AE (2 cases) exhibited mass with plentiful calcifications. Conclusion: CT can define the location and morphology of the lesion, providing a reliable method for the diagnosis and treatment of the disease

  16. Tranexamic acid in diffuse alveolar hemorrhage (case report

    Directory of Open Access Journals (Sweden)

    Owlia MB

    2007-05-01

    Full Text Available Background: Wagener's granulomatosis (WG is a systemic necrotizing vasculitis characterized by upper and lower respiratory tract involvement and glomerulonephritis in most instances. Case Report: We report a 36 years old man with DAH secondary to WG, as the presenting feature. He successfully treated with standard immune suppressive agents including pulse methylprednisolone and cyclophospha-mide, along with tranexamic acid as adjunctive therapy for control of active bleeding. Laboratory results showed mild to moderate anemia, increased serum lactate dehydrogenase and very high c-ANCA titer. Chest radiograph showed bilateral alveolar infilterates. Conclusion: Diffuse Alveolar hemorrhage (DAH is a dread complication of Wagener’s granulomatosis. Control of acute phase of hemorrhage with tranexamic acid can improve out come of patients.

  17. Post-neonatal drop in alveolar SP-A expression

    DEFF Research Database (Denmark)

    Stray-Pedersen, Arne; Vege, Ashild; Stray-Pedersen, Asbjorg

    2008-01-01

    BACKGROUND: Surfactant protein A (SP-A) is synthesized in the lung and is a part of the innate immune system. The aim of this study was to evaluate the expression of SP-A in lung tissue from fetuses, infants, children and adults with special regard to sudden infant death syndrome (SIDS). METHODS......: A total of 160 cases were studied; 19 fetuses and neonates, 59 SIDS and 49 explained infant deaths below 1 year of age, 19 toddlers and 14 adults. Immunohistochemical detection of SP-A using monoclonal antibodies was performed by microscopy of lung tissue specimens collected at autopsy. A scoring system...... was developed enabling semi-quantitative estimation of staining intensity and distribution. RESULTS: SP-A was detected in the terminal bronchioles and alveolar spaces of fetuses >35 weeks gestation. The intra-alveolar SP-A expression increased in the perinatal period followed by a marked drop in infants aged...

  18. Diffuse alveolar hemorrhage resulting from Pauci-immune pulmonary capillaritis

    Directory of Open Access Journals (Sweden)

    Andreia Salarini Monteiro

    2003-08-01

    Full Text Available A 27 year-old female patient, cocaine user, presenting hemoptysis and progressive dyspnea with onset 48 hours prior to hospital admission, without any other signs or symptoms. Serum tests for infectious diseases, collagen disorders and vasculitis were negative. Urinalysis was normal. Computed tomography of the chest showed diffuse alveolar infiltrate, affecting mainly the lower left lobe. A thoracoscopic lung biopsy was performed to clarify the diagnosis. The histopathological findings showed capillaritis and diffuse intra-alveolar hemorrhage. Treated with steroid and cyclophosphamide pulse therapy, a good clinical and radiographical response was obtained. The recently described pauci-immune pulmonary capillaritis is characterized by the presence of isolated pulmonary capillaritis and negative serum testing for auto-immune diseases.

  19. AUTOMATIC SEGMENTATION AND CLASSIFICATION OF CELLS FROM BRONCHO ALVEOLAR LAVAGE

    Directory of Open Access Journals (Sweden)

    Olivier Lezoray

    2011-05-01

    Full Text Available Broncho alveolar lavage is the most commonly used diagnostic tool for confirming alveolar hemorrhage. Golde has introduced a ranking score, based on the hemosiderin content of macrophages which enables ranking cells from 0 to 4 based on the degree of Prussian blue stain. We propose a complete image analysis scheme to automatically perform both the extraction of the cellular objects and the ranking of each cell according to the Golde score. The image analysis techniques used mainly involve clustering and mathematical morphology. A 2D histogram is clustered to extract the main cellular components, a color watershed is used to determine and refine the regions. Finally, the cellular components of interest are firstly classified according to their hue and secondly according to their staining repartition. The proposed image analysis technique is very fast and produces reliable and accurate results.

  20. Alveolar ridge augmentation in rats by Bio-Oss

    DEFF Research Database (Denmark)

    Pinholt, E M; Bang, G; Haanaes, H R

    1991-01-01

    The purpose of the study was to examine if Bio-Oss initiated osteoinduction or osteoconduction when implanted into rats. Sintered and unsintered granules of the anorganic bovine bone Bio-Oss was implanted subperiosteally for alveolar ridge augmentation purposes and heterotopically in the abdominal...... muscles of rats. Light microscopic evaluation revealed no osteoinduction or osteoconduction in connection with sintered or unsintered Bio-Oss. A foreign body reaction was observed around both forms....

  1. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings

    OpenAIRE

    Eguía-Aguilar, Pilar; López-Martínez, Briceida; Retana-Contreras, Carmen; Perezpeña-Diazconti, Mario

    2016-01-01

    We present the case of a 2-year-old male patient with a facial tumor partially treated with chemotherapy before his admission to our institution. The tumor involved from the frontal region to the maxillary floor, the orbit, and the maxillary and sphenoid sinuses. The histopathological diagnosis revealed a stage IV alveolar rhabdomyosarcoma with infiltration to bone marrow and cerebrospinal fluid. He was managed with four cycles of adriamycin, actinomycin, cyclophosphamide and vincristine; cis...

  2. Nerve damage associated with inferior alveolar nerve blocks.

    Science.gov (United States)

    Pogrel, M A; Bryan, J; Regezi, J

    1995-08-01

    The authors reviewed 12 cases in which altered sensation occurred in the distribution of the inferior alveolar or lingual nerves following injection of a local anesthetic for restorative treatment only. Most patients suffered only partial damage, but recovery was poor. The exact mechanism of the nerve damage is unknown, but a number of theories are proposed. The extent of this problem is also unknown, but many more cases probably exist than have been reported to date.

  3. Modulation of epithelial sodium channel in human alveolar epithelial ...

    African Journals Online (AJOL)

    Modulation of epithelial sodium channel in human alveolar epithelial cells by lipoxin A4 through AhR-cAMP-dependent pathway. Bi-Huan Cheng1,2, Li-Wei Pan2, Sheng-Rong Zhang3, Bin-Yu Ying2, Ben-Ji. Wang2, Guo-Liang Lin2 and Shi-Fang Ding1*. 1Department of Critical Care Medicine, Qilu Hospital of Shandong ...

  4. Oxidative Stress, Cell Death, and Other Damage to Alveolar Epithelial Cells Induced by Cigarette Smoke

    Directory of Open Access Journals (Sweden)

    Nagai A

    2003-09-01

    Full Text Available Abstract Cigarette smoking is a major risk factor in the development of various lung diseases, including pulmonary emphysema, pulmonary fibrosis, and lung cancer. The mechanisms of these diseases include alterations in alveolar epithelial cells, which are essential in the maintenance of normal alveolar architecture and function. Following cigarette smoking, alterations in alveolar epithelial cells induce an increase in epithelial permeability, a decrease in surfactant production, the inappropriate production of inflammatory cytokines and growth factors, and an increased risk of lung cancer. However, the most deleterious effect of cigarette smoke on alveolar epithelial cells is cell death, i.e., either apoptosis or necrosis depending on the magnitude of cigarette smoke exposure. Cell death induced by cigarette smoke exposure can largely be accounted for by an enhancement in oxidative stress. In fact, cigarette smoke contains and generates many reactive oxygen species that damage alveolar epithelial cells. Whether apoptosis and/or necrosis in alveolar epithelial cells is enhanced in healthy cigarette smokers is presently unclear. However, recent evidence indicates that the apoptosis of alveolar epithelial cells and alveolar endothelial cells is involved in the pathogenesis of pulmonary emphysema, an important cigarette smoke-induced lung disease characterized by the loss of alveolar structures. This review will discuss oxidative stress, cell death, and other damage to alveolar epithelial cells induced by cigarette smoke.

  5. Simulation of lung alveolar epithelial wound healing in vitro.

    Science.gov (United States)

    Kim, Sean H J; Matthay, Michael A; Mostov, Keith; Hunt, C Anthony

    2010-08-06

    The mechanisms that enable and regulate alveolar type II (AT II) epithelial cell wound healing in vitro and in vivo remain largely unknown and need further elucidation. We used an in silico AT II cell-mimetic analogue to explore and better understand plausible wound healing mechanisms for two conditions: cyst repair in three-dimensional cultures and monolayer wound healing. Starting with the analogue that validated for key features of AT II cystogenesis in vitro, we devised an additional cell rearrangement action enabling cyst repair. Monolayer repair was enabled by providing 'cells' a control mechanism to switch automatically to a repair mode in the presence of a distress signal. In cyst wound simulations, the revised analogue closed wounds by adhering to essentially the same axioms available for alveolar-like cystogenesis. In silico cell proliferation was not needed. The analogue recovered within a few simulation cycles but required a longer recovery time for larger or multiple wounds. In simulated monolayer wound repair, diffusive factor-mediated 'cell' migration led to repair patterns comparable to those of in vitro cultures exposed to different growth factors. Simulations predicted directional cell locomotion to be critical for successful in vitro wound repair. We anticipate that with further use and refinement, the methods used will develop as a rigorous, extensible means of unravelling mechanisms of lung alveolar repair and regeneration.

  6. Diffuse alveolar hemorrhage in isolated pulmonary capillaritis: Case report

    Directory of Open Access Journals (Sweden)

    Medenica Milić

    2014-01-01

    Full Text Available Introduction. Pulmonary capillaritis is a small-diameter vessel vasculitis of the lung, which may occur in isolation as in isolated pauci-immune capillaritis, usually associated with the systemic vasculitis but it could be also related to collagen vascular diseases and in lung transplant rejection. Pulmonary capillaritis leads to diffuse alveolar hemorrhage. The clinical presentation includes symptoms like dyspnea, cough, pleuritic chest pain, fever and hemoptysis. Case Outline. A 48 year-old female patient, smoker, presented with progressive dyspnea. Serum tests for infectious diseases, collagen disorders and vasculitis were negative. Radiography and computed tomography of the chest showed diffuse alveolar infiltrates. Cytology of bronchoalveolar lavage showed presence of siderophages. A thoracoscopic lung biopsy was performed to clarify the diagnosis. The histopathological findings showed capillaritis and diffuse intraalveolar hemorrhage. Patient was treated with steroids, and good clinical and minimal radiographic response was obtained. Recently described pauci-immune pulmonary capillaritis has been characterized as p-ANCA (antineutrophil cytoplasmic antibodies negative isolated pulmonary capillaritis. Conclusion. Isolated pauci-immune pulmonary capillaritis is a rare disease. First clinical manifestations of the isolated pulmonary capillaritis were the symptoms of progressive dyspnea, radiographic and functional signs of the interstitial fibrosis. At the same time, the signs of extrapulmonary diseases were not found. Presence of siderophages in bronchoalveolar lavage indicated alveolar hemorrhage. Histopathological tests of the sample of the lung pointed to pulmonary capillaritis and intraalveolar hemorrhage. Prolonged treatment with corticosteroids was necessary.

  7. Strategies for alveolar ridge reconstruction and preservation for implant therapy.

    Science.gov (United States)

    Masaki, Chihiro; Nakamoto, Tetsuji; Mukaibo, Taro; Kondo, Yusuke; Hosokawa, Ryuji

    2015-10-01

    In dental implant treatment, ridge preservation and immediate or early implant placement are recommended to minimize bone resorption after tooth extraction and achieve esthetic outcomes. However, there is no consensus concerning the efficacy of this surgical method. There is also no consensus on the efficacy of bone and soft tissue grafts and surgical methods for alveolar ridge reconstruction. This paper reports ridge alteration in the anterior maxilla after tooth extraction, and summarizes the efficacy of various ridge preservation methods and immediate or early implant placement as alveolar ridge preservation methods to minimize bone resorption after tooth extraction. The advantages and complications of alveolar ridge reconstruction methods, and the efficacy and surgical method of soft tissue graft are reviewed. The anterior maxilla is in the esthetic zone, and the thickness of the bone on the labial side around the natural tooth is less than 1mm in many cases. Therefore, it is impossible to prevent bone resorption completely, even if ridge preservation and immediate or early implant placement are performed after tooth extraction. It is necessary to obtain stable and long-term esthetics by combining connective tissue and free gingival grafts, in addition to hard tissue augmentation. It is important to consider the burden and level of satisfaction of patients, such as in terms of donor site morbidity in hard and soft tissue grafting, and to pay attention to appropriate indications to avoid overtreatment. Copyright © 2015 Japan Prosthodontic Society. Published by Elsevier Ltd. All rights reserved.

  8. Effect of Alveolar Ridge Preservation after Tooth Extraction

    Science.gov (United States)

    Avila-Ortiz, G.; Elangovan, S.; Kramer, K.W.O.; Blanchette, D.; Dawson, D.V.

    2014-01-01

    Alveolar ridge preservation strategies are indicated to minimize the loss of ridge volume that typically follows tooth extraction. The aim of this systematic review was to determine the effect that socket filling with a bone grafting material has on the prevention of postextraction alveolar ridge volume loss as compared with tooth extraction alone in nonmolar teeth. Five electronic databases were searched to identify randomized clinical trials that fulfilled the eligibility criteria. Literature screening and article selection were conducted by 3 independent reviewers, while data extraction was performed by 2 independent reviewers. Outcome measures were mean horizontal ridge changes (buccolingual) and vertical ridge changes (midbuccal, midlingual, mesial, and distal). The influence of several variables of interest (i.e., flap elevation, membrane usage, and type of bone substitute employed) on the outcomes of ridge preservation therapy was explored via subgroup analyses. We found that alveolar ridge preservation is effective in limiting physiologic ridge reduction as compared with tooth extraction alone. The clinical magnitude of the effect was 1.89 mm (95% confidence interval [CI]: 1.41, 2.36; p preservation. PMID:24966231

  9. Effects of alveolar ridge preservation on delayed implant osseointegration.

    Science.gov (United States)

    Shao, Shan; Li, Bin; Xue, Hui-Min; Huang, Hai-Yun; Liu, Gang-Li

    2015-01-01

    To evaluate the effects of alveolar ridge preservation with Bio-Oss bone substitute (Geistlich Pharma) on delayed implant osseointegration. The 3rd and 4th left and right mandibular premolars were extracted from four adult healthy male and female dogs. For the experimental group, we randomly selected two extraction sockets in each dog to be filled with Bio-Oss bone substitute (Geistlich Pharma). The two remaining extraction sockets remained untreated and served as the control group. Three months after Bio-Oss placement, dental implants were inserted into the alveolar bone of the experimental group and the control group. The osteogenic activity of the bone around the implants was assessed by evaluating the histological morphology and by estimating histomorphometric parameters at 3 and 6 months after delayed implantation. At 3 months, Goldner's trichrome staining analysis showed that the bone-implant contact rate and mineralised bone area around the implant were significantly higher in the experimental group (75.98% ± 8.97% and 69.52% ± 9.63%, respectively) than in the control group (56.13% ± 8.18% and 52.82% ± 7.25%, respectively; P alveolar ridge preservation by using Bio-Oss placement can promote osseointegration of delayed implantation. This may be a promising option for clinical use.

  10. Pulmonary alveolar microlithiasis: review of the 1022 cases reported worldwide

    Directory of Open Access Journals (Sweden)

    Giuseppe Castellana

    2015-12-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a rare disease characterised by the widespread intra-alveolar accumulation of minute calculi called microliths. It is caused by mutation of the SLC34A2 gene encoding the type IIb sodium phosphate cotransporter in alveolar type II cells. The present study explores the epidemiological, familial, genetic, clinical, diagnostic, radiological and therapeutic aspects with the aim of contributing to a better understanding of this uncommon disease. We searched articles on PAM published up to December 2014 and 544 papers were found, accounting for 1022 cases. PAM is present in all continents and in many nations, in particular in Turkey, China, Japan, India, Italy and the USA. Familiality is frequent. The clinical course is not uniform and the causes of this clinical variability seem to be largely nongenetic. The optimal diagnostic procedure is the association of chest high-resolution computed tomography (HRCT with bronchoalveolar lavage, but a chest radiograph may suffice in families in which a case has already been diagnosed. Moreover, chest radiography and HRCT allow the classification of the evolutionary phase of the disease and its severity. At present lung transplantation is the only effective therapy. However, better knowledge of the gene responsible offers hope for new therapies.

  11. Alveolar echinococcosis of the liver. Findings of magnetic resonance imaging

    Energy Technology Data Exchange (ETDEWEB)

    Hayasaka, Kazumasa; Tanaka, Yoshiaki; Okuhata, Yoshitaka; Yoshinobu, Takashi; Takemoto, Akiko; Himi, Kazuhisa; Mutoh, Haruomi [Nihon Univ., Tokyo (Japan). School of Medicine; Shuke, Noriyuki; Aburano, Tamio

    1995-06-01

    The purpose of the present study was to evaluate the findings of MR imaging obtained in patients with Echinococcus multilocularis involving the liver. For 10 patients with alveolar echinococcosis of the liver, the MR findings were compared with the histopathologic findings after biopsy or surgery. Conventional T1-weighted spin echo, T2-weighted spin echo and T1-weighted spin echo after Gd-DTPA were employed. The signal from the lesions of alveolar liver echinococcosis on T1-weighted images was hypointense in 16 of 23 lesions (69.6%), hyperintense in 4 (17.4%), and isointense in 3 (13.0%). The signal from the lesions on T2-weighted images was hyperintense in 20 lesions (87.0%), hypointense in 2 (8.7%), and isointense in one (4.3%). On using Gd-DTPA, 7 of 21 lesions (33.3%) were observed with rim enhancement, and 14 lesions (66.7%) were non-enhanced. We describe our clinical experience together with the various findings of MR imaging as observed in the patients with alveolar echinococcosis of the liver. MR imaging excels in visualizing a low-intensity rim and small cystic foci, with liquefaction necrotic foci displaying a variety of signal intensities. After Gd-DTPA administration, the surrounding inflammatory granulomatous foci could be more clearly visualized. (author).

  12. Requirement of alveolar bone formation for eruption of rat molars.

    Science.gov (United States)

    Wise, Gary E; He, Hongzhi; Gutierrez, Dina L; Ring, Sherry; Yao, Shaomian

    2011-10-01

    Tooth eruption is a localized event that requires a dental follicle (DF) to regulate the resorption of alveolar bone to form an eruption pathway. During the intra-osseous phase of eruption, the tooth moves through this pathway. The mechanism or motive force that propels the tooth through this pathway is controversial but many studies have shown that alveolar bone growth at the base of the crypt occurs during eruption. To determine if this bone growth (osteogenesis) was causal, experiments were designed in which the expression of an osteogenic gene in the DF, bone morphogenetic protein-6 (Bmp6), was inhibited by injection of the first mandibular molar of the rat with a small interfering RNA (siRNA) targeted against Bmp6. The injection was followed by electroporation to promote uptake of the siRNA. In 45 first molars injected, eruption was either delayed or completely inhibited (seven molars). In the impacted molars, an eruption pathway formed but bone growth at the base of the crypt was greatly reduced compared with the erupted first-molar controls. These studies show that alveolar bone growth at the base of the crypt is required for tooth eruption and that Bmp6 may be essential for promoting this growth. © 2011 Eur J Oral Sci.

  13. Massive Alveolar Hemorrhage During Wegener Granulomatosis: a Case Report

    Directory of Open Access Journals (Sweden)

    Gökhan Perincek

    2011-11-01

    Full Text Available This is a presentation of Wegener Granulomatosis (WG disease. Even though the lungs are rarely affected. massive alveolar hemorrhage is seen which leads to mortality. The patient was a 28 year old man. His illness was diagnosed as WG and glomerulonephritis a year previously and he was treated by administration of methylprednisolone orally. He had been treated irregularly. He applied to the emergency service with hemoptysis and asthma complaints two days earlier. After the results of his examination Hb: 3.6 gr/dl, Htc:10.3%, Üre:131 mg /dl, kreatini: 7.7 mg/dl, pH: 7.41, pO2: 55 mmHg, pCO2:33 mmHg, and being diagnosed as alveolar consolidation on lung X-ray, he was taken to the intensive care unit with a diagnosis of a massive alveolar hemorrhagei. He was intubated and attached to mechanical ventilation. He was treated with parenteral 1 mg/kg/day methylprednisolone and, siklofosfamid 2 mg/kg/day. He was extubated on the 21st day. He was taken to the chest service department on 24th day. He is still being treated.

  14. Alveolar osteitis following surgical removal of mandibular third molars.

    Science.gov (United States)

    Fridrich, K L; Olson, R A

    1990-01-01

    The purpose of this study was to evaluate 2 methods that could be used universally to reduce the incidence of alveolar osteitis. In addition, other variables including age and sex of patient, preoperative aspirin use and discomfort, and the use of oral contraceptives (OCs) were studied. A large controlled prospective study was completed with 952 surgical extraction sites in 476 patients. Postoperative dressings included lincomycin hydrochloride (Lincocin)/absorbable gelatin sponge (Gelfoam), oxytetracycline HCL-hydrocortisone acetate (Terra-Cortril)/absorbable gelatin sponge, and absorbable gelatin sponge/saline. Bilaterally impacted mandibular 3rd molars of similar surgical difficulty were selected. Standard accepted surgical technique was used. Patients were seen 1 and 7 days after surgery or as needed. Lincomycin hydrochloride/absorbable gelatin sponge and oxytetracycline HC1-hydrocortisone acetate/absorbable gelatin sponge were effective in reducing the incidence of alveolar osteitis. Lincomycin hydrochloride/absorbable gelatin sponge is preferred because of the increased morbidity associated with dressings containing petrolatum products. Absorbable gelatin sponge alone is not effective in reducing the incidence of alveolar osteitis. Age and OC use were found to be significant factors in the incidence of this problem.

  15. Identification of genes differentially regulated in rat alveolar bone wound healing by subtractive hybridization.

    Science.gov (United States)

    Ohira, T; Myokai, F; Shiomi, N; Yamashiro, K; Yamamoto, T; Murayama, Y; Arai, H; Nishimura, F; Takashiba, S

    2004-07-01

    Periodontal healing requires the participation of regulatory molecules, cells, and scaffold or matrix. Here, we hypothesized that a certain set of genes is expressed in alveolar bone wound healing. Reciprocal subtraction gave 400 clones from the injured alveolar bone of Wistar rats. Identification of 34 genes and analysis of their expression in injured tissue revealed several clusters of unique gene regulation patterns, including the up-regulation at 1 wk of cytochrome c oxidase regulating electron transfer and energy metabolism, presumably occurring at the site of inflammation; up-regulation at 2.5 wks of pro-alpha-2 type I collagen involving the formation of a connective tissue structure; and up-regulation at 1 and 2 wks and down-regulation at 2.5 and 4 wks of ubiquitin carboxyl-terminal hydrolase l3 involving cell cycle, DNA repair, and stress response. The differential expression of genes may be associated with the processes of inflammation, wound contraction, and formation of a connective tissue structure.

  16. Experimental alveolitis in rats: microbiological, acute phase response and histometric characterization of delayed alveolar healing.

    Science.gov (United States)

    Rodrigues, Moacyr Tadeu Vicente; Cardoso, Camila Lopes; Carvalho, Paulo Sérgio Perri de; Cestari, Tânia Mary; Feres, Magda; Garlet, Gustavo Pompermaier; Ferreira, Osny

    2011-01-01

    The pathogenesis of alveolitis is not well known and therefore experimental situations that mimic some features of this disease should be developed. In this study, the evolution of the experimentally induced infection in rat sockets is characterized, which leads to clinical signs of suppurative alveolitis with remarkable wound healing disturbs. Non-infected (Group I) and experimentally infected sockets in Rattus novergicus (Group II) were histometrically evaluated regarding the kinetics of alveolar healing. In addition, the characterization of the present bacteria in inoculation material and the serum levels of C-reactive protein (CRP) were performed. The detected species were Capnocytophaga ochracea, Fusobacterium nucleatum ss nucleatum, Prevotella melaninogenica, Streptococcus anginosus, Treponema socranskii and Streptococcus sanguis. All experimentally infected rats developed suppurative alveolitis, showing higher levels of CRP in comparison to those non-infected ones. Furthermore, infected rats presented a significant delayed wound healing as measured by the histometric analysis (higher persistent polymorphonuclear infiltrate and lower density of newly formed bone). These findings indicate that rat sockets with experimentally induced infection produced higher levels of serum CRP, showing the potential of disseminated infection and a disturb in the alveolar repair process in an interesting experimental model for alveolitis studies.

  17. Cola beverage consumption delays alveolar bone healing: a histometric study in rats

    Directory of Open Access Journals (Sweden)

    Juliana Mazzonetto Teófilo

    2010-06-01

    Full Text Available Epidemiological studies have suggested that cola beverage consumption may affect bone metabolism and increase bone fracture risk. Experimental evidence linking cola beverage consumption to deleterious effects on bone is lacking. Herein, we investigated whether cola beverage consumption from weaning to early puberty delays the rate of reparative bone formation inside the socket of an extracted tooth in rats. Twenty male Wistar rats received cola beverage (cola group or tap water (control group ad libitum from the age of 23 days until tooth extraction at 42 days and euthanasia 2 and 3 weeks later. The neoformed bone volume inside the alveolar socket was estimated in semi-serial longitudinal sections using a quantitative differential point-counting method. Histological examination suggested a decrease in the osteogenic process within the tooth sockets of rats from both cola groups, which had thinner and sparser new bone trabeculae. Histometric data confirmed that alveolar bone healing was significantly delayed in cola-fed rats at three weeks after tooth extraction (ANOVA, p = 0.0006, followed by Tukey's test, p < 0.01. Although the results of studies in rats cannot be extrapolated directly to human clinical dentistry, the present study provides evidence that cola beverage consumption negatively affect maxillary bone formation.

  18. Electron-microscopic studies of alveolar macrophages from gamma-ray irradiated guinea pigs

    International Nuclear Information System (INIS)

    Krystev, Kh.; Najdenski, Kh.M.; Velyanov, D.K.; Radoevska, S.A.

    1988-01-01

    The alveolar macrophages (AM) were obtained from whole body gamma-irradiated guinea pigs (0.5 Gy and 2 Gy; 92.5 rad/min). The cell suspension contained granulocytes, lymphocytes and disintegrating epithelial and white blood cells, as well as two types of microphages: large (possessing nuclei of saddle bag-like or highly folded form) and small (with spherical or eggshaped nuclei). Eleven electronograms were presented showing all ultrastuctural changes of both small and large AM. The morphological differences between the small and large alveolar macrophages were slight. Marked changes were observed in the large AM on day 1 following 0.5 Gy irradiation: a considerable increase in dimensions of phagosomes turning in digestive vacuoles, lamellarly limited and containing osmiophilic, irregularly formed, densely or lamellarly arranged matter; folded nuclei with slightly vacuolized cytoplasm. The ultrastructural changes in the AM of sublethal dose (2 Gy) irradiated animals were stronger and regenerative processes in them were less possible. On day 30 after irradiation several damaged AM were observed with large digestive vacuoles of fine-grain content, vacuolized endoplasmic reticulum, entirely lyzed nuclear chromatin and free nuclei without cytoplasm. All observations were a convincing indication that guinea pigs AM were more radiosensitive than that obtained from rats and mice

  19. Relationship between the morphologic features of alveolar trabecular bone and systemic osteoporosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Chang Jin; Chang, Hoon Sang; Lee, Byung Do [Wonkwang University College of Medicine, Iksan (Korea, Republic of)

    2005-09-15

    The purpose of this study was to investigate the preliminary use of morphologic operation (MO) in analyzing trabecular pattern of alveolar bone for the predicting systemic osteoporosis. Study subjects consisted of 35 females (average age 48.5 years) and 25 males (average age 25.8 years). Bone mineral density BMD (grams/cm) of lumbar spine and proximal femur of these subjects were measured by a dual energy X-ray absorptiometry (DEXA). Regions of interest (ROIs) were selected from the digitized peri apical radiographs of subjects' posterior jaw. A custom computer program processed morphology operations of ROIs. We compared mean values of 11 MO variables according to the osteoporotic group divided by the T-scores of DEXA. We also studied correlation between radiographic density and these MO variables. The mean radiographic densities insignificantly correlated with MO variables. There were statistically significant differences among the values of 9 MO variables according to the osteoporotic group. Morphologic operation can be effective in analyzing trabecular pattern of alveolar bone for the predicting osteoporosis.

  20. Alveolar socket preservation technique: Effect of biomaterial on bone regenerative pattern.

    Science.gov (United States)

    Canullo, Luigi; Pellegrini, Gaia; Canciani, Elena; Heinemann, Friedhelm; Galliera, Emanuela; Dellavia, Claudia

    2016-07-01

    There is a lack of evidence in the literature on the correlation between histomorphometric findings and gene/protein expression markers for bone metabolism. Evaluation of the histological features, changes in protein expression and gene activation for specific markers of bone metabolism following application of the alveolar ridge preservation technique with magnesium-enriched hydroxyapatite (MgHA). For each patient (n=15), bone samples were harvested after tooth extraction and processed for immunohistochemical and gene expression analysis (T0). Then, all alveolar sockets were grafted with MgHA. After 4 months (T1), bone samples were harvested for histomorphometrical, immunohistochemical and gene expression analysis. Gene expression and protein expression were evaluated for: RANK, RANKL, OPG, IL-6, TNF-α. For all markers, gene expression increased, but not significantly, from T0 to T1. The mean RANKL/OPG ratio was 1.88±1.24. Protein expression increased significantly (ppreservation with MgHA, markers for bone catabolism were activated. No significant correlation was found between histomorphometrical features of the regenerated tissue and protein expression at baseline. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Alveolar socket preservation with demineralised bovine bone mineral and a collagen matrix.

    Science.gov (United States)

    Maiorana, Carlo; Poli, Pier Paolo; Deflorian, Matteo; Testori, Tiziano; Mandelli, Federico; Nagursky, Heiner; Vinci, Raffaele

    2017-08-01

    The aim of the present study was to evaluate the healing of post-extraction sockets following alveolar ridge preservation clinically, radiologically, and histologically. Overall, 7 extraction sockets in 7 patients were grafted with demineralised bovine bone mineral and covered with a porcine-derived non-crosslinked collagen matrix (CM). Soft tissue healing was clinically evaluated on the basis of a specific healing index. Horizontal and vertical ridge dimensional changes were assessed clinically and radiographically at baseline and 6 months after implant placement. For histological and histomorphometric analysis, bone biopsies were harvested from the augmented sites during implant surgery 6 months after the socket preservation procedure. Clinically, healing proceeded uneventfully in all the sockets. A trend towards reduced horizontal and vertical socket dimensions was observed from baseline to the final examination. The mean width and height of resorption were 1.21 mm ( P =0.005) and 0.46 mm ( P =0.004), respectively. Histologically, residual xenograft particles (31.97%±3.52%) were surrounded by either newly formed bone (16.02%±7.06%) or connective tissue (50.67%±8.42%) without fibrous encapsulation. The CM underwent a physiological substitution process in favour of well-vascularised collagen-rich connective tissue. Socket preservation using demineralised bovine bone mineral in combination with CM provided stable dimensional changes of the alveolar ridge associated with good re-epithelialisation of the soft tissues during a 6-month healing period.

  2. Functional alterations of alveolar macrophages subjected to smoke exposure and antioxidant lazaroids.

    Science.gov (United States)

    Wang, S; Lantz, R C; Vermeulen, M W; Chen, G J; Breceda, V; Robledo, R F; Hays, A M; Young, S; Witten, M L

    1999-08-01

    Acute inhalation of diesel fuel-polycarbonate plastic (DFPP) smoke causes severe lung injury, leading to acute respiratory distress syndrome (ARDS) and death. It has been reported that the initiation of acute lung injury is associated with the activation of pulmonary alveolar macrophages (PAM). To further explore the pathogenesis, alveolar macrophages (AM) of New Zealand rabbits ventilated and exposed to a 60 tidal volume of DFPP smoke in vivo were recovered at 1 h post-smoke. Smoke exposure induced significant increases in both mRNA and protein levels for PAM tumor necrosis factor-alpha (TNF-alpha), when compared to smoke control. Smoke also induced a biphasic response (inhibited at 2 h, enhanced at 24 h after cell isolation) in the production of superoxide (O2-) by PAM. However, aerosolized lazaroid, U75412E (1.6 mg/kg body weight), significantly attenuated smoke-induced expression in AM TNF-alpha at the protein level but not at the mRNA level, and smoke-induced changes in AM production of O2-. This study suggests that highly expressing AM TNF-alpha following smoke may be a key contributor to the cascade that establishes an acute injury process and exacerbates oxidant-derived cell injury. Whereas, the lazaroid may ameliorate smoke-induced lung injury by attenuating AM TNF-alpha release, in addition to its primary antioxidative mechanism.

  3. Quantification and visualization of alveolar bone resorption from 3D dental CT images

    International Nuclear Information System (INIS)

    Nagao, Jiro; Mori, Kensaku; Kitasaka, Takayuki; Suenaga, Yasuhito; Yamada, Shohzoh; Naitoh, Munetaka

    2007-01-01

    Purpose A computer aided diagnosis (CAD) system for quantifying and visualizing alveolar bone resorption caused by periodontitis was developed based on three-dimensional (3D) image processing of dental CT images. Methods The proposed system enables visualization and quantification of resorption of alveolar bone surrounding and between the roots of teeth. It has the following functions: (1) vertical measurement of the depth of resorption surrounding the tooth in 3D images, avoiding physical obstruction; (2) quantification of the amount of resorption in the furcation area; and (3) visualization of quantification results by pseudo-color maps, graphs, and motion pictures. The resorption measurement accuracy in the area surrounding teeth was evaluated by comparing with dentist's recognition on five real patient CT images, giving average absolute difference of 0.87 mm. An artificial image with mathematical truth was also used for measurement evaluation. Results The average absolute difference was 0.36 and 0.10 mm for surrounding and furcation areas, respectively. The system provides an intuitive presentation of the measurement results. Conclusion Computer aided diagnosis of 3D dental CT scans is feasible and the technique is a promising new tool for the quantitative evaluation of periodontal bone loss. (orig.)

  4. Quantification and visualization of alveolar bone resorption from 3D dental CT images

    Energy Technology Data Exchange (ETDEWEB)

    Nagao, Jiro; Mori, Kensaku; Kitasaka, Takayuki; Suenaga, Yasuhito [Nagoya University, Graduate School of Information Science, Nagoya (Japan); Yamada, Shohzoh; Naitoh, Munetaka [Aichi-Gakuin University, School of Dentistry, Nagoya (Japan)

    2007-06-15

    Purpose A computer aided diagnosis (CAD) system for quantifying and visualizing alveolar bone resorption caused by periodontitis was developed based on three-dimensional (3D) image processing of dental CT images. Methods The proposed system enables visualization and quantification of resorption of alveolar bone surrounding and between the roots of teeth. It has the following functions: (1) vertical measurement of the depth of resorption surrounding the tooth in 3D images, avoiding physical obstruction; (2) quantification of the amount of resorption in the furcation area; and (3) visualization of quantification results by pseudo-color maps, graphs, and motion pictures. The resorption measurement accuracy in the area surrounding teeth was evaluated by comparing with dentist's recognition on five real patient CT images, giving average absolute difference of 0.87 mm. An artificial image with mathematical truth was also used for measurement evaluation. Results The average absolute difference was 0.36 and 0.10 mm for surrounding and furcation areas, respectively. The system provides an intuitive presentation of the measurement results. Conclusion Computer aided diagnosis of 3D dental CT scans is feasible and the technique is a promising new tool for the quantitative evaluation of periodontal bone loss. (orig.)

  5. Alveolar bone loss associated to periodontal disease in lead intoxicated rats under environmental hypoxia.

    Science.gov (United States)

    Terrizzi, Antonela R; Fernandez-Solari, Javier; Lee, Ching M; Bozzini, Clarisa; Mandalunis, Patricia M; Elverdin, Juan C; Conti, María Ines; Martínez, María Pilar

    2013-10-01

    Previously reported studies from this laboratory revealed that rats chronically intoxicated with lead (Pb) under hypoxic conditions (HX) impaired growth parameters and induced damages on femoral and mandibular bones predisposing to fractures. We also described periodontal inflammatory processes under such experimental conditions. Periodontitis is characterised by inflammation of supporting tissues of the teeth that result in alveolar bone loss. The existence of populations living at high altitudes and exposed to lead contamination aimed us to establish the macroscopic, biochemical and histological parameters consistent with a periodontal disease in the same rat model with or without experimental periodontitis (EP). Sixty female rats were divided into: Control; Pb (1000ppm of lead acetate in drinking water); HX (506mbar) and PbHX (both treatments simultaneously). EP was induced by placing ligatures around the molars of half of the rats during the 14 days previous to the autopsy. Hemi-mandibles were extracted to evaluate bone loss by histomorphometrical techniques. TNFα plasmatic concentration was greater (plead intoxication under hypoxic environment enhanced not only alveolar bone loss but also systemic and oral tissues inflammatory parameters, which could aggravate the physiopathological alterations produced by periodontal disease. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. A co-culture system with an organotypic lung slice and an immortal alveolar macrophage cell line to quantify silica-induced inflammation.

    Directory of Open Access Journals (Sweden)

    Falk Hofmann

    Full Text Available There is growing evidence that amorphous silica nanoparticles cause toxic effects on lung cells in vivo as well as in vitro and induce inflammatory processes. The phagocytosis of silica by alveolar macrophages potentiates these effects. To understand the underlying molecular mechanisms of silica toxicity, we applied a co-culture system including the immortal alveolar epithelial mouse cell line E10 and the macrophage cell line AMJ2-C11. In parallel we exposed precision-cut lung slices (lacking any blood cells as well as residual alveolar macrophages of wild type and P2rx7-/- mice with or without AMJ2-C11 cells to silica nanoparticles. Exposure of E10 cells as well as slices of wild type mice resulted in an increase of typical alveolar epithelial type 1 cell proteins like T1α, caveolin-1 and -2 and PKC-β1, whereas the co-culture with AMJ2-C11 showed mostly a slightly lesser increase of these proteins. In P2rx7-/- mice most of these proteins were slightly decreased. ELISA analysis of the supernatant of wild type and P2rx7-/- mice precision-cut lung slices showed decreased amounts of IL-6 and TNF-α when incubated with nano-silica. Our findings indicate that alveolar macrophages influence the early inflammation of the lung and also that cell damaging reagents e.g. silica have a smaller impact on P2rx7-/- mice than on wild type mice. The co-culture system with an organotypic lung slice is a useful tool to study the role of alveolar macrophages during lung injury at the organoid level.

  7. The Milieu of Damaged Alveolar Epithelial Type 2 Cells Stimulates Alveolar Wound Repair by Endogenous and Exogenous Progenitors

    Science.gov (United States)

    Buckley, Susan; Shi, Wei; Carraro, Gianni; Sedrakyan, Sargis; Da Sacco, Stefano; Driscoll, Barbara A.; Perin, Laura; De Filippo, Roger E.

    2011-01-01

    Alveolar epithelial integrity is dependent upon the alveolar milieu, yet the milieu of the damaged alveolar epithelial cell type 2 (AEC2) has been little studied. Characterization of its components may offer the potential for ex vivo manipulation of stem cells to optimize their therapeutic potential. We examined the cytokine profile of AEC2 damage milieu, hypothesizing that it would promote endogenous epithelial repair while recruiting cells from other locations and instructing their engraftment and differentiation. Bronchoalveolar lavage and lung extract from hyperoxic rats represented AEC2 in vivo damage milieu, and medium from a scratch-damaged AEC2 monolayer represented in vitro damage. CINC-2 and ICAM, the major cytokines detected by proteomic cytokine array in AEC2 damage milieu, were chemoattractive to normoxic AECs and expedited in vitro wound healing, which was blocked by their respective neutralizing antibodies. The AEC2 damage milieu was also chemotactic for exogenous uncommitted human amniotic fluid stem cells (hAFSCs), increasing migration greater than 20-fold. hAFSCs attached within an in vitro AEC2 wound and expedited wound repair by contributing cytokines migration inhibitory factor and plasminogen activator inhibitor 1 to the AEC2 damage milieu, which promoted wound healing. The AEC2 damage milieu also promoted differentiation of a subpopulation of hAFSCs to express SPC, TTF-1, and ABCA3, phenotypic markers of distal alveolar epithelium. Thus, the microenvironment created by AEC2 damage not only promotes autocrine repair but also can attract uncommitted stem cells, which further augment healing through cytokine secretion and differentiation. PMID:21700959

  8. Mechanism of action and morphologic changes in the alveolar bone in response to selective alveolar decortication-facilitated tooth movement.

    Science.gov (United States)

    Baloul, S Susan; Gerstenfeld, Louis C; Morgan, Elise F; Carvalho, Roberto S; Van Dyke, Thomas E; Kantarci, Alpdogan

    2011-04-01

    The aim of this study was to test if corticotomy-induced osteoclastogenesis and bone remodeling underlie orthodontic tooth movement and how selective alveolar decortication enhances the rate of tooth movement. A total of 114 Sprague-Dawley rats were included in 3 treatment groups: selective alveolar decortication alone (SADc); tooth movement alone (TM); and "combined" therapy (SADc + TM). Surgery was performed around the buccal and palatal aspects of the left maxillary first molar tooth and included 5 decortication dots on each side. Tooth movement was performed on the first molar using a 25-g Sentalloy spring. Measurements were done at baseline (day 0: no treatment rendered) and on days 3, 7, 14, 21, 28 and 42. Microcomputed tomography, Faxitron analyses, and quantitative real-time polymerase chain reaction (q-PCR) of expressed mRNAs were used to assess changes. The combined group showed increased tooth movement (P = 0.04) at 7 days compared with the tooth movement group with significantly decreased bone volume (62%; P = 0.016) and bone mineral content (63%; P = 0.015). RNA markers of osteoclastic cells and key osteoclastic regulators (M-CSF [macrophage colony-stimulating factor], RANKL [receptor activator of nuclear factor kappa-B ligand], OPG [osteoprotegerin], calcitonin receptor [CTR], TRACP-5b [tartrate-resistant acid phosphatase 5b], cathepsin K [Ctsk]) all showed expression indicating increased osteoclastogenesis in the combined group. RNA markers of osteoblastic cells (OPN [osteopontin], BSP [bone sialoprotein], OCN [osteocalcin]) also showed increased anabolic activity in response to the combination of alveolar decortication and tooth movement. The data suggest that the alveolar decortication enhances the rate of tooth movement during the initial tooth displacement phase; this results in a coupled mechanism of bone resorption and bone formation during the earlier stages of treatment, and this mechanism underlies the rapid orthodontic tooth movement

  9. Influence of the Alveolar Cleft Type on Preoperative Estimation Using 3D CT Assessment for Alveolar Cleft

    Directory of Open Access Journals (Sweden)

    Hang Suk Choi

    2012-09-01

    Full Text Available Background The bone graft for the alveolar cleft has been accepted as one of the essentialtreatments for cleft lip patients. Precise preoperative measurement of the architecture andsize of the bone defect in alveolar cleft has been considered helpful for increasing the successrate of bone grafting because those features may vary with the cleft type. Recently, somestudies have reported on the usefulness of three-dimensional (3D computed tomography(CT assessment of alveolar bone defect; however, no study on the possible implication of thecleft type on the difference between the presumed and actual value has been conducted yet.We aimed to evaluate the clinical predictability of such measurement using 3D CT assessmentaccording to the cleft type.Methods The study consisted of 47 pediatric patients. The subjects were divided according tothe cleft type. CT was performed before the graft operation and assessed using image analysissoftware. The statistical significance of the difference between the preoperative estimationand intraoperative measurement was analyzed.Results The difference between the preoperative and intraoperative values were -0.1±0.3cm3 (P=0.084. There was no significant intergroup difference, but the groups with a cleftpalate showed a significant difference of -0.2±0.3 cm3 (P<0.05.Conclusions Assessment of the alveolar cleft volume using 3D CT scan data and image analysissoftware can help in selecting the optimal graft procedure and extracting the correct volumeof cancellous bone for grafting. Considering the cleft type, it would be helpful to extract anadditional volume of 0.2 cm3 in the presence of a cleft palate.

  10. Technical note: Intra-alveolar morphology assessed in empty dental sockets of teeth missing post-mortem.

    Science.gov (United States)

    Capeletti, Lucas Raineri; Franco, Ademir; Reges, Rogério Vieira; Silva, Rhonan Ferreira

    2017-08-01

    Dental human identification relies on distinctive traits detected and compared between ante-mortem (AM) and post-mortem (PM) data. Several distinctive traits may be found in dental roots, such as dilacerations and bifurcations. However, teeth are often dislodged during the manipulation of skeletal remains, charred bodies and bodies retrieved from water. In these situations the identification process is hampered. The present study aims to retrieve information of teeth missing PM through the investigation of intra-alveolar morphology in empty dental sockets using different dental impression materials. This study was conducted using a dry human skull and 6 techniques for intra-alveolar impression, namely: (1) alginate using a dental tray; (2) heavy-body condensation silicone (HBCS) using manual compression; (3) HBSC using a blunt tip probe; (4) HBCS using a dental tray; (5) light- and HBCS using a syringe and a dental tray; and (6) polyether using a syringe and a dental tray. These techniques were evaluated based on 5 criteria: (I) intra-alveolar flow; (II) registration of apical morphology; (III) tensile strength; (IV) complexity; and (V) cost. The best outcomes considering the cost and benefit relation of each technique were observed in the following order: techniques #3>#2>#5>#6. Techniques #1 and #4 did not reach satisfactory outcomes for application in the forensic routine. Forensic dentists must be aware of the possibility of retrieving PM dental information even in the absence of teeth. The impression of intra-alveolar morphology may contribute significantly as source of PM dental information for human identifications. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. [Role of oxidative stress in endoplasmic reticulum stress? induced apoptosis of alveolar macrophages triggered by quartz dust].

    Science.gov (United States)

    Song, Jing; Lu, Xiaoting; Li, Qiuying; Liu, Chengyun; Liu, Ying

    2014-07-01

    To investigate the role of oxidative stress in the endoplasmic reticulum stress-induced apoptosis of alveolar macrophages triggered by quartz dust. Seventy-two healthy adult Wistar rats were randomly divided into control group, quartz dust group, quartz dust plus N-acetyl cysteine (NAC) group, and NAC group, with 18 rats in each group. One milliliter of sterile saline (for the control and NAC groups) or 1 ml of saline with 5%ultrafine quartz dust (for dust group and dust plus NAC group) was given to each rat by non-exposed endotracheal infusion. From the second day after dust infusion, rats in dust plus NAC group and NAC group received intragastric administration of NAC (100 mg/kg). In each week, the treatment with NAC lasted for 5 consecutive days, followed by 2 days' interval. For each group, 6 rats were randomly selected on the 14th, 28th, or 56th day after dust exposure; they were sacrificed by bloodletting from the femoral artery, and the lungs were collected. Bronchoalveolar lavage fluid was collected to separate macrophages. The protein expression of caspase-12 in alveolar macrophages, the apoptosis rate and reactive oxygen species (ROS) content of alveolar macrophages, and the protein carbonyl content of alveolar macrophages were determined by Western blot, flow cytometry, and colorimetry, respectively. Increased protein expression of caspase-12, apoptosis rate, and content of ROS and protein carbonyl were discovered on the 14th day in the dust group, in comparison with the control group (P quartz dust. Oxidative damage of protein in the endoplasmic reticulum may play an important role in the process.

  12. Characterization of Particulate Matter Profiling and Alveolar Deposition from Biomass Burning in Northern Thailand: The 7-SEAS Study

    Science.gov (United States)

    Chuang, Hsiao-Chi; Hsiao, Ta-Chih; Wang, Sheng-Hsiang; Tsay, Si-Chee; Lin, Neng-Huei

    2016-01-01

    Biomass burning (BB) frequently occurs in SouthEast Asia (SEA), which significantly affects the air quality and could consequently lead to adverse health effects. The aim of this study was to characterize particulate matter (PM) and black carbon (BC) emitted from BB source regions in SEA and their potential of deposition in the alveolar region of human lungs. A 31-day characterization of PM profiling was conducted at the Doi Ang Khang (DAK) meteorology station in northern Thailand in March 2013. Substantial numbers of PM (10147 +/- 5800 # per cubic centimeter) with a geometric mean diameter (GMD) of 114.4 +/- 9.2 nm were found at the study site. The PM of less than 2.5 micron in aerodynamic diameter (PM sub 2.5) hourly-average mass concentration was 78.0 +/- 34.5 per cubic microgram whereas the black carbon (BC) mass concentration was 4.4 +/- 2.6 micrograms per cubic meter. Notably, high concentrations of nanoparticle surface area (100.5 +/- 54.6 square micrometers per cubic centimeter) emitted from biomass burning can be inhaled into the human alveolar region. Significant correlations with fire counts within different ranges around DAK were found for particle number, the surface area concentration of alveolar deposition, and BC. In conclusion, biomass burning is an important PM source in SEA, particularly nanoparticles, which has high potency to be inhaled into the lung environment and interact with alveolar cells, leading to adverse respiratory effects. The fire counts within 100 to 150 km shows the highest Pearson's r for particle number and surface area concentration. It suggests 12 to 24 hr could be a fair time scale for initial aging process of BB aerosols. Importantly, the people lives in this region could have higher risk for PM exposure.

  13. Effects of fibrin adhesive material (Tissucol) on alveolar healing in rats under stress.

    OpenAIRE

    Alves-Rezende, Maria C. R. [UNESP; Okamoto, Tetuo [UNESP

    1997-01-01

    The effects of Tissucol on alveolar healing following stress were evaluated histologically, comparing three groups of 28 male albino rats each. Stress was applied and their right upper incisors were extracted. Group A served as an empty control site. In Group B, Tissucol was applied into the alveolar cavity. Group C received local antifibrinolytic treatment (alveolar irrigation with epsilon-aminocaproic acid solution) before implant of Tissucol into the tooth socket. Four animals in each grou...

  14. Differentiated bronchiolar epithelium in alveolar ducts of rats exposed to ozone for 20 months

    Energy Technology Data Exchange (ETDEWEB)

    Pinkerton, K.E.; Dodge, D.E.; Cederdahl-Demmler, J.; Wong, V.J.; Peake, J.; Haselton, C.J.; Mellick, P.W.; Singh, G.; Plopper, C.G. (Univ. of California, Davis (United States))

    1993-03-01

    The effects of exposure to 1.0 ppm of ozone for twenty months were studied in male Fischer 344 rats. Light microscopic, morphometric, and immunohistological approaches were used to determine the distribution and degree of differentiation of ciliated and nonciliated bronchiolar epithelial (Clara) cells lining alveolar ducts of the central acinus, a primary target of ozone-induced lung injury. Alveolar duct pathways extending beyond the level of the most proximal alveolar outpocketing of terminal bronchioles were isolated in longitudinal profile. The distance that ciliated and nonciliated bronchiolar epithelial (Clara) cells projected down each alveolar duct pathway was determined by placing concentric arcs radiating outward from a single reference point at the level of the first alveolar outpocketing. A high degree of heterogeneity in the magnitude of bronchiolar epithelial cell extension into alveolar ducts was noted for each isolation and animal. Age-matched control animals also demonstrated variation in the degree of bronchiolar epithelial cell extension down alveolar ducts. In animals exposed to ozone, a striking similarity was noted by scanning electron microscopy in the surface characteristics of cells lining both terminal bronchioles and alveolar ducts. The presence of Clara cell secretory protein in cells of bronchioles and alveolar ducts was also detected immunohistochemically and visualized using confocal laser scanning microscopy in the reflectance mode. Well-differentiated ciliated and nonciliated bronchiolar epithelial cells were found lining alveolar septal tips and alveoli up to a depth of 1,000 mu into the pulmonary acinus after 20 months of exposure to ozone. No evidence of inflammation was present in alveolar ducts, suggesting that epithelial cell transformations in alveolar ducts is a natural consequence of lifetime exposures to oxidant gases.

  15. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation

    OpenAIRE

    Schwartz, João Paulo; Raveli, Taisa Boamorte; Schwartz-Filho, Humberto Osvaldo; Raveli, Dirceu Barnabé

    2016-01-01

    ABSTRACT Objective: This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. Methods: The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years), Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0) and after Herbst treatment (T1). Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B), lingual (L) and to...

  16. Silver nanowire interactions with primary human alveolar type-II epithelial cell secretions: contrasting bioreactivity with human alveolar type-I and type-II epithelial cells

    Science.gov (United States)

    Sweeney, Sinbad; Theodorou, Ioannis G.; Zambianchi, Marta; Chen, Shu; Gow, Andrew; Schwander, Stephan; Zhang, Junfeng (Jim); Chung, Kian Fan; Shaffer, Milo S. P.; Ryan, Mary P.; Porter, Alexandra E.; Tetley, Teresa D.

    2015-06-01

    Inhaled nanoparticles have a high deposition rate in the alveolar units of the deep lung. The alveolar epithelium is composed of type-I and type-II epithelial cells (ATI and ATII respectively) and is bathed in pulmonary surfactant. The effect of native human ATII cell secretions on nanoparticle toxicity is not known. We investigated the cellular uptake and toxicity of silver nanowires (AgNWs; 70 nm diameter, 1.5 μm length) with human ATI-like cells (TT1), in the absence or presence of Curosurf® (a natural porcine pulmonary surfactant with a low amount of protein) or harvested primary human ATII cell secretions (HAS; containing both the complete lipid as well as the full protein complement of human pulmonary surfactant i.e. SP-A, SP-B, SP-C and SP-D). We hypothesised that Curosurf® or HAS would confer improved protection for TT1 cells, limiting the toxicity of AgNWs. In agreement with our hypothesis, HAS reduced the inflammatory and reactive oxygen species (ROS)-generating potential of AgNWs with exposed TT1 cells. For example, IL-8 release and ROS generation was reduced by 38% and 29%, respectively, resulting in similar levels to that of the non-treated controls. However in contrast to our hypothesis, Curosurf® had no effect. We found a significant reduction in AgNW uptake by TT1 cells in the presence of HAS but not Curosurf. Furthermore, we show that the SP-A and SP-D are likely to be involved in this process as they were found to be specifically bound to the AgNWs. While ATI cells appear to be protected by HAS, evidence suggested that ATII cells, despite no uptake, were vulnerable to AgNW exposure (indicated by increased IL-8 release and ROS generation and decreased intracellular SP-A levels one day post-exposure). This study provides unique findings that may be important for the study of lung epithelial-endothelial translocation of nanoparticles in general and associated toxicity within the alveolar unit.Inhaled nanoparticles have a high deposition rate in

  17. Augmentation of residual alveolar bone height with tissue engineering for dental implant placement

    Directory of Open Access Journals (Sweden)

    S M Balaji

    2014-01-01

    Full Text Available The challenge of correcting deficient vertical alveolar height for dental implant placement has been there since dental implants came in to regular clinical placement. The ability of various methods to increase the residual alveolar height has met with varying results. The primary reason is that the techniques were not quite successful in maintaining the required residual alveolar height. Use of Bone Morphogentic Protein, especially rhBMP-2 has been met with high degree of success in deficient vertical alveolar height in a mandibular ridge. The demonstration of this using a case has been presented here.

  18. Alveolar nitric oxide in adults with asthma: evidence of distal lung inflammation in refractory asthma.

    Science.gov (United States)

    Berry, M; Hargadon, B; Morgan, A; Shelley, M; Richter, J; Shaw, D; Green, R H; Brightling, C; Wardlaw, A J; Pavord, I D

    2005-06-01

    Recent studies have suggested that alveolar nitric oxide (NO) concentration is a noninvasive test of distal lung inflammation. The current study determined whether alveolar NO concentration can be measured in patients with asthma of varying severity, tested the hypothesis that there is an association between alveolar NO and bronchoalveolar lavage (BAL) eosinophil count and determined whether refractory asthma is characterised by a raised alveolar NO concentration. Finally, the present authors assessed the effect of 2 weeks of prednisolone (30 mg q.d.) on alveolar NO concentration. Alveolar NO concentration was both measurable and repeatable in patients with refractory asthma. A positive correlation was found between alveolar NO concentration and BAL eosinophil count but not with bronchial wash or sputum eosinophil count. Alveolar NO concentration was increased in patients with refractory asthma (7.1 ppb) compared with mild-to-moderate asthma (3.4 ppb) and normal controls (3.4 ppb) and reduced by treatment with prednisolone. In conclusion, these findings support the hypothesis that alveolar nitric oxide is a measure of distal airway inflammation and suggest that distal lung inflammation is present in refractory asthma.

  19. Alveolar corticotomies for accelerated orthodontics: A systematic review.

    Science.gov (United States)

    Gil, A P S; Haas, O L; Méndez-Manjón, I; Masiá-Gridilla, J; Valls-Ontañón, A; Hernández-Alfaro, F; Guijarro-Martínez, R

    2018-03-01

    It has been suggested that alveolar corticotomies may accelerate tooth movement, broaden the scope of malocclusion types that can be treated orthodontically, decrease the need for extractions, and support long-term stability. Several techniques have been proposed, although the indications, ideal design and technical characteristics, potential complications, and objective clinician and patient satisfaction remain unclear. This systematic review aimed to provide scientific support to validate alveolar corticotomies as a reliable approach to accelerated orthodontics. A literature search was conducted using MEDLINE (via PubMed), Cochrane, and EMBASE electronic databases until December, 2016. Articles written in any language other than English, Spanish, French, German, and Portuguese were excluded. Randomized controlled trials, controlled clinical trials, and case series involving healthy adult patients, with a sample size of at least 5 patients, and using alveolar corticotomy techniques were included. Two reviewers extracted the data independently. Three randomized clinical trials, 2 prospective randomized clinical trials, 6 case series and 1 randomized controlled split-mouth study were included. No clinical trials were retrieved. Mean total treatment time in corticotomy-facilitated orthodontic cases was 8.85 months (range, 4-20 months); control groups treatment duration was 16.4 months (range, 7.8-28.3 months). Complications such as pain, swelling, and dentin hypersensitivity were reported. Few studies mentioned patient/clinician satisfaction. The faster and less invasive procedures appeared to be well tolerated. However, the methodological quality of the selected studies was low, with only low to moderate scientific evidence. Corticotomy-facilitated orthodontics resulted in decreased treatment time. Few complications and low morbidity were found. More solid evidence-based research is required to support these results. Copyright © 2018 European Association for Cranio

  20. Metabolic shift in lung alveolar cell mitochondria following acrolein exposure.

    Science.gov (United States)

    Agarwal, Amit R; Yin, Fei; Cadenas, Enrique

    2013-11-15

    Acrolein, an α,β unsaturated electrophile, is an environmental pollutant released in ambient air from diesel exhausts and cooking oils. This study examines the role of acrolein in altering mitochondrial function and metabolism in lung-specific cells. RLE-6TN, H441, and primary alveolar type II (pAT2) cells were exposed to acrolein for 4 h, and its effect on mitochondrial oxygen consumption rates was studied by XF Extracellular Flux analysis. Low-dose acrolein exposure decreased mitochondrial respiration in a dose-dependent manner because of alteration in the metabolism of glucose in all the three cell types. Acrolein inhibited glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity, leading to decreased substrate availability for mitochondrial respiration in RLE-6TN, H441, and pAT2 cells; the reduced GAPDH activity was compensated in pAT2 cells by an increase in the activity of glucose-6-phosphate dehydrogenase, the regulatory control of the pentose phosphate pathway. The decrease in pyruvate from glucose metabolism resulted in utilization of alternative sources to support mitochondrial energy production: palmitate-BSA complex increased mitochondrial respiration in RLE-6TN and pAT2 cells. The presence of palmitate in alveolar cells for surfactant biosynthesis may prove to be the alternative fuel source for mitochondrial respiration. Accordingly, a decrease in phosphatidylcholine levels and an increase in phospholipase A2 activity were found in the alveolar cells after acrolein exposure. These findings have implications for understanding the decrease in surfactant levels frequently observed in pathophysiological situations with altered lung function following exposure to environmental toxicants.

  1. Influence of platelet-rich fibrin on alveolar ridge preservation.

    Science.gov (United States)

    Suttapreyasri, Srisurang; Leepong, Narit

    2013-07-01

    The aim of this study was to investigate the influence of platelet-rich fibrin (PRF) on early wound healing and preservation of the alveolar ridge shape following tooth extraction. In this clinical trial, 20 symmetrical, premolar extraction sockets using split-mouth design were randomly selected with PRF or blood clot. The evaluations of wound healing, alveolar ridge contour changes, and crestal bone resorption were performed in dental casts and periapical radiographs (T0, initial; T1, 1 week; T2, 2 weeks; T4, 4 weeks; T6, 6 weeks; T8, 8 weeks). Platelet-rich fibrin clinically showed early healing of soft tissue covering socket orifices in the first 4 weeks. At the first week, the horizontal resorption on buccal aspect of PRF (1.07 ± 0.31 mm) was significantly less than that of the control (1.81 ± 0.88 mm). Platelet-rich fibrin demonstrated the tendency to enter the steady stage after the fourth week following tooth extraction, whereas in the control group the progression of buccal contour contraction was still detected through the eighth week. Radiographically, the overall resorption of marginal bone levels at mesial and distal to the extraction site in PRF (0.70, 1.23 mm) was comparable to that of the control (1.33, 1.14 mm). Although the PRF group demonstrated faster bone healing compared with the control, no statistically significant difference was detected. This preliminary result demonstrated neither better alveolar ridge preservation nor enhanced bone formation of PRF in the extraction socket. The use of PRF revealed limited effectiveness by accelerated soft-tissue healing on the first 4 weeks.

  2. Alveolar hemorrhage and kidney disease: characteristics and therapy.

    Science.gov (United States)

    Fatma, Lilia Ben; El Ati, Zohra; Lamia, Rais; Aich, Dorra Ben; Madiha, Krid; Wided, Smaoui; Maiz, Hedi Ben; Beji, Somaya; Karim, Zouaghi; Moussa, Fatma Ben

    2013-07-01

    Anti-neutrophil cytoplasmic antibody-associated vasculitis and Goodpasture's glomerular basement membrane disease are the most common causes of diffuse alveolar hemorrhage, a life-threatening disease. Systemic lupus erythematosus and the antiphospholipid syndrome are also causes of alveolar hemorrhage. We retrospectively reviewed 15 cases of diffuse alveolar hemorrhage (DAH) associated with renal diseases. Diagnosis of DAH was based on the presence of bloody bronchoalveolar lavage fluid. There were three men and 12 women, with a mean age of 50.5 years (extremes: 24-74 years). Proteinuria and hematuria were observed, respectively, in 15 and 14 cases. Six patients revealed arterial hypertension. Crescentic glomerulonephritis was diagnosed with kidney biopsies in ten cases. The etiology of renal disease was microscopic polyangiitis (MPA) in seven cases, Wegener disease in four cases, systemic lupus erythematous in one case, cryoglobulinemia in one case, myeloma in one case and propyl-thiouracil-induced MPA in one case. Hemoptysis occurred in 14 cases. The mean serum level of hemoglobin was 7.1 g/dL (5.1-10 g/dL). The mean serum creatinine concentration was 7.07 mg/dL (2.4-13.7 mg/dL). Gas exchange was severely compromised, with an oxygenation index <80 mmHg in 14 patients and <60 mmHg in seven patients. Bronchoalveolar lavage was performed in 11 cases, and had positive findings for hemorrhage in all. Methylprednisolone pulses and cyclophosphamide were used in 14 patients. Plasmapheresis was performed in three cases. One patient received cycles of Dexamethasome-Melphalan. Three patients died as a result of DAH. The mortality rate in our study was 20%.

  3. Enhanced rifampicin delivery to alveolar macrophages by solid lipid nanoparticles

    International Nuclear Information System (INIS)

    Chuan Junlan; Li Yanzhen; Yang Likai; Sun Xun; Zhang Qiang; Gong Tao; Zhang Zhirong

    2013-01-01

    The present study aimed at developing a drug delivery system targeting the densest site of tuberculosis infection, the alveolar macrophages (AMs). Rifampicin (RFP)-loaded solid lipid nanoparticles (RFP-SLNs) with an average size of 829.6 ± 16.1 nm were prepared by a modified lipid film hydration method. The cytotoxicity of RFP-SLNs to AMs and alveolar epithelial type II cells (AECs) was examined using MTT assays. The viability of AMs and AECs was above 80 % after treatment with RFP-SLNs, which showed low toxicity to both AMs and AECs. Confocal Laser Scanning Microscopy was employed to observe the interaction between RFP-SLNs and both AMs and AECs. After incubating the cells with RFP-SLNs for 2 h, the fluorescent intensity in AMs was more and remained longer (from 0.5 to 12 h) when compared with that in AECs (from 0.5 to 8 h). In vitro uptake characteristics of RFP-SLNs in AMs and AECs were also investigated by detection of intracellular RFP by High performance liquid chromatography. Results showed that RFP-SLNs delivered markedly higher RFP into AMs (691.7 ng/mg in cultured AMs, 662.6 ng/mg in primary AMs) than that into AECs (319.2 ng/mg in cultured AECs, 287.2 ng/mg in primary AECs). Subsequently, in vivo delivery efficiency and the selectivity of RFP-SLNs were further verified in Sprague–Dawley rats. Under pulmonary administration of RFP-SLNs, the amount of RFP in AMs was significantly higher than that in AECs at each time point. Our results demonstrated that solid lipid nanoparticles are a promising strategy for the delivery of rifampicin to alveolar macrophages selectively.

  4. A methodological approach to assessing alveolar ridge preservation procedures in humans: soft tissue profile.

    Science.gov (United States)

    Vanhoutte, Vanessa; Rompen, Eric; Lecloux, Geoffrey; Rues, Stefan; Schmitter, Marc; Lambert, France

    2014-03-01

    The aesthetic results of implant restoration in the anterior maxilla are particularly related to the soft tissue profile. Although socket preservation techniques appear to reduce bone remodelling after tooth extraction, there is still few investigations assessing the external soft tissue profile after such procedures. The goal of this study was to describe an accurate technique to evaluate soft tissue contour changes after performing socket preservation procedures. The secondary objective was to apply the newly developed measuring method to a specific socket preservation using a "saddled" connective tissue graft combined with the insertion of slowly resorbable biomaterials into the socket. A total of 14 patients needing tooth replacement in the aesthetic region were included to receive a socket preservation procedure using a connective tissue graft. Impressions were taken before the tooth extraction (baseline) and at 2, 4, and 12 weeks after the procedure. The corresponding plaster casts were scanned, and the evolution of the soft tissue profile in relation to the baseline situation was assessed using imaging software. The measuring technique allowed assessing the soft tissue profiles accurately at different levels of the alveolar process. The insertion of a saddled connective tissue appeared to compensate for the horizontal and vertical bone remodelling after a socket preservation procedure in most regions of the alveolar crest. After 12 weeks, the only significant change was located in the more cervical and central region of the alveolar process and reached a median drop of 0.62 mm from baseline. Within the limitations of this study, we found that a saddled connective tissue graft combined with a socket preservation procedure could almost completely counteract the bone remodelling in terms of the external soft tissue profile. The minor changes found in the cervical region might disappear with the emergence profile of the prosthodontic components. The described

  5. Diffuse alveolar hemorrhage as initial manifestation of microscopic polyangiitis

    OpenAIRE

    Campanholo, Cristiano Barbosa; Cavalcante, Leonardo de Oliveira; Torigoe, Dawton Yukito; Souza, Branca Dias Batista de

    2007-01-01

    Hemorragia alveolar (HA) é uma manifestação clínica com alta taxa de mortalidade que deve ser investigada, reconhecida e estabilizada. Causas possíveis para a HA incluem infecções respiratórias ou sistêmicas, malformações arteriovenosas, estenose mitral, discrasias sangüíneas e doenças auto-imunes, como o lúpus eritematoso sistêmico (LES), a síndrome de Goodpasture e as vasculites sistêmicas primárias, principalmente aquelas associadas aos anticorpos anticitoplasma de neutrófilos (Anca), como...

  6. Case report 501: Alveolar soft parts sarcoma with pulmonary metastases

    International Nuclear Information System (INIS)

    Munk, P.L.; Connell, D.G.; Mueller, N.L.; Lentle, B.C.

    1988-01-01

    Alveolar soft part sarcoma (ASPS) is a rare, soft tissue malignancy, usually presenting in young adults. We report a patient with ASPS in the thigh, evaluated with plain films, computed tomography, and a radionuclide scan. The findings in this patient and those in which CT findings have been reported in the literature, show a similar appearance which we believe is highly suggestive of this unusual tumor. The combination of a soft tissue lesion, that on CT appears highly vascular, with features suggestive of an arteriovenous malformation, in association with multiple pulmonary nodules and a bone scan with features suggestive of infection should lead to a consideration of this rare entity. (orig./GDG)

  7. A review on alveolar ridge preservation following tooth extraction.

    Science.gov (United States)

    Horowitz, Robert; Holtzclaw, Danny; Rosen, Paul S

    2012-09-01

    The question that clinicians face is whether the use of bone replacement grafts and/or barrier membranes enhance their ability to provide for the future placement of a dental implant or to maximize ridge dimensions following the extraction of a tooth versus no additional treatments. The evidence was obtained by search of Entrez PubMed and manual search of The International Journal of Oral and Maxillofacial Implants, The International Journal of Periodontics & Restorative Dentistry, Clinical Oral Implant Research, The Journal of Periodontology, The Journal of Clinical Periodontology, and The Compendium of Continuing Education in Dentistry. Key search words included Guided Bone Regeneration, Dental Extraction, Tooth Extraction, Bone Replacement Graft, Alveolar Ridge. The years of search included from January 2011 through February 2012. The recurring theme was that there was considerable heterogeneity to study designs, time periods, and methods of evaluation. This created great difficulty in trying to answer with good high-quality evidence questions about the techniques and materials to be used for maximizing regeneration at the time of tooth extraction or in which situations this ought to be used. There appears to be consensus from the reviewed literature supporting ridge preservation techniques as a whole. Multiple studies demonstrated less ridge resorption occurring when alveolar ridge preservation procedures were used versus the placement of no graft material in fresh alveolar sockets. The analysis did not show any grafting materials demonstrating a clear benefit over any others or that a barrier membrane is necessary. The evidence is also too premature about whether socket preservation efforts require primary closure. In the emerging area of growth factors, there is no high-quality evidence to either support or refute their use. Tooth extraction is one of the most widely performed procedures in dentistry today and it has been historically well documented that

  8. Is acute alveolar dilation an indicator of strangulation homicide?

    DEFF Research Database (Denmark)

    Klysner, Anne; Lynnerup, Niels; Hougen, Hans Petter

    2011-01-01

    Some cases of suspected homicidal strangulation are difficult to diagnose if the classical injuries of strangulation are few or lacking. The main purpose of this study was to determine if abnormal distension of alveolar airspaces is present in strangulation deaths and whether or not it can be used...... to support this diagnosis. Another purpose was to see how often the gross examination of the lungs was in agreement with the microscopic examination. The material comprised 33 victims of homicidal strangulation above the age of 15 years, autopsied at the Department of Forensic Medicine in Copenhagen between...

  9. Alveolar hemorrhage after scuba diving: a case report.

    Science.gov (United States)

    Tsai, Ming-Ju; Tsai, Mee-Sun; Tsai, Ying-Ming; Lien, Chi-Tun; Hwang, Jhi-Jhu; Huang, Ming-Shyan

    2010-07-01

    Self-contained underwater breathing apparatus (scuba) diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving. Copyright 2010 Elsevier. Published by Elsevier B.V. All rights reserved.

  10. Alveolar Hemorrhage After Scuba Diving: A Case Report

    Directory of Open Access Journals (Sweden)

    Ming-Ju Tsai

    2010-07-01

    Full Text Available Self-contained underwater breathing apparatus (scuba diving is increasingly popular in Taiwan. There are few references in the literature regarding pulmonary hemorrhage as the sole manifestation of pulmonary barotrauma in scuba divers, and no study from Taiwan was found in the literature. We present the case of a 25-year-old man who suffered alveolar hemorrhage related to pulmonary barotrauma as a complication of scuba diving. To our knowledge, this is the first case report describing a Taiwanese subject suffering from non-fatal pulmonary hemorrhage after scuba diving.

  11. Demineralized dentin matrix scaffolds for alveolar bone engineering

    Directory of Open Access Journals (Sweden)

    In-Woong Um

    2017-01-01

    Full Text Available From the point of view of implant dentistry, this review discusses the development and clinical use of demineralized dentin matrix (DDM scaffolds, produced from the patient's own extracted teeth, to repair alveolar bone defects. The structure and the organic and inorganic components of DDM are presented to emphasize the similarities with autogenous bone. Studies of DDM properties, such as osteoinductive and osteoconductive functions as well as efficacy and safety, which are mandatory for its use as a bone graft substitute, are also presented. The clinical applications of powder, block, and moldable DDM are discussed, along with future developments that can support growth factor and stem cell delivery.

  12. Primary alveolar soft part sarcoma of vertebra: a case report and literature review

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Fei-Peng [Nanjing University, Department of Medical Imaging, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Xuzhou Medical College, Xuzhou, Jiangsu Province (China); Lu, Guang-Ming; Zhang, Long-Jiang [Nanjing University, Department of Medical Imaging, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Wang, Jian-Dong [Nanjing University, Department of Pathology, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); An, Xiao-Jing [Nanjing University, Department of Pathology, Jinling Hospital, Clinical School of Medical College, Nanjing, Jiangsu Province (China); Nanjing University, Medical College, Nanjing, Jiangsu Province (China); Dong, Ying-Chun [Nanjing Stomatology Hospital/The Affiliated Stomatology Hospital of Medical School of Nanjing University, Department of Anesthesiology, Nanjing, Jiangsu Province (China)

    2009-08-15

    Alveolar soft part sarcoma (ASPS) is a rare malignant soft tissue tumor, which rarely occurs in bone. We present a case of ASPS in a 23-year-old man with a 2-month history of back pain. Computed tomography scanning and magnetic resonance images demonstrated a destructive process in the 12th thoracic vertebra associated with a unilateral soft tissue mass. The tumor showed evidence of hypervascularity on MRI; it obviously was enhanced on T1-weighted images after injection of Gd-GDPA, and signal voids were shown on all pulse sequences which may help to differentiate ASPS from other tumors of the vertebra. We believe that this is the first case of ASPS arising in a vertebra. (orig.)

  13. The axonal guidance cue semaphorin 3C contributes to alveolar growth and repair.

    Directory of Open Access Journals (Sweden)

    Arul Vadivel

    Full Text Available Lung diseases characterized by alveolar damage such as bronchopulmonary dysplasia (BPD in premature infants and emphysema lack efficient treatments. Understanding the mechanisms contributing to normal and impaired alveolar growth and repair may identify new therapeutic targets for these lung diseases. Axonal guidance cues are molecules that guide the outgrowth of axons. Amongst these axonal guidance cues, members of the Semaphorin family, in particular Semaphorin 3C (Sema3C, contribute to early lung branching morphogenesis. The role of Sema3C during alveolar growth and repair is unknown. We hypothesized that Sema3C promotes alveolar development and repair. In vivo Sema3C knock down using intranasal siRNA during the postnatal stage of alveolar development in rats caused significant air space enlargement reminiscent of BPD. Sema3C knock down was associated with increased TLR3 expression and lung inflammatory cells influx. In a model of O2-induced arrested alveolar growth in newborn rats mimicking BPD, air space enlargement was associated with decreased lung Sema3C mRNA expression. In vitro, Sema3C treatment preserved alveolar epithelial cell viability in hyperoxia and accelerated alveolar epithelial cell wound healing. Sema3C preserved lung microvascular endothelial cell vascular network formation in vitro under hyperoxic conditions. In vivo, Sema3C treatment of hyperoxic rats decreased lung neutrophil influx and preserved alveolar and lung vascular growth. Sema3C also preserved lung plexinA2 and Sema3C expression, alveolar epithelial cell proliferation and decreased lung apoptosis. In conclusion, the axonal guidance cue Sema3C promotes normal alveolar growth and may be worthwhile further investigating as a potential therapeutic target for lung repair.

  14. Comparison of Accuracy of determining the Distance between Alveolar Crest and Cementoenamel Junction in Digital Radiography with Scanora and DentalEye Software Programs.

    Science.gov (United States)

    Mehdizadeh, Mojdeh; Maarefat, Negar; Bagherieh, Shervin

    2016-10-01

    To compare the accuracy of determining the distance between alveolar crest and cementoenamel junction (CEJ) in digital radiography with two image processing software programs. In this in vitro study, 63 sites in a dried human mandible underwent digital periapical radiography. The distance from the alveolar crest to the CEJ was calculated using DentalEye and Scanora software programs and compared with the standard mode (measured on the skull). Statistical analysis was performed with analysis of variance (ANOVA) and paired t-test using Statistical Package for the Social Sciences (SPSS) 23 at α = 0.05. There were significant differences in the distances between CEJ and the alveolar crest at the mesial surfaces as measured by the three techniques in standard mode, using DentalEye and Scanora (p-value ≤ 0.03) softwares; however, there were no significant differences between the results on distal surfaces (p-value = 0.248). Under the limitations of the present study, the measurements made to determine the distance from the CEJ to the alveolar crest with DentalEye and Scanora, relative to each other, and relative to the standard mode, were accurate only on distal surfaces of teeth. Digital dental software programs are useful assets that can enhance the diagnosing ability and reduce the need of taking extra images.

  15. Gravidez em paciente com microlitíase alveolar pulmonar grave Pregnancy in a patient with severe pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    José Osmar Bezerra de Souza Filho

    2008-10-01

    Full Text Available A microlitíase alveolar pulmonar (MAP é uma doença rara que atinge ambos os pulmões, caracterizada pela presença de pequenos cálculos (fosfato de cálcio nos espaços alveolares. Relatamos o caso de uma paciente do sexo feminino, de 26 anos, cujo diagnóstico foi confirmado com base nos achados marcantes na radiografia de tórax e tomografia computadorizada de alta resolução. A paciente, gestante de 28 semanas, retornou ao hospital 10 meses após o diagnóstico apresentando insuficiência respiratória hipoxêmica e com distúrbio ventilatório restritivo grave à espirometria. Após completadas 32 semanas e 4 dias de gestação, foi submetida aparto cesariano, com sucesso para mãe e filha. A MAP tem evolução clínica variável. Tem provável caráter autossômico recessivo e associação com história familiar positiva. A etiologia é incerta, e muitos autores especulam que haja um defeito enzimático local responsável pelo acúmulo intra-alveolar de cálcio. Relatos de pacientes com MAP que engravidaram são excepcionais, sendo o presente caso o primeiro descrito no Brasil. O curso dessa doença costuma ser lentamente progressivo, e os pacientes geralmente falecem devido à insuficiência cardiorrespiratória. O presente caso ilustra a necessidade de se oferecer aconselhamento genético e orientações sobre o risco de gravidez às pacientes, especialmente em casos de doença avançada. Atualmente, a única terapia efetiva é o transplante pulmonar.Pulmonary alveolar microlithiasis (PAM is a rare disease that affects both lungs. It is characterized by the presence of small calculi (calcium phosphate within the alveolar spaces. We report the case of a 26-year-old female whose diagnosis was based on characteristic findings on chest X-rays and high-resolution computed tomography scans. The patient, 28 weeks pregnant, was rehospitalized 10 months after the diagnosis, presenting hypoxemic acute respiratory failure and severe restrictive

  16. Ovariectomy delays alveolar wound healing after molar extractions in rats.

    Science.gov (United States)

    Pereira, Michele Conceição; Zecchin, Karina Gottardello; Campagnoli, Eduardo Bauml; Jorge, Jacks

    2007-11-01

    This study was conducted to investigate the morphological effects of the absence of estrogen on alveolar wound healing of young female rats after tooth extraction. A total of 60 4- to 6-week-old female rats underwent bilateral ovariectomy (OVX) or sham operations. Three weeks later, the first mandibular molars were extracted. Subsequently, the animals were killed by cervical dislocation 3, 5, 7, 14, 21, or 28 days after tooth extraction. The mandibles were removed, and serial transversal sections of mesial alveolus of the first mandibular molars were obtained for histometric analysis. OVX sockets showed significant increases in fibroblasts and collagen content 3 and 5 days after the extractions, followed by significant decreases in these parameters in the subsequent periods. In accordance with the decreased collagen content in the latest period of healing, new bone formation was significantly reduced in the OVX animals. These findings suggest that the initial molecular changes observed in the absence of estrogen lead to delayed alveolar wound healing.

  17. Alveolar rhabdomyosarcoma: origin and prognostic implications of molecular findings.

    Science.gov (United States)

    Eguía-Aguilar, Pilar; López-Martínez, Briceida; Retana-Contreras, Carmen; Perezpeña-Diazconti, Mario

    We present the case of a 2-year-old male patient with a facial tumor partially treated with chemotherapy before his admission to our institution. The tumor involved from the frontal region to the maxillary floor, the orbit, and the maxillary and sphenoid sinuses. The histopathological diagnosis revealed a stage IV alveolar rhabdomyosarcoma with infiltration to bone marrow and cerebrospinal fluid. He was managed with four cycles of adriamycin, actinomycin, cyclophosphamide and vincristine; cisplatin and irinotecan were added to the last cycle. The tumor had a 50% size reduction, but the patient died after a neutropenia and fever episode. The aggressive behavior of alveolar rhabdomyosarcoma has been associated with the expression of oncogenic fusion proteins resulting from chromosomal translocations, particularly t(2;13) (q35;q14) PAX3/FOXO1, and t(1;13) (p36;q14) PAX7/FOXO1 which were present in this patient. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  18. Primary pulmonary alveolar proteinosis: computed tomography features at diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Berteloot, Laureline; Emond-Gonsard, Sophie; Mamou-Mani, Tania; Lambot, Karen; Grevent, David [Hopital Necker Enfants-Malades, Department of Pediatric Radiology, Paris (France); Taam, Rola Abou; Le Bourgeois, Muriel [Hopital Necker Enfants-Malades, Department of Pediatric Pneumology and Allergology, Paris (France); Elie, Caroline [Hopital Necker Enfants-Malades, Department of Biostatistics, Paris (France); Paris Descartes University, Paris (France); Delacourt, Christophe; Blic, Jacques de [Hopital Necker Enfants-Malades, Department of Pediatric Pneumology and Allergology, Paris (France); Paris Descartes University, Paris (France); Brunelle, Francis [Hopital Necker Enfants-Malades, Department of Pediatric Radiology, Paris (France); Paris Descartes University, Paris (France)

    2014-07-15

    Pulmonary alveolar proteinosis (PAP) is characterized by an abnormal accumulation of periodic acid-schiff-positive lipoproteinaceous material in the alveoli. Early diagnosis allows setting up of therapeutic lung lavages, which reduces the need for oxygen supplementation and weight gain. To provide a description of radiological features by CT at the onset of primary PAP in children. The clinical and radiological data of 24 patients, including 16 boys and 8 girls (median age: 12 months), diagnosed with a primary form of PAP between April 1992 and May 2012 in a tertiary referral hospital, were retrospectively reviewed. CT images were examined for the presence of alveolar and interstitial elementary lesions. Correlation between clinical and radiological findings was assessed. The types of elementary lesions detected were: ground-glass opacities (n = 24), intralobular lines (n = 24), thickened interlobular septa (n = 22), thickened fissures (n = 21), airspace consolidation (n = 16), hyperinflation (n = 16), cystic lesions (n = 2) and micronodules (n = 1). A crazy-paving pattern was found in 92% of cases. Consolidation and hyperinflation were especially detected in younger children (median age, 8 months, P < 0.01). A density dependent gradient was found. The distribution of the lesions was symmetrical. There was no correlation between radiological and clinical data of severity of the disease. CT findings are suggestive of diagnosis of PAP in immunocompetent children with chronic respiratory failure. (orig.)

  19. Alveolar macrophage dysregulation in Hermansky-Pudlak syndrome type 1.

    Science.gov (United States)

    Rouhani, Farshid N; Brantly, Mark L; Markello, Thomas C; Helip-Wooley, Amanda; O'Brien, Kevin; Hess, Richard; Huizing, Marjan; Gahl, William A; Gochuico, Bernadette R

    2009-12-01

    Individuals with Hermansky-Pudlak syndrome type 1 (HPS-1), an autosomal recessive disorder characterized by defective biogenesis of lysosome-related organelles, develop an accelerated form of progressive fibrotic lung disease. The etiology of pulmonary fibrosis associated with HPS-1 is unknown. To investigate the potential pathogenesis of pulmonary fibrosis in HPS-1, lung cells and proteins from individuals with HPS-1 were studied. Forty-one subjects with HPS-1 with and without pulmonary fibrosis were evaluated with pulmonary function tests, high-resolution computed tomography scan, and bronchoscopy. Bronchoalveolar lavage cells and analytes were analyzed. Concentrations of total bronchoalveolar lavage cells and alveolar macrophages were significantly higher in epithelial lining fluid from subjects with HPS-1 with and without pulmonary fibrosis compared with healthy research volunteers. Concentrations of cytokines and chemokines (i.e., monocyte chemoattractant protein-1, macrophage inflammatory protein-1alpha, and granulocyte-macrophage colony-stimulating factor) in alveolar epithelial lining fluid were significantly higher in subjects with HPS-1 with and without pulmonary fibrosis compared with healthy research volunteers (P system in which to study the pathogenesis and treatment of HPS pulmonary fibrosis.

  20. Alveolar Bone Housing- A Modified Wilkodontics Approach- A Case Report

    Science.gov (United States)

    Sanjay, Kothamachu; Bhongade, ML; Shrivastav, Sunita

    2016-01-01

    Accelerated orthodontic treatment is the need of the hour in current scenario as the conventional orthodontics is time taking. Corticotomy assisted orthodontics have been used for years to reduce the treatment duration by reducing the resistance provided by alveolar bone housing. This case report describes the orthodontic treatment combined with the modification in conventional wilkodontic technique in a patient to accelerate tooth movement and shorten the treatment time with an anterior open bite and flared and spaced upper and lower incisors. Firstly plaque control was achieved with supra and subgingival scaling. A modified approach using periodontal access flap followed by vertical bone cuts in the cortical bone from the crest of the alveolar bone margin to 2mm-3mm below the apices of all the anterior teeth extending from upper left canine to upper right canine were performed. These vertical cuts were joined by horizontal cuts apically and flap repositioned. An MBT 0.018 inch appliance was bonded. Orthodontic therapy proceeded with frequent activation of the appliances to retract the incisors every two weeks. The total treatment time was four and half months with active period of two months and no adverse effects were observed at the end of active treatment. The modified decortication technique reduced the treatment time to a considerable extent. The interdental spacing closed and optimum overjet and overbite was achieved. PMID:27656577

  1. Advances in multidisciplinary individualized treatment of refractory hepatic alveolar echinococcosis

    Directory of Open Access Journals (Sweden)

    ABUDUAINI Abulizi

    2015-04-01

    Full Text Available Hepatic alveolar echinococcosis (HAE is a zoonotic parasitic disease that seriously threatens the population in western China and compromises patients′ quality of life. With the continuous improvement in radical resection rate in recent years, late-stage HAE patients that were incurable in the past now have the opportunity for radical resection. However, patients who are not suitable candidates for radical resection still suffer from various complications and poor quality of life. Therefore, HAE is still considered a refractory and complex disease. The simple empirical treatment model provided by traditional professional discussion is unable to satisfy the treatment of advanced refractory HAE as it is unable to integrate specialized, standardized clinical skills for diagnosis and treatment. Multidisciplinary individualized treatment (MDT organically integrates the advantages of the available treatment into a reasonable individualized comprehensive treatment regimen. This review summarizes the advances in MDT for HAE as the best option to increase long-term survival, and suggests MDT as the first-line treatment for late-stage refractory hepatic alveolar echinococcosis.

  2. Peptide secreted by human alveolar macrophages releases neutrophil granule contents

    International Nuclear Information System (INIS)

    MacArthur, C.K.; Miller, E.J.; Cohen, A.B.

    1987-01-01

    A monoclonal antibody was developed against an 8000-kDa enzyme-releasing peptide (ERP) released from human alveolar macrophages. ERP was isolated on an immunoaffinity column containing the antibody bound to staphylococcal protein A-Sepharose, and by autoradiography. Release of ERP from the macrophages is not changed by plastic adherence, phagocytosis, calcium ionophore, or phorbol esters. The peptide was not antigenically similar to interferon-γ, tumor necrosis factor, or interleukin lα or 1β. The release of constituents from azurophilic and specific granules was the main identified biologic function of ERP. ERP was a more effective secretagogue in the untreated neutrophils and f-met-leu-phe was more effective in the cytochalasin B-treated neutrophils. Absorption of ERP from macrophage-conditioned medium removed a small amount of the chemotactic activity; however, the immunopurified peptide was not chemotactic or chemokinetic for neutrophils, and at high concentrations, it suppressed base line chemokinesis. Treatment of washed macrophages with trypsin released active ERP of approximately the same m.w. of spontaneously secreted ERP. These studies showed that human alveolar macrophages release a peptide which is a secretagogue for human neutrophils under conditions which may be encountered in the lungs during certain disease states. Proteolytic enzymes which are free in the lungs may release the peptide and lead to the secretion of neutrophil enzymes

  3. Primary pulmonary alveolar proteinosis: computed tomography features at diagnosis

    International Nuclear Information System (INIS)

    Berteloot, Laureline; Emond-Gonsard, Sophie; Mamou-Mani, Tania; Lambot, Karen; Grevent, David; Taam, Rola Abou; Le Bourgeois, Muriel; Elie, Caroline; Delacourt, Christophe; Blic, Jacques de; Brunelle, Francis

    2014-01-01

    Pulmonary alveolar proteinosis (PAP) is characterized by an abnormal accumulation of periodic acid-schiff-positive lipoproteinaceous material in the alveoli. Early diagnosis allows setting up of therapeutic lung lavages, which reduces the need for oxygen supplementation and weight gain. To provide a description of radiological features by CT at the onset of primary PAP in children. The clinical and radiological data of 24 patients, including 16 boys and 8 girls (median age: 12 months), diagnosed with a primary form of PAP between April 1992 and May 2012 in a tertiary referral hospital, were retrospectively reviewed. CT images were examined for the presence of alveolar and interstitial elementary lesions. Correlation between clinical and radiological findings was assessed. The types of elementary lesions detected were: ground-glass opacities (n = 24), intralobular lines (n = 24), thickened interlobular septa (n = 22), thickened fissures (n = 21), airspace consolidation (n = 16), hyperinflation (n = 16), cystic lesions (n = 2) and micronodules (n = 1). A crazy-paving pattern was found in 92% of cases. Consolidation and hyperinflation were especially detected in younger children (median age, 8 months, P < 0.01). A density dependent gradient was found. The distribution of the lesions was symmetrical. There was no correlation between radiological and clinical data of severity of the disease. CT findings are suggestive of diagnosis of PAP in immunocompetent children with chronic respiratory failure. (orig.)

  4. A 55 years old man with pulmonary alveolar microlithiasis

    Directory of Open Access Journals (Sweden)

    Rebeen R Saeed

    2014-01-01

    Full Text Available Pulmonary alveolar microlithiasis (PAM is a very rare diffuse chronic lung disease characterized by deposition of small spherules of calcium phosphate within the alveolar cavity. The disease is usually seen from birth up to 40 years of age and is usually diagnosed incidentally during radiography of the chest for other reasons. Most of patients are asymptomatic or having very mild symptoms and the majority of patients either have normal or restrictive pulmonary function test. Clinically, the course of the disease is different; it remains static in few patients or it may progress to pulmonary fibrosis, respiratory failure and cor pulmonale in others. In this case report, we present a 55-year-old man who presented with moderate shortness of breath which has progressed from mild symptoms with in the previous years. His chest high-resolution CT scan showed diffusely scattered, ill-defined little shadowy micronodules which involve the left lung; lingula and left lower lobe in particular. A lung biopsy confirmed the diagnosis of PAM. He was followed up for 1 year with treatment by steroid and alendronate, and no progression was noticed in fact improvement in pulmonary function test noticed. This is the first case report of PAM in Kurdistan.

  5. Evaluation of the Effect of Platelet-Rich Fibrin on the Alveolar ...

    African Journals Online (AJOL)

    2018-02-23

    Feb 23, 2018 ... nonsmokers or positively affect periodontal healing, but it positively affected postoperative pain levels. Keywords: Alveolar osteitis, mandibular third molar, platelet-rich fibrin, probing depth. Evaluation of the Effect of Platelet-Rich Fibrin on the Alveolar Osteitis. Incidence and Periodontal Probing Depth after ...

  6. Is 2 mm a safe distance from the inferior alveolar canal to avoid ...

    African Journals Online (AJOL)

    2015-10-30

    Oct 30, 2015 ... related to implants inserted closer than 2 mm to the inferior alveolar canal (IAC) with those inserted further than 2 ... KEYWORDS: Dental implants, inferior alveolar nerve injury, neurosensory complication. Department of .... such injury occurs, a complete healing is difficult if the extent of the injury is not minor ...

  7. Alveolar index as a means of skull classification: a radiological study ...

    African Journals Online (AJOL)

    Alveolar index is an important parameter in intra and inter-ethnic classification of skull and in defining the positional relation of the maxilla to the mandible. The objective of the study was to evaluate the alveolar index of Nigerians using radiographs. 130 (90 males and 40 females) normal lateral view skull radiographs of ...

  8. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation

    Directory of Open Access Journals (Sweden)

    João Paulo Schwartz

    2016-04-01

    Full Text Available ABSTRACT Objective: This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. Methods: The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years, Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0 and after Herbst treatment (T1. Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B, lingual (L and total (T bone thicknesses were assessed at crestal (1, midroot (2 and apical (3 levels of mandibular incisors. Student's t-test and Wilcoxon t-test were used to compare dependent samples in parametric and nonparametric cases, respectively. Pearson's and Spearman's rank correlation analyses were performed to determine the relationship of changes in alveolar bone thickness. Results were considered at a significance level of 5%. Results: Mandibular incisors showed no statistical significance for vertical alveolar bone level. Alveolar bone thickness of mandibular incisors significantly reduced after treatment at B1, B2, B3, T1 and significantly increased at L2. The magnitude of the statistically significant changes was less than 0.2 mm. The changes in alveolar bone thickness showed no statistical significance with incisor inclination degree. Conclusions: CBCT scans showed an association between the Herbst appliance and alveolar bone loss on the buccal surface of mandibular incisors; however, without clinical significance.

  9. Popliteal pterygium syndrome (PPS) with intra-alveolar syngnathia: a discussion of anesthetic and surgical considerations.

    Science.gov (United States)

    Gahm, Caroline; Kuylenstierna, Richard; Papatziamos, Georgios

    2007-10-01

    Popliteal pterygium syndrome (PPS) is a rare genetic disorder that involves the association of a popliteal web with a combination of craniofacial, genitourinary and extremity malformations. In this article, we describe a patient with PPS complicated with multiple intra-alveolar syngnathia. We discuss the anesthetic and the surgical management of this case and review the literature regarding PPS and intra-alveolar syngnathia.

  10. Morbidity of chin bone transplants used for reconstructing alveolar defects in cleft patients

    NARCIS (Netherlands)

    Booij, A; Raghoebar, GM; Jansma, J; Kalk, WWI; Vissink, A

    Objective: The aim of this study was to evaluate the objective and subjective morbidity of symphyseal chin bone harvesting used for reconstruction of alveolar defects in young cleft patients. Design: All patients who had undergone chin bone harvesting for alveolar cleft reconstruction in the period

  11. Changes in alveolar bone support induced by the Herbst appliance: a tomographic evaluation.

    Science.gov (United States)

    Schwartz, João Paulo; Raveli, Taisa Boamorte; Schwartz-Filho, Humberto Osvaldo; Raveli, Dirceu Barnabé

    2016-01-01

    This study evaluated alveolar bone loss around mandibular incisors, induced by the Herbst appliance. The sample consisted of 23 patients (11 men, 12 women; mean age of 15.76 ± 1.75 years), Class II, Division 1 malocclusion, treated with the Herbst appliance. CBCT scans were obtained before treatment (T0) and after Herbst treatment (T1). Vertical alveolar bone level and alveolar bone thickness of mandibular incisors were assessed. Buccal (B), lingual (L) and total (T) bone thicknesses were assessed at crestal (1), midroot (2) and apical (3) levels of mandibular incisors. Student's t-test and Wilcoxon t-test were used to compare dependent samples in parametric and nonparametric cases, respectively. Pearson's and Spearman's rank correlation analyses were performed to determine the relationship of changes in alveolar bone thickness. Results were considered at a significance level of 5%. Mandibular incisors showed no statistical significance for vertical alveolar bone level. Alveolar bone thickness of mandibular incisors significantly reduced after treatment at B1, B2, B3, T1 and significantly increased at L2. The magnitude of the statistically significant changes was less than 0.2 mm. The changes in alveolar bone thickness showed no statistical significance with incisor inclination degree. CBCT scans showed an association between the Herbst appliance and alveolar bone loss on the buccal surface of mandibular incisors; however, without clinical significance.

  12. Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients

    DEFF Research Database (Denmark)

    Andersen, Kristian; Nørholt, Sven Erik; Knudsen, Johan

    Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients......Postoperative morbidity after reconstruction of alveolar bone defects with chin bone transplants in cleft patients - 111 consecutive patients...

  13. Is there a relation between local bone quality as assessed on panoramic radiographs and alveolar bone level?

    Science.gov (United States)

    Nackaerts, Olivia; Gijbels, Frieda; Sanna, Anna-Maria; Jacobs, Reinhilde

    2008-03-01

    The aim was to explore the relation between radiographic bone quality on panoramic radiographs and relative alveolar bone level. Digital panoramic radiographs of 94 female patients were analysed (mean age, 44.5; range, 35-74). Radiographic density of the alveolar bone in the premolar region was determined using Agfa Musica software. Alveolar bone level and bone quality index (BQI) were also assessed. Relationships between bone density and BQI on one hand and the relative loss of alveolar bone level on the other were assessed. Mandibular bone density and loss of alveolar bone level were weakly but significantly negatively correlated for the lower premolar area (r = -.27). The BQI did not show a statistically significant relation to alveolar bone level. Radiographic mandibular bone density on panoramic radiographs shows a weak but significant relation to alveolar bone level, with more periodontal breakdown for less dense alveolar bone.

  14. A contemporary perspective on techniques for the clinical assessment of alveolar bone

    Energy Technology Data Exchange (ETDEWEB)

    Hausmann, E. (State Univ. of New York, Buffalo (USA))

    1990-03-01

    Radiographic techniques, traditional ones as well as newer ones under development, for clinically assessing alveolar bone are critically assessed. Traditional intraoral radiography is reexamined, in particular with regard to the accuracy with which the alveolar crest is seen. Evidence is presented for a more accurate representation of the alveolar crest on bitewings rather than periapical films. Application in periodontics of newer radiographic techniques, subtraction radiography, and single and dual photon aborptiometry presently under clinical development are discussed in regard to their potential and limitations. Similarly, radiopharmaceuticals to evaluate the metabolic status of alveolar bone are discussed as well as the potential for using analyses of gingival crevice fluid as a window for assessment of alveolar crest metabolism. 46 references.

  15. A contemporary perspective on techniques for the clinical assessment of alveolar bone

    International Nuclear Information System (INIS)

    Hausmann, E.

    1990-01-01

    Radiographic techniques, traditional ones as well as newer ones under development, for clinically assessing alveolar bone are critically assessed. Traditional intraoral radiography is reexamined, in particular with regard to the accuracy with which the alveolar crest is seen. Evidence is presented for a more accurate representation of the alveolar crest on bitewings rather than periapical films. Application in periodontics of newer radiographic techniques, subtraction radiography, and single and dual photon aborptiometry presently under clinical development are discussed in regard to their potential and limitations. Similarly, radiopharmaceuticals to evaluate the metabolic status of alveolar bone are discussed as well as the potential for using analyses of gingival crevice fluid as a window for assessment of alveolar crest metabolism. 46 references

  16. Clinical study of the alveolar bone height for the dental implant using preoperative computed tomographic examination

    International Nuclear Information System (INIS)

    Sekiya, Keiko; Mori, Shintaro; Sekiya, Kotaro

    2008-01-01

    CT examination is useful for preoperative dental implant, and many studies of concerning clinical studies using CT images have been reported. However, there are few reports comparing alveolar bone heights among age groups of many cases. The purpose of this study was to evaluate the clinical studies of preoperative CT examinations for alveolar bone heights and patient ages at our department of radiology using 64 multi-detector row CT. The subjects consisted of 5174 regions in 1312 (425 males and 887 females, mean age 55.5 yrs, 16-86 yrs) cases of preoperative CT examinations, between April 2006 and December 2007. CT machine used was the Aquilion TM 64 (Toshiba Medical Systems, Japan), and the workstation used was the ZIOSTATION (ZIOSOFT, Japan). All of CT examinations were performed the position of implant placement and disease examined from CT findings. Alveolar bone heights for dental implants were examined from the CT images. For the maxilla, the alveolar bone height was the distance from the alveolar crest to the base of the nasal cavity, or the base of the maxillary sinus. For the mandible, the alveolar bone height is the distance from the alveolar crest and the upper wall of the mandibular canal, or the distance between the alveolar crest and inferior border of mandible. The numbers of the implant position were 955 site for the first molar of the mandible (the average alveolar bone height is 13.9 mm), 652 site for the second molar of the mandible (12.8 mm), and 567 site for the first molar of the maxilla (6.8 mm). In conclusion, the position where implant were to placed the most was the first molar of the mandible, and it's alveolar bone height got lower with age for women. It is over 60% of the maxillary molar area were lower 8 mm, so some kind of osteogenetic treatment was required in many cases, and hence we reassured the importance of CT. (author)

  17. The use of digital periapical radiographs to study the prevalence of alveolar domes

    Energy Technology Data Exchange (ETDEWEB)

    Xambre, Pedro Augusto Oliveira Santos; Valerio, Claudia Scigliano; Alves Cardoso, Claudia Assuncoe; Custodio, Antonio Luis Neto; Manzi, Flavio Ricardo [Dept. of Oral Radiology, School of Dentistry, Pontifical Catholic University of Minas Gerais, Belo Horizonte (Brazil)

    2016-09-15

    In the present study, we coined the term 'alveolar dome' and aimed to demonstrate the prevalence of alveolar domes through digital periapical radiographs. This study examined 800 digital periapical radiographs in regard to the presence of alveolar domes. The periapical radiographs were acquired by a digital system using a photostimulable phosphor (PSP) plate. The χ2 test, with a significance level of 5%, was used to compare the prevalence of alveolar domes in the maxillary posterior teeth and, considering the same teeth, to verify the difference in the prevalence of dome-shaped phenomena between the roots. The prevalence of alveolar domes present in the first pre-molars was statistically lower as compared to the other maxillary posterior teeth (p<0.05). No statistically significant difference was observed in the prevalence of alveolar domes between the maxillary first and second molars. Considering the maxillary first and second molars, it was observed that the palatal root presented a lower prevalence of alveolar domes when compared to the distobuccal and mesiobuccal roots (p<0.05). The present study coined the term 'alveolar dome', referring to the anatomical projection of the root into the floor of the maxillary sinus. The maxillary first and second molars presented a greater prevalence of alveolar domes, especially in the buccal roots, followed by the third molars and second pre-molars. Although the periapical radiograph is a two-dimensional method, it can provide dentists with the auxiliary information necessary to identify alveolar domes, thus improving diagnosis, planning, and treatment.

  18. Effects of diclofenac and celecoxib on osteoclastogenesis during alveolar bone healing, in vivo

    Directory of Open Access Journals (Sweden)

    Parichehr Ghalayani

    2014-01-01

    Full Text Available Background: Osteoclastogenesis is coordinated by the interaction of members of the tumor necrosis factor (TNF superfamily: Receptor activator of nuclear factor- κB ligand (RANKL and Osteoprotegerin (OPG. The aim of this study was to compare the effect of two different types of non-steroidal anti-inflammatory drugs (NSAIDs on the RANKL/OPG balance during the healing of the alveolar process. Materials and Methods: This was an experimental study, carried on 45 male Wistar rats (200 ± 25 g, 8-10 weeks old. After extraction of the right maxillary first molar, 15 rats received 5 mg/kg/day of diclofenac and 15 rats received 15 mg/kg/day of celecoxib and 15 rats received normal saline. The animals were sacrificed 7, 14 and 21 days after tooth extraction. The number of osteoclasts, OPG and RANKL messenger ribonucleic acid expression were determined by tartrate-resistant acid phosphate (TRAP staining and polymerase chain reaction (PCR respectively. The data were analyzed by one-way ANOVA followed by Tukey′s post-hoc test. Values of P < 0.05 were considered significant. Results: On days 7, 14 and 21 the ratio of RANKL/OPG in the control group was higher than diclofenac and celecoxib groups. TRAP immunolabeling of the control group was more than diclofenac group on day 7 and was more than celecoxib group on day 14. On day 21, no significant differences were noted among the three studied groups. Conclusion: Both drugs affect RANKL/OPG gene expression and also osteoclastogenesis in alveolar socket during the experimental period of 21 days.

  19. Spatiotemporal dynamics of actin remodeling and endomembrane trafficking in alveolar epithelial type I cell wound healing.

    Science.gov (United States)

    Godin, Lindsay M; Vergen, Jorge; Prakash, Y S; Pagano, Richard E; Hubmayr, Rolf D

    2011-04-01

    Alveolar epithelial type I cell (ATI) wounding is prevalent in ventilator-injured lungs and likely contributes to pathogenesis of "barotrauma" and "biotrauma." In experimental models most wounded alveolar cells repair plasma membrane (PM) defects and survive insults. Considering the force balance between edge energy at the PM wound margins and adhesive interactions of the lipid bilayer with the underlying cytoskeleton (CSK), we tested the hypothesis that subcortical actin depolymerization is a key facilitator of PM repair. Using real-time fluorescence imaging of primary rat ATI transfected with a live cell actin-green fluorescent protein construct (Lifeact-GFP) and loaded with N-rhodamine phosphatidylethanolamine (PE), we examined the spatial and temporal coordination between cytoskeletal remodeling and PM repair following micropuncture. Membrane integrity was inferred from the fluorescence intensity profiles of the cytosolic label calcein AM. Wounding led to rapid depolymerization of the actin CSK near the wound site, concurrent with accumulation of endomembrane-derived N-rhodamine PE. Both responses were sustained until PM integrity was reestablished, which typically occurs between ∼10 and 40 s after micropuncture. Only thereafter did the actin CSK near the wound begin to repolymerize, while the rate of endomembrane lipid accumulation decreased. Between 60 and 90 s after successful PM repair, after translocation of the actin nucleation factor cortactin, a dense actin fiber network formed. In cells that did not survive micropuncture injury, actin remodeling did not occur. These novel results highlight the importance of actin remodeling in ATI cell repair and suggest molecular targets for modulating the repair process.

  20. An Optimised Human Cell Culture Model for Alveolar Epithelial Transport

    Science.gov (United States)

    Birch, Nigel P.; Suresh, Vinod

    2016-01-01

    Robust and reproducible in vitro models are required for investigating the pathways involved in fluid homeostasis in the human alveolar epithelium. We performed functional and phenotypic characterisation of ion transport in the human pulmonary epithelial cell lines NCI-H441 and A549 to determine their similarity to primary human alveolar type II cells. NCI-H441 cells exhibited high expression of junctional proteins ZO-1, and E-cadherin, seal-forming claudin-3, -4, -5 and Na+-K+-ATPase while A549 cells exhibited high expression of pore-forming claudin-2. Consistent with this phenotype NCI-H441, but not A549, cells formed a functional barrier with active ion transport characterised by higher electrical resistance (529 ± 178 Ω cm2 vs 28 ± 4 Ω cm2), lower paracellular permeability ((176 ± 42) ×10−8 cm/s vs (738 ± 190) ×10−8 cm/s) and higher transepithelial potential difference (11.9 ± 4 mV vs 0 mV). Phenotypic and functional properties of NCI-H441 cells were tuned by varying cell seeding density and supplement concentrations. The cells formed a polarised monolayer typical of in vivo epithelium at seeding densities of 100,000 cells per 12-well insert while higher densities resulted in multiple cell layers. Dexamethasone and insulin-transferrin-selenium supplements were required for the development of high levels of electrical resistance, potential difference and expression of claudin-3 and Na+-K+-ATPase. Treatment of NCI-H441 cells with inhibitors and agonists of sodium and chloride channels indicated sodium absorption through ENaC under baseline and forskolin-stimulated conditions. Chloride transport was not sensitive to inhibitors of the cystic fibrosis transmembrane conductance regulator (CFTR) under either condition. Channels inhibited by 5-nitro-1-(3-phenylpropylamino) benzoic acid (NPPB) contributed to chloride secretion following forskolin stimulation, but not at baseline. These data precisely define experimental conditions for the application of NCI

  1. Osteopontin regulates dentin and alveolar bone development and mineralization.

    Science.gov (United States)

    Foster, B L; Ao, M; Salmon, C R; Chavez, M B; Kolli, T N; Tran, A B; Chu, E Y; Kantovitz, K R; Yadav, M; Narisawa, S; Millán, J L; Nociti, F H; Somerman, M J

    2018-02-01

    The periodontal complex is essential for tooth attachment and function and includes the mineralized tissues, cementum and alveolar bone, separated by the unmineralized periodontal ligament (PDL). To gain insights into factors regulating cementum-PDL and bone-PDL borders and protecting against ectopic calcification within the PDL, we employed a proteomic approach to analyze PDL tissue from progressive ankylosis knock-out (Ank -/- ) mice, featuring reduced PP i , rapid cementogenesis, and excessive acellular cementum. Using this approach, we identified the matrix protein osteopontin (Spp1/OPN) as an elevated factor of interest in Ank -/- mouse molar PDL. We studied the role of OPN in dental and periodontal development and function. During tooth development in wild-type (WT) mice, Spp1 mRNA was transiently expressed by cementoblasts and strongly by alveolar bone osteoblasts. Developmental analysis from 14 to 240days postnatal (dpn) indicated normal histological structures in Spp1 -/- comparable to WT control mice. Microcomputed tomography (micro-CT) analysis at 30 and 90dpn revealed significantly increased volumes and tissue mineral densities of Spp1 -/- mouse dentin and alveolar bone, while pulp and PDL volumes were decreased and tissue densities were increased. However, acellular cementum growth was unaltered in Spp1 -/- mice. Quantitative PCR of periodontal-derived mRNA failed to identify potential local compensators influencing cementum in Spp1 -/- vs. WT mice at 26dpn. We genetically deleted Spp1 on the Ank -/- mouse background to determine whether increased Spp1/OPN was regulating periodontal tissues when the PDL space is challenged by hypercementosis in Ank -/- mice. Ank -/- ; Spp1 -/- double deficient mice did not exhibit greater hypercementosis than that in Ank -/- mice. Based on these data, we conclude that OPN has a non-redundant role regulating formation and mineralization of dentin and bone, influences tissue properties of PDL and pulp, but does not

  2. Interaction of rat alveolar macrophages with dental composite dust.

    Science.gov (United States)

    Van Landuyt, K L; Cokic, S M; Asbach, C; Hoet, P; Godderis, L; Reichl, F X; Van Meerbeek, B; Vennemann, A; Wiemann, M

    2016-11-26

    Dental composites have become the standard filling material to restore teeth, but during the placement of these restorations, high amounts of respirable composite dust (nano-sized particles may be released in the breathing zone of the patient and dental operator. Here we tested the respirable fraction of several composite particles for their cytotoxic effect using an alveolar macrophage model system. ​METHODS: Composite dust was generated following a clinical protocol, and the dust particles were collected under sterile circumstances. Dust was dispersed in fluid, and 5-μm-filtered to enrich the respirable fractions. Quartz DQ12 and corundum were used as positive and negative control, respectively. Four concentrations (22.5 μg/ml, 45 μg/ml, 90 μg/ml and 180 μg/ml) were applied to NR8383 alveolar macrophages. Light and electron microscopy were used for subcellular localization of particles. Culture supernatants were tested for release of lactate dehydrogenase, glucuronidase, TNF-α, and H 2 O 2 . Characterization of the suspended particles revealed numerous nano-sized particles but also many high volume particles, most of which could be removed by filtering. Even at the highest concentration (180 μg/ml), cells completely cleared settled particles from the bottom of the culture vessel. Accordingly, a mixture of nano- and micron-scaled particles was observed inside cells where they were confined to phagolysosomes. The filtered particle fractions elicited largely uniform dose-dependent responses, which were elevated compared to the control only at the highest concentration, which equaled a mean cellular dose of 120 pg/cell. A low inflammatory potential was identified due to dose-dependent release of H 2 O 2 and TNF-α. However, compared to the positive control, the released levels of H 2 O 2 and TNF-α were still moderate, but their release profiles depended on the type of composite. Alveolar macrophages are able to phagocytize respirable composite dust

  3. Hormonal regulation of alveolarization: structure-function correlation

    Directory of Open Access Journals (Sweden)

    Godinez Marye H

    2006-03-01

    Full Text Available Abstract Background Dexamethasone (Dex limits and all-trans-retinoic acid (RA promotes alveolarization. While structural changes resulting from such hormonal exposures are known, their functional consequences are unclear. Methods Neonatal rats were treated with Dex and/or RA during the first two weeks of life or were given RA after previous exposure to Dex. Morphology was assessed by light microscopy and radial alveolar counts. Function was evaluated by plethysmography at d13, pressure volume curves at d30, and exercise swim testing and arterial blood gases at both d15 and d30. Results Dex-treated animals had simplified lung architecture without secondary septation. Animals given RA alone had smaller, more numerous alveoli. Concomitant treatment with Dex + RA prevented the Dex-induced changes in septation. While the results of exposure to Dex + RA were sustained, the effects of RA alone were reversed two weeks after treatment was stopped. At d13, Dex-treated animals had increased lung volume, respiratory rate, tidal volume, and minute ventilation. On d15, both RA- and Dex-treated animals had hypercarbia and low arterial pH. By d30, the RA-treated animals resolved this respiratory acidosis, but Dex-treated animals continued to demonstrate blood gas and lung volume abnormalities. Concomitant RA treatment improved respiratory acidosis, but failed to normalize Dex-induced changes in pulmonary function and lung volumes. No differences in exercise tolerance were noted at either d15 or d30. RA treatment after the period of alveolarization also corrected the effects of earlier Dex exposure, but the structural changes due to RA alone were again lost two weeks after treatment. Conclusion We conclude that both RA- and corticosteroid-treatments are associated with respiratory acidosis at d15. While RA alone-induced changes in structure andrespiratory function are reversed, Dex-treated animals continue to demonstrate increased respiratory rate, minute

  4. CONDUCTO ALVEOLAR INFERIOR. CORRELATO ANATOMO-IMAGENOLOGICO E IMPLICANCIA EN LOS PROCEDIMIENTOS QUIRURGICOS DE MANDIBULA. Inferior alveolar canal. Imaginological anatomical correlation and implication in jaw surgical procedures

    Directory of Open Access Journals (Sweden)

    Andrés C Limardo

    2016-03-01

    descriptive observational study with a sample of 44 dry hemijaws and 100 CT scans of patients. Measur-ements of the mandibular foramen and mental foramen with respect to jaw edges were made. Cuts in the branch and body were made with their respective measurements. Cone Beam Computed Tomography 3D (CBCT 3D of 100 patients were processed by the Compudent Navigator 3D® program. The use of this program permited the same measurements done in the cadaveric jaws and the reconstruction of the duct. In a second stage we performed a correlation between the anatomic morphometric values compared with imaging studies (CT Dental Scan with 3D reconstruction Results: They were shown in tables with different variables. Discussion: The classic texts of Anatomy and surgery books describe in detail the pathway and relations of the duct, and present morphometric data but not in local population. We may conclude that it is possible to avoid injuries of the inferior alveolar nerve during jaw surgery by considering the anatomy and its correlation with images.

  5. [Evaluation with different measuring methods for the alveolar bone change of ridge preservation in molar sites].

    Science.gov (United States)

    Zhao, Li-ping; Zhan, Ya-lin; Hu, Wen-jie; Xu, Tao; Wei, Yi-ping; Zhen, Min; Wang, Cui

    2016-02-18

    To investigate the changes of the vertical height and width of the alveolar bone six months after the alveolar ridge preservation in periodontal compromised molar sites of severe alveolar bone defects with clinical direct measurement, parallel periapical radiographs, and cone-beam computed tomography (CBCT), and to analyze the effect of the three different methods of measurement. In this study, 20 subjects requiring tooth extraction on account of periodontal disease with a total of 23 extracted molars were enrolled. Extractions were performed atraumatically and patients were received alveolar ridge preservation procedure with Bio-Oss and Bio-Gide. Clinical direct measurements were taken after tooth extraction and during the implant surgery 6 months later, CBCT scans and parallel periapical radiographs were taken immediately after ridge preservation and 6 months later. The changes of alveolar ridge width and vertical height after six months were measured and analyzed through the above-mentioned three methods and the similarities and differences of the measured effect were compared. There were no significant difference of alveolar vertical height in the center of the extraction sites, the center of distal aspect, and distobuccal aspect between the clinical direct measurements and the CBCT measurements (P>0.05), alveolar vertical height in other points and alveolar width measurements were statically significant (Palveolar increased significantly and the changes of alveolar vertical height of clinical direct and CBCT measurement were (6.15 ± 1.73) mm and (6.59 ± 2.53) mm, respectively. The measurements of the width of the alveolar bone were (8.45 ± 1.18) mm and (8.52 ± 1.27) mm, respectively. The measurements of the two methods were not statistically significant (P>0.05). The change of the alveolar height in the center of the extraction socket after six months measured by parallel periapical was (5.84 ± 4.28) mm, which was closed to the clinical direct measurement

  6. Modified technique for preservation of inferior alveolar nerve during mandibulectomy.

    Science.gov (United States)

    Chen, Min-Jie; Yang, Chi; Huang, Dong; He, Dong-Mei; Wang, Yi-Wen; Zhang, Wen-Hao

    2017-12-01

    The purpose of this article is to introduce the modified technique of preservation of the inferior alveolar nerve (IAN) during mandibulectomy for a benign lesion. Five cases of osteofibrous hyperplasia and 3 cases of centricity osteomyelitis were included. During surgery, the IAN was marked using a planned cutting guide. Using an oscillating saw, the depth of the osteotomy along the IAN was controlled until the bone cortex was cut through. After splitting, the bony section was removed, leaving the neurovascular bundle intact. The sensation of the lower lip was evaluated using current perceptive threshold testing during follow-up. After follow-up for 6-27 months, no recurrence or secondary deformity was found. One patient had severe sensory disturbance. With the use of a cutting guide and osteotomy tricks, mandibulectomy with preservation of the IAN can be accurately performed. © 2017 Wiley Periodicals, Inc.

  7. Hepatic alveolar echinococcosis: correlative US and CT study

    Energy Technology Data Exchange (ETDEWEB)

    Didier, D.; Weiler, S.; Rohmer, P.; Lasseque, A.; Deschamps, J.P.; Vuitton, D.; Miguet, J.P.; Weill, F.

    1985-01-01

    A total of 24 cases of hepatic alveolar echinococcosis (HAE) due to Echinococcus multilocularis was assessed by US and CT. The diagnosis was confirmed in all cases by immunologic and histologic study. Both US and CT patterns of HAE showed changes of liver morphology in both contour and size. Abnormal areas of parenchyma were nodular or in fields, irregular, heterogeneous, and basically echogenic. Clustered microcalcifications were encountered within the abnormal parenchymal fields in 50% of cases, and necrotized zones occurred in 40% of cases. Dilatation of intrahepatic bile ducts was commonly seen, especially on US; hilar involvement was frequent. Follow-up by both techniques can display increases of primary lesions, occurrence of new foci, and local or regional extensions. Precise evaluations of the lesions arising from correlative use of US and CT permits adequate therapeutic management.

  8. Alveolar bone tissue engineering using composite scaffolds for drug delivery

    Directory of Open Access Journals (Sweden)

    Tomonori Matsuno

    2010-08-01

    Full Text Available For many years, bone graft substitutes have been used to reconstruct bone defects in orthopedic and dental fields. However, synthetic bone substitutes such as hydroxyapatite or β-tricalcium phosphate have no osteoinductive or osteogenic abilities. Bone tissue engineering has also been promoted as an alternative approach to regenerating bone tissue. To succeed in bone tissue engineering, osteoconductive scaffolding biomaterials should provide a suitable environment for osteogenic cells and provide local controlled release of osteogenic growth factors. In addition, the scaffold for the bone graft substitute should biodegrade to replace the newly formed bone. Recent advances in bone tissue engineering have allowed the creation of composite scaffolds with tailored functional properties. This review focuses on composite scaffolds that consist of synthetic ceramics and natural polymers as drug delivery carriers for alveolar bone tissue engineering.

  9. A case of pulmonary alveolar microlithiasis with Cor Pulmonale.

    Science.gov (United States)

    Chen, Wen; Gu, Tao

    2012-03-01

    Pulmonary alveolar microlithiasis (PAM) is a rare disease characterized by the formation and deposition of microliths within the alveoli and a paucity of symptoms in contrast to the imaging findings. It has familial tendency and is thought to be an autosomal recessive disorder with the mutation in the SLC34A2 gene. We describe a case of PAM with Cor Pulmonale. Ultrasonic cardiogram showed pulmonary hypertension (82 mmHg). Chest radiography revealed diffuse, bilateral sandstorm-like micronodules with greater density in the lower lung fields. HRCT scans demonstrated diffuse ground-grass opacities, thickening and calcification of interlobular septa and confluent calcified nodules. A diagnosis of PAM was suggested and confirmed by transbronchial lung biopsy (TBLB).

  10. Effects of implant drilling parameters for pilot and twist drills on temperature rise in bone analog and alveolar bones.

    Science.gov (United States)

    Chen, Yung-Chuan; Hsiao, Chih-Kun; Ciou, Ji-Sih; Tsai, Yi-Jung; Tu, Yuan-Kun

    2016-11-01

    This study concerns the effects of different drilling parameters of pilot drills and twist drills on the temperature rise of alveolar bones during dental implant procedures. The drilling parameters studied here include the feed rate and rotation speed of the drill. The bone temperature distribution was analyzed through experiments and numerical simulations of the drilling process. In this study, a three dimensional (3D) elasto-plastic dynamic finite element model (DFEM) was proposed to investigate the effects of drilling parameters on the bone temperature rise. In addition, the FE model is validated with drilling experiments on artificial human bones and porcine alveolar bones. The results indicate that 3D DFEM can effectively simulate the bone temperature rise during the drilling process. During the drilling process with pilot drills or twist drills, the maximum bone temperature occurred in the region of the cancellous bones close to the cortical bones. The feed rate was one of the important factors affecting the time when the maximum bone temperature occurred. Our results also demonstrate that the elevation of bone temperature was reduced as the feed rate increased and the drill speed decreased, which also effectively reduced the risk region of osteonecrosis. These findings can serve as a reference for dentists in choosing drilling parameters for dental implant surgeries. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.

  11. Evaluation of rat alveolar bone response to Angelus MTA or experimental light-cured mineral trioxide aggregate using fluorochromes.

    Science.gov (United States)

    Gomes-Filho, João Eduardo; de Moraes Costa, Mariana Machado Teixeira; Cintra, Luciano Tavares Angelo; Duarte, Paulo Carvalho Tobias; Takamiya, Aline Satie; Lodi, Carolina Simonetti; Bernabé, Pedro Felício Estrada

    2011-02-01

    The aim of this study was to evaluate the rat alveolar bone response after the implantation of experimental light-cured mineral trioxide aggregate (MTA) or Angelus MTA (Angelus, Londrina, Paraná, Brazil) by histological and fluorescence analysis. Thirty Wistar Albino rats were divided into three groups. In the control group, empty polyethylene tubes were inserted into the rat alveolar sockets immediately after extraction. In the other groups, the tubes were filled with light-cured MTA or Angelus MTA. Five animals from each group were injected with calcein on day 7, alizarin on day 14, and oxytetracycline on day 21. On day 30, these animals were killed, and the right hemimaxillas were removed and histologically processed. Half of the maxillas were processed and stained with hematoxylin and eosin. The remaining maxillas were processed for fluorescence analysis and stained with Stevenel blue and alizarin red. New bone was histomorphometrically evaluated using a Merz grid. The light-cured MTA presented a similar response when compared with Angelus MTA; it was characterized by a mild inflammatory response and complete bone healing. In the light-cured MTA group, the fluorescence areas were more evident at 21 days, showing an increase in bone formation. However, dystrophic mineralization was observed only with Angelus MTA. It was concluded that both materials present a similar inflammatory response and bone healing, but dystrophic mineralization was observed only with Angelus MTA. Copyright © 2011 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  12. Alveolar wound healing in rats fed on high sucrose diet.

    Science.gov (United States)

    Baró, María A; Rocamundi, Marina R; Viotto, Javier O; Ferreyra, Ruth S

    2013-01-01

    The potential for bone repair is influenced by various biochemical, biomechanical, hormonal, and pathological mechanisms and factors such as diet and its components, all of which govern the behavior and function of the cells responsible for forming new bone. Several authors suggest that a high sucrose diet could change the calcium balance and bone composition in animals, altering hard tissue mineralization. The mechanism by which it occurs is unclear. Alveolar healing following tooth extraction has certain characteristics making this type of wound unique, in both animals and humans. The general aim of this study was to evaluate and quantify the biological response during alveolar healing following tooth extraction in rats fed on high sucrose diets, by means of osteocyte lacunae histomorphometry, counting empty lacunae and measuring areas of bone quiescence, formation and resorption. Forty-two Wistar rats of both sexes were divided into two groups: an experimental group fed on modified Stephan Harris diet (43% sucrose) and a control group fed on standard balanced diet. The animals were anesthetized and their left and right lower molars extracted. They were killed at 0 hours, 14, 28, 60 and 120 days. Samples were fixed, decalcified in EDTA and embedded in paraffin to prepare sections for optical microscopy which were stained with hematoxylin/eosin. Histomorphometric analysis showed significant differences in the size of osteocyte lacunae between groups at 28 and 60 days, with the experimental group having larger lacunae. There were more empty lacunae in the experimental group at 14 days, and no significant difference in the areas of bone activity. A high sucrose diet could modify the morphology and quality of bone tissue formed in the alveolus following tooth extraction.

  13. The Effects of Alveolar Ridge Preservation: A Meta-Analysis.

    Science.gov (United States)

    Willenbacher, Maximillian; Al-Nawas, Bilal; Berres, Manfred; Kämmerer, Peer W; Schiegnitz, Eik

    2016-12-01

    The aim of this article was to analyze the horizontal, vertical, and histological effects of alveolar ridge preservation (ARP) versus the ones of unassisted socket healing, in the format of an up-to-date review and meta-analysis. An extensive electronic search in the electronic databases of the National Library of Medicine was conducted for articles published up to June 2014 to identify literature presenting data on the topic of ARP. Only randomized controlled trials, controlled clinical trials, and prospective trials were included for meta-analysis. After screening 903 abstracts from the electronic database, we included 64 studies in qualitative and 18 in quantitative synthesis. Quality assessment characterized a medium risk of bias for the included literature. The meta-analysis showed a mean difference between test and control groups of approximately 1.31 to 1.54 mm in bucco-oral bone width and 0.91 to 1.12 mm in bone height. Additionally, the intergroup difference in percentage of vital bone was assessed to be inconclusive across the included studies. Implants could be inserted into the determined position without further augmentation in 90.1% of the experimental sites, while this was the case in only 79.2% of the control sockets. Resorption of the alveolar ridge cannot be totally stopped by ARP, while it still can be prevented compared with unassisted healing. No reliable predictions on the histological effects could be made due to limited data. Further on, no recommendation for a specific technique of ARP could be made. In conclusion, there is still need for ongoing research on the topic, even though the lower percentage of implant sites that needed additional augmentation in test sockets seemed to bring a patient benefit. © 2015 Wiley Periodicals, Inc.

  14. Mean alveolar bone crest height decrement in subjects with an osteoporosis risk

    Science.gov (United States)

    Effrianto, H. P. S.; Priminiarti, M.; Makes, B. N.

    2017-08-01

    People 40-75 years of age have an osteoporosis risk that may be signaled by a decrease in alveolar bone crest height. Thus, this measure can be used as an indicator of osteoporosis risk. This study was conducted to provide a database of decreased alveolar bone crest heights in ages at risk of osteoporosis by using intraoral radiographs. Forty periapical radiographs of the posterior region of tooth 36 (or 46) were measured twice at different times by two different observers. The interproximal decrease in alveolar bone crest height was measured from the alveolar bone crest to the cementoenamel junction (CEJ) for each tooth on the mesial and distal sides using a ruler (mm). The mean decrease in alveolar bone crest height in at-risk ages for osteoporosis was 3.50±1.085 mm, with a mean of 3.15±0.864 mm for those 45-59 years of age, and 3.90±1.156 mm for those aged 60-75 years. The mean decrease in alveolar bone crest height in people 60-75 years of age was larger than in people 45-59 years of age. There was a medium correlation between age and decreased alveolar bone crest height.

  15. Alveolar type II cell transplantation restores pulmonary surfactant protein levels in lung fibrosis.

    Science.gov (United States)

    Guillamat-Prats, Raquel; Gay-Jordi, Gemma; Xaubet, Antoni; Peinado, Victor I; Serrano-Mollar, Anna

    2014-07-01

    Alveolar Type II cell transplantation has been proposed as a cell therapy for the treatment of idiopathic pulmonary fibrosis. Its long-term benefits include repair of lung fibrosis, but its success partly depends on the restoration of lung homeostasis. Our aim was to evaluate surfactant protein restoration after alveolar Type II cell transplantation in an experimental model of bleomycin-induced lung fibrosis in rats. Lung fibrosis was induced by intratracheal instillation of bleomycin. Alveolar Type II cells were obtained from healthy animals and transplanted 14 days after bleomycin was administered. Furthermore, one group transplanted with alveolar macrophages and another group treated with surfactant were established to evaluate the specificity of the alveolar Type II cell transplantation. The animals were euthanized at 21 days after bleomycin instillation. Lung fibrosis was confirmed by a histologic study and an evaluation of the hydroxyproline content. Changes in surfactant proteins were evaluated by mRNA expression, Western blot and immunofluorescence studies. The group with alveolar Type II cell transplantation was the only one to show a reduction in the degree of lung fibrosis and a complete recovery to normal levels of surfactant proteins. One of the mechanisms involved in the beneficial effect of alveolar Type II cell transplantation is restoration of lung surfactant protein levels, which is required for proper respiratory function. Copyright © 2014 International Society for Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

  16. Oral administration of 5-hydroxytryptophan aggravated periodontitis-induced alveolar bone loss in rats.

    Science.gov (United States)

    Li, Xianxian; Wu, Xiangnan; Ma, Yuanyuan; Hao, Zhichao; Chen, Shenyuan; Fu, Taozi; Chen, Helin; Wang, Hang

    2015-05-01

    5-Hydroxytryptophan (5-HTP) is the precursor of serotonin and 5-HTP has been widely used as a dietary supplement to raise serotonin level. Serotonin has recently been discovered to be a novel and important player in bone metabolism. As peripheral serotonin negatively regulates bone, the regular take of 5-HTP may affect the alveolar bone metabolism and therefore influence the alveolar bone loss induced by periodontitis. The aim of this study was to investigate the effect of 5-HTP on alveolar bone destruction in periodontitis. Male Sprague-Dawley rats were randomly divided into the following four groups: (1) the control group (without ligature); (2) the 5-HTP group (5-HTP at 25 mg/kg/day without ligature); (3) the L group (ligature+saline placebo); and (4) the L+5-HTP group (ligature+5-HTP at 25 mg/kg/day). Serum serotonin levels were determined by ELISA. The alveolar bones were evaluated with micro-computed tomography and histology. Tartrate-resistant acid phosphatase staining was used to assess osteoclastogenesis. The receptor activator of NF-kB ligand (RANKL) and osteoprotegerin (OPG) expression in the periodontium as well as the interleukin-6 positive osteocytes were analysed immunohistochemically. 5-HTP significantly increased serum serotonin levels. In rats with experimental periodontitis, 5-HTP increased alveolar bone resorption and worsened the micro-structural destruction of the alveolar bone. 5-HTP also stimulated osteoclastogenesis and increased RANKL/OPG ratio and the number of IL-6 positive osteocytes. However, 5-HTP treatment alone did not cause alveolar bone loss in healthy rats. The present study showed that 5-HTP aggravated alveolar bone loss, deteriorated alveolar bone micro-structure in the presence of periodontitis, which suggests 5-HTP administration may increase the severity of periodontitis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Alveolar bone loss and mineralization in the pig with experimental periodontal disease

    Directory of Open Access Journals (Sweden)

    Mandee Yang

    2018-03-01

    Full Text Available Objective: To address how experimental periodontal disease affects alveolar bone mass and mineral apposition in a young pig model. Materials and methods: Seven three-month-old pigs were periodically inoculated with 4 types of periodontal bacteria, along with a ligature around the last maxillary deciduous molar for 8 weeks to induce periodontal disease (PG. Eight same-aged pigs served as the control (CG. Segmentations of 3D cone-beam CT images were performed to quantify volumes of the total alveolar bone, alveolar ridge, and all roots of the target molar. Calcein and alizarin were administered for labeling mineral apposition before euthanasia. The harvested molar blocks were sectioned and examined under epifluorescence. The inter-label distance between the two vital markers at regional bone surfaces were measured and mineral apposition rate (MAR was calculated. Results: A significant reduction of total alveolar bone volume was seen in PG with the major loss at the alveolar ridge. MAR was significantly higher at the root furcation region than those at both buccal and palatal ridges in CG. Compared with CG, PG animals showed more interrupted labeled bands with significantly lower MAR at the furcation region. MARs were positively associated with both the volumes of total alveolar bone and ridge in CG, but only with the total alveolar bone in PG. Conclusions: In young growing pigs, mineral apposition is region specific. The experimental periodontal disease not only leads to alveolar bone loss, but also perturbs mineral apposition for new bone formation, thus impairing the homeostasis of alveolar bone remodeling. Keyword: Dentistry

  18. HIV-1 transgene expression in rats causes oxidant stress and alveolar epithelial barrier dysfunction

    Directory of Open Access Journals (Sweden)

    Jacob Barbara A

    2009-02-01

    Full Text Available Abstract Background HIV-infected individuals are at increased risk for acute and chronic airway disease even though there is no evidence that the virus can infect the lung epithelium. Although HIV-related proteins including gp120 and Tat can directly cause oxidant stress and cellular dysfunction, their effects in the lung are unknown. The goal of this study was to determine the effects of HIV-1 transgene expression in rats on alveolar epithelial barrier function. Alveolar epithelial barrier function was assessed by determining lung liquid clearance in vivo and alveolar epithelial monolayer permeability in vitro. Oxidant stress in the alveolar space was determined by measuring the glutathione redox couple by high performance liquid chromatography, and the expression and membrane localization of key tight junction proteins were assessed. Finally, the direct effects of the HIV-related proteins gp120 and Tat on alveolar epithelial barrier formation and tight junction protein expression were determined. Results HIV-1 transgene expression caused oxidant stress within the alveolar space and impaired epithelial barrier function even though there was no evidence of overt inflammation within the airways. The expression and membrane localization of the tight junction proteins zonula occludens-1 and occludin were decreased in alveolar epithelial cells from HIV-1 transgenic rats. Further, treating alveolar epithelial monolayers from wild type rats in vitro with recombinant gp120 or Tat for 24 hours reproduced many of the effects on zonula occludens-1 and occludin expression and membrane localization. Conclusion Taken together, these data indicate that HIV-related proteins cause oxidant stress and alter the expression of critical tight junction proteins in the alveolar epithelium, resulting in barrier dysfunction.

  19. Diagnosis of alveolar and root fractures: an in vitro study comparing CBCT imaging with periapical radiographs

    Directory of Open Access Journals (Sweden)

    Solange KOBAYASHI-VELASCO

    Full Text Available Abstract Objective To compare periapical radiograph (PR and cone-beam computed tomography (CBCT in the diagnosis of alveolar and root fractures. Material and Methods Sixty incisor teeth (20 higid and 40 with root fracture from dogs were inserted in 60 anterior alveolar sockets (40 higid and 20 with alveolar fracture of 15 macerated canine maxillae. Each fractured socket had a root fractured tooth inserted in it. Afterwards, each maxilla was submitted to PR in two different vertical angulation incidences, and to CBCT imaging with a small field of view (FOV and high-definition protocol. Images were randomized and posteriorly analyzed by two oral and maxillofacial radiologists two times, with a two-week interval between observations. Results Sensitivity and specificity values were good for root fractures for PR and CBCT. For alveolar fractures, sensitivity ranged from 0.10 to 0.90 for PR and from 0.50 to 0.65 for CBCT. Specificity for alveolar fractures showed lower results than for root fractures for PR and CBCT. Areas under the ROC curve showed good results for both PR and CBCT for root fractures. However, results were fair for both PR and CBCT for alveolar fractures. When submitted to repeated measures ANOVA tests, there was a statistically significant difference between PR and CBCT for root fractures. Root fracture intraobserver agreement ranged from 0.90 to 0.93, and alveolar fracture intraobserver agreement ranged from 0.30 to 0.57. Interobserver agreement results were substantial for root fractures and poor/fair for alveolar fractures (0.11 for PR and 0.30 for CBCT. Conclusion Periapical radiograph with two different vertical angulations may be considered an accurate method to detect root fractures. However, PR showed poorer results than CBCT for the diagnosis of alveolar fractures. When no fractures are diagnosed in PR and the patient describes pain symptoms, the subsequent exam of choice is CBCT.

  20. Diagnosis of alveolar and root fractures: an in vitro study comparing CBCT imaging with periapical radiographs

    Science.gov (United States)

    KOBAYASHI-VELASCO, Solange; SALINEIRO, Fernanda Cristina Sales; GIALAIN, Ivan Onone; CAVALCANTI, Marcelo Gusmão Paraiso

    2017-01-01

    Abstract Objective To compare periapical radiograph (PR) and cone-beam computed tomography (CBCT) in the diagnosis of alveolar and root fractures. Material and Methods Sixty incisor teeth (20 higid and 40 with root fracture) from dogs were inserted in 60 anterior alveolar sockets (40 higid and 20 with alveolar fracture) of 15 macerated canine maxillae. Each fractured socket had a root fractured tooth inserted in it. Afterwards, each maxilla was submitted to PR in two different vertical angulation incidences, and to CBCT imaging with a small field of view (FOV) and high-definition protocol. Images were randomized and posteriorly analyzed by two oral and maxillofacial radiologists two times, with a two-week interval between observations. Results Sensitivity and specificity values were good for root fractures for PR and CBCT. For alveolar fractures, sensitivity ranged from 0.10 to 0.90 for PR and from 0.50 to 0.65 for CBCT. Specificity for alveolar fractures showed lower results than for root fractures for PR and CBCT. Areas under the ROC curve showed good results for both PR and CBCT for root fractures. However, results were fair for both PR and CBCT for alveolar fractures. When submitted to repeated measures ANOVA tests, there was a statistically significant difference between PR and CBCT for root fractures. Root fracture intraobserver agreement ranged from 0.90 to 0.93, and alveolar fracture intraobserver agreement ranged from 0.30 to 0.57. Interobserver agreement results were substantial for root fractures and poor/fair for alveolar fractures (0.11 for PR and 0.30 for CBCT). Conclusion Periapical radiograph with two different vertical angulations may be considered an accurate method to detect root fractures. However, PR showed poorer results than CBCT for the diagnosis of alveolar fractures. When no fractures are diagnosed in PR and the patient describes pain symptoms, the subsequent exam of choice is CBCT. PMID:28403364

  1. Part II. Minimizing alveolar bone loss during and after extractions. Protocol and techniques for alveolar bone preservation.

    Science.gov (United States)

    Iyer, Shankar; Haribabu, Prashanth Konatham; Xing, Yi

    2014-01-01

    Alveolar ridge resorption accelerates following extraction of teeth and the residual defect varies from socket to socket. This article proposes a new treatment oriented classification of extraction defects. It also reviews several graft materials and membranes that aid in the decision for selecting an appropriate socket preservation technique. The algorithm developed by the authors helps design a potentially successful treatment plan based on the classification of extraction defects, with choices ranging from no treatment to complex grafting procedures (i.e. allogenic block grafts). In addition, the principles of wound healing and the ideal time points for utilizing the various types of graft materials and implants are discussed. This socket preservation treatment algorithm will guide clinicians to employ surgical procedures using various biomaterials to promote a successful outcome.

  2. Ozone Treatment of Alveolar Bone in the Cape Chacma Baboon Does Not Enhance Healing Following Trauma

    OpenAIRE

    Kotze, Marthinus; Bütow, Kürt-W; Olorunju, Steve A.; Kotze, Harry F.

    2013-01-01

    In the international literature, the role of Ozone (O3) in the advancement in alveolar bone healing in the absence of bone pathology was not tested before. The purpose of this study was to evaluate alveolar bone regeneration after a bone defect was created and treated with a single topical administration of O3. Alveolar bone defects were created on five healthy chacma baboons. One side of the maxilla and mandible was topically treated with a single treatment of an O3/O2 mixture (3,5–4 % O3), ...

  3. A preliminary study of the pathogenesis of malnutrition in patients with hepatic alveolar echinococcosis

    Directory of Open Access Journals (Sweden)

    MA Bao

    2018-01-01

    Full Text Available Hepatic echinococcosis has become a major threat to human health. Hepatic alveolar echinococcosis caused by Echinococcus multilocularis infection has the features of slow and insidious onset, a high probability of surgery, slow postoperative recovery, and many complications and thus does great harm to humans. Most of the patients with hepatic alveolar echinococcosis also have varying degrees of malnutrition on admission, which is closely associated with surgical tolerance, postoperative rehabilitation, and the development of complications. However, the pathogenesis of malnutrition in patients with hepatic alveolar echinococcosis remains unknown. This article elaborates on possible mechanisms and points out that malnutrition in such patients is a result of various factors and complex mechanisms.

  4. Evolución en el tratamiento de la atrofia alveolar

    OpenAIRE

    Oscar García-Roco Pérez; Miguel Arredondo López

    2002-01-01

    Con el objetivo de describir la evolución del tratamiento de la atrofia alveolar se realiza una revisión bibliográfica actualizada de 25 referencias, se destacan las vestibuloplastias, injertos óseos, biomateriales, implantes endóseos, regeneración ósea guiada y la distracción ósea, que corrigen o compensan la atrofia alveolar con sus indicaciones, ventajas y desventajas.An updated literature review of 25 references was made to describe the development in the treatment of dental alveolar atro...

  5. Mechanisms underlying the redistribution of particles among the lung's alveolar macrophages during alveolar phase clearance

    Energy Technology Data Exchange (ETDEWEB)

    Lehnert, B.E.; Oritz, J.B.; Steinkamp, J.A.; Tietjen, G.L.; Sebring, R.J. (Los Alamos National Lab., NM (United States)); Oberdorster, G. (Rochester Univ., NY (United States))

    1991-01-01

    In order to obtain information about the particle redistribution phenomenon following the deposition of inhaled particles, as well as to obtain information about some of the mechanisms that may be operable in the redistribution of particles, lavaged lung free cell analyses and transmission electron microscopic (TEM) analyses of lung tissue and were performed using lungs from rats after they were subchronically exposed to aerosolized dioxide (TiO{sub 2}). TEM analyses indicated that the in situ autolysis of particle-containing Alveolar Macropages (AM) is one important mechanism involved in the redistribution of particles. Evidence was also obtained that indicated that the engulfment of one particle-containing phagocyte by another phagocyte also occurs. Another prominent mechanism of the particle redistribution phenomenon may be the in situ proliferation of particle-laden AM. We used the macrophage cell line J774A.1 as a surrogate for AM to investigate how different particulate loads in macrophages may affect their abilities to proliferate. These in vitro investigations indicated that the normal rate of proliferation of macrophages is essentially unaffected by the containment of relatively high particulate burdens. Overall, the results of our investigations suggest that in situ autolysis of particle-containing AM and the rephagocytosis of freed particles by other phagocytes, the phagocytosis of effete and disintegrating particle-containing phagocytes by other AM, and the in situ division of particle-containing AM are likely mechanisms that underlie the post-depositional redistribution of particles among the lung's AM during alveolar phase clearance. 19 refs., 8 figs., 2 tabs.

  6. Unsuspected small ameloblastoma in the alveolar bone: a collaborative study of 14 cases with discussion of their cellular sources.

    Science.gov (United States)

    Ide, F; Mishima, K; Yamada, H; Horie, N; Saito, I; Shimoyama, T; Kusama, K

    2008-04-01

    Intraosseous ameloblastoma (IA) is the quintessence of epithelial odontogenic tumor and histologically and behaviorally defined as an undoubted neoplastic process. Current information must lead to the consensus that IA arises from the embryologic inclusions of odontogenic epithelium within the jawbone. Nevertheless, clinically oriented evidence is limited to this day. The clinical and radiographic features, behavior, and pathology of 14 cases of small IA confined to the alveolar region were systematically examined. Six cases were a chance finding. There was no gender predilection and half of the lesions clustered in middle age (>40 years). The posterior region of the mandible (n = 7) and the anterior segment of the maxilla (n = 4) were favored. Five radiographic characteristics were recognized: interradicular (n = 5) and periradicular (n = 3), and periapical, residual and pericoronal (n = 2 each). They showed solid (n = 12) or unicystic (n = 2) growth pattern and 12 lesions were divided into seven follicular, three desmoplastic, and two plexiform subtypes. The main location of tumor was microscopically traceable in six cases; three interradicular type outside the periodontal ligament space and two periradicular and one periapical variants inside. By in-depth evaluation of the spatial relationship between tumor and its surrounding structure, the alveolar process, periodontal ligament space, and pericoronal area are all the likely starting points of IA. This report re-awakens the oral pathologist to the histogenetic significance of incipient IA as the only available human specimen for reappraisal of their origin.

  7. Lateral expansion of the rat lower dental arch by applying an active plate model to the mandibular first molar region: observation of histological changes in the lower alveolar bone over a 2-week period.

    Science.gov (United States)

    Ogihara, Eiwa; Ogihara, Kazuhiko; Aiyama, Shigeo

    2004-03-01

    Lateral expansion of the lower dental arch has rarely been conducted clinically because the structure of the lower jaw is considered to be unsuitable for this type of treatment. However, successful lateral expansion of the lower dental arch using SCHWALZ, an orthopedic appliance has been reported in recent years. Therefore, an experimental study was performed to examine the histological changes in the lower alveolar bone when lateral expansion is applied to the lower dental arch for periods of up to 2 weeks. An active plate model based on the Schwarz appliance was attached to the first molar region in rats. The distance between the right and left first molars was measured, and the mandible and first molar tooth were processed for light microscopy at different times after the fitting. The lateral expansion caused by lateral movement of the right and left first molars following the application of the active plate amounted to an average of 1.06 mm over a period of 14 days. Alkaline phosphatase/tartrate-resistant acid phosphatase staining revealed bone deposition on the periosteal surface of the buccal alveolar bone and the periodontal surface of the lingual alveolar bone, whereas bone absorption was observed on the periodontal surface of the buccal alveolar bone and the periosteal surface of the lingual alveolar bone. These findings demonstrate that lateral expansion of the lower dental arch through the application of an active plate model was achieved by bony deposition and absorption of alveolar bone, similar to the process that occurs in association with lateral expansion of the upper dental arch.

  8. Exogenous surfactant application in a rat lung ischemia reperfusion injury model: effects on edema formation and alveolar type II cells

    Directory of Open Access Journals (Sweden)

    Richter Joachim

    2008-01-01

    Full Text Available Abstract Background Prophylactic exogenous surfactant therapy is a promising way to attenuate the ischemia and reperfusion (I/R injury associated with lung transplantation and thereby to decrease the clinical occurrence of acute lung injury and acute respiratory distress syndrome. However, there is little information on the mode by which exogenous surfactant attenuates I/R injury of the lung. We hypothesized that exogenous surfactant may act by limiting pulmonary edema formation and by enhancing alveolar type II cell and lamellar body preservation. Therefore, we investigated the effect of exogenous surfactant therapy on the formation of pulmonary edema in different lung compartments and on the ultrastructure of the surfactant producing alveolar epithelial type II cells. Methods Rats were randomly assigned to a control, Celsior (CE or Celsior + surfactant (CE+S group (n = 5 each. In both Celsior groups, the lungs were flush-perfused with Celsior and subsequently exposed to 4 h of extracorporeal ischemia at 4°C and 50 min of reperfusion at 37°C. The CE+S group received an intratracheal bolus of a modified natural bovine surfactant at a dosage of 50 mg/kg body weight before flush perfusion. After reperfusion (Celsior groups or immediately after sacrifice (Control, the lungs were fixed by vascular perfusion and processed for light and electron microscopy. Stereology was used to quantify edematous changes as well as alterations of the alveolar epithelial type II cells. Results Surfactant treatment decreased the intraalveolar edema formation (mean (coefficient of variation: CE: 160 mm3 (0.61 vs. CE+S: 4 mm3 (0.75; p 3 (0.90 vs. CE+S: 0 mm3; p 3 (0.39 vs. CE+S: 268 mm3 (0.43; p 3(0.10 and CE+S (481 μm3(0.10 compared with controls (323 μm3(0.07; p Conclusion Intratracheal surfactant application before I/R significantly reduces the intraalveolar edema formation and development of atelectases but leads to an increased development of

  9. Differential effects of hypoxic stress in alveolar epithelial cells and microvascular endothelial cells

    NARCIS (Netherlands)

    Signorelli, Sara; Jennings, Paul; Leonard, Martin O; Pfaller, Walter

    2010-01-01

    Under hypoxic conditions eukaryotic cells and tissues undergo adaptive responses involving glycolysis, angiogenesis, vasoconstriction and inflammation. The underlying molecular mechanisms are not yet fully elucidated and are most likely cell and tissue specific. In the lung, alveolar epithelial

  10. Long-term outcome of secondary alveolar bone grafting in cleft lip and palate patients

    DEFF Research Database (Denmark)

    Meyer, Steffen; Pedersen, Kirsten Mølsted

    2013-01-01

    The objective was to assess the long-term outcome of secondary alveolar bone grafting (SABG) in cleft lip and palate patients and to examine relationships between preoperative and postoperative factors and overall long-term bone graft success. The records of 97 patients with cleft lip and palate......, who had secondary alveolar bone grafting of 123 alveolar clefts, were examined. Interalveolar bone height was assessed radiographically a minimum of 10 years after grafting using a 4-point scale (I-IV), where types I and II were considered a success. After an average follow-up of 16 years after SABG...... to the cleft. No significant differences were found with regard to the other parameters investigated. The timing of secondary alveolar bone grafting is critical with regard to the age of the patient and the stage of eruption of the tooth distal to the cleft....

  11. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    National Research Council Canada - National Science Library

    Ribot, Wilson J; Panchal, Rekha G; Brittingham, Katherine C; Ruthel, Gordon; Kenny, Tara A; Lane, Douglas; Curry, Bob; Hoover, Timothy A; Friedlander, Arthur M; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses...

  12. Is 2 mm a safe distance from the inferior alveolar canal to avoid ...

    African Journals Online (AJOL)

    . Conclusion: When 2 mm is considered as a safety distance, the distance of the implants to the IAC did not yield any statistical difference regarding postoperative neurosensory complications. Keywords: Dental implants, inferior alveolar nerve ...

  13. Quantitative determination of alveolar bone density using digital image analysis of microradiographs

    International Nuclear Information System (INIS)

    Jaeger, A.; Radlanski, R.J.; Taufall, D.; Klein, C.; Steinhoefel, N.; Doeler, W.

    1990-01-01

    Horizontal 100 μm ground sections of 20 alveolar bone specimens from adult human mandibles obtained from autopsies were prepared for microradiography. Quantitative analysis of bone density of the alveolar cortex was performed using a semiautomatic digital image analysis system (KONTRON). The results demonstrated that bone density was higher in the lingual than in the labial alveolar cortex (p < 0.05). In addition, the coronal portion of alveolar cortical bone was significantly more porous than the medial and apical ones (p < 0.05). These variances were primarily due to increased canal size rather than to an increased number of canals. No significant age dependent changes in bone density could be determined. (author)

  14. Evolución en el tratamiento de la atrofia alveolar

    Directory of Open Access Journals (Sweden)

    Oscar García-Roco Pérez

    2002-08-01

    Full Text Available Con el objetivo de describir la evolución del tratamiento de la atrofia alveolar se realiza una revisión bibliográfica actualizada de 25 referencias, se destacan las vestibuloplastias, injertos óseos, biomateriales, implantes endóseos, regeneración ósea guiada y la distracción ósea, que corrigen o compensan la atrofia alveolar con sus indicaciones, ventajas y desventajas.An updated literature review of 25 references was made to describe the development in the treatment of dental alveolar atrophy. Some procedures that correct or compensate alveolar atrophies such as vestibuloplasty, bone grafting, biomaterials, endo-bone implants, guided bone regeneration and bone distraction. Their indications, advantages and disadvantages are set forth.

  15. Runx3 is a key modulator during the epithelial-mesenchymal transition of alveolar type II cells in animal models of BPD.

    Science.gov (United States)

    Yang, Haiping; Fu, Jianhua; Yao, Li; Hou, Ana; Xue, Xindong

    2017-11-01

    Bronchopulmonary dysplasia (BPD) is a major challenge for premature infants; however, the underlying mechanisms remain unclear. We previously reported that epithelial-mesenchymal transition (EMT) in alveolar type II (AT2) epithelial cells influences the normal alveolar development process. In this study, we wished to examine whether Runx3 is an important factor for BPD by regulating EMT in AT2 cells. In vivo, animal models of BPD were established by placing newborn rats in hyperoxia tanks. Lung tissue and isolated AT2 cells were collected on different days following exposure to oxygen. The pathological changes in lung tissue, alveolar development and Runx3 expression were then investigated. In vitro, RLE-6TN cells were divided into 5 groups as follows: the cont-rol, Runx3, siRunx3, transforming growth factor-β1 (TGF-β1) and Runx3 + TGF-β1 groups, and the biomarkers of EMT were investigated. In the newborn rat model of BPD, Runx3 protein and mRNA levels in both lung tissue and BPD-derived AT2 cells were significantly lower than those in the control group. The correlation between Runx3 protein expression and pulmonary development indicators was analyzed; Runx3 expression positively correlated with the radial alveolar count (RAC) and the percentage of smooth muscle actin-positive secondary septa, but negatively correlated with alveolar wall thickness. EMT was observed in the RLE-6TN cells in which the Runx3 gene was knocked down and follwoing TGF-β1‑induced EMT stimulation; however, TGF-β1 failed to induce EMT in the RLE-6TN cells overexpressing Runx3. On the whole, our data indicte that low Runx3 levels may promote EMT, while high Runx3 levels inhibit TGF-β1-induced EMT. Therefore, we predict that low levels of Runx3 in BPD lung tissue may promote EMT in AT2 cells, thus affecting alveolar development.

  16. Systemic Osteoporosis and Reduction of the Edentulous Alveolar Ridge

    Directory of Open Access Journals (Sweden)

    Srđan D. Poštić

    2013-09-01

    Full Text Available Systemic osteoporosis can damage skeletal bones to different degrees or remain persistent in intensity. The aim of this study was to determine the intensity and correlation of the osteoporotic changes in the bone density of the skeleton and body mass index (BMI with a reduction in edentulous mandibles. Material and Methods: In this study, 89 edentulous patients with decreased bone density comprised the experimental group, and 43 edentulous patients with normal bone densities formed the control. The age of the patients ranged between 53 and 73 years. Radiographs of the hands and panoramic radiographs were done for all the patients. The values of BMI, metacarpal index , density of lumbar spine (L2-L4, in the phalanx and segments of the mandibles as well as the heights of the edentulous alveolar ridges were measured, assessed and calculated.Results: The lowest value of the total skeletal density was established in the osteoporotic patients on the basis of the average T-score of -2.5 in men, and - 2.6 in women. Minimum values of the heights of the edentulous ridges (right/left, in mm were measured in both osteoporotic female (21.84/22.39 and male (24.90/24.96 patients. By comparison of the densities of the metacarpal bones, proximal phalanx, segments of the edentulous mandibles and based on the numerical values of the heights of the edentulous ridges, χ²=3.81 was found in men and χ²=4.03 was found in women with normal bone densities; χ²=5.92 was found in men and χ²=6.25 was found in women with osteopenia; χ²=2.63 was found in men and χ²=3.85 was found in women with osteoporosis, on the P level of probability of 0.05. Conclusion: Systemic osteoporosis causes a decrease of the jawbone density and induces residual edentulous alveolar ridge reduction.

  17. Alveolar soft-part sarcoma in paranasal sinuses

    Directory of Open Access Journals (Sweden)

    Jie ZHANG

    2015-07-01

    Full Text Available Objective To investigate clinicopathological features, immune phenotype, diagnosis and differential diagnosis of alveolar soft-part sarcoma (ASPS in paranasal sinuses. Methods Retrospective study of clinical manifestations, histopathological features and immunohistochemical features was conducted in one case of ASPS in paranasal sinuses.  Results A 28-year-old female presented with bulging forehead for 2 months. MRI revealed a well-circumscribed lesion in left frontal and ethmoid sinuses extending to anterior skull base that showed slightly hyperintense signal on T1WI and hypointense signal on T2WI without obvious enhancement after contrast administration. The patient subsequently underwent endoscopic open surgery on left ethmoid and bilateral frontal sinuses and performed partial resection of the lesion. Three months after the initial surgery, the patient received reoperation for total removal of residual lesion and reconstructive surgery of anterior skull base. Adjuvant chemotherapy and radiotherapy were not administered. Histologically, the tumor was composed of epithelioid cells arranged in organoid nests and/or alveolar structures varying in size and shape, which were separated by connective tissue richly containing sinusoidal vascular channels. The tumor cells were generally large-sized, round, oval or polygonal with abundant eosinophilic granular or translucent vacuolated cytoplasm. The nuclei showed round or oval shape containing centrally placed and obvious nucleoli. The presence a lot of mono- or multi-nuclear giant cells served as another striking feature. Mitotic activities were rare. Reticular fiber staining indicated that reticular fibers surrounded the nest of tumor cells, and diastase-resistant periodic acid-Schiff (PAS-positive crystalline inclusions were identified within the cytoplasm of tumor cells. Immunohistochemically, the tumor cells were reactive for TFE3, while were negative for glial fibrillary acidic protein (GFAP

  18. [Domiciliary noninvasive positive pressure ventilation in chronic alveolar hypoventilation].

    Science.gov (United States)

    Casas, J P; Robles, A M; Pereyra, M A; Abbona, H L; López, A M

    2000-01-01

    Effectiveness of treatment with domiciliary nocturnal noninvasive positive pressure ventilation is analyzed in a group of patients with chronic alveolar hypoventilation of different etiologies. It was applied with two levels of pressure (BiPAP) via nasal mask. Criteria for evaluation were symptomatology and improvement in gas exchange. Data were analyzed by Student t tests. A total of 13 patients were included, mean age 55.7 range 20 to 76 years (5 male 8 female). Main diagnosis was tuberculosis in 6, four of them having had surgical procedure (thoracoplasty 2, frenicectomy 1 and neumonectomy 1), myopathy 3 (myasthenia gravis 1, muscular dystrophy 1 and diaphragmatic paralysis 1), obesity-hypoventilation syndrome 1, escoliosis 1, bronchiectasis 1 and cystic fibrosis 1. These last two patients were on waiting list for lung transplantation. At the moment of consultation, the symptoms were: dysnea 13/13 (100%), astenia 13/13 (100%), hypersomnolency 10/13 (77%), cephalea 9/13 (69%), leg edema 6/13 (46%), loss of memory 6/13 (46%). Regarding gas exchange, they showed hypoxemia and hypercapnia. Mean follow up was of 2.2 years (range 6 months to 4 years). Within the year, all 13 patients became less dyspneic. Astenia, hypersomnolency, cephalea, leg edema and memory loss disappeared. Improvement in gas exchange was: PaO2/FiO2 from 269 +/- 65.4 (basal) to 336.7 +/- 75.3 post-treatment (p = 0.0018). PaCO2 from 70.77 +/- 25.48 mmHg (basal) to 46.77 +/- 8.14 mmHg (p = 0.0013). Ventilatory support was discontinued en 5 patients: three because of pneumonia requiring intubation and conventional mechanical ventilation, two of them died and one is still with tracheostomy; One patient with bronchiectasis and one with cystic fibrosis were transplanted. The remaining eight patients are stable. In conclusion, chronic alveolar hypoventilation can be effectively treated with domiciliary nocturnal noninvasive ventilation. Long term improvement in symptomatology and arterial blood gases

  19. Quantitative GPCR and ion channel transcriptomics in primary alveolar macrophages and macrophage surrogates

    Directory of Open Access Journals (Sweden)

    Groot-Kormelink Paul J

    2012-10-01

    Full Text Available Abstract Background Alveolar macrophages are one of the first lines of defence against invading pathogens and play a central role in modulating both the innate and acquired immune systems. By responding to endogenous stimuli within the lung, alveolar macrophages contribute towards the regulation of the local inflammatory microenvironment, the initiation of wound healing and the pathogenesis of viral and bacterial infections. Despite the availability of protocols for isolating primary alveolar macrophages from the lung these cells remain recalcitrant to expansion in-vitro and therefore surrogate cell types, such as monocyte derived macrophages and phorbol ester-differentiated cell lines (e.g. U937, THP-1, HL60 are frequently used to model macrophage function. Methods The availability of high throughput gene expression technologies for accurate quantification of transcript levels enables the re-evaluation of these surrogate cell types for use as cellular models of the alveolar macrophage. Utilising high-throughput TaqMan arrays and focussing on dynamically regulated families of integral membrane proteins, we explore the similarities and differences in G-protein coupled receptor (GPCR and ion channel expression in alveolar macrophages and their widely used surrogates. Results The complete non-sensory GPCR and ion channel transcriptome is described for primary alveolar macrophages and macrophage surrogates. The expression of numerous GPCRs and ion channels whose expression were hitherto not described in human alveolar macrophages are compared across primary macrophages and commonly used macrophage cell models. Several membrane proteins known to have critical roles in regulating macrophage function, including CXCR6, CCR8 and TRPV4, were found to be highly expressed in macrophages but not expressed in PMA-differentiated surrogates. Conclusions The data described in this report provides insight into the appropriate choice of cell models for

  20. Candidate salivary biomarkers associated with alveolar bone loss: cross-sectional and in vitro studies

    OpenAIRE

    Ng, Patricia Yen Bee; Donley, Maureen; Hausmann, Ernest; Hutson, Alan D.; Rossomando, Edward F.; Scannapieco, Frank A.

    2007-01-01

    This cross-sectional study evaluated the association between radiographic evidence of alveolar bone loss and the concentration of host-derived bone resorptive factors (interleukin-1 beta, tumor necrosis factor-alpha, interleukin-6, prostaglandin-E2), and markers of bone turnover [pyridinoline cross-linked carboxyterminal telopeptide of type I collagen (ICTP), osteocalcin, osteonectin] in stimulated human whole saliva collected from 110 untreated dental patients. Alveolar bone loss scores for ...

  1. Alveolar rhabdomyosarcoma originating between the fourth and fifth metatarsal--case report and literature review.

    LENUS (Irish Health Repository)

    Bolger, J C

    2010-09-01

    We report a case of alveolar rhabdomyosarcoma arising between the fourth and fifth metatarsal. A 13-year-old boy presented to outpatients with a history of pain and swelling in the lateral aspect of his left forefoot. Plain radiographs and MRI showed a soft tissue mass displacing the fourth metatarsal. Percutaneous biopsy revealed an alveolar rhabdomyosarcoma. Staging scans showed advanced metastatic disease. The patient was treated with chemotherapy. This highly malignant lesion remains challenging to diagnose, and difficult to treat successfully.

  2. Changes in Morphology of Alveolar Buccal Walls Following Atraumatic Internal Root Fragmentation

    OpenAIRE

    Engelke, Wilfried; Beltrán, Víctor; Decco, Oscar; Valdivia-Gandur, Iván; Navarro, Pablo; Fuentes, Ramón

    2015-01-01

    The buccal alveolar wall represents the most important structure to provide shape and volume of the alveolous following tooth extraction. The aim of the study was the evaluation of buccal alveolar bone structures following minimally invasive surgery. In 15 patients (3 male, 12 female), aged 20–67 years, 3 central incisors, 5 lateral incisors, and 7 bicuspids were removed using flapless enucleation. The enucleation comprised endoscopically assisted mesiodistal root sectioning with inw...

  3. Response of a phagocyte cell system to products of macrophage breakdown as a probable mechanism of alveolar phagocytosis adaptation to deposition of particles of different cytotoxicity.

    Science.gov (United States)

    Privalova, L I; Katsnelson, B A; Osipenko, A B; Yushkov, B N; Babushkina, L G

    1980-04-01

    The adaptation of the alveolar phagocytosis response to the quantitative and qualitative features of dust deposited during inhalation consists not only in enhanced recruitment of alveolar macrophages (AM), but also in adding a more or less pronounced neutrophil leukocyte (NL) recruitment as an auxiliary participant of particle clearance. The NL contribution to clearance is especially typical for response to cytotoxic particles (quartz, in particular). An important feature of the adaptation considered is the limitation of the number of AM and NL recruited when an efficient clearance can be achieved by a lesser number of cells due to increased AM reistance to the damaging actin of phagocytized particles. The main mechanism providing the adequacy of the alveolar phagocytosis response is its self-regulation thrugh the products of macrophage breakdown (PMB). In a series of experiments with intraperitoneal and intratracheal injections of syngenetic PMB into rats and mice, it was shown that these products stimulate respiration and migration of phagocytic cells, their dose-dependent attraction to the site of PMB formation with the predominant NL contribution, increasing with the increase of amount of PMB, the AM and NL precursor cells recruitment from reserve pools, and the replenishment of these reserves in the process of hemopoiesis. At least some of the above effects are connected with the action of the lipid components of PMB. The action of specialized regulative systems of the organism can modify the response to PMB, judging by the results obtained by hydrocortisone injection. Autocontrol of alveolar phagocytosis requires great care in attempts at artificial stimulation of this process, as an excessive cell recruitment may promote the retention of particles in lungs.

  4. Kinetics of gene expression of alkaline phosphatase during healing of alveolar bone in rats.

    Science.gov (United States)

    Rodrigues, Willian Caetano; Fabris, André Luís da Silva; Hassumi, Jaqueline Suemi; Gonçalves, Alaíde; Sonoda, Celso Koogi; Okamoto, Roberta

    2016-06-01

    Immunohistochemical studies and molecular biology have enabled us to identify numerous proteins that are involved in the metabolism of bone, and their encoding genes. Among these is alkaline phosphatase (ALP), an enzyme that is responsible for the initiation of mineralisation of the extracellular matrix during alveolar bone repair. To evaluate the gene expression of ALP during this process, we studied nine healthy adult male rats, which had their maxillary central incisors extracted from the right side and were randomly divided into three groups. During three experimental periods, 7 days, 14 days, and 28 days, the alveoli were curetted, the rats killed, and samples analysed by real-time reverse transcription polymerase chain reaction (qRT-PCR). The RNAm that encodes the gene for the synthesis of ALP was expressed during the three periods analysed, but its concentration was significantly increased at 14 and 28 days compared with at 7 days. There was no significant difference between 14 and 28 days (p=0.0005). We conclude that genes related to ALP are expressed throughout the healing process and more intensively during the later periods (14 and 28 days), which coincides with the increased formation of mineralised bone. Copyright © 2016 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  5. Silicoproteinosis and primary pulmonary alveolar proteinosis: high-resolution computed tomography criteria for differential diagnosis

    International Nuclear Information System (INIS)

    Marchiori, Edson; Mueller, Nestor L.; Martins, Erick Malheiro Leoncio; Souza Junior, Arthur Soares; Escuissato, Dante L.; Gasparetto, Emerson L.

    2003-01-01

    Pulmonary alveolar proteinosis is a rare disease of unknown etiology, in which the main histologic finding is the presence of alveolar filling with proteinaceous material, causing restrictive lung function hypoxaemia and several radiological abnormalities. In this manuscript we reviewed the (HRCT) findings in 13 patients with pulmonary alveolar proteinosis. The study included six patients with primary disease and seven with alveolar proteinosis secondary to silicosis in sandblasters. The aim of this work was to establish HRCT distinguishing features between these conditions, since the histological findings can be identical. The most common HRCT feature of primary alveolar proteinosis was patchy ground-glass attenuation associated with smooth interlobular septal thickening, resulting in a crazy paving pattern. There was no preferential regional lung distribution of this condition, HRCT manifestations of silicoproteinosis included areas of consolidation and foci of increased attenuation consistent with calcification, hilar lymph nodes enlargement and node calcification. We concluded that in the majority of patients the presence of foci of high attenuation in the parenchyma and lymph nodes allows a prompt distinction between silicoproteinosis and primary alveolar proteinosis. (author)

  6. Characterization of CD44 expressed on alveolar macrophages in patients with diffuse panbronchiolitis

    Science.gov (United States)

    Katoh, S; Matsubara, Y; Taniguchi, H; Fukushima, K; Mukae, H; Kadota, J; Matsukura, S; Kohno, S

    2001-01-01

    Interleukin (IL)-8 may play an important role in neutrophil infiltration in the airways of patients with diffuse panbronchiolitis (DPB). Furthermore, alveolar macrophages could produce IL-8 subsequent to CD44-hyaluronic acid (HA) interaction. The purpose of this study was to evaluate the contribution of CD44 expressed on alveolar macrophages to the pathogenesis of DPB. We examined the concentration of soluble CD44 (sCD44) in bronchoalveolar lavage fluid (BALF) and CD44 expression on macrophages in BALF from patients with DPB before and after low-dose, long-term macrolide therapy. We also assessed the HA-binding ability of alveolar macrophages as a functional analysis of the CD44 molecule. The sCD44 concentration in BALF was significantly lower in patients with DPB than in healthy volunteers. Percentages of alveolar macrophages expressing low CD44 (CD44 low+) and HA-nonbinding alveolar macrophages were higher in patients with DPB compared with healthy volunteers. Furthermore, macrolide therapy normalized CD44 expression and HA-binding ability of macrophages in BALF from DPB patients. Our findings suggest that alveolar macrophage dysfunction could result from abnormalities of CD44 expression in patients with DPB and that these events could contribute to the pathogenesis of DPB. PMID:11737075

  7. Alveolar soft-part sarcoma of the mediastinum: A case report

    Directory of Open Access Journals (Sweden)

    Yohei Kameda

    2017-02-01

    Full Text Available We report a 53-year-old man with metastases of alveolar soft-part sarcoma originated from the mediastinum. He was hospitalized due to lower extremities’ paralysis. Computed tomography scan findings revealed multiple nodules of bilateral lungs, swollen mediastinal lymph nodes, and osteolysis of thoracic vertebrae. We performed spinal decompression and biopsy from vertebra. And, we finally diagnosed this case as metastases of mediastinal alveolar soft-part sarcoma which was removed 10 years ago. Alveolar soft-part sarcoma is rare tumor accounted for 0.5%–1.0% of soft tissue sarcoma that often occurs primarily in the lower extremities and trunk. It is difficult to distinguish between alveolar soft-part sarcoma and paraganglioma, renal cell carcinoma and granular cell tumor morphologically. Periodic acid–Schiff stain and immunohistochemical staining of ASPL-TFE3 are useful in making a definitive diagnosis of alveolar soft-part sarcoma. This case is a rare case of alveolar soft-part sarcoma originated in the mediastinum with local recurrence and distant metastases 10 years after the initial surgery.

  8. A histomorphometric study of the effect of doxycycline and erythromycin on bone formation in dental alveolar socket of rat

    Directory of Open Access Journals (Sweden)

    Mohammad Shahabooei

    2015-01-01

    Full Text Available Background: The aim of the present study was to evaluate whether subantimicrobial doses of doxycycline (DOX and erythromycin (EM used for the treatment of peri-implant osteolysis due to their anti-osteoclastogenesis can interfere with the osseous wound healing process in rat alveolar socket. Materials and Methods: Forty-five male Wistar rats had their first maxillary right molar extracted and were divided into three groups. DOX and EM at the doses of 5 mg/kg/day orally (p.o. and 2 mg/kg/day intraperitoneally (i.p. were administered respectively to two separate groups for 7 days after operation. In the control group the animals received normal saline (5 ml/kg. Five rats were sacrificed at 7, 14 and 21 days post-extraction in each study group. A histomorphometric analysis was used to evaluate new bone formation inside the alveolar socket. Significant level was set at 0.05. Results: The findings showed that the percentage of new bone formation (NBF enhanced significantly on days 7 and 14. There was no significant difference in the NBF between DOX and EM groups. Conclusion: Short-term treatment with both DOX and EM enhanced new bone formation without any advances in favor of each drug.

  9. [Determining the alveolar component of nitric oxide in exhaled air: procedures and reference values for healthy persons].

    Science.gov (United States)

    Fortuna, Ana María; Balleza, Marco; Calaf, Núria; González, Mercedes; Feixas, Teresa; Casan, Pere

    2009-03-01

    Nitric oxide (NO) production has been described using a 2-compartment model for the synthesis and movement of NO in both the alveoli and the airways. The alveolar concentration of NO (Ca(NO)), an indirect marker of the inflammatory state of the distal portions of the lung, can be deduced through exhalation at multiple flow rates. Our objective was to determine reference values for Ca(NO). The fraction of exhaled NO (Fe(NO)) was measured in 33 healthy individuals at a rate of 50mL/s; the subjects then exhaled at 10, 30, 100, and 200mL/s to calculate Ca(NO). A chemiluminescence analyzer (NIOX Aerocrine) was used to perform the measurements. The mean (SD) Fe(NO) was 15 (6)ppb. The mean Ca(NO) was 3.04 (1.30)ppb. These values of Ca(NO) measured in healthy individuals will allow us to analyze alveolar inflammatory behavior in respiratory and systemic processes.

  10. Inferior alveolar nerve cutting; legal liability versus desired patient outcomes.

    Science.gov (United States)

    Kim, Soung Min; Lee, Jong Ho

    2017-10-01

    Mandibular angle reduction or reduction genioplasty is a routine well-known facial contouring surgery that reduces the width of the lower face resulting in an oval shaped face. During the intraoral resection of the mandibular angle or chin using an oscillating saw, unexpected peripheral nerve damage including inferior alveolar nerve (IAN) damage could occur. This study analyzed cases of damaged IANs during facial contouring surgery, and asked what the basic standard of care in these medical litigation-involved cases should be. We retrospectively reviewed a total of 28 patients with IAN damage after mandibular contouring from August 2008 to July 2015. Most of the patients did not have an antipathy to medical staff because they wanted their faces to be ovoid shaped. We summarized three representative cases according to each patient's perceptions and different operation procedures under the approvement by the Institutional Review Board of Seoul National University. Most of the patients did not want to receive any further operations not due to fear of an operation but because of the changes in their facial appearance. Thus, their fear may be due to a desire for a better perfect outcome, and to avoid unsolicited patient complaints related litigation. This article analyzed representative IAN cutting cases that occurred during mandibular contouring esthetic surgery and evaluated a questionnaire on the standard of care for the desired patient outcomes and the specialized surgeon's position with respect to legal liability.

  11. Expanding the phenotype of alveolar capillary dysplasia (ACD).

    Science.gov (United States)

    Sen, Partha; Thakur, Nivedita; Stockton, David W; Langston, Claire; Bejjani, Bassem A

    2004-11-01

    To define the phenotype of congenital alveolar capillary dysplasia (ACD) as a first step toward mapping the responsible gene(s). Analysis of pathology reports and microscopic slides of 23 subjects with ACD and sequence analysis of two candidate genes. Our review of the pre- and postmortem records delineates both the natural history of this condition and the associated anomalies. Our collection of families corroborates the likely autosomal recessive nature of this condition in some families and provides additional data for genetic and prenatal counseling. Anomalies of many organ systems were detected either in the prenatal period or during the hospital course. However, some major anomalies were not detected until postmortem examination. Left-right asymmetry and gastrointestinal malrotation emerge as important, previously recognized but underappreciated phenotypic features of ACD. Finally, we used sequence analysis to exclude mutations in the coding region of two candidate genes, bone morphogenetic protein type II receptor (BMPR2) and endothelial monocyte-activating polypeptide II (EMAP II), as candidates for ACD. Understanding the clinical spectrum of ACD and the cloning of an "ACD gene" both have implications for counseling, for prenatal testing, and for understanding the molecular pathophysiology of ACD and other organ malformations that are associated with this condition.

  12. Gaining surgical access for repositioning the inferior alveolar neurovascular bundle.

    Science.gov (United States)

    Al-Siweedi, Saif Yousif Abdullah; Nambiar, P; Shanmuhasuntharam, P; Ngeow, W C

    2014-01-01

    This study is aimed at determining anatomical landmarks that can be used to gain access to the inferior alveolar neurovascular (IAN) bundle. Scanned CBCT (i-CAT machine) data of sixty patients and reconstructions performed using the SimPlant dental implant software were reviewed. Outcome variables were the linear distances of the mandibular canal to the inferior border and the buccal cortex of the mandible, measured immediately at the mental foramen (D1) and at 10, 20, 30, and 40 mm (D2-D5) distal to it. Predictor variables were age, ethnicity, and gender of subjects. Apicobasal assessment of the canal reveals that it is curving downward towards the inferior mandibular border until 20 mm (D3) distal to the mental foramen where it then curves upwards, making an elliptic-arc curve. The mandibular canal also forms a buccolingually oriented elliptic arc in relation to the buccal cortex. Variations due to age, ethnicity, and gender were evident and this study provides an accurate anatomic zone for gaining surgical access to the IAN bundle. The findings indicate that the buccal cortex-IAN distance was greatest at D3. Therefore, sites between D2 and D5 can be used as favorable landmarks to access the IAN bundle with the least complications to the patient.

  13. Arachidonic acid metabolism in silica-stimulated bovine alveolar macrophages

    International Nuclear Information System (INIS)

    Englen, M.D.

    1989-01-01

    The in vitro production of arachidonic acid (AA) metabolites in adherent bovine alveolar macrophages (BAM) incubated with silica was investigated. BAM were pre-labelled with 3 H-AA, and lipid metabolites released into the culture medium were analyzed by high performance liquid chromatography (HPLC). Lactate dehydrogenase (LDH) release was simultaneously assayed to provide an indication of cell injury. Increasing doses of silica selectively stimulated the 5-lipoxygenase pathway of AA metabolism, while cyclooxygenase metabolite output was suppressed. LDH release increased in a linear, dose-dependent fashion over the range of silica doses used. Moreover, within 15 min following addition of a high silica dose, a shift to the production of 5-lipoxygenase metabolites occurred, accompanied by a reduction in cyclooxygenase products. This rapid alteration in AA metabolism preceded cell injury. To examine the relationship between cytotoxicity and AA metabolite release by BAM exposed to silicas with different cytotoxic and fibrogenic activities, BAM were exposed to different doses of DQ-12, Minusil-5, and Sigma silicas, and carbonyl iron beads. The median effective dose (ED 50 ) of each particulate to stimulate the release of AA metabolites and LDH was calculated. The ED 50 values for DQ-12, Minusil-5, and Sigma silica showed that the relative cytotoxicities of the different silicas for BAM corresponded to the relative potencies of the silicas to elicit 5-lipoxygenase metabolites from BAM. These results indicate that the cytotoxic, and presumed fibrogenic potential, of a silica is correlated with the potency to stimulate the release of leukotrienes from AM

  14. Effect of Preoperative Pain on Inferior Alveolar Nerve Block

    Science.gov (United States)

    Aggarwal, Vivek; Singla, Mamta; Subbiya, Arunajatesan; Vivekanandhan, Paramasivam; Sharma, Vikram; Sharma, Ritu; Prakash, Venkatachalam; Geethapriya, Nagarajan

    2015-01-01

    The present study tested the hypothesis that the amount and severity of preoperative pain will affect the anesthetic efficacy of inferior alveolar nerve block (IANB) in patients with symptomatic irreversible pulpitis. One-hundred seventy-seven adult volunteer subjects, actively experiencing pain in a mandibular molar, participated in this prospective double-blind study carried out at 2 different centers. The patients were classified into 3 groups on the basis of severity of preoperative pain: mild, 1–54 mm on the Heft-Parker visual analog scale (HP VAS); moderate, 55–114 mm; and severe, greater than 114 mm. After IANB with 1.8 mL of 2% lidocaine, endodontic access preparation was initiated. Pain during treatment was recorded using the HP VAS. The primary outcome measure was the ability to undertake pulp access and canal instrumentation with no or mild pain. The success rates were statistically analyzed by multiple logistic regression test. There was a significant difference between the mild and severe preoperative pain group (P = .03). There was a positive correlation between the values of preoperative and intraoperative pain (r = .2 and .4 at 2 centers). The amount of preoperative pain can affect the anesthetic success rates of IANB in patients with symptomatic irreversible pulpitis. PMID:26650491

  15. Gaining Surgical Access for Repositioning the Inferior Alveolar Neurovascular Bundle

    Directory of Open Access Journals (Sweden)

    Saif Yousif Abdullah Al-Siweedi

    2014-01-01

    Full Text Available This study is aimed at determining anatomical landmarks that can be used to gain access to the inferior alveolar neurovascular (IAN bundle. Scanned CBCT (i-CAT machine data of sixty patients and reconstructions performed using the SimPlant dental implant software were reviewed. Outcome variables were the linear distances of the mandibular canal to the inferior border and the buccal cortex of the mandible, measured immediately at the mental foramen (D1 and at 10, 20, 30, and 40 mm (D2–D5 distal to it. Predictor variables were age, ethnicity, and gender of subjects. Apicobasal assessment of the canal reveals that it is curving downward towards the inferior mandibular border until 20 mm (D3 distal to the mental foramen where it then curves upwards, making an elliptic-arc curve. The mandibular canal also forms a buccolingually oriented elliptic arc in relation to the buccal cortex. Variations due to age, ethnicity, and gender were evident and this study provides an accurate anatomic zone for gaining surgical access to the IAN bundle. The findings indicate that the buccal cortex-IAN distance was greatest at D3. Therefore, sites between D2 and D5 can be used as favorable landmarks to access the IAN bundle with the least complications to the patient.

  16. Quality assessment of systematic reviews on alveolar ridge preservation.

    Science.gov (United States)

    De Buitrago, Juan G; Avila-Ortiz, Gustavo; Elangovan, Satheesh

    2013-12-01

    The authors conducted a study to assess the quality of systematic reviews (SRs) published on the topic of alveolar ridge preservation (ARP). The authors conducted a search for SRs on ARP on the basis of a set of eligibility criteria (only SRs involving ARP, with or without meta-analyses, written in English). The authors assessed the quality of the SRs independently of one another by using two established checklists. The authors selected eight SRs. The results of all of the SRs indicated that ARP was effective in preserving the ridge volume as compared with extraction alone, but it did not fully prevent bone-resorptive events. None of the SRs, however, received the highest possible score in either of the checklists. One SR that had a score of 5 (of a possible 11) using one checklist and 5 (of a possible 14) using the other checklist had the lowest overall score. The results of this assessment revealed that a significant proportion of the investigators in the SRs did not include non-English language articles, perform hand searching of published literature or evaluate the gray literature. Assessment of publication bias and reporting of conflicts of interest also was lacking in some studies. Practical Implications. Although ARP appears to be an effective approach to preventing resorption after tooth extraction, significant structural and methodological variability exists among SRs on this topic. Future SRs on ARP should consider the use of quality assessment checklists to minimize methodological shortcomings for better dissemination of scientific evidence.

  17. Determinants of alveolar ridge preservation differ by anatomic location.

    Science.gov (United States)

    Leblebicioglu, Binnaz; Salas, Mabel; Ort, Yirae; Johnson, Ashley; Yildiz, Vedat O; Kim, Do-Gyoon; Agarwal, Sudha; Tatakis, Dimitris N

    2013-04-01

    To investigate and compare outcomes following alveolar ridge preservation (ARP) in posterior maxilla and mandible. Twenty-four patients (54 ± 3 years) with single posterior tooth extraction were included. ARP was performed with freeze-dried bone allograft and collagen membrane. Clinical parameters were recorded at extraction and re-entry. Harvested bone cores were analysed by microcomputed tomography (micro-CT), histomorphometry and immunohistochemistry. In both jaws, ARP prevented ridge height loss, but ridge width was significantly reduced by approximately 2.5 mm. Healing time, initial clinical attachment loss and amount of keratinized tissue at extraction site were identified as determinants of ridge height outcome. Buccal plate thickness and tooth root length were identified as determinants of ridge width outcome. In addition, initial ridge width was positively correlated with ridge width loss. Micro-CT revealed greater mineralization per unit volume in new bone compared with existing bone in mandible (p < 0.001). Distributions of residual graft, new cellular bone and immature tissue were similar in both jaws. Within the limitations of this study, the results indicate that in different anatomic locations different factors may determine ARP outcomes. Further studies are needed to better understand determinants of ARP outcomes. © 2013 John Wiley & Sons A/S.

  18. Sulfite induces release of lipid mediators by alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Beck-Speier, I.; Dayal, N.; Maier, L. [GSF - National Research Center for Environment and Health, Neuherberg (Germany). Inst. for Inhalation Biology; Denzlinger, C. [Tuebingen Univ. (Germany). Dept. II, Medical Clinic; Haberl, C. [Tuebingen Univ. (Germany). Dept. III, Medical Clinic

    1998-03-01

    Air pollutants are supposed to modulate physiological responses of alveolar macrophages (AM). This study was addressed to the question whether at neutral pH sulfur(IV) species in comparison to sulfur(VI) species cause AM to release proinflammatory mediators and which pathways are involved in their generation. Supernatants obtained from canine AM treated with sulfite (0.1 mM to 2 mM) enhanced the respiratory burst of canine neutrophils, measured by lucigenin-dependent chemiluminescence, whereas supernatants derived from AM treated with sulfate (1 mM) did not. The neutrophil-stimulating activity released by sulfite-treated AM consisted of platelet-activating factor (PAF) and leukotriene B{sub 4} (LTB{sub 4}) as shown by desensitization of the platelet-activating factor (PAF) and leukotriene B{sub 4} (LTB{sub 4}) as shown by desensitization of the corresponding receptors. Inhibitors of phospholipase A{sub 2} substantially suppressed release of neutrophil-stimulating activity by sulfite-treated AM. Inhibition of 5-lipoxygenase in sulfite-treated AM also reduced neutrophil-stimulating activity, while inhibition of cyclooxygenase had no effect. In conclusion, sulfite induces AM to release lipid mediators via phospholipase A{sub 2}- and 5-lipoxygenase-dependent pathways. These mediators activate neutrophils via the receptors for PAF and LTB{sub 4}. (orig.)

  19. Antioxidant properties of taurine in rat alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Castranova, V.; Banks, M.A.; Porter, D.W.; Martin, W.G. (National Inst. for Occupational Safety and Health, Morgantown, WV (United States) West Virginia Univ., Morgantown (United States))

    1990-02-26

    Isolated rat alveolar macrophages (RAM) which had taken-up and accumulated extracellular (0-500 {mu}M) taurine (TAU) were exposed to 0.45 {plus minus} 0.05 ppm ozone for 30 minutes in a modified tissue culture flask containing TAU-supplemented medium. Recovered cells were assayed for oxidant damage and media analyzed for leakage of intracellular components. Cell viability significantly increased, while recovery of cells decreased (possibly due to increased adherence) with increasing TAU. At 100 {mu}M (rat plasma TAU level), TAU protected against the ozone-induced increase in zymosan-stimulated chemiluminescence, diminished leakages of lipid peroxidation products and protein into the medium, and partially restored the ozone-inactivated Na{sup +}/K{sup +} ATPase activity of RAM. Efflux of oxidized glutathione was maximized and K{sup +} leakage was minimized by the addition of 250 {mu}M TAU. At 250-500 {mu}M TAU, leakages of lipid peroxidation products and protein were enhanced, while the intracellular TAU content dramatically increased. These results indicate that TAU has both direct and indirect antioxidant properties at low levels and pro-oxidant properties at high levels in RAM.

  20. Pulmonary alveolar proteinosis: Quantitative CT and pulmonary functional correlations

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Yubao, E-mail: yubaoguan@163.com [Department of Radiology, the First Affiliated Hospital of Guangzhou Medical College, Guangzhou 510120 (China); State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); Zeng, Qingsi [Department of Radiology, the First Affiliated Hospital of Guangzhou Medical College, Guangzhou 510120 (China); Yang, Haihong; Zheng, Jinping; Li, Shiyue; Gao, Yi [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); Deng, Yu [Department of Radiology, the First Affiliated Hospital of Guangzhou Medical College, Guangzhou 510120 (China); Mei, Jiang [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); He, Jianxing, E-mail: jianxing63@163.com [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China); Zhong, Nanshan, E-mail: nanshan@vip.163.com [State Key Laboratory of Respiratory Disease, Guangzhou 510120 (China)

    2012-09-15

    Objective: We assessed the relationship between quantitative computer tomography (qCT) and the pulmonary function test (PFT) or blood gas analysis in pulmonary alveolar proteinosis (PAP) patients, as well as the utility of these analyses to monitor responses to whole lung lavage (WLL) therapy. Methods: Thirty-eight PAP patients simultaneously received a CT scan and PFT. Fifteen of these patients, undergoing sequential WLL for a total of 20 lavages, also underwent chest CT scans and blood gas analysis before and after WLL, and 14 of 15 patients underwent simultaneous PFT analysis. Differences between the qCT and PFT results were analyzed by canonical correlation. Results: PAP patients with low predicted values for FVC, FEV1, D{sub LCO} and D{sub LCO}/VA indicated small airspace volume and mean lung inflation, low airspace volume/total lung volume ratio and high mean lung density. Correlation and regression analysis revealed a strong correlation between D{sub LCO} and PaO{sub 2} values with CT results. The qCT results indicated that WLL significantly decreased lung weights and mean lung densities, and improved the total airspace volume/total lung volume ratios and mean lung inflations. Conclusion: Quantitative CT may be a sensitive tool for measuring the response of PAP patients to medical interventions such as WLL.

  1. Automatic lung segmentation in the presence of alveolar collapse

    Directory of Open Access Journals (Sweden)

    Noshadi Areg

    2017-09-01

    Full Text Available Lung ventilation and perfusion analyses using chest imaging methods require a correct segmentation of the lung to offer anatomical landmarks for the physiological data. An automatic segmentation approach simplifies and accelerates the analysis. However, the segmentation of the lungs has shown to be difficult if collapsed areas are present that tend to share similar gray values with surrounding non-pulmonary tissue. Our goal was to develop an automatic segmentation algorithm that is able to approximate dorsal lung boundaries even if alveolar collapse is present in the dependent lung areas adjacent to the pleura. Computed tomography data acquired in five supine pigs with injured lungs were used for this purpose. First, healthy lung tissue was segmented using a standard 3D region growing algorithm. Further, the bones in the chest wall surrounding the lungs were segmented to find the contact points of ribs and pleura. Artificial boundaries of the dorsal lung were set by spline interpolation through these contact points. Segmentation masks of the entire lung including the collapsed regions were created by combining the splines with the segmentation masks of the healthy lung tissue through multiple morphological operations. The automatically segmented images were then evaluated by comparing them to manual segmentations and determining the Dice similarity coefficients (DSC as a similarity measure. The developed method was able to accurately segment the lungs including the collapsed regions (DSCs over 0.96.

  2. Comparison of digitized radiographic alveolar features with age

    International Nuclear Information System (INIS)

    Lee, Keon Il

    1997-01-01

    The purpose of the present study was to use digital profile image features and digital image analysis of fixed-dimension bone regions, extracted from standardized periapical radiographs of the maxilla, to determine whether differences exist in alveolar bone of younger women (mean age : 59.23 ± 7.34 years) and just menopaused women (mean age : 59.23 ± 7.34), Periapical films were used from two groups of 20 randomly selected women. None of the subjects had a remarkable medical history. To simplify protocol, we chose one interproximal bone area between the maxillary right canine and lateral incisor for study. Each film was digitized into a 1312 X 1024 pixel X 8 bit depth matrix by means of a Nikon 35 mm film scanner (LS-3510AF, Japan) with fixed gain and internal dark current correction to maintain constant illumination. The scanner was interfaced to a Macintosh LC III computer(Apple Computer, Charlotte, N.C.). Area and profile orientation were selected with a NIMH Image 1.37 (NIH Research Services Brach, Bethesda, Md.). Histogram features were extracted form each profile and area. The results of this study indicate that mean pixel intensities didn't differ significantly between two groups and there was a high correlation-coefficient between digitized radiographic profile features and area features.

  3. Alveolar Fracture Caused by Tooth Extraction at Home.

    Science.gov (United States)

    de Carvalho, Fabrício Kitazono; Xavier, Thaís Aparecida; Lima, Nicole Gonçalves; de Queiroz, Alexandra Mussolino; Vinhorte, Marcilene Coelho; Nelson-Filho, Paulo

    Injuries to the teeth and surrounding structures are relatively common. Although traumatic injuries caused by falls or activities related to sports are widely discussed, the same cannot be said regarding accidents arising from non-professional extraction of primary teeth. The present study reports a 6-year-old male child who underwent mandibular alveolar bone fracture during non-professional extraction of his central lower left incisor at home, performed by his 30-year-old aunt. The root of the tooth was with an irregular physiological resorption, which acted as a lever component for the mechanical force applied, leading to bone fracture. Although not common, the possibility that dental roots with irregular resorption can act as a possible risk factor for accidents if the parents or guardians of children during the period of transitional dentition try to perform intentional extraction of primary teeth should be highlighted. Parents should always consult a professional, preferably a pediatric dentist, for monitoring this period of transitional dentition.

  4. Evidence for particle transport between alveolar macrophages in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Benson, J.M.; Nikula, K.J.; Guilmette, R.A.

    1995-12-01

    Recent studies at this Institute have focused on determining the role of alveolar macrophages (AMs) in the transport of particles within and form the lung. For those studies, AMs previously labeled using the nuclear stain Hoechst 33342 and polychromatic Fluoresbrite microspheres (1 {mu}m diameter, Polysciences, Inc., Warrington, PA) were instilled into lungs of recipient F344 rats. The fate of the donor particles and the doubly labeled AMs within recipient lungs was followed for 32 d. Within 2-4 d after instillation, the polychromatic microspheres were found in both donor and resident AMs, suggesting that particle transfer occurred between the donor and resident AMs. However, this may also have been an artifact resulting from phagocytosis of the microspheres form dead donor cells or from the fading or degradation of Hoechst 33342 within the donor cells leading to their misidentification as resident AMs. The results support the earlier findings that microspheres in donor AMs can be transferred to resident AMs within 2 d after instillation.

  5. HES6 enhances the motility of alveolar rhabdomyosarcoma cells

    International Nuclear Information System (INIS)

    Wickramasinghe, Caroline M; Domaschenz, Renae; Amagase, Yoko; Williamson, Daniel; Missiaglia, Edoardo; Shipley, Janet; Murai, Kasumi; Jones, Philip H

    2013-01-01

    Absract: HES6, a member of the hairy-enhancer-of-split family of transcription factors, plays multiple roles in myogenesis. It is a direct target of the myogenic transcription factor MyoD and has been shown to regulate the formation of the myotome in development, myoblast cell cycle exit and the organization of the actin cytoskeleton during terminal differentiation. Here we investigate the expression and function of HES6 in rhabdomyosarcoma, a soft tissue tumor which expresses myogenic genes but fails to differentiate into muscle. We show that HES6 is expressed at high levels in the subset of alveolar rhabdomyosarcomas expressing PAX/FOXO1 fusion genes (ARMSp). Knockdown of HES6 mRNA in the ARMSp cell line RH30 reduces proliferation and cell motility. This phenotype is rescued by expression of mouse Hes6 which is insensitive to HES6 siRNA. Furthermore, expression microarray analysis indicates that the HES6 knockdown is associated with a decrease in the levels of Transgelin, (TAGLN), a regulator of the actin cytoskeleton. Knockdown of TAGLN decreases cell motility, whilst TAGLN overexpression rescues the motility defect resulting from HES6 knockdown. These findings indicate HES6 contributes to the pathogenesis of ARMSp by enhancing both proliferation and cell motility.

  6. Aumento del reborde alveolar residual mediante técnica de rollo Increase of residual alveolar ridge using roll technique

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Simancas Pallares

    2011-03-01

    Full Text Available La pérdida dentaria, asociada a factores sistémicos, patológicos y traumáticos, promueve el proceso de reabsorción ósea de los rebordes residuales y genera problemas funcionales, como la falta de estabilidad y retención de las prótesis dentarias removibles, y disturbios estéticos y psicológicos. Estos defectos varían en dependencia de la cantidad de pérdida ósea y de tejidos blandos que hayan alcanzado. En la actualidad son descritas diversas técnicas que permiten corregir estos defectos. Una de ellas es la técnica del rollo, la cual demuestra muy buenos resultados al aumentar el tamaño del reborde alveolar y disminuir los defectos estéticos que causa sobre todo en el sector anterior. El objetivo del presente artículo es describir el caso clínico de un paciente con pérdida ósea en el sector anterior, tipo III según Seibert, rehabilitado con prótesis parcial fija y sometido a un procedimiento quirúrgico con la técnica del rollo. Se alcanzaron los objetivos planteados y proporciona una mejoría estética así como una mejora en su calidad de vida. Se demostró que con esta técnica se obtienen resultados predecibles que devuelven la estética en zonas de alta exigencia por parte de los pacientes.Tooth loss associated with systemic factors, pathological and traumatic conditions, promotes the bone resorption of residual ridges, this, creates functional problems such as lack of stability and retention of removable dentures as well as aesthetic and psychological disturbances. These defects vary depending on the amount of bone loss and soft tissue they reach. At present there are described various techniques that can correct these defects. One of these is the roll technique which shows very good results by increasing the size of the alveolar ridge and decrease aesthetic defects in the anterior area of the maxilla. The aim of this article is to describe a case of a patient with Seibert bone loss type III, rehabilitated with

  7. Intermittent PTH administration improves alveolar bone formation in type 1 diabetic rats with periodontitis.

    Science.gov (United States)

    Kim, Ji-Hye; Kim, Ae Ri; Choi, Yun Hui; Kim, Aeryun; Sohn, Yongsung; Woo, Gye-Hyeong; Cha, Jeong-Heon; Bak, Eun-Jung; Yoo, Yun-Jung

    2018-03-15

    Periodontitis is an infectious disease that manifests as alveolar bone loss surrounding the roots of teeth. Diabetes aggravates periodontitis-induced alveolar bone loss via suppression of bone formation. Intermittent parathyroid hormone (PTH) administration displays an anabolic effect on bone. In this study, we investigated the effect of intermittent PTH administration on alveolar bone loss in type 1 diabetic rats with periodontitis. Rats were divided into control (C), periodontitis (P), periodontitis treated with PTH (P + PTH), diabetes with periodontitis (DP), and diabetes with periodontitis treated with PTH (DP + PTH) groups. To induce type 1 diabetes, rats were injected with streptozotocin and periodontitis was induced bilaterally by applying ligatures to the mandibular first molars for 30 days. During the experimental period, the P + PTH and DP + PTH groups were subcutaneously injected with PTH (40 μg/kg) three times per week, whereas the C, P, and DP groups were injected with citrate buffer. To observe the mineralization of the alveolar bone, the DP and DP + PTH groups were injected with calcein on days 10 and 27, and with alizarin red on day 20. Thirty days after ligation, histological findings and fluorescence labeling were analyzed in the furcations of the mandibular first molars. Sclerostin-positive osteocytes were assessed by immunohistochemical analyses. The DP groups had smaller areas of alveolar bone than the other groups, and the DP + PTH group had a larger alveolar bone area than the DP group. The DP group had less osteoid formation than the C group, whereas the DP + PTH had greater osteoid formation than the DP group. Fluorescence labeling results revealed that the DP + PTH group had more mineral deposition on the alveolar bone than the DP group. The DP + PTH group exhibited lower percentage of sclerostin-positive osteocytes in alveolar bone than the DP group. Intermittent PTH administration diminishes

  8. Breakdown of Epithelial Barrier Integrity and Overdrive Activation of Alveolar Epithelial Cells in the Pathogenesis of Acute Respiratory Distress Syndrome and Lung Fibrosis

    Directory of Open Access Journals (Sweden)

    Shigehisa Yanagi

    2015-01-01

    Full Text Available Individual alveolar epithelial cells (AECs collaboratively form a tight barrier between atmosphere and fluid-filled tissue to enable normal gas exchange. The tight junctions of AECs provide intercellular sealing and are integral to the maintenance of the AEC barrier integrity. Disruption and failure of reconstitution of AEC barrier result in catastrophic consequences, leading to alveolar flooding and subsequent devastating fibrotic scarring. Recent evidences reveal that many of the fibrotic lung diseases involve AECs both as a frequent target of injury and as a driver of ongoing pathological processes. Aberrantly activated AECs express most of the growth factors and chemokines responsible for the proliferation, migration, and activation of fibroblasts. Current evidences suggest that AECs may acquire overdrive activation in the initial step of fibrosis by several mechanisms, including abnormal recapitulation of the developmental pathway, defects of the molecules essential for epithelial integrity, and acceleration of aging-related properties. Among these initial triggering events, epithelial Pten, a multiple phosphatase that negatively regulates the PI3K/Akt pathway and is crucial for lung development, is essential for the prevention of alveolar flooding and lung fibrosis through the regulation of AEC barrier integrity after injury. Reestablishment of AEC barrier integrity also involves the deployment of specialized stem/progenitor cells.

  9. Regenerative potential of leucocyte- and platelet-rich fibrin. Part B: sinus floor elevation, alveolar ridge preservation and implant therapy. A systematic review.

    Science.gov (United States)

    Castro, Ana B; Meschi, Nastaran; Temmerman, Andy; Pinto, Nelson; Lambrechts, Paul; Teughels, Wim; Quirynen, Marc

    2017-02-01

    To analyse the effect of leucocyte- and platelet-rich fibrin (L-PRF) on bone regeneration procedures and osseointegration. An electronic and hand search was conducted in three databases (MEDLINE, EMBASE and Cochrane). Only randomized clinical trials, written in English where L-PRF was applied in bone regeneration and implant procedures, were selected. No follow-up restrictions were applied. A total of 14 articles were included and processed. Three subgroups were created depending on the application: sinus floor elevation (SFE), alveolar ridge preservation and implant therapy. In SFE, for a lateral window as well as for the trans-alveolar technique, histologically faster bone healing was reported when L-PRF was added to most common xenografts. L-PRF alone improved the preservation of the alveolar width, resulting in less buccal bone resorption compared to natural healing. In implant therapy, better implant stability over time and less marginal bone loss were observed when L-PRF was applied. Meta-analyses could not be performed due to the heterogeneity of the data. Despite the lack of strong evidence found in this systematic review, L-PRF might have a positive effect on bone regeneration and osseointegration. © 2016 The Authors. Journal of Clinical Periodontology Published by John Wiley & Sons Ltd.

  10. Retention of inhaled plutonium oxide. Elimination procedures by pulmonary lavage and effect of the alveolar macrophage

    International Nuclear Information System (INIS)

    Nolibe, Daniel.

    1977-03-01

    A large fraction of the plutonium particles, reaching the deeper lung are retained in the alveolar macrophages during several months. Cell function changes were measured in vivo and in vitro. Stimulation of macrophage mobility and phagocytosis or natural clearance processes were uneffective on PuO 2 excretion. In vivo pulmonary lavage was the only effective therapy. The procedures of in toto pulmonary lavage in order to obtain the highest number of macrophages are described. A study of the physiological and histological consequences showed no long-term pathology, lesions observed during 48 h after lavage were restored quickly. A single lavage eliminated 12-25% only of the lung burden. A procedure of ten repeated lavages (1 per week) eliminated 60-90% of the lung burden. The action of lavage seemed twofold: direct elimination in the rinsing liquid and faster pulmonary clearance with low lymph node overload. Survivals in treated animals kept for long-term observations were compatible with the lung burdens remaining after treatment. Demontration of an inhibiting effect on pulmonary fibrosis should indicate a larger utilization [fr

  11. Composite Alginate-Hyaluronan Sponges for the Delivery of Tranexamic Acid in Postextractive Alveolar Wounds.

    Science.gov (United States)

    Catanzano, Ovidio; D'Esposito, Vittoria; Formisano, Pietro; Boateng, Joshua S; Quaglia, Fabiana

    2018-02-01

    The management of wounds in patients on anticoagulant therapy who require oral surgical procedures is problematic and often results in a nonsatisfactory healing process. Here, we report a method to prepare an advanced dressing able to avoid uncontrolled bleeding by occluding the postextractive alveolar wounds, and simultaneously, capable of a fast release of tranexamic acid (TA). Composite alginate/hyaluronan (ALG/HA) sponge dressings loaded with TA were prepared by a straightforward internal gelation method followed by a freeze-drying step. Both blank and drug-loaded sponges were soft, flexible, and elegant in appearance and nonbrittle in nature. Scanning electron microscopy analysis confirmed the porous nature of these dressings. The integration of HA influenced the microstructure, reducing the porosity, modifying the water uptake kinetic, and increasing the resistance to compression. TA release from ALG/HA sponges showed a controlled release up to 3 h, and it was faster in the presence of HA. Finally, an in vitro clotting test performed on human whole blood confirmed that the TA-loaded sponges significantly reduce the blood clotting index by 30% compared with ALG/HA 20 sponges. These results suggest that, if placed in a socket cavity, these dressings could give a relevant help to the blood hemostasis after dental extractions, especially in patients with coagulation disorders. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  12. Alveolar ridge preservation with autologous particulated dentin-a case series.

    Science.gov (United States)

    Valdec, Silvio; Pasic, Pavla; Soltermann, Alex; Thoma, Daniel; Stadlinger, Bernd; Rücker, Martin

    2017-12-01

    Ridge preservation can be performed with autologous bone, alloplastic bone substitute material or a combination of both. Dentin is similar to bone in its chemical composition. In its use as bone substitute material, it undergoes a remodelling process and transforms to bone. The presented case report introduces a technique in which the extraction socket is augmented with autologous, particulated dentin. The fractured, non-savable mesial incisor of the upper jaw was carefully extracted in axial direction. After the extraction, the tooth was cleared from remaining periodontal tissue. The vital pulp tissue or a root canal filling, enamel and cementum were also removed. Following the particulation of the remaining dentin in a bone mill, the dentin particles were immediately filled orthotope into the alveolar socket. The soft tissue closure was performed with a free gingival graft of the palate. After an observation period of 4 months, an implant was placed in the augmented area, which osseointegrated successfully and could be restored prosthodontically in the following. The results of this method showed a functional and aesthetic success. The pre-implantological, autologous ridge preservation with dentin could be performed successfully. For the establishment of dentin as augmentation material for jaw augmentation procedures, a prospective, clinical trial is now necessary.

  13. An in vitro cytotoxicity assessment of graphene nanosheets on alveolar cells

    Science.gov (United States)

    Dervin, Saoirse; Murphy, James; Aviles, Ruth; Pillai, Suresh C.; Garvey, Mary

    2018-03-01

    The collection of intrinsic properties possessed by graphene family nanomaterials (GFNs) results in their continuous exploitation for biomedical applications. The materials biomedical potential has motivated an upsurge in green preparation routes for the production of graphene like materials with limited toxicity. A number of bio-friendly reducing agents have been utilized for the preparation of chemically reduced graphene oxide (GO), and their resulting cytotoxic effects examined. However, the toxicology effects of one of the first biomolecules implemented for the reduction of GO, ascorbic acid (AA) has yet to be investigated. Herein, the toxicity of three distinct GFNs; GO, hydrazine reduced GO (H.rGO) and AA.rGO, prepared through diverse chemical routes are studied, to demonstrate the cytotoxic activity of a green reducer, in comparison to an established reduction method using hydrazine hydrate. The variation in atomic structure of GO, H.rGO and AA.rGO resulting from different synthesis techniques demonstrates the dependence of toxicity on particle shape and size. All GFNs induced high levels of alveolar cell toxicity. Interaction of AA.rGO with the A549 human lung epithelial carcinoma cell line resulted in increased leakage of lactate dehydrogenase, indicative of diminished cell membrane integrity. The uncharacteristic shape of the AA.rGO may be responsible for this proliferated release of the essential protein. The presented data therefore demonstrates that modification of synthetic processes significantly alter the biological activities of GFNs.

  14. OCLI-023, a Novel Pyrimidine Compound, Suppresses Osteoclastogenesis In Vitro and Alveolar Bone Resorption In Vivo.

    Directory of Open Access Journals (Sweden)

    Hye Jung Ihn

    Full Text Available An abnormal increase in osteoclast differentiation and activation results in various bone-resorptive diseases, including periodontitis, rheumatoid arthritis, and osteoporosis. Chemical compounds containing pyrimidine ring have been shown to regulate a variety of biological processes. Therefore, in order to identify an antiresorptive agent, we synthesized a series of pyrimidine ring-containing chemical compounds, and found that OCLI-023 suppressed the differentiation and activation of osteoclasts in vitro. OCLI-023 directly inhibited receptor activator of nuclear factor-κB ligand (RANKL-induced differentiation of bone marrow macrophages into osteoclasts, without a cytotoxic response. OCLI-023 also downregulated the RANKL-induced mRNA expression of osteoclast markers as well as inhibited the formation of actin rings and resorption pits. OCLI-023 attenuated the RANKL-induced activation of c-Jun N-terminal kinase and nuclear factor kappa-light-chain-enhancer of activated B cell signaling pathways. In a mouse model of periodontitis, ligature induced an increase of distance between cementoenamel junction (CEJ and alveolar bone crest (ABC in the second molar, and OCLI-023 significantly reduced it. Histological analysis showed ligature-induced increase of osteoclast numbers was also significantly reduced by OCLI-023. These data demonstrated the inhibitory effect of OCLI-023 on osteoclast differentiation and activity of osteoclasts in vitro, as well as on ligature-induced bone loss in vivo, and OCLI-023 can be proposed as a novel anti-resorptive compound.

  15. Tissue factor deficiency increases alveolar hemorrhage and death in influenza A virus-infected mice.

    Science.gov (United States)

    Antoniak, S; Tatsumi, K; Hisada, Y; Milner, J J; Neidich, S D; Shaver, C M; Pawlinski, R; Beck, M A; Bastarache, J A; Mackman, N

    2016-06-01

    Essentials H1N1 Influenza A virus (IAV) infection is a hemostatic challenge for the lung. Tissue factor (TF) on lung epithelial cells maintains lung hemostasis after IAV infection. Reduced TF-dependent activation of coagulation leads to alveolar hemorrhage. Anticoagulation might increase the risk for hemorrhages into the lung during severe IAV infection. Background Influenza A virus (IAV) infection is a common respiratory tract infection that causes considerable morbidity and mortality worldwide. Objective To investigate the effect of genetic deficiency of tissue factor (TF) in a mouse model of IAV infection. Methods Wild-type mice, low-TF (LTF) mice and mice with the TF gene deleted in different cell types were infected with a mouse-adapted A/Puerto Rico/8/34 H1N1 strain of IAV. TF expression was measured in the lungs, and bronchoalveolar lavage fluid (BALF) was collected to measure extracellular vesicle TF, activation of coagulation, alveolar hemorrhage, and inflammation. Results IAV infection of wild-type mice increased lung TF expression, activation of coagulation and inflammation in BALF, but also led to alveolar hemorrhage. LTF mice and mice with selective deficiency of TF in lung epithelial cells had low basal levels of TF and failed to increase TF expression after infection; these two strains of mice had more alveolar hemorrhage and death than controls. In contrast, deletion of TF in either myeloid cells or endothelial cells and hematopoietic cells did not increase alveolar hemorrhage or death after IAV infection. These results indicate that TF expression in the lung, particularly in epithelial cells, is required to maintain alveolar hemostasis after IAV infection. Conclusion Our study indicates that TF-dependent activation of coagulation is required to limit alveolar hemorrhage and death after IAV infection. © 2016 International Society on Thrombosis and Haemostasis.

  16. Relationship of distraction rate with inferior alveolar nerve degeneration-regeneration shift

    Directory of Open Access Journals (Sweden)

    Ying-hua Zhao

    2018-01-01

    Full Text Available Distraction osteogenesis is an important technique for the treatment of maxillofacial abnormities and defects. However, distraction osteogenesis may cause the injury of the inferior alveolar nerve. The relationship between distraction rate and nerve degeneration-regeneration shift remains poorly understood. In this study, 24 rabbits were randomly divided into four groups. To establish the rabbit mandibular distraction osteogenesis model, the mandibles of rabbits in distraction osteogenesis groups were subjected to continuous osteogenesis distraction at a rate of 1.0, 1.5 and 2.0 mm/d, respectively, by controlling rounds of screwing each day in the distractors. In the sham group, mandible osteotomy was performed without distraction. Pin-prick test with a 10 g blunt pin on the labium, histological and histomorphometric analyses with methylene blue staining, Bodian's silver staining, transmission electron microscopy and myelinated fiber density of inferior alveolar nerve cross-sections were performed to assess inferior alveolar nerve conditions. At 28 days after model establishment, in the pin-prick test, the inferior alveolar nerve showed no response in the labium to a pin pricks in the 2 mm/d group, indicating a severe dysfunction. Histological and histomorphometric analyses indicated that the inferior alveolar nerve suffered more degeneration and injuries at a high distraction rate (2 mm/d. Importantly, the nerve regeneration, indicated by newborn Schwann cells and axons, was more abundant in 1.0 and 1.5 mm/d groups than in 2.0 mm/d group. We concluded that the distraction rate was strongly associated with the inferior alveolar nerve function, and the distraction rates of 1.0 and 1.5 mm/d had regenerative effects on the inferior alveolar nerve. This study provides an experimental basis for the relationship between distraction rate and nerve degeneration-regeneration shift during distraction osteogenesis, and may facilitate reducing nerve

  17. Impact of SMOFLipid on Pulmonary Alveolar Development in Newborn Guinea Pigs.

    Science.gov (United States)

    Lavoie, Jean-Claude; Mohamed, Ibrahim; Nuyt, Anne-Monique; Elremaly, Wesam; Rouleau, Thérèse

    2018-03-13

    Parenteral nutrition (PN) is associated with bronchopulmonary dysplasia in premature infants. In animals, PN leads to alveolar loss following stimulation of apoptosis by oxidative stress (oxidized redox potential). Peroxides and aldehydes generated in PN can induce hypo-alveolarization. The implication of peroxides, which is reduced by light protection, is demonstrated. The implication of aldehydes from omega-6 fatty acids oxidation is expected. The hypothesis is that composition and light exposure of PN influences bronchopulmonary dysplasia development. Since SMOFLipid (SMOF) contains a lower amount of omega-6 fatty acids than Intralipid (IL), the aim was to compare, the impacts of PN compounded with SMOF or IL, photo-protected or not, on alveolar development. Three-day-old Guinea pigs received PN, photo-protected or not, made with SMOF or IL through a jugular vein catheter. After 4 days, lungs were sampled for determinations of redox potential of glutathione, apoptosis (caspase-3, caspase-8, and caspase-9) and alveolarization index (histology: number of intercepts/mm). Compared with IL, SMOF induces a greater oxidation of redox potential (-200 ± 1 versus [vs] -205 ± 1 mV), apoptosis (caspase-3: 0.27 ± 0.04 vs 0.16 ± 0.02; caspase-9: 0.47 ± 0.03 vs 0.30 ± 0.03), and a lower alveolarization index (27.2 ± 0.8 vs 30.0 ± 0.9). Photo-protection prevented activation of caspase-9 and was statistically without effect on redox potential, caspase-3, and alveolarization index. In our model, SMOF is pro-oxidant and induces hypo-alveolarization following exaggerated apoptosis. These results highlight the need for further studies before introducing SMOFLipid in standard neonatal care. (Nutr Clin Pract. 2018;xx:xx-xx). © 2018 American Society for Parenteral and Enteral Nutrition.

  18. Human Alveolar Echinococcosis in Poland: 1990–2011

    Science.gov (United States)

    Nahorski, Wacław L.; Knap, Józef P.; Pawłowski, Zbigniew S.; Krawczyk, Marek; Polański, Jerzy; Stefaniak, Jerzy; Patkowski, Waldemar; Szostakowska, Beata; Pietkiewicz, Halina; Grzeszczuk, Anna; Felczak-Korzybska, Iwona; Gołąb, Elżbieta; Wnukowska, Natalia; Paul, Małgorzata; Kacprzak, Elżbieta; Sokolewicz-Bobrowska, Elżbieta; Niścigorska-Olsen, Jolanta; Czyrznikowska, Aleksandra; Chomicz, Lidia; Cielecka, Danuta; Myjak, Przemysław

    2013-01-01

    Background Alveolar echinococcosis (AE) caused by Echinococcus multilocularis infections is a dangerous old disease in the Northern Hemisphere. The aim of the paper was to collect and analyze data on human AE in Poland in the last two decades. Methodology/Principal Findings The sources of data were both the cases officially registered and detected by an active field and laboratory surveillance. The cases were verified by clinical, epidemiological, and laboratory criteria. Altogether 121 human cases of AE were detected. Among these 83 (68,6%) cases were classified as confirmed, 16 as probable and 22 as possible. During the two decades a continuous increase in detection rate was noticed. The cases were 6–82 years old at the time of diagnosis (mean - 47.7 years). Sex ratio M/F was 0.86/1.0. The AE was fatal in 23 (19%) patients (mean age at death - 54.1 years). Family agglomeration of AE was found in 4 foci, involving 9 patients. Seventy six of the cases were diagnosed in an advanced stage of disease. In all cases the liver was the primary location of AE. In 30 (24.8%) patients a spread to other organs was observed. Ninety four of the patients were treated with albendazole. In 73 (60%) patients a surgical operation was performed, including 15 liver transplantations. Conclusions/Significance The studies confirmed that AE is an emerging disease in Poland, which is the fourth country in Europe with over 120 cases detected. The results also indicate the need of a wider national programme for implementation of screening in the highest AE risk areas (north-eastern Poland) with an effort to increase the public awareness of the possibility of contracting E. multilocularis, and above all, training of the primary care physicians in the recognition of the risk of AE to allow for an early detection of this dangerous disease. PMID:23301116

  19. The inferior alveolar artery in the mandibular canal

    International Nuclear Information System (INIS)

    Kato, Hisanao

    1991-01-01

    The present study investigated the course of the inferior alveolar artery (IAA) of the mandibular canal (MC), as well as morphological structure of the vascular wall, and the effects of Co-60 gamma irradiation on it. Male Sprague-Dawley strain 7-week-old rats were used as experimental animals. Histopathological changes in the vascular wall were observed by both light and electron microscopy. A single gamma irradiation of 17.82 Gy (TDF 100), 27.97 Gy (TDF 200), or 36.41 Gy (TDF 300) was given to the mandibular area. The IAA/MC ratio on the cross section was 3.4% at the mandibular foramen, 0.1% at the area between the second and third molar teeth, and 0.1% at the mental foramen. The corresponding diameters for these sites were 100 μm, 30 μm, and 20 μm. Morphological examination revealed IAA to be the muscular type of artery. Trichrome staining revealed three layers, including the lamina intima (1.4 μm), lamina media (13.3 μm), and lamina adventitia (11.2 μm). Dilatation of IAA occurred immediately after irradiation, followed by marked contraction on Day 3 after irradiation in the 17.82 Gy group, on Day 5 in the 27.97 Gy group, and on Day 7 in the 36.41 Gy group. During the period between Weeks 2 and 7, however, the 17.82 Gy group showed IAA dilatation. None of radiation injuries, such as rupture, necrosis and stenosis, was seen, but both vacuolation of the lamina intima and media, and irregular arrangement of the fibrous layer were seen. The vasculonervous bundle in MC seemed to be supported with fibrous connective tissues, suggesting an effective buffer effect on the dilatation of the vascular wall and the resistance to traumatic injuries. (N.K.)

  20. Computed tomography of the alveolar bone; Computertomographie des Alveolarkammes

    Energy Technology Data Exchange (ETDEWEB)

    Schueller, H. [Bonn Univ. (Germany). Radiologische Klinik

    1996-03-01

    In addition to the conventional radiological methods used in odontology, computed tomography (CT) provides superposition-free images of the mandible and maxilla. Its value has been proved not only in cases of malignancy but also in many other problems. If an examination is performed with a slice thickness of less than 1.5 mm, the form and position of retained teeth in the alveolar bone, as well as subsequent lesions of neighboring permanent teeth, can be visualized so that early treatment can be planned. If the parodontal space of a retained tooth is visible, orthodontic intervention is possible. Precise assessment of horizontal or vertical bone loss is essential in inflammatory dental diseases. The morphology and extent of benign cystic lesions are also shown by CT. With CT surgical strategy of an intended implant therapy can take into account the remaining bone substance and the exact position of nerves and foramina. If such therapy is possible, the location, form and number of implants are easily defined. (orig.) [Deutsch] Die Computertomographie ermoeglicht in Ergaenzung zu den in der Zahnheilkunde gebraeuchlichen radiologischen Untersuchungsverfahren eine ueberlagerungsfreie Darstellung von Ober- und Unterkiefer. Neben der bereits etablierten Anwendung der CT bei malignen Erkrankungen hat sich ihr Einsatz bei weiteren Fragestellungen bewaehrt. Wird die Untersuchung mit einer Schichtdicke von weniger als 1,5 mm durchgefuehrt, lassen sich Form und Lage retinierter Zaehne im Kieferknochen und die durch die retinierten Zaehne verursachten Schaeden an bleibenden Zaehnen beurteilen, so dass eine fruehzeitige Therapie moeglich ist. Laesst sich der Parodontalspalt des retinierten Zahnes abgrenzen, ist eine kieferorthopaedische Einordnung moeglich. Bei entzuendlichen Zahnerkrankungen ist der horizontale und vertikale Knochenabbau genau zu bestimmen. Die Morphologie und Ausdehnung von benignen zystischen Raumforderungen ist mit der CT erfassbar. Vor einer beabsichtigten

  1. Pathogenetics of alveolar capillary dysplasia with misalignment of pulmonary veins.

    Science.gov (United States)

    Szafranski, Przemyslaw; Gambin, Tomasz; Dharmadhikari, Avinash V; Akdemir, Kadir Caner; Jhangiani, Shalini N; Schuette, Jennifer; Godiwala, Nihal; Yatsenko, Svetlana A; Sebastian, Jessica; Madan-Khetarpal, Suneeta; Surti, Urvashi; Abellar, Rosanna G; Bateman, David A; Wilson, Ashley L; Markham, Melinda H; Slamon, Jill; Santos-Simarro, Fernando; Palomares, María; Nevado, Julián; Lapunzina, Pablo; Chung, Brian Hon-Yin; Wong, Wai-Lap; Chu, Yoyo Wing Yiu; Mok, Gary Tsz Kin; Kerem, Eitan; Reiter, Joel; Ambalavanan, Namasivayam; Anderson, Scott A; Kelly, David R; Shieh, Joseph; Rosenthal, Taryn C; Scheible, Kristin; Steiner, Laurie; Iqbal, M Anwar; McKinnon, Margaret L; Hamilton, Sara Jane; Schlade-Bartusiak, Kamilla; English, Dawn; Hendson, Glenda; Roeder, Elizabeth R; DeNapoli, Thomas S; Littlejohn, Rebecca Okashah; Wolff, Daynna J; Wagner, Carol L; Yeung, Alison; Francis, David; Fiorino, Elizabeth K; Edelman, Morris; Fox, Joyce; Hayes, Denise A; Janssens, Sandra; De Baere, Elfride; Menten, Björn; Loccufier, Anne; Vanwalleghem, Lieve; Moerman, Philippe; Sznajer, Yves; Lay, Amy S; Kussmann, Jennifer L; Chawla, Jasneek; Payton, Diane J; Phillips, Gael E; Brosens, Erwin; Tibboel, Dick; de Klein, Annelies; Maystadt, Isabelle; Fisher, Richard; Sebire, Neil; Male, Alison; Chopra, Maya; Pinner, Jason; Malcolm, Girvan; Peters, Gregory; Arbuckle, Susan; Lees, Melissa; Mead, Zoe; Quarrell, Oliver; Sayers, Richard; Owens, Martina; Shaw-Smith, Charles; Lioy, Janet; McKay, Eileen; de Leeuw, Nicole; Feenstra, Ilse; Spruijt, Liesbeth; Elmslie, Frances; Thiruchelvam, Timothy; Bacino, Carlos A; Langston, Claire; Lupski, James R; Sen, Partha; Popek, Edwina; Stankiewicz, Paweł

    2016-05-01

    Alveolar capillary dysplasia with misalignment of pulmonary veins (ACDMPV) is a lethal lung developmental disorder caused by heterozygous point mutations or genomic deletion copy-number variants (CNVs) of FOXF1 or its upstream enhancer involving fetal lung-expressed long noncoding RNA genes LINC01081 and LINC01082. Using custom-designed array comparative genomic hybridization, Sanger sequencing, whole exome sequencing (WES), and bioinformatic analyses, we studied 22 new unrelated families (20 postnatal and two prenatal) with clinically diagnosed ACDMPV. We describe novel deletion CNVs at the FOXF1 locus in 13 unrelated ACDMPV patients. Together with the previously reported cases, all 31 genomic deletions in 16q24.1, pathogenic for ACDMPV, for which parental origin was determined, arose de novo with 30 of them occurring on the maternally inherited chromosome 16, strongly implicating genomic imprinting of the FOXF1 locus in human lungs. Surprisingly, we have also identified four ACDMPV families with the pathogenic variants in the FOXF1 locus that arose on paternal chromosome 16. Interestingly, a combination of the severe cardiac defects, including hypoplastic left heart, and single umbilical artery were observed only in children with deletion CNVs involving FOXF1 and its upstream enhancer. Our data demonstrate that genomic imprinting at 16q24.1 plays an important role in variable ACDMPV manifestation likely through long-range regulation of FOXF1 expression, and may be also responsible for key phenotypic features of maternal uniparental disomy 16. Moreover, in one family, WES revealed a de novo missense variant in ESRP1, potentially implicating FGF signaling in the etiology of ACDMPV.

  2. Effect of single and contiguous teeth extractions on alveolar bone remodeling: a study in dogs.

    Science.gov (United States)

    Al-Askar, Mansour; O'Neill, Rory; Stark, Paul C; Griffin, Terrence; Javed, Fawad; Al-Hezaimi, Khalid

    2013-08-01

    Tooth extraction is associated with dimensional changes in the alveolar ridge. The aim was to examine the effect of single versus contiguous teeth extractions on the alveolar ridge remodeling. Five female beagle dogs were randomly divided into three groups on the basis of location (anterior or posterior) and number of teeth extracted - exctraction socket classification: group 1 (one dog): single-tooth extraction; group 2 (two dogs): extraction of two teeth; and group 3 (two dogs): extraction of three teeth in four anterior sites and four posterior sites in both jaws. The dogs were sacrificed after 4 months. Sagittal sectioning of each extraction site was performed and evaluated using microcomputed tomography. Buccolingual or palatal bone loss was observed 4 months after extraction in all three groups. The mean of the alveolar ridge width loss in group 1 (single-tooth extraction) was significantly less than those in groups 2 and 3 (p < .001) (multiple teeth extraction). Three-teeth extraction (group 3) had significantly more alveolar bone loss than two-teeth extraction (group 2) (p < .001). The three-teeth extraction group in the upper and lower showed more obvious resorption on the palatal/lingual side especially in the lower group posterior locations. Contiguous teeth extraction caused significantly more alveolar ridge bone loss as compared with when a single tooth is extracted. © 2011 Wiley Periodicals, Inc.

  3. In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Dao-Cai [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Department of Stomatology, The 291st Hospital of P.L.A, Baotou (China); Li, De-Hua [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Ji, Hui-Cang [Military Sanatorium of Retired Cadres, Baotou (China); Rao, Guo-Zhou [Center of Laboratory, School of Stomatology, Xi' an Jiaotong University, Xi' an (China); Liang, Li-Hua [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China); Ma, Ai-Jie [Xi' an Technology University, Xi' an (China); Xie, Chao; Zou, Gui-Ke; Song, Ying-Liang [Department of Implant Dentistry, School of Stomatology, Fourth Military Medical University, Xi' an (China)

    2012-04-05

    In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones.

  4. [Establishment and experimental study of alveolar preservation before dental implantation in Beagle dogs].

    Science.gov (United States)

    Han, Xue-song; Li, Xiu-juan; Huang, Yuan-liang; Zhu, Guo-guang; You, Su-lan; Tan, Luan-jun

    2013-02-01

    To establish the model of alveolar ridge preservation after tooth extraction for dental implant replacement, and to observe the effect of tissue engineered bone on osseointegration. Isolated BMSCs were expanded and osteogenically induced in vitro. The tissue engineering complex was constructed with BMSCs/A-PCPC in vitro. Six extraction sockets, with three on each side, were created in the mandibles of four Beagle dogs by extracting the second, third and fourth premolars. BMSCs/A-PCPC were placed on one side of the extraction sockets, while autogenous bone, A-PCPC and nothing were placed on the other side as control. X-ray and CT scans were conducted 1day, 4 and 12 weeks after operation to detect the change of the alveolar ridge. The bone of sockets were harvested at 8-week post-implantation and subject to histological for evaluating. SPSS17.0 software package was used for data analysis. Radiographs demonstrated higher radiodensity in group of complex than in simple materials group, autogenous bone group after 4 weeks. Hard tissue biopsy at 12-week showed that bone activity of BMSCs/A-PCPC complex was better than the other groups. Spiral CT analysis showed that alveolar ridge of each group experienced a certain degree of absorption. At 12-week, the alveolar ridge height reduction values in A-PCPC group was smaller than in A-PCPC group, autogenous bone group and blank group (Ppreservation of alveolar ridge.

  5. Preclinical Testing of Erlotinib in a Transgenic Alveolar Rhabdomyosarcoma Mouse Model

    Directory of Open Access Journals (Sweden)

    Jinu Abraham

    2011-01-01

    Full Text Available Rhabdomyosarcoma is an aggressive childhood malignancy, accounting for more than 50% of all soft-tissue sarcomas in children. Even with extensive therapy, the survival rate among alveolar rhabdomyosarcoma patients with advanced disease is only 20%. The receptor tyrosine kinase Epidermal Growth Factor Receptor (EGFR has been found to be expressed and activated in human rhabdomyosarcomas. In this study we have used a genetically engineered mouse model for alveolar rhabdomyosarcoma (ARMS which faithfully recapitulates the human disease by activating the pathognomic Pax3:Fkhr fusion gene and inactivating p53 in the maturing myoblasts. We have demonstrated that tumors from our mouse model of alveolar rhabdomyosarcoma express EGFR at both the mRNA and protein levels. We then tested the EGFR inhibitor, Erlotinib, for its efficacy in this mouse model of alveolar rhabdomyosarcoma. Surprisingly, Erlotinib had no effect on tumor progression, yet mice treated with Erlotinib showed 10–20% loss of body weight. These results suggest that EGFR might not be an a priori monotherapy target in alveolar rhabdomyosarcoma.

  6. Depletion of alveolar macrophages in CD11c diphtheria toxin receptor mice produces an inflammatory response

    Science.gov (United States)

    Roberts, Lydia M; Ledvina, Hannah E; Tuladhar, Shraddha; Rana, Deepa; Steele, Shaun P; Sempowski, Gregory D; Frelinger, Jeffrey A

    2015-01-01

    Alveolar macrophages play a critical role in initiating the immune response to inhaled pathogens and have been shown to be the first cell type infected following intranasal inoculation with several pathogens, including Francisella tularensis. In an attempt to further dissect the role of alveolar macrophages in the immune response to Francisella, we selectively depleted alveolar macrophages using CD11c.DOG mice. CD11c.DOG mice express the diphtheria toxin receptor (DTR) under control of the full CD11c promoter. Because mice do not express DTR, tissue restricted expression of the primate DTR followed by treatment with diphtheria toxin (DT) has been widely used as a tool in immunology to examine the effect of acute depletion of a specific immune subset following normal development. We successfully depleted alveolar macrophages via intranasal administration of DT. However, alveolar macrophage depletion was accompanied by many other changes to the cellular composition and cytokine/chemokine milieu in the lung that potentially impact innate and adaptive immune responses. Importantly, we observed a transient influx of neutrophils in the lung and spleen. Our experience serves as a cautionary note to other researchers using DTR mice given the complex changes that occur following DT treatment that must be taken into account when analyzing data. PMID:26029367

  7. Barrier-protective effects of activated protein C in human alveolar epithelial cells.

    Directory of Open Access Journals (Sweden)

    Ferranda Puig

    Full Text Available Acute lung injury (ALI is a clinical manifestation of respiratory failure, caused by lung inflammation and the disruption of the alveolar-capillary barrier. Preservation of the physical integrity of the alveolar epithelial monolayer is of critical importance to prevent alveolar edema. Barrier integrity depends largely on the balance between physical forces on cell-cell and cell-matrix contacts, and this balance might be affected by alterations in the coagulation cascade in patients with ALI. We aimed to study the effects of activated protein C (APC on mechanical tension and barrier integrity in human alveolar epithelial cells (A549 exposed to thrombin. Cells were pretreated for 3 h with APC (50 µg/ml or vehicle (control. Subsequently, thrombin (50 nM or medium was added to the cell culture. APC significantly reduced thrombin-induced cell monolayer permeability, cell stiffening, and cell contraction, measured by electrical impedance, optical magnetic twisting cytometry, and traction microscopy, respectively, suggesting a barrier-protective response. The dynamics of the barrier integrity was also assessed by western blotting and immunofluorescence analysis of the tight junction ZO-1. Thrombin resulted in more elongated ZO-1 aggregates at cell-cell interface areas and induced an increase in ZO-1 membrane protein content. APC attenuated the length of these ZO-1 aggregates and reduced the ZO-1 membrane protein levels induced by thrombin. In conclusion, pretreatment with APC reduced the disruption of barrier integrity induced by thrombin, thus contributing to alveolar epithelial barrier protection.

  8. In vitro culture and characterization of alveolar bone osteoblasts isolated from type 2 diabetics

    International Nuclear Information System (INIS)

    Sun, Dao-Cai; Li, De-Hua; Ji, Hui-Cang; Rao, Guo-Zhou; Liang, Li-Hua; Ma, Ai-Jie; Xie, Chao; Zou, Gui-Ke; Song, Ying-Liang

    2012-01-01

    In order to understand the mechanisms of poor osseointegration following dental implants in type 2 diabetics, it is important to study the biological properties of alveolar bone osteoblasts isolated from these patients. We collected alveolar bone chips under aseptic conditions and cultured them in vitro using the tissue explants adherent method. The biological properties of these cells were characterized using the following methods: alkaline phosphatase (ALP) chemical staining for cell viability, Alizarin red staining for osteogenic characteristics, MTT test for cell proliferation, enzyme dynamics for ALP contents, radio-immunoassay for bone gla protein (BGP) concentration, and ELISA for the concentration of type I collagen (COL-I) in the supernatant. Furthermore, we detected the adhesion ability of two types of cells from titanium slices using non-specific immunofluorescence staining and cell count. The two cell forms showed no significant difference in morphology under the same culture conditions. However, the alveolar bone osteoblasts received from type 2 diabetic patients had slower growth, lower cell activity and calcium nodule formation than the normal ones. The concentration of ALP, BGP and COL-I was lower in the supernatant of alveolar bone osteoblasts received from type 2 diabetic patients than in that received from normal subjects (P < 0.05). The alveolar bone osteoblasts obtained from type 2 diabetic patients can be successfully cultured in vitro with the same morphology and biological characteristics as those from normal patients, but with slower growth and lower concentration of specific secretion and lower combining ability with titanium than normal ones

  9. Minimum alveolar concentration of isoflurane in green iguanas and the effect of butorphanol on minimum alveolar concentration.

    Science.gov (United States)

    Mosley, Craig A E; Dyson, Doris; Smith, Dale A

    2003-06-01

    To determine minimum alveolar concentration (MAC) of isoflurane in green iguanas and effects of butorphanol on MAC. Prospective randomized trial. 10 healthy mature iguanas. in each iguana, MAC was measured 3 times: twice after induction of anesthesia with isoflurane and once after induction of anesthesia with isoflurane and IM administration of butorphanol (1 mg/kg [0.45 mg/lb]). A blood sample was collected from the tail vein for blood-gas analysis at the beginning and end of the anesthetic period. The MAC was determined with a standard bracketing technique; an electrical current was used as the supramaximal stimulus. Animals were artificially ventilated with a ventilator set to deliver a tidal volume of 30 mL/kg (14 mL/lb) at a rate of 4 breaths/min. Mean +/- SD MAC values during the 3 trials (2 without and 1 with butorphanol) were 2.0 +/- 0.6, 2.1 +/- 0.6, and 1.7 +/- 0.7%, respectively, which were not significantly different from each other. Heart rate and end-tidal partial pressure of CO2 were also not significantly different among the 3 trials. Mean +/- SD heart rate was 48 +/- 10 beats/min; mean end-tidal partial pressure of CO2 was 22 +/- 10 mm Hg. There were no significant differences in blood-gas values for samples obtained at the beginning versus the end of the anesthetic period. Results suggest that the MAC of isoflurane in green iguanas is 2.1% and that butorphanol does not have any significant isoflurane-sparing effects.

  10. Effect of biphasic calcium phosphate nanocomposite on healing of surgically created alveolar bone defects in beagle dogs

    Science.gov (United States)

    Wang, Lanlei; Guan, Aizhong; Shi, Han; Chen, Yangxi; Liao, Yunmao

    2009-09-01

    The aim of the present study was to investigate the effect of porous biphasic calcium phosphate nanocomposite (nanoBCP) scaffolds bioceramic. Alveolar bone defects were surgically created bilaterally at the buccal aspects of the upper second premolar in fourteen beagle dogs. After root conditioning with ethylenediaminetetraacetate (EDTA), nanoBCP was randomly filled in the defects and nothing was put into the contralaterals as controls. Dogs were killed at the 12th weeks. Histological observations were processed through a light microscopy. The results revealed that a great amount of functional periodontal fissures formed in the defects in the nanoBCP groups while minimal bone took shape in the controls. In this study, nanoBCP has proved to work well as a biocompatible and osteoconductive scaffold material to promote periodontal regeneration effectively.

  11. Various autogenous fresh demineralized tooth forms for alveolar socket preservation in anterior tooth extraction sites: a series of 4 cases.

    Science.gov (United States)

    Kim, Eun-Suk; Lee, In-Kyung; Kang, Ji-Yeon; Lee, Eun-Young

    2015-12-01

    The aim of this study was to evaluate the clinical relevance of autogenous fresh demineralized tooth (Auto-FDT) prepared at chairside immediately after extraction for socket preservation. Teeth were processed to graft materials in block, chip, or powder types immediately after extraction. Extraction sockets were filled with these materials and dental implants were installed immediately or after a delay. A panoramic radiograph and a conebeam CT were taken. In two cases, tissue samples were taken for histologic examination. Vertical and horizontal maintenance of alveolar sockets showed some variance depending on the Auto-FDT and barrier membrane types used. Radiographs showed good bony healing. Histologic sections showed that it guided good new bone formation and resorption pattern of the Auto-FDT. This case series shows that Auto-FDT prepared at chairside could be a good material for the preservation of extraction sockets. This study will suggest the possibility of recycling autogenous tooth after immediate extraction.

  12. Is length an appropriate estimator to characterize pulmonary alveolar capillaries? A critical evaluation in the human lung

    DEFF Research Database (Denmark)

    Mühlfeld, Christian; Weibel, Ewald R.; Hahn, Ute

    2010-01-01

    Stereological estimations of total capillary length have been used to characterize changes in the alveolar capillary network (ACN) during developmental processes or pathophysiological conditions. Here, we analyzed whether length estimations are appropriate to describe the 3D nature of the ACN. Semi...... resulted in a mean of 2,746 km (SD: 722 km). Because of the geometry of the ACN both approaches carry an unpredictable bias. The bias incurred by the design-based approach is proportional to the ratio between radius and length of the capillary segments in the ACN, the number of branching points...... and the winding of the capillaries. The model-based approach is biased because of the real noncylindrical shape of capillaries and the network structure. In conclusion, the estimation of the total length of capillaries in the ACN cannot be recommended as the geometry of the ACN does not fulfill the requirements...

  13. High resolution computed tomographic features of pulmonary alveolar microlithiasis

    International Nuclear Information System (INIS)

    Deniz, Omer; Ors, Fatih; Tozkoparan, Ergun; Ozcan, Ayhan; Gumus, Seyfettin; Bozlar, Ugur; Bilgic, Hayati; Ekiz, Kudret; Demirci, Necmettin

    2005-01-01

    Background: Pulmonary alveolar microlithiasis (PAM) is a rare, chronic lung disease with unknown etiology and with a nonuniform clinical course. Nonuniformity of clinical course might be related to the degree of pulmonary parenchymal alterations, which can be revealed with high resolution computed tomography (HRCT). However, HRCT findings of PAM were not fully described in the current literature. Aim: The aim of this study was to interpret and to contribute to describe HRCT findings of PAM and to investigate a correlation between profusion of micro nodules (MN) and pulmonary parenchymal alterations in patients with PAM. Material and methods: Ten male patients with PAM (mean age: 22 ± 3.2) were included into the study. HRCT images were assessed for patterns, distribution, and profusion of pulmonary abnormalities. Dividing the lungs into three zones, profusion of abnormalities was assessed. A profusion score (1-4) was given and the scores of each zone were then summed to obtain a global profusion score for HRCT ranging from 0 to 12. Also a parenchymal alteration score (PAS) was defined with respect to profusion of abnormalities. Chest X-rays were also scored. Results: All of ten patients with PAM had findings of interstitial lung disease in varying degrees on their HRCTs. HRCT findings of patients with PAM were as following: MN, parenchymal bands (PB), ground glass opacity (GGO) and, sub pleural interstitial thickening (SPIT) in 10 patients; interlobular septal thickening (ILST), in 9 patients; paraseptal emphysema (PSA) in 8 patients; centrilobular emphysema (CLA) in 7 patients; bronchiectasis (BE), confluent micro nodules (CMN) in 6 patients; peri bronchovascular interstitial thickening (PBIT) in 5 patients; panacinar emphysema (PANAA) in 3 patients; pleural calcification (PC) in 2 patients. A significant correlation between MN scores and PAS (r = 0.68, p = 0.031, MN scores and GGO scores (r = 0.69, p = 0.027) and, MN scores and CLA scores (r = 0.67, p = 0

  14. Long-term experience on surgical treatment of alveolar echinococcosis.

    Science.gov (United States)

    Buttenschoen, Klaus; Carli Buttenschoen, Daniela; Gruener, Beate; Kern, Peter; Beger, Hans G; Henne-Bruns, Doris; Reuter, Stefan

    2009-07-01

    Alveolar echinococcosis (AE) is life-threatening and reports on surgical procedures and results are rare, but essential. Longitudinal surveillance and long-term follow-up of patients surgically treated for AE during the periods 1982-1999 (group A) and 2000-2006 (group B). University hospital within an endemic area. The median (min-max) follow-up period was 141 (5-417) months. Forty-eight surgical procedures were performed in 36 patients with AE: 63% were partial resections of the liver (additional extrahepatic resection in ten of them), 17% just extrahepatic resections, 10% biliodigestive anastomosis, and 10% exploratory laparotomies. Seventy-five percent of the operations were first-time procedures, 25% done due to a relapse. Forty-two percent of the operations were estimated to be curative (R0), whereas 58% were palliative (R1, R2). All patients had additional medical treatment and periodical follow-up. Two out of 18 (11%) patients, estimated to have had curative surgery, developed a relapse 42 and 54 months later. R0-resection rates depended on the primary, neighboring, metastasis stage of AE (S1, 100%; S2, 100%; S3a, 33%; S3b, 27%; S4, 11%). During the period 2000-2006 elective radical surgery for AE was done only if a safe distance of at least 2 cm was attainable. This concept was associated with an increased R0-resection rate of 87% for group B compared to 24% for group A. Operative procedures done to control complicated courses of AE (jaundice, cholangitis, vascular compression, bacterial superinfection) have not been curative (R2) in 82% because the disease had spread into irresectable structures. Morbidity was 19%. All patients with curative resections are alive. Fifty-six percent of the patients with palliative treatment are alive as long as 14-237 months, 28% died from AE 164-338 months after diagnosis (late lethality), and 17% died due to others diseases 96-417 months after diagnosis of AE. One out of seven (14%) patients suffering from suppurative

  15. Human Cytomegalovirus is Present in Alveolar Soft Part Sarcoma.

    Science.gov (United States)

    Price, Richard L; Harkins, Lualhati; Chiocca, Ennio A; Zhang, Paul J; Kurt, Habibe; Iwenofu, Obiajulu H

    2017-10-01

    Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that

  16. 1H MR spectroscopy characteristics of cerebral alveolar echinococcosis

    International Nuclear Information System (INIS)

    Wang Jian; Yibanu Abudureheman; Jiang Chunhui; Yao Weihong; Tian Xiongling; Zhang Deqing; Liu Chen; Liu Wenya; Wen Hao

    2014-01-01

    Objective: To investigate the characteristics of proton magnetic resonance spectroscopy ( 1 H MRS) in patients with cerebral alveolar echinococcosis (CAE). Methods: Thirteen patients with 33 lesions proven to be CAE histologically and clinically were examined by conventional MRI and 2D multi-voxel spectroscopy with a 3.0 T double gradient superconductivity magnetic resonance scanner. Concentrations of the metabolites containing N-acetyl-aspartic-acid (NAA), Choline (Cho), Creatine (Cr), lipids and lactic acid (Lip + Lac), myo-Inositol (mI) were detected and the value of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr, mI/Cr were calculated. The values of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr, mI/Cr were compared between the lesions and the contralateral normal brain parenchyma. Statistical analysis was performed using the Wilcoxon signed-rank test. Results: CAE 1 H MRS in the lesions was characterized by the decrease of Cho, NAA to varying degrees, and a visible lipid with or without lactate peak. Compared with the control group, the ratio of NAA/Cr was decreased markedly, whereas Cho/Cr, mI/Cr increased mildly and (Lip + Lac)/Cr increased markedly in the lesions. The medians and interquartile ranges of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr and mI/Cr in the lesions were: 1.88 (1.24-2.23), 1.32 (1.07-1.58), 32.96 (24.59-47.30) and 0.91 (0.67-1.08), respectively. The medians and interquartile ranges of Cho/Cr, NAA/Cr, (Lip + Lac)/Cr and mI/Cr of control group were 0.84 (0.704-0.98), 2.00 (1.80-2.18), 0.90 (0.74-0.99) and 0.26 (0.18-0.31), respectively. There were statistically significant differences of the measures between the lesions and the control regions (Z=-5.932, -6.086, -6.946, -6.984, P<0.01). Conclusions: Multi-voxel 1 H MRS can reflect pathological characteristics of CAE. 1 H MRS provides metabolic information for diagnosis of CAE and may be a supplement to conventional magnetic resonance examination. (authors)

  17. Lung Metastasis of Primary Alveolar Soft-Part Sarcoma Occurring 20 Years after Initial Treatment

    Directory of Open Access Journals (Sweden)

    R. F. Falkenstern-Ge

    2013-01-01

    Full Text Available A 30-year old woman was referred to our center because of suspicion of a primary lung tumor of the right upper lobe. Histological examination of the lung lesion revealed lung metastasis of a previously treated alveolar soft part sarcoma of the musculus vastus medialis of the right femur, which was resected 20 years ago. Alveolar soft-part sarcoma is a rare malignant tumor that occurs most often in the soft tissue of lower limbs. It is a slow-growing malignant soft tissue tumor arising in muscle tissue, usually in young adults. Due to pleural and extensive mediastinal infiltration with bilateral lung metastases, a systemic treatment with chemotherapy doxorubicin and ifosfamide was initiated. Late metastases from previously treated alveolar part sarcoma should be considered in patients with suspicious lung lesions even if surgical treatment was performed a long time ago.

  18. An Experimental Study of Radiographic Density of Alveolar Bone and Cortical Thickness of Mandible by Osteoporosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Byeong Do [Dept. of Oral and Maxillofacial Radiology, School of Dentistry, Wonkwang University, Iksan (Korea, Republic of)

    2000-12-15

    To evaluate the effect of the systemic osteoporosis on radiographic density of alveolar bone and cortical thickness of mandible. The bone mineral density values of lumbar and femur were measured by dual-energy X-ray absorptiometry and T scores of lumbar, femur were obtained respectively. Radiographic densities of alveolar bones and panorama mandibular index (PMI, represents as cortical thickness) were analysed statistically according to age and T score variavles. The radiographic density of alveolar bone of maxillary molar showed significant difference by age and femur T group. That of mandibular molar showed significant difference between femur T group. Panorama mandibular index showed significant difference between age groups. The radiographic density of alvealar bones was more dependent on age femur T than lumbar T. Cortical thickness of mandible was correlated with increasing age.

  19. Placement of fin type dental implant in three different surgical situations of alveolar bone

    Directory of Open Access Journals (Sweden)

    Coen Pramono D

    2007-03-01

    Full Text Available Three different dental implant placements according to surgical implant bed situations were observed in its bone integration 3 months after dental implant insertion. This observation was done on implant system which has plateau or fin system. Elf implants were placed in the upper jaw in two patients. In case one, two implants were inserted immediately after tooth extraction, and the other six implants were placed in the alveolar crest regions in delayed implantation or in which the teeth had been extracted over 6 months of period. In case two, three implants were inserted in the post trauma region in the anterior maxilla, which the labial plate had been lost and reconstructed with bone grafting procedure using a mixture of alloplastic and autogenous bones. The alveolar reconstruction was needed to be performed due to only thin alveolar crest width was left intact. All of those implants observed showed in good integration.

  20. Legionella pneumonia associated with severe acute respiratory distress syndrome and diffuse alveolar hemorrhage - A rare association

    Directory of Open Access Journals (Sweden)

    Muhammad Kashif

    2017-01-01

    Full Text Available Legionella pneumophila is a common, usually underreported and undiagnosed cause of community acquired pneumonia which can lead to significant morbidity and mortality. Diffuse alveolar hemorrhage rarely have been associated with legionella infection. We present a 61-year-old man with hypertension, diabetes mellitus and obesity admitted with severe acute respiratory distress syndrome. He was found to have Legionella pneumonia with associated diffuse alveolar hemorrhage diagnosed with bronchoscopic sequential bronchoalveolar lavage. He was successfully managed with antibiotics, lung protective strategies and intravenous pulse dose steroids. This patient highlights the unusual association of Legionella infection and diffuse alveolar hemorrhage. Additionally, the case re-enforces the need for early and aggressive evaluation and management of patients presenting with pneumonia and progressive hypoxia despite adequate treatment.

  1. Pulmonary Alveolar Proteinosis and tuberculosis in a diabetic patient: a rare or a seldom diagnosed association

    Directory of Open Access Journals (Sweden)

    Pereira-Silva J.L.

    2002-01-01

    Full Text Available A case of Pulmonary Alveolar Proteinosis (PAP, in association with tuberculosis, is described in a 35-year-old diabetic patient. Lung biopsy showed an intra-alveolar accumulation of PAS-positive material, and multifocal granulomas compatible with tuberculosis. The bronchoalveolar culture was positive for Mycobacterium tuberculosis. PAP results from an imbalance of the mechanisms that regulate the homeostasis of the surfactant, where specific proteins are involved, especially SP-A and SP-D, the cytokines, IL-10 and GM-CSF, in addition to alveolar macrophages and type-II pneumocytes. Chemotaxis and phagocytic capacity are reduced. PAP and diabetes share several immunological disfunctions that may increase the risk for tuberculosis. Although there are no controlled studies, the diagnosis of PAP in diabetic patients with tuberculosis must be considered.

  2. Alveolar cleft bone grafts: results and imprecisions of the dental radiograph.

    Science.gov (United States)

    Lee, C; Crepeau, R J; Williams, H B; Schwartz, S

    1995-12-01

    Alveolar cleft bone grafts customarily have been evaluated by one-dimensional dental radiographic measurements. Based on the dental radiograph, remarkable successes with just a single bone graft have been reported in the literature. At the Montreal Children's Hospital, the experience with 101 alveolar bone grafts in 62 cleft lip and palate patients was retrospectively reviewed to determine (1) the precision of dental radiographs at evaluating the clinical outcome, (2) the effect of dental maturation on alveolar bone grafts, and (3) the effect of augmentation bone grafts. The dental radiograph significantly overestimated the number of clefts that could be managed orthodontically (p orthodontic closure of the dental gap. Bone grafts performed during the preeruptive canine dentition yielded significantly better results (p < 0.05, chi-squared test). With each subsequent augmentation bone-graft procedure performed, there existed a trend toward improved dental arch stability and radiographic and clinical outcomes.

  3. New regenerative treatment for tooth and periodontal bone defect associated with posttraumatic alveolar bone crush fracture.

    Science.gov (United States)

    Kiyokawa, Kensuke; Kiyokawa, Munekatsu; Takagi, Mikako; Rikimaru, Hideaki; Fukaya, Takuji

    2009-05-01

    We developed a new regenerative treatment of tooth and periodontal defect and tooth dislocation associated with posttraumatic alveolar bone crush fracture in the region of the maxillary anterior teeth. Using this method, dislocated teeth are first extracted and crushed alveolar bone is debrided. The dislocated teeth are then reimplanted, and cancellous iliac bone (bone marrow) is grafted to the area surrounding the teeth to regenerate periodontal bone. Tooth reimplantation was completely successful in 2 cases, and periodontal bone regenerated to a sufficient height with the iliac bone graft. Compared with the general method of treatment with a prosthesis (bridge), when using this method to treat cases such as these, there is no sacrifice of healthy teeth adjacent to the defect, and sufficient esthetic and functional recovery is possible. It is thought that this method could be applied as a new treatment of alveolar bone fracture in the future.

  4. Protective effect of ellagic acid on healing alveolar bone after tooth extraction in rat--a histological and immunohistochemical study.

    Science.gov (United States)

    Al-Obaidi, Mazen M Jamil; Al-Bayaty, Fouad Hussain; Al Batran, Rami; Hassandarvish, Pouya; Rouhollahi, Elham

    2014-09-01

    This study has attempted to evaluate the effects of ellagic acid (EA) on alveolar bone healing after tooth extraction in rats. Twenty-four Sprague Dawley (SD) male rats (200-250g) were selected and were anaesthetised for the extraction of upper left incisor. Then, the rats were divided into two groups, comprising 12 rats each; the first group has been considered as a control group and was given only normal saline, whereas, the second group (treated group) was intragastrically administrated with EA daily once, for 28 days. Then three rats from each group had been selected on 7th, 14th, 21st, and 28th days to dissect their maxilla tissue either for histological observation and homogenisation purposes. The tissues fixed, decalcified and embedded in paraffin. Serial sections of 5μm thickness were prepared and stained with haematoxylin and eosin (H&E) for the histological study. Similar sections were taken for immunohistochemical analysis to assess osteocalcin (OSC) and osteopontin (OPN). Furthermore, Malondialdehyde (MDA) and superoxide dismutase (SOD) were measured in homogenated gingival maxilla tissue of rat by commercial kit. Based on the histological analysis we have identified that, EA treatment has induced earlier trabecular bone deposition in the treated group, resulting in more organised bone matrix on the 14th, 21st, and 28th days after tooth extraction, as against the control group. In comparison to control group, the positive labelling of OSC and OPN of the treated group have been highly expressed in the alveolar socket on 14th, and 21st days, which has indicated a the possibility of formation of new bone trabeculae at the beginning of the mineralisation process, after tooth extraction. In the EA treatment group, lipid per-oxidation (MDA) was significantly decreased (Phealing process in teeth socket of rats. Furthermore, the EA treated group showed a stronger positive immunolabelling for OSC and OPN, when compared with the control group. Copyright © 2014

  5. Edema toxin impairs anthracidal phospholipase A2 expression by alveolar macrophages.

    Directory of Open Access Journals (Sweden)

    Benoit Raymond

    2007-12-01

    Full Text Available Bacillus anthracis, the etiological agent of anthrax, is a spore-forming gram-positive bacterium. Infection with this pathogen results in multisystem dysfunction and death. The pathogenicity of B. anthracis is due to the production of virulence factors, including edema toxin (ET. Recently, we established the protective role of type-IIA secreted phospholipase A2 (sPLA2-IIA against B. anthracis. A component of innate immunity produced by alveolar macrophages (AMs, sPLA2-IIA is found in human and animal bronchoalveolar lavages at sufficient levels to kill B. anthracis. However, pulmonary anthrax is almost always fatal, suggesting the potential impairment of sPLA2-IIA synthesis and/or action by B. anthracis factors. We investigated the effect of purified ET and ET-deficient B. anthracis strains on sPLA2-IIA expression in primary guinea pig AMs. We report that ET inhibits sPLA2-IIA expression in AMs at the transcriptional level via a cAMP/protein kinase A-dependent process. Moreover, we show that live B. anthracis strains expressing functional ET inhibit sPLA2-IIA expression, whereas ET-deficient strains induced this expression. This stimulatory effect, mediated partly by the cell wall peptidoglycan, can be counterbalanced by ET. We conclude that B. anthracis down-regulates sPLA2-IIA expression in AMs through a process involving ET. Our study, therefore, describes a new molecular mechanism implemented by B. anthracis to escape innate host defense. These pioneering data will provide new molecular targets for future intervention against this deadly pathogen.

  6. Risk factors for permanent injury of inferior alveolar and lingual nerves during third molar surgery.

    Science.gov (United States)

    Nguyen, Edward; Grubor, Dragan; Chandu, Arun

    2014-12-01

    The purpose of this study was to assess the incidence of and risk factors for permanent neurologic injuries to the inferior alveolar nerve (IAN) or lingual nerve (LN) after the removal of third molars. This report also describes the use of a Clinical Incident Review (CIR) process, allowing close monitoring of all patients with neurologic injuries as a result of dentoalveolar surgery. A database associated with a CIR process at the Royal Dental Hospital of Melbourne from January 2006 through December 2009 was assessed. Factors assessed included gender, age, operator class, method of anesthesia, spacial relation, depth of impaction, ramus relation, proximity of the IAN on orthopantomogram, cone-beam computed tomographic usage, and side of injury. During this 4-year period, 11,599 lower third molars were removed in 6,803 patients. The incidence of an IAN injury was 0.68%, and the incidence of an LN injury was 0.15%. Important risk factors for permanent IAN injury were increasing age, surgery performed by staff dentists, type of anesthesia, and mesioangular impactions. The mean time of complete resolution was 4.3 months. No factors were found to statistically increase the risk of LN injury, although most injuries were seen in patients with a distoangular impaction. The overall incidences of IAN and LN injuries were low. Some risk factors for permanent IAN nerve injury were identified. Important risk factors for permanent IAN injury were increasing age (≥25 yr old), surgery performed by staff dentists, surgery under general anesthesia, and mesioangular impaction. No factors were found to statistically increase the risk of LN injury. Copyright © 2014 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  7. PPAR{gamma} regulates the expression of cholesterol metabolism genes in alveolar macrophages

    Energy Technology Data Exchange (ETDEWEB)

    Baker, Anna D.; Malur, Anagha; Barna, Barbara P.; Kavuru, Mani S. [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Malur, Achut G. [Department of Microbiology and Immunology, East Carolina University (United States); Thomassen, Mary Jane, E-mail: thomassenm@ecu.edu [Department of Internal Medicine, Division of Pulmonary, Critical Care, and Sleep Medicine, East Carolina University (United States); Department of Microbiology and Immunology, East Carolina University (United States)

    2010-03-19

    Peroxisome proliferator-activated receptor-gamma (PPAR{gamma}) is a nuclear transcription factor involved in lipid metabolism that is constitutively expressed in the alveolar macrophages of healthy individuals. PPAR{gamma} has recently been implicated in the catabolism of surfactant by alveolar macrophages, specifically the cholesterol component of surfactant while the mechanism remains unclear. Studies from other tissue macrophages have shown that PPAR{gamma} regulates cholesterol influx, efflux, and metabolism. PPAR{gamma} promotes cholesterol efflux through the liver X receptor-alpha (LXR{alpha}) and ATP-binding cassette G1 (ABCG1). We have recently shown that macrophage-specific PPAR{gamma} knockout (PPAR{gamma} KO) mice accumulate cholesterol-laden alveolar macrophages that exhibit decreased expression of LXR{alpha} and ABCG1 and reduced cholesterol efflux. We hypothesized that in addition to the dysregulation of these cholesterol efflux genes, the expression of genes involved in cholesterol synthesis and influx was also dysregulated and that replacement of PPAR{gamma} would restore regulation of these genes. To investigate this hypothesis, we have utilized a Lentivirus expression system (Lenti-PPAR{gamma}) to restore PPAR{gamma} expression in the alveolar macrophages of PPAR{gamma} KO mice. Our results show that the alveolar macrophages of PPAR{gamma} KO mice have decreased expression of key cholesterol synthesis genes and increased expression of cholesterol receptors CD36 and scavenger receptor A-I (SRA-I). The replacement of PPAR{gamma} (1) induced transcription of LXR{alpha} and ABCG1; (2) corrected suppressed expression of cholesterol synthesis genes; and (3) enhanced the expression of scavenger receptors CD36. These results suggest that PPAR{gamma} regulates cholesterol metabolism in alveolar macrophages.

  8. Connexin 43 contributes to ectopic orofacial pain following inferior alveolar nerve injury.

    Science.gov (United States)

    Kaji, Kaori; Shinoda, Masamichi; Honda, Kuniya; Unno, Syumpei; Shimizu, Noriyoshi; Iwata, Koichi

    2016-01-01

    Clinically, it is well known that injury of mandibular nerve fiber induces persistent ectopic pain which can spread to a wide area of the orofacial region innervated by the uninjured trigeminal nerve branches. However, the exact mechanism of such persistent ectopic orofacial pain is not still known. The present study was undertaken to determine the role of connexin 43 in the trigeminal ganglion on mechanical hypersensitivity in rat whisker pad skin induced by inferior alveolar nerve injury. Here, we examined changes in orofacial mechanical sensitivity following inferior alveolar nerve injury. Furthermore, changes in connexin 43 expression in the trigeminal ganglion and its localization in the trigeminal ganglion were also examined. In addition, we investigated the functional significance of connexin 43 in relation to mechanical allodynia by using a selective gap junction blocker (Gap27). Long-lasting mechanical allodynia in the whisker pad skin and the upper eyelid skin, and activation of satellite glial cells in the trigeminal ganglion, were induced after inferior alveolar nerve injury. Connexin 43 was expressed in the activated satellite glial cells encircling trigeminal ganglion neurons innervating the whisker pad skin, and the connexin 43 protein expression was significantly increased after inferior alveolar nerve injury. Administration of Gap27 in the trigeminal ganglion significantly reduced satellite glial cell activation and mechanical hypersensitivity in the whisker pad skin. Moreover, the marked activation of satellite glial cells encircling trigeminal ganglion neurons innervating the whisker pad skin following inferior alveolar nerve injury implies that the satellite glial cell activation exerts a major influence on the excitability of nociceptive trigeminal ganglion neurons. These findings indicate that the propagation of satellite glial cell activation throughout the trigeminal ganglion via gap junctions, which are composed of connexin 43, plays a

  9. Myricetin Prevents Alveolar Bone Loss in an Experimental Ovariectomized Mouse Model of Periodontitis

    Directory of Open Access Journals (Sweden)

    Jialiang Huang

    2016-03-01

    Full Text Available Periodontitis is a common chronic inflammatory disease, which leads to alveolar bone resorption. Healthy and functional alveolar bone, which can support the teeth and enable their movement, is very important for orthodontic treatment. Myricetin inhibited osteoclastogenesis by suppressing the expression of some genes, signaling pathways, and cytokines. This study aimed to investigate the effects of myricetin on alveolar bone loss in an ovariectomized (OVX mouse model of periodontitis as well as in vitro osteoclast formation and bone resorption. Twenty-four healthy eight-week-old C57BL/J6 female mice were assigned randomly to four groups: phosphate-buffered saline (PBS control (sham OVX + ligature + PBS (vehicle, and OVX + ligature + low or high (2 or 5 mg∙kg−1∙day−1, respectively doses of myricetin. Myricetin or PBS was injected intraperitoneally (i.p. every other day for 30 days. The maxillae were collected and subjected to further examination, including micro-computed tomography (micro-CT, hematoxylin and eosin (H&E staining, and tartrate-resistant acid phosphatase (TRAP staining; a resorption pit assay was also performed in vitro to evaluate the effects of myricetin on receptor activator of nuclear factor κ-B ligand (RANKL-induced osteoclastogenesis. Myricetin, at both high and low doses, prevented alveolar bone resorption and increased alveolar crest height in the mouse model and inhibited osteoclast formation and bone resorption in vitro. However, myricetin was more effective at high dose than at low dose. Our study demonstrated that myricetin had a positive effect on alveolar bone resorption in an OVX mouse model of periodontitis and, therefore, may be a potential agent for the treatment of periodontitis and osteoporosis.

  10. Study of the inferior alveolar canal and mental foramen on digital panoramic images.

    Science.gov (United States)

    Pria, Carlos M; Masood, Farah; Beckerley, Joy M; Carson, Robert E

    2011-07-01

    To study the radiographic location of the mental foramen and appearance of the inferior alveolar canal and the relationship between image gray values and the clarity of inferior alveolar canal on the digital panoramic images and to evaluate if the histogram equalization of the digital image would improve the visualization of the inferior alveolar canal outline on the digital panoramic images in the mandible. Five hundred digital panoramic images were evaluated by two examiners using a specific inclusion criteria. Only the right side of the mandible was studied. Chi-square analyses were used for comparisons of distributions. Mean and median pixel values were analyzed separately with a one-way analysis of variance. Also, percentages were calculated to report the usefulness of the histogram equalization for visualization of canal. RESULTS show variation in location of mental foramen. Most frequent location of the mental foramen was reported as first and second premolar region. Chi-square analysis showed that the frequency of occurrence of the mental foramen was equally probable for any of the three locations. The study did not find significant usefulness of the gray values obtained from the histogram equalization in predicting the clarity of inferior alveolar canal outlines. Knowing the normal relationship and the anatomical variation of the maxillofacial structures for each patient is important for surgical implant treatment planning to avoid future complications. It is also important to be familiar with the advantages and limitations of diagnostic aids available before making treatment planning decisions based on such findings. Digital imaging, Panoramic, Inferior alveolar canal, Mental foramen. How to cite this article: Pria CM, Masood F, Beckerley JM, Carson RE. Study of the Inferior Alveolar Canal and Mental Foramen on Digital Panoramic Images. J Contemp Dent Pract 2011;12(4):265-271. Source of support: Nil Conflict of interest: None declared.

  11. The effect of therapeutic radiation on canine alveolar ridges augmented with hydroxylapatite

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1992-01-01

    on the alveolar ridge. Following 4 months of healing, 12 dogs (experimental group) underwent therapeutic radiation therapy (Co60, 4,000 rad [40 Gy]) to the head and neck region. Four dogs were not irradiated and served as controls. Four animals (three experimental and one control) were killed at 5,6,7, and 8......The purpose of this investigation was to evaluate the effect of radiation on hydroxylapatite (HA) implanted subperiosteally for alveolar ridge augmentation in dogs. All bicuspids and molars were extracted from 16 dogs. After 6 weeks, nonporous HA granules were implanted subperiosteally...

  12. Chemical, physical, and histologic studies on four commercial apatites used for alveolar ridge augmentation

    DEFF Research Database (Denmark)

    Pinholt, E M; Ruyter, I E; Haanaes, H R

    1992-01-01

    The purpose of this study was to evaluate four commercial apatite products. Subperiosteal alveolar ridge augmentation was performed on the maxilla of rats by implantation of granules of two dense products and of two porous products, and the tissue response was compared with the material character......The purpose of this study was to evaluate four commercial apatite products. Subperiosteal alveolar ridge augmentation was performed on the maxilla of rats by implantation of granules of two dense products and of two porous products, and the tissue response was compared with the material...

  13. Automatic methods for alveolar bone loss degree measurement in periodontitis periapical radiographs.

    Science.gov (United States)

    Lin, P L; Huang, P Y; Huang, P W

    2017-09-01

    Periodontitis involves progressive loss of alveolar bone around the teeth. Hence, automatic alveolar bone loss measurement in periapical radiographs can assist dentists in diagnosing such disease. In this paper, we propose an automatic length-based alveolar bone loss measurement system with emphasis on a cementoenamel junction (CEJ) localization method: CEJ_LG. The bone loss measurement system first adopts the methods TSLS and ABLifBm, which we presented previously, to extract teeth contours and bone loss areas from periodontitis radiograph images. It then applies the proposed methods to locate the positions of CEJ, alveolar crest (ALC), and apex of tooth root (APEX), respectively. Finally the system computes the ratio of the distance between the positions of CEJ and ALC to the distance between the positions of CEJ and APEX as the degree of bone loss for that tooth. The method CEJ_LG first obtains the gradient of the tooth image then detects the border between the lower enamel and dentin (EDB) from the gradient image. Finally, the method identifies a point on the tooth contour that is horizontally closest to the EDB. Experimental results on 18 tooth images segmented from 12 periodontitis periapical radiographs, including 8 views of upper-jaw teeth and 10 views of lower-jaw teeth, show that 53% of the localized CEJs are within 3 pixels deviation (∼ 0.15 mm) from the positions marked by dentists and 90% have deviation less than 9 pixels (∼ 0.44 mm). For degree of alveolar bone loss, more than half of the measurements using our system have deviation less than 10% from the ground truth, and all measurements using our system are within 25% deviation from the ground truth. Our results suggest that the proposed automatic system can effectively estimate degree of horizontal alveolar bone loss in periodontitis radiograph images. We believe that our proposed system, if implemented in routine clinical practice, can serve as a valuable tool for early and accurate

  14. Ontogenesis of the alveolar walls of the tooth germ according to orthopantomography

    Directory of Open Access Journals (Sweden)

    Okushko M.R.

    2015-12-01

    Full Text Available Objective: to identify changes of the configuration and size of the walls of the alveolar stages of ontogenesis. Materials and Methods. Orthopantomograms studied 196 children aged 5 to 12 years. We used visual and morphometric methods. Results. The data on the three diameters of the dental alveoli (proximal, middle and distal has been presented, under which subsequently the main stages of age transformation have been highlighted. Conclusion. Transformation of the alveolar walls radiologically determined and its advancing character in relation to the macroprocesses in the germ tooth have made it possible to consider alveolus as one of the leading biological tools of odontogenesis.

  15. Alveolar Bone Expansion for Implant Placement in Compromised Aesthetic Zone – Case Series

    Science.gov (United States)

    Mohamed, Jumshad B; Alam, Md Nazish; Singh, Gurudeep; Chandrasekaran, S.N

    2014-01-01

    Implant placement and restoration of compromised alveolar ridges in the aesthetic zone has always been a challenge to the oral implantologists. The use of bone expanders and bone condensers without the use of traditional drilling sequences in this scenario is becoming popular because of its predictable results. Xenograft along with Platelet-rich fibrin (PRF) used as scaffold also provides growth factors to accelerate both soft and hard tissue healing as well as regeneration. The paper highlights this combined approach in the placement of implants in compromised alveolar ridges with good results. All implants were successfully restored and followed up for one year. PMID:24701543

  16. Distracción osteogénica alveolar: una alternativa en la reconstrucción de rebordes alveolares atróficos: Descripción de 10 casos Alveolar distraction osteogenesis: an alternative in the reconstruction of atrophic alveolar ridges: Report of 10 cases

    Directory of Open Access Journals (Sweden)

    P.E. Maurette O’Brien

    2004-02-01

    Full Text Available La distracción osteogénica alveolar (DOA es un método alternativo para la reconstrucción de rebordes alveolares atróficos que ofrece un resultado previsible y que disminuye los tiempo de espera entre la reconstrucción del reborde alveolar atrófico y la colocación de los implantes óseo-integrados, en comparación con los métodos tradicionalmente utilizados. Fueron atendidos 10 pacientes que presentaban deficiencia de reborde alveolar mandibular y/o maxilar por medio de distracción osteogénica, utilizando un dispositivo yuxtaoseo (Conexión Implant System® - SP-Brasil. Todos los pacientes fueron atendidos de forma ambulatoria, bajo anestesia local y sedación conciente, comenzando la activación del dispositivo a los 7 días posteriores a la instalación, con un patrón de activación de 1 mm diarios hasta alcanzar la altura ósea deseada. Posteriormente se aguardaron 10 semanas como parte del periodo de consolidación ósea y se realizo la colocación de los implantes oseointegrados y local y el retiro del dispositivo de distracción, pudiéndose comprobar clínica y radiográficamente la ganancia de la altura y volumen óseo necesario para la rehabilitación por medio de implantes.The alveolar distraction osteogenesis is an alternative method for the reconstruction of atrophic alveolar ridges with success, that decrease the time of wait between the reconstruction of the alveolar ridge and the placement of the osseointegrated implants in comparison with the traditionally used methods. 10 patients that presented deficiency of the alveolar ridge in the maxilla and/or mandible were assisted by means of distraction osteogenesis, using a juxtaosseous device (Conexion Implant System® - SP-Brazil. All the patients were assisted of form ambulatory, under local anesthesia and conscientious sedation, beginning the activation from the device 7 days later to the installation, with a pattern of activation 1 mm diary until reaching the wanted

  17. An integrative approach for comparing microcirculation between normal and alveolar cleft gingiva in children scheduled for secondary bone grafting procedures

    NARCIS (Netherlands)

    Milstein, Dan M. J.; Cheung, Yuk Wah; Žiūkaitė, Laura; Ince, Can; van den Akker, Hans P.; Lindeboom, Jérôme A. H.

    2013-01-01

    The aim of this study was to compare microcirculatory parameters in normal versus alveolar cleft gingiva in children selected for secondary bone grafting procedures. This study included 11 consecutive patients with complete unilateral alveolar clefts who required secondary bone grafting procedures.

  18. An integrative approach for comparing microcirculation between normal and alveolar cleft gingiva in children scheduled for secondary bone grafting procedures

    NARCIS (Netherlands)

    Milstein, D.M.J.; Cheung, Y.W.; Ziukaite, L.; Ince, C.; van den Akker, H.P.; Lindeboom, J.A.H.

    2013-01-01

    Objective The aim of this study was to compare microcirculatory parameters in normal versus alveolar cleft gingiva in children selected for secondary bone grafting procedures. Study Design This study included 11 consecutive patients with complete unilateral alveolar clefts who required secondary

  19. Early secondary closure of alveolar clefts with mandibular symphyseal bone grafts and beta-tri calcium phosphate (beta-TCP).

    NARCIS (Netherlands)

    Weijs, W.L.J.; Siebers, T.J.H.; Kuijpers-Jagtman, A.M.; Berge, S.J.; Meijer, G.J.; Borstlap, W.A.

    2010-01-01

    Alveolar reconstruction of bony defects in cleft lip and palate patients is a widely accepted treatment regimen for which multiple donor sites can be used. For 25 years, autogeneous bicortical mandibular symphyseal bone grafts have been used at the authors' centre. In cases in which the alveolar

  20. Pre-operative assessment of impacted mandibular third molar and inferior alveolar canal using orthopantomograhpy and cone beam computed tomography

    Directory of Open Access Journals (Sweden)

    Mahmuda Akter

    2016-12-01

    Full Text Available The aim of this study was to assess the proximity and relation of impacted mandibular third molar and inferior alveolar canal on orthopantomogram and cone beam computed tomography (CBCT. Sixty impacted mandibular third molars having close proximity with the  inferior alveolar canal were included. CBCT images were done to determine the exact location and relationship of impacted third molar tooth and inferior alveolar canal. We assessed the radiographic signs from orthopantomogram, the course of  inferior alveolar canal and proximity to the third molar tooth in CBCT. The buccal course of  inferior alveolar canal was most frequently detected (n=36 in CBCT findings. The impacted lower third molar roots were 55% contact with the  inferior alveolar canal and 45% separate from the canal. On orthopantomogram, the following signs were strongly correlated with actual contact: Superimposed relationship between the third molar and the inferior alveolar canal. CBCT is useful as a presurgical planning in patients with impacted mandibular third molar showing close proximity to the  inferior alveolar canal.

  1. An Unusual Radiologic Manifestation of Pulmonary Tuberculosis with Bilateral Multiple Lung Nodules and Diffuse Alveolar Hemorrhage: A Case Report

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Seo In; Seon, Hyun Ju; Kim, Yun Hyeon [Dept. of Radiology, Chunnam National University Hospital, Gwangju (Korea, Republic of); Choi, Sung [Dept. of Radiology, Chunnam National University Hwasun Hospital, Hwasun(Korea, Republic of)

    2011-12-15

    Pulmonary tuberculosis presenting as bilateral multiple lung nodules or diffuse alveolar hemorrhage is very rare. Here, we report a case of pulmonary tuberculosis presenting as bilateral multiple lung nodules and diffuse alveolar hemorrhage mimicking granulomatous vasculitis, such as Wegener's granulomatosis.

  2. Osteogenesis effect of guided bone regeneration combined with alveolar cleft grafting: assessment by cone beam computed tomography.

    Science.gov (United States)

    Xiao, W-L; Zhang, D-Z; Chen, X-J; Yuan, C; Xue, L-F

    2016-06-01

    Cone beam computed tomography (CBCT) allows for a significantly lower radiation dose than conventional computed tomography (CT) scans and provides accurate images of the alveolar cleft area. The osteogenic effect of guided bone regeneration (GBR) vs. conventional alveolar bone grafting alone for alveolar cleft defects was evaluated in this study. Sixty alveolar cleft patients were divided randomly into two groups. One group underwent GBR using acellular dermal matrix film combined with alveolar bone grafting using iliac crest bone grafts (GBR group), while the other group underwent alveolar bone grafting only (non-GBR group). CBCT images were obtained at 1 week and at 3 months following the procedure. Using Simplant 11.04 software, the bone resorption rate was calculated and compared between the two groups. The bone resorption rate from 1 week to 3 months following bone grafting without the GBR technique was 36.50±5.04%, whereas the bone resorption rate using the GBR technique was 31.69±5.50% (P=0.017). The application of autogenous iliac bone combined with the GBR technique for alveolar bone grafting of alveolar cleft patients can reduce bone resorption and result in better osteogenesis. Copyright © 2016. Published by Elsevier Ltd.

  3. Limited Evidence Suggests That Alveolar Ridge Preservation is More Favorable Than Unassisted Socket Healing in Minimizing Alveolar Ridge Dimensional Changes After Extraction.

    Science.gov (United States)

    Tu, Victor; Kumar, Satish

    2018-03-01

    Alveolar ridge preservation after tooth extraction: a Bayesian Network meta-analysis of grafting materials efficacy on prevention of bone height and width reduction. Iocca O, Farcomeni A, Pardiñas Lopez S, Talib HS. J Clin Periodontol 2017; 44(1):104-14. Self-funded by the authors and their institutions TYPE OF STUDY/DESIGN: Meta-analysis and Bayesian network meta-analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Evaluation of Inflammatory Cytokine Secretion by Human Alveolar Macrophages

    Directory of Open Access Journals (Sweden)

    J. E. Losa García

    1999-01-01

    Full Text Available The alveolar macrophage (AM secretes interleukin 1β (IL-1β, tumour necrosis factor-α (TNF-α, interleukin-6 (IL-6 and interleukin-8 (IL-8, all of them inflammatory cytokines involved in the pathogenesis of many lung diseases. The aim of the present work was to evaluate the basal and stimulated secretion of these cytokines by human AMs. Human AMs were collected by bronchoalveolar lavage (BAL from four healthy controls and 13 patients with diffuse interstitial lung disease (five cases of sarcoidosis, three of hypersensitivity pneumonitis and five of idiopathic pulmonary fibrosis. AMs were cultured in the presence or absence of different concentrations of lipopolysaccharide (LPS, phorbolmyristate and gammainterferon. IL-1β, TNF-α, IL-6 and IL-8 levels were measured in BAL fluid and culture supernatant using specific enzyme-linked immunosorbent assays. The substance found to stimulate the secretion of inflammatory cytokines to the greatest extent was LPS at a concentration of 10 μg/ml. Regarding the secretion of IL-1β, four observations were of interest: basal secretion was very low; LPS exerted a potent stimulatory effect; considerable within-group variability was observed; and there were no significant differences in the comparisons among groups. With respect to TNF-α secretion, the results were similar. The only striking finding was the higher basal secretion of this cytokine with respect to that of IL-1β. Regarding the secretion of IL-6, the same pattern followed by TNF-α was found. However, it should be stressed that the increase induced by LPS was smaller than in the two previous cytokines. Regarding the secretion of IL-8, three findings were patent: the strong basal secretion of this cytokine; the moderate increase induced by LPS; and the existence of significant differences among the different groups with respect to the stimulated secretion of this cytokine, which reached maximum values in patients with idiopathic pulmonary

  5. Platelet CLEC-2 protects against lung injury via effects of its ligand podoplanin on inflammatory alveolar macrophages in the mouse.

    Science.gov (United States)

    Lax, Siân; Rayes, Julie; Wichaiyo, Surasak; Haining, Elizabeth J; Lowe, Kate; Grygielska, Beata; Laloo, Ryan; Flodby, Per; Borok, Zea; Crandall, Edward D; Thickett, David R; Watson, Steve P

    2017-12-01

    There is no therapeutic intervention proven to prevent acute respiratory distress syndrome (ARDS). Novel mechanistic insights into the pathophysiology of ARDS are therefore required. Platelets are implicated in regulating many of the pathogenic processes that occur during ARDS; however, the mechanisms remain elusive. The platelet receptor CLEC-2 has been shown to regulate vascular integrity at sites of acute inflammation. Therefore the purpose of this study was to establish the role of CLEC-2 and its ligand podoplanin in a mouse model of ARDS. Platelet-specific CLEC-2-deficient, as well as alveolar epithelial type I cell (AECI)-specific or hematopoietic-specific podoplanin deficient, mice were established using cre-loxP strategies. Combining these with intratracheal (IT) instillations of lipopolysaccharide (LPS), we demonstrate that arterial oxygen saturation decline in response to IT-LPS in platelet-specific CLEC-2-deficient mice is significantly augmented. An increase in bronchoalveolar lavage (BAL) neutrophils and protein was also observed 48 h post-IT-LPS, with significant increases in pro-inflammatory chemokines detected in BAL of platelet-specific CLEC-2-deficient animals. Deletion of podoplanin from hematopoietic cells but not AECIs also reduces lung function and increases pro-inflammatory chemokine expression following IT-LPS. Furthermore, we demonstrate that following IT-LPS, platelets are present in BAL in aggregates with neutrophils, which allows for CLEC-2 interaction with podoplanin expressed on BAL inflammatory alveolar macrophages. Taken together, these data suggest that the platelet CLEC-2-podoplanin signaling axis regulates the severity of lung inflammation in mice and is a possible novel target for therapeutic intervention in patients at risk of developing ARDS. Copyright © 2017 the American Physiological Society.

  6. Cyclophilin A (CypA) is associated with the inflammatory infiltration and alveolar bone destruction in an experimental periodontitis

    International Nuclear Information System (INIS)

    Liu, Lihua; Li, Chengzhang; Cai, Cia; Xiang, Junbo; Cao, Zhengguo

    2010-01-01

    Background and objective: CypA is able to regulate inflammatory responses and MMPs production via interaction with its cell surface receptor, EMMPRIN. This study aimed to address the possible association of CypA with pathological inflammation and destruction of periodontal tissues, and whether CypA-EMMPRIN interaction exists in periodontitis. Materials and methods: Experimental periodontitis was induced by ligation according to our previous method. Histological and radiographic examinations were performed. Western blot was used to detect CypA and EMMPRIN expressions in gingival tissues. Immunohistochemistry was applied for CypA, EMMPRIN, MMP-1, MMP-2, MMP-9, as well as cell markers of macrophage, lymphocyte and neutrophil. CypA expression, alveolar bone loss, and inflammatory infiltrations were quantified followed by correlation analyses. Results: Western blot revealed that CypA and EMMRPIN expressions were dramatically elevated in inflamed gingival tissues (ligature group) as compared to healthy gingival tissues (control group). The enhanced CypA and EMMPRIN expressions were highly consistent in cell localization on seriate sections. They were permanently co-localized in infiltrating macrophages and lymphocytes, as well as osteoclasts and osteoblasts in interradicular bone, but rarely expressed by infiltrating neutrophils. MMP-1, MMP-2, and MMP-9 expressions were also sharply increased in inflamed gingiva. MMP-2 and MMP-9 were mainly over-expressed by macrophages, while MMP-1 was over-produced by fibroblasts and infiltrating cells. The number of CypA-positive cells was strongly correlated with the ACJ-AC distance (r = 0.839, p = 0.000), the number of macrophages (r = 0.972, p = 0.000), and the number of lymphocytes (r = 0.951, p = 0.000). Conclusion: CypA is associated with the inflammatory infiltration and alveolar bone destruction of periodontitis. CypA-EMMPRIN interaction may exist in these pathological processes.

  7. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    Energy Technology Data Exchange (ETDEWEB)

    Miyata, Ryohei; Eeden, Stephan F. van, E-mail: Stephan.vanEeden@hli.ubc.ca

    2011-12-15

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 {mu}m or less, PM{sub 10}) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 {mu}m or less, PM{sub 2.5}) and ultrafine particles (0.1 {mu}m or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-{kappa}B and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1{beta}, IL-6, and tumor necrosis factor-{alpha}] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-{kappa}B pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  8. The innate and adaptive immune response induced by alveolar macrophages exposed to ambient particulate matter

    International Nuclear Information System (INIS)

    Miyata, Ryohei; Eeden, Stephan F. van

    2011-01-01

    Emerging epidemiological evidence suggests that exposure to particulate matter (PM) air pollution increases the risk of cardiovascular events but the exact mechanism by which PM has adverse effects is still unclear. Alveolar macrophages (AM) play a major role in clearing and processing inhaled PM. This comprehensive review of research findings on immunological interactions between AM and PM provides potential pathophysiological pathways that interconnect PM exposure with adverse cardiovascular effects. Coarse particles (10 μm or less, PM 10 ) induce innate immune responses via endotoxin-toll-like receptor (TLR) 4 pathway while fine (2.5 μm or less, PM 2.5 ) and ultrafine particles (0.1 μm or less, UFP) induce via reactive oxygen species generation by transition metals and/or polyaromatic hydrocarbons. The innate immune responses are characterized by activation of transcription factors [nuclear factor (NF)-κB and activator protein-1] and the downstream proinflammatory cytokine [interleukin (IL)-1β, IL-6, and tumor necrosis factor-α] production. In addition to the conventional opsonin-dependent phagocytosis by AM, PM can also be endocytosed by an opsonin-independent pathway via scavenger receptors. Activation of scavenger receptors negatively regulates the TLR4-NF-κB pathway. Internalized particles are subsequently subjected to adaptive immunity involving major histocompatibility complex class II (MHC II) expression, recruitment of costimulatory molecules, and the modulation of the T helper (Th) responses. AM show atypical antigen presenting cell maturation in which phagocytic activity decreases while both MHC II and costimulatory molecules remain unaltered. PM drives AM towards a Th1 profile but secondary responses in a Th1- or Th-2 up-regulated milieu drive the response in favor of a Th2 profile.

  9. Canine Eruption After Secondary Alveolar Bone Graft in Unilateral Cleft Lip and Palate Patients.

    Science.gov (United States)

    Vellone, Valentino; Cirignaco, Giulio; Cavarretta, Bruno; Cascone, Piero

    2017-07-01

    The aim of this article is to analyze dental abnormalities in unilateral cleft lip and palate patients by focusing on the role of the secondary alveolar bone graft (SABG) surgery and its outcomes on canine eruption/inclusion. A sample of 24 patients with unilateral cleft lip and palate were selected.Dental anomalies, canine eruption based on the existence of supernumeraries, agenesis elements, inclination of the major canine axis before and after surgery, distance from the occlusal plane before and after surgery, and sector classification were analyzed. Out of the 24 patients, 87.5% presented a canine spontaneously erupted in the dental arch while 12.5% needed surgical-orthodontic traction.There is also no proof that inclination of the canine significantly influenced the eruption before (P = 0.5889) and after (P = 0.4029) surgery. Also, there is no any correlation between the 2 sides (P = 0.1257).The SABG surgery showed a significant correlation with canine eruption (P = 0.009242); moreover, SABG shows a positive relationship with the radicular development of the canine (P = 0.005163).Lateral incisive (P = 0.8493) and second premolar agenesis (P = 1) are not statistically correlated with the eruption of the canine. This does not happen with supernumerary elements that are correlated with the surgical-orthodontic traction (P = 0.0004464). Agenesis does not play any role in the process of canine eruption while supernumeraries do. There is no relationship between the inclination and eruption of the canine.The SABG surgery has a key role because it contributes to create an appropriate support for the erupting canine, the nasal base and the anterior maxilla.

  10. Alveolar macrophages infected with Ames or Sterne strain of Bacillus anthracis elicit differential molecular expression patterns.

    Directory of Open Access Journals (Sweden)

    Felicia D Langel

    Full Text Available Alveolar macrophages (AMs phagocytose Bacillus anthracis following inhalation and induce the production of pro-inflammatory cytokines and chemokines to mediate the activation of innate immunity. Ames, the virulent strain of B. anthracis, contains two plasmids that encode the antiphagocytic poly-γ-d-glutamic acid capsule and the lethal toxin. The attenuated Sterne strain of B. anthracis, which lacks the plasmid encoding capsule, is widely adapted as a vaccine strain. Although differences in the outcome of infection with the two strains may have originated from the presence or absence of an anti-phagocytic capsule, the disease pathogenesis following infection will be manifested via the host responses, which is not well understood. To gain understanding of the host responses at cellular level, a microarray analysis was performed using primary rhesus macaque AMs infected with either Ames or Sterne spores. Notably, 528 human orthologs were identified to be differentially expressed in AMs infected with either strain of the B. anthracis. Meta-analyses revealed genes differentially expressed in response to B. anthracis infection were also induced upon infections with multiple pathogens such as Francisella Novicida or Staphylococcus aureus. This suggests the existence of a common molecular signature in response to pathogen infections. Importantly, the microarray and protein expression data for certain cytokines, chemokines and host factors provide further insights on how cellular processes such as innate immune sensing pathways, anti-apoptosis versus apoptosis may be differentially modulated in response to the virulent or vaccine strain of B. anthracis. The reported differences may account for the marked difference in pathogenicity between these two strains.

  11. Spatially-Resolved Proteomics: Rapid Quantitative Analysis of Laser Capture Microdissected Alveolar Tissue Samples

    Energy Technology Data Exchange (ETDEWEB)

    Clair, Geremy; Piehowski, Paul D.; Nicola, Teodora; Kitzmiller, Joseph A.; Huang, Eric L.; Zink, Erika M.; Sontag, Ryan L.; Orton, Daniel J.; Moore, Ronald J.; Carson, James P.; Smith, Richard D.; Whitsett, Jeffrey A.; Corley, Richard A.; Ambalavanan, Namasivayam; Ansong, Charles

    2016-12-22

    Global proteomics approaches allow characterization of whole tissue lysates to an impressive depth. However, it is now increasingly recognized that to better understand the complexity of multicellular organisms, global protein profiling of specific spatially defined regions/substructures of tissues (i.e. spatially-resolved proteomics) is essential. Laser capture microdissection (LCM) enables microscopic isolation of defined regions of tissues preserving crucial spatial information. However, current proteomics workflows entail several manual sample preparation steps and are challenged by the microscopic mass-limited samples generated by LCM, and that impact measurement robustness, quantification, and throughput. Here, we coupled LCM with a fully automated sample preparation workflow that with a single manual step allows: protein extraction, tryptic digestion, peptide cleanup and LC-MS/MS analysis of proteomes from microdissected tissues. Benchmarking against the current state of the art in ultrasensitive global proteomic analysis, our approach demonstrated significant improvements in quantification and throughput. Using our LCM-SNaPP proteomics approach, we characterized to a depth of more than 3,400 proteins, the ontogeny of protein changes during normal lung development in laser capture microdissected alveolar tissue containing ~4,000 cells per sample. Importantly, the data revealed quantitative changes for 350 low abundance transcription factors and signaling molecules, confirming earlier transcript-level observations and defining seven modules of coordinated transcription factor/signaling molecule expression patterns, suggesting that a complex network of temporal regulatory control directs normal lung development with epigenetic regulation fine-tuning pre-natal developmental processes. Our LCM-proteomics approach facilitates efficient, spatially-resolved, ultrasensitive global proteomics analyses in high-throughput that will be enabling for several clinical and

  12. Essential role for cathepsin D in bleomycin-induced apoptosis of alveolar epithelial cells.

    Science.gov (United States)

    Li, Xiaopeng; Rayford, Heather; Shu, Ruijie; Zhuang, Jiaju; Uhal, Bruce D

    2004-07-01

    Our earlier studies showed that bleomycin-induced apoptosis of type II alveolar epithelial cells (AECs) requires the autocrine synthesis and proteolytic processing of angiotensinogen into ANG II and that inhibitors of ANG-converting enzyme (ACEis) block bleomycin-induced apoptosis (Li X, Zhang H, Soledad-Conrad V, Zhuang J, and Uhal BD. Am J Physiol Lung Cell Mol Physiol 284: L501-L507, 2003). Given the documented role of cathepsin D (CatD) in apoptosis of other cell types, we hypothesized that CatD might be the AEC enzyme responsible for the conversion of angiotensinogen into ANG I, the substrate for ACE. Primary cultures of rat type II AECs challenged with bleomycin in vitro showed upregulation and secretion of CatD enzymatic activity and immunoreactive protein but no increases in CatD mRNA. The aspartyl protease inhibitor pepstatin A, which completely blocked CatD enzymatic activity, inhibited bleomycin-induced nuclear fragmentation by 76% and reduced bleomycin-induced caspase-3 activation by 47%. Antisense oligonucleotides against CatD mRNA reduced CatD-immunoreactive protein and inhibited bleomycin-induced nuclear fragmentation by 48%. A purified fragment of angiotensinogen (F1-14) containing the CatD and ACE cleavage sites, when applied to unchallenged AEC in vitro, yielded mature ANG II peptide and induced apoptosis. The apoptosis induced by F1-14 was inhibited 96% by pepstatin A and 77% by neutralizing antibodies specific for CatD (both P CatD in bleomycin-induced apoptosis of cultured AEC and suggest that the role(s) of CatD in AEC apoptosis include the conversion of newly synthesized angiotensinogen to ANG II.

  13. Densitometric analysis of the autogenous demineralized dentin matrix on the dental socket wound healing process in humans Análise densitométrica da matriz dentinária desmineralizada autógena na reparação alveolar de humanos

    Directory of Open Access Journals (Sweden)

    Mônica Fernandes Gomes

    2006-12-01

    Full Text Available The aim of this study was to evaluate the effects of the autogenous demineralized dentin matrix (ADDM on the third molar socket wound healing process in humans, using the guided bone regeneration technique and a polytetrafluoroethylene barrier (PTFE. Twenty-seven dental sockets were divided into three groups: dental socket (Control, dental socket with PTFE barrier (PTFE, and dental socket with ADDM slices associated to PTFE barrier (ADDM + PTFE. The dental sockets were submitted to radiographic bone densitometry analysis and statistical analysis on the 15th, 30th, 60th and 90th days using analysis of variance (ANOVA and Tukey's test (p £ 0.05. The radiographic analysis of the ADDM + PTFE group showed greater homogeneity of bone radiopacity than the Control group and the PTFE group, during all the observation times. The dentin matrix gradually disappeared from the dental socket during the course of the repair process, suggesting its resorption during the bone remodeling process. It was concluded that the radiographic bone density of the dental sockets treated with ADDM was similar to that of the surrounding normal bone on the 90th day. The ADDM was biocompatible with the bone tissue of the surgical wounds of human dental sockets. The radiographic analysis revealed that the repair process was discreetly faster in the ADDM + PTFE group than in the Control and PTFE groups, although the difference was not statistically significant. In addition, the radiographic image of the ADDM + PTFE group suggested that its bone architecture was better than that of the Control and PFTE groups.O objetivo desta pesquisa foi avaliar a reparação óssea em alvéolos dentários após exodontia dos terceiros molares inferiores em humanos, com implantação de matriz dentinária desmineralizada autógena (MDDA na cavidade e cobertura desta com barreira de politetrafluoretileno (PTFE. Foram selecionados 27 dentes, os quais foram divididos em três grupos: alvéolo dent

  14. Alveolar epithelial type II cells induce T cell tolerance to specific antigen

    DEFF Research Database (Denmark)

    Lo, Bernice; Hansen, Søren; Evans, Kathy

    2008-01-01

    The lungs face the immunologic challenge of rapidly eliminating inhaled pathogens while maintaining tolerance to innocuous Ags. A break in this immune homeostasis may result in pulmonary inflammatory diseases, such as allergies or asthma. The observation that alveolar epithelial type II cells (Ty...

  15. Inflammatory response and barrier properties of a new alveolar type 1-like cell line (TT1).

    NARCIS (Netherlands)

    Bogaard, E.H.J. van den; Dailey, L.A.; Thorley, A.J.; Tetley, T.D.; Forbes, B.

    2009-01-01

    PURPOSE: To evaluate the inflammatory response and barrier formation of a new alveolar type 1-like (transformed type I; TT1) cell line to establish its suitability for toxicity and drug transport studies. METHODS: TT1 and A549 cells were challenged with lipopolysaccharide (LPS). Secretion of

  16. Healing of Horizontal Intra-alveolar Root Fractures after Endodontic Treatment with Mineral Trioxide Aggregate.

    Science.gov (United States)

    Kim, Dohyun; Yue, Wonyoung; Yoon, Tai-Cheol; Park, Sung-Ho; Kim, Euiseong

    2016-02-01

    The purpose of this retrospective study was to evaluate the healing type and assess the outcome of horizontal intra-alveolar root fractures after endodontic treatment with mineral trioxide aggregate (MTA) as filling material. The clinical database of the Department of Conservative Dentistry at Yonsei University Dental Hospital, Seoul, Korea, was searched for patients with histories of intra-alveolar root fractures and endodontic treatments with MTA between October 2005 and September 2014. Radiographic healing at the fracture line was evaluated independently by 2 examiners and was classified into 4 types according to Andreasen and Hjørting-Hansen. Of the 22 root-fractured teeth that received endodontic treatment with MTA, 19 cases participated in the follow-up after a period of at least 3 months. Seventeen of the 19 teeth (89.5%) exhibited healing of the root fractures. For each healing type, 7 teeth (36.8%) showed healing with calcified tissue, 8 teeth (42.1%) showed interposition of connective tissue, 2 teeth (10.5%) showed interposition of connective tissue and bone, and 2 teeth (10.5%) showed interposition of granulation tissue without healing. Within the limitations of this study, intra-alveolar root fractures showed satisfactory healing outcomes after endodontic treatment with MTA. MTA could be considered to be suitable filling material for the endodontic treatment of horizontal intra-alveolar root fractures. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  17. ALVEOLAR BONE REGENERATION AFTER DEMINERALIZED FREEZE DRIED BONE ALOGRAFT (DFDBA BONE GRAFTING

    Directory of Open Access Journals (Sweden)

    Sri Oktawati

    2006-04-01

    Full Text Available Periodontal treatment by conventional way will result in healing repair, which easily cause recurrence. Modification of treatment should be done to get an effective result, that is the regeneration of alveolar bone and to reduce inflammation. The objective of this study is to determine the alveolar bone regeneration after using DFDBA (Demineralized Freeze Dried Bone Allograft. Quasi experimental designs with pre and post test method was used in this study. From 13 patients, 26 defects got conventional or regenerative treatment. The indicator of alveolar bone regenaration in bone height in radiographic appearance and level of osteocalsin in gingival crevicular fluid (GCF were checked before and after the treatment, then the changes that occurred were analyzed. The result of the research showed that alveolar bone regeneration only occurred to the group of regenerative treatment using DFDBA. The conclusion is the effective periodontal tissue regeneration occurred at regenerative treatment by using DFDBA, and the osteocalsin in GCF can be used as indicator of bone growth.

  18. beta-TCP Versus Autologous Bone for Repair of Alveolar Clefts in a Goat Model.

    NARCIS (Netherlands)

    Ruiter, A. de; Meijer, G.J.; Dormaar, T.; Janssen, N.; Bilt, A. van der; Slootweg, P.J.; Bruijn, J. de; Rijn, L. van; Koole, R.A.

    2011-01-01

    Objective : The aim of this study in goats was to test the hypothesis that a novel synthetic bone substitute beta tricalcium phosphate (beta-TCP) can work as well as autologous bone harvested from the iliac crest for grafting and repair of alveolar clefts. Design : Ten adult Dutch milk goats ( Capra

  19. Evaluation of the effect of platelet-rich fibrin on the alveolar osteitis ...

    African Journals Online (AJOL)

    Evaluation of the effect of platelet-rich fibrin on the alveolar osteitis incidence and periodontal probing depth after extracting partially erupted mandibular third ... Conclusions: PRF significantly reduced the AO incidence among smokers and had a positive effect on postoperative pain levels but not on periodontal healing.

  20. B Cell IgD Deletion Prevents Alveolar Bone Loss Following Murine Oral Infection

    Directory of Open Access Journals (Sweden)

    Pamela J. Baker

    2009-01-01

    and CD4+ T cells in immune normal mice compared to IgD deficient mice. These data suggest that IgD is an important mediator of alveolar bone resorption, possibly through antigen-specific coactivation of B cells and CD4+ T cells.

  1. The sloping alveolar plateau of tracer gases washed out from mixed venous blood in man

    NARCIS (Netherlands)

    Schrikker, A.C.M.; Vries, W.R. de; Zwart, A.; Luijendijk, S.C.M.

    1989-01-01

    We have investigated the slope of the alveolar plateau for inert tracer gases that were washed out from mixed venous blood. Two pairs of tracer gases were used (He, SFe) and (C2H2, Freon 22). The gases of each pair share almost the same blood-gas partition coefïicient but they have different

  2. Crazy paving pattern caused by pulmonary alveolar proteinosis: CT findings and the pathologic basis.

    Science.gov (United States)

    Luo, Jianguang; Yang, Dongyi; Zhou, Shunke; Xiao, Enhua; Chen, Ping; Fan, Songqing; Liu, Jun

    2014-09-01

    To explore CT findings and pathologic basis of crazy paving pattern caused by pulmonary alveolar proteinosis. Twenty-four patients who were diagnosed pathologically as pulmonary alveolar proteinosis by transbronchial lung biopsy and bronchoalveolar lavage fluid from June 2006 to May 2012 were included in this retrospective study. All patients underwent a 64-slice CT of the lungs. CT findings: crazy paving pattern was observed on CT imaging of all 24 patients. In 23 patients, crazy paving pattern displayed strip-shaped opacities with smooth edges, and there was a clear boundary between the pathological and normal lung tissues. The reticular opacities were connected with peripheral blood vessels and the branches were formed, and their diameters decreased slightly. Microscopically, hemangiectasis were seen in 17 patients. Crazy paving pattern caused by pulmonary alveolar proteinosis displayed clear edges, and smooth reticular opacities, most of which were due to hemangiectasis of interlobular, interacinar and interalveolar septa. These findings of CT are helpful for the specific diagnosis of pulmonary alveolar proteinosis.

  3. Inferior alveolar nerve injury with laryngeal mask airway: a case report.

    LENUS (Irish Health Repository)

    Hanumanthaiah, Deepak

    2011-01-01

    The incidence of damage to the individual cranial nerves and their branches associated with laryngeal mask airway use is low; there have been case reports of damage to the lingual nerve, hypoglossal nerve and recurrent laryngeal nerve. To the best of our knowledge we present the first reported case of inferior alveolar nerve injury associated with laryngeal mask airway use.

  4. Massive gingival enlargement and alveolar bone loss: report of two cases.

    Science.gov (United States)

    Schmidt, B L; Pogrel, M A; Perrott, D H; Regezi, J A

    1995-09-01

    We present two cases of massive gingival enlargement and osteolysis of alveolar bone in a 30-year-old female and a 36-year-old male. The etiology could not be established in either case. Histologically, both lesions contained hyperplastic fibrous connective tissue and intense plasma cell infiltrates. Both patients responded well to extensive gingivectomy, extraction of all teeth, and alveoplasty.

  5. Alveolar Capillary Dysplasia with Misalignment of Pulmonary Veins (ACD/MPV): A Case Series.

    Science.gov (United States)

    Miranda, Joana; Rocha, Gustavo; Soares, Henrique; Vilan, Ana; Brandão, Otília; Guimarães, Hercília

    2013-01-01

    Alveolar capillary dysplasia with misalignment of pulmonary veins (ACD/MPV) is a rare, fatal, developmental lung disorder, which usually presents as persistent pulmonary hypertension of the newborn (PPHN) unresponsive to treatment. The authors present their own experience with three cases admitted during the last 15 years.

  6. Differential gene expression profiling of Actinobacillus pleuropneumoniae during induction of primary alveolar macrophage apoptosis in piglets

    NARCIS (Netherlands)

    Wang, Lei; Qin, Wanhai; Ruidong, Zhai; Liu, Shiting; Zhang, Hu; Sun, Changjiang; Feng, Xin; Gu, Jingmin; Du, Chongtao; Han, Wenyu; Langford, P. R.; Lei, Liancheng

    2015-01-01

    Actinobacillus pleura pneumoniae (A. pleuropneumoniae) is the causative agent of porcine pleuropneumonia, a disease that causes serious problems for the swine industry. Successful infection by this bacterium requires breaking the first line of defence in the lungs, the primary alveolar macrophages

  7. A multivariate statistical analysis on variables affecting inferior alveolar nerve damage during third molar surgery.

    Science.gov (United States)

    Pippi, R; Santoro, M

    2015-08-28

    The risk factors associated with inferior alveolar nerve damage during third molar surgery were investigated. Surgeries performed during a period of 50 months by a single expert surgeon were reviewed. Only those surgeries that met the selected inclusion criteria were considered for this study. The following tests were applied for the statistical analysis: the Kolmogorov-Smirnov test, the principal components analysis, the Mann-Whitney U test, the two-tailed exact Fisher test and the Bonferroni sequential correction. The surgical difficulty index, multi-rooted third molars and changes in the inferior alveolar nerve running in relation to the tooth roots are predictors of nerve damage. Computed tomography is mandatory when the nerve is superimposed on the tooth root on the ortopantomography. SCIENTIFIC RATIONALE FOR STUDY: Lower third molar extraction is one of the most common procedures in oral and maxillofacial surgery, and it is burdened by the risk of inferior alveolar nerve damage. Understanding which factors are able to predict this complication is therefore essential in correctly programming surgery. Surgical difficulty index, multi-rooted third molars and changes in inferior alveolar nerve running in relation to the tooth roots are predictors of nerve damage. If, on the orthopantomography, the nerve is superimposed on the tooth root, a computed tomography is mandatory to define all of these variables.

  8. Mast cell-associated alveolar inflammation in patients with atopic uncontrolled asthma

    OpenAIRE

    Andersson, Cecilia; Bergqvist, Anders; Mori, Michiko; Mauad, Thais; Bjermer, Leif; Erjefält, Jonas

    2011-01-01

    Background: A significant proportion of patients with asthma have persistent symptoms despite treatment with inhaled glucocorticosteroids. Objective: We hypothesized that in these patients, the alveolar parenchyma is subjected to mast cell-associated alterations. Methods: Bronchial and transbronchial biopsies from healthy controls (n = 8), patients with allergic rhinitis (n = 8), and patients with atopic uncontrolled asthma (symptoms despite treatment with inhaled glucocorticosteroids; mean d...

  9. Alveolar Antral Artery: Review of Surgical Techniques Involving this Anatomic Structure

    Directory of Open Access Journals (Sweden)

    Amin Rahpeyma

    2014-04-01

    Full Text Available Introduction: The horizontal bony canal in the lateral maxillary wall is the site of anastomosis between the arterial branches from the posterior superior alveolar artery (PSAa and the infraorbital artery. This anatomic structure is known as the ‘alveolar antral artery’.   Materials and Methods: We performed a literature review. The anatomic location of the alveolar antral artery in the lateral maxillary sinus wall was researched and its importance in surgical procedures routinely performed on this bony wall discussed.   Results: This artery can be accidentally involved during surgical procedures on the lateral maxillary sinus wall, such as open sinus lift surgery, horizontal osteotomy of the maxilla, Le Fort I fracture treatment, and Caldwell-Luc surgeries.   Conclusion: The alveolar antral artery is an important anatomic structure in the lateral maxillary sinus wall. A preoperative cone beam computed tomography (CBCT scan can be used as a good diagnostic procedure to reduce surgical complications in suspected cases as well as conditions that may involve this artery. 

  10. The Ovariectomized Rat as a Model for Studying Alveolar Bone Loss in Postmenopausal Women

    Directory of Open Access Journals (Sweden)

    Bryan D. Johnston

    2015-01-01

    Full Text Available In postmenopausal women, reduced bone mineral density at the hip and spine is associated with an increased risk of tooth loss, possibly due to a loss of alveolar bone. In turn, having fewer natural teeth may lead to compromised food choices resulting in a poor diet that can contribute to chronic disease risk. The tight link between alveolar bone preservation, tooth retention, better nutritional status, and reduced risk of developing a chronic disease begins with the mitigation of postmenopausal bone loss. The ovariectomized rat, a widely used preclinical model for studying postmenopausal bone loss that mimics deterioration of bone tissue in the hip and spine, can also be used to study mineral and structural changes in alveolar bone to develop drug and/or dietary strategies aimed at tooth retention. This review discusses key findings from studies investigating mandible health and alveolar bone in the ovariectomized rat model. Considerations to maximize the benefits of this model are also included. These include the measurement techniques used, the age at ovariectomy, the duration that a rat is studied after ovariectomy and habitual diet consumed.

  11. EFFECTS OF DIESEL EXHAUST PARTICLES ON HUMAN ALVEOLAR MACROPHAGE RESPONSIVENESS TO LIPOPOLYSACCHARIDE

    Science.gov (United States)

    Effects of diesel exhaust particles on human alveolar macrophage responsiveness to lipopolysaccharideS. Mundandhara1 , S. Becker2 and M. Madden2, 1UNC Center for Environmental Medicine, Asthma, and Lung Biology, 2US EPA, NHEERL, HSD, Chapel Hill, NC, USEpidemiological...

  12. Validation of a dental image analyzer tool to measure alveolar bone loss in periodontitis patients

    NARCIS (Netherlands)

    Teeuw, W.J.; Coelho, L.; de Silva, A.; van der Palen, C.J.N.M.; Lessmann, F.G.J.M.; van der Velden, U.; Loos, B.G.

    2009-01-01

    Background and Objective:  Radiographs are an essential adjunct to the clinical examination for periodontal diagnoses. Over the past few years, digital radiographs have become available for use in clinical practice. Therefore, the present study investigated whether measuring alveolar bone loss,

  13. Stimulation of DNA synthesis in cultured rat alveolar type II cells

    International Nuclear Information System (INIS)

    Leslie, C.C.; McCormick-Shannon, K.; Robinson, P.C.; Mason, R.J.

    1985-01-01

    Restoration of the alveolar epithelium after injury is thought to be dependent on the proliferation of alveolar type II cells. To understand the factors that may be involved in promoting type II cell proliferation in vivo, we determined the effect of potential mitogens and culture substrata on DNA synthesis in rat alveolar type II cells in primary culture. Type II cells cultured in basal medium containing 10% fetal bovine serum (FBS) exhibited essentially no DNA synthesis. Factors that stimulated 3 H-thymidine incorporation included cholera toxin, epidermal growth factor, and rat serum. The greatest degree of stimulation was achieved by plating type II cells on an extracellular matrix prepared from bovine corneal endothelial cells and then by culturing the pneumocytes in medium containing rat serum, cholera toxin, insulin, and epidermal growth factor. Under conditions of stimulation of 3 H-thymidine incorporation there was an increased DNA content per culture dish but no increase in cell number. The ability of various culture conditions to promote DNA synthesis in type II cells was verified by autoradiography. Type II cells were identified by the presence of cytoplasmic inclusions, which were visualized by tannic acid staining before autoradiography. These results demonstrate the importance of soluble factors and culture substratum in stimulating DNA synthesis in rat alveolar type II cells in primary culture

  14. Outcomes of Alveolar Ridge Preservation With Recombinant Human Bone Morphogenetic Protein-2: A Systematic Review.

    Science.gov (United States)

    Moslemi, Neda; Khoshkam, Vahid; Rafiee, Sahar; Bahrami, Naghmeh; Aslroosta, Hoori

    2018-02-01

    The main focused question of this systematic review was as follows: Does the application of recombinant human bone morphogenetic protein-2 (rhBMP-2) placed in extraction sockets reduce the alveolar ridge changes? A systematic literature search was performed up to February 2017. Clinical studies published in English were included. Outcome variables of interest were as follows: changes in alveolar ridge width and height, the quality of new bone, patient's safety, adverse events, and postoperative complications. Seven articles were included. Because of the vast heterogeneity and high risk of bias among the studies, performing a meta-analysis deemed not feasible. Application of rhBMP-2 in the extraction socket was more effective in the reduction of ridge width compared with that of ridge height. The superiority of 1.5 mg/mL rhBMP-2/absorbable collagen sponge over the carrier alone on alveolar ridge width/height remodeling was more significant when it was applied in the sockets with ≥50% buccal bone dehiscence. The limited available data showed that rhBMP-2 did not improve the quality of new bone. Antibodies against rhBMP-2 were detected in the serum in 1 trial. Within the limits of this review, 1.5 mg/mL rhBMP-2 might be beneficial for preserving the alveolar ridge width within extraction sockets given as to whether the cost-effectiveness is justifiable. Studies with lower risk of bias should be performed to confirm the above findings.

  15. Titanium implant insertion into dog alveolar ridges augmented by allogenic material

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Donath, K

    1994-01-01

    The purpose of this investigation was to evaluate whether titanium endosseous implants would osseointegrate in dog alveolar ridges augmented by allogenic material. In 8 dogs en bloc resection, including 2 pre-molars, was performed bilaterally in the maxilla and the mandible. After a healing period...

  16. A Potent Tartrate Resistant Acid Phosphatase Inhibitor to Study the Function of TRAP in Alveolar Macrophages

    NARCIS (Netherlands)

    Boorsma, Carian E; van der Veen, T. Anienke; Putri, Kurnia S S; de Almeida, Andreia; Draijer, Christina; Mauad, Thais; Fejer, Gyorgy; Brandsma, Corry-Anke; van den Berge, Maarten; Bossé, Yohan; Sin, Don; Hao, Ke; Reithmeier, Anja; Andersson, Göran; Olinga, Peter; Timens, Wim; Casini, Angela; Melgert, Barbro N

    2017-01-01

    The enzyme tartrate resistant acid phosphatase (TRAP, two isoforms 5a and 5b) is highly expressed in alveolar macrophages, but its function there is unclear and potent selective inhibitors of TRAP are required to assess functional aspects of the protein. We found higher TRAP activity/expression in

  17. p53 alterations in atypical alveolar hyperplasia of the human lung

    NARCIS (Netherlands)

    Slebos, R. J.; Baas, I. O.; Clement, M. J.; Offerhaus, G. J.; Askin, F. B.; Hruban, R. H.; Westra, W. H.

    1998-01-01

    Atypical alveolar hyperplasia (AAH) is a potential precursor lesion from which lung adenocarcinomas arise and may be a good target for studying the early events of lung tumorigenesis. We have previously shown that AAHs are neoplastic epithelial proliferations that often harbor activating mutations

  18. Alveolar soft-part sarcoma of the orbit | Rose | African Journal of ...

    African Journals Online (AJOL)

    Alveolar soft-part sarcoma (ASPS) is a rare soft tissue tumour of uncertain cellular origin. It accounts for only 1% of all sarcomas, which themselves represent only a small proportion of human tumours. ASPS can arise in any soft tissue of the body, but there is an unexplained predilection for the right side. The most common ...

  19. Mammary alveolar epithelial cells convert to brown adipocytes in post-lactating mice

    DEFF Research Database (Denmark)

    Giordano, Antonio; Perugini, Jessica; Kristensen, David Møbjerg

    2017-01-01

    found close to the mammary alveoli contain milk protein granules. Use of the Cre-loxP recombination system allowed showing that the involuting mammary gland of whey acidic protein-Cre/R26R mice, whose secretory alveolar cells express the lacZ gene during pregnancy, contains some X...

  20. Diesel and biodiesel exhaust particle effects on rat alveolar machrophages with in vitro exposure

    Science.gov (United States)

    We conducted in vitro exposures of Wistar rat alveolar macrophages (AM) to compare and contrast the toxicity of particulate matter (PM) produced in combustion of biodiesel blend (B20) and petroleum diesel (PDEP). The PM contain detectable levels of transition metals and ions howe...

  1. [Alveolar echinococcosis in the French province of Ardennes: isolated case or new focus?].

    Science.gov (United States)

    Depaquit, J; Gallego, A; Usseglio, F; Liance, M; Favriel, J M

    1998-09-01

    The first three autochthonous cases of alveolar echinococcosis were diagnosed in the Ardennes area (France). This is the most occidental localization of this disease in Northern Europe. The authors discuss these cases with an epidemiological regard. They are looking for relationships with natural parasitic cycle in the neighbouring country Belgium and their consequences on local public health in the future.

  2. Rapid host defense against Aspergillus fumigatus involves alveolar macrophages with a predominance of alternatively activated phenotype.

    Directory of Open Access Journals (Sweden)

    Shikha Bhatia

    Full Text Available The ubiquitous fungus Aspergillus fumigatus is associated with chronic diseases such as invasive pulmonary aspergillosis in immunosuppressed patients and allergic bronchopulmonary aspergillosis (ABPA in patients with cystic fibrosis or severe asthma. Because of constant exposure to this fungus, it is critical for the host to exercise an immediate and decisive immune response to clear fungal spores to ward off disease. In this study, we observed that rapidly after infection by A. fumigatus, alveolar macrophages predominantly express Arginase 1 (Arg1, a key marker of alternatively activated macrophages (AAMs. The macrophages were also found to express Ym1 and CD206 that are also expressed by AAMs but not NOS2, which is expressed by classically activated macrophages. The expression of Arg1 was reduced in the absence of the known signaling axis, IL-4Rα/STAT6, for AAM development. While both Dectin-1 and TLR expressed on the cell surface have been shown to sense A. fumigatus, fungus-induced Arg1 expression in CD11c(+ alveolar macrophages was not dependent on either Dectin-1 or the adaptor MyD88 that mediates intracellular signaling by most TLRs. Alveolar macrophages from WT mice efficiently phagocytosed fungal conidia, but those from mice deficient in Dectin-1 showed impaired fungal uptake. Depletion of macrophages with clodronate-filled liposomes increased fungal burden in infected mice. Collectively, our studies suggest that alveolar macrophages, which predominantly acquire an AAM phenotype following A. fumigatus infection, have a protective role in defense against this fungus.

  3. The effect of osteoporosis on periodontal status, alveolar bone and orthodontic tooth movement. A literature review.

    Science.gov (United States)

    Sidiropoulou-Chatzigiannis, Sossani; Kourtidou, Maria; Tsalikis, Lazaros

    2007-07-01

    Osteoporosis, an age-related condition, is defined as a systemic skeletal disease characterized by low bone mass and micro-architectural deterioration with a consequent increase in bone fragility and susceptibility to fracture. It is considered the most common bone metabolic disease and it constitutes a major public health problem. Several studies indicate that osteoporosis may be related to decreased oral bone density and alveolar bone loss. In osteoporotic patients, uncoupling of bone resorption and bone formation has taken place. Both bone resorption and bone formation are accelerated, and excessive bone resorption usually leads to loss of attachment. Osteoporosis could also affect the rate of tooth movement through the involvement of alveolar bone. In healthy individuals, bone is constantly being remodeled in the coupled sequence of bone resorption and formation. When a force is applied to a tooth, alveolar bone formation and resorption occur predominantly on the tension and pressure sides of the root, respectively, and the tooth moves with increased alveolar bone remodeling. Experimental studies suggest that systemic-osteoporotic hormone imbalance increases bone turnover and accelerates tooth movement while under orthodontic treatment. Based on these observations it can be concluded that deviations in bone turnover and consequent periodontal problems influence the response to orthodontic forces, and this should be taken into consideration when planning orthodontic treatment in adult patients with metabolic bone disease, especially postmenopausal females or those on chronic medication affecting bone metabolism.

  4. Evidence for an intracellular niche for Bordetella pertussis in broncho-alveolar lavage cells of mice

    NARCIS (Netherlands)

    Hellwig, SMM; Hazenbos, WLW; van de Winkel, JGJ; Mooi, FR

    1999-01-01

    Bordetella pertussis can attach, invade and survive intracellularly in human macrophages in vitro. To study the significance of this bacterial feature in vivo, we analyzed the presence of viable bacteria in broncho-alveolar lavage (BAL) cells of mice infected with B, pertussis. We found B. pertussis

  5. Alveolar dimensional changes relevant to implant placement after minimally traumatic tooth extraction with primary closure.

    Science.gov (United States)

    Carranza, Nelson; Bonta, Hernan; Gualtieri, Ariel F; Rojas, Mariana A; Galli, Federico G; Caride, Facundo

    2016-09-01

    The purpose of this study is to evaluate the dimensional changes that occur in the alveolar ridge after minimally traumatic tooth extraction by means of computed tomography (CT), with special focus on the portion of bone supporting the gingival zenith. Twenty subjects with indication for singlerooted tooth extraction and preserved alveolar walls were selected for this study. After a minimally traumatic extraction, two CT scans were performed; the first within 24 hours postextraction (TC1) and the second 6 months (TC2) later. A radiographic guide with a radiopaque marker was used to obtain references that enabled accurate measurements over time, in both vertical and horizontal directions. The bone crest immediately apical to the gingival zenith was identified and termed "osseous zenith". The displacement of the osseous zenith in horizontal and vertical direction was analyzed and correlated with several alveolar anatomical variables with the aim of identifying possible predictors for bone remodeling. Dimensional changes that occur in postextraction sockets within a 6month period showed significant vertical and horizontal displacement of the osseous zenith (p 3 mm) should be expected. The present study suggests that the width of the alveolar crest at its midlevel, rather than crestal width, may be correlated with the displacement of the osseous zenith. Sociedad Argentina de Investigación Odontológica.

  6. Combined influence of implant diameter and alveolar ridge width on crestal bone stress: a quantitative approach.

    Science.gov (United States)

    Yu, Wonjae; Jang, Yoon-Je; Kyung, Hee-Moon

    2009-01-01

    To quantitatively evaluate the combined influence of implant diameter and alveolar ridge width on crestal bone stress. ITI solid-screw implants, 10 mm in length and 3.3, 4.1, and 4.8 mm in diameter, and the alveolar bone were modeled using axisymmetric finite elements. Four different alveolar ridge geometries were selected for each implant: 5-, 6-, 7-, and 8-mm-wide ridges for the 3.3-mm implants; 6-, 7-, 8-, and 9-mm-wide ridges for the 4.1-mm implants; and 7-, 8-, 9-, and 10-mm-wide ridges for the 4.8-mm implants. A nonaxial oblique load of 100 N was applied at 30 degrees to the implant axis. Regression analysis was used to avoid ambiguity when estimating the peak stress occurring at the coronal contact point between the implant and the crestal bone, ie, the singularity point. Peak stresses were dependent on both implant diameter and alveolar ridge width. Substantially lower stresses were recorded around the implants placed in narrower ridges. A regression analysis may be used to quantify the peak stress at the singularity point. An implant with a diameter that is at least half the ridge width is recommended to reduce the stress concentration in the crestal bone.

  7. Correlation analysis of alveolar bone loss in buccal/palatal and proximal surfaces in rats

    Directory of Open Access Journals (Sweden)

    Carolina Barrera de Azambuja

    2012-12-01

    Full Text Available The aim was to correlate alveolar bone loss in the buccal/palatal and the mesial/distal surfaces of upper molars in rats. Thirty-three, 60-day-old, male Wistar rats were divided in two groups, one treated with alcohol and the other not treated with alcohol. All rats received silk ligatures on the right upper second molars for 4 weeks. The rats were then euthanized and their maxillae were split and defleshed with sodium hypochlorite (9%. The cemento-enamel junction (CEJ was stained with 1% methylene blue and the alveolar bone loss in the buccal/palatal surfaces was measured linearly in 5 points on standardized digital photographs. Measurement of the proximal sites was performed by sectioning the hemimaxillae, restaining the CEJ and measuring the alveolar bone loss linearly in 3 points. A calibrated and blinded examiner performed all the measurements. Intraclass Correlation Coefficient revealed values of 0.96 and 0.89 for buccal/lingual and proximal surfaces, respectively. The Pearson Correlation Coefficient (r between measurements in buccal/palatal and proximal surfaces was 0.35 and 0.05 for the group treated with alcohol, with and without ligatures, respectively. The best correlations between buccal/palatal and proximal surfaces were observed in animals not treated with alcohol, in sites both with and without ligatures (r = 0.59 and 0.65, respectively. A positive correlation was found between alveolar bone loss in buccal/palatal and proximal surfaces. The correlation is stronger in animals that were not treated with alcohol, in sites without ligatures. Areas with and without ligature-induced periodontal destruction allow detection of alveolar bone loss in buccal/palatal and proximal surfaces.

  8. Orthodontically guided bone transport in the treatment of alveolar cleft: A case report

    Science.gov (United States)

    Gómez, Elena; Otero, Marta; Berraquero, Rosario; Wucherpfennig, Begona; Hernández-Godoy, Juan; Guiñales, Jorge; Vincent, Germán; Burgueño, Miguel

    2016-01-01

    Introduction Conventional treatments are sometimes not possible in certain alveolar cleft cases due to the severity of the gap which separates the fragments. Various management strategies have been proposed, including sequential surgical interventions or delaying treatment until adulthood to then carry out maxillary osteotomies. A further alternative approach has also been proposed, involving the application of bone transport techniques to mobilise the osseous fragments and thereby reduce the gap between lateral fragments and the premaxilla. Case Report We introduce the case of a 10-year-old patient who presented with a bilateral alveolar cleft and a severe gap. Stable occlusion between the premaxilla and the mandible was achieved following orthodontic treatment, making it inadvisable to perform a retrusive osteotomy of the premaxilla in order to close the alveolar clefts. Faced with this situation, it was decided we would employ a bone transport technique under orthodontic guidance using a dental splint. This would enable an osseous disc to be displaced towards the medial area and reduce the interfragmentary distance. During a second surgical intervention, closure of the soft tissues was performed and the gap was filled in using autogenous bone. Conclusions The use of bone transport techniques in selected cases allows closure of the osseous defect, whilst also preserving soft tissues and reducing the amount of bone autograft required. In our case, we were able to respect the position of the premaxilla and, at the same time, generate new tissues at both an alveolar bone and soft tissue level with results which have remained stable over the course of time. Key words:Alveolar cleft, bone transport, graft. PMID:26855699

  9. Zanthoxylum piperitum reversed alveolar bone loss of periodontitis via regulation of bone remodeling-related factors.

    Science.gov (United States)

    Kim, Mi Hye; Lee, Hye Ji; Park, Jung-Chul; Hong, Jongki; Yang, Woong Mo

    2017-01-04

    Zanthoxylum piperitum (ZP) has been used to prevent toothache in East Asia. In this study, we investigated the effects of ZP on periodontitis along with alveolar bone loss. Twenty-eight male Sprague-Dawley rats were assigned into 4 groups; non-ligated (NOR), ligated and treated vehicle (CTR), ligated and treated 1mg/mL ZP (ZP1), and ligated and treated 100mg/mL ZP (ZP100). Sterilized 3-0 nylon ligature was placed into the subgingival sulcus around the both sides of mandibular first molar. After topical application of 1 and 100mg/mL ZP for 2 weeks, mandibles was removed for histology. In addition, SaOS-2 osteoblast cells were treated 1, 10 and 100μg/mL ZP for 24h to analyze the expressions of alveolar bone-related markers. Several alveolar bone resorption pits, which indicate cementum demineralization were decreased by ZP treatment. Topical ZP treatment inhibited periodontitis-induced alveolar bone loss. In addition, there were significant reduction of osteoclastic activities following topical ZP treatment in periodontium. The expression of RANKL was decreased in SaOS-2 osteoblast cells by treating ZP, while that of OPG was increased. ZP treatment increased the expressions of Runx2 and Osterix in SaOS-2 cells. In summary, ZP treatment inhibited alveolar bone loss as well as maintained the integrity of periodontal structures via regulation of bone remodeling. ZP may be a therapeutic target for treating periodontitis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  10. Influence of lip closure on alveolar cleft width in patients with cleft lip and palate

    Directory of Open Access Journals (Sweden)

    Schmelzle Rainer

    2011-01-01

    Full Text Available Abstract Background The influence of surgery on growth and stability after treatment in patients with cleft lip and palate are topics still under discussion. The aim of the present study was to investigate the influence of early lip closure on the width of the alveolar cleft using dental casts. Methods A total of 44 clefts were investigated using plaster casts, 30 unilateral and 7 bilateral clefts. All infants received a passive molding plate a few days after birth. The age at the time of closure of the lip was 2.1 month in average (range 1-6 months. Plaster casts were obtained at the following stages: shortly after birth, prior to lip closure, prior to soft palate closure. We determined the width of the alveolar cleft before lip closure and prior to soft palate closure measuring the alveolar cleft width from the most lateral point of the premaxilla/anterior segment to the most medial point of the smaller segment. Results After lip closure 15 clefts presented with a width of 0 mm, meaning that the mucosa of the segments was almost touching one another. 19 clefts showed a width of up to 2 mm and 10 clefts were still over 2 mm wide. This means a reduction of 0% in 5 clefts, of 1-50% in 6 clefts, of 51-99% in 19 clefts, and of 100% in 14 clefts. Conclusions Early lip closure reduces alveolar cleft width. In most cases our aim of a remaining cleft width of 2 mm or less can be achieved. These are promising conditions for primary alveolar bone grafting to restore the dental bony arch.

  11. Comparison of the buccolingual inclination in alveolar bone and tooth using dental CBCT

    International Nuclear Information System (INIS)

    Kim, Sung Eun; Kim, Jin Soo; Kim, Jae Duk

    2008-01-01

    It is important to determine the bucco-lingual inclination of implants on radiographs before the implant surgery. The purpose of this study was to compare the buccolingual inclination in alveolar bone and the tooth with dental cone beam CT and to prepare the standard for the buccolingual inclination of implant. Axial, panoramic, and buccolingually sectioned images of 80 implant cases with stent including straight marker using CB Mercuray TM (Hitachi, Japan) were evaluated. The comparison of the buccolingual inclination of remained alveolar bone with the tooth and the marker on buccolingually sectioned views was performed statistically. The average buccolingual inclination of remained alveolar bone and tooth was 82.8 ± 4.6 .deg. C and 85.8 ± 4.7 .deg. C (p 0.05, r=0.12) at the 2nd premolar area in upper jaw. The average buccolingual inclination of remained alveolar bone and tooth was 81.3 ± 8.3 .deg. C and 87.5 ± 6.3 .deg. C (p>0.05, r=0.85) at the lower 2nd premolar area and 94.3 ± 6.6 .deg. C and 93.3 ± 7.2 .deg. C respectively (p>0.05, r=0.91) at the 1st molar area in lower jaw. The inclinations of markers were very different from those of remained bone at the most of areas except the upper 2nd premolar area (r=0.79). We recommend dental CBCT analysis for determining the buccolingual inclination of dental implant, because of significant difference, in average, between the buccolingual inclination of remained alveolar bone and tooth.

  12. Intravenous S-Ketamine Does Not Inhibit Alveolar Fluid Clearance in a Septic Rat Model

    Science.gov (United States)

    Weber, Nina C.; van der Sluijs, Koen; Hackl, Florian; Hotz, Lorenz; Dahan, Albert; Hollmann, Markus W.; Berger, Marc M.

    2014-01-01

    We previously demonstrated that intratracheally administered S-ketamine inhibits alveolar fluid clearance (AFC), whereas an intravenous (IV) bolus injection had no effect. The aim of the present study was to characterize whether continuous IV infusion of S-ketamine, yielding clinically relevant plasma concentrations, inhibits AFC and whether its effect is enhanced in acute lung injury (ALI) which might favor the appearance of IV S-ketamine at the alveolar surface. AFC was measured in fluid-instilled rat lungs. S-ketamine was administered IV over 6 h (loading dose: 20 mg/kg, followed by 20 mg/kg/h), or intratracheally by addition to the instillate (75 µg/ml). ALI was induced by IV lipopolysaccharide (LPS; 7 mg/kg). Interleukin (IL)-6 and cytokine-induced neutrophil chemoattractant (CINC)-3 were measured by ELISA in plasma and bronchoalveolar lavage fluid. Isolated rat alveolar type-II cells were exposed to S-ketamine (75 µg/ml) and/or LPS (1 mg/ml) for 6 h, and transepithelial ion transport was measured as short circuit current (ISC). AFC was 27±5% (mean±SD) over 60 min in control rats and was unaffected by IV S-ketamine. Tracheal S-ketamine reduced AFC to 18±9%. In LPS-treated rats, AFC decreased to 16±6%. This effect was not enhanced by IV S-ketamine. LPS increased IL-6 and CINC-3 in plasma and bronchoalveolar lavage fluid. In alveolar type-II cells, S-ketamine reduced ISC by 37% via a decrease in amiloride-inhibitable sodium transport. Continuous administration of IV S-ketamine does not affect rat AFC even in endotoxin-induced ALI. Tracheal application with direct exposure of alveolar epithelial cells to S-ketamine decreases AFC by inhibition of amiloride-inhibitable sodium transport. PMID:25386677

  13. Cultured alveolar epithelial cells from septic rats mimic in vivo septic lung.

    Directory of Open Access Journals (Sweden)

    Taylor S Cohen

    2010-06-01

    Full Text Available Sepsis results in the formation of pulmonary edema by increasing in epithelial permeability. Therefore we hypothesized that alveolar epithelial cells isolated from septic animals develop tight junctions with different protein composition and reduced barrier function relative to alveolar epithelial cells from healthy animals. Male rats (200-300 g were sacrificed 24 hours after cecal ligation and double puncture (2CLP or sham surgery. Alveolar epithelial cells were isolated and plated on fibronectin-coated flexible membranes or permeable, non-flexible transwell substrates. After a 5 day culture period, cells were either lysed for western analysis of tight junction protein expressin (claudin 3, 4, 5, 7, 8, and 18, occludin, ZO-1, and JAM-A and MAPk (JNK, ERK, an p38 signaling activation, or barrier function was examined by measuring transepithelial resistance (TER or the flux of two molecular tracers (5 and 20 A. Inhibitors of JNK (SP600125, 20 microM and ERK (U0126, 10 microM were used to determine the role of these pathways in sepsis induced epithelial barrier dysfunction. Expression of claudin 4, claudin 18, and occludin was significantly lower, and activation of JNK and ERK signaling pathways was significantly increased in 2CLP monolayers, relative to sham monolayers. Transepithelial resistance of the 2CLP monolayers was reduced significantly compared to sham (769 and 1234 ohm-cm(2, respectively, however no significant difference in the flux of either tracer was observed. Inhibition of ERK, not JNK, significantly increased TER and expression of claudin 4 in 2CLP monolayers, and prevented significant differences in claudin 18 expression between 2CLP and sham monolayers. We conclude that alveolar epithelial cells isolated from septic animals form confluent monolayers with impaired barrier function compared to healthy monolayers, and inhibition of ERK signaling partially reverses differences between these monolayers. This model provides a unique

  14. Cigarette Smoke Enhances the Expression of Profibrotic Molecules in Alveolar Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Marco Checa

    Full Text Available Idiopathic pulmonary fibrosis (IPF is a progressive and lethal disease of unknown etiology. A growing body of evidence indicates that it may result from an aberrant activation of alveolar epithelium, which induces the expansion of the fibroblast population, their differentiation to myofibroblasts and the excessive accumulation of extracellular matrix. The mechanisms that activate the alveolar epithelium are unknown, but several studies indicate that smoking is the main environmental risk factor for the development of IPF. In this study we explored the effect of cigarette smoke on the gene expression profile and signaling pathways in alveolar epithelial cells. Lung epithelial cell line from human (A549, was exposed to cigarette smoke extract (CSE for 1, 3, and 5 weeks at 1, 5 and 10% and gene expression was evaluated by complete transcriptome microarrays. Signaling networks were analyzed with the Ingenuity Pathway Analysis software. At 5 weeks of exposure, alveolar epithelial cells acquired a fibroblast-like phenotype. At this time, gene expression profile revealed a significant increase of more than 1000 genes and deregulation of canonical signaling pathways such as TGF-β and Wnt. Several profibrotic genes involved in EMT were over-expressed, and incomplete EMT was observed in these cells, and corroborated in mouse (MLE-12 and rat (RLE-6TN epithelial cells. The secretion of activated TGF-β1 increased in cells exposed to cigarette smoke, which decreased when the integrin alpha v gene was silenced. These findings suggest that the exposure of alveolar epithelial cells to CSE induces the expression and release of a variety of profibrotic genes, and the activation of TGF-β1, which may explain at least partially, the increased risk of developing IPF in smokers.

  15. Importance of Bacterial Replication and Alveolar Macrophage-Independent Clearance Mechanisms during Early Lung Infection with Streptococcus pneumoniae

    Science.gov (United States)

    Camberlein, Emilie; Cohen, Jonathan M.; José, Ricardo; Hyams, Catherine J.; Callard, Robin; Chimalapati, Suneeta; Yuste, Jose; Edwards, Lindsey A.; Marshall, Helina; van Rooijen, Nico; Noursadeghi, Mahdad

    2015-01-01

    Although the importance of alveolar macrophages for host immunity during early Streptococcus pneumoniae lung infection is well established, the contribution and relative importance of other innate immunity mechanisms and of bacterial factors are less clear. We have used a murine model of S. pneumoniae early lung infection with wild-type, unencapsulated, and para-amino benzoic acid auxotroph mutant TIGR4 strains to assess the effects of inoculum size, bacterial replication, capsule, and alveolar macrophage-dependent and -independent clearance mechanisms on bacterial persistence within the lungs. Alveolar macrophage-dependent and -independent (calculated indirectly) clearance half-lives and bacterial replication doubling times were estimated using a mathematical model. In this model, after infection with a high-dose inoculum of encapsulated S. pneumoniae, alveolar macrophage-independent clearance mechanisms were dominant, with a clearance half-life of 24 min compared to 135 min for alveolar macrophage-dependent clearance. In addition, after a high-dose inoculum, successful lung infection required rapid bacterial replication, with an estimated S. pneumoniae doubling time of 16 min. The capsule had wide effects on early lung clearance mechanisms, with reduced half-lives of 14 min for alveolar macrophage-independent and 31 min for alveolar macrophage-dependent clearance of unencapsulated bacteria. In contrast, with a lower-dose inoculum, the bacterial doubling time increased to 56 min and the S. pneumoniae alveolar macrophage-dependent clearance half-life improved to 42 min and was largely unaffected by the capsule. These data demonstrate the large effects of bacterial factors (inoculum size, the capsule, and rapid replication) and alveolar macrophage-independent clearance mechanisms during early lung infection with S. pneumoniae. PMID:25583525

  16. Raloxifene reduces the risk of local alveolar bone destruction in a mouse model of periodontitis combined with systemic postmenopausal osteoporosis.

    Science.gov (United States)

    Ichimaru, Ryota; Tominari, Tsukasa; Yoshinouchi, Shosei; Matsumoto, Chiho; Watanabe, Kenta; Hirata, Michiko; Numabe, Yukihiro; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato; Inada, Masaki

    2018-01-01

    Periodontitis is characterized by local inflammation leading to tooth loss and severe destruction of alveolar bone. Raloxifene is a selective estrogen receptor modulator (SERM) that halts estrogen deficiency-induced systemic bone loss in postmenopausal osteoporosis without the side effects of cancer in breast and uterus. In this study, we examined the effects of raloxifene on alveolar bone mass in a mouse model with estrogen deficiency-induced periodontitis. Periodontitis was induced by the injection of lipopolysaccharide (LPS) into the lower gingiva in ovariectomized (OVX) mice, and the alveolar bone and femur bone mineral density (BMD) were analyzed by dual-energy X-ray absorptiometry. To explore the direct osteoclast inhibitory effect of raloxifene, a co-culture system for osteoclast formation and organ culture of alveolar bone was established. When OVX mice were treated with raloxifene, the bone loss in both alveolar bone and femur were abrogated. Interleukin 1 and/or LPS stimulated the osteoclast formation and bone-resorbing activity; however, raloxifene did not show any inhibitory effect on the osteoclast formation or function. In vivo local injection of raloxifene also did not prevent bone resorption in a mouse model of periodontitis. However, the systemic treatment of raloxifene using a mini-osmotic pump did prevent the loss of BMD of alveolar bone induced by LPS. These results suggest that the SERM raloxifene systemically maintain alveolar bone mass in a mouse model of periodontitis with osteoporosis. Increasing the alveolar bone mass by SERMs treatment in patients with postmenopausal osteoporosis may be a useful approach to preventing the destruction of alveolar bone in late-onset periodontitis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Diagnosis of alveolar and root fractures in macerated canine maxillae: a comparison between two different CBCT protocols.

    Science.gov (United States)

    Kobayashi-Velasco, Solange; Salineiro, Fernanda C S; Gialain, Ivan O; Cavalcanti, Marcelo G P

    2017-08-01

    To compare two small-field-of-view (FOV) CBCT protocols with different voxel sizes and number of frames for the diagnosis of root and alveolar fractures in macerated canine maxillae. 80 incisor teeth from the canine species were inserted in 80 anterior alveolar sockets of 20 canine maxillae. An operator randomly divided each maxilla site (80 sites in total) into 4 equal groups of 20 sites: 1 (sound tooth and non-fractured alveolar socket); 2 (sound tooth and fractured alveolar socket); 3 (fractured root and non-fractured alveolar socket); and 4 (fractured root and fractured alveolar socket). The CBCT images were obtained using two different protocols: normal (N) (voxel 0.20 mm, 400 frames and radiation exposure 5.6 mGy) and high definition (HD) (voxel 0.15 mm, 500 frames and radiation exposure 7.0 mGy). Sensitivity numbers for alveolar fractures were lower than specificity, resulting in comparable areas under the receiver operating characteristic curves (AUC) for both protocols. Sensitivity, specificity and AUC for N and HD protocols were very similar for root fractures. When comparing AUC for both N and HD protocols by submitting them to Student's t-test, the comparison among the curves produced statistically non-significant results for alveolar fractures and root fractures likewise. Our findings demonstrated that the elected protocol for the diagnosis of root and alveolar fractures was N. This protocol allowed similar diagnosis results than HD protocol; however, with a lower amount of radiation exposure for the patient (5.6 mGy for N vs 7.0 mGy for HD).

  18. A randomized controlled evaluation of alveolar ridge preservation following tooth extraction using deproteinized bovine bone mineral and demineralized freeze-dried bone allograft.

    Science.gov (United States)

    Sadeghi, Rokhsareh; Babaei, Maryam; Miremadi, S Asghar; Abbas, Fatemeh Mashadi

    2016-01-01

    Alveolar ridge preservation could be performed immediately following tooth extraction to limit dimensional changes of alveolar process due to bone resorption. The aim of this study was to compare the clinical and histologic outcomes of socket preservation using two different graft materials; deproteinized bovine bone mineral (DBBM) and demineralized freeze-dried bone allograft (DFDBA) with absorbable collagen membrane. Twenty extraction sockets in 20 patients were randomly divided into 2 treatment groups: 10 sockets were augmented with DBBM and collagen membrane whereas 10 sockets were filled with DFDBA and covered by collagen membrane. Primary closure was achieved over extraction sockets by flap advancement. Horizontal and vertical ridge dimensional changes were assessed at baseline and after 4-6 months at the time of implant placement. For histological and histomorphometrical analysis, bone samples were harvested from the augmented sites with trephine during implant surgery. All data were analyzed using SPSS version 18 (α=0.05). Clinical measurements revealed that average horizontal reduction was 2.3 ± 0.64 mm for DFDBA and 2.26 ± 0.51 mm for DBBM. Mean vertical ridge resorption at buccal side was 1.29 ± 0.68 mm for DFDBA and 1.1 ± 0.17 mm for DBBM. Moreover, mean vertical ridge reduction at lingual site was 0.41 ± 0.38 mm and 0.35 ± 0.34 mm for DFDBA and DBBM, respectively. No significant differences were seen between two groups in any of those clinical parameters. Histologic analysis showed statistically significant more new bone deposition for DFDBA compared to DBBM (34.49 ± 3.19 vs. 18.76 ± 3.54) (P alveolar ridge preservation after tooth extraction, but there was more new bone formation and less residual graft particles in DFDBA group than in DBBM group.

  19. Comparative Alveolar Ridge Preservation Using Allogenous Tooth Graft versus Free-dried Bone Allograft: A Randomized, Controlled, Prospective, Clinical Pilot Study.

    Science.gov (United States)

    Joshi, Chaitanya Pradeep; D'Lima, Cynthia Bernardo; Samat, Urmila Chandrashekhar; Karde, Prerna Ashok; Patil, Agraja Ganpat; Dani, Nitin Hemchandra

    2017-01-01

    For the first time in India, allografts from human extracted teeth were prepared. A randomized, prospective, clinicoradiographical, histological study was conducted to evaluate their efficacy in comparison with freeze-dried bone allograft (FDBA) in alveolar ridge preservation. Graft preparation: with written consent, teeth were collected from three donors (full mouth extraction cases). Once donors' serums were tested negative for HIV, HBV, HCV, and Venereal disease research laboratory (VDRL), mineralized whole tooth allograft (WTA) and dentin allograft (DA) were prepared using the standard protocol of Tissue Bank at Tata Memorial Hospital, Mumbai, India. In this randomized controlled trial, 15 patients undergoing extraction of at least four teeth were selected. In each patient after atraumatic extractions, one socket was grafted with WTA, second with DA, third with FDBA, and fourth was left ungrafted (control site). All the sites were covered with chorion membrane. To estimate three-dimensional alveolar crest changes, cone beam computed tomography scans were taken immediately after grafting and 4 months postoperatively. Bone biopsies using 3 mm trephine bur were obtained from four patients at the time of implant placement and evaluated histologically. Clinically uneventful healing was observed at all sites. Compared to other sites, WTA and DA consistently showed superior results demonstrating least reduction in alveolar crest height and width which was statistically significant ( P < 0.05). Between WTA and DA sites, there was no statistically significant difference. Histological analysis also confirmed more new bone formation at WTA and DA sites. Rather than disposing extracted human teeth as a biomedical waste (common practice), they can be collected from suitable systemically healthy donors. With the help of tissue bank, they can be processed into an allograft, serving as an excellent alternative to conventional allografts.

  20. Alterations of alveolar type II cells and intraalveolar surfactant after bronchoalveolar lavage and perfluorocarbon ventilation. An electron microscopical and stereological study in the rat lung

    Directory of Open Access Journals (Sweden)

    Burkhardt Wolfram

    2007-06-01

    Full Text Available Abstract Background Repeated bronchoalveolar lavage (BAL has been used in animals to induce surfactant depletion and to study therapeutical interventions of subsequent respiratory insufficiency. Intratracheal administration of surface active agents such as perfluorocarbons (PFC can prevent the alveolar collapse in surfactant depleted lungs. However, it is not known how BAL or subsequent PFC administration affect the intracellular and intraalveolar surfactant pool. Methods Male wistar rats were surfactant depleted by BAL and treated for 1 hour by conventional mechanical ventilation (Lavaged-Gas, n = 5 or partial liquid ventilation with PF 5080 (Lavaged-PF5080, n = 5. For control, 10 healthy animals with gas (Healthy-Gas, n = 5 or PF5080 filled lungs (Healthy-PF5080, n = 5 were studied. A design-based stereological approach was used for quantification of lung parenchyma and the intracellular and intraalveolar surfactant pool at the light and electron microscopic level. Results Compared to Healthy-lungs, Lavaged-animals had more type II cells with lamellar bodies in the process of secretion and freshly secreted lamellar body-like surfactant forms in the alveoli. The fraction of alveolar epithelial surface area covered with surfactant and total intraalveolar surfactant content were significantly smaller in Lavaged-animals. Compared with Gas-filled lungs, both PF5080-groups had a significantly higher total lung volume, but no other differences. Conclusion After BAL-induced alveolar surfactant depletion the amount of intracellularly stored surfactant is about half as high as in healthy animals. In lavaged animals short time liquid ventilation with PF5080 did not alter intra- or extracellular surfactant content or subtype composition.

  1. Disseminated Alveolar Hydatid Disease Resembling a Metastatic Malignancy: A Diagnostic Challenge—A Report of Two Cases

    Directory of Open Access Journals (Sweden)

    Mesut Bulakci

    2014-01-01

    Full Text Available Alveolar hydatid disease or alveolar echinococcosis is a disease of the parasite Echinococcus multilocularis that is potentially fatal if left untreated. It primarily involves the liver but can be disseminated to other organs like the lungs and the brain by hematogenous route. Multiorgan involvement and the aggressive appearance of lesions make alveolar hydatid disease easy to confuse with a metastatic malignancy. For this reason, histopathological confirmation is essential for definite diagnosis. We present the imaging features of this disease in two patients in order to emphasize that these lesions can be easily misdiagnosed as malignancies.

  2. [Application of miniscrew for extraction of mesially impacted wisdom tooth adjacent to the inferior alveolar nerve canal].

    Science.gov (United States)

    Ma, Xiao-qing; Fan, Jian-fen; Xu, Pei-cheng; Xiang, Fei; Qin, Fei

    2015-04-01

    To study the value of miniscrew for extraction of mesially impacted wisdom tooth adjacent to the inferior alveolar nerve canal. Fourteen mesially impacted wisdom teeth were proven to be adjacent to the inferior alveolar nerve canal by means of cone-beam CT scan. The treatment began with the miniscrew traction of the wisdom teeth. After 2-5 months, they were moved away from the canal and then extracted. After extraction, all 14 cases did not show any obvious side effect. Application of miniscrew traction is a valuable method for minimally invasive extraction of mesially impacted wisdom tooth that is adjacent to the inferior alveolar nerve canal.

  3. Proteinase-activated receptor 4 stimulation-induced epithelial-mesenchymal transition in alveolar epithelial cells

    Directory of Open Access Journals (Sweden)

    Araki Hiromasa

    2007-04-01

    Full Text Available Abstract Background Proteinase-activated receptors (PARs; PAR1–4 that can be activated by serine proteinases such as thrombin and neutrophil catepsin G are known to contribute to the pathogenesis of various pulmonary diseases including fibrosis. Among these PARs, especially PAR4, a newly identified subtype, is highly expressed in the lung. Here, we examined whether PAR4 stimulation plays a role in the formation of fibrotic response in the lung, through alveolar epithelial-mesenchymal transition (EMT which contributes to the increase in myofibroblast population. Methods EMT was assessed by measuring the changes in each specific cell markers, E-cadherin for epithelial cell, α-smooth muscle actin (α-SMA for myofibroblast, using primary cultured mouse alveolar epithelial cells and human lung carcinoma-derived alveolar epithelial cell line (A549 cells. Results Stimulation of PAR with thrombin (1 U/ml or a synthetic PAR4 agonist peptide (AYPGKF-NH2, 100 μM for 72 h induced morphological changes from cobblestone-like structure to elongated shape in primary cultured alveolar epithelial cells and A549 cells. In immunocytochemical analyses of these cells, such PAR4 stimulation decreased E-cadherin-like immunoreactivity and increased α-SMA-like immunoreactivity, as observed with a typical EMT-inducer, tumor growth factor-β (TGF-β. Western blot analyses of PAR4-stimulated A549 cells also showed similar changes in expression of these EMT-related marker proteins. Such PAR4-mediated changes were attenuated by inhibitors of epidermal growth factor receptor (EGFR kinase and Src. PAR4-mediated morphological changes in primary cultured alveolar epithelial cells were reduced in the presence of these inhibitors. PAR4 stimulation increased tyrosine phosphorylated EGFR or tyrosine phosphorylated Src level in A549 cells, and the former response being inhibited by Src inhibitor. Conclusion PAR4 stimulation of alveolar epithelial cells induced epithelial

  4. Assessment of alveolar bone height and width using 64-MDCT examination for dental implants

    International Nuclear Information System (INIS)

    Sekiya, Kotaro; Kaneda, Takashi; Sekiya, Keiko; Mori, Shintaro; Sakayanagi, Masashi

    2011-01-01

    There have been many reports showing the usefulness of CT examinations for preoperative dental implant treatment, and some reports on clinical statistics using CT examinations. However, there have been few reports on alveolar bone height and width of over 1,000 Japanese cases. The purpose of this study was to evaluate alveolar bone height and width of 4,123 sites in 1,056 Japanese cases using preoperative CT examinations. The subjects consisted of 4,123 regions in 1,056 cases (370 males and 686 females, mean age 56.1 years old, range 15-87) of preoperative CT examinations conducted from January 2008 to March 2009. The CT examinations were performed using the Aquilion TM 64 (Toshiba Medical Systems Corporation) as the multi detector row CT (MDCT) unit, and ZIOSTATION (ZIOSOFT) as the workstation. The CT images were displayed on the workstation, and the alveolar bone height and width were measured to one decimal place (rounded off to two decimal places). The average alveolar bone height was 14.8 mm (SD±3.8) in the upper anterior area, 11.2 mm (SD±5.5) in the upper premolar area, 6.8 mm (SD±5.4) in the upper molar area, 19.5 mm (SD±5.4) in the lower anterior area, 14.2 mm (SD±3.9) in the lower premolar area, and 13.4 mm (SD±3.4) in the lower molar area. The average alveolar bone width was 4.3 mm (SD±1.9) in the anterior area, 5.7 mm (SD±2.3) in the upper premolar area, 7.9 mm (SD±3.1) in the upper molar area, 4.8 mm (SD±2.1) in the lower anterior area, 5.9 mm (SD±2.2) in the lower premolar area, and 6.9 mm (SD±2.5) in the lower molar area. Our results using preoperative CT examinations indicated that many of the Japanese cases had insufficient alveolar bone height and width for dental implants. (author)

  5. Deoxypyridinoline level in gingival crevicular fluid as alveolar bone loss biomarker in periodontal disease

    Directory of Open Access Journals (Sweden)

    Agustin Wulan Suci Dharmayanti

    2012-06-01

    Full Text Available Background: Periodontal diseases have high prevalence in Indonesia. They are caused by bacteria plaque that induced host response to release pro inflammatory mediator. Pro inflammatory mediators and bacteria product cause degradation of collagen fibers in periodontal tissue. Deoxypyridinoline is one of pyridinoline cross-link of collagen type I that can be used as biomarker in bone metabolic diseases, however, their contribution to detect alveolar bone loss in periodontal diseases remains unclear. Purpose: This study was to evaluate deoxypyridinoline level in gingival crevicular fluid as alveolar bone loss biomarker on periodontal disease. Methods: This study used 24 subjects with periodontal diseases and 6 healthy subjects. Dividing of periodontal disease was based on index periodontal. Gingival crevicular fluid was taken at mesial site of maxillary posterior tooth by paper point and deoxypyridinoline be measured by ELISA technique. Results: We found increasing of deoxypyridinoline level following of the severity of periodontal diseases. There was also significant difference between healthy subjects and periodontal diseases subjects (p<0.05. Conclusion: Deoxypyridinoline level in gingiva crevicular fluid can be used as alveolar bone loss biomarker in periodontal disease subjects.Latar belakang: Prevalensi penyakit periodontal di Indonesia cukup tinggi. Ini disebabkan oleh bakteri plak yang merangsang respon tubuh untuk mengeluarkan mediator keradangan. Mediator keradangan dan produk bakteri menyebabkan degradasi serat kolagen jaringan periodontal. Deoksipiridinolin merupakan salah satu ikatan piridinium dari kolagen tipe I yang dapat digunakan sebagai biomarker penyakit metabolisme tubuh. Akan tetapi, penggunaan deoksipiridinolin untuk mendeteksi kehilangan tulang alveolar pada penyakit periodontal masih belum jelas. Tujuan: Tujuan penelitian ini untuk mengetahui bahwa kadar deoksipiridinolin pada cairan krevikular gingival dapat digunakan

  6. Potential Link between the Sphingosine-1-Phosphate (S1P System and Defective Alveolar Macrophage Phagocytic Function in Chronic Obstructive Pulmonary Disease (COPD.

    Directory of Open Access Journals (Sweden)

    Jameel Barnawi

    Full Text Available We previously reported that alveolar macrophages from patients with chronic obstructive pulmonary disease (COPD are defective in their ability to phagocytose apoptotic cells, with a similar defect in response to cigarette smoke. The exact mechanisms for this defect are unknown. Sphingolipids including ceramide, sphingosine and sphingosine-1-phosphate (S1P are involved in diverse cellular processes and we hypothesised that a comprehensive analysis of this system in alveolar macrophages in COPD may help to delineate the reasons for defective phagocytic function.We compared mRNA expression of sphingosine kinases (SPHK1/2, S1P receptors (S1PR1-5 and S1P-degrading enzymes (SGPP1, SGPP2, SGPL1 in bronchoalveolar lavage-derived alveolar macrophages from 10 healthy controls, 7 healthy smokers and 20 COPD patients (10 current- and 10 ex-smokers using Real-Time PCR. Phagocytosis of apoptotic cells was investigated using flow cytometry. Functional associations were assessed between sphingosine signalling system components and alveolar macrophage phagocytic ability in COPD. To elucidate functional effects of increased S1PR5 on macrophage phagocytic ability, we performed the phagocytosis assay in the presence of varying concentrations of suramin, an antagonist of S1PR3 and S1PR5. The effects of cigarette smoking on the S1P system were investigated using a THP-1 macrophage cell line model.We found significant increases in SPHK1/2 (3.4- and 2.1-fold increases respectively, S1PR2 and 5 (4.3- and 14.6-fold increases respectively, and SGPL1 (4.5-fold increase in COPD vs. controls. S1PR5 and SGPL1 expression was unaffected by smoking status, suggesting a COPD "disease effect" rather than smoke effect per se. Significant associations were noted between S1PR5 and both lung function and phagocytosis. Cigarette smoke extract significantly increased mRNA expression of SPHK1, SPHK2, S1PR2 and S1PR5 by THP-1 macrophages, confirming the results in patient

  7. Potential Link between the Sphingosine-1-Phosphate (S1P) System and Defective Alveolar Macrophage Phagocytic Function in Chronic Obstructive Pulmonary Disease (COPD).

    Science.gov (United States)

    Barnawi, Jameel; Tran, Hai; Jersmann, Hubertus; Pitson, Stuart; Roscioli, Eugene; Hodge, Greg; Meech, Robyn; Haberberger, Rainer; Hodge, Sandra

    2015-01-01

    We previously reported that alveolar macrophages from patients with chronic obstructive pulmonary disease (COPD) are defective in their ability to phagocytose apoptotic cells, with a similar defect in response to cigarette smoke. The exact mechanisms for this defect are unknown. Sphingolipids including ceramide, sphingosine and sphingosine-1-phosphate (S1P) are involved in diverse cellular processes and we hypothesised that a comprehensive analysis of this system in alveolar macrophages in COPD may help to delineate the reasons for defective phagocytic function. We compared mRNA expression of sphingosine kinases (SPHK1/2), S1P receptors (S1PR1-5) and S1P-degrading enzymes (SGPP1, SGPP2, SGPL1) in bronchoalveolar lavage-derived alveolar macrophages from 10 healthy controls, 7 healthy smokers and 20 COPD patients (10 current- and 10 ex-smokers) using Real-Time PCR. Phagocytosis of apoptotic cells was investigated using flow cytometry. Functional associations were assessed between sphingosine signalling system components and alveolar macrophage phagocytic ability in COPD. To elucidate functional effects of increased S1PR5 on macrophage phagocytic ability, we performed the phagocytosis assay in the presence of varying concentrations of suramin, an antagonist of S1PR3 and S1PR5. The effects of cigarette smoking on the S1P system were investigated using a THP-1 macrophage cell line model. We found significant increases in SPHK1/2 (3.4- and 2.1-fold increases respectively), S1PR2 and 5 (4.3- and 14.6-fold increases respectively), and SGPL1 (4.5-fold increase) in COPD vs. controls. S1PR5 and SGPL1 expression was unaffected by smoking status, suggesting a COPD "disease effect" rather than smoke effect per se. Significant associations were noted between S1PR5 and both lung function and phagocytosis. Cigarette smoke extract significantly increased mRNA expression of SPHK1, SPHK2, S1PR2 and S1PR5 by THP-1 macrophages, confirming the results in patient-derived macrophages

  8. Rapid Progression of Metastatic Pulmonary Calcification and Alveolar Hemorrhage in a Patient with Chronic Renal Failure and Primary Hyperparathyroidism

    International Nuclear Information System (INIS)

    Yoon, Eun Joo; Kim, Dong Hun; Yoon, Seong Ho; Suk, Eun Ha

    2013-01-01

    Metastatic pulmonary calcification (MPC) is common in patients with chronic renal failure. The authors experienced a patient with chronic renal failure and primary hyperparathyroidism by parathyroid adenoma accompanied with rapid progressions of MPC and alveolar hemorrhage. Recent chest radiographs, compared with previous chest radiographs, showed rapid accumulation of calcification in both upper lungs. Following up on the high-resolution CT scan after five years demonstrates more increased nodules in size and ground glass opacity. The patient was diagnosed with MPC and alveolar hemorrhage by transbronchial lung biopsy. We assumed rapid progression of MPC and alveolar hemorrhage in underlying chronic renal failures could be a primary hyperparathyroidism which may be caused by parathyroid adenoma detected incidentally. Therefore parathyroid adenoma was treated with ethanol injections. Herein, we have reported on CT findings of MPC with alveolar hemorrhage and reviewed our case along with other articles.

  9. Alveolar bone mass in pre- and postmenopausal women with serum calcium as a marker: A comparative study

    Directory of Open Access Journals (Sweden)

    Amitha Ramesh

    2011-01-01

    Conclusion: Postmenopausal women exhibit a reduced alveolar bone mass and lowered levels of serum total calcium with the increasing age. These changes may be useful indicators for low skeletal bone mineral density or osteoporosis.

  10. Rapid Progression of Metastatic Pulmonary Calcification and Alveolar Hemorrhage in a Patient with Chronic Renal Failure and Primary Hyperparathyroidism

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Eun Joo; Kim, Dong Hun; Yoon, Seong Ho [Chosun University College of Medicine, Gwangju (Korea, Republic of); Suk, Eun Ha [Dept. of Anaesthesiology and Pain Medicine, Seonam University College of Medicine, Namwon (Korea, Republic of)

    2013-06-15

    Metastatic pulmonary calcification (MPC) is common in patients with chronic renal failure. The authors experienced a patient with chronic renal failure and primary hyperparathyroidism by parathyroid adenoma accompanied with rapid progressions of MPC and alveolar hemorrhage. Recent chest radiographs, compared with previous chest radiographs, showed rapid accumulation of calcification in both upper lungs. Following up on the high-resolution CT scan after five years demonstrates more increased nodules in size and ground glass opacity. The patient was diagnosed with MPC and alveolar hemorrhage by transbronchial lung biopsy. We assumed rapid progression of MPC and alveolar hemorrhage in underlying chronic renal failures could be a primary hyperparathyroidism which may be caused by parathyroid adenoma detected incidentally. Therefore parathyroid adenoma was treated with ethanol injections. Herein, we have reported on CT findings of MPC with alveolar hemorrhage and reviewed our case along with other articles.

  11. Early activation of the alveolar macrophage is critical to the development of lung ischemia-reperfusion injury.

    NARCIS (Netherlands)

    Naidu, BV; Krishnadasan, B; Farivar, AS; Woolley, SM; Thomas, R; Rooijen, van N.; Verrier, ED; Mulligan, MS

    2003-01-01

    .006) and marked reductions in bronchoalveolar lavage fluid leukocyte accumulation. Alveolar macrophage-depleted animals also demonstrated marked reductions of the elaboration of multiple proinflammatory chemokines and cytokines in the lavage effluent and nuclear transcription factors in lung

  12. Radiographic evaluation of the effect of obesity on alveolar bone in rats with ligature-induced periodontal disease

    Science.gov (United States)

    do Nascimento, Cassiane Merigo; Cassol, Tiago; da Silva, Fernanda Soares; Bonfleur, Maria Lucia; Nassar, Carlos Augusto; Nassar, Patricia Oehlmeyer

    2013-01-01

    There is evidence that the lack of metabolic control of obese patients may accelerate periodontitis. The aim of this study was to evaluate radiographically the effect of cafeteria-diet-induced obesity on alveolar bone loss in rats subjected to periodontal disease. Twenty male Wistar rats were randomly divided into four groups: 1) control group, 2) control and ligature group; 3) cafeteria group; and 4) cafeteria and ligature group. The animals were evaluated for obesity and euthanized, and the mandible of each rat was removed to perform a radiographic evaluation of alveolar bone loss and its effect on diet-induced obesity. The results showed greater alveolar bone loss in the mice in Group 4 (P<0.01). Thus, we concluded that obese mice, on average, showed greater radiographic evidence of alveolar bone loss than mice undergoing induction of obesity. PMID:24124386

  13. A computerized system to measure interproximal alveolar bone levels in epidemiologic, radiographic investigations. I

    International Nuclear Information System (INIS)

    Wouters, F.R.; Jon-And, C.; Frithiof, L.; Soeder, P.Oe.; Lavstedt, S.

    1988-01-01

    The aims of the study were to adapt a computerized system to epidemiologic conditions, for rapid full-mouth measurements of alveolar bone levels from X5-magnified periapical radiographs and to analyze the variations in measurement due to different system components. Full-mouth measurements of interproximal alveolar bone height in percentage of root and tooth lengths were completed within av average time of 15 min. per set of radiographs. An analysis of variance showed that the examiner variation in measurement of a linear scale distance was 0.02 mm. The measurement accuracy was different for different distances. Each distance (d) measured with this system should therefore be calibrated with the equation Y = -0.007 - 0.014 (log 3d - 1.50) where Y is the estimate of measurement accuracy. The present computerized system enabled rapid recordings and demonstrated good measurement precision and accuracy. These are valuable features in epidemiologic investigations

  14. Computerized system to measure interproximal alveolar bone levels in epidemiologic, radiographic investigations. I. Methodologic study

    Energy Technology Data Exchange (ETDEWEB)

    Wouters, F.R.; Jon-And, C.; Frithiof, L.; Soeder, P.Oe.; Lavstedt, S.

    1988-01-01

    The aims of the study were to adapt a computerized system to epidemiologic conditions, for rapid full-mouth measurements of alveolar bone levels from X5-magnified periapical radiographs and to analyze the variations in measurement due to different system components. Full-mouth measurements of interproximal alveolar bone height in percentage of root and tooth lengths were completed within av average time of 15 min. per set of radiographs. An analysis of variance showed that the examiner variation in measurement of a linear scale distance was 0.02 mm. The measurement accuracy was different for different distances. Each distance (d) measured with this system should therefore be calibrated with the equation Y = -0.007 - 0.014 (log 3d - 1.50) where Y is the estimate of measurement accuracy. The present computerized system enabled rapid recordings and demonstrated good measurement precision and accuracy. These are valuable features in epidemiologic investigations. 31 refs.

  15. Effect of porcine reproductive and respiratory syndrome virus (PRRSV) on alveolar lung macrophage survival and function

    DEFF Research Database (Denmark)

    Oleksiewicz, Martin B.; Nielsen, Jens

    1999-01-01

    Porcine reproductive and respiratory syndrome virus (PRRSV) recently emerged as an important cause of reproductive disorders and pneumonia in domestic pigs throughout the world. Acute cytocidal replication of PRRSV in alveolar lung macrophages causes the acute pneumonia; however, it remains largely...... analysis of cell size and membrane integrity) led to 40% reduction in the total number of phagocytozing cells. However, viable/uninfected macrophages in PRRSV-infected cultures exhibited normal phagocytic ability at 48 h, indicating that no soluble phagocytosis-suppressive mediators were induced by PRRSV...... infection in this system. In short, in our minimal system containing only a single cell type, phagocytosis-suppressive effects of PRRSV infection were detected, that acted at the culture level by reducing the total number of alveolar lung macrophages....

  16. Microfluidic wound-healing assay to assess the regenerative effect of HGF on wounded alveolar epithelium.

    Science.gov (United States)

    Felder, Marcel; Sallin, Pauline; Barbe, Laurent; Haenni, Beat; Gazdhar, Amiq; Geiser, Thomas; Guenat, Olivier

    2012-02-07

    We present a microfluidic epithelial wound-healing assay that allows characterization of the effect of hepatocyte growth factor (HGF) on the regeneration of alveolar epithelium using a flow-focusing technique to create a regular wound in the epithelial monolayer. The phenotype of the epithelial cell was characterized using immunostaining for tight junction (TJ) proteins and transmission electron micrographs (TEMs) of cells cultured in the microfluidic system, a technique that is reported here for the first time. We demonstrate that alveolar epithelial cells cultured in a microfluidic environment preserve their phenotype before and after wounding. In addition, we report a wound-healing benefit induced by addition of HGF to the cell culture medium (19.2 vs. 13.5 μm h(-1) healing rate).

  17. Clearance of 99mTc-DTPA and experimentally increased alveolar surfactant content

    International Nuclear Information System (INIS)

    Bos, J.A.H.; Wollmer, P.; Bakker, W.; Hannappel, E.; Lachmann, B.

    1992-01-01

    The authors measured clearance of 99m Tc-labeled diethylenetriamine pentaacetic acid ( 99m Tc-DTPA) in rabbits with experimentally increased alveolar surfactant content. In one group of animals, surfactant production was increased by treatment with ambroxol, and another group of animals was treated with tracheal instillation of natural surfactant. A group of untreated control animals and animals treated with instillation of saline were also studied. Clearance was measured during standard conditions of mechanical ventilation and during ventilation with large tidal volumes. In ambroxol- and surfactant-treated groups, clearance rate was reduced compared with untreated control animals. In contrast, clearance rate increased after saline instillation. The differences were observed at both modes of ventilation. The findings indicate that the pulmonary surfactant system is a rate-limiting factor for the clearance of 99m Tc-DTPA and that the volume dependence of clearance is not explained by stretching of the alveolar wall only. 28 refs., 2 figs., 1 tab

  18. Should we be giving bilateral inferior alveolar and lingual nerve blocks for third molar surgery?

    Science.gov (United States)

    Jabbar, J; Shekar, V; Mitchell, D A; Brennan, P A

    2014-01-01

    Extraction of mandibular third molars is one of the most common procedures in oral and maxillofacial surgery, and it is normal practice to extract both teeth at one visit under general anaesthesia. However, when both teeth are extracted under local anaesthesia, bilateral inferior alveolar and lingual nerve blocks are required, which is a subject of debate among clinicians. Much of the controversy surrounds the safety and efficacy of bilateral anaesthesia even though many surgeons use local anaesthetic solutions for perioperative and postoperative pain relief after day case general anaesthesia with no reports of unwanted effects. The evidence presented in this review explores published research for and against the use of unilateral and bilateral inferior alveolar and lingual nerve blocks. Copyright © 2013 The British Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  19. Síndrome de hipoventilación alveolar central congénita

    OpenAIRE

    Edwin Hernando Herrera-Flores; Alfredo Rodríguez-Tejada; Martha Margarita Reyes-Zúñiga; Martha Guadalupe Torres-Fraga; Armando Castorena-Maldonado; José Luis Carrillo-Alduenda

    2015-01-01

    Introducción: El síndrome de hipoventilación alveolar central congénita (SHACC) es un raro trastorno respiratorio del dormir, aunque cada vez más frecuentemente diagnosticado en clínicas de sueño y servicios de neumología pediátrica. Si bien se desconoce su epidemiología, en la literatura médica existen cerca de 300 casos reportados, y su incidencia es de 1 caso por cada 200,000 recién nacidos vivos. Se caracteriza por hipoventilación alveolar que se presenta o empeora durante el sueño. Es se...

  20. 3D-Printed Scaffolds and Biomaterials: Review of Alveolar Bone Augmentation and Periodontal Regeneration Applications

    Directory of Open Access Journals (Sweden)

    Farah Asa’ad

    2016-01-01

    Full Text Available To ensure a successful dental implant therapy, the presence of adequate vertical and horizontal alveolar bone is fundamental. However, an insufficient amount of alveolar ridge in both dimensions is often encountered in dental practice due to the consequences of oral diseases and tooth loss. Although postextraction socket preservation has been adopted to lessen the need for such invasive approaches, it utilizes bone grafting materials, which have limitations that could negatively affect the quality of bone formation. To overcome the drawbacks of routinely employed grafting materials, bone graft substitutes such as 3D scaffolds have been recently investigated in the dental field. In this review, we highlight different biomaterials suitable for 3D scaffold fabrication, with a focus on “3D-printed” ones as bone graft substitutes that might be convenient for various applications related to implant therapy. We also briefly discuss their possible adoption for periodontal regeneration.

  1. Horizontal alveolar ridge expansion followed by immediate placement of implants and rehabilitation with zirconia prosthesis

    Directory of Open Access Journals (Sweden)

    Tatiana Miranda Deliberador

    2017-01-01

    Full Text Available In recent years, there have been a growing number of procedures involving dental implants. Most cases, though, are characterized by bone atrophy, especially horizontal atrophy. This clinical case aims to report a technique for the expansion of the horizontal alveolar ridge. A longitudinal fracture was created in the alveolar ridge to expand the bone, followed by immediate insertion of dental implants along with a particulate allogeneic bone graft. Eight implants were placed in the maxilla, and after 12 months, a surgical reopening was performed, along with rehabilitation with a protocol-type prosthesis, for which a zirconia infrastructure was made. The patient was observed during a 10-month follow-up period in which an effective osseointegration of all implants was achieved as a result of such a technique. The split-crest technique followed by the immediate placement of implants and a particulate allogeneic bone graft proved to be effective, with a predictable osseointegration.

  2. Guided bone regeneration of a pronounced gingivo-alveolar cleft due to orthodontic space closure.

    Science.gov (United States)

    Pinheiro, Maria Letícia B; Moreira, Teresa Cristina; Feres-Filho, Eduardo J

    2006-06-01

    Gingival invagination is a relatively common occurrence following orthodontic closure of extraction sites. The present paper reports a combined periodontal and orthodontic treatment in a patient with a severe gingivo-alveolar cleft due to orthodontic closure of maxillary central incisor extraction space. A definite interdental gingival cleft, extending 8 mm into the alveolar bone, required the correction of the gingival deformity as a first step, followed by guided bone regeneration (GBR). The GBR approach included the emptying of the incisive foramen to approximately 5 mm in depth followed by the insertion of bioabsorbable hydroxyapatite and covering with a bioabsorbable barrier membrane. Six months afterward, the orthodontic therapy was resumed. Radiographs and clinical examination 4 years after the completion of therapy indicates functionally and aesthetically satisfactory and stable results. The present paper illustrates an additional application for the guided bone regeneration technique.

  3. 3D-Printed Scaffolds and Biomaterials: Review of Alveolar Bone Augmentation and Periodontal Regeneration Applications

    Science.gov (United States)

    Asa'ad, Farah; Giannì, Aldo Bruno; Giannobile, William V.; Rasperini, Giulio

    2016-01-01

    To ensure a successful dental implant therapy, the presence of adequate vertical and horizontal alveolar bone is fundamental. However, an insufficient amount of alveolar ridge in both dimensions is often encountered in dental practice due to the consequences of oral diseases and tooth loss. Although postextraction socket preservation has been adopted to lessen the need for such invasive approaches, it utilizes bone grafting materials, which have limitations that could negatively affect the quality of bone formation. To overcome the drawbacks of routinely employed grafting materials, bone graft substitutes such as 3D scaffolds have been recently investigated in the dental field. In this review, we highlight different biomaterials suitable for 3D scaffold fabrication, with a focus on “3D-printed” ones as bone graft substitutes that might be convenient for various applications related to implant therapy. We also briefly discuss their possible adoption for periodontal regeneration. PMID:27366149

  4. Bronchial damage and diffuse alveolar hemorrhage following chlorine gas inhalation: A case report.

    Science.gov (United States)

    Uemura, Kosuke; Isono, Momoko; Kagohashi, Katsunori; Hasegawa, Ryuichi; Satoh, Hiroaki

    2017-11-01

    Chlorine is a toxic inhalant and sources of exposure for individuals include accidental releases of chlorine vapor due to industrial or chemical transportation accidents. Inhalation of a large quantity of gas may cause circulatory and respiratory disorders or even mortality; however, the effects of a small amount of chlorine gas may be asymptomatic. The present case study presents a successfully treated 55-year-old male patient exposed to chlorine gas, resulting in bronchial damage and diffuse alveolar hemorrhage. Endobronchial and alveolar injuries were evaluated by direct observation using fiberoptic bronchoscopy (FB) and analyzing bronchoalveolar lavage fluid obtained by FB. Taking a precise medical history from the patient is crucial to correctly diagnose toxic gas inhalation. In addition, a timely and proper evaluation with chest imaging as well as FB may provide useful clinical information. Therefore, clinicians should consider performing FB if the circumstances permit.

  5. Manobra de recrutamento alveolar e suporte ventilatorio perioperatorio em pacientes obesos submetidos a cirurgia abdominal

    Directory of Open Access Journals (Sweden)

    Luiz Alberto Forgiarini Junior

    2013-12-01

    Full Text Available O desenvolvimento da cirurgia abdominal proporcionou uma alternativa terapêutica para obesos mórbidos; entretanto, os pacientes submetidos a esse procedimento frequentemente apresentam complicações pulmonares pós-operatórias. Uma possível alternativa para a redução dessas complicações é a utilização da manobra de recrutamento alveolar e/ou estratégias ventilatórias perioperatórias, com foco na redução das complicações pulmonares pós-operatórias. Nesta revisão, são descritos os benefícios de estratégias ventilatórias perioperatórias, assim como a realização de manobra de recrutamento alveolar em pacientes obesos submetidos a cirurgia abdominal.

  6. The effect of therapeutic radiation on canine alveolar ridges augmented with hydroxylapatite

    DEFF Research Database (Denmark)

    Pinholt, E M; Kwon, P H

    1992-01-01

    The purpose of this investigation was to evaluate the effect of radiation on hydroxylapatite (HA) implanted subperiosteally for alveolar ridge augmentation in dogs. All bicuspids and molars were extracted from 16 dogs. After 6 weeks, nonporous HA granules were implanted subperiosteally...... on the alveolar ridge. Following 4 months of healing, 12 dogs (experimental group) underwent therapeutic radiation therapy (Co60, 4,000 rad [40 Gy]) to the head and neck region. Four dogs were not irradiated and served as controls. Four animals (three experimental and one control) were killed at 5,6,7, and 8...... reaction. This reaction decreased significantly as time elapsed after implantation. Osteoclastic activity was seen at the junction of HA and periosteum and as part of bone remodeling. Dissolution of the HA granules and the granulomatous inflammatory reaction were not significantly increased by therapeutic...

  7. Alveolar ridge expansion-assisted orthodontic space closure in the mandibular posterior region.

    Science.gov (United States)

    Ozer, Mete; Akdeniz, Berat Serdar; Sumer, Mahmut

    2013-12-01

    Orthodontic closure of old, edentulous spaces in the mandibular posterior region is a major challenge. In this report, we describe a method of orthodontic closure of edentulous spaces in the mandibular posterior region accelerated by piezoelectric decortication and alveolar ridge expansion. Combined piezosurgical and orthodontic treatments were used to close 14- and 15-mm-wide spaces in the mandibular left and right posterior areas, respectively, of a female patient, aged 18 years and 9 months, diagnosed with skeletal Class III malocclusion, hypodontia, and polydiastemas. After the piezoelectric decortication, segmental and full-arch mechanics were applied in the orthodontic phase. Despite some extent of root resorption and anchorage loss, the edentulous spaces were closed, and adequate function and esthetics were regained without further restorative treatment. Alveolar ridge expansion-assisted orthodontic space closure seems to be an effective and relatively less-invasive treatment alternative for edentulous spaces in the mandibular posterior region.

  8. Horizontal alveolar ridge expansion followed by immediate placement of implants and rehabilitation with zirconia prosthesis.

    Science.gov (United States)

    Deliberador, Tatiana Miranda; Verbicaro, Thalyta; Minerva, Leonel; Scariot, Rafaela; Giovanini, Allan Fernando; Zielak, João César

    2017-01-01

    In recent years, there have been a growing number of procedures involving dental implants. Most cases, though, are characterized by bone atrophy, especially horizontal atrophy. This clinical case aims to report a technique for the expansion of the horizontal alveolar ridge. A longitudinal fracture was created in the alveolar ridge to expand the bone, followed by immediate insertion of dental implants along with a particulate allogeneic bone graft. Eight implants were placed in the maxilla, and after 12 months, a surgical reopening was performed, along with rehabilitation with a protocol-type prosthesis, for which a zirconia infrastructure was made. The patient was observed during a 10-month follow-up period in which an effective osseointegration of all implants was achieved as a result of such a technique. The split-crest technique followed by the immediate placement of implants and a particulate allogeneic bone graft proved to be effective, with a predictable osseointegration.

  9. Dichloroacetate Decreases Cell Health and Activates Oxidative Stress Defense Pathways in Rat Alveolar Type II Pneumocytes

    Directory of Open Access Journals (Sweden)

    Alexis Valauri-Orton

    2015-01-01

    Full Text Available Dichloroacetate (DCA is a water purification byproduct that is known to be hepatotoxic and hepatocarcinogenic and to induce peripheral neuropathy and damage macrophages. This study characterizes the effects of the haloacetate on lung cells by exposing rat alveolar type II (L2 cells to 0–24 mM DCA for 6–24 hours. Increasing DCA concentration and the combination of increasing DCA concentration plus longer exposures decrease measures of cellular health. Length of exposure has no effect on oxidative stress biomarkers, glutathione, SOD, or CAT. Increasing DCA concentration alone does not affect total glutathione or its redox ratio but does increase activity in the SOD/CAT oxidative stress defense pathway. These data suggest that alveolar type II cells rely on SOD and CAT more than glutathione to combat DCA-induced stress.

  10. [Contributions of edentulous mandibular alveolar ridge height and denture adhesive to complete denture retention].

    Science.gov (United States)

    Zeng, Xingqi; Chen, Xinmin; Peng, Yan; Xu, Chao; Men, Qinglin

    2011-10-01

    The present paper is to investigate the relationship between height and stress-bearing area of mandibular alveolar ridge, their influence on retention of complete denture, and the effectiveness of denture adhesive (DA). Five mandibular edentulous models of different heights and a rabbit palate model were prepared in Die-Stone. Measurements were made on the heights and stress-bearing areas of mandibular alveolar ridge, the retention force of mandibular models 15 min after DA administration, and the retention force on the rabbit palate before and after adhering. All available data were analyzed statistically. Linear regression relationship was demonstrated between ridge height and bearing area, ridge height and retention force, and bearing area and retention force (Pridge directly correlate with the retention of complete denture, and DA significantly improves the retention ability of complete denture.

  11. MicroRNAs: Potential Biomarkers and Therapeutic Targets for Alveolar Bone Loss in Periodontal Disease

    Directory of Open Access Journals (Sweden)

    Tadayoshi Kagiya

    2016-08-01

    Full Text Available Periodontal disease is an inflammatory disease caused by bacterial infection of tooth-supporting structures, which results in the destruction of alveolar bone. Osteoclasts play a central role in bone destruction. Osteoclasts are tartrate-resistant acid phosphatase (TRAP-positive multinucleated giant cells derived from hematopoietic stem cells. Recently, we and other researchers revealed that microRNAs are involved in osteoclast differentiation. MicroRNAs are novel, single-stranded, non-coding, small (20–22 nucleotides RNAs that act in a sequence-specific manner to regulate gene expression at the post-transcriptional level through cleavage or translational repression of their target mRNAs. They regulate various biological activities such as cellular differentiation, apoptosis, cancer development, and inflammatory responses. In this review, the roles of microRNAs in osteoclast differentiation and function during alveolar bone destruction in periodontal disease are described.

  12. Study of possible changes brought about by plutonium oxide in the acid phosphatase activity of alveolar macrophages of the rabbit

    International Nuclear Information System (INIS)

    Rouvroy, Huguette

    1970-06-01

    This report describes the various techniques used for determining the acid phosphatase activity of alveolar rabbit macrophages after inhalation of radioactive plutonium oxide particles, exposure of the animals, removal and sampling of the alveolar cells, and technical dosage. The results obtained are presented; they do not make it possible, in this particular case, to affirm that an important change in the enzymatic activity studied occurs. (author) [fr

  13. Regeneración ósea guiada para el aumento vertical del reborde alveolar Guided osseous regeneration for the vertical augmentation of the alveolar ridge

    Directory of Open Access Journals (Sweden)

    CE Nappe

    2013-04-01

    Full Text Available Se considera como aumento óseo vertical, cualquier técnica que apunte a crear una mayor altura del reborde alveolar. A inicios de la década de los 90’s se empezó a utilizar la regeneración ósea guiada (ROG en mandíbulas atróficas, con el fin de permitir la instalación de implantes óseointegrados. Con el fin de evaluar y exponer parte de la evidencia disponible en la actualidad, con respecto a la ROG para aumento óseo vertical, se realizó la siguiente revisión bibliográfica.Any technique aimed to improve the alveolar ridge height is considered as a vertical bone augmentation procedure. In the early 90’s guided bone regeneration (GBR procedures began to be used in atrophic mandibles to allow the installation of osseointegrated dental implants. The following bibliographic review was made with the purpose of evaluating and exposing part of the available evidence at present in this field.

  14. Hemorragia alveolar como complicación del uso de trombolíticos Alveolar hemorrhage as a complication of thrombolytic therapy

    Directory of Open Access Journals (Sweden)

    Alejandra González

    2011-12-01

    Full Text Available La trombolisis se usa como estrategia de reperfusión coronaria en el infarto agudo de miocardio. El sangrado es su principal complicación; la mayoría ocurre en los sitios de accesos venosos y es leve, pero también pueden presentarse hemorragia gastrointestinal, retroperitoneal, genitourinaria, pulmonar y a nivel del sistema nervioso central, episodios estos generalmente de mayor gravedad y a veces fatales. Se describe aquí el caso de un paciente que recibió terapia trombolítica con estreptoquinasa como tratamiento por un infarto de miocardio, y que posteriormente desarrolló insuficiencia respiratoria aguda, infiltrados pulmonares bilaterales, caída del hematocrito y aumento de la difusión de monóxido de carbono, cuadro compatible con diagnóstico de hemorragia alveolar.Coronary thrombolysis is used as a strategy for coronary reperfusion for acute myocardial infarction. Bleeding is the main complication described. Although most of these events occur at sites of vascular access and are mild, in some cases gastrointestinal, retroperitoneal, genitourinary, lung and central nervous system bleeding may occur. These episodes are usually serious and sometimes fatal. The following report describes the case of a patient who received thrombolytic therapy with streptokinase as a treatment for myocardial infarction. Subsequently he developed acute respiratory failure, bilateral pulmonary infiltrates and fall of hematocrit compatible with diagnosis of alveolar hemorrhage.

  15. Titanium implant insertion into dog alveolar ridges augmented by allogenic material

    DEFF Research Database (Denmark)

    Pinholt, E M; Haanaes, H R; Donath, K

    1994-01-01

    The purpose of this investigation was to evaluate whether titanium endosseous implants would osseointegrate in dog alveolar ridges augmented by allogenic material. In 8 dogs en bloc resection, including 2 pre-molars, was performed bilaterally in the maxilla and the mandible. After a healing period...... and only minimal osteoconduction, few multinuclear giant cells and a sparse inflammatory reaction. The titanium implants healed mainly by fibrous encapsulation....

  16. Microfluidic wound-healing assay to assess the regenerative effect of HGF on wounded alveolar epithelium.

    OpenAIRE

    Felder Marcel; Sallin Pauline; Barbe Laurent; Haenni Beat; Gazdhar Amiq; Geiser Thomas; Guenat Olivier

    2012-01-01

    We present a microfluidic epithelial wound healing assay that allows characterization of the effect of hepatocyte growth factor (HGF) on the regeneration of alveolar epithelium using a flow focusing technique to create a regular wound in the epithelial monolayer. The phenotype of the epithelial cell was characterized using immunostaining for tight junction (TJ) proteins and transmission electron micrographs (TEMs) of cells cultured in the microfluidic system a technique that is reported here ...

  17. Effect of piezoelectric instruments on healing propensity of alveolar sockets following mandibular third molar extraction

    OpenAIRE

    Shang-Jye Tsai; Yen-Liang Chen; Hao-Hueng Chang; Yow-Chyun Shyu; Chun-Pin Lin

    2012-01-01

    Background/purpose: The purpose of this study was to investigate whether the use of piezoelectric instruments affected the healing propensity of alveolar sockets after mandibular third molar extraction, compared with conventional rotary instruments. Materials and methods: Thirty patients with impacted bilateral symmetrical mandibular third molars participated in this investigation. We conducted a randomized, crossover study using conventional rotary instruments for extraction on one side a...

  18. Piperine inhibit inflammation, alveolar bone loss and collagen fibers breakdown in a rat periodontitis model.

    Science.gov (United States)

    Dong, Y; Huihui, Z; Li, C

    2015-12-01

    Piperine exhibits anti-inflammatory activity, and has a long history of medicinal use. The objective of this study was to investigate the protective effects of piperine on inflammation, alveolar bone and collagen fibers in experimental periodontitis. We evaluated the related expression of interleukin (IL)-1β, tumor necrosis factor (TNF)-α, matrix metalloproteinase (MMP)-8 and MMP-13 to enhance insight into these effects. Thirty-two Wistar rats were divided into four groups of eight animals each: control group, periodontitis group, periodontitis plus 50 mg/kg piperine group and periodontitis plus 100 mg/kg piperine group. Histopathologic changes were detected by hematoxylin and eosin staining. Alveolar bone loss and trabecula microstructures were evaluated by micro-computed tomography. Changes in collagen fibers were assessed by picrosirius red staining. Western blot analysis was conducted to determine the levels of IL-1β, TNF-α, MMP-8 and MMP-13. Piperine clearly inhibited alveolar bone loss and reformed trabecula microstructures in a dose-dependent manner. Histological staining showed that piperine significantly reduced the infiltration of inflammation in soft tissues. Both doses of piperine limited the fractions of degraded areas in collagen fibers. Piperine (100 mg/kg) significantly downregulated the expressions of IL-1β, MMP-8 and MMP-13 in periodontitis, but not that of TNF-α. Piperine displays significantly protective effects on inflammation, alveolar bone loss, bone microstructures and collagen fiber degradation in experimental periodontitis. The effects may be ascribed to its inhibitory activity on the expressions of IL-1β, MMP-8 and MMP-13. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Chronic lung disease in preterm lambs: effect of daily vitamin A treatment on alveolarization.

    Science.gov (United States)

    Albertine, Kurt H; Dahl, Mar Janna; Gonzales, Linda W; Wang, Zheng-Ming; Metcalfe, Drew; Hyde, Dallas M; Plopper, Charles G; Starcher, Barry C; Carlton, David P; Bland, Richard D

    2010-07-01

    Neonatal chronic lung disease is characterized by failed formation of alveoli and capillaries, and excessive deposition of matrix elastin, which are linked to lengthy mechanical ventilation (MV) with O(2)-rich gas. Vitamin A supplementation has improved respiratory outcome of premature infants, but there is little information about the structural and molecular manifestations in the lung that occur with vitamin A treatment. We hypothesized that vitamin A supplementation during prolonged MV, without confounding by antenatal steroid treatment, would improve alveolar secondary septation, decrease thickness of the mesenchymal tissue cores between distal air space walls, and increase alveolar capillary growth. We further hypothesized that these structural advancements would be associated with modulated expression of tropoelastin and deposition of matrix elastin, phosphorylated Smad2 (pSmad2), cleaved caspase 3, proliferating cell nuclear antigen (PCNA), VEGF, VEGF-R2, and midkine in the parenchyma of the immature lung. Eight preterm lambs (125 days' gestation, term approximately 150 days) were managed by MV for 3 wk: four were treated with daily intramuscular Aquasol A (vitamin A), 5,000 IU/kg, starting at birth; four received vehicle alone. Postmortem lung assays included quantitative RT-PCR and in situ hybridization, immunoblot and immunohistochemistry, and morphometry and stereology. Daily vitamin A supplementation increased alveolar secondary septation, decreased thickness of the mesenchymal tissue cores between the distal air space walls, and increased alveolar capillary growth. Associated molecular changes were less tropoelastin mRNA expression, matrix elastin deposition, pSmad2, and PCNA protein localization in the mesenchymal tissue core of the distal air space walls. On the other hand, mRNA expression and protein abundance of VEGF, VEGF-R2, midkine, and cleaved caspase 3 were increased. We conclude that vitamin A treatment partially improves lung development in

  20. Osteoclastogenesis in Local Alveolar Bone in Early Decortication-Facilitated Orthodontic Tooth Movement.

    Science.gov (United States)

    Chen, Ya-Wen; Wang, Hai-Cheng; Gao, Long-Hua; Liu, Chang; Jiang, Yu-Xi; Qu, Hong; Li, Cui-Ying; Jiang, Jiu-Hui

    2016-01-01

    In the current study, we aimed to investigate the effects of alveolar decortication on local bone remodeling, and to explore the possible mechanism by which decortication facilitates tooth movement. Forty rabbits were included in the experiment. The left mandible was subjected to decortication-facilitated orthodontics, and the right mandible underwent traditional orthodontics as a control. The animals were sacrificed on the days 1, 3, 5, 7 and 14, after undergoing orthodontic procedures. Tooth movement was measured by Micro-CT, and the local periodontal tissues were investigated using H&E, Masson's trichrome and tartrate-resistant acid phosphatase (TRAP) staining. The mRNA levels of genes related to bone remodeling in the alveolar bone were analyzed using real-time PCR. On days 3, 5, 7 and 14, tooth movement was statistically accelerated by decortication (P<0.05) and was accompanied by increased hyperemia. Despite the lack of new bone formation in both groups, more osteoclasts were noted in the decorticated group, with two peak counts (P<0.05). The first peak count was consistent with the maximum values of ctsk and TRAP expression, and the second peak counts accompanied the maximum nfatc1 and jdp2 expression. The increased fra2 expression and the ratio of rankl/opg also accompanied the second peak counts. Following alveolar decortication, osteoclastogenesis was initially induced to a greater degree than the new bone formation which was thought to have caused a regional acceleratory phenomenon (RAP). The amount of steoclastogenesis in the decorticated alveolar bone was found to have two peaks, perhaps due to attenuated local resistance. The first peak count in osteoclasts may have been due to previously existing osteoclast precursors, whereas the second may represent the differentiation of peripheral blood mononuclear cells which came from circulation as the result of hyperemia.

  1. Enhanced alveolar monocytic phagocyte (macrophage) proliferation in tobacco and marijuana smokers

    Energy Technology Data Exchange (ETDEWEB)

    Barbers, R.G.; Evans, M.J.; Gong, H. Jr.; Tashkin, D.P. (Univ. of California-Los Angeles School of Medicine (USA))

    1991-05-01

    We tested the hypothesis that enhanced cell division accounted for the augmented numbers of monocytic phagocytes with characteristics attributed to alveolar macrophages (AM) found in the lungs of habitual tobacco (T) and marijuana (M) smokers. The monocytic phagocytes, that is, alveolar macrophages, were obtained by bronchoalveolar lavage (BAL) from 12 nonsmoking subjects; 10 subjects who smoked T only (TS); 13 subjects who smoked M only (MS); and 6 smokers of both T and M (MTS). The replication of these cells was determined by measuring the incorporation of ({sup 3}H)thymidine into the DNA of dividing cells and visually counting 2,000 cells on autoradiographically prepared cytocentrifuge cell preparations. This study demonstrated that the number of ({sup 3}H)thymidine-labeled monocytic phagocytes with characteristics of alveolar macrophages from either TS or MS have a higher proliferative index compared to cells (macrophages) from nonsmokers, p less than 0.05 by one-way ANOVA. The total number of BAL macrophages that are in mitosis in TS (17.90 +/- 4.50 labeled AM x 10(3)/ml) or MTS (10.50 +/- 4.20 labeled AM x 10(3)/ml) are 18- and 10-fold greater, respectively, than the number obtained from nonsmokers (1.01 +/- 0.18 labeled AM x 10(3)/ml). Interestingly, the number of ({sup 3}H)thymidine-labeled macrophages from MS (2.90 +/- 0.66 labeled AM x 10(3)/ml) are also greater than the number obtained from nonsmokers, although this is not statistically significant. The stimulus augmenting alveolar macrophage replication is as yet unknown but may likely be found in the T or M smoke.

  2. Bronchoalveolar lavage fluid from normal rats stimulates DNA synthesis in rat alveolar type II cells

    International Nuclear Information System (INIS)

    Leslie, C.C.; McCormick-Shannon, K.; Mason, R.J.

    1989-01-01

    Proliferation of alveolar type II cells after lung injury is important for the restoration of the alveolar epithelium. Bronchoalveolar lavage fluid (BALF) may represent an important source of growth factors for alveolar type II cells. To test this possibility, BALF fluid was collected from normal rats, concentrated 10-fold by Amicon filtration, and tested for its ability to stimulate DNA synthesis in rat alveolar type II cells in primary culture. BALF induced a dose-dependent increase in type II cell DNA synthesis resulting in a 6-fold increase in [3H]thymidine incorporation. Similar doses also stimulated [3H]thymidine incorporation into rat lung fibroblasts by 6- to 8-fold. Removal of pulmonary surface active material by centrifugation did not significantly reduce the stimulatory activity of BALF for type II cells. The stimulation of type II cell DNA synthesis by BALF was reduced by 100% after heating at 100 degrees C for 10 min, and by approximately 80% after reduction with dithiothreitol, and after trypsin treatment. Dialysis of BALF against 1 N acetic acid resulted in a 27% reduction in stimulatory activity. The effect of BALF in promoting type II cell DNA synthesis was more pronounced when tested in the presence of serum, although serum itself has very little effect on type II cell DNA synthesis. When BALF was tested in combination with other substances that stimulate type II cell DNA synthesis (cholera toxin, insulin, epidermal growth factor, and acidic fibroblast growth factor), additive effects or greater were observed. When BALF was chromatographed over Sephadex G150, the activity eluted with an apparent molecular weight of 100 kDa

  3. An unexpected cause of diffuse alveolar hemorrhage in a kidney transplant patient.

    Science.gov (United States)

    Schlageter, Manuel; Jahn, Kathleen D; Tzankov, Alexandar; Wiese, Mark; Bubendorf, Lukas; Tamm, Michael; Savic, Spasenija

    2014-01-01

    Diffuse alveolar hemorrhage (DAH) is a life-threatening condition requiring urgent treatment. There are many different treatment-relevant causes of DAH, making the diagnostic approach to these patients complex and necessitating a multidisciplinary team. We report the case of a kidney transplant recipient in whom all diagnostic efforts did not reveal the cause of DAH, and only autopsy was able to establish an unexpected diagnosis. © 2014 S. Karger AG, Basel.

  4. Alveolar ridge expansion-assisted orthodontic space closure in the mandibular posterior region

    OpenAIRE

    Ozer, Mete; Akdeniz, Berat Serdar; Sumer, Mahmut

    2013-01-01

    Orthodontic closure of old, edentulous spaces in the mandibular posterior region is a major challenge. In this report, we describe a method of orthodontic closure of edentulous spaces in the mandibular posterior region accelerated by piezoelectric decortication and alveolar ridge expansion. Combined piezosurgical and orthodontic treatments were used to close 14- and 15-mm-wide spaces in the mandibular left and right posterior areas, respectively, of a female patient, aged 18 years and 9 month...

  5. Evaluation of Amoxicillin & Cephalexin concentrations in dental alveolar sockets after tooth extraction

    OpenAIRE

    Fakhraei AH.; Jabal Ameli F.; Ghobadi G

    2005-01-01

    Statement of Problem: One of the most important complications after tooth extraction and oral and maxillofacial surgery is transient bacteraemia and prescription of prophylactic antibiotic is necessary to prevent postoperative infections in immunocompromised patients. Purpose: The aim of this study was the evaluation of cephalexin and amoxicillin concentrations in dental alveolar sockets following tooth extraction. Materials and Methods: In this interventional study, 80 healthy patients subje...

  6. Improving oral rehabilitation through the preservation of the tissues through alveolar preservation

    OpenAIRE

    Afrashtehfar, Kelvin Ian; Kurtzman, Gregori Michael; Mahesh, Lanka

    2012-01-01

    When performing a tooth extraction, imminent collapse of the tissue by resorption and remodeling of the socket is a natural occurrence. The procedure for the preservation of the alveolar ridge has been widely described in the dental literatures and aims to maintain hard and soft tissues in the extraction site for optimal rehabilitation either with conventional fixed or removable prosthetics or implant-supported prosthesis.

  7. Radiographic alveolar bone changes following ridge preservation with two different biomaterials.

    Science.gov (United States)

    Mardas, Nikos; D'Aiuto, Francesco; Mezzomo, Luis; Arzoumanidi, Marina; Donos, Nikolaos

    2011-04-01

    The aim of this randomized controlled trial was to evaluate radiographical bone changes following alveolar ridge preservation with a synthetic bone substitute or a bovine xenograft. Alveolar ridge preservation was performed in 27 patients randomized in two groups. In the test group (n=14), the extraction socket was treated with Straumann bone ceramic(®) (SBC) and a collagen barrier membrane (Bio-Gide(®)), whereas in the control group (n=13) with deproteinized bovine bone mineral and the same barrier. Standardized periapical X-rays were taken at 4 time points, BL: after tooth extraction, GR: immediately after socket grafting, 4M: 16 weeks, 8M: 32 weeks post-operatively. The levels of the alveolar bone crest at the mesial (Mh), and distal (Dh) and central aspects of the socket were measured at all time points. All the radiographs obtained were subtracted from the follow-up images. The gain, loss and unchanged areas in terms of grey values were tested for significant difference between the two groups. In the test group, the Mh and Dh showed a mean difference (± standard deviation) of 0.9 ± 1.2 and 0.7 ± 1.8 mm, respectively, among BL-8M. In the control group, the Mh and Dh showed a mean difference of 0.4 ± 1.3 and 0.7 ± 1.3 mm, respectively (P>0.05). Both treatments presented similar gain in grey values between BL-GR, BL-4M and BL-8M. The SBC presented less loss in grey values between BL-4M and BL-8M (Palveolar bone changes when used for alveolar ridge preservation. © 2011 John Wiley & Sons A/S.

  8. Improving oral rehabilitation through the preservation of the tissues through alveolar preservation.

    Science.gov (United States)

    Afrashtehfar, Kelvin Ian; Kurtzman, Gregori Michael; Mahesh, Lanka

    2012-08-01

    When performing a tooth extraction, imminent collapse of the tissue by resorption and remodeling of the socket is a natural occurrence. The procedure for the preservation of the alveolar ridge has been widely described in the dental literatures and aims to maintain hard and soft tissues in the extraction site for optimal rehabilitation either with conventional fixed or removable prosthetics or implant-supported prosthesis.

  9. Pain caused by a dental implant impinging on an accessory inferior alveolar canal: a case report.

    Science.gov (United States)

    Maqbool, Arman; Sultan, Ahmed Ali; Bottini, Gian Battista; Hopper, Colin

    2013-01-01

    This report presents a case history of intractable facial pain following the placement of a posterior mandibular implant. The pain was resistant to all medical management, but a cone beam computed tomography (CBCT) scan showed that the implant impinged on an unusual accessory inferior alveolar nerve. The decision to remove the implant led to significant pain reduction. This clinical example underscores the need for scrupulous imaging prior to implant placement.

  10. Carbon Nanotube-Induced Pulmonary Granulomatous Disease: Twist1 and Alveolar Macrophage M1 Activation

    Directory of Open Access Journals (Sweden)

    Barbara P. Barna

    2013-12-01

    Full Text Available Sarcoidosis, a chronic granulomatous disease of unknown cause, has been linked to several environmental risk factors, among which are some that may favor carbon nanotube formation. Using gene array data, we initially observed that bronchoalveolar lavage (BAL cells from sarcoidosis patients displayed elevated mRNA of the transcription factor, Twist1, among many M1-associated genes compared to healthy controls. Based on this observation we hypothesized that Twist1 mRNA and protein expression might become elevated in alveolar macrophages from animals bearing granulomas induced by carbon nanotube instillation. To address this hypothesis, wild-type and macrophage-specific peroxisome proliferator-activated receptor gamma (PPARγ knock out mice were given oropharyngeal instillation of multiwall carbon nanotubes (MWCNT. BAL cells obtained 60 days later exhibited significantly elevated Twist1 mRNA expression in granuloma-bearing wild-type or PPARγ knock out alveolar macrophages compared to sham controls. Overall, Twist1 expression levels in PPARγ knock out mice were higher than those of wild-type. Concurrently, BAL cells obtained from sarcoidosis patients and healthy controls validated gene array data: qPCR and protein analysis showed significantly elevated Twist1 in sarcoidosis compared to healthy controls. In vitro studies of alveolar macrophages from healthy controls indicated that Twist1 was inducible by classical (M1 macrophage activation stimuli (LPS, TNFα but not by IL-4, an inducer of alternative (M2 macrophage activation. Findings suggest that Twist1 represents a PPARγ-sensitive alveolar macrophage M1 biomarker which is induced by inflammatory granulomatous disease in the MWCNT model and in human sarcoidosis.

  11. Microscopic polyangiitis: Atypical presentation with extensive small bowel necrosis, diffuse alveolar hemorrhage, and renal failure

    OpenAIRE

    Segraves, Justin M.; Iyer, Vivek N.

    2017-01-01

    Microscopic polyangiitis is an uncommon systemic vasculitis of varying severity that is associated with myeloperoxidase (MPO) and perinuclear antineutrophil cytoplasmic (p-ANCA) antibodies. The most commonly affected organs are the lungs and kidneys. We report on a very unusual case of microscopic polyangiitis presenting with severe mesenteric ischemia in addition to diffuse alveolar hemorrhage and acute renal failure. The patient was initially diagnosed with acute pancreatitis at an outside ...

  12. Ridge split and implant placement in deficient alveolar ridge: Case report and an update

    Directory of Open Access Journals (Sweden)

    Reenesh Mechery

    2015-01-01

    Full Text Available Dr. Hilt Tatum 1970s introduced a method of ridge splitting or bone spreading, which over a period have been used in implant dentistry for esthetic rehabilitation and implant site preparation in cases of deficient alveolar ridges to satisfy the basic ideal need of hard tissue augmentation for functional and esthetic outcome of implant. In this case report, we describe a case of horizontal ridge augmentation using ridge split and simultaneous implant placement in esthetic maxillary premolar zone.

  13. Correction: Inferior alveolar nerve injury with laryngeal mask airway: a case report.

    LENUS (Irish Health Repository)

    Hanumanthaiah, Deepak

    2011-11-30

    ABSTRACT: Following the publication of our article [Inferior alveolar nerve injury with laryngeal mask airway: a case report. Journal of Medical Case Reports 2011, 5:122] it was brought to our attention that we inadvertently used the registered trademark of the Laryngeal Mask Company Limited (LMA) as the abbreviation for laryngeal mask airway. A Portex(R) Soft Seal(R) Laryngeal Mask was used and not a device manufactured by the Laryngeal Mask Company.

  14. Enhanced alveolar monocytic phagocyte (macrophage) proliferation in tobacco and marijuana smokers

    International Nuclear Information System (INIS)

    Barbers, R.G.; Evans, M.J.; Gong, H. Jr.; Tashkin, D.P.

    1991-01-01

    We tested the hypothesis that enhanced cell division accounted for the augmented numbers of monocytic phagocytes with characteristics attributed to alveolar macrophages (AM) found in the lungs of habitual tobacco (T) and marijuana (M) smokers. The monocytic phagocytes, that is, alveolar macrophages, were obtained by bronchoalveolar lavage (BAL) from 12 nonsmoking subjects; 10 subjects who smoked T only (TS); 13 subjects who smoked M only (MS); and 6 smokers of both T and M (MTS). The replication of these cells was determined by measuring the incorporation of [ 3 H]thymidine into the DNA of dividing cells and visually counting 2,000 cells on autoradiographically prepared cytocentrifuge cell preparations. This study demonstrated that the number of [ 3 H]thymidine-labeled monocytic phagocytes with characteristics of alveolar macrophages from either TS or MS have a higher proliferative index compared to cells (macrophages) from nonsmokers, p less than 0.05 by one-way ANOVA. The total number of BAL macrophages that are in mitosis in TS (17.90 +/- 4.50 labeled AM x 10(3)/ml) or MTS (10.50 +/- 4.20 labeled AM x 10(3)/ml) are 18- and 10-fold greater, respectively, than the number obtained from nonsmokers (1.01 +/- 0.18 labeled AM x 10(3)/ml). Interestingly, the number of [ 3 H]thymidine-labeled macrophages from MS (2.90 +/- 0.66 labeled AM x 10(3)/ml) are also greater than the number obtained from nonsmokers, although this is not statistically significant. The stimulus augmenting alveolar macrophage replication is as yet unknown but may likely be found in the T or M smoke

  15. Extracorporeal Membrane Oxygenation in Diffuse Alveolar Hemorrhage Secondary to Systemic Lupus Erythematosus

    OpenAIRE

    Claudio, Christine Pacheco; Charbonney, Emmanuel; Durand, Madeleine; Kolan, Christophe; Laskine, Mikhael

    2014-01-01

    Diffuse alveolar hemorrhage (DAH) is a rare and potentially deadly complication of systemic lupus erythematosus (SLE). We report two adult cases where extracorporeal membrane oxygenation (ECMO) was used as rescue therapy for severe respiratory failure in this setting. We discuss the risk related to coagulation disturbance and the need for the circuit anticoagulation in this particular setting. We also briefly discuss the clinical problem of lack of knowledge on the bioavailability of the immu...

  16. The Impact of Alveolar Bone Grafting on Cleft Lip and Palate: A literature review

    Directory of Open Access Journals (Sweden)

    Toby J. Gillgras

    2014-09-01

    Full Text Available Introduction: Alveolar bone grafting between the ages of nine years to eleven years is a routine procedure for children with a cleft involving the alveolus. It is believed to encourage dental development and subsequent treatment within the region of the cleft and to improve nasolabial aesthetics. The aims of this article are to review the literature as to its impact on dental development and subsequent treatment, nasolabial aesthetics and the nasal airway. Methods: An electronic search was conducted using Medline and Embase, with no restriction as to date of publication, study design or language. Results: The results suggest that secondary alveolar bone grafting when carried out at the appropriate time has significant benefits and for subsequent dental treatment, often allows space closure of adjacent teeth and eliminating the need for a prosthesis. Although it has an effect of nasolabial aesthetics it is equivocal as to whether this improves nasolabial aesthetics or merely improves the likelihood of aesthetic improvement of subsequent nasal surgery. Nasal obstruction is a significant issue in patients with cleft lip and palate with smaller nasal volume and mean cross-sectional area. It would appear that there is a reduction in the growth of the airway after an age that approximates to the timing for secondary alveolar grafting, although there are no studies that can refute or confirm its actual impact. Conclusions: Alveolar bone grafting between the ages of 9 – 11 years appears to produce clear benefits in terms of dental development and subsequent dental treatment. Its impact on nasolabial aesthetics appear equivocal as although there are changes in some landmarks post-surgery it is unclear as to whether these changes produce a benefit in terms of aesthetics for the patient.

  17. Benzo(a)pyrene activation and detoxification by human pulmonary alveolar macrophages and lymphocytes

    International Nuclear Information System (INIS)

    Marshall, M.V.; McLemore, T.L.; Martin, R.R.; Marshall, M.H.; Wray, N.P.; Busbee, D.L.; Cantrell, E.T.; Arnott, M.S.; Griffin, A.C.

    1980-01-01

    Comparisons of pulmonary alveolar macrophages and circulating lymphocytes from five smokers and five nonsmokers for their ability to metabolize benzo(a)pyrene as determined by high pressure liquid chromatography were carried out. Utilizing this approach, further investigation of activation and detoxification by several human cell types could provide the basis for more precise and comprehensive studies of carcinogen and drug metabolism in the human lung, and for a better assessment of cancer risk in selected populations

  18. Value of Tc99m-DTPA alveolar permeability in lung involvement detection of patients with HIV infection

    International Nuclear Information System (INIS)

    Massardo Vega, Teresa; Jofre Manieu, Maria Josefina; Cabello Araya, Hernan; Sepulveda Carvajal, Cecilia; Ruiz Carmona, Mauricio; Moyano Schlegel, Leonor; Fica Cubillos, Alberto; Alay Perez, Rita

    2001-01-01

    We studied 35 HIV patients in order to know the value of Tc99mDTPA in the assessment of pulmonary lung involvement, especially pneumocystis carinii (PC) infection. Lung DTPA clearance measures increased alveolar permeability. Twenty patients with respiratory symptoms were included, 4 with systemic symptoms and also 11 asymptomatics, with similar immune condition (CD4 lymphocytes <400) as a control group. Smoking habit was suspended prior the test. Clinical follow up, chest film, induced sputum and/or fibrobronchoscopy were obtained. There was histological confirmation of PC presence or absence in 16 symptomatics and 3 asymptomatics. DTPA sensitivity for PC detection was 78%, specificity 40% and accuracy 58%; the values were 85%, 60% and 79%, respectively, for inflammatory lung processes. There were 4/6 cases false positive for PC detection with respiratory features explaining DTPA abnormalities. Concluding, Tc99m-DTPA is sensitive but not specific for detecting PC pneumonia but its value is higher for pulmonary inflammatory processes (Au)

  19. Reinforcing the Mucoperiosteal Pocket with the Scarpa Fascia Graft in Secondary Alveolar Bone Grafting: A Retrospective Controlled Outcome Study.

    Science.gov (United States)

    Lonic, Daniel; Yamaguchi, Kazuaki; Chien-Jung Pai, Betty; Lo, Lun-Jou

    2017-10-01

    Secondary alveolar bone grafting is the gold standard for the treatment of alveolar clefts in cleft lip and palate patients. The authors present a modified method using a Scarpa fascia graft that is placed deep into the mucoperiosteal pocket for watertight sealing of the bone graft chamber and limiting the graft position to the alveolar region for bony stability and tooth support. The outcome was assessed for clinical success in terms of bone graft stability and infection rate. Seventy-four unilateral complete cleft lip and palate patients were enrolled in this retrospective study consisting of equal-size Scarpa fascia and control groups of consecutive unilateral complete cleft lip and palate patients undergoing secondary alveolar bone grafting. Occlusal radiographs of the alveolar cleft taken at least 1 year postoperatively were evaluated for Spearman correlated Bergland and Witherow scales. Statistical evaluation was conducted using t test, chi-square test, and odds ratio. The clinical success rate (Bergland types I and II) of the Scarpa fascia procedure was significantly higher (67.6 versus 94.6 percent, respectively), with a significantly lower infection rate (16.2 versus 2.7 percent, respectively) and a high correlation of Bergland and Witherow scales (0.964; p fascia group. The authors' new method of alveolar bone grafting with the Scarpa fascia graft is safe and effective, and has one of the highest documented success rates. Therapeutic, III.

  20. Alveolar epithelial and endothelial cell apoptosis in emphysema: What we know and what we need to know

    Directory of Open Access Journals (Sweden)

    Mathieu C Morissette

    2008-12-01

    Full Text Available Mathieu C Morissette, Julie Parent, Julie MilotCentre de Recherche de l’Hôpital Laval, Institut Universitaire de Cardiologie et de Pneumologie de l’Université Laval, Québec, CanadaAbstract: Emphysema is mainly caused by cigarette smoking and is characterized by the loss of alveolar integrity and an enlargement of the alveolar space. However, mechanisms involved in its development are not fully understood. Alveolar cell apoptosis has been previously investigated in the lung of emphysematous subjects as a potential contributor to the loss of alveolar cell and has been found abnormally elevated. Though, mechanisms involved in the increased alveolar apoptosis that occurs in emphysema have now become a prolific field of research. Those mechanisms are reviewed here with special focus on how they affect cell viability and how they may be implicated in emphysema. Moreover, we suggest a model that integrates all those mechanisms to explain the increased alveolar apoptosis observed in emphysema. This review also includes some reflections and suggestions on the research to come.Keywords: emphysema, apoptosis, proteases, VEGF, oxidative stress, TRAIL, autoimmunity